Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
the bis ( 4 - hydroxyphenyl thio ) benzenes of the present invention have the general structural formula : ## str2 ## wherein r 1 , r 2 and r 3 , which may be the same or different , are c 1 - c 4 - alkyl , cl or br , and n 1 , n 2 and n 3 , which may be the same or different , are 0 , 1 or 2 . a route suitable for the synthesis of the generic bis ( 4 - hydroxyphenyl thio ) benzenes is illustrated by the following general reaction scheme for the synthesis of bis ( 4 - hydroxyphenyl thio ) benzenes ( n 1 - n 3 = 0 ), the preferred monomer of the present invention : ## str3 ## as indicated in the above reaction scheme , 4 - mercaptophenol is reacted with p - dibromobenzene in the presence of potassium carbonate and dimethylformamide to produce the preferred bis ( 4 - hydroxphenyl thio ) benzene of the present invention . the resulting monomer is recovered as a precipitate and is then separated and dried . when the reaction is performed on 0 . 1 mol of p - dibromo benzene , only the desired monomer is formed in 87 . 8 % yield . scale up of the reaction on a 3 . 0 mol basis produced a mixture of the desired monomer and the expected by - product , 4 &# 39 ;- bromo , 4 - hydroxy diphenyl sulfide , in the ratio of 55 / 45 weight %. ## str4 ## separation of bis ( 4 - hydroxyphenyl thio ) benzene from 4 &# 39 ;- bromo - 4 - hydroxy diphenyl sulfide is effected by difference in solubility . 4 &# 39 ;- bromo - 4 - hydroxy diphenyl sulfide being soluble in cyclohexane is removed by soxhlet extraction of the reaction mixture . soxhlet extraction is a well - known continuous type of extraction practiced in organic chemistry to separate a mixture having one component possessing solubility in solvent . the generic bis ( 4 - hydroxyphenyl thio ) benzenes of the invention are useful as monomers or one of the comonomers in the synthesis of polycarbonates , polyurethanes , polyesters , polysulfones , polyethers and other polymers . such polycarbonates may be produced using the novel monomers of the invention by well - known methods , such as disclosed in u . s . pat . nos . 2 , 964 , 794 ; 2 , 970 , 131 ; 2 , 991 , 237 ; 2 , 999 , 835 ; 2 , 999 , 846 ; 3 , 028 , 365 ; 3 , 153 , 008 ; 3 , 187 , 065 ; 3 , 215 , 668 and 3 , 248 , 414 , all incorporated herein by reference and in the monograph h . schnell , chemistry and physics of polycarbonates , interscience publishers , new york , n . y ., 1964 . such polyurethanes may be produced using the novel monomers of the invention by well - known methods , such as disclosed in u . s . pat . nos . 2 , 266 , 777 ; 2 , 284 , 637 ; 2 , 284 , 296 ; 2 , 511 , 544 , all incorporated herein by reference and in the text polyurethanes : chemistry and technology , vol . 1 , s . h . saunders and k . c . frisch , interscience publishers , new york , n . y ., 1964 . such polyesters may be produced using the novel monomers of the invention by well - known methods , such as disclosed in u . s . pat . nos . 2 , 980 , 650 ; 3 , 185 , 668 ; 3 , 185 , 670 and 3 , 268 , 482 , all incorporated herein by reference , and in the text polyesters ( two parts ), edited by norman g . gaylord , interscience publishers , new york , 1962 . such polysulfones may be produced using the novel monomers of the invention by well - known methods , such as disclosed in u . s . pat . nos . 3 , 236 , 808 ; 3 , 236 , 809 ; 3 , 409 , 599 and 3 , 742 , 087 , all incorporated herein by reference . such polyethers may be produced using the novel monomers of the invention by well - known methods , such as disclosed in u . s . pat . nos . 1 , 922 , 459 ; 2 , 253 , 723 ; 2 , 991 , 313 and 3 , 651 , 151 , all incorporated herein by reference , and in the text polyethers , ( three parts ), edited by norman g . gaylord , interscience publishers , new york , 1962 . the invention will be further illustrated , but is not intended to be limited by the following examples . 4 - mercaptophenol ( 756 g ; 6 . 0 moles ) was added to a slurry of anhydrous potassium carbonate ( 910 g ; 6 . 59 mols , 10 % excess ) and 7 liters of distilled dimethyl formamide contained in a 12 liter stirred resin reactor . the reaction was carried out under dry nitrogen atmosphere . the mixture was slowly heated to 60 ° c . at which time a yellow coloration to the reaction mixture was observed . this is due to the formation of potassium salt of 4 - mercaptophenol . the reaction mixture was held at 90 ° c . for 3 hours . para dibromobenzene ( 708 g ; 3 moles ) dissolved in 1 . 5 liters of distilled dimethyl formamide was added to the reaction mixture through an addition funnel in 1 / 2 hour . the reaction temperature was raised to 130 ° c . and maintained at this temperature for 20 hours . the reaction mixture was filtered through a buchner funnel to remove potassium bicarbonate and unreacted potassium carbonate . the residue in the buchner funnel was washed with 500 ml of hot dimethyl formamide . the combined filrate was divided in 3 equal portions and each portion poured into a stirred 5 - gallon plastic pail containing 3 gallons of demineralized h 2 o and 175 ml of concentrated hydrochloric acid . after adjusting the ph to 6 , the contents of the pail were cooled . water from the pail was decanted . the crude product , a viscous material thus obtained , was washed two times with water -- 1 gallon each time . the powdery material thus obtained was filtered and washed free of acid with demineralized water . the crude product was dried under vacuum at 90 ° c . overnight --( m . p . 125 °- 130 ° c .). the crude product obtained from the reaction ( larger scale , 3 mole basis ) contained bis ( 4 - hydroxyphenyl thio ) benzene and 4 &# 39 ;- bromo - 4 - hydroxy diphenylsulfide in the ratio of 55 / 45 ( weight %). to remove 4 &# 39 ;- bromo - 4 - hydroxydiphenyl sulfide , the crude reaction product was slurried with hot cyclohexane for 2 hours , and the resultant mixture was filtered . it required 3 similar extractions to separate 4 &# 39 ;- bromo - 4 - hydroxydiphenyl sulfide from the bis ( 4 - hydroxyphenyl thio ) benzene . 4 &# 39 ;- bromo - 4 - hydroxydiphenyl sulfide in white flakes ( 390 g )--( m . p . 78 °- 79 ° c .) -- was obtained after removal of cyclohexane from the extract . the insoluble portion of 398 g was found to be 99 % bis ( 4 - hydroxyphenyl thio ) benzene --( m . p . 158 °- 160 ° c .). the infrared ( ir ) and nuclear magnetic resonance ( nmr ) spectra of the bis ( 4 - hydroxyphenyl thio ) benzene and 4 &# 39 ;- bromo - 4 - hydroxydiphenyl sulfide were consistent with the assigned structures . elemental analysis given below is also consistent for the two products . bis ( 4 - hydroxyphenyl thio ) benzene : molecular formula : c 18 h 14 s 2 o 2 ( molecular weight 326 . 292 ); theory : % c : 66 . 26 ; % h : 4 . 32 ; % s : 19 . 6 ; found : % c : 64 . 32 ; % h : 3 . 98 ; % s : 18 . 84 . 4 &# 39 ;- bromo - 4 - hydroxydiphenyl sulfide : molecular formula : c 12 h 9 brso ( molecular weight 281 . 192 ); theory : % c : 51 . 25 ; % h : 3 . 23 ; % s : 11 . 38 ; % br : 28 . 45 ; found : % c : 51 . 36 ; % h : 3 . 22 ; % s : 11 . 32 ; % br : 28 . 43 . preparation of a copolycarbonate produced from bisphenol a and bis ( 4 - hydroxyphenyl thio ) benzene a copolycarbonate resin was prepared by reacting a mixture of the disodium salts of 2 , 2 - bis ( 4 - hydroxyphenyl ) propane ( bisphenol a ) and bis ( 4 - hydroxyphenyl thio ) benzene with phosgene in accordance with the interfacial polycondensation synthesis . 5 weight % of bis ( 4 - hydroxyphenyl thio ) benzene and 95 weight % of bisphenol a , based on the weight of the diphenols , were used . the properties measured for this copolycarbonate are reported in table 1 . table 1______________________________________ units value us us si conv si conv______________________________________izod impact strength . sup . 1 j / m ft lb / in1 / 8 &# 34 ; thickness 817 15 . 301 / 4 &# 34 ; thickness 145 2 . 71critical thickness mm mil 4 . 95 195melt index . sup . 2 g / 10 min 6 . 70heat deflectiontemp . sup . 3under load ° c . 3 ( 264 psi ) 1 . 82 mpa ° c . ° f . 120 . 8 250tensile properties . sup . 4tensile strength at mpa psi 61 8800yieldtensile strength , mpa psi 61 8800ultimatetensile strength , mpa psi 49 7100failureelongation , yield % 8elongation , fail % 103flexural properties . sup . 5strength mpa psi 86 12422ultimate mpa psi 86 12422modulus gpa psi 2 . 3 334000flammabilitypropertiesul - 94 . sup . 6 94v - 23 . 2 mm ( 1 / 8 &# 34 ; thickness ) oxygen index . sup . 7 % 23 . 9optical properties . sup . 8 % brightness 83 . 26 % yellowness index 11 . 8at 550 ° f . molding % haze at 2 . 2550 ° f . molding % yellowness at 17 . 4650 ° f . molding % brightness at 80 . 5650 ° f . moldingmelt viscosity , pa &# 39 ; s poise300 ° c . 7 . 2 s . sup .- 1 620 620014 . 4 600 600036 . 0 540 540072 . 00 510 5100144 510 5100360 440 4400720 360 36001440 290 2900melt stability , 300 ° c . pa &# 39 ; s poise5 min 510 510035 min 370 370065 min 350 3500 ( 5 - 65 ) 160 1600initial rv 1 . 292after 65 &# 39 ; strand rv 1 . 279______________________________________ . sup . 1 astm d256 . sup . 2 astm d2138 ; at 300 ° c . and 1200 g load . sup . 3 astm d648 / 72 . sup . 4 astm d638 . sup . 5 astm d790 . sup . 6 underwriters laboratories , inc . 94 : standard for tests for flammability of plastic materials for parts in devices and appliances . sup . 7 astm d2863 . sup . 8 astm d1003 although the invention has been described in detail in the foregoing for the purpose of illustration , it is to be understood that such detail is solely for that purpose and that variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention except as it may be limited by the claims .	2
referring to fig1 - 3 , the mixing and dispensing apparatus generally 10 includes a cabinet member 12 which provides a housing 16 composed of two hinged doors 17 and 18 connected to side panels 20 and 21 , respectively . the housing also includes a rear wall 23 and a top wall 25 . there are slots such as 24 in the rear wall 23 to afford connection to a wall by means of screws or bolts . there is also a central section generally 27 formed with walls 37 and 39 . there are flanges 29 and 30 extending from walls 37 and 39 as well as from side panels 16 and 21 to provide a support for plates 32 . these plates 32 inside cabinet 12 provide pockets 33 for supporting containers such as 34 for liquid chemical concentrate . bottom panels 26 and 31 connect side walls 37 and 39 with side panels 20 and 21 , respectively . there is also a hinged panel 28 connected to top wall 25 . there is an additional alcove - like pocket 36 in central section 27 with a drip tray 38 which is slideably supported and positioned at the bottom thereof . it affords support for a liquid container 40 as shown in fig4 . alcove pocket is provided by back wall 35 and side walls 37 and 39 . referring to fig2 , 3 and 4 , there is a water supply hose 42 with a filter valve 44 for supplying water to the header 46 in the customary manner . there are two valves 48 and 50 connected to the header 46 . water supply line 52 supplies water to a low flow rate eductor 56 whereas water supply line 54 supplies high flow rate to eductor 58 . the preferred eductors 56 and 58 are those described in commonly owned u . s . patent application ser . no . 11 / 195 , 052 filed aug . 2 , 2005 , which teachings are incorporated herein by reference . an outlet line 60 conveys product from eductor 56 to container 40 . similarly hose outlet line 64 and gun / nozzle 66 convey product to bucket 69 . the gun of gun / nozzle 66 is connected to cable 67 which is also connected to valve 50 . gun nozzle 66 as well as valve 50 , are described in u . s . pat . no . 6 , 299 , 035 , which teachings are incorporated herein by reference . a four - way valve 68 is connected to eductors 56 and 58 and positioned inside central section 27 . it is controlled by knob 70 . there are four product inlet lines 72 , 73 , 74 and 75 connected to the four - way valve 68 as well as to container caps 80 , 81 , 82 and 83 , respectively . the preferred four - way valve 68 is described in commonly assigned u . s . patent application ser . no . 60 / 707 , 399 filed aug . 11 , 2005 , which teachings are incorporated herein by reference . there is an outlet line 86 interconnected with common line 88 as well as eductors 56 and 58 . two check valves 90 and 92 are positioned in line 88 , for purposes as will be explained later in the operation . as seen in fig5 , 6 and 7 , a bottle contact bar 84 extends through opening 76 in alcove back wall 35 . bar 84 extends from arm 78 pivotally connected at 79 to flanges ( not shown ) extending from the bottom of alcove side walls 37 and 39 . arm 78 contacts crank portion 89 pivotally attached at 91 by trunion 87 to flanges 85 connected to rear wall 23 ( see fig3 ). yoke 94 connects pull chain 96 to valve 48 in the manner described in u . s . pat . no . 6 , 299 , 035 . the previously described components comprise the linkage 97 for actuating valve 48 . a better understanding of the dispensing apparatus will be had by a description of its operation . referring to fig3 , containers with chemical concentrate such as shown at 34 are placed in pockets such as 33 in cabinet 12 and connected to caps 80 , 81 , 82 and 83 . each container will preferably contain a different chemical concentrate . doors 17 and 18 are closed and latched such as by latches 19 engaging cut outs 22 in central support section 27 . filter valve 44 is connected to a source of pressurized water which causes water to flow to header as seen in fig4 . the operator then selects which of the chemical concentrates is to be diluted and educted by means of knob 70 and pointer 71 . the pointer 71 of a knob 70 is directed toward which container in which pocket 33 is to be activated by means of the four way valve 68 . the operator then determines whether a bottle 40 is to be filled with the diluted chemical concentrate or a bucket 69 . if a bottle 40 is to be filled , it is placed in alcove pocket 36 . placement of bottle 40 therein presses against bar 84 which by means of linkage 97 activates valve 48 as shown in fig7 . activation is effected by arm 78 moving away from wall 35 which causes arm 98 of crank portion 89 to move downwardly . this exerts a pulling effect on connector 94 and chain 96 to open valve 48 . this causes pressurized water to flow into low flow rate eductor 56 . at the same time , reduced pressure is effected in lines 88 and 86 as well as one of the conduit lines 72 - 75 depending upon which is selected by the operator by means of the four - way valve 68 . in this instance check valve 90 opens whereas check valve 92 closes so there is no siphoning effect beyond line 86 and eductor 58 . diluted chemical concentrate flows through outlet line 60 into bottle 40 . once bottle 40 is filled with diluted concentrate , it is removed from the alcove pocket 36 which releases the force on bar 84 and closes valve 48 . this is shown in fig6 . if a bucket 69 is to be filled with diluted chemical concentrate , gun nozzle 66 is activated by pressing lever 99 ( see fig3 ). this creates a pulling force on cable 67 to activate valve 50 which causes pressurized water to flow into high flow rate eductor 58 . a siphoning action is effected in outlet lines 88 and 86 with an opening of check valve 92 and a closing of check valve 90 . this in turn draws chemical concentrate from one of the conduit lines 72 - 75 and accordingly the selected container 34 . when the lever is released , valve 50 closes and the previously described siphoning action ceases . it will thus be seen that there is now provided a mixing and dispensing apparatus which affords ease of dispensing . once the selector knob 70 is moved to a position to select the desired chemical concentrate , all that is required to activate the dispenser 10 is to place a bottle 40 in alcove 36 and against bar 84 . this is accomplished with one hand . the same advantages pertain to filling bucket 69 . all that is required is a selection of the desired concentrate by means of selector knob 70 and four - way valve 68 , and a pressing of lever 99 of gun nozzle 66 . this also affords remote bucket filling . other important features of the dispenser 10 are latches 19 which are key locks and afford a locking of the doors 17 and 18 . this is seen in fig3 . the doors 17 and 18 are composed of stainless steel or powder coated mild steel whereas the cabinet is composed of durable molded abs plastic . this affords a reduced maintenance dispenser . product identification is easily made through windows 15 . the cabinet 12 affords on - wall repair , compatibility with multiple packages , in field retrofit as well as quick connect of serviceable components and improved ergonomics . hinged panel 28 provides ready access to the eductors 56 and 58 which are connected to panel 61 . eductors 56 and 58 are connected to valves 48 and 50 by a gardena connector 57 such as illustrated in fig3 . this provides ease of connection or disconnection . if desired , a battery powered indicator light could be employed in conjunction with knob 70 and pockets 33 to indicate which chemical concentrate is selected for dispensing . particular magnetic , pull - chain operated valves 48 and 50 are employed in conjunction with linkage 97 and gun / nozzle 66 . any valve which can be linkage or cable operated could be substituted . while eductors 56 and 58 are of the non - air gap type , depending on plumbing codes , air gap eductors can be employed such as that described in u . s . pat . no . 5 , 927 , 338 and no . 6 , 279 , 598 . a four - way valve 68 is described for use in conjunction with dispenser 10 . if desired , a valve with any number of product inlet lines could be used depending on the size of the cabinet 12 . all such and other modifications within the spirit of the invention are meant to be within its scope , as defined by the appended claims .	8
traditionally , tissue engineering scaffolds have been made by the solvent casting ( mikos , a . g ., et al ., “ preparation and characterization of poly ( l - lactic acid ) foams ” polymer 35 : 1068 , 1994 ) and gas foaming ( harris , l . d ., et al ., “ open pore biodegradable matrices formed with gas foaming ” j biomed mater res 42 : 396 , 1998 ) processes . in the solvent casting process ( mikos , a . g ., et al ., “ preparation and characterization of poly ( l - lactic acid ) foams ” polymer 35 : 1068 , 1994 ), a polymer is dissolved in a suitable solvent , added to a porogen - containing mold and the porogen is dispersed . the solvent is then allowed to evaporate from the mixture under ambient conditions leaving a polymer matrix containing a porogen which can then be leached out in an appropriate solvent . in the gas foaming process ( harris , l . d ., et al ., “ open pore biodegradable matrices formed with gas foaming ” j biomed mater res 42 : 396 , 1998 ), polymer particles are mixed with porogen particles and the mixture is compressed into a solid mixture of a discontinuous polymer with an interspersed porogen . the resulting pellet is then exposed to high pressure co 2 gas , and after the pressure is allowed to equilibrate over a period of time the pressure is rapidly released causing a thermodynamic instability in the polymer component of the mixture . the instability causes the polymer to foam , and the originally discontinuous polymer particles fuse together to form a continuous polymer matrix around interspersed porogen particles , which are then leached out in a solvent . in each of these processes the degree of interconnection between pores in the resulting scaffold is determined by the interconnection of porogen particles during the solvent evaporation or polymer foaming steps , respectively . because the porogen is dispersed within the polymer before fusion , the degree of interconnection between porogen particles is not actively controlled and the interconnectivity of pores in the final scaffold product is uncontrolled . enhancement in and control over porogen interconnectivity may be an important concern in various tissue engineering strategies in view of the substantial advantages of pore interconnectivity within scaffolds . certain embodiments of the present invention solve these problems in control over scaffold porosity and interconnectivity . in a preferred embodiment of the present invention , the porogen is not dispersed . rather , the progen is fused to create a framework ( or lattice ) and a polymer solution is introduced over and into this framework . it is not intended that the present invention be limited by the source of the cells . in one embodiment , the cells used for tissue engineering are from a biopsy . cells from the biopsy are then cultured from explants or a collagenase digestion to create a “ cell bank ”. these cells are then further cultured on substrates and scaffolds , under the correct physiological conditions , to form tissue - engineered constructs for implantation . the process is carried out in a tissue culture facility to maintain a sterile environment . cellular biochemical and physical activity can be enhanced by the addition of growth factors or cytokines and also by the use of physical stimulation . in some applications , a device that applies minute physical loads stimulates the resident cell population in the scaffold into biochemical and bio - physical activity normally associated with organogenesis and tissue repair . after further tissue culture under the correct conditions , the construct can then be implanted back into the patient from whom the cells were originally removed . this technology will eliminate the need for anti - rejection drugs because the tissue engineered tissue has been grown from the patients own cells and , therefore , will be accepted as a natural part of the patients body . in an embodiment of the present invention , salt crystals can be fused via exposure to certain conditions ( e . g ., approximately 95 % humidity ), resulting in enhanced pore interconnectivity within both solvent cast and gas foamed plg scaffolds . fusion of a salt matrix prior to solvent casting results in formation of holes in pore walls , and the diameter and sphericity of these holes increases with increasing salt fusion treatment . salt fusion treatment causes an increase in the compressive modulus of solvent cast scaffolds , possibly due to the formation of thick annular struts adjacent to holes in pore walls . enhanced pore interconnectivity may be useful in a variety of tissue engineering applications , particularly those requiring intimate cell - cell contact ( i . e ., neural and muscular applications ). also , because the salt fusion method imparts improved pore interconnectivity in both the solvent casting and gas foaming processes , the concept may be applicable to other solid porogen - based methods for producing macro - or micro - porous material systems with high interconnectivity . utilization of a fused salt mold in a solvent casting , particulate leaching method results in the formation of holes between pore walls in the scaffold . with increased salt fusion time the pore structure within the scaffold cross sections became less organized . the apparent lack of an organized pore structure is due to the excellent interconnectivity of the salt fused samples , which reduces the presence of well - organized , largely closed - off pores . upon scaffold bisection many of the pores have flattened out due to their lack of a continuous pore wall . in effect , the increased continuity of the fused salt matrix creates corresponding discontinuity in the polymer matrix , leading to large openings between pores and superior interconnectivity . additionally , intact samples could not be fabricated using salt fusion time periods of 48 hours or more . this further supports the inverse relationship between salt matrix continuity and tissue engineering scaffold continuity . previous studies using solvent casting , particulate leaching processes in which salt is dispersed allow no control over pore interconnectivity in accord with the holes in pore walls displayed in the present study ( mikos , a . g ., et al ., “ preparation and characterization of poly ( l - lactic acid ) foams ” polymer 35 : 1068 , 1994 ; kaufmann , p . m ., et al ., “ highly porous polymer matrices as a three - dimensional culture system for hepatocytes ” cell transplant 6 : 463 , 1997 ; murphy , w . l ., et al ., “ growth of continuous bone - like mineral within porous poly ( lactide - co - glycolide ) scaffolds in vitro ” j biomed mater res 50 : 50 , 2000 ). in a recent study , investigators utilized heat to fuse polymeric porogen particles together prior to solvent casting ( ma , p . x . and choi , j . “ biodegradable polymer scaffolds with well - defined interconnected spherical pore network ” tissue eng 7 : 23 , 2001 ). although the use of heat may prove useful in several tissue engineering applications , the localized dissolution approach described herein may hold more broad applicability due to its potential for room temperature fusion of several types of porogen particle ( both organic and inorganic ), and its potential addition to processing techniques that include bioactive inductive factors ( i . e ., gas foaming / particulate leaching ). the fusion of nacl crystals within plg / nacl mixtures prior to gas foaming also has a pronounced effect on pore structure . the pores within 24 hr of salt fusion ( sf ), gas foamed scaffolds appear to feed directly into one another , implying a very high interconnectivity without a large decrease in scaffold compressive moduli ( see , for example , fig6 b ). the gas foaming process has previously been used to process scaffolds containing biologically active vascular endothelial growth factor ( sheridan , m ., et al ., “ bioabsorbable polymer scaffolds for tissue engineering capable of sustained growth factor delivery ” j control rel 64 : 91 , 2000 ; murphy , w . l ., et al ., “ sustained release of vascular endothelial growth factor from mineralized poly ( lactide - co - glycolide ) scaffolds for tissue engineering ” biomaterials 21 : 2521 , 2000 ) and plasmid dna encoding for platelet - derived growth factor ( shea , l . d ., et al ., “ dna delivery from polymer matrices for tissue engineering ” nat biotech 17 : 551 , 1999 ) to promote ingrowth of vascular tissue . adding the novel salt fusion method of the present invention to the gas foaming and solvent casting methods has lead to the formation of a highly interconnected vascular supply throughout the interior of a tissue engineering scaffold . achieving vascular ingrowth to maximum depths within a scaffold system is a substantial goal in bulk tissue engineering strategies , and the highly interconnected pore structure of the present invention is advantageous for optimal vascular tissue ingrowth . when exposed to humid environments , adjacent salt crystals fuse in a process called ‘ caking ’, which often results in the formation of large agglomerations of rock salt or improperly stored table salt ( anti - caking agents , such as calcium silicate , are added to table salt to prevent caking , essentially by absorbing moisture inside the package that otherwise would be absorbed into the surface of the salt particles ). in a preferred embodiment , the present invention does not contemplate the use of anti - caking agents . the rate of diffusion of atoms within the solid salt crystal lattice is increased by the presence of absorbed water . the increased diffusion allows the surfaces of the contacting salt particles to coalesce , forming bridges between particles in a process similar to that used for solid sintering of non - vitreous ceramic materials . the individual particles begin to coalesce because , in the process , the total surface area of the salt particles is reduced , thus reducing the surface energy ( van vlack , l . h . “ elements of materials science and engineering ,” 4ed . addison - wesley publishing company , reading , mass ., pp . 120 & amp ; 316 , 1980 ). the increased sphericity of each particle of salt is also thermodynamically favored , since this also reduces the total surface energy of each particle . the solvent cast scaffolds had a significantly increased compressive modulus after 24 hours of salt fusion , whereas the gas foamed scaffolds did not . the solvent cast scaffolds the thicker struts of plg material that were permitted to form in the space vacated by rounded corners and edges of the salt particles formed a stiffer structure , without an increase in the volume fraction of plg in the scaffold . a similar increase in the modulus of the gas foamed scaffolds did not occur with increased nacl fusion time . this may be due to the presence of plg particles during the salt fusion in the gas foaming process . undoubtedly there is some void space for interaction between adjacent nacl crystals , even in the presence of both types of particles ( nacl and plg ). the displacement of the salt surface resulting from diffusion was restricted to movement within the available void space . evidence in support of this is clear in fig5 ( b & amp ; d ), in which the scaffold is composed of micro perforated sheets , not present in the solvent cast scaffold , suggesting that during the nacl fusion process the moving salt crystal surface was obstructed by , and perhaps flowed around , the smaller plg particles . thus , although bridges were formed between adjacent salt particles , the movement of the crystal surfaces was constrained by the presence of the plg particles . this may have prevented the growth of void spaces in the salt structure that would lead to the formation of thick - section struts in the plg scaffold , explaining why there was increased pore interconnectivity , but not increased compressive modulus , in the gas foamed scaffolds . although not limited to any particular application , the salt fusion method of embodiments of the present invention will be applicable to the engineering of neural and muscular tissues due to their dependence on pore interconnectivity . regenerative processes in the bridging of neural tissue defects ( axonal elongation ) and the development of functional skeletal muscle tissue ( myoblast fusion ) are examples of physiological processes requiring intimate cell - cell interaction . strategies to bridge nerve gaps using a variety of natural and synthetic scaffolding materials have been only moderately successful even in gaps less than 10 mm in length ( valentini , r . f ., et al ., “ collagen - and laminin - containing gels impede peripheral nerve regeneration through semipermeable nerve guidance channels ” exp neurol 98 : 350 , 1987 ; aldini , n . n ., et al ., “ effectiveness of a bioabsorbable conduit in the repair of peripheral nerves ” biomaterials 17 : 959 , 1996 ), and reasons for failure in many cases include lack of adequate pore interconnectivity and inadequate mechanical integrity of the conduit . recent studies using porous poly ( lactic - co - glycolic acid ) ( evans , g . r . d ., et al ., “ tissue engineered conduits : the use of biodegradable poly ( d , l - lactic - co - glycolic acid ) scaffolds in peripheral nerve regeneration ” in : stark , g . e ., horch , r ., tanczos , e ., eds . biological matrices and tissue reconstruction . berlin : springer , 1998 , pp . 225 - 235 ) and poly ( l - lactic acid ) ( evans , g . r . d ., et al ., “ in vivo evaluation of poly ( l - lactic acid ) porous conduits for peripheral nerve regeneration ” biomaterials 20 : 1109 , 1999 ) scaffolds for neural regeneration have shown promise in 12 mm nerve defects in a rat sciatic nerve model . extension of this basic concept to larger , critical nerve defects requires controlled pore interconnectivity to allow vascular ingrowth , avoid pruning of regenerating fibers during axonal elongation and ensure that elongating axons reach their target organs . enhanced and controlled pore interconnectivity are necessary scaffold characteristics to promote successful myoblast fusion . further , the survival of cells within a functioning muscle organoid is diffusion limited ( dennis , r . g . and kosnik , p . e ., “ excitability and isometric contractile properties of mammalian skeletal muscle constructs engineered in vitro ” in vitro cell dev biol — animal 36 : 327 , 2000 ) and thus ingrowth of vascular tissue is essential to increase the maximum diameter of functional muscle constructs in order to amplify contractile properties . although not limited to any particular application , certain embodiments of the present invention ( e . g ., the salt fusion process ) are particularly applicable in preparing highly interconnected scaffolds for neural and muscular applications . although the present invention is not limited to any particular theory , the substantial advantages of pore interconnectivity in promoting three dimensional cell - cell interaction are believed to aid in the growth of neural and muscular tissue in tissue engineering scaffolds . the following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof . in the experimental disclosure which follows , the following abbreviations apply : eq ( equivalents ); m ( molar ); μm ( micromolar ); n ( normal ); mol ( moles ); mmol ( millimoles ); μmol ( micromoles ); nmol ( nanomoles ); g ( grams ); mg ( milligrams ); μg ( micrograms ); l ( liters ); dl ( decalitters ); ml ( milliliters ); μl ( microliters ); cm ( centimeters ); mm ( millimeters ); μm ( micrometers ); nm ( nanometers ); ° c . ( degrees centigrade ); rda ( representational difference analysis ); nts ( nucleotides ); kv ( kilovolts ). in this example , nacl frames and biodegradable polymer scaffolds are produced . the salt particles ( mallinkrodt , paris , ky .) were sieved to yield a range of sizes . nacl crystals of a diameter of about 250 - 425 μm were used . porous scaffolds were prepared either by solvent casting / particulate leaching , or gas foaming / particulate leaching processes using nacl as the particulate porogen . the solvent cast scaffolds were prepared essentially as described by mikos , a . g ., et al . (“ preparation and characterization of poly ( l - lactic acid ) foams ” polymer 35 : 1068 , 1994 ; which is incorporated herein by reference ). nacl molds were made by subjecting nacl crystals ( diameter of about 250 - 425 μm ) to 95 % humidity for periods from 0 - 24 hr to achieve fusion of nacl crystals prior to solvent casting . a closed , water - jacketed cell culture incubator ( forma scientific , inc .) held at 37 ° c . was used to create a 95 % humidity environment for fusion of nacl crystals . poly ( lactide - co - glycolide ) ( plg ) pellets with a lactide : glycolide ratio of 85 : 15 were obtained from medisorb , inc . ( intrinsic viscosity ( i . v . )= 0 . 78 dl / g ) and boehringer - ingelheim inc . ( i . v .= 1 . 5 dl / g ). high inherent viscosity plg was used in the solvent casting process to ensure that the scaffolds would retain adequate mechanical integrity despite their relatively high porosity (˜ 97 %). plg pellets were dissolved in chloroform ( mallinkrodt , paris , ky .) to yield a solution of 10 % weight / volume ( w / v ). the polymer solution was then poured into an nacl - containing mold wherein the salt crystals had been fused , as described above . following solvent evaporation , the salt was removed by immersion in distilled water for about 48 hours . the gas foamed scaffolds were essentially prepared as described by harris , l . d ., et al . (“ open pore biodegradable matrices formed with gas foaming ” j biomed mater res 42 : 396 , 1998 ; which is incorporated herein by reference ). nacl molds were made by subjecting nacl crystals ( diameter of about 250 - 425 μm ) to 95 % humidity for periods from 0 - 24 hr to achieve fusion of nacl crystals prior to solvent casting . following treatment in 95 % humidity samples were dried in a vacuum desiccator for 48 hr before further processing . a closed , water jacketed cell culture incubator ( forma scientific , inc .) held at 37 ° c . was used to create a 95 % humidity environment for fusion of nacl crystals . plg pellets ( prepared as above ) were dissolved in chloroform . frames of fused nacl were mixed with plg were loaded into an aluminum die ( 1 . 35 cm diameter ; aldrich chemical co ., milwaukee , wis .) and was compressed at 1500 psi for 1 minute using a carver laboratory press ( fred s . carver , inc ., menominee falls , wis .) to yield solid disks ( thickness of about 3 . 4 mm ). the samples were then exposed to high pressure co 2 gas ( 800 psi ) for 24 hours to saturate the polymer with gas . a theromodynamic instability then was created by decreasing the gas pressure to ambient pressure . this lead to the nucleation and growth of co 2 pores within the polymer matrices . the nacl particles subsequently were removed from the matrices by leaching the matrices in distilled water for 48 hours . all processing steps were performed at ambient temperature . scaffolds were circular disks with a diameter of about 12 mm and a thickness of about 3 mm . the pore size range was controlled by using nacl particles with a diameter of about 250 - 425 μm in the processing . the total porosity of scaffolds was calculated using the known density of the solid polymer , the measured polymer mass of the scaffold , and the measured external volume of the scaffold . in this example , the scaffolds are characterized . incubation of nacl crystals in 95 % humidity resulted in fusion of the crystals , creating a highly interconnected nacl matrix ( fig1 a - b ). fused salt molds were bisected and imaged prior to solvent casting to observe the extent of nacl crystal fusion . in addition , polymer scaffolds were bisected after preparation via freeze fracture . a carbon coating was evaporated onto the surface of each bisected salt mold and polymer scaffold , and samples were imaged under high vacuum using a hitachi s - 3200n sem operating at 20 - 30 kv . fusion of salt crystals prior to addition of plg in chloroform ( solvent casting ) resulted in enhanced pore interconnectivity within the scaffold . the pore structure within the scaffolds ( fig2 ) appears similar to the structure of the fused salt matrix ( fig1 a - b ), as expected . pores within the cross section of 1 hr salt fusion ( sf ) samples display a defined pore structure with intermittent holes in pore walls , ( fig2 a , 2 c ), while the cross section of scaffolds created from 24 hr sf samples display a much less organized pore structure and a very large density of holes in pore walls ( fig2 b , 2 d ). the hole size increased significantly with fusion time , from an average diameter of 31 ± 10 μm after 1 hour of fusion to 78 ± 21 μm after 24 hours of fusion ( p & lt ; 0 . 05 ). in addition , the pore walls in the 24 hr sf scaffolds display thickness contours such that the walls appear thicker in the area adjacent to the holes in pore walls and along the outer diameter of the walls ( fig2 d ). a higher magnification view of a pore wall within a 24 hr sf scaffold further displays the contoured structure of the pore walls ( fig2 e ). the salt fusion process had no effect on the porosity of the scaffolds , and the calculated total porosities of the solvent cast scaffolds for each salt fusion time period were 97 ± 1 %. a close examination of the electron micrographs of the solvent cast scaffolds formed after 1 and 24 hours of nacl fusion indicate that the exposure to 95 % humidity has caused several important changes in the structure of the salt particles . in addition to the formation of bridges between particles at the points of contact , the radius of curvature of edges and corners in individual particles of salt has increased ( fig1 a and b ). these changes are shown schematically ( fig3 ). the radius of curvature of salt crystals was calculated from electron micrographs using microsoft ™ paint ™ software . the pixel size for each image was calibrated , and the pencil tool was used to mark tangent points on crystal edges . the calibration values and pixel coordinates were then used to calculate the cord length between tangent points , which was multiplied by ( 2 / 2 to obtain the crystal radius of curvature . the diameter of holes in pore walls was determined by measuring the major and minor diametral axes of each hole using microsoft paint and taking the average . the increased radius of curvature at the edges and corners of each particle of salt results in an increased sphericity of each particle ( fig4 ), and thus in each resulting pore in the scaffold . the mean radius of curvature of the crystal edges increased from 19 ± 10 μm , to 32 ± 15 μm after 12 hours of exposure to 95 % humidity , then to 62 ± 18 μm after a full 24 hours of exposure ( fig4 ). as a result , many of the smaller crystals became nearly spherical in shape after 24 hours of fusion . one additional consequence is that thicker polymeric struts may be formed in the space vacated by the corners and edges of each salt crystal , which may result in the thickness contours in pore walls described above and in varied mechanical properties . fusion of salt crystals in plg / nacl pellets prior to gas foaming also resulted in a pronounced variation in pore structure . the cross section of 1 hr sf samples ( fig5 a , 5 c ) shows small holes in pore walls similar to those in the solvent cast 1 hr sf samples . the 24 hr salt fusion samples lack a defined pore structure and pores appear to simply feed into each other ( fig5 b , 5 d ). the gas foamed sf scaffolds do not display any of the contours in pore walls observed in the solvent cast sf samples . again , the salt fusion process had no effect on the total scaffold porosity . the total porosities of the gas foamed scaffolds for each salt fusion time period were 94 ± 1 %. fusion of salt crystals for 24 hr resulted in a 2 - fold increase in the compressive modulus of the solvent cast scaffolds ( fig6 a ). compressive moduli of scaffolds were determined using an mts bionix 100 mechanical testing system . samples were compressed between platens with a constant deformation rate of 1 mm / min . compression plates had a diameter of 45 mm , and thus covered the entire 12 mm diameter surface of the scaffold . a small pre - load was applied to each sample to ensure that the entire scaffold surface was in contact with the compression plates prior to testing , and the distance between plates prior to each test was equal to the measured thickness of the scaffold being tested . compressive moduli were determined for scaffolds without salt fusion and for each of four samples for each salt fusion time . values on graphs represent means and standard deviations . statistical analysis was performed using instat ™ software , version 2 . 01 . at each time point , experimental moduli were compared to control moduli via a student &# 39 ; s t - test to reveal significant differences in compressive modulus . no significant modulus change is observed after 1 hr , or 12 hr of salt fusion . alternatively , there was a statistically significant decrease in the compressive modulus of gas foamed scaffolds processed using salt fusion when compared with control scaffolds ( fig6 b ). in this example , the scaffolds of the present invention are use for the culture of cells . the scaffold is sterilized by gamma radiation , ethylene oxide or cold sterilants . cells are seeded on to the scaffold in an appropriate culture medium with any necessary growth factors , if needed . cell culture media may be replaced by batch feeding or by perfusion methods . sterility is maintained at all times . in this example , scaffolds of the present invention are used for the implantation of tissue into the body of test subjects . in other examples , scaffolds are used for direct implantation without tissue or cells to allow the conductive and inductive migration of cells from the body . biopsies are taken form 16 mice . biopsies are taken from any non - hemopoietic or hemopoietic tissue . biopsies are taken from the same tissues source from all test animals . this example may be preformed on as many tissue types as desired . cells are disassociated from basement membranes and syncytia by collagenase treatment . cells from 8 of the mice are cultured in petri dishes . cells from the other 8 mice are cultured on the scaffolds of the present invention . after culture of about 7 to 21 days , the cells or scaffolds with cells are implanted back into the respective mice . follow up observation shows that the cell / scaffold implants of the present invention become invaginated with blood vessels and maintain a three dimensional structure . follow up observation shows that the cells cultured without the scaffolds of the present invention dissipate into the host animal and do not become invaginated nor maintain a recognizable three dimensional structure . in examples where cells migrate into the scaffold from the surrounding tissues , follow up observation shows establishment of cells in the scaffolds with invagination of circulatory vessels . as is evident from the foregoing , the present invention contemplates novel compositions and methods for the production of tissue engineering scaffolds . these novel compositions and methods allow for the efficient production of biocompatable structures of consistent pore size and interconnectivity .	0
fig1 schematically shows an embodiment according to the prior art , in which latex mattresses are made . the device 1 is built up of a conveying system 2 , preferably a circulating conveying system . a number of mattress moulds 3 are transported over said circular conveying system 2 in succession , and a mattress is formed in each of the mattress moulds 3 . while the mattress moulds 3 are being moved over the conveying system 2 , the amount of latex contained in the mattress moulds 3 is subjected to a number of mattress - forming operations . in fig1 a number of such mattress - forming operations , indicated 4 a - 4 d , are shown merely to illustrate and explain the system , which is known per se . numeral 4 a indicates a filling station , from which each passing mattress mould 3 is filled with a predetermined amount of liquid latex . numeral 4 b indicates a heating or vulcanisation line , in which the amount of latex contained in each of the mattress moulds 3 is vulcanised so as to form the mattress . numeral 4 c indicates the location in the conveying system 2 where the latex mattresses that have been formed in each of the mattress moulds 3 are removed therefrom and carried to a discharge station 5 . said discharge station is partially built up of a conveyor belt , on which each of the removed , newly formed mattresses is carried off for further processing . subsequently , each mattress mould 3 from which the latex mattress has been removed is conditioned ( prepared ) at the location indicated by reference numeral 4 c before being filled with an amount of liquid latex at the filling station 4 a , after which the entire manufacturing cycle is repeated . fig2 is a detailed view of the discharge station 5 , i . e . the location in the conveying system 2 where the newly formed mattresses are removed from each of the mattress moulds . as fig2 shows , the conveying system 2 is built up of two drivable guideways 10 a - 10 b , over which the mattress mould 3 can be moved . the mattress mould 3 is built up of two shell members 3 a and 3 b , which are interconnected by a hinge 13 . the shell members 3 a , 3 b comprise a lower mould section 14 a and an upper mould section 14 b , respectively , which fit together exactly when the shell members 3 a and 3 b are moved together , thus creating a moulding cavity 17 into which latex ( not shown ) can be introduced so as to form the latex mattress . the lower mould section 14 a is provided with an upright edge 15 , which may alternatively be present on the upper mould section 14 b , however . it should be noted that the manner in which the mattress mould 3 is filled with liquid latex is not relevant for a correct understanding of the invention . according to one manufacturing method , the mattress mould 3 is filled in open condition and the desired amount of liquid latex is introduced into the lower mould section 14 a . the upright edge 15 prevents undesirable leakage of liquid latex . according to another manufacturing method , the mattress mould 3 is filled in closed condition and the correct amount of liquid latex is injected into the moulding cavity 17 enclosed by the two closed mould sections 14 a - 14 b through an opening formed in the upper mould section 14 b . a number of upright pins 16 a - 16 b are provided in each of the lower and upper mould sections 14 a - 14 b , which pins extend into the latex mattress during the forming process of the latex mattress . said upright pins function to transfer heat more efficiently into the core of the mattress to enable an improved control of or assist in the mattress forming process . at the end of the manufacturing process , the mattress mould 3 ( which is closed at that stage ) is conveyed in the direction of the removing station 4 d ( see fig1 ). the shell member 3 b of the mattress mould 3 is pivoted upwards — in a manner which is not relevant for a correct understanding of the present invention — providing access to the two mould sections 14 a - 14 b . the mattress ( not shown ) that has been formed in said mattress mould 3 may have come loose from both mould sections 14 a - 14 b as a result of the preparatory application of a so - called releasing agent , and consequently it is contained , being more or less freely accessible , in either the lower mould section 14 a or the upper mould section 14 b . at present , as already described above , the mattress that is present in the open mattress mould 3 is manually removed from the respective lower or upper mould section 14 a - 14 b at the location of the removing station 4 d . according to the invention , the device comprises removing means that remove the newly formed mattress from the lower or the upper mould section . said removing means are indicated at 30 , and in this embodiment they are freely movable with respect to the mattress mould 3 . in this embodiment , the removing means 30 are movable in horizontal and in vertical direction in the device 1 . the removing means 30 are movable in vertical direction away from and towards the open mattress mould 3 by means of a flexible connecting element 24 . the connecting element 24 is connected to the removing means 30 with one end and passed over a pulley 23 towards a rotary winding element 22 , which can be driven by a driving motor 22 a . the flexible connecting element 24 is wound on the rotary winding element 22 in one or more windings , so that the removing means 30 can be moved in vertical direction by suitably winding or unwinding the connecting element on or from the winding element 22 by means of the driving motor 22 a . the winding element 22 as well as the driving motor 22 a are mounted in a supporting construction 20 , which can be moved in horizontal direction over two slightly spaced - apart , parallel guides 21 a - 21 b . said movement over the guides 21 a - 21 b can be effected by means of suitable guide wheels 25 a - 25 b , for example . the operation of the removing means according to the invention will now be explained by means of an embodiment as shown in fig3 a and 3b . as is shown in fig3 a , the removing means 30 comprise a deforming element 33 , which is placed on the newly formed latex mattress , directly along a long side of the mattress and the upright edge 15 of the lower or upper mould section . the position at which the deforming element 33 is placed on the latex mattress to be removed ( which is present in the moulding cavity 17 ) is indicated at a in fig2 . the deforming element 33 extends along the entire length of the mattress to be removed , parallel to the upright edge 15 . the deforming element 33 forms part of a yoke 31 , which is coupled to the flexible connecting element 24 for realising the vertical movement with respect to the mattress that is to be removed . the yoke 31 has a considerable weight , which can be further increased by means of an auxiliary weight 31 a . as a result of the force of gravity and the considerable weight of the yoke 31 ( and the auxiliary weight 31 a ), the deforming element 33 is moved down some distance into the supple , flexible latex mattress . as a result , the circumferential edge of the latex mattress , which abuts directly against the circumferential edge 15 , will be moved clear of the circumferential edge at that location . the removing means 30 are furthermore provided with first clamping means made up of first and second clamping elements 34 - 35 , which are movable relative to each other . in the embodiment as shown in fig3 a and 3b , the first clamping element 34 is fixedly connected to the yoke 31 at the location of the deforming element 33 . upon deformation of the latex mattress to be removed by the deforming element 33 , the first clamping element 34 , too , will move down into the supple , flexible mattress material . the second clamping element 35 is pivotally connected to the yoke 31 via pivot point 36 . the second clamping element 35 is provided with a flange 35 a , which is pivotally connected , via pivot point 43 a , to a spindle shaft 42 that forms part of first moving means 40 . the spindle 42 is slidably accommodated in an extension cylinder 41 . the extension cylinder 41 is in turn connected to the upper side of the yoke 31 via pivot point 43 b . the long side of the latex mattress , which has been moved clear of the circumferential edge 15 by the deforming element 33 , can be clamped down by the first clamping means 34 - 35 by suitably driving the first moving means 40 , so that the second clamping element 35 will pivot about the pivot point 36 in the direction of the first clamping element 34 , as is shown in fig3 b . now that the long side of the latex mattress , which has been moved clear of the circumferential edge 15 of the mattress mould 17 , is clamped down between the first and the second clamping element 34 - 35 , the mattress can be taken or pulled out of the lower mould section 14 a by moving the removing means 30 in upward direction ( by winding the flexible connecting element 24 on the winding element 22 ). to prevent the mattress being damaged or torn on account of its weight at the long side that is clamped down between the first and the second clamping element 34 - 35 , the removing means 30 are provided with second clamping means made up of a third clamping element 38 , which can be moved with respect to the deforming element 33 by second moving means 50 . said third clamping element 38 is pivotally connected to the yoke 31 via pivot point 39 , and furthermore to the extension spindle 52 via point 53 a . the spindle 52 is movably accommodated in the extension cylinder 51 , which is connected to the yoke 31 at point 53 b . the third clamping element 38 has a clamping point 37 , which , when actuated , can be moved towards the deforming element 33 , as is shown in fig3 b . the mattress , which may or may not have been partially removed from the mould section 14 a , can be fully clamped down by means of the third clamping element 38 , thus preventing damaging or tearing of the mattress . to obtain a good clamping action , in order to prevent the mattress from being damaged upon removal and movement thereof , both the deforming element 33 and the first , second and third clamping elements 34 - 35 - 38 ( including the clamping point 37 ) extend along the full length of the mattress to be removed . as a result , a satisfactory clamping down of the mattress with a good pressure distribution is obtained . the occurrence of pressure points , which will inevitably lead to damage to the mattress to be removed , is prevented in this manner . furthermore , the yoke 31 is provided with a bearing edge 32 , which will be supported on the upper edge of a circumferential edge 15 of the mould section 14 a . in this way a proper orientation of the deforming elements 33 and of the first , second and third clamping elements 34 - 35 - 38 with respect to the mattress to be removed is obtained . fig4 schematically shows another embodiment of the device according to the invention . in this embodiment , the removing means 30 , which are schematically shown in fig4 , are mounted on a drivable arm 60 , which forms part of a driving unit 61 . the arm 60 is an articulated arm made up of , for example , two arm sections 62 a - 62 b , which are connected to the driving unit 61 by means of flexible couplings or hinges 63 a - 63 b . the driving unit 61 is mounted on a support that extends above the conveying system 2 . both mattresses that are present in the lower mould section 14 a and mattresses that are present in the upper mould section 14 b can be removed by the removing means , using the robot arm 60 , and be discharged in the direction of the discharge station 5 ( fig2 ) in a simple manner . once the mattress has been fully removed from the mould section 14 a by the removing means 30 , the mattress is vertically suspended between the third clamping element 38 and the deforming element 33 . by moving the supporting construction 22 back in the direction of the discharge station 5 ( see fig2 ) over the guides 21 a - 21 b by suitable driving means ( not shown ), the clamped - down mattress is positioned above a conveyor belt 5 a , which conveyor belt is configured as an endless carrier 11 that moves on drivable rollers 12 a - 12 b . the mattress is placed on the conveyor belt 11 at the location indicated at q by moving the yoke 31 down via the flexible connecting element 24 ( a cable , for example ) by means of the winding element 22 . by subsequently moving the third clamping element back to the position that is shown in fig3 a , the mattress is released and can be further discharged , for example to a drying device , for further processing via the conveyor belt section 5 a and the next conveyor belt section 5 b . having thus described exemplary embodiments of the present invention , it should be noted by those skilled in the art that the within disclosures are exemplary only and that various other alternatives , adaptations , and modifications may be made within the scope of the present invention . accordingly , the present invention is not limited to the specific embodiments as illustrated herein , but is only limited by the following claims .	1
fig1 a provides a schematic view of a damaged component 1 . the base material of the component 1 comprises an alloy , preferably based on nickel , and has a directional microstructure , which in the figures is indicated by short diagonal dashes . the damage 3 to the component 1 is located in the region of the surface 5 and is illustrated as an indentation in the figure . to repair the damaged component 1 , a solder 7 , which in the present exemplary embodiment is preferably in powder form , is applied to the precleaned , damaged location 3 and is then soldered to the base material of the component 1 by means of the action of heat ( fig1 b ). it is preferable for all of the solder 7 required to be introduced into the preferably precleaned , damaged location 3 , if appropriate in a small excess , and in particular for it not to be supplied in steps during the fusing operation . prior to fusing , it is preferable for the solder 7 to be pressed into the damaged location 3 . this has the advantage that the entire damaged location 3 is filled with the solder 7 . in particular in the case of very deep cracks 3 ( high aspect ratio ) with a nonuniform cross - sectional area , according to the prior art an external supply of powder using a powder feeder would not ensure that the solder 7 would reach the tip of the crack . the solder 7 can be applied in the form of a paste , a slurry , in pure powder form or by means of a foil and then introduced into the damaged location 3 . further forms of introduction or application are also conceivable . it is in this context advantageous if the material composition of the solder 7 is similar to that of the component 1 . “ similar ” means that the material of the solder 7 includes all the elements of the base material plus , in addition , one or more agents that lower the melting point ( e . g . boron , silicon ). however , the solder 7 must comprise at least one constituent with a melting temperature that is lower than the melting temperature of the base material of the component 1 , so that the action of heat melts the solder 7 but not the base material of the component 1 . it is preferable for the solder 7 to consist of one constituent , i . e . the solder 7 consists of an alloy and not a powder mixture of two alloys . the soldering temperature of the solder 7 during soldering is at least 30 ° c . or at least 50 ° c . lower than the melting temperature of the base material of the component 1 , so that there is no risk to the base material . it is preferable for the difference between the soldering temperature and the melting temperature to be between 50 ° c . and 70 ° c . this is important in particular if the base material is a superalloy . when using superalloys , chromium is vaporized at high temperatures close to its melting temperatures , and consequently the melting temperature of the solder 7 should be kept as low as possible so that the difference between soldering temperatures of the solder 7 and the melting temperature of the base material is as great as possible . the difference in the soldering temperature of solder 7 and the melting temperature of the base material is preferably also at least 70 ° c ., preferably 70 ° c .± 4 ° c . the maximum difference in the soldering temperature of the solder 7 and the melting temperature of the base material is preferably 120 ° c . it is preferable for the solder 7 first of all to be melted in such a way that it runs into the location 3 that is to be repaired . the temperature required to achieve this may be higher or lower than the temperatures used to set the directional microstructure . there are no restrictions on the superalloy that is to be soldered . however , the materials pwa 1483 , pwa 1484 and rene n5 have proven particularly advantageous for use of the solder 7 according to the invention . pwa 1483 has a melting point of around 1341 ° c ., rene n5 has a melting point in the region around 1360 ° c .- 1370 ° c . the melting points of the solders 7 are , for example , between 1160 ° c .- 1220 ° c . when using high temperatures , a further problem is recrystallization in ds or sx materials , and consequently in this case too it is necessary for there to be a considerable difference between the soldering temperature of the solder 7 and the melting temperature of the base material of the component 1 . to realize the action of heat on the solder 7 , in the present exemplary embodiment it is preferable for there to be an electron beam gun 9 which irradiates the solder 7 that is to be melted and thereby imparts to it the heat required for melting . the electron beam treatment is preferably carried out in vacuo . in particular in the case of oxidation - sensitive materials , such as for example in the case of superalloys , oxidation plays an important role , and consequently a heat treatment should be carried out by means of a laser or an electron beam and in vacuo . the electron beam treatment has the advantage of leading to better introduction of energy into the material and the further advantage that the electron beams can be moved contactlessly over the location 3 that is to be repaired by coils , which in this case constitute the optics . the action of heat on the solder 7 can also be implemented by means of laser beams . the laser power or the power of the electron beams is such that it is able to completely melt the solder 7 and bring it to the soldering temperature . the soldering temperature of the solder 7 is in some cases up to 140 ° above the melting temperature of the solder 7 . the power of a nd - yag laser is preferably between 1500 and 2000 w . according to the invention , during the soldering operation a temperature gradient is produced in the region of the damage 3 deliberately in a preferential direction of the microstructure of the base material . the temperature gradient can be produced by moving the component 1 and the electron beam gun 9 relative to one another . in the exemplary embodiment , therefore , the electron beam gun 9 is guided over the solder 7 parallel to the surface 5 . the rate at which the electron beam gun 9 is guided over the solder 7 is selected in such a manner that the desired temperature gradient is established in the region of the damage 3 , i . e . in the solder 7 . the temperature gradient induces the formation of an epitaxially directional microstructure when the solder 7 that has been melted by the electron beam gun 9 solidifies again . the steepness of the temperature gradient can be set , for example , by the rate at which the electron beam gun 9 and component 1 are moved relative to one another or by means of the power . in this context , the steepness of the gradient is to be understood as meaning the increase or decrease in the temperature per unit length . the steepness of the temperature gradient , which leads to the formation of a directional microstructure in the solidifying solder 7 , is dependent on the composition of the solder 7 . the temperature gradient that is to be set is given by the so - called gv diagram , which differs for different metals and metal alloys and needs to be calculated or experimentally determined for every alloy . a curve l in the gv diagram separates the range of the two parameters solidification rate and temperature gradient in which the alloy solidifies in globulitic form from that in which the alloy solidifies to form a dendritic directional microstructure . a description and explanation of the gv diagram is to be found , for example , in material science engineering volume 65 , 1984 in the publication by j . d . hunt entitled “ columnar to equiangular transition ”. the temperature gradient is determined from the soldering temperature of the solder 7 and the temperature of the component on the rear side of the location 3 that is to be repaired . preferably , the component 1 is not cooled or held at room temperature or if appropriate preheated up to 300 °, as described in documents wo 98 / 20995 , wo 98 / 05450 , wo 96 / 05006 or ep 0 631 832 a1 . processes for producing single - crystal structures by means of a laser or in an equivalent way by electron beams are also disclosed in ep 1 437 426 a1 or in wo 03 / 087439 a1 , which are intended to form part of the present disclosure with regard to the use of laser or electron beams for generating single - crystal structures . in the present exemplary embodiment , the preferential direction of the directional microstructure in the base material of the component 1 extends from left to right in the plane of the drawing . to induce the formation of a directional microstructure with a preferential direction corresponding to that of the base material in the solidifying solder 7 , the electron beam gun 9 is moved relative to the component 1 parallel to the preferential direction of the directional microstructure of the base material . if the component 1 has a sx structure , the repaired location 3 may likewise have a sx or alternatively a ds structure . if the component 1 has a ds structure , the repaired location 3 may likewise have a ds or alternatively a sx structure . it is preferable for component 1 and repaired location 3 to have the same microstructure . equally , the component 1 does not need to have a directionally solidified structure , in which case the directionally solidified structure in the repaired location 3 at high temperatures increases the strength of the component 1 , since the directionally solidified structure of the solder 7 in the repaired location compensates for the negative effect of the low melting point on the mechanical strength at higher temperatures . a width b ( fig1 a ) of the location that is to be repaired is between 1 μm and 1000 μm , preferably around 500 μm . the laser or electron beam may preferably cover the entire width b of the location 3 that is to be repaired . since the component 1 is heated only in the region of the location 3 that is to be repaired , this constitutes a local repair process or local soldering process . it is preferable for the width b of the location 3 that is to be repaired to be between 5 μm and 300 μm . it is equally advantageous for the location 3 that is to be repaired to have a width b of between 5 μm and 1000 μm . furthermore , crack widths b of between 20 μm and 300 μm can be repaired . the location 3 that is to be repaired preferably has widths b of between 20 μm and 100 μm . it is equally preferable for the location 3 that is to be repaired to have a width of between 50 μm and 300 μm . further advantages are achieved if the location 3 that is to be repaired has a width b of between 50 μm and 200 μm . moreover , cracks 3 with a width of between 50 μm and 100 μm are also repaired in an advantageous way by the process . there are no restrictions on the length of the location that can be repaired . in this context , however , the laser 9 and the electron beams may have to be moved in the longitudinal direction ( into the plane of the drawing ), in which case the laser is moved in this direction as described in wo 03 / 087439 a1 . the rates at which the laser beams or electron beams are moved are preferably 100 mm / min to 130 mm / min . the holding times of the laser or electron beam depend on the material and the weight of solidification . fig1 c shows the component 1 after the damage 3 has been repaired . as indicated by the diagonally running dashes in the region of the now solidified solder 7 , the solidified solder 7 , i . e . the repair material , has a directional microstructure with the same preferential direction as the directional microstructure of the base material of the component 1 . the electron beam can also be widened in such a way that , for example , it irradiates all of the solder 7 and at least thereby completely heats said solder . it is not absolutely imperative that the electron beam gun be moved . the dissipation of heat from the solder 7 into the substrate of the component 1 produces a temperature gradient within the solder 7 . the temperature is highest at the outer surface of the solder 7 and cooler at the interface between the solder 7 and the substrate of the component 1 . if appropriate , the component 1 can be cooled or heated on the rear side , opposite the damage 3 or elsewhere , in order to set a desired , specific temperature gradient as a function of the geometry of the component 1 and of the damage 3 . in the present exemplary embodiment , an electron beam gun 9 was used to supply the heat . alternatively , however , it is also possible to use other optical heating methods , for example illumination with a conventional illumination apparatus . moreover , it is also possible to use inductive heating methods instead of optical heating methods , in which case the solder is heated by means of heating coils . finally , it is also possible to use special heating furnaces such as for example a “ hot box ” or a casting furnace for producing a casting with a directionally directed microstructure . in any case , the process used must be suitable for producing a temperature gradient in the direction desired for solidification in the region of the damage or of the solder - filled damage . if a furnace is used , this can be effected , for example , by means of a stationary furnace which makes it possible to set the action of heat separately in different regions of the furnace . fig2 illustrates a modification of the exemplary embodiment that has been illustrated with reference to fig1 a to 1 c . in the modification of the exemplary embodiment , the solder 17 applied to the damaged location 3 comprises two constituents , of which the first constituent has a melting temperature that is significantly lower than that of the base material of the component 1 . by contrast , the second constituent has a melting temperature which is in the range between the melting temperature of the first constituent and the melting temperature of the base material . moreover , the second constituent in particular also has a high strength , for example of the order of magnitude of the base material . it is preferable for the solder 17 in powder form to be applied to the precleaned , damaged location 3 in such a manner that first of all a solder composition 18 in which the first constituent forms a relatively high proportion of the powder is applied . this is followed by application of a solder composition 19 in which the first constituent is present in a reduced proportion compared to the second constituent . if the solder 17 is then soldered to the base material , the high proportion of the first constituent , i . e . of the constituent with the low melting temperature , makes it easier to solder the solder to the base material , whereas the solder composition 19 in which the proportion of the first constituent is reduced ensures a higher strength of the repaired location . it is also possible for the solder composition 18 to ensure a higher strength of the location 3 that is to be repaired and for the solder composition 19 closer to the surface to have a higher resistance to oxidation and / or corrosion . as an alternative to this two - layer structure of the solder 7 , the solder 7 in the location 3 that is to be repaired may have a material gradient from the base of the location 3 to the surface 5 of the component in which the composition of the solder 7 changes continuously . in both exemplary embodiments of the process according to the invention , it is also possible for the action of heat for soldering the solder 7 , 17 to the base material of the component 1 to be used simultaneously to carry out a heat treatment on the base material , in order thereby to allow refurbishment ( rejuvenation ) of the base material properties . in the exemplary embodiment described and its modification , the solder 7 , 17 is applied in powder form to the location that is to be repaired . alternatively , however , it can also be applied as a foil or a paste . the powder of the solder 7 , 17 is , for example , in the form of a nanopowder , i . e . the grain sizes of the powder are less than 500 or less than 300 or less than 100 nanometers . this is because it has been found that a nanopowder solder 7 has a lower melting temperature than a conventional powder of the same composition with micrometer - sized grains . the powder of the solder 7 , 17 may also comprise a mixture of nanopowder and conventional powder , i . e . a powder with grain sizes in the micrometer range . the reduction in melting point can be set in a targeted way as a result . it is also possible for the foil or paste by means of which the solder 7 is applied to partially or completely include a nanopowder . the advantage over the prior art is that in this case the powder is not supplied via a powder feeder , but rather is fed in ready - compacted form to the location 3 that is to be repaired . supplying a nanopowder to a location 3 that is to be repaired via a nozzle , as is known from the prior art , is almost impossible , since the grains of the nanopowder are much too small and would be scattered very widely during spraying . fig3 shows a perspective view of a rotor blade 120 or guide vane 130 of a turbomachine 100 , which extends along a longitudinal axis 121 and which is repaired with the inventive process . the turbomachine may be a gas turbine of an aircraft or of a power plant for generating electricity , a steam turbine or a compressor . the blade or vane 120 , 130 has , in succession along the longitudinal axis 121 , a securing region 400 , an adjoining blade or vane platform 403 and a main blade or vane part 406 . as a guide vane 130 , the vane 130 may have a further platform ( not shown ) at its vane tip 415 . a blade or vane root 183 , which is used to secure the rotor blades 120 , 130 to a shaft or a disk ( not shown ), is formed in the securing region 400 . the blade or vane root 183 is designed , for example , in hammerhead form . other configurations , such as a fir - tree or dovetail root , are possible . the blade or vane 120 , 130 has a leading edge 409 and a trailing edge 412 for a medium which flows past the main blade or vane part 406 . in the case of conventional blades or vanes 120 , 130 , by way of example solid metallic materials , in particular superalloys , are used in all regions 400 , 403 , 406 of the blade or vane 120 , 130 . superalloys of this type are known , for example , from ep 1 204 776 b1 , ep 1 306 454 , ep 1 319 729 a1 , wo 99 / 67435 or wo 00 / 44949 ; these documents , form part of the disclosure with regard to the chemical composition of the alloy . the blade or vane 120 , 130 is in this case produced by a casting process by means of directional solidification . workpieces with a single - crystal structure or structures are used as components for machines which , in operation , are exposed to high mechanical , thermal and / or chemical stresses . single - crystal workpieces of this type are produced , for example , by directional solidification from the melt . this involves casting processes in which the liquid metallic alloy solidifies to form the single - crystal structure , i . e . the single - crystal workpiece , or solidifies directionally . in this case , dendritic crystals are oriented along the direction of heat flow and form either a columnar crystalline grain structure ( i . e . grains which run over the entire length of the workpiece and are referred to here , in accordance with the language customarily used , as directionally solidified ) or a single - crystal structure , i . e . the entire workpiece consists of one single crystal . in these processes , a transition to globular ( polycrystalline ) solidification needs to be avoided , since non - directional growth inevitably forms transverse and longitudinal grain boundaries , which negate the favorable properties of the directionally solidified or single - crystal component . where the text refers in general terms to directionally solidified microstructures , this is to be understood as meaning both single crystals , which do not have any grain boundaries or at most have small - angle grain boundaries , and columnar crystal structures , which do have grain boundaries running in the longitudinal direction but do not have any transverse grain boundaries . this second form of crystalline structures is also described as directionally solidified microstructures ( directionally solidified structures ). processes of this type are known from u . s . pat . no . 6 , 024 , 792 and ep 0 892 090 a1 ; these documents form part of the disclosure . the blades or vanes 120 , 130 may likewise have protective layers 8 according to the invention protecting against corrosion or oxidation e . g . ( mcralx ; m is at least one element selected from the group consisting of iron ( fe ), cobalt ( co ), nickel ( ni ), x is an active element and represents yttrium ( y ) and / or silicon and / or at least one rare earth element , or hafnium ( hf )). alloys of this type are known from ep 0 486 489 b1 , ep 0 786 017 b1 , ep 0 412 397 b1 or ep 1 306 454 a1 , which are intended to form part of the present disclosure with regard to the chemical composition of the alloy . it is also possible for a thermal barrier coating , consisting for example of zro 2 , y 2 o 4 — zro 3 , i . e . unstabilized , partially stabilized or completely stabilized by yttrium oxide and / or calcium oxide and / or magnesium oxide , to be present on the mcralx . columnar grains are produced in the thermal barrier coating by means of suitable coating processes , such as for example electron beam physical vapor deposition ( eb - pvd ). refurbishment means that after they have been used , protective layers may have to be removed from components 120 , 130 ( e . g . by sand - blasting ). then , the corrosion and / or oxidation layers and products are removed . if appropriate , cracks in the component 120 , 130 are also repaired . this is followed by recoating of the component 120 , 130 , after which the component 120 , 130 can be reused . the blade or vane 120 , 130 may be hollow or solid in form . if the blade or vane 120 , 130 is to be cooled , it is hollow and may also have film - cooling holes 418 ( indicated by dashed lines ). fig4 shows a combustion chamber 110 of a gas turbine 100 . the combustion chamber 110 is configured , for example , as what is known as an annular combustion chamber , in which a multiplicity of burners 107 , which generate flames 156 , arranged circumferentially around the axis of rotation 102 open out into a common combustion chamber space 154 . for this purpose , the combustion chamber 110 overall is of annular configuration positioned around the axis of rotation 102 . to achieve a relatively high efficiency , the combustion chamber 110 is designed for a relatively high temperature of the working medium m of approximately 1000 ° c . to 1600 ° c . to allow a relatively long service life even with these operating parameters , which are unfavorable for the materials , the combustion chamber wall 153 is provided , on its side which faces the working medium m , with an inner lining formed from heat shield elements 155 . on the working medium side , each heat shield element 155 made from an alloy is equipped with a particularly heat - resistant protective layer ( mcralx layer and / or ceramic coating ) or is made from material that is able to withstand high temperatures ( solid ceramic bricks ). these protective layers may be similar to the turbine blades or vanes , i . e . for example mcralx : m is at least one element selected from the group consisting of iron ( fe ), cobalt ( co ), nickel ( ni ), x is an active element and stands for yttrium ( y ) and / or silicon and / or at least one rare earth or hafnium ( hf ). alloys of this type are known for example from ep 0 486 489 b1 , ep 0 786 017 b1 , ep 0 412 397 b1 or ep 1 306 454 a1 , which are intended to form part of the present disclosure with regard to the chemical composition of the alloy . it is also possible for a , for example , ceramic thermal barrier coating to be present on the mcralx , consisting for example of zro 2 , y 2 o 4 — zro 2 , i . e . unstabilized , partially stabilized or fully stabilized by yttrium oxide and / or calcium oxide and / or magnesium oxide . columnar grains are produced in the thermal barrier coating by means of suitable coating processes , such as for example electron beam physical vapor deposition ( eb - pvd ). refurbishment means that after they have been used , protective layers may have to be removed from heat shield elements 155 ( e . g . by sand - blasting ). then , the corrosion and / or oxidation layers and products are removed . if appropriate , cracks in the heat shield element 155 are also repaired . it is followed by recoating of the heat shield element 155 , after which the heat shield element 155 can be reused . moreover , a cooling system may be provided for the heat shield elements 155 and / or their holding elements , on account of the high temperatures in the interior of the combustion chamber 110 . the heat shield elements 155 are then , for example , hollow and may also have film - cooling holes ( not shown ) opening out into the combustion chamber space 154 . fig5 shows , by way of example , a partial longitudinal section through a gas turbine 100 . in the interior , the gas turbine 100 has a rotor 103 with a shaft 101 which is mounted such that it can rotate about an axis of rotation 102 and is also referred to as the turbine rotor . an intake housing 104 , a compressor 105 , a , for example , toroidal combustion chamber 110 , in particular an annular combustion chamber , with a plurality of coaxially arranged burners 107 , a turbine 108 and the exhaust - gas housing 109 follow one another along the rotor 103 . the annular combustion chamber 110 is in communication with a , for example , annular hot - gas passage 111 , where , by way of example , four successive turbine stages 112 form the turbine 108 . each turbine stage 112 is formed , for example , from two blade or vane rings . as seen in the direction of flow of a working medium 113 , in the hot - gas passage 111 a row of guide vanes 115 is followed by a row 125 formed from rotor blades 120 . the guide vanes 130 are secured to an inner housing 138 of a stator 143 , whereas the rotor blades 120 of a row 125 are fitted to the rotor 103 for example by means of a turbine disk 133 . a generator ( not shown ) is coupled to the rotor 103 . while the gas turbine 100 is operating , the compressor 105 sucks in air 135 through the intake housing 104 and compresses it . the compressed air provided at the turbine - side end of the compressor 105 is passed to the burners 107 , where it is mixed with a fuel . the mix is then burnt in the combustion chamber 110 , forming the working medium 113 . from there , the working medium 113 flows along the hot - gas passage 111 past the guide vanes 130 and the rotor blades 120 . the working medium 113 is expanded at the rotor blades 120 , transferring its momentum , so that the rotor blades 120 drive the rotor 103 and the latter in turn drives the generator coupled to it . while the gas turbine 100 is operating , the components which are exposed to the hot working medium 113 are subject to thermal stresses . the guide vanes 130 and rotor blades 120 of the first turbine stage 112 , as seen in the direction of flow of the working medium 113 , together with the heat shield elements which line the annular combustion chamber 110 , are subject to the highest thermal stresses . to be able to withstand the temperatures which prevail there , they have to be cooled by means of a coolant . substrates of the components may likewise have a directional structure , i . e . they are in single - crystal form ( sx structure ) or have only longitudinally oriented grains ( ds structure ). by way of example , iron - base , nickel - base or cobalt - base superalloys are used as material for the components , in particular for the turbine blade or vane 120 , 130 and components of the combustion chamber 110 . superalloys of this type are known , for example , from ep 1 204 776 b1 , ep 1 306 454 , ep 1 319 729 a1 , wo 99 / 67435 or wo 00 / 44949 ; these documents form part of the disclosure with regard to the chemical composition of the alloys . the blades or vanes 120 , 130 may also have coatings which protect against corrosion ( mcralx ; m is at least one element selected from the group consisting of iron ( fe ), cobalt ( co ), nickel ( ni ), x is an active element and represents yttrium ( y ) and / or silicon and / or at least one rare earth element or hafnium ). alloys of this type are known from ep 0 486 489 b1 , ep 0 786 017 b1 , ep 0 412 397 b1 or ep 1 306 454 a1 , which are intended to form part of the present disclosure with regard to the chemical composition of the alloys . a thermal barrier coating , consisting for example of zro 2 , y 2 o 3 — zro 2 , i . e . unstabilized , partially stabilized or completely stabilized by yttrium oxide and / or calcium oxide and / or magnesium oxide , may also be present on the mcralx . columnar grains are produced in the thermal barrier coating by suitable coating processes , such as for example electron beam physical vapor deposition ( eb - pvd ). the guide vane 130 has a guide vane root ( not shown here ), which faces the inner housing 138 of the turbine 108 , and a guide vane head which is at the opposite end from the guide vane root . the guide vane head faces the rotor 103 and is fixed to a securing ring 140 of the stator 143 .	1
the subject application describes a vehicle barrier that in one configuration may be used for separating the front seat area from the rest of the vehicle . more generally , the subject application describes a flexible or inflexible barrier having multiple attachment points that allow it to be secured between and at least partially dividing different areas of a vehicle . the subject application describes a specific use for the barrier in confining animals , such as pets , to an area away from the driver . however , it should be understood that the embodiments of the subject invention are applicable to a variety of uses , including containing non - animal objects to an area away from the driver . in one embodiment , shown , for example , in fig1 , a flexible material is utilized as an adjustable curtain . the flexible material may be mesh or solid and may be opaque , transparent , or translucent . use of a mesh material facilitates viewing the back of the vehicle to monitor pets or other objects therein . use of a transparent curtain material such as clear plastic ( whether mesh or solid ) likewise facilitates viewing the back of the vehicle . but in an alternative embodiment , the curtain can comprise an opaque material that reduces or eliminates visual contact between the front and back areas of the vehicle . optionally , the curtain may be rigid rather than flexible . in one embodiment , the curtain can be manufactured of molded or woven nylon , plastic , polypropylene , rayon , acetate , modacrylic , olefin , acrylic including but not limited to orlon , polyester , carbon fiber , vinyon , pvdc including but not limited to saran , elastane including but not limited to spandex , vinalon , aramid including but not limited to nomex , kevlar , or twaron , modal , polyethylene or high performance polyethylene including but not limited to dyneema or spectra , pbi ( polybenzimidazole fiber ), polyphenylene sulfide fibers including but not limited to sulfar , regenerated cellulose including but not limited to lyocell , pla , m5 , pbo or other polyoxazole including but not limited to zylon , aromatic polyester including but not limited to vectran ( tlcp fiber ), derclon , acrylonitrile or other synthetic rubber , or other synthetic material , or combinations thereof . in an alternative embodiment , the curtain comprises natural materials , such as cotton , linen , silk , wool , sisal , hemp , latex rubber , or other woven plant or animal fibers , wood , metal , or other natural materials in any combination . natural and synthetic materials may also optionally be used together in any combination . in one embodiment , material incorporating natural or synthetic elastic strands such as rubber strands may be used . in a further embodiment , the periphery or edges of the curtain are joined to a reinforcement material 2 . the reinforcing material may be any synthetic or natural material , including those materials indicated herein as being suitable for the curtain . in this embodiment , the periphery of the curtain is reinforced with a high strength material capable of withstanding any stretching and pulling that may be encountered when installing the barrier or in confining a pet or object to the desired area of a vehicle . in a specific embodiment , the edges of the curtain are joined to ( e . g ., enclosed in ) a woven nylon webbing material . however , in an alternative embodiment , the edges can be reinforced by folding or rolling the edges around a reinforcing material such as cording or piping . in yet another embodiment , the edges may be reinforced by folding or rolling even without use of a distinct reinforcing material such as cording ; the additional layers created by folding or rolling will themselves serve as reinforcement . a person with skill in the art would be able to determine any of a variety of additional devices and methods for reinforcing one or more edges of the curtain . such variations are contemplated to be within the scope of the subject invention . the barrier &# 39 ; s curtain 1 can employ a variety of circumferential shapes and configurations suitable for the intended purpose of separating different areas of a vehicle . in one embodiment , the curtain can comprise a generally rectangular shape . however , in alternative embodiments , the curtain can utilize any of a variety of other shapes , including square , round , oval , trapezoid , triangular , quadrilateral , pentagonal , hexagonal , heptagonal , octagonal , other polygonal , or any other shape . a unique advantage of some embodiments of the barrier of the subject invention is the ability to alter the shape to separate a variety of spaces , for example by folding the barrier and / or utilizing alternative points of attachment . thus , in a still further embodiment , the barrier can have a combination of straight and curved edges to accommodate an even broader range of uses and vehicles . in one embodiment , the barrier is shaped like an hourglass . in an embodiment , the barrier may incorporate 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , or more energy - absorbing features designed to reduce peak stresses when the barrier experiences high forces of short duration , such as during a collision . for example , if a heavy animal ( or other object ) were thrown into a barrier without energy - absorbing features , there would be a risk of barrier failure ( and / or anchor failure ). when energy - absorbing features are incorporated , the barrier itself ( and / or its modes of attachment ) can elongate in a controlled manner to decelerate the animal or object over a longer period of time , thus reducing the risk of barrier or anchor failure and reducing the risk of damage to the animal or object due to sudden deceleration . in one embodiment , the material of the barrier curtain can elastically elongate under load by 5 , 10 , 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , 60 , 65 , 70 , 75 , 80 , 85 , 90 , 95 , 100 , 105 , 110 , 115 , 120 , 125 , 130 , 135 , 140 , 145 , 150 , 155 , 160 , 165 , 170 , 175 , 180 , 185 , 190 , 195 , or 200 % or more without failing . in one embodiment , the modes of attachment can elastically elongate under load by 5 , 10 , 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , 60 , 65 , 70 , 75 , 80 , 85 , 90 , 95 , 100 , 105 , 110 , 115 , 120 , 125 , 130 , 135 , 140 , 145 , 150 , 155 , 160 , 165 , 170 , 175 , 180 , 185 , 190 , 195 , or 200 % or more without failing . in one embodiment , one or more local - failure elements may be used to absorb energy . for example , the curtain itself , or its optional reinforced periphery , or both , may be folded and stitched in a z - fold or t - fold orientation ( or a variation thereof ) with low - strength stitching ; upon heavy impact , the z - fold or t - fold stitching will rip out partially or completely while the barrier as a whole maintains its integrity . a great variety of local - failure elements may be used including stitching ; snaps , buttons , rivets , hooks , or other fasteners that disengage sequentially ; and mated hook - and - loop fabric surfaces ( for example in a t - fold or z - fold ). in one embodiment , either the modes of attachment or the barrier material or both are of limited elasticity . while not required , it is especially preferred that local - failure elements be incorporated in such a case . for example , the material of the barrier curtain may optionally be able to elastically elongate under load by less than 5 , 10 , 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , 60 , 65 , 70 , 75 , 80 , 85 , 90 , 95 , 100 , 105 , 110 , 115 , 120 , 125 , 130 , 135 , 140 , 145 , 150 , 155 , 160 , 165 , 170 , 175 , 180 , 185 , 190 , 195 , or 200 % before failure . independently , the modes of attachment may optionally be able to elastically elongate under load by less than 5 , 10 , 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , 60 , 65 , 70 , 75 , 80 , 85 , 90 , 95 , 100 , 105 , 110 , 115 , 120 , 125 , 130 , 135 , 140 , 145 , 150 , 155 , 160 , 165 , 170 , 175 , 180 , 185 , 190 , 195 , or 200 % before failure . the barrier can be removably attached across the vehicle space by a variety of devices and methods . in one embodiment as shown in fig1 , one or more openings are formed within the reinforced edges of the barrier and serve as points of attachment . in a preferred embodiment , grommets 3 , as known to those with skill in the art , are utilized to reinforce the openings , as shown , for example , in several of the figures . in one embodiment , openings are provided at the corners of the curtain . in another embodiment , openings are provided in the corners and at generally equidistant points along one , two , or more edges of the curtain . openings may also be provided at non - equidistant points along one , two , or more edges of the curtain . in one embodiment , at least some of the openings are spaced at alternating longer and shorter distances . for example , a set of 10 openings along an edge could have sequential spacings of 1 - inch , 10 - inch , 1 - inch , 10 - inch , 1 - inch , 10 - inch , 1 - inch , 10 - inch , 1 - inch . in one embodiment , the shorter spacing ( s ) are less than 80 %, 70 %, 60 %, 50 %, 40 %, 30 %, 20 %, 10 %, or 5 % of the length of the adjacent longer spacing ( s ). in one embodiment , the shorter spacings are approximately equal , within a tolerance of ¼ , ½ , ¾ , 1 , 1 . 25 , 1 . 5 , 1 . 75 , or 2 inches or less . in one embodiment , the longer spacings are approximately equal , within a tolerance of ¼ , ½ , ¾ , 1 , 1 . 25 , 1 . 5 , 1 . 75 , or 2 inches or less . in one embodiment , the shorter spacings are approximately equal and are less than 0 . 5 , 0 . 5 , 0 . 75 , 1 , 1 . 25 , 1 . 5 , 1 . 75 , 2 , 2 . 25 , 2 . 5 , 2 . 75 , 3 , 3 . 25 , 3 . 5 , 3 . 75 , 4 , 4 . 25 , 4 . 5 , 4 . 75 , 5 , 5 . 25 , 5 . 5 , 5 . 75 , 6 , 6 . 25 , 6 . 5 , 6 . 75 , 7 , 7 . 25 , 7 . 5 , 7 . 75 , 8 , 8 . 25 , 8 . 5 , 8 . 75 , 9 , 9 . 25 , 9 . 5 , 9 . 75 , or 10 inches , or more . in one embodiment the larger spacings are approximately equal and are about 3 , 3 . 25 , 3 . 5 , 3 . 75 , 4 , 4 . 25 , 4 . 5 , 4 . 75 , 5 , 5 . 25 , 5 . 5 , 5 . 75 , 6 , 6 . 25 , 6 . 5 , 6 . 75 , 7 , 7 . 25 , 7 . 5 , 7 . 75 , 8 , 8 . 25 , 8 . 5 , 8 . 75 , 9 , 9 . 25 , 9 . 5 , 9 . 75 , 10 , 10 . 5 , 10 . 75 , 11 , 11 . 25 , 11 . 5 , 11 . 75 , 12 , 12 . 25 , 12 . 5 , 12 . 75 , 13 , 13 . 25 , 13 . 5 , 13 . 75 , 14 , 14 . 25 , 14 . 5 , 14 . 75 , 15 , 15 . 25 , 15 . 5 , 15 . 75 , 16 , 16 . 25 , 16 . 5 , 16 . 75 , 17 , 17 . 25 , 17 . 5 , 17 . 75 , 18 , 18 . 25 , 18 . 5 , 18 . 75 , 19 , 19 . 25 , 19 . 5 , 19 . 75 , 20 , 20 . 5 , 20 . 75 , 21 , 21 . 25 , 21 . 5 , 21 . 75 , 22 , 22 . 25 , 22 . 5 , 22 . 75 , 23 , 23 . 25 , 23 . 5 , 23 . 75 , or 24 inches , or more . to ensure adjustability of the curtain and allow use in either a horizontal or vertical position , it can be preferable to employ a plurality of openings within two or more edges of the curtain . thus , in some of the embodiments shown in the figures , at least five reinforced openings are provided within each of two edges of the curtain . this can allow the entire curtain to be extended across the vehicle space . alternatively , only a portion of the curtain can be utilized to extend across the entire space of the vehicle or only a portion of the vehicle space . in this embodiment , the curtain can be folded or draped such that the excess curtain portion remains free of attachment , or the openings in the unused curtain portion can be aligned and attached with the openings in the used curtain portion , providing a double - curtain , if desired . in an embodiment , any mechanical fastener including but not limited to snaps , hooks , pins , bolts , buttons , or other fastener , in any combination , can take the place of some or all openings to serve as points of attachment on the barrier . in a further embodiment , one or more elastic bands ( or other modes of attachment ) are utilized to secure the barrier at multiple points utilizing the openings ( or other points of attachment ). in a specific embodiment , multiple elongated , elastic tie - downs with fixedly attached hooks at either end can be used to wrap around fixtures within the vehicle and attach both hooks to the openings in the barrier . in an alternative embodiment , elongated , elastic tie - downs with fixedly attached hooks at either end can be used to secure the curtain attaching one hooked end to an opening and the other hooked end to various features or structures within the vehicle . the use of removable elastic tie - downs can expedite adjustment of the barrier to a variety of vehicle styles and classes . however , in an alternative embodiment , multiple adjustable straps are utilized to secure the edges of the barrier . in a still further embodiment , a combination of adjustable straps and elastic tie - downs are utilized . in addition , there are a variety of types of clamps , hook styles , snap closures , or other fasteners that can be utilized with the tie - downs , adjustable straps , or similar devices , to attach to the openings in the curtain and / or vehicle features or structures . it is anticipated that a person with skill in the art would be able to devise any of a variety of devices for removably attaching to the openings and / or vehicle structures to secure the barrier &# 39 ; s curtain across and / or within the vehicle space . such alternatives are contemplated to be within the scope of the present invention . as often happens with flexible materials utilized across a space , the upper - most edge can droop or sag . this is particularly prone to happen when the fabric is supported at the distal most edges or corners . such an effect can be unsightly , but , more importantly , it can alter the effectiveness of the barrier . to reduce or eliminate this effect , the upper edge of the barrier curtain can be further supported by utilizing the front seats themselves or the headrests at the top of the front seats of most vehicles . in one embodiment , one or more elastic and / or adjustable headrest bands are utilized to affix the upper edge of the barrier curtain to one or more headrests . in a specific embodiment , the headrest band can have at least one hook ( for example , a single hook ) to which both ends of the elastic band is fixedly attached to form an elastic loop . the headrest band can be placed around the headrest or actual seat and at least one hook can then be utilized to attach to an opening in the upper edge of the curtain . in a second embodiment , an elongated , elastic tie - down with hooks or other attachment devices at both ends can be utilized by affixing one end to an opening , wrapping the tie - down around the headrest or seat , and affixing the other end to an opening . in a third embodiment , the headrest band can be utilized in a loop shape with a ball or knob for securing the tie - down . in a similar embodiment , where the curtain is installed behind the back seat separating the “ cargo area ” from the rest of the vehicle , elastic tie - downs with balls or knobs may be utilized to secure the curtain around the back seat &# 39 ; s “ headrests ”, although such headrests are not necessarily identical to those associated with front seats . use of headrest bands is not limited to supporting the upper edge of the barrier curtain ; in another embodiment , the lower edge of the barrier curtain may be attached to headrest bands and the barrier may be extended upward toward the roof of the vehicle . it should be understood that tie - down assemblies and similar devices are well known in the art . a person having benefit of the subject application and knowledge in the art would be able to determine any of a variety of methods and devices ( i . e ., modes of attachment ) for securing and / or attaching a barrier of the subject invention within a vehicle . any and all such variations are considered to be within the spirit and scope of the subject invention . for example , modes of attachment may be flat or have a cross - sectional shape that is round , oval , rectangular , i - shaped , square , or of any other shape . modes of attachment may comprise any type of fiber or material listed herein as appropriate for the barrier and / or optional reinforced periphery . modes of attachment may connect to the barrier via hook ( s ); knob ( s ), ball ( s ), or other stopper ( s ); snap ( s ); clip ( s ); bolt ( s ); pin ( s ); button ( s ); or any other type of mechanical fastener described herein or known in the art . in one embodiment , a barrier and one , two , three , four , five , six , seven , eight , or more individual modes of attachment are provided in , upon , attached to , or removably associated with packaging . an individual mode of attachment may be , for example , a headrest band or loop with single hook ; a headrest band or loop with knob ; an elongated elastic tie - down with a hook on each of its two ends ; an adjustable strap with 0 , 1 , 2 , or more hooks ; or any other mode of attachment described herein . individual modes of attachment may be provided in any combination . for example , if six individual modes of attachment are provided with packaging , the six modes could be two loops with knob and four elongated elastic tie - downs with hooks on each end . in one embodiment , 1 , 2 , 3 , 4 , or more openings of at least 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , or more inches in their largest dimension are provided within the barrier . such openings may be selected from round , oval , square , rectangular , triangular , pentagonal , hexagonal , or any other regular or irregular shape ( including a slit ), in any combination . in one embodiment , at least one of the openings is partially or fully closable , and may employ zipper ( s ), button ( s ), hook ( s ), snap ( s ), hook - and - loop fabric , clip ( s ), drawstring ( s ), or any other means of closure known in the art . in one embodiment , at least one of the provided openings is adjustable in size . for example , the opening may be adjusted by partial closure via drawstring ( s ) or other means of closure previously mentioned . alternatively , a large permanent opening may be provided along with attachable adaptors to reduce the opening to a desired size . for example , an opening of 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , or more inches may be provided along with separate ( for example , zip - in or button - in ) insert ( s ) to reduce the opening size by 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , or more inches . the attachable adaptor ( s ) may be attached by zipper ( s ), button ( s ), hook ( s ), snap ( s ), hook - and - loop fabric , clip ( s ), or any other means of closure known in the art . in one embodiment , the opening in the attachable adaptor is an adjustable opening , for example by drawstring ( s ). in one embodiment , one or more of the openings may be sized ( either permanently or by adjustable mechanism ) large enough to allow the head of an adult ( or juvenile ) animal to pass through the opening , but small enough to prevent the shoulders , body , or entire animal to pass through the opening , where the animal is a cat , dog , or other animal , for example a dachshund , dalmation , rottweiler , pekinese , shar - pei , golden retriever , black lab , chihuahua , great dane , irish wolfhound , cocker spaniel , portuguese water dog , or other recognized dog or cat breed ( see , e . g ., dog breeds recognized by the american kennel club at akc . org and cat breeds recognized by the cat fanciers &# 39 ; association at cfa . org ). while the invention has been particularly shown and described with reference to certain specific embodiments , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention . the following example is intended to illustrate one particular embodiment and use of the subject invention . it is not intended to be limiting in any way . the subject invention is contemplated as a barrier for installation within a vehicle with a curtain comprised of nylon mesh outlined with nylon webbing around the entire perimeter . it is rectangular in shape , and within the outlining webbing on the long sides are installed 5 metal grommets evenly spaced for attachment to the interior of the vehicle . the attachment system consists of two different types of elastic ( bungee ) cords : 1 ) single loop cord with hook ( or with ball , knob , or other stopper ) and 2 ) single cord with double hook . two single loop cords with hooks ( or with ball , knob , or other stopper ) are intended to secure around the driver &# 39 ; s and passenger &# 39 ; s headrests or actual seats . four single cords with double hooks are intended to secure in one of two ways , either from grommet to anchor , or from grommet , looping ( or curving ) around anchor and back to grommet . a single cord with double hook that extends from grommet to anchor and back to grommet may return to the same grommet , an adjacent grommet , or a more distal grommet . four examples of anchors are : 1 ) the housing for the seatbelt mechanism ( for the front seats ) where it joins the wall of the vehicle at approximately head height ; 2 ) the handle common in many vehicles located next to the backseat windows and near the housing for the seatbelt mechanism ( for the front seats ) where it joins the wall of the vehicle at approximately head height ; 3 ) the housing for the seatbelt mechanism ( for the front seats ) where it joins the floor of the vehicle on the side of each front seat next to the door ; 4 ) the housing for the seatbelt mechanism ( for the front seats ) where it joins the floor of the vehicle between the two front seats . 1 . a barrier comprising a curtain , wherein said curtain comprises a periphery and a plurality of points of attachment situated in said periphery . 2 . the barrier of embodiment 1 , wherein said periphery is reinforced . 3 . the barrier of embodiment 2 , wherein said periphery is reinforced with webbing , cording , or piping . 4 . the barrier of any preceding embodiment , wherein at least one of the points of attachment is an opening . 5 . the barrier of embodiment 4 , wherein the opening is reinforced with a grommet . 6 . the barrier of any preceding embodiment , further comprising at least one mode of attachment , wherein said mode of attachment is an elongated elastic tie - down or a strap . 7 . the barrier of embodiment 6 , wherein said at least one mode of attachment is a bungee or elastic band or cord in the form of a loop attached to a single hook , ball , or knob . 8 . the barrier of any preceding embodiment , wherein said curtain is flexible . 9 . the barrier of any preceding embodiment , wherein said curtain is mesh or opaque . 10 . the barrier of any preceding embodiment , wherein said curtain comprises nylon , plastic , polypropylene , cotton , plant fibers , wood , metal , or combinations thereof 11 . the barrier of any preceding embodiment , wherein said curtain is rectangular , square , round , oval , or trapezoid . 12 . the barrier of any preceding embodiment , wherein said plurality of points of attachment situated in said periphery comprise openings at the corners and at approximately equidistant points along two or more edges . 13 . the barrier of any preceding embodiment except 12 , wherein said plurality of points of attachment situated in said periphery comprise openings at the corners and at alternating long and short spacings along two or more edges . 14 . the barrier of any preceding embodiment , wherein the size of said curtain in its shortest dimension is less than 6 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , or more than 40 inches . 15 . the barrier of any preceding embodiment , wherein the size of said curtain in its longest dimension is less than 12 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , 60 , or more than 60 inches . 16 . the barrier of any preceding embodiment , wherein said curtain is mesh and the mesh is less than ⅛ , ⅛ , ¼ , ⅜ , ½ , ⅝ , ¾ , ⅞ , 1 , 1⅛ , 1¼ , 1⅜ , 1½ , 1⅝ , 1¾ , 1⅞ , or 2 or more inches , wherein the mesh size refers to the size of a ball that would fall through the mesh if placed on the mesh . 17 . the barrier of any preceding embodiment , wherein the periphery is reinforced with webbing having a width of less than ¼ , ¼ , ⅜ , ½ , ⅝ , ¾ , ⅞ , 1 , 1⅛ , 1¼ , 1⅜ , 1½ , 1⅝ , 1¾ , 1⅞ , or 2 or more inches . 18 . the barrier of embodiment 5 , wherein said grommet has an opening of less than ⅛ , ⅛ , ¼ , ⅜ , ½ , ⅝ , ¾ , ⅞ , 1 , 1⅛ , 1¼ , 1⅜ , 1½ , 1⅝ , 1¾ , 1⅞ , or 2 or more inches . 19 . the barrier of any preceding embodiment , wherein said barrier comprises 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , or more local - failure elements . 20 . the barrier of any preceding embodiment , wherein said barrier comprises 1 , 2 , 3 , 4 , or more openings of at least 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , or more inches in their largest dimension when opened fully . 21 . the barrier of any preceding embodiment , wherein the barrier is approximately oval or rectangular and is about 24 by 47 inches . 22 . the barrier of any preceding embodiment , wherein the barrier is approximately oval or rectangular and is about 34 by 47 inches .	0
a system of renal , abdominal , and iliac arteries is denoted in fig1 as a whole by the reference numeral 10 . healthy renal arteries are denoted 12 , 14 , an abdominal artery having a diseased section 16 a where an aneurysm has formed is denoted 16 , a first common iliac artery having a diseased section 18 b where an aneurysm has formed is denoted 18 , and a second , healthy common iliac artery is denoted 20 . 18 a indicates where first common iliac artery 18 is cut down for insertion of guide wires , insertion sheaths , and catheters , and 20 a indicates where second common iliac artery 20 is cut down for the same reason . fig2 depicts arterial system 10 when the main body of stent graft 22 is advanced over guide wire 24 and introducer sheath 26 . the delivery system used to deliver and deploy the main body of a stent graft is not depicted ; fig2 is a post deployment depiction . stent graft 22 has elongate limb 22 a and truncate limb 22 b and is deployed so that it does not interfere with renal arteries 12 , 14 . wires 28 are known in the industry as the bare stent because no graft covers the bare wires . wires 28 have no significant effect on blood flow through said renal arteries . in fig2 , guide wire 24 and introducer sheath 26 are in position for advancing a novel main catheter , not depicted in fig2 . as depicted in fig3 , novel main catheter 30 , having exit opening 31 formed therein , is then advanced over guide wire 24 and introducer sheath 26 until leading or distal end 30 a of said main catheter is positioned beyond the distal end of stent graft 22 . distal end 30 a is clearly visible under fluoroscopic imaging . reference numeral 32 at the lower left corner of fig3 indicates the inner cannula that is slideably mounted within the non - round lumen of main catheter 30 . the lumen of the main catheter may be round , like the external surface of the main catheter , if the inner cannula extends through a non - round structure that is added to the round lumen . one example of a non - round lumen is denoted 29 in fig1 b . inner cannula 32 is formed by two cannulas that are secured to one another at their respective distal ends . in a first embodiment of the inner cannula , the two cannulas are secured to one another along their respective lengths , thereby forming a figure eight configuration in transverse section or end view . the second cannula is cut a few inches from its distal end and separated from the first cannula along those few inches except at its distal end which is joined to the distal end of the first cannula . in a second embodiment of the inner cannula , the two cannulas are not secured to one another along their respective lengths proximal to the interconnected distal ends . in this second embodiment , the second cannula is cut a few inches from its distal end and the extent of the cannula proximal to the cut is discarded . the remaining extent of the second cannula forms the extended arm . the two cannulas that collectively form the inner cannula are joined to one another at their respective distal ends in both embodiments . first cannula 32 a of said two cannulas slideably receives guide wire 24 and second cannula 32 b forms extended arm 36 . extended arm 36 is held against first inner cannula 32 a by main catheter 30 when extended arm 36 is disposed within the lumen of main cannula 30 . the lower left corner of fig4 depicts manually pulling inner cannula 32 in the distal - to - proximal direction indicated by directional arrow 34 when the first or second embodiment of inner cannula 32 is used , i . e ., both embodiments include extended arm 36 . retraction of inner cannula 32 relative to stationary main catheter 30 therefore enables extended arm 36 ( center of fig4 ) to travel through exit opening 31 formed in main catheter 30 . exit opening 31 and its associated kick plate 62 that guides extended arm 36 out said exit opening is best depicted in fig1 a . main catheter 30 is then advanced and rotated so that exit opening 31 and therefore extended arm 36 are aligned with but spaced apart from the gate of the stent graft . as is well - known , the gate is located in truncate leg 22 b slightly below the flow divider of the stent graft . when it is clear that extended arm 36 will pass through the gate and enter into the lumen of truncate leg 22 b when inner catheter 32 is retracted relative to stationary main catheter 30 , i . e ., pulled in a distal - to - proximal direction , inner catheter 32 is retracted until the distal end of extended arm 36 is external to truncate limb 22 b of main stent graft 22 as depicted in fig4 . in a first embodiment of extended arm 36 , the free end of extended arm 36 is formed of a ferromagnetic material such as a wire and in a second embodiment , a magnetic tip is secured to said free end when main catheter 30 is manufactured . fig5 depicts the next step of the novel method . mating catheter 42 is advanced over a guide wire , not depicted , through surgical incision 20 a in common iliac artery 20 . an introducer sheath , not depicted , smaller in diameter than introducer sheath 26 , is also introduced through said incision 20 a . the leading end of mating catheter 42 carries magnetic tip 44 which has a magnetic polarity opposite to the magnetic polarity of magnetic tip 40 if the second embodiment of the extended arm is in use . mating catheter 42 is then advanced and manipulated until magnetic tip 44 magnetically couples with magnetic tip 40 ( or the ferromagnetic wire if the first embodiment of extended arm 36 is used ) as illustrated in fig6 . the guide wire referred to but not depicted in connection with fig5 is depicted in the lower right corner of fig6 and is denoted 46 . it is hereinafter referred to as the contralateral guide wire . reference numeral 48 denotes an exit opening formed in mating catheter 42 near its distal end for said contralateral guide wire 46 . both catheters , i . e ., main catheter 30 and mating catheter 42 , are advanced together in order to advance contralateral guide wire 46 through exit opening 48 in a proximal - to - distal direction . after contralateral guide wire 46 is successfully extended through exit opening 48 , it is extended until it is positioned distal to the distal end of the stent graft , just like the distal end of first guide wire 24 , as indicated in said fig7 . magnetic tips 40 and 44 are then separated from one another . fig8 depicts the respective positions of the parts after magnetic tips 40 and 44 are decoupled . the separation is accomplished by holding main catheter 30 in a fixed position while pulling on mating catheter 42 . mating catheter 42 is then retracted through contralateral puncture site 20 a . contralateral guide wire 46 is left in place . fig9 depicts contralateral guide wire 46 in its fig8 position , i . e ., with mating catheter 42 removed . inner cannula 32 , depicted in the lower left corner of fig1 , is then pushed in the proximal - to - distal direction of directional arrow 52 to retrieve extended arm 36 through exit opening 31 into main catheter 30 . fig1 depicts withdrawal of main catheter 30 and inner cannula 32 , including extended arm 36 , through puncture opening 18 a in the ipsilateral side of the patient &# 39 ; s body . fig1 depicts site 10 when main catheter 30 is fully withdrawn through puncture opening 18 a . guide wires 24 and 46 remain in their respective fig1 positions . contralateral guide wire 46 is used to advance the contralateral limb of the stent graft for accurate placement . fig1 a is a longitudinal sectional view of main catheter 30 . exit opening 31 is formed in main catheter 30 , said opening being the exit opening for extended arm 36 . radiopaque ring 58 is also depicted in said fig1 a , said radiopaque ring being disposed in lumen 29 of main catheter 30 and having opening 60 that is in registration with exit opening 31 . in addition to enhancing the imaging of the novel tool and procedure , radiopaque ring 58 also structurally reinforces main catheter 30 in the region of exit opening 31 . fig1 a also depicts kick plate 62 which is formed in ring 58 and has utility in controlling the angle of exit of extended arm 36 as disclosed more fully in connection with fig1 . fig1 b is an end view of main catheter 30 . main catheter 30 has oval lumen 29 to receive inner cannula 32 and to prevent rotation of said inner cannula in said lumen of main catheter 30 . fig1 a is a longitudinal sectional view of inner cannula 32 . inner cannula 32 may be provided in two embodiments as aforesaid , both embodiments having a non - round structure that is prevented from rotation by the mating non - round lumen of main catheter 30 . in both embodiments of inner cannula 32 , the first cannula having lumen 32 a receives main guide wire 24 as best depicted in fig1 and the second cannula having lumen 32 b is cut near its distal end to form extended arm 36 , as also best depicted in fig1 . in the second embodiment of inner cannula 32 , that part of lumen 32 b proximal to the cut is removed and discarded as aforesaid . in both embodiments , the first and second inner cannulas are separated from one another for a predetermined extent on the distal end of the cut , remaining connected to one another at their respective distal ends so that extended arm 36 has a free end that extends through exit opening 31 when inner cannula 32 is retracted in a distal - to - proximal direction . fig1 is a longitudinal sectional view depicting extended arm 36 inside lumen 32 b of inner cannula 32 . magnetic tip 40 is in open communication with exit opening 31 . extended arm 36 and hence magnetic tip 40 have exited exit opening 31 in fig1 because inner cannula 32 has been pulled in the distal - to - proximal direction indicated by directional arrow 34 as disclosed above in connection with fig4 . the function of kick plate 62 in controlling the angle of extended arm 36 is made clear by said fig1 . in a third embodiment of extended arm 36 , depicted in fig1 , said extended arm is formed of a nickel - titanium alloy ( nitinol ® memory metal ) so that its deployed shape can be predetermined at the time of manufacture . in an additional embodiment of the inventive structure as a whole , also depicted in fig1 , stainless steel tubing 33 ensleeves first inner cannula having lumen 32 a along a predetermined extent thereof . stainless steel tubing 33 is positioned in the lumen of main catheter 30 in non - sliding relation thereto . the stainless steel tubing facilitates pushing of the first inner cannula in a proximal - to - distal direction by providing rigidity in the direction of the pushing force . it also facilitates rotation of said first inner cannula and hence of the second inner cannula to which it is connected . however , stainless steel tubing 33 has limited flexibility . in still another embodiment of the novel structure as a whole , also depicted in fig1 , elongate coiled spring 35 ensleeves the first inner cannula along a predetermined extent thereof , said elongate coiled spring being positioned in lumen 29 of main cannula 30 . coiled spring 35 facilitates pushing of the first inner cannula in a proximal - to - distal direction by providing rigidity in the direction of the pushing force and flexibility to negotiate bends or curves within the patient &# 39 ; s body . it also facilitates rotation of main catheter 30 and hence of the first and second inner cannulas . instead of providing main catheter 30 with an oval or other non - round lumen , a truncate non - rotation catheter 37 may be secured to lumen 29 of main catheter 30 as depicted in fig1 . truncate catheter 37 is cut out or slotted as depicted to receive inner cannula 32 to prevent rotation of said inner cannula relative to said main catheter lumen as said inner cannula is slidingly advanced or retracted within the lumen of the main catheter as the novel method steps are performed . the advantages set forth above , and those made apparent from the foregoing description , are efficiently attained . since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense .	0
turning to the drawings , wherein like numerals denote like components throughout the several views , in fig1 , a surgical stapling and severing instrument 10 includes a handle portion 12 that is manipulated to position an implement portion 14 including a fastening end effector , depicted as a staple applying assembly 16 , distally attached to an elongate shaft 18 . the implement portion 14 is sized for insertion through a cannula of a trocar ( not shown ) for an endoscopic or laparoscopic surgical procedure with an upper jaw ( anvil ) 20 and a lower jaw 22 of the staple applying assembly 16 closed by depression of a closure trigger 24 toward a pistol grip 26 of the handle portion 12 , which advances an outer closure sleeve 28 of the elongate shaft 18 to pivot shut the anvil 20 . once inserted into an insufflated body cavity or lumen , the surgeon may rotate the implement portion 14 about its longitudinal axis by twisting a shaft rotation knob 30 that engages across a distal end of the handle 12 and a proximal end of the elongate shaft 18 . thus positioned , the closure trigger 24 may be released , opening the anvil 20 so that tissue may be grasped and positioned . once satisfied with the tissue held in the staple applying assembly 16 , the surgeon depresses the closure trigger 24 until locked against the pistol grip 26 , clamping tissue inside of the staple applying assembly 16 . then a firing trigger 32 is depressed , drawn toward the closure trigger 24 and pistol grip 26 , thereby distally advancing a firing member , depicted as including a proximal firing rod 34 attached to a distal firing bar 36 , that is supported within a frame ground 38 that connects the handle portion 12 to the staple applying assembly 16 . the firing bar 36 engages an elongate staple channel 40 and actuates a staple cartridge 42 contained therein , both forming the lower jaw 22 . the firing bar 36 also engages the closed anvil 20 . after releasing the firing trigger 32 to retract the firing bar 36 , depression of a closure release button 44 unclamps the closure trigger 24 so that the closure sleeve 28 may be retracted to pivot and open the anvil 20 to release the severed and stapled tissue from the staple applying assembly 16 . in fig2 , the staple applying assembly 16 is closed upon compressed tissue 46 . in fig2 – 3 , the firing bar 36 has a proximal portion 48 that is attached to a distal e - beam 50 that translates within the staple applying assembly 16 . as depicted with the firing bar 36 retracted , a vertical portion 52 of the e - beam 50 resides essentially aft of the staple cartridge 42 , as after a new staple cartridge 42 has been inserted into the elongate staple channel 40 . an upper pin 54 that extends laterally from an upper portion of the vertical portion 52 of the e - beam 50 initially resides within an anvil pocket 56 recessed near a proximal pivoting end of the anvil 20 . as the e - beam 50 is distally advanced during firing , the vertical portion 52 passes through a narrow longitudinal anvil slot 58 ( fig1 , 11 ) formed in an undersurface 60 of the anvil 20 , a proximally open vertical slot 62 formed in the staple cartridge 42 and an underlying longitudinal channel slot 64 formed in the elongate staple channel 40 . in fig2 , 11 , the narrow longitudinal anvil slot 58 ( fig2 ) communicates upwardly to a laterally widened longitudinal anvil channel 66 sized to slidingly receive the upper pin 54 . the longitudinal channel slot 64 communicates downwardly to a laterally widened longitudinal channel track 68 that receives a lower foot 70 , which is sized to slide therein and is attached at a bottom of the vertical portion 52 of the e - beam 50 . a laterally widened middle pin 72 extending from the vertical portion 52 of the e - beam 50 is positioned to slide along a top surface of a bottom tray 74 of the staple cartridge 42 , which in turn rests upon the elongate staple channel 40 . a longitudinal firing recess 75 formed in the staple cartridge 42 above the bottom tray 74 is sized to allow the middle pin 72 to translate through the staple cartridge 42 . a distal driving surface 76 of the vertical portion 52 of the e - beam 50 is positioned to translate through the proximally open vertical slot 62 of the staple cartridge 42 and distally drive a wedge sled 78 proximally positioned in the staple cartridge 42 . the vertical portion 52 of the e - beam 50 includes a cutting surface 80 along a distal edge above the distal driving surface 76 and below the upper pin 54 that severs the clamped tissue 46 simultaneously with this stapling . with particular reference to fig1 , it should be appreciated that the wedge sled 78 drives upwardly staple drivers 82 that in turn drive upwardly staples 83 out of staple apertures 84 formed in a staple body 85 of the staple cartridge 42 to form against the undersurface 60 of the anvil 20 ( fig2 ). in fig2 , 11 , advantageously , the illustrative spacing , denoted by arrow 86 ( fig2 ), between the upper pin 54 is compliantly biased toward a compressed state wherein 0 . 015 inches of compressed tissue 46 is contained in the staple applying assembly 16 . however , a larger amount of compressed tissue 46 up to about 0 . 025 inches is allowed by an inherent flexure of the e - beam 50 . excessive flexure , of perhaps up to 0 . 030 inches , is avoided should the length of staples be insufficient to form with the additional height . it should be appreciated that these dimensions are illustrative for a staple height of 0 . 036 inches . the same would be true for each category of staple , however . in fig4 . a first version of a compliant e - beam 50 a includes top and bottom horizontal slits 90 , 92 from a distal edge of the vertical portion 52 a , perhaps formed by electro drilling machine ( edm ). the vertical portion 52 a thus contains a vertically compliant top distally projecting arm 94 containing the upper pin 54 , a knife flange 96 containing the cutting surface 80 , and a lower vertical portion 98 containing the distal driving surface 76 , middle pin 72 and lower foot 70 . the horizontal slits 90 , 92 allow a compliant vertical spacing by allowing the top distally arm 94 to pivot upwardly to adjust to increased force from compressed tissue 46 ( not shown ). in fig5 – 6 , a second version of a compliant e - beam 50 b includes left and right lower relieved areas 110 , 112 formed into an upper pin 54 b to each side of the vertical portion 52 , leaving left and right lower bearing points 114 , 116 respectively . the outboard position of the bearing points 114 , 116 provides a long moment arm to exert the force to flex . it should be appreciated given the benefit of the present disclosure that the dimensions of the relieved areas 110 , 112 and the choice of materials for the compliant e - beam 50 b may be selected for a desired degree of flexure , given the staple size and other considerations . in fig7 , a third version of a compliant e - beam 50 c is as described above in fig5 – 6 with further flexure provided by left and right upper narrow relieved areas 120 , 122 formed into opposite top root surfaces of an upper pin 54 c proximate to the vertical portion 52 . in fig8 , a fourth version of a compliant e - beam 50 d is as described for fig2 – 3 with an added feature of a composite / laminate vertical portion 52 d that includes a central resilient vertical layer 130 sandwiched between left and right vertical layers 132 , 134 that support respectively left and right portions 136 , 138 of an upper pin 54 d . as the left and right portions 136 , 138 are flexed either up or down , the resulting bowing of the left and right vertical layers 132 , 134 are accommodated by a corresponding compression or expansion of the central resilient vertical layer 130 . in fig9 , a fifth version of a compliant e - beam 50 e is as described for fig2 – 3 with an added feature of a discrete upper pin 54 e formed of a more flexible material that is inserted through a horizontal aperture 140 through a vertical portion 52 e . thus , left and right outer ends 142 , 144 of the discrete upper pin 54 e flex in accordance with loading forces . alternatively or in addition to incorporating flexure into an upper pin 54 , in fig1 – 11 , a sixth version of a compliant e - beam 50 f as described for fig2 – 3 further includes resilient pads 150 that are attached to upper surfaces 152 of the bottom foot 70 . the resilient pads 150 adjust the spacing of the upper pin 54 in accordance to the compression force experienced at the bottom foot 70 . in fig1 , a seventh version of a compliant e - beam 50 g is as described above for fig2 – 3 with the added feature of a bottom foot ( shoe ) 70 g having an upwardly aft extended spring finger 160 that resiliently urges the e - beam 50 g downwardly to adjust vertical spacing in accordance with loading force . in fig1 , an eighth version of a compliant e - beam 50 h is as described above in fig2 – 3 with the added feature of an oval spring washer 170 resting upon the bottom foot 70 encircling the vertical portion 52 and having an upwardly bowed central portion 172 that resiliently urges the e - beam 50 h downwardly to adjust vertical spacing in accordance with loading force . while the present invention has been illustrated by description of several embodiments and while the illustrative embodiments have been described in considerable detail , it is not the intention of the applicant to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications may readily appear to those skilled in the art . for example , while a manually operated surgical stapling and severing instrument 10 is depicted for clarity , it should be appreciated that robotically manipulated and / or controlled fastening devices may incorporate a force controlled firing bar . for another example , a compliant e - beam consistent with aspects of the present invention may include engagement to an anvil similar to the engagement in the illustrative versions of two structures that slide against opposite sides of the elongate staple channel . similarly , a compliant e - beam may engage a lower jaw by having a laterally widened portion that slides internally within a channel formed in a lower jaw structure . as yet an additional example , in the illustrative version , the staple cartridge 42 is replaceable so that the other portions of the staple applying assembly 16 may be reused . it should be appreciated given the benefit of the present disclosure that applications consistent with the present invention may include a larger disposable portion , such as a distal portion of an elongate shaft and the upper and lower jaws with a staple cartridge permanently engaged as part of the lower jaw . as yet another example , the illustrative e - beam advantageously affirmatively spaces the upper and lower jaws from each other . thus , the e - beam has inwardly engaging surfaces that pull the jaws together during firing in instances where a larger amount of compressed tissue tends to spread the jaws . thereby the e - beam prevents malformation of staples due to exceeding their effective length . in addition , the e - beam has outwardly engaging surfaces that push the jaws apart during firing in stances where a small amount of tissue or other structure attributes of the instrument tend to pinch the jaws together that may result in staple malformation . either or both functions may be enhanced by applications consistent with aspects of the invention wherein inherent flexure in the e - beam adjusts to force to allow a degree of closing of the jaws or of opening of the jaws .	0
the present invention alleviates some of the difficulties described above in systems in which resources are selected based on historical utilization rates , and particularly the difficulties in such systems , where the resource with the lowest or highest utilization metric is selected to perform a task or to be evicted from whatever group of resources is being considered , that arise when a new resource is added to the group . the solution of the present invention is to assign to the new resource an arbitrary initial utilization metric that does not accurately reflect the past utilization of the resource , either because the resource is brand new and has never been used ( or has been used only once ), or because no past utilization data are available . it should be noted that while the utilization statistics have been referred to as utilization &# 34 ; rates ,&# 34 ; the utilization rate frequently , and even preferably , may be as simple as a count of the number of times the resource has been used ( or has used another resource ), possibly limited to a particular time period . such a count would preferably be incremented each time the resource was used ( or used another resource ). the arbitrary initial utilization metric assigned in accordance with the invention preferably places the resource approximately in the middle of the group under consideration from a utilization standpoint . preferably , the initial utilization metric assigned to the new resource is either the median or the mean of the utilization metrics of the other members of the group . assigning an initial utilization metric substantially equal to the mean utilization metric for the group is particularly preferred because as each individual utilization metric is updated , it is relatively easy to modify the mean incrementally in constant time , by adding to the previous mean value the quotient of ( a ) the change in the utilization metric of the group member whose utilization metric has changed , and ( b ) the number of members of the group . determining the median , while not difficult , could not be done incrementally and would require more computation . by assigning to the new resource an initial arbitrary utilization metric that is neither the lowest in the group nor the highest in the group , one assures that the new resource initially will not be selected by a selection process that requires either a minimum utilization metric ( such as those described above ), or a maximum utilization metric ( such as a process for moving data resources to processors that most frequently use them ). although initially , in an application where the group member with the minimum utilization is sought to perform a task , group members with higher utilization metrics will be chosen when the new resource actually has the minimum utilization metric , eventually , as the other members of the group are selected and the new resource is not , their utilization metrics will rise while that of the new resource remains constant , until it becomes the minimum and is selected . however , no one resource will retain the minimum utilization metric long enough to be overwhelmed , as would be the case where the new resource is assigned its actual utilization metric as its initial metric . similarly , in an application where the group member with the maximum utilization is sought , although the new resource may prove extremely popular , it will take some time before the arbitrary initial utilization metric increases to reflect the actual utilization of the resource . during that time other resources with apparently higher utilization metrics will be selected , but eventually the utilization metric of the new resource will become the highest and it will be selected . more importantly , the new resource will not be eliminated from the group , and therefore from consideration altogether , before it is given the opportunity for its low initial utilization metric to be replaced by a higher utilization metric that reflects its popularity and keeps it in the competition against other resources . the invention will now be described with reference to fig1 - 3 . a computer system of the type with which the present invention can be used is shown in fig1 . as shown in this example , computer system 10 is a local - or wide - area network , although it could also be a parallel , or massively - parallel , processing system ( not shown ). system 10 has a plurality of stations 11 , and a plurality of resources including disk drives and other storage systems 12 , modems and other communications facilities 13 , as well as other types of resources ( not shown ). substantially all of the resources are generally available to each of stations 11 . operations of system 10 are under the supervision of one or more servers 14 . as seen in fig2 server 14 preferably has a processor 20 and directories 21 identifying the locations of various resources and their association with particular stations 11 or with other resources . server 14 preferably has its own storage 22 which may be internal to server 14 or in an external unit 12 . as discussed above , one or more of storage units 12 may hold cache memory for various processes . when a data item not currently in the cache is requested , it is added to the cache . of the items already in the cache , the item whose metric ( e . g ., rate or count ) has the minimum value is evicted from the cache . in accordance with the present invention , the metric for the new member is preferably assigned to be the average of the metric of the pre - existing members of the population , to prevent it from automatically being evicted the first time room is required in the cache , before it has an opportunity to establish its popularity . similarly as described above , various data objects can be placed on any of the storage units 12 which are shown in physical proximity with particular ones of stations 11 . physical location of resources 12 relative to the stations 11 that use them may have significance if system 10 is large enough , because then the added traffic on system 10 involved in routing data to and from resources 12 , and the associated time delays , may prove unacceptable . it may therefore be desirable to locate a particular data object on a storage unit 12 near one of stations 11 that uses it frequently . when the number of candidate stations 11 for &# 34 ; co - location &# 34 ; of the particular data object is high , it is impractical to maintain the utilization statistics for each candidate and each data object . instead , the statistics can be kept on a small group of likely candidates for each data object . when a new candidate , not currently in the group , requests the data object , it is added to the group , replacing an existing member with the lowest metric ( e . g ., rate or count ) for utilization of the data object . to prevent that existing member from being the newest candidate , which has not yet had a chance to show its true level of usage of the data object , the metric for the new candidate is preferably assigned to be the average of the metric of the pre - existing members of the candidate population . when the time comes to select a member of the candidate group with which to co - locate the data object , the member of the candidate group with the highest utilization metric for this object is selected . the member that is selected will have survived to achieve the highest utilization metric , without being evicted from the candidate group , because at the time it was added to the group it was assigned an arbitrary utilization metric in accordance with the invention . at the same time , while other , newer members of the candidate group are assigned arbitrary initial utilization metrics higher than their actual utilization , those arbitrary initial utilization metrics are not so high as to cause those other , newer candidates to be inappropriately selected for co - location . similarly , if system 10 is a parallel processing system , and server 14 needs to assign a task to one of stations 11 , it preferably would assign the task to the station 11 with the lowest utilization metric ( e . g ., rate or count ). again , to prevent the most recently added station 11 from being assigned the most work , to the point that its performance , and that of the whole system 10 , degrades , its initial utilization metric preferably is set to the average of the utilization metrics of the other stations 11 . fig3 is a flow diagram of a portion of the system operating software for assigning the metric to the new member of the population , the remainder of the selection process being conventional . process 30 starts at 31 where the new member arrives . the process proceeds to test 32 to determine whether there is room in the population for the new member , or if there is not room and eviction of one of the older members is required . if there is no room , then the process proceeds to step 33 where the member whose metric for the particular characteristic being measured is lowest is evicted to make room for the new member . after step 33 , or if at test 32 there is room for a new member without eviction of an old member , the process proceeds to step 34 where the mean metric for the preexisting members of the population is calculated , and assigned arbitrarily to the new member as its value for the metric , and the process ends . although in the process as described , the mean is used , the median could also be used . however , in order to update the median whenever the metric for one member changes ( e . g ., when the member is accessed by another component of the system ), a new calculation of the median would be required . on the other hand , as stated above , if the mean is used , it can be updated incrementally as any member is accessed by the system , simply by adding to the old mean quotient of ( 1 ) the change in the value of the metric for the accessed member , and ( 2 ) the number of members in the population being examined . thus it is seen that a computer system or network in which selection of resources depends on historical loading , but which provides a mechanism for handling a resource that has no history , either because it is new or because its history has not been maintained , has been provided . one skilled in the art will appreciate that the present invention can be practice by other than the described embodiments , which are presented for purposes of illustration and not of limitation , and the present invention is limited only by the claims which follow .	7
fig1 is a simplified block diagram illustrating a typical integrated circuit tester . most of the components of the tester are housed in a cabinet 10 . those components housed in cabinet 10 typically include the basic control structures of the tester and to outside computers . the tester architecture may be of the type described in co - pending application ser . no . 656 , 812 , filed of even date herewith , now u . s . pat . no . 4 , 604 , 744 , assigned to the assignee of the present application . typically , one or more operator interface console 12 are provided coupled to tester cabinet 10 . the actual testing takes place at one or more test heads 14 coupled to tester cabinet 10 . each test head 14 includes a socket 15 used to couple the device under test to the test electronics . other means of means of providing this coupling , such as probers , are also familiar in the art . in high speed , multi - pin integrated circuit testers , it has been found necessary to locate a relatively large portion of the forcing and measuring circuitry necessary to accomplish the testing in test heads 14 . this is necessary to avoid interference , timing and other problems . in order to perform high speed integrated circuit testing it is necessary to accurately time edges of pulses , accurately measure relatively small currents and voltages and rapidly switch between states , among others . achieving these goals over long lines is particularly difficult . the most common solution is to shorten the lines by placing the force and measure circuits close to the pins of the device under test . as the complexity of the tests to be performed and the number of pins has increased , the size of test heads 14 and their resulting cost has increased dramatically . fig2 is a detailed block diagram illustrating a particular embodiment of the present invention . in the present invention , a low device count circuit 20 at the test head couples each pin 21 of the device under test to a force and measure ( fam ) unit 22 , which may be located up to approximately 10 feet from the test head . circuit 20 is repeated for each pin 21 of the socket or prober at the test head . remote fam 22 can be located within the same enclosure as the remainder of the tester or anywhere else that is convenient . as is typical , remote fam 22 is multiplexed to number of test heads at multiplexer point 23 . in the particular embodiment of the invention shown in fig2 remote fam 22 is capable of forcing and measuring both current and voltage over two ranges , a high range and a low range . a first pair of field effect transistors , or fet &# 39 ; s , 25 and 26 are used to switch between the high range forcing and measuring circuits and the low range forcing and measuring circuits , respectively . a gate of fet 25 is connected to a switch high line from remote fam 22 . a drain of fet 25 is connected to pin 21 . a source of fet 25 is connected to high range force and measure line 27 . as is familiar in the art , the gate of an fet controls conductivity between the source and the drain . therefore , remote fam 22 can selectively couple and decouple high range force and measure line 27 to pin 21 via fet 25 . a gate of fet 26 is connected to a switch low line from remote fam 22 . a drain of fet 26 is coupled to pin 21 . a source of fet 26 is connected to low range force and measure line 28 . therefore , remote fam 22 can selectively couple and decouple low range force and measure line 28 to pin 21 via fet 26 . fet &# 39 ; s 25 and 26 are used as high speed switches between the high and low force and measure ranges of remote fam 22 . the voltage gain available from these devices permits relatively fast switching of the low speed signals on lines 27 and 28 . fet &# 39 ; s 25 and 26 , and each of the other fet &# 39 ; s discussed below are preferably very low capacitance devices . this is because the capacitance limits the switching speed . of particular use in this regard are vmos devices available from a number of discrete semiconductor suppliers . a second pair of fet &# 39 ; s 30 and 31 are used to control the coupling of the current forcing and measuring circuits to pin 21 . a gate of fet 30 is connected to a force high current line from remote fam 22 . a drain of fet 30 is connected to high range force and measure line 27 . a source of fet 30 is connected to high range current force and measure line 32 . therefore , remote fam 22 can control , via its force high current line and fet 30 , the coupling of high current force and measure line 32 to high range force and measure line 27 . similarly , a gate of fet 31 is connected to a force low current line from remote fam 22 . a drain of fet 31 is connected to low range force and measure line 28 . a source of fet 31 is connected to low range current force and measure line 33 . therefore , remote fam 22 , through its force low current line and fet 31 can control the coupling of low current force and measure line 33 to low range force and measure line 28 . in addition to functioning as simple switches , fet &# 39 ; s 30 and 31 act as common gate impedance converters for current forcing . in other words , fet &# 39 ; s 30 and 31 are operated as active devices when forcing current rather than being operated as saturated switches . this provides that lines 32 and 33 &# 34 ; see &# 34 ; a high impedance at fet &# 39 ; s 30 and 31 , respectively , and that lines 27 and 28 &# 34 ; see &# 34 ; a low impedance . a third pair of fet &# 39 ; s 35 and 26 are used to control the voltage forcing pathways . a gate of fet 35 is connected to a force high voltage line of remote fam 22 . a drain of fet 35 is connected to high range force and measure line 27 . a source of fet 35 is connected to a high range voltage forcing line 37 . therefore , remote fam 22 , via its force high voltage line and fet 35 , can control the coupling of high range voltage forcing line 37 to high range force and measure line 27 . a gate of fet 36 is connected to a force low voltage line from remote fam 22 . a drain of fet 36 is connected to low range force and measure line 28 . a of fet 36 is connected to low range voltage forcing line 38 . therefore , remote fam 22 , via its force low voltage line and fet 36 , can control the coupling of low range voltage forcing line 38 to low range force and measure line 28 . in addition to acting as switches , fet &# 39 ; s 35 and 36 include parasitic diodes which function as voltage compliant clamps when forcing current . a further function of fet &# 39 ; s 35 and 36 is to speed up very low level current measuring . this measurement has typically been slow because of the time required to charge up all the stray capacities between the pin and the measuring device at low current levels . when measuring current with the present invention . fet 35 or 36 , as is appropriate , is made conductive briefly at the start of the test . this provides a low impedance pathway to charge all the capacities very quickly , then the fet 35 or 36 is made non - conductive and the actual measurement takes place . a capacitor 40 is connected between high range voltage forcing line 37 and ground in order to reduce the ac impedance of the line . similarly a capacitor 41 is connected between low range voltage forcing line 38 and ground . a pair of coaxial cables 45 and 46 couple the high and low range forcing and measuring circuits , respectively , to the fet switches . other transmission line devices , such as shielded ribbon cables , may be used in place of coaxial cable . a center conductor of coaxial cable 45 is connected at one end to high range current force and measure line 32 and at the other end to line 50 entering remote fam 22 . an outer , or shield , conductor of coaxial cable 45 is connected at one end to high range voltage forcing line 37 and at the other end to line 51 entering remote fam 22 . similarly , a center conductor of coaxial cable 46 is connected at one end to low range current force and measure line 33 and at the other end to line 52 entering remote fam 22 . an outer , or shield , conductor of coaxial cable 46 is connected at one end to low range voltage forcing line 38 and at the other end to line 53 entering remote fam 22 . a digital word corresponding to an analog value of current to be forced utilizing the high range current forcing circuits is passed from other portions of the tester to digital - to - analog converter 55 . once converted , the analog value is passed to force high current circuit 56 . force high current circuit 56 is simply a programmable current source . circuit 56 &# 34 ; force &# 34 ; the current value specified by the tester as received from converter 55 . the output of force high current circuit 56 is connected to line 50 and thence to the center conductor of coaxial cable 45 . as long as fet &# 39 ; s 25 and 30 are conductive , as determined by the switch high line and the force high current line , the current forcing condition specified by force high current circuit 56 will be applied to pin 21 . line 50 entering remote fam 22 is also connected to high current measuring circuit 57 . high current measuring circuit 57 also receives a reference input from line 51 , which is connected to the outer conductor of coaxial cable 45 . the output of high current measuring circuit 57 is connected , through calibrator 58 , to the high current measuring circuits of the tester . a voltage forcing condition to be applied to pin 21 via the high range forcing circuits is passed digitally to digital - to - analog converter 60 . once converted , the analog signal is passed to force high voltage circuit 61 . force high voltage circuit 61 is a programmable voltage source . circuit 61 &# 34 ; forces &# 34 ; the voltage value specified . the output of force high voltage circuit 61 is connected to line 51 and thence to the outer conductor of coaxial cable 45 . as long as fet &# 39 ; s 25 and 35 are conductive , the voltage forcing conditions specified by force high voltage circuit 61 will be applied to pin 21 . the low range force and measure circuitry parallels that just described for the high range . low range current forcing conditions are connected to digital - to - analog converter 65 and thence to force low current circuit 66 . the output of force low current circuit 66 is connected to line 52 and thence to the center conductor of coaxial cable 46 . low range current measuring is accomplished by means of low current measuring circuit 67 , which receives inputs from lines 52 and 53 and passes its output through calibrator 68 . fet &# 39 ; s 26 and 31 must be conductive for low range current forcing and measuring to take place . low range voltage forcing conditions are connected to digital to analog converter 70 and thence to force low voltage circuit 71 . the output of force low voltage circuit 71 is connected to line 53 and thence to the outer conductor of coaxial cable 46 . fet &# 39 ; s 26 and 36 must be conductive for the voltage forcing in the low range to occur . voltage sensing at pin 21 is accomplished by means of a follower amplifier 75 which has one input connected to pin 21 and the other input connected to its own output . the output of voltage follower 75 is connected through the center conductor of coaxial cable 76 to the voltage measuring circuitry of remote fam 22 . the outer conductor of coaxial cable 76 is grounded . the combination of several force and measure units and the circuit described above provides for high speed testing of integrated circuits with a low cost test head . all switching is accomplished by means of lines coupled to the gates of low capacitance fet &# 39 ; s , thereby decreasing the importance of line length . in addition , the ability to quickly measure low current levels is provided . in the preferred embodiment described above , the high range fet &# 39 ; s are on one channel type ( p channel ) while the low range fet &# 39 ; s are of the opposite channel type ( n channel ). this is useful if , for instance , it is desired to force and measure positive current and voltage with the high range circuits and negative current and voltage with the low range circuits . but now it should be apparent that an improvement in automated integrated circuit testers is offered by the present invention . through the use of more than one force and measure circuit per pin and high input impedance switches at the pin , high switching rate tests may be performed . the force and measure units are removed from the test head and replaced by a low device count circuit at each pin which provides high speed switching and compensates for the long lines to the force and measure units . test head cost is thereby reduced .	6
first , referring to the drawings to describe the prior art , it may be seen that when a person drinks from beverage can 10 of the prior art , it is necessary for him to tilt his head backwards as particularly shown in fig2 . it will be understood , referring to fig6 that normally spot 12 of the beverage can which is removed is spaced from rim 14 a small distance . therefore , it is necessary for the can to be tilted above level so that all or most of the beverage will drain inasmuch as the opening in the top does not extend all the way to the rim 14 . fig3 shows a person drinking from improved can 16 of my invention . referring to the improved can it may be seen that the can 16 basically has a cylindrical shape having the cylindrical walls 18 . the cylinder of the can 16 will have an axis . the bottom 20 of the can will be at right angles or normal to the axis of the cylinder . it will be remembered that in the prior art can 10 both the bottom and the top are normal to the axis of the cylinder . however , top 22 of the can 16 is angled or sloping to the axis of the cylinder . the top will form an angle of about 30 ° to the bottom which is to say that it will have an angle of about 60 ° to the axis . when using the term &# 34 ; about 30 °&# 34 ;, it will be understood that this angle could vary from that , and it is intended that &# 34 ; about 30 °&# 34 ; to cover an angle of about 25 ° to 35 ° to the bottom which would be an angle of about 55 ° to 65 ° to the axis of the cylinder . as may be seen in fig4 , and 7 , the edge of the rim 14 of the can will have less of an angle to the bottom than the top . i . e ., the edge of the rim 14 will be about a 25 ° angle to the bottom of the can which will be about 65 ° to the axis of the can . the angled top will result in there being a high side 26 of the top and a low side 28 of the top . frangible spot 12 on the high side 26 , by the manipulation of tab 24 , opens the can so that the beverage within the can 16 could readily be consumed from the can . such construction is well known at the time of my invention . fig8 shows can 30 , a modified form of my invention . the modified can 30 has a cylindrical walls 18 and bottom 20 normal to the axis of the cylindrical walls 18 . the modified can 30 also has angled top 32 but only partially so . the high side 34 of the top is flattened . i . e ., the high side 34 is parallel to the bottom 20 or normal to the axis of the cylinder 18 . the frangible sport 12 with the tab 24 is located upon this high side 34 . the top is bent or broken along edge 36 so that low side 38 angles downward . i . e ., the low side 38 of the top is angled to the axis . the embodiments shown and described above are only exemplary . i do not claim to have invented all the parts , elements or steps described . various modifications can be made in the construction , material , arrangement , and operation , and still be within the scope of my invention . the restrictive description and drawing of the specific examples above do not point out what an infringement of this patent would be , but are to enable one skilled in the art to make and use the invention . the limits of the invention and the bounds of the patent protection are measured by and defined in the following claims .	8
fig1 of the accompanying drawings illustrates in block diagram form a detonator 10 which is connected to a battery 12 , and an rfid tag 14 . the rfid tag , in itself , is of conventional construction . typically the tag allows for the receipt and transmission of a large number of signals in accordance with a predetermined standard . usually , however , only a limited number of the signals are used when the tag is employed for traditional applications of the kind referred to hereinbefore . in this respect the invention is based on the premise that extensions in an existing standard command set can be employed for communicating with the detonator 10 . the detonator is of conventional construction and includes a controller 15 , embodied in an integrated circuit 16 , and a memory 17 which is also embodied in the integrated circuit . commands and other information are directed to the circuit via the medium of the rfid tag which thus functions purely as a communication channel between external structure and the control circuit . the rfid tag , in this respect , replaces a conventional wireless or conductor arrangement which would otherwise be used for channeling signals to and from the controller . fig2 shows another configuration which makes use of the principles of the invention . an rfid tag 14 is associated with a connector 18 which is connected to a harness 20 . the tag 14 may , for example , be included in a housing of the connector or it may be associated with the connector in any other appropriate manner . in the establishment of a blasting system the connector 18 is connected to a detonator 22 , and is thus used in the making of a communication channel to the detonator 22 . the detonator has an on - board battery 24 used for powering circuits in the detonator . alternatively the battery is incorporated into the connector 18 . in the manner which has been described communication with a control circuit 26 , typically an integrated circuit or a microprocessor , is accomplished using extensions to a standard command set associated with the tag . the circuit 26 corresponds to the circuit 15 in fig1 . in each embodiment data transfer takes place through the medium of the rfid tag 14 . the data may be of the kind referred to hereinbefore and may be stored in the memory 17 ( fig1 ) or in the control circuit 26 ( fig2 ). conversely , information and commands from an external controller , not shown , can be transmitted to the detonator using the communication protocol which is automatically made available by means of the rfid tag . a significant benefit in this respect is that the rfid technology , available through the use of the tag , is employed without the development of dedicated communication protocols . when the rfid tag is directly associated with the detonator the rfid capability is preferably embedded in the control circuit , normally an integrated circuit , used for controlling operation of the detonator — this reduces manufacturing costs and enhances reliability of operation of the detonator . fig3 illustrates further possible details of the arrangement shown in fig1 . the rfid tag 14 is , as noted , preferably directly associated with a controller 15 so that the rfid facility is incorporated in an integrated circuit which also provides a detonator control function . the rfid tag may be a battery - assisted rfid tag . thus , in a standby mode , a battery 24 is not connected to the tag . however , upon exposure to an interrogating signal from an rfid reader 30 which reads data 32 , the tag is activated and the battery 24 can be employed for a detonator control function and to provide energy to fire the detonator 22 . the information which is transmitted to the detonator may be of the kind which is herein described . similarly commands to the detonator may include a full operational set of instructions for verifying detonator functionality , calibration processes , the setting of timing periods and for arming and / or firing . typically firing would be accomplished through other means such as an alternative wired or wireless communication mechanism or by means of a shocktube trigger input to the detonator device . a log can be kept in a memory 34 ( or 17 ) which records each time information or commands are transmitted to the controller 26 ( or 15 ). this feature is particularly useful if a detonator fails to fire when a firing signal is given . if the detonator can be retrieved and interrogated , then it might be possible to access the log and thereby determine at what point , or for what reason , detonator failure occurred . the data and commands which are transmitted to and from the detonator are not limited . in general terms data commands necessary for the effective , reliable and safe control of the functioning of the detonator can be transmitted . preferably use is made of known protocols , such as iso 15693 , by accessing manufacturer reserved protocol extensions . alternatively , new command or modulation schemes or combinations of existing standards can be adopted , as may be appropriate . a proprietary protocol or access control technique , based on the use of a password , an encryption process , biometrics , or the like may be adopted to improve the security of the device and , in particular , to avoid tampering with the device taking place through the use of a conventional rfid reader or development kit . on the other hand , compatibility with existing standards , at least to some extent , enables interoperability with existing rfid scanning facilities and allows for integration with existing stock control tools . thus a hybrid approach may be employed . fig4 shows a detonator 40 which includes a metallic tube 42 in which are located a battery 44 , a control circuit 46 , an ignition element 48 , and primary and secondary explosive charges 50 . the control circuit 46 includes an rfid tag 52 . any appropriate signal transmission device 54 , e . g . a shock tube , may be connected to the detonator in the establishment of a blasting system . the rfid tag 52 may be battery - assisted . the tag includes an antenna 60 which is used for transmitting and receiving signals . if signal transmission takes place the metallic enclosure , constituted by the housing 42 , automatically leads to a signal strength reduction . to help in this respect the antenna 60 , which is connected to the rfid tag , is encapsulated in a plastics material 62 , and is located close to a mouth 64 of the metallic housing 42 . the material 62 acts as a non - conductive plug for the housing . the use of rfid technology simplifies communication with a detonator . additionally rfid tracking and asset control facilities are automatically available . as indicated hereinbefore capacitive coupling techniques can be employed to establish communication links with a detonator . fig5 shows a mechanical arrangement for a contactless capacitive communication interface with a detonator while fig6 illustrates an electrical circuit which is established through the use of the arrangement in fig5 . fig5 shows a detonator tube 100 with a crimp plug 102 which is used to attach a shock tube 104 to the detonator . a communication generator 106 is used to communicate with a circuit associated with the detonator . the generator 106 may be a voltage generator that is modulated in any appropriate way e . g . amplitude modulated , frequency modulated or phase modulated . these are exemplary techniques only and are non - limiting . the generator functions at a communication frequency which may for example lie in the ism ( industrial , scientific and medical ) band . the generator 106 has one terminal connected to a sliding contact 108 made from a resilient material , and a terminal 110 which is connected to a cylindrical - shaped metal coupling electrode 112 . the arrangement is such that the detonator tube can be inserted into a holder , not shown , which correctly positions the crimp plug 102 in relation to the cylindrical electrode 112 . at the same time the contact 108 comes into connection with the conductive detonator tube 100 . a sound electrical contact between the last - mentioned components is achieved by making the contact 108 from a resilient material or by using a simple spring - loaded slide contact . the crimp plug 102 which is made from a suitable insulating material , e . g . an isolating polymer , has embedded in it a cylindrical metal ring 118 . when the components are relatively positioned as shown in fig5 the capacitive coupling electrode 112 is directly opposed to the ring 118 . the detonator is then in a communication position for capacitive coupling is established between the generator 106 and a circuit inside the detonator ( rfid tag ) via the medium of the components 100 , 108 , 112 and 118 . fig6 illustrates an electrical circuit 130 which is established through the use of the mechanical arrangement shown in fig5 . assume for the sake of example that the communication generator 106 works on amplitude modulated techniques . as noted this is an exemplary and non - limiting embodiment of the invention . the inner and outer electrodes 118 and 112 respectively form a capacitor 132 that couples a signal from the generator 106 to a circuit inside the detonator . diodes 134 and 136 , respectively , together with a capacitor 138 and a resistor 140 form a voltage doubling envelope demodulator which delivers a demodulated signal , originating in the generator 106 , to a circuit inside the detonator . in the return direction a signal from inside the detonator is transmitted by load modulation of the carrier signal of the generator 106 . this load modulation is realised by a transistor 144 which is combined with a load resistor 146 . the load modulation is detectable at the generator 106 and the return signal from the detonator can be recovered .	5
referring first to fig1 the invention is shown in perspective view . a pumping system 10 has a reciprocable pump 12 mechanically coupled to an electric motor 14 . motor 14 is controlled by an electronic control circuit in housing 18 , which circuit is also coupled via a pressure transducer to sense the liquid pressure delivered by pump 12 . a suction pipe 20 is adapted for immersion into a container of liquid , preferably paint , for supplying pump 12 . the liquid delivered by pump 12 is fed through a filter 16 and a hose 22 to a spray gun 24 . hose 22 may be twenty - five feet to more than several hundred feet in length , and spray gun 24 is preferably adapted for the atomization of the liquid , preferably paint , into fine droplets for spraying onto a workpiece . pumping system 10 is preferably adapted for providing liquid paint at pressures upwards of 3 , 000 psi , and delivering paint at the rate of 0 - 1 gallon per minute ( gpm ), although the inventive concepts taught herein are equally applicable to both larger and smaller pumping systems . referring next to fig2 a symbolic diagram of the invention is shown wherein dc motor 14 is mechanically coupled to pump 12 , and the electromechanical devices for controlling motor 14 are shown in several boxes . pump 12 delivers liquid , preferably paint , through a flow - through transducer 26 to a fluid delivery line 21 which may be connected to a filter 16 and a hose 22 . fluid delivery line 21 passes through a pressure / voltage transducer 26 which has an electrical signal output line 28 . the signal on line 28 is an electrical voltage proportional to the liquid pressure in delivery line 21 , and it is coupled to an input terminal of comparator 30 . a second input to comparator 30 is a dc voltage level signal coupled to an input of comparator 30 via line 32 . line 32 is connected to a pressure set point potentiometer 34 which may be adjusted to vary the dc voltage level signal . the output of comparator 30 is coupled to a comparator 40 input via line 36 , and a second input line 38 carries a reference voltage v ref .. the output of comparator 40 is coupled to a timer circuit 35 via line 41 . timer circuit 35 functions to develop a timed gating signal for controlling the turn - on timing of scr drive circuit 50 . scr drive circuit 50 also has inputs connected to receive alternating current from a utility power source , typically 110 volts ac at 60 cycles per second ( cps ). the output of scr drive circuit 50 is a dc signal delivered to motor 14 over line 44 . the dc signal on line 44 is a voltage proportional to the difference between the pressure set point signal and the pressure sense signal , and serves to drive motor 14 at a rate of speed calculated to increase the pump 12 output volume until the pump output pressure equals the pressure set point . referring next to fig3 the pertinent construction details of pressure / voltage transducer 26 are shown . a housing 18 , preferably constructed to meet trade specifications for electrical enclosures , encloses the electrical circuitry required for the operation of the invention . housing 18 has a liquid inlet 48 and a liquid outlet 46 passing through a sidewall , each of which are coupled to a tube 52 . tubes 52 have a free end manifold 54 which has a plate 56 fixedly attached thereto . the combination of tubes 52 , manifold 54 and plate 56 operate as a pressure responsive device , wherein increasing liquid pressures within the device operate to deflect plate 56 upwardly and decreasing liquid pressures operate to deflect plate 56 downwardly . a detailed description of a pressure responsive device similar to that shown in fig3 may be found in u . s . patent application ser . no . 153 , 443 , filed may 27 , 1980 , entitled &# 34 ; fluid pressure sensor &# 34 ;. a linear variable differential transformer 60 is clamped against a bar 58 threaded fastener 59 . a movable core rod 62 projects from transformer 60 and contacts plate 56 . linear variable differential transformer 60 may be a commercially available product , as for example , a product manufactured by pickering & amp ; co ., of plainview , new york , as model designation 7304 - w2 - a0 . this model includes a precision differential transformer , a solid state multivibrator , and a bridge - type demodulator packaged in a rugged metal case . the differential transformer 60 is designed to provide excellent inherent linearity with the primary and secondary windings chosen to match the multivibrator and demodulator . the multivibrator operating frequency is chosen to achieve optimum linearity , null shift and sensitivity change with temperature , as well as minimum power dissipation . the multivibrator is a conventional arrangement which alternately interrupts the current through either side of a center - tapped primary winding , producing a square wave voltage across it . the switching period is determined not by the saturation level of the transformer core , but by the transistor characteristics , the l - r time constant of the transformer primary inductance and the transistor coupling and biasing networks . these characteristics and contributing components are controlled in the unit to produce the desired performance . a pair of transistors is used in a push - pull configuration with their collectors connected to the ends of the transformer primary . the positive side of a six - volt dc power source is connected to the center tap . the collector of each transistor is brought to the base of the opposite transistor through a resistive divider providing positive feedback and operating bias . the emitters of the two transistors are joined and returned to the negative side of the power source through a common temperature compensating resistor . this emitter resistor resistance is bypassed with a capacitor to assure turn - on at low temperatures . in the aforementioned model designation , the output voltage signal on line 28 is linearly related to the travel of core rod 62 over a range of plus or minus 0 . 050 inches from a preselected null point . the output voltage signal reaches a level of two volts dc at the rod 62 maximum displacement position . bar 58 is securely attached to housing 18 by means of threaded fastener 61 , which is secured against bar 58 and holds it against a shoulder on shaft 64 . shaft 64 is affixed to the wall of housing 18 . a knob 66 is attached to a potentiometer shaft 68 coupled to a potentiometer 34 . rotation of knob 66 causes a resistance variation between potentiometer terminal 72 and terminals 73 and 74 . the variable resistance setting provided at terminal 72 is used to develop a pressure set point signal as will be hereinafter described . referring next to fig4 a portion of the electronic circuit of the present invention is shown . potentiometer 34 is serially connected into a resistor divider network , terminal 73 being connected to a 5 , 000 ohm ( 5k ) resistance , and terminal 74 being connected to a 100 ohm resistance . potentiometer 34 is preferably a 2 , 000 ohm ( 2k ) potentiometer . terminal 72 of potentiometer 34 is connected to an input terminal of an operational amplifier 100 , which is a type commonly and commercially available . for example , national semiconductor corporation type lm324 consists of a single semiconductor package having four independent , high - gain , internally frequency - compensated operational amplifiers designed specifically to operate from a single power source over a wide range of voltages . this type designation is applicable to the operational amplifiers described in connection with the present invention . operational amplifier 100 has a parallel r - c feedback network connected between its output terminal 102 and a second input terminal 103 , which combination forms comparator 30 . input terminal 103 is also connected via an r - c network to signal line 28 from differential transformer 60 . a second signal line ( not shown ) from differential transformer 60 is connected to a common or ground connection . the signal on output line 36 of comparator 30 is coupled to the input 113 of operational amplifier 110 . a second input 111 to operational amplifier 110 is connected to a resistance divider network , and thereby receives a constant dc voltage input . the output 112 of operational amplifier 110 is connected back to input 113 via a resistor and is connected to ground via a capacitor , and the entire circuit combination comprises comparator 40 . the voltage output of comparator 40 is a dc signal whose magnitude is proportional to the error signal difference between the actual pump pressure and the pressure set point . this output voltage is coupled to timer 35 via line 41 . timer 35 comprises a combination of electrical components and semiconductor circuits , and is capable of generating a timed gating signal . the semiconductor element 120 of timer 35 is a commercially available product designated type lm556 , and manufactured by national semiconductor corporation . in fig4 the small numerals adjacent input and output connections on semiconductor 120 are indicative of the pin connections of the lm556 semiconductor circuit . for example , output line 41 of comparator 40 is connected to pin 3 of circuit 120 . circuit 120 has a number of other inputs and outputs , the functions of which will be described in more detail hereinafter , its principal output being line 42 , which is connected to scr drive circuit 50 . line 42 carries a gating signal for controlling the firing time of the scr elements in scr drive circuit 50 . power is supplied to the circuit of fig4 by means of a conventional transformer and rectifier circuit 49 . this circuit produces unregulated dc voltage at approximately 7 volts dc on line 105 , and regulated , voltage at 6 volts dc on line 107 . a conventional semiconductor voltage regulator 51 is connected between lines 105 and 107 . all resistor values are designated on fig4 in ohms , and capacitor values are designated in microfarads . fig5 shows a schematic diagram of the silicon controlled rectifier ( scr ) drive circuit 50 which forms a part of the present invention . this circuit may be obtained commercially in the form shown , specifically from gentron corporation under the designation &# 34 ; powertherm b series &# 34 ; bridge circuit . this circuit converts an ac input voltage to a dc voltage level , the magnitude of the dc voltage output being a function of the portion of the ac voltage cycle during which the gating signals are applied via line 42 . the output of scr drive circuit 50 is developed between lines 44 and 45 . line 45 may be a common or ground connection , and line 44 is connected to the field winding of dc motor 14 . the operation of the invention will be described with reference to the drawings , including fig6 a and 6b . fig6 a illustrates pertinent voltage wave forms under conditions of relatively slow pump operation ; fig6 b illustrates voltage wave forms under conditions of relatively fast pump operation . in other words , fig6 a illustrates conditions wherein the actual pumping pressure is very nearly equal to the set point pressure , and fig6 b illustrates conditions wherein the actual pumping pressure is significantly lower than the set point pressure . in both fig6 a and 6b the voltage waveforms a - e are measured at the circuit points identified in fig4 and 5 . the voltage a which is the output of comparator 30 is a dc voltage representative of the error signal developed as a difference between the set point pressure and the actual pump output pressure . this signal is represented as voltage v 1 in fig6 a and v 2 in fig6 b ; it is apparent that the error voltage a is of greater magnitude in fig6 b than in fig6 a , indicating a greater demand for increased pumping volume . this signal is coupled into comparator 40 , wherein it is compared against a reference signal v ref , and the output of comparator 40 is a dc voltage shown as waveform b which is a magnitude , subtracted from v ref , proportional to the magnitude of the error voltage a . in fig6 a the voltage v 3 indicates a relatively small departure from v ref ; in fig6 b the voltage v 4 indicates a relatively larger departure from v ref . voltage waveform c is a ramp voltage applied to pin 2 of timer 120 at twice the line frequency . voltage waveform c proceed from zero to a voltage v f to provide a constant time base under all operating conditions . the internal logic of timer circuit 120 generates an output gating signal d whenever ramp voltage c equals or exceeds voltage waveform b . this is shown as voltage waveform d in fig6 a and 6b , and it is apparent that the gating signal d is turned on for a shorter period of time in fig6 a than it is in fig6 b . voltage waveform d is applied on line 42 and is used as the gating signal to drive the scr circuit 50 . this signal triggers the scr gates and therefore permits a dc output signal to be developed on line 44 . this is shown in fig6 a and 6b as voltage waveform e , and it is apparent that the dc voltage of fig6 a is of lower magnitude than the dc voltage of fig6 b . voltage waveform e provides an average dc drive current into motor 14 to create a motor drive torque and thereby to drive pump 12 . under operating conditions , dc motor 14 will drive pump 12 at a relatively high rate of speed until the pump output pressure begins to approach the set point pressure . as the two pressures become equal the drive voltage into motor 14 will diminish until motor 14 is no longer able to reciprocate pump 12 against its output pressure . at this point motor 14 will stall and will continue to draw only the current required to maintain an output torque necessary to maintain the set point pressure at the output of pump 12 . as soon as the pressure in the fluid delivery line is reduced , as for example by triggering the spray valve in spray gun 24 , the liquid pressure will incrementally drop and thereby develop the electrical drive signals to increase the motor drive voltage in motor 14 to reciprocate pump 12 to build the pressure back up to the set point pressure . the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof , and it is therefore desired that the present embodiment be considered in all respects as illustrative and not restrictive , reference being made to the appended claims rather than to the forgoing description to indicate the scope of the invention .	8
the herein frontal airbags of the various embodiments have a dual purpose . ( 1 ) the first purpose is that of reducing injury of an occupant caused by vehicle bumper height incompatibility . this is found when a truck - type vehicle , such as a suv , crashes into the side of an automobile . in a crash wherein the struck vehicle is struck broadside by the striking vehicle , there is a tendency for the head of the occupant of the struck vehicle to hit the hood or some part of the front of the striking vehicle causing injury to the head . ( 2 ) the second purpose is to reduce injury to pedestrians who are hit by the striking vehicle . the frontal airbag protects the pedestrian from potentially severe injury due to striking hard surfaces including the grille 28 and the front of the hood 26 of the motor vehicle 24 . there are at least four unique features of the embodiments of a frontal airbag constructed in accordance with the teachings of the present invention . ( a ) the first is that the airbag deploys vertically against gravity . ( b ) the second is that the airbag has internal tethers 30 interconnecting the front surface of the airbag to the rear surface of the airbag at regular intervals to create a tufted surface . the tufting reduces the total volume of the airbag for a given surface area , enabling the airbag to deploy more rapidly , without resort to incorporation of multiple chambers within the airbag . ( c ) the third is that the airbag has frangible internal tethers 31 located in the central region that are designed to break during inflation allowing the airbag to expand in its center portion once the airbag is fully deployed and reaching its full inflation pressure . ( d ) the remaining internal tethers 30 are also designed to break at a higher pressure than the frangible internal tethers 31 such that during a collision as the pressure within the airbag exceeds the maximum inflation pressure , the internal tethers 30 break expanding the volume to lower the pressure in the airbag down to the required level , thus managing the energy in a vehicle crash . referring to fig1 , there is illustrated a front view of a motor vehicle 24 showing one embodiment 20 of a vehicle frontal airbag system . plural crash sensors 32 , 33 are mounted on the motor vehicle and adapted to sense the presence of an object about to collide with the motor vehicle . the sensors 32 , 33 are electrically connected to an electronic control unit 34 , “ ecu ”, as are pluralities of vehicle sensors 36 responsive to vehicle engine operating parameters . the electronic control unit 34 , not shown , is mounted to the firewall or inside of the passenger compartment of the motor vehicle 24 , and responds to the crash sensors 32 , 33 and the vehicle sensors 36 for determining that a collision is about to happen and deploying the frontal airbag 20 . a bumper member 38 is mounted on the motor vehicle 24 with the inside surface 58 of the bumper 38 facing the front of the motor vehicle 24 and the outside surface of the bumper facing away from the front of the motor vehicle in the direction the vehicle is generally traveling forward . a module member 40 , fig5 - 6 , is mounted behind and adjacent to the inside surface of the bumper member 38 . the module member 40 has an aperture or opening 42 in one , typically the top , surface so that when it is mounted the opening 42 is aligned in a direction that is facing upward relative to the normal position of the motor vehicle 24 . a frangible cover 44 , fig4 , encloses the aperture or opening 42 and is mounted on the module 40 . an inflation fluid connector 46 is mounted on the module 40 on the side closest to the grille 28 . the frangible cover 46 is designed to fit tight to the bumper 38 and the module 40 has a bracket or cover ring 48 surrounding the frangible cover 44 to hold the module 40 tight to the bumper 38 . the inflation fluid connector 46 is adapted to receive inflation fluid from an inflator 50 , 52 that may be mounted on the module 40 or located on the vehicle and connected to the connector 46 by a high - pressure hose . the inflator 50 , 52 is also electrically connected to the ecu 34 . illustrated in fig5 and 6 are both a cylindrical inflator 50 and a pancake inflator 52 . the selection of the type of inflator is up to the airbag designer . either or both may be used . located in the module member 40 is an inflatable frontal airbag 20 that is securely connected to the module member 40 and adapted to receive inflation fluid from the inflator 50 , 52 through the inflation fluid connector 46 . in one embodiment , fig1 - 3 , the frontal airbag 20 may be fabricated from a pair of sheets of fabric , or a single sheet folded over , that have a pair of opposite sides held together by stitching substantially around the perimeter leaving an open throat 54 at the bottom . the frontal airbag 20 is accordion folded and placed within the module member 40 such that the throat of the airbag is operatively connected to receive the inflation fluid . the frangible cover 44 functions to restrain the uninflated folded airbag and when the airbag is inflated , the frangible cover 44 is broken allowing the airbag 20 to be deployed . the electronic control unit 34 , fig1 , responds to at least one sensor 32 or 33 indicating a potential crash between the motor vehicle 24 and a struck vehicle and by means of an appropriate algorithm 56 causes the folded frontal airbag 20 to inflate and break through the frangible cover 44 . fig4 and 6 illustrate a bumper 38 having an opening intermediate its ends . the module 40 is mounted against the inside 58 of the bumper 38 and the opening 42 in the module 40 is aligned with the opening in the bumper 38 . the frangible cover 44 overlies the opening in the bumper , hence the opening 42 in the module 40 . the frangible cover 44 is secured by means of fasteners 60 such as bolts and nuts . typically at least two sensors 32 , 33 are mounted in a spaced apart relationship on the front of the motor vehicle 24 to sense the approach of another vehicle or object . the algorithm 56 in the electronic control unit 34 is designed to determine the characteristic of the approaching vehicle or object in a manner well known in the art . the algorithm 56 will , from the information generated by the sensors 32 , 33 determine when to inflate the airbag 20 . as illustrated in fig1 , the frontal airbag 20 when inflated is generally t - shaped with the vertical member 62 of the t - shaped airbag extending from the throat 54 and the aperture 42 in the module 40 . the cross - arm member 64 of the t - shape extends across the grille 28 of the motor vehicle ( although the illustrative embodiment shows a conventional grille , as used herein grille means and refers to the region of the vehicle immediately behind the bumper , whether it be a conventional grille , light array or sloped portion of the hood .) as shown in fig2 - 3 , the cross - arm member 64 has a plurality of inflated cylindrically shaped rows 66 . optionally , fig2 - 3 , a plurality of external tethers 68 is connected between the rear surfaces of at least two of the uppermost cylindrically shape rows 66 . as the rows inflate , the external tethers 68 cause the uppermost two rows to bend over the top portion of the vehicle grille 28 and cover the forward edge of the hood 26 . without the optional external tethers 68 , the airbag 20 will extend vertically and the force of the object hitting the airbag 20 will cause the airbag to deflect over the edge of the hood 26 . in another embodiment , as shown in fig7 , the inflatable airbag 22 is t - shaped when inflated with the vertical member 70 of the t - shaped airbag 22 extending from the throat 54 . the cross - arm member 72 of the t - shaped airbag 22 extends vertically in front of the grille 28 of the motor vehicle 24 . there is a plurality of internal tether members 30 , fig8 , located between the opposed inner surfaces 74 of the opposite sides of the airbag 22 tending to hold the shape of the airbag 22 until the pressure increases and the internal tethers 30 break allowing the airbag 22 to expand . the inflation pressure between 7 - 9 psi , in the airbag 22 maintains it in a vertical orientation from the opening in the bumper 38 holding the airbag 22 in front of the grille 28 of the motor vehicle 24 . fig6 shows the module 40 mounted to the vehicle bumper 38 with a frangible cover 44 enclosing a non inflated airbag stored therein . an inflator 50 or 52 is responsive to the ecu 34 control system and operates to inflate the airbag 22 for opening the frangible cover 44 and deploying now inflated airbag across the grille 28 at the front of the vehicle 24 . depending upon the design of the algorithm 56 which is not the subject of this invention , the sensors 32 , 33 deployed on the front of the motor vehicle 24 may be of many types such as an infrared sensor or a capacitive sensor . this is a choice of the system designer . fig5 illustrates the module 40 being a rectangular - shaped member having first 74 and second 76 elongated side plates or members . the third 76 and fourth 77 end plates or members and fifth 78 bottom plate or member complete the enclosing of the module 40 except for the open top . all of the members 74 - 78 are rigid members connected together to form the rigid rectangular - shaped member having an open top . in the preferred embodiment , all of the members 74 - 78 are steel . connected to one of the elongated rigid side members 75 is an inflation fluid connector 46 . the frangible cover 44 is fastened to the module 40 to enclose the open top . in fig6 , the frangible cover 44 is spaced from the open top to allow the top bumper panel 80 to fit between a cover ring 48 and the frangible cover 44 . the cover ring 48 operates to hold the rigid module 40 in position on the vehicle 24 . extending from the side members 74 - 78 is a plurality of holders or fasteners 82 for securing stored folded frontal airbag 22 to the module 40 . when the module 40 is secured to the motor vehicle 24 , the frangible cover 44 faces upward in the direction of the grille 28 of the motor vehicle . in fig7 , upon inflation of the frontal airbag 22 , the frangible cover 44 is burst open and the airbag 22 moves out of the module 40 and spreads up and across in front of the grille 28 . in one embodiment , fig1 , the airbag 20 folds over the front of the hood 26 and in another embodiment , fig7 , the frontal airbag 22 remains vertical in front of the grille 28 . fig9 illustrates one embodiment of the frontal airbag 22 . this embodiment is typically fabricated from sheet material having a first sheet of material having at least one side being coated . the second sheet of the material has a shape that is congruent with the first sheet and also has at least one side coated . in the preferred embodiment , the coating is silicone . the shape of both sheets is in the form of a “ t ”. the coating is for sealing the airbag 22 and being silicone or urethane to provide a smooth surface to facilitate deployment of the airbag 22 . in the alternative , instead of two separate sheets , the airbag may be fabricated from a single sheet first folded in half and then the shape is formed . a plurality of internal tethers 30 , represented by open arrows 85 in fig9 , are each sewn at their respective ends to each of the uncoated sides . similarly a plurality of frangible internal tethers 31 represented by arrows 87 are attached in the region represented by the dashed line 92 . the internal tethers 30 and 31 form a plurality of rows , in the preferred embodiment five rows of internal tethers 30 and 31 separated by five blank rows . each row is substantially parallel to the cross - arm of the “ t ”. the first and second sheets are positioned to overlie each other so that the uncoated sides are facing each other . the perimeter edges 86 of the two overlying sheets are sewn together except across the base of the vertical arm 70 of the t - shape that forms the throat 54 . the rows , which are ten in the preferred embodiment , are folded together in an accordion fold extending from the top of said cross - arm toward the throat 54 . the fabric of one embodiment of the airbag is 525 denier with a silicone coating ; the fabric of the internal tethers 30 and 31 are 840 denier with either a silicone coating or a urethane coating on both sides of the fabric . the stitching for the perimeter and the tethers is “ double needle chain stitch “ dncs ” with 138 spectra thread available from honeywell , inc . ( formerly allied thread ) of morristown , n . j . referring to fig9 , the first step is to secure a sheet of the fabric 64 for the piece about to be cut and then cut out the pattern for that piece . next mark horizontal lines 88 on the each sheet of the airbag fabric 84 to represent the fold lines . these fold lines 88 are spaced a distance as determined by the airbag designer . it has been found that by pressing the lines 88 to cause a fold , folding of the airbag 22 is greatly enhanced . then , sew a reinforcing strip 90 of 525 denier fabric at each location represented by a pattern box . this sewing is done on the uncoated side of the fabric . next cut the internal tethers 30 and 31 from 840 denier fabric , the three frangible tethers 31 having a urethane coating . the three urethane coated frangible tethers 31 are sewn at the middle location , surrounded by an endless line 92 of the first three rows . preferably the stitching that passes through the airbag surface is sealed with a silicone or urethane sealant . the appropriate length internal tethers 30 should be sewn to each row at the marked locations and sewn on the uncoated side of the airbag fabric . the internal tethers 30 are attached to each sheet of the airbag , effectively securing both sides of the airbag 22 a fixed distance apart when the airbag is deployed . then sew the perimeter edge 86 of the airbag 22 together except for the throat 54 portion at the bottom of the airbag that should remain open . next fold the flat , un - inflated airbag 22 in a telescopic fold . the folding begins at the top and proceeds along each marked horizontal line 88 until the folding reaches the fourth row . then each side of the cross - arm 72 of the t - shaped bag is folded in toward the middle to allow the remaining portion of the airbag 22 to be telescoped up providing the complete packaged airbag . the throat 54 is located at the bottom and will be secured to the module 40 by the holders 82 around its perimeter . in the preferred embodiment , the pressure in the airbag when fully inflated is between seven and nine pounds per square inch . the airbag 20 is completely deployed in approximately seventy milliseconds . when the airbag becomes almost fully inflated , the internal tethers 31 in the middle of the airbag 22 tend to break forming a bulge in the airbag 22 at substantially the center of the inflated airbag and lowering the internal pressure in the airbag . by telescoping the un - inflated airbag due to the folding , the airbag 22 , during inflation , will come out of the module in an orderly manner , typically with the top of the t - being the first part of the airbag that has broken through the frangible cover 44 . it is understood that the step of making the horizontal lines 88 on the airbag sheet material 84 may be done automatically by the pattern machine or in the alternative , the stitching machine can be programmed to correctly place the reinforcing strips 90 for securing the internal tethers 30 and 31 . an alternative to the above method is to have two pieces of fabric that are positioned such that one overlies the other . if the desired fabric weight is 840 denier , in this method each sheet can be 420 denier . each piece of fabric is coated on one side and the uncoated sides face each other . the next step is to weave the two pieces of fabric together . typically each weave pattern is two or more rows . the rows are transverse to the length of the fabric , i . e . across the width of the fabric . each group of rows is spaced a predetermined distance from the preceding group . the predetermined distance is equal to one half the initial thickness of the partially inflated airbag as illustrated fig8 . at certain groups of rows , this to be a design decision of the airbag designer , cut through one layer of the cloth creating a flap extending the width of the sheet . note each flap is held to the double fabric by a group of rows of the weaving . by weaving the two sheets of fabric together there is substantially no leakage through the seam and the seam is substantially flush with the surface of the fabric , wherein a sewn seam will have leakage due to the needle holes and will be a raised seam . cut the woven sheet to the desired pattern and size . take two cut sheets and place the flap sides together . cut the flaps , which now extend the width of the sheets , to a desired width , having a space between the flaps , and sew the edge of the flaps from one sheet to the corresponding edge of the other sheet . at this stage , the sewn flaps hold the two outside sheets together . the space between the flaps will allow the inflation fluid to pass . when the flaps are all connected , then sew the perimeter , except for the throat area 59 , of the two outside sheets together forming the desired t - shaped airbag . the stitching for the perimeter can be “ double needle chain stitch “ dncs ” with 138 spectra thread . the completed t - shaped airbag is now telescopically folded and put into the module . what you have at this time is an airbag with the outside surfaces coated , the internal seams are woven together and the perimeter seam is sewn with such a stitch and thread sized to make the airbag substantially leak proof . however , it is known that after a period of time the pressure inside the inflated airbag will cause the inflation fluid to leak off and the airbag will deflate . accordingly , various changes and modifications may be made to the illustrative embodiment without departing from the spirit or scope of the invention . it is intended that the scope of the invention , not be limited in any way to the illustrative embodiment shown and described , but that the invention be limited only by claims appended hereto and by the rules and principals of applicable law .	1
fig1 a through 1c illustrate the structure and operation of a tip assembly 100 for a data storage device including the data storage medium according to the embodiments of the present invention . in fig1 a , probe tip assembly 100 includes a u - shaped cantilever 105 having flexible members 105 a and 105 b connected to a support structure 110 . flexing of members 105 a and 105 b provides for substantial pivotal motion of cantilever 105 about a pivot axis 115 . cantilever 105 includes an indenter tip 120 fixed to a heater 125 connected between flexing members 105 a and 105 b . flexing members 105 a and 105 b and heater 125 are electrically conductive and connected to wires ( not shown ) in support structure 110 . in one example , flexing members 105 a and 105 b and indenter tip 120 are formed of highly - doped silicon and have a low electrical resistance , and heater 125 is formed of lightly doped silicon having a high electrical resistance sufficient to heat indenter tip 120 , in one example , to between about 100 ° c . and about 500 ° c . when current is passed through heater 125 . the electrical resistance of heater 125 is a function of temperature . also illustrated in fig1 a is a storage medium ( or a recording medium ) 130 comprising a substrate 130 a , and a cured polyaryletherketone resin layer 130 b . in one example , substrate 130 a comprises silicon . cured polyaryletherketone resin layer 130 b may be formed by solution coating , spin coating , dip coating or meniscus coating polyaryletherketone copolymer and reactive diluent formulations and performing a curing operation on the resultant coating . in one example , cured polyaryletherketone resin layer 130 b has a thickness between about 10 nm and about 500 nm . the composition of cured polyaryletherketone resin layer 130 b is described infra . an optional penetration stop layer 130 c is shown between cured polyaryletherketone resin layer 130 b and substrate 130 a . penetration stop layer 130 c limits the depth of penetration of indenter tip 120 into cured polyaryletherketone resin layer 130 b . turning to the operation of tip assembly 100 , in fig1 a , an indentation 135 is formed in cured polyaryletherketone resin layer 130 b by heating indenter tip 120 to a writing temperature t w by passing a current through cantilever 105 and pressing indenter tip 120 into cured polyaryletherketone resin layer 130 b . heating indenter tip 120 allows the tip to penetrate the cured polyaryletherketone resin layer 130 b forming indentation 135 , which remains after the tip is removed . in a first example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being not greater than about 500 ° c ., to form indentation 135 . in a second example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being not greater than about 400 ° c ., to form indentation 135 . in a third example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being between about 200 ° c . and about 500 ° c ., to form indentation 135 . in a fourth example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being between about 100 ° c . and about 400 ° c ., to form indentation 135 . as indentations 135 are formed , a ring 135 a of cured polyaryletherketone resin is formed around the indentation . indentation 135 represents a data bit value of “ 1 ”, a data bit value of “ 0 ” being represented by an absence of an indentation . indentations 135 are nano - scale indentations ( several to several hundred nanometers in width ). fig1 b and 1c illustrate reading the bit value . in fig1 b and 1c , tip assembly 100 is scanned across a portion of cured polyaryletherketone resin layer 130 b . when indenter tip 120 is over a region of cured polyaryletherketone resin layer 130 b not containing an indentation , heater 125 is a distance d 1 from the surface of the cured polyaryletherketone resin layer ( see fig1 b ). when indenter tip 120 is over a region of cured polyaryletherketone resin layer 130 b containing an indentation , heater 125 is a distance d 2 from the surface of the cured polyaryletherketone resin layer ( see fig1 c ) because the tip “ falls ” into the indentation . d 1 is greater than d 2 . if heater 125 is at a temperature t r ( read temperature ), which is lower than t w ( write temperature ), there is more heat loss to substrate 130 a when indenter tip 120 is in an indentation than when the tip is not . this can be measured as a change in resistance of the heater at constant current , thus “ reading ” the data bit value . it is advantageous to use a separate heater for reading , which is mechanically coupled to the tip but thermally isolated from the tip . a typical embodiment is disclosed in patent application ep 05405018 . 2 , 13 jan . 2005 . “ erasing ” ( not shown ) is accomplished by positioning indenter tip 120 in close proximity to indentation 135 , heating the tip to a temperature t e ( erase temperature ), and applying a loading force similar to writing , which causes the previously written indent to relax to a flat state whereas a new indent is written slightly displaced with respect to the erased indent . the cycle is repeated as needed for erasing a stream of bits whereby an indent always remains at the end of the erase track . t e is typically greater than t w . the erase pitch is typically on the order of the rim radius . in a first example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is not greater than about 500 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a second example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is not greater than about 400 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a third example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is between about 200 ° c . and about 400 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a fourth example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is between about 200 ° c . and about 500 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . fig2 is an isometric view of a local probe storage array 140 including the data storage medium according to the embodiments of the present invention . in fig2 , local probe storage array 140 includes substrate 145 having a cured polyaryletherketone resin layer 150 ( similar to cured polyaryletherketone resin layer 130 b of fig1 a , 1 b and 1 c ), which acts as the data - recording layer . an optional tip penetration stop layer may be formed between cured polyaryletherketone resin layer 150 and substrate 145 . in one example , substrate 145 comprises silicon . cured polyaryletherketone resin layer 150 may be formed by solution coating , spin coating , dip coating or meniscus coating uncured polyaryletherketone resin formulations and performing a curing operation on the resultant coating . in one example , cured polyaryletherketone resin layer 150 has a thickness between about 10 nm and about 500 nm and a root mean square surface roughness across a writeable region of cured polyaryletherketone resin layer 150 of less than about 1 . 0 nm across the cured polyaryletherketone resin layer . the composition of cured polyaryletherketone resin layer 150 is described infra . positioned over cured polyaryletherketone resin layer 150 is a probe assembly 155 including an array of probe tip assemblies 100 ( described supra ). probe assembly 155 may be moved in the x , y and z directions relative to substrate 145 and cured polyaryletherketone resin layer 150 by any number of devices as is known in the art . switching arrays 160 a and 160 b are connected to respective rows ( x - direction ) and columns ( y - direction ) of probe tip assemblies 100 in order to allow addressing of individual probe tip assemblies . switching arrays 160 a and 160 b are connected to a controller 165 which includes a write control circuit for independently writing data bits with each probe tip assembly 100 , a read control circuit for independently reading data bits with each probe tip assembly 100 , an erase control circuit for independently erasing data bits with each probe tip assembly 100 , a heat control circuit for independently controlling each heater of each of the probe tip assembles 100 , and x , y and z control circuits for controlling the x , y and z movement of probe assembly 155 . the z control circuit controls a contact mechanism ( not shown ) for contacting the cured polyaryletherketone resin layer 150 with the tips of the array of probe tip assemblies 100 . during a write operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are formed as described supra . each of the probe tip assemblies 100 writes only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus time required for writing data . during a read operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are detected as described supra . each of the probe tip assemblies 100 reads only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus the time required for reading data . during an erase operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 , and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are erased as described supra . each of the probe tip assemblies 100 erases only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus time required for erasing data . additional details relating to data storage devices described supra may be found in the articles “ the millipede — more than one thousand tips for future afm data storage ,” p . vettiger et al ., ibm journal of research and development . vol . 44 no . 3 , may 2000 and “ the millipede — nanotechnology entering data storage ,” p . vettiger et al ., ieee transaction on nanotechnology , vol . 1 , no , 1 , march 2002 . see also united states patent publication 2005 / 0047307 , published mar . 3 , 2005 to frommer et al . and united states patent publication 2005 / 0050258 , published mar . 3 , 2005 to frommer et al ., both of which are hereby included by reference in their entireties . turning to the composition of cured polyaryletherketone resin layer 130 b of fig1 a through 1c . it should be understood that for the purposes of the present invention curing a polymer implies cross - linking the polymer to form a cross - linked polymer or resin . the polyaryletherketone resin medium or imaging layer of the embodiments of the present invention advantageously meets certain criteria . these criteria include high thermal stability to withstand millions of write and erase events , low wear properties ( little or no pickup of material by tips ), low abrasion ( tips do not easily wear out ), low viscosity for writing , glassy character with no secondary relaxations for long data bit lifetime , and shape memory for erasability . cured polyaryletherketone resins according to embodiments of the present invention have high temperature stability while maintaining a low glass transition temperature ( tg ). in a first example , cured polyaryletherketone resins according to embodiments of the present invention have a tg of less than about 180 ° c . in a second example , cured polyaryletherketone resins according to embodiments of the present invention have a tg of between about 100 ° c . and about 180 ° c . the glass transition temperature should be adjusted for good write performance . to optimize the efficiency of the write process there should be a sharp transition from the glassy state to the rubbery state . a sharp transition allows the cured resin to flow easily when a hot tip is brought into contact and quickly return to the glassy state once the hot tip is removed . however , too high a t g leads to high write currents and damage to the probe tip assemblies described supra . a formulation of polyaryletherketone copolymer according to embodiments of the present invention comprises one or more polyaryletherketone copolymers , each polyaryletherketone copolymer of the one or more polyaryletherketone copolymers having the structure : ( i ) m repeat units represented by the structure — r 1 — o — r 2 — o — ( e . g ., randomly ) interspersed with n repeat units represented by the structure — r 3 — o — r 2 — o —, and terminated by a first terminal group represented by the structure r 4 — o — and a second terminal group represented by the structure — r 1 — o — r 4 or — r 3 — o — r 4 , or ( ii ) m repeat units represented by the structure — r 1 — o — r 2 — o — ( e . g ., randomly ) interspersed with n repeat units represented by the structure — r 1 — o — r 5 — o —, and terminated by a first terminal group represented by the structure r 4 — o — and a second terminal group represented by the structure — r 1 — o — r 4 , or ( iii ) m repeat units represented by the structure — r 2 — o — r 1 — o — ( e . g ., randomly ) interspersed with n repeat units represented by the structure — r 2 — o — r 3 — o —, terminated by a first terminal group represented by the structure r 6 — o — and a second terminal group represented by the structure — r 2 — o — r 6 , or ( iv ) m repeat units represented by the structure — r 2 — o — r 1 — o — ( e . g ., randomly ) interspersed with n repeat units represented by the structure — r 5 — o — r 1 — o —, a first terminal group represented by the structure r 6 — o — and a second terminal group represented by the structure — r 2 — o — r 6 or — r 5 — o — r 6 ; wherein o = oxygen , and occurs as a link between all r groups ; wherein r 1 is selected from the group consisting of : wherein r 2 is selected from the group consisting of : wherein r 3 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 4 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 5 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 6 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein m is an integer of 2 or more , n is an integer of 1 or more , m is greater than n and m + n is from about 5 to about 50 . the molar ratio of a first repeat unit ( containing r 1 and r 2 groups ) to a second repeat unit ( containing either r 1 and r 5 groups or r 3 and r 2 groups ) in structures ( i ), ( ii ), ( iii ) and ( iv ) is kept greater than 1 , therefore the ratio m / n is greater than 1 . the acetylene moieties in the r 3 , r 4 , r 5 , and r 6 groups , whichever are present , react during thermal curing with each other to cross - link the polyaryletherketone copolymers into a polyaryletherketone resin by cyclo - addition . in a first example , polyaryletherketone copolymers according to embodiments of the present invention advantageously have a molecular weight between about 3 , 000 daltons and about 10 , 000 daltons . in a second example , polyaryletherketone copolymers according to embodiments of the present invention advantageously have a molecular weight between about 4 , 000 daltons and about 5 , 000 daltons . all materials were purchased from aldrich and used without further purification unless otherwise noted . 3 - iodophenol ( 5 . 00 gram , 22 . 7 mmol ), bis ( triphenylphospine ) palladium ( ii ) dichloride ( pdcl 2 ( pph 3 ) 2 ) ( 160 mg ), triphenylphospine ( pph 3 ) ( 420 mg ), and cui ( 220 mg ) were suspended in triethylamine ( net 3 ) ( 150 ml ) under an n 2 atmosphere . phenylacetylene ( 3 . 1 ml , 2 . 9 gram , 28 . 4 mmol , 1 . 25 eq ) was added by syringe . the reaction mixture was then stirred and heated to 70 ° c . using an oil bath for 38 hours . excess net 3 was removed under reduced pressure . the remaining solids were extracted with 3 × 50 ml diethyl ether , which was then filtered and evaporated . the crude product was purified by column chromatography ( silica , 3 : 1 hexanes - ethyl acetate ) to give 4 . 1 gram of an orange solid . further purification was accomplished by sublimation ( 100 ° c ., 28 mtorr ) to give 3 -( phenylethynyl ) phenol as a white solid ( 3 . 3 g , 75 % yield ). to a suspension of 3 - iodophenol ( 3 . 73 gram , 17 mmol ), pdcl 2 ( pph 3 ) 2 ( 120 mg ), cui ( 161 mg ), and pph 3 ( 333 mg ) in net 3 ( 100 ml ) under n 2 was added a solution of 3 - hydroxyphenylacetylene ( 2 . 00 gram , 17 mmol ) in net 3 ( 10 ml ). the mixture was stirred and heated to 70 ° c . using an oil bath for 18 h . excess net 3 was removed under reduced pressure , and the remaining solids were extracted with 4 × 50 ml diethyl ether which was then filtered and evaporated . the crude product was purified by suspending in 80 ml ch 2 cl 2 , stirring for 1 hour , and filtering to give the final product as a yellow powder ( 2 . 96 g , 83 % yield ). in a multi - necked flask equipped with a mechanical stiffing apparatus and a dean - stark trap , 4 , 4 ′- difluorobenzophenone ( 1 . 4187 gram , 6 . 502 mmol ), resorcinol ( 0 . 5326 g , 4 . 838 mmol ), 3 , 3 ′- dihydroxydiphenylacetylene ( 0 . 2540 g , 1 . 209 mmol ), 3 - hydroxydiphenylacetylene ( 0 . 1753 g , 0 . 9037 mmol ), and potassium carbonate ( 3 g , 22 mmol ) were suspended in a mixture of dimethylformamide ( dmf ) ( 10 ml ) and toluene ( 20 ml ). the reaction mixture was vigorously stirred and heated to 130 ° c . for 16 hours under a slow flow of dry nitrogen , and toluene was removed periodically via the dean - stark trap . at the end of the 16 h period , the temperature was increased to 150 ° c . for another 8 hours . the reaction was then cooled and the polymer was isolated by multiple precipitations using thf and methanol . molecular weights were adjusted by using different proportions of ( r 1 + r 2 ) to ( r 3 ) and several different molecular weight polymers were prepared . thus , the embodiments of the present invention provide for compositions of matter for the storage media that operate in the nanometer regime . the description of the embodiments of the present invention is given above for the understanding of the present invention . it will be understood that the invention is not limited to the particular embodiments described herein , but is capable of various modifications , rearrangements and substitutions as will now become apparent to those skilled in the art without departing from the scope of the invention . therefore , it is intended that the following claims cover all such modifications and changes as fall within the true spirit and scope of the invention .	6
to avoid repetition , in the following description and in the figures at least in part the same reference characters are used for identical modules and components , provided the description does not require further differentiation . according to the invention , a structural wing - fuselage component b for connecting two upper components of wing shells 11 , 12 , which in each case are associated with one of the two aerofoils f 1 , f 2 , comprises a fuselage shell component 30 or upper shell component 50 of the fuselage or a lower shell component of a fuselage section 3 of an aircraft . fig1 shows an exemplary embodiment of an inventive upper component of a wing shell 11 with a longitudinal direction l 1 . as intended , the upper component of the wing shell 11 is integrated in the wing f 1 in such a manner that the longitudinal direction l 1 extends in the wingspan direction s 1 of the wing f 1 . the upper component of the wing shell 11 comprises two partial sections , namely a shell component 11 a on the wing side , and a shell component 11 b on the fuselage side , which are arranged one behind the other when viewed in longitudinal direction l 1 . the two shell components 11 a , 11 b are formed in a single piece or are produced in a single piece . the longitudinal direction l 1 extends from the shell component 11 b on the fuselage side to the shell component 11 a on the wing side ; it can also be curved , depending on the shape of the shell component 11 a , 11 b . in the region of the transition from the shell component 11 a on the wing side to the shell component 11 b on the fuselage side the two shell components 11 a , 11 b form an obtuse angle at an imaginary connection line . the size of this obtuse angle depends on the installation situation of the upper component of the wing shell 11 or of the aerofoil f 1 , f 2 . in other embodiments there is no angle between the shell component 11 b on the fuselage side and the shell component 11 a on the wing side . in particular , the longitudinal direction from the shell component 11 b on the fuselage side to the shell component 11 a on the wing side can extend continuously and / or at the same direction of curvature , i . e . the angle can also be 180 degrees . the shell component 11 a on the wing side is shaped as a closed quadrangle , while the shell component 11 b on the fuselage side in the exemplary embodiment shown comprises the form of a fork end with three finger - shaped coupling parts 31 , 32 , 33 in the shape of elongated rectangles which between themselves form two recesses 34 , 35 in the form of openings , and also have the shape of elongated rectangles . the coupling parts 31 , 32 , 33 and the recesses 34 , 35 each extend , for example , from the imaginary connection line v 1 to the end of the shell component 11 b on the fuselage side , which end points to the fuselage . however , it may also be sufficient if the coupling parts 31 , 32 , 33 and the recesses 34 , 35 extend only over some of the length of the shell component on the fuselage side in the direction of the wingspan . likewise , it is not mandatory for the finger - shaped coupling parts 31 , 32 , 33 and recesses 34 , 35 to be rectangular in shape ; they could just as well comprise a triangular shape or any other shape . in this arrangement the shape of the coupling parts 31 , 32 , 33 determines the shape of the recesses 34 , 35 and vice versa . the number of coupling parts and recesses can also vary . for example , the shell component 11 b on the fuselage side can comprise only one coupling part and one recess each which are then arranged side - by - side in axial direction of the aircraft fuselage . the maximum number of coupling parts and recesses is limited by design specifications . in this arrangement , in a manner that differs from that shown in fig1 , the coupling parts and recesses can as an alternative or in addition be formed at rims of the shell component 11 b on the fuselage side , which rims are directed transversely to the longitudinal direction l 1 . finally , the shell component 11 b on the fuselage side can comprise any desired shape , for example the shape of a cross , wherein in this case the cross forms the coupling part of a first wing shell component , while the recess of the other wing shell component comprises a shape that matches the surroundings of the coupling part in the plane of the coupling part . conversely , the cross can also be formed as a recess in the shell component 11 b on the fuselage side . the at least one recess 34 , 35 of the shell component 11 b on the fuselage side can also be an indentation in which in each case an elevation of an extension part of the respective other shell component on the fuselage side is received . in this arrangement the recesses can either be designed as through - holes of whatever shape , or they can reach only over part of the material thickness into the material of the shell component on the fuselage side , in other words they are blind holes instead of through - holes . in this arrangement all the recesses can be formed on a shell component on the fuselage side , and the coupling parts can be formed on the other shell component on the fuselage side , or each of the two shell components on the fuselage side comprises both recesses in the form of indentations , and coupling parts in the form of coupling parts that project in the direction of connection . if the recesses are holes , the two coupling parts on the fuselage side , which coupling parts are to be connected , can be placed one on top of the other in order to establish the connection ; in other words , in the region of the connection the shell component in the connected state comprises a thickness which when measured perpendicularly to the cabin plane of the aircraft corresponds to the thickness of the base bodies , i . e . without recesses or coupling parts , of the two shell components on the fuselage side . in this arrangement the coupling parts can project from the base body of the shell component on the fuselage side , on which base body they are formed , by a dimension that essentially corresponds to the thickness of the shell component 11 b on the fuselage side , which shell component 11 b receives said coupling parts . the upper shell component 11 of the wing can comprise a composite material with main fibres ( not shown ) that extend continuously along the entire length of the upper shell component 11 of the wing , in other words the main fibres extend without interruption from the wing - side end of the upper shell component 11 of the wing to the fuselage - side end of the upper shell component 11 of the wing . apart from the main fibres , furthermore , other fibres ( not shown ), which extend , for example , perpendicularly to the main fibres or extend in any other desired angle to the main fibres , can form part of the composite material . in this arrangement the upper shell component 11 of the wing can form part of an upper shell 10 of the wing , or it can itself form the upper shell 10 of the wing . on the coupling parts 31 , 32 , 33 of the upper shell component 11 of the wing in fig1 , extension parts 31 a , 32 a , 33 a are formed which on the fuselage - side ends extend in longitudinal direction at an angle to the extension of the arrangement of the interlocking shell components 11 b , 12 b on the fuselage side , wherein the purpose of said extension parts 31 a , 32 a , 33 a will be explained in more detail in the context of fig5 . the ends on the fuselage side of these extension parts 31 a , 32 a , 33 a are identical to the ends of the coupling parts 31 , 32 , 33 on the fuselage side . in the exemplary embodiment shown in the figures the extension parts 31 a , 32 a , 33 a project upwards at an angle relative to the extension of the remaining part of the shell components 11 b , 12 b on the fuselage side . fig2 shows two upper shell components 11 , 12 of the wing in the state assembled as intended , wherein the coupling parts 31 , 32 , 33 of the shell component 11 b , on the fuselage side , of the first wing shell component 11 engage , or are situated in , the recesses 43 , 44 , 45 of the shell component 12 b on the fuselage side of the second wing shell component 12 , and the coupling parts 41 , 42 of the shell component 12 b on the fuselage side of the second wing shell component 12 engage , or are situated in , the recesses 34 , 35 of the shell component 11 b on the fuselage side of the first wing shell component 11 . to establish a fixed connection between the two upper shell components 11 , 12 of the wing the two interlocking shell components 11 b , 12 b on the fuselage side can be bonded or welded together or can be non - detachably interconnected by way of connecting elements or in some other manner . fig3 shows the upper shell components 11 , 12 of the wing in the installed situation on the aircraft , wherein only those components that are essential to the installation are shown . each of the two upper shell components 11 , 12 of the wing is connected to a shell component 11 a , 12 a on the wing side . the two shell components 11 b , 12 b on the fuselage side of the upper shell components 11 , 12 of the wing are interconnected as described above and in the connecting region are supported by a lower shell ( not designated ) of the fuselage . in this arrangement the lower shell of the fuselage is connected to the shell components on the fuselage side by way of connecting elements or alternative fasteners . the fuselage shell can comprise a keel beam , a landing gear bay and / or a pressure bulkhead that follows on from the connecting region of the upper shell components 11 , 12 of the wing in the direction of the rear of the aircraft . in addition to the upper shell 10 of the wing , the wings 1 , 2 comprise a lower shell 20 of the wing . in the exemplary embodiment the upper shell 10 of the wing and the lower shell 20 of the wing form a central wing box . the connected shell components 11 b , 12 b on the fuselage side form a part of the pressure bulkhead , which part is in the front when viewed in axial direction of the aircraft . fig4 shows an upper shell component 50 of the fuselage that is designed for connection to the upper shell components 11 , 12 of the wing . the upper shell component of the fuselage comprises the shape of an interrupted ring . the upper shell component 50 of the fuselage is thus a partially cylindrical fuselage shell component 30 with two supporting rims that are aligned transversely to its longitudinal direction and that are situated opposite each other . the two ends or supporting rims of the open ring face each other in a plane , with the distance of the two ends in the exemplary embodiment shown essentially corresponding to the length , measured in the wingspan direction , of the shell components 11 b , 12 b on the fuselage side , or of the connecting region formed by the shell components 11 b , 12 b on the fuselage side . in its assembled state the upper shell component 30 of the fuselage comprises a first supporting rim 51 situated on the side of the first wing shell component 11 , and a second supporting rim 52 situated on the side of the second wing shell component 12 , wherein the first supporting rim 51 comprises recesses 51 a , 51 b which in each case are engaged by extension parts of the second wing , and wherein the second supporting rim 52 comprises recesses 52 a , 52 b , 52 c which are engaged by extension parts of the first wing f 1 . on one end of the open circle , which end forms a first supporting rim 51 , two recesses 51 a , 51 b are formed , while on the opposite end , which forms a second supporting rim 52 , three recesses 52 a , 52 b , 52 c are formed . the extension parts 31 a , 32 a , 33 a ; 41 a , 42 a that are formed on the ends on the fuselage side of the coupling parts 31 , 32 , 33 ; 41 , 42 can engage , with positive fit , these recesses 51 a , 51 b ; 52 a , 52 b , 52 c . in this way the upper shell component 30 of the fuselage is connected to the upper shell components 11 , 12 of the wing . in the region of engagement and along the first supporting rim and the second supporting rim the interlocking recesses 51 a , 51 b ; 52 a , 52 b , 52 c and coupling parts 31 , 32 , 33 ; 41 , 42 can be detachably or non - detachably interconnected , for example bonded or welded together , by way of connecting elements or alternative fastening methods . fig5 diagrammatically shows an arrangement comprising the upper shell component of the fuselage according to fig4 with two upper components of wing shells , which components were complementarily joined according to fig2 , while fig3 shows the structural wing - fuselage component b installed in an aircraft . the aerofoils f 1 , f 2 , which are connected by way of the upper shell components 11 , 12 of the wing , and the upper shell component 50 of the fuselage , which upper shell component 50 is also connected to the upper shell components 11 , 12 of the wing , form one unit . the connections between the upper shell components 11 , 12 of the wing can be established in a simple and safe manner , wherein the number of necessary connecting elements depends on the type of connection . if the upper shell components 11 , 12 of the wing are , for example , bonded together , it may be possible to entirely do without any additional connecting parts . this also applies to connecting the upper shell component 30 of the fuselage to the upper shell components 11 , 12 of the wing . instead of using an upper shell component 50 of the fuselage , it is also possible to use a lower shell component 60 of the fuselage , which lower shell component 60 of the fuselage in its state where it is integrated in the aircraft structure is situated opposite the upper shell component 50 of the fuselage so that generally a fuselage shell component 30 is used .	1
an electromagnetic noise filter as a filter apparatus reducing electromagnetic noises in example according to the present invention , or a frequency converter to which the filter apparatus is connected will be described in detail below using example shown in figures . fig1 shows an implementation of the electromagnetic noise filter as example according to the present invention . in the figure , reference numeral 1 denotes a frequency converter housing , reference numeral 2 denotes an electromagnetic noise filter case , reference numeral 3 denotes a terminal board cover , reference numeral 4 denotes a wiring drawing plate , and reference numeral 5 denotes an earth bar for frequency converters . the frequency converter housing 1 is provided with a groove 6 for mounting the wiring drawing plate 4 , and the wiring drawing plate 4 is provided with a raised portion 7 . the electromagnetic noise filter case 2 is also provided with the raised portion 7 . if no filter is required , the electromagnetic noise filter case 2 can be removed to fit the wiring drawing plate 4 directly into the groove 6 provided in a case of the frequency converter 1 . attachment / detachment can be eased by providing a raised portion 22 on the side face of the electromagnetic noise filter case 2 and providing a recessed portion 21 on the side face of the frequency converter housing 1 as shown in fig7 . the recessed portion 21 is a hole - like portion provided on the side face of the frequency converter housing 1 , and the raised portion 22 is a protruding portion provided on the side face of the electromagnetic noise filter case 2 . the recessed portion 21 and the raised portion 22 are fitted to or engaged with each other to fix the electromagnetic noise filter case 2 to the frequency converter housing 1 . in the configuration shown in fig1 , the frequency converter housing 1 and the filter housing of the electromagnetic noise filter case 2 are fitted to each other to fix the electromagnetic noise filter to the frequency converter . for this purpose , a fitting portion fitting part of the frequency converter housing 1 and the filter housing of the electromagnetic noise filter case 2 to each other is provided in each housing . in fig1 , the recessed groove 6 for mounting the wiring drawing plate 4 in the frequency converter housing 1 or the raised portion 7 in the electromagnetic noise filter case 2 is the fitting portion . however , the fitting portion is not limited to the specific shape of the recessed groove 6 or raised portion 7 , but may have any different shape as appropriate as long as it allows the frequency converter housing 1 to be fixed to the filter housing of the electromagnetic noise filter case 2 . example of fixation by fitting has been described above , but fixation is not limited thereto , and part of the frequency converter housing 1 and part of the filter housing of the electromagnetic noise filter case 2 may be interlocked or engaged with each other for fixation . in this case , an interlocking portion interlocked with part of each housing or an engagement portion engaging parts of the housings with each other is provided . if a filter having better characteristics or a filter having a larger size is required for making the filter compliant with a higher specification in terms of the specification , the attached filter can be removed to attach a filter for the specification with ease in the manner described above . alternatively , a noise filter effect can be increased by coupling together electromagnetic noise filter cases 2 having the same shape as shown in fig2 . in this case , the fitting portion composed of the recessed portion 21 and the raised portion 22 is provided in the electromagnetic noise filter case 2 , thus making it possible to couple together electromagnetic noise filter cases 2 at the fitting portion composed of the recessed portion 21 and the raised portion 22 . the coupled noise filter cases may be different in size , thickness , characteristics of filters , contained condensers , electronic parts constituting the filter , and the like . however , by equalizing the outer dimensions of electromagnetic noise filter cases , the overall dimensional and the like as the frequency converter can be approximately estimated to afford convenience during installation in equipment as a matter of course . a fixing screw for installing the electromagnetic noise filter is not required because the groove 6 provided originally for use in the frequency converter is used , and thus the need for screws can be eliminated for fixation . however , for fixing the electromagnetic noise filter case 2 to the frequency converter housing 1 , a screw may be used , or an adhesive or hook - and - loop fastener ( detachable plane fastener with a hook shape and a pile shape interlocked ) may be used . in this case , positioning for positioning the electromagnetic noise filter case 2 at a predetermined location in the frequency converter housing 1 can be considered . for example , a positioning portion is provided in part of the frequency converter housing 1 , and the electromagnetic noise filter case 2 is positioned based on the positioning portion and is then fixed with the screw or the like , whereby efficiency of fixation work and the like can be improved . for the positioning portion , a portion such as the recessed portion 21 or raised portion 22 described with fig2 may be used as a positioning portion . alternatively , positioning may be done by protruding a heat dissipation fin 30 shown in fig7 by a predetermined length relative to the frequency converter housing 1 and abutting part of the electromagnetic noise filter case 2 against the protruding portion . of course , positioning may be done by providing a protruding portion in part of the frequency converter housing 1 and abutting part of the electromagnetic noise filter case 2 against the protruding portion . the location in the frequency converter housing 1 at which the electromagnetic noise filter case 2 is mounted , shown in fig1 , is a location at which a space must be usually provided for wiring to the frequency converter such as main circuit wiring . for this reason , it is not required to provide a space for mounting the electromagnetic noise filter case in the frequency converter housing 1 . thus , the frequency converter housing 1 is never upsized even if the electromagnetic noise filter case is mounted . the shape of the frequency converter housing 1 should not be changed between a type of frequency converter in which the electromagnetic noise filter case is mounted and a type of frequency converter in which electromagnetic noise filter case is not mounted . that is , regardless of whether the electromagnetic noise filter case is mounted or not , the shape of the frequency converter housing 1 can be equalized . this contributes to reduction in costs for moldings that are used during production of the frequency converter housing 1 , and the like . a view seen from the top is shown in fig3 . from the electromagnetic noise filter case 2 , terminals 8 , 9 and 10 are connected to input terminals r , s and t , respectively . the terminals 8 , 9 and 10 are made of conductive materials such as metals such as copper , aluminum and copper - nickel alloys . the terminals 8 , 9 and 10 are made of thin metal and therefore , even if a slight difference in height occurs during connection to a terminal board provided in the frequency converter 1 , the material is warped and deformed to make connection easy . the terminals 8 , 9 and 10 are conductive plates in the figure , but the same effect can be obtained if they are wire rods . a sectional view of the electromagnetic noise filter case is shown in fig6 . another sectional view of the electromagnetic noise filter case is shown in fig7 . inside the electromagnetic noise filter case 2 , a filter condenser 11 is placed and walls 12 and 13 for partitioning the filter condenser 11 are provided . the filter condenser 11 is usually covered with a resin 23 of plastic as a sealing agent for ensuring improvement in moisture resistance and heat resistance and an insulation distance specified in the specification , and is thus unseen after assembly . usually , the filter condenser 11 that is used in example does not have a case that is provided when the condenser is formed . a usual condenser has electronic parts composed of metal plates and an insulator or the like as a dielectric material held between the metal plates covered with a condenser case . in example , the electronic part composed of metal plates and an insulator or the like as a dielectric material held between the metal plates is placed directly in the noise filter case 2 and covered with the resin 23 of plastic . with this configuration , the filter can be downsized and lightened as a whole because the usual condenser is absent . a groove 15 through which an earth bar 14 for filter condenser connected to the earth bar 5 for frequency converter passes . the wall 13 provided near the groove 15 is made to be little taller than the wall 12 partitioning the condenser 11 , whereby the resin of plastic is prevented from flowing into the groove 15 even if a low - viscosity plastic resin is used when the filter condenser 11 is covered with the resin 23 of plastic . as a result , even if a low - viscosity resin not requiring a degassing apparatus or the like is used , the plastic resin is never leaked from the groove into which the earth bar 14 being a connection conductor on the ground side is fitted , and thus workability is improved . when a high - viscosity plastic resin is used , the groove 15 is made to have an appropriate size , whereby the plastic resin used for sealing the filter condenser 11 is never leaked from the groove 15 owing to the viscosity of the plastic resin , thus making it possible to eliminate the need for the wall 13 . the earth bar 5 for frequency converter and the earth bar 14 for filter condenser are connected directly on the undersurface of the electromagnetic noise filter case 2 , or connected through a conductor plate or wire rod . as in the connection form described above , the connection conductor on the ground side of the electromagnetic noise filter case 2 should be connected to the connection conductor on the installation side of the frequency converter at a shortest possible distance . the conductor plate 20 grounding the filter condenser 11 on the ground side inside the electromagnetic noise filter case 2 is placed along the inner wall of the electromagnetic noise filter case 2 , whereby electromagnetic noises generated in the electromagnetic noise filter case 2 can be blocked . a volume control knob 17 placed in the frequency converter 1 and provided in a digital operator 16 can easily be attached and detached . the digital operator 16 is held between a waterproof cover 19 and a waterproof case 18 as shown in fig4 , whereby waterproof measures can be made . the filter apparatus and the frequency converter in the example described above may be , for example , distributed , sold , and transferred in the market and the like with each of them as a single product . alternatively , they may be , for example , distributed , sold and transferred in the market and the like as the frequency converter with the filter apparatus connected thereto , i . e . in an integrated state . for a condenser element that is used in the filter apparatus in the example described above , a condenser element having an electronic part having an insulator as a dielectric material held between conductor plates can be used . characteristics of the filter apparatus may be defined as not having influences such as electromagnetic noises on other electrical apparatuses and the like based on , for example , the ce specification , en55011 and the specification of en61800 . it should be further understood by those skilled in the art that although the foregoing description has been made on embodiments of the invention , the invention is not limited thereto and various changes and modifications may be made without departing from the spirit of the invention and the scope of the appended claims .	7
in general , the present invention provides a method of fabrication of sb - mos devices . in one embodiment of the present invention a method of fabricating a sb - mos device includes providing a semiconductor substrate and doping the semiconductor substrate and channel region . the method further includes providing an electrically insulating layer in contact with the semiconductor substrate . the method further includes providing a gate electrode on the insulating layer , providing a thin insulating layer around the gate electrode and exposing the substrate on one or more areas proximal to the gate electrode . the method further includes etching of the exposed areas proximal to the gate electrode using a partially isotropic etch . the method further includes depositing a thin film of metal and reacting the metal with the exposed substrate , such that a metal silicide forms on the substrate . the method further includes removing any unreacted metal . one of the advantages of the present invention is that the metal source and drain electrodes provide significantly reduced parasitic series resistance (˜ 10 ω - μm ) and contact resistance ( less than 10 − 8 ω - cm 2 ). the built - in schottky barrier at the schottky contacts provides superior control of off - state leakage current . the device substantially eliminates parasitic bipolar action , making it unconditionally immune to latch - up , snapback effects , and multi - cell soft errors in memory and logic . elimination of bipolar action also significantly reduces the occurrence of other deleterious effects related to parasitic bipolar action such as single event upsets and single cell soft errors . the device of the present invention is easily manufacturable , requiring two fewer masks for source / drain formation , no shallow extension or deep source / drain implants , and a low temperature source / drain formation process . due to low temperature processing , integration of new , potentially critical materials such as high k gate insulators , strained silicon and metal gates is made easier . fig2 shows a silicon substrate 210 that has means for electrically isolating transistors from one another . throughout the discussion herein , there will be examples provided that make reference to a semiconductor substrate on which an sb - mos device is formed . the present invention does not restrict the semiconductor substrate to any particular type . one skilled in the art will readily realize that many semiconductor substrates may be used for sb - mos devices including for example silicon , silicon germanium , gallium arsenide , indium phosphide , strained semiconductor substrates , and silicon on insulator ( soi ). these substrate materials and any other semiconductor substrate may be used and are within the scope of the teachings of the present invention . as shown in fig2 , a thin screen oxide 220 is grown on the substrate 210 to act as an implant mask . in one embodiment , the oxide is grown to a thickness of approximately 200 å . the appropriate channel dopant species 230 is then ion - implanted through the screen oxide such that a maximum dopant concentration 240 is provided to a predetermined depth d 1 250 in the silicon . in one embodiment , the channel dopant species is arsenic for p - type devices and indium for n - type devices . however , it is appreciated that any other suitable channel dopant species commonly used at the transistor for p - type or n - type devices can be used in accordance with the principles of the present invention . in another embodiment , the channel dopant concentration profile varies significantly in the vertical direction but is generally constant in the lateral direction . in a further embodiment , the depth d 1 250 of the maximum dopant concentration is approximately 20 to 200 nm . as shown in fig3 , the screen oxide is then removed in a chemical etch , and a thin gate insulator 310 , such as silicon dioxide , is grown . in one embodiment , the screen oxide etch is comprised of hydrofluoric acid . however , any other suitable chemistries commonly used to etch oxide , including both wet and dry etches , can be used in accordance with the principles of the present invention . in another embodiment , the thin gate insulator is comprised of silicon dioxide with a thickness of approximately 6 to 50 å . in a further embodiment , a material having a high dielectric constant ( high k ) is provided . examples of high k materials are those materials having dielectric constants greater than that of silicon dioxide , including for example nitrided silicon dioxide , silicon nitride , and metal oxides such as tio 2 , al 2 o 3 , la 2 o 3 , hfo 2 , zro 2 , ceo 2 , ta 2 o 5 , wo 3 , y 2 o 3 , and laalo 3 , and the like . the gate insulator growth is immediately followed by providing an in - situ doped silicon film . the film is heavily doped with , for example , phosphorous for an n - type device and boron for a p - type device . using lithographic techniques and a silicon etch , the gate electrode 320 is patterned as shown in the process step 300 illustrated in fig3 . in one embodiment , following gate electrode patterning , additional channel dopants are provided and result in a channel dopant concentration profile that varies significantly in both the vertical and lateral directions . as shown in fig4 , a thin insulator is then provided on the top surface 425 and sidewalls 410 of the silicon gate electrode 320 . in one embodiment , the thin insulator is a thermally grown oxide that has a thickness of approximately 50 to 500 å . in another embodiment , the thermally grown thin oxide is provided by a rapid thermal oxidation ( rto ) process having a maximum temperature of 900 to 1200 ° c . for a dwell time of 0 . 0 to 60 seconds . one skilled in the art will readily realize that there are many manufacturing methods for providing thin insulator layers such as deposition . one skilled in the art will further realize that other materials may be used for the thin insulator , such as nitrides , and that the insulating layer may be comprised of multiple insulator materials . an anisotropic etch is then used to remove the insulator layer on the horizontal surfaces ( and thus expose the silicon 420 , 425 ) thereby exposing the horizontal surface , while preserving the insulator layer on the vertical surfaces . in this way , a sidewall insulator 410 is formed . it will be appreciated by one skilled in the art that the gate electrode 320 and the sidewall insulator 410 function as a mask to the anisotropic etch such that the openings in the thin insulator layer on the silicon substrate are proximal with the gate electrode 320 . in the embodiment in which the thin insulator is approximately 50 to 500 å , the openings in the thin insulator layer will be proximal to the gate electrode 320 and located within a lateral distance away from the gate electrode 320 that is approximately 50 to 500 å . in one exemplary embodiment , the silicon surface 420 is recessed below the bottom of the gate insulator to a depth d 2 430 of approximately 1 nm to approximately 5 nm . in the embodiment in which an rto process is used to provide the sidewall insulator , the dopants both in the gate electrode and in the channel region of the device are electrically activated simultaneously with the sidewall insulator formation , as shown in the process step 400 illustrated in fig4 . as shown in fig5 , a second etch process step etches the semiconductor substrate both laterally and vertically . this etch is known as a partially isotropic etch . in one embodiment , a partially isotropic etch having a lateral etch rate at least 10 % of a vertical etch rate is used . in another embodiment , a partially isotropic etch having a vertical etch rate at least 10 % of a lateral etch rate is used . the depth of the second etch is d 3 510 . the lateral etch displaces the exposed vertical sidewall of the semiconductor substrate 520 laterally a distance l 1 530 from the edge of the sidewall oxide 410 to a position below the gate electrode 320 . because the etch is partially isotropic , l 1 may be less than or equal to ten times d 3 or d 3 may be less than or equal to ten times l 1 . in yet another embodiment , an etch having a lateral etch rate approximately equal to a vertical etch rate is used . for this embodiment , d 3 may be approximately equal to l 1 . in yet a further embodiment , the partially isotropic etch is provided by any one or a combination of a sf 6 dry etch , a hf : hno 3 wet etch , or any wet or dry etch that is commonly used for the purpose of etching semiconductor material . as shown in fig6 , the next step encompasses depositing an appropriate metal as a blanket film on all exposed surfaces . deposition may be provided by either a sputter or evaporation process or more generally any thin film formation process . in one embodiment , the substrate is heated during metal deposition to encourage diffusion of the impinging metal atoms to the exposed silicon surface 520 , below the gate insulator . in one embodiment , this metal is approximately 250 å thick but more generally approximately 50 to 1000 å thick . throughout the discussion herein there will be examples provided that make reference to schottky and schottky - like barriers and contacts in regards to ic fabrication . the present invention does not recognize any limitations in regards to what types of schottky interfaces may be used in affecting the scope of the present invention . thus , the present invention specifically anticipates these types of contacts to be created with any form of conductive material or alloy . for example , for the p - type device , the metal source and drain 610 , 620 may be formed from any one or a combination of platinum silicide , palladium silicide , or iridium silicide . for the n - type device , the metal source and drain 610 , 620 may be formed from a material from the group comprising rare earth silicides such as erbium silicide , dysprosium silicide or ytterbium silicide , or combinations thereof . it is appreciated that any other suitable metals commonly used at the transistor level , such as titanium , cobalt and the like , can be used as well as a plethora of more exotic metals and other alloys . in another embodiment , the silicided source / drain can be made of multiple layers of metal silicide , in which case other exemplary silicides , such as titanium silicide or tungsten silicide for example , may be used . the wafer is then annealed for a specified time at a specified temperature so that , at all places where the metal is in direct contact with the silicon , a chemical reaction takes place that converts the metal to a metal silicide 610 , 620 , 630 . in one embodiment , for example , the wafer is annealed at about 400 ° c . for about 45 minutes or more generally approximately 300 to 700 ° c . for approximately 1 to 120 min . the metal that was in direct contact with a non - silicon surface such as the gate sidewall spacer 410 is left unreacted and thereby unaffected . a wet chemical etch is then used to remove the unreacted metal while leaving the metal - silicide untouched . in one embodiment , aqua regia is used to remove platinum and hno 3 is used to remove erbium . it is appreciated that any other suitable etch chemistries commonly used for the purpose of etching platinum or erbium , or any other suitable metal systems used to form schottky or schottky - like contacts can be used within the scope of the present invention . the channel - implanted , short channel sb - mos device is now complete and ready for electrical contacting to gate 320 , source 610 , and drain 620 , as shown in the process step 600 illustrated in fig6 . as a result of this exemplary process , schottky or schottky - like contacts are formed to the channel region 540 and substrate 210 respectively wherein the schottky contacts are located at a position controlled by the partially isotropic etch process . in one embodiment , the interface 520 of the source 610 and drain 620 electrodes to the channel region 540 is located laterally below the spacer 410 and is aligned with the edge of the sides of the gate electrodes 640 . in another embodiment , the interface 520 of the source 610 and drain 620 electrodes to the channel region 540 is located laterally below the spacer 410 and partially below the gate electrode 320 . in yet another embodiment , a gap is formed between the interface 520 of the source 610 and drain 620 electrodes to the channel region 540 and the edge of the sides of the gate electrode 640 . while traditional schottky contacts are abrupt , the present invention specifically anticipates that in some circumstances an interfacial layer may be utilized between the silicon substrate and the metal . these interfacial layers may be ultra - thin , having a thickness of approximately 10 nm or less . thus , the present invention specifically anticipates schottky - like contacts and their equivalents to be useful in implementing the present invention . furthermore , the interfacial layer may comprise materials that have conductive , semi - conductive , and / or insulator - like properties . for example , ultra - thin interfacial layers of oxide or nitride insulators may be used , ultra - thin dopant layers formed by dopant segregation techniques may be used , or ultra - thin interfacial layers of a semiconductor , such as germanium , may be used to form schottky - like contacts , among others . one of the important performance characteristics for sb - mos devices is the drive current ( i d ), which is the electrical current from source to drain when the applied source voltage ( v s ) is grounded , and the gate voltage ( v g ) and drain voltage ( v d ) are biased at the supply voltage ( v dd ). another important property for sb - mos devices is the total gate capacitance ( c g ), which is determined by various capacitances such as that due to gate insulator 310 , the fringing field capacitance and the overlap capacitance . drive current and total gate capacitance are two of the critical parameters that determines circuit performance . for example , the switching speed of a transistor scales as i d / c g so that higher drive current devices and lower total gate capacitance devices switch faster , thereby providing higher performance integrated circuits . there are many variables that can affect the drive current and total gate capacitance of a sb - mos device , including for example , as shown in fig6 , the lateral location of the schottky or schottky - like contact 520 in relation to the edge of the gate electrode 640 . in a sb - mos device , the drive current , which is generally determined by the tunneling current density ( j sb ) through the schottky barrier into the channel , is strongly controlled by the gate induced electric field ( e s ) located at the interface of the source and the channel region . as the voltage applied to the gate ( v g ) is increased , e s will also increase . increasing e s modifies the schottky barrier such that j sb increases approximately according to equation ( 1 ), which shows that j sb is exponentially sensitive to e s , where a and b are constants , and the units of j sb and e s are ( a / cm 2 ) and ( v / m ) respectively . in addition to v g , e s is also strongly affected by the schottky barrier - channel region interface 520 proximity to the edge of the gate electrode 640 . when interface 520 is not located below the gate electrode 320 , e s and therefore j sb and i d decrease substantially and continue to decrease as the interface moves further laterally away from the edge of the gate electrode 640 . accordingly , the present invention provides a method of fabricating a sb - mos device that allows the placement of the schottky or schottky - like source and drain regions to be accurately controlled with respect to the gate electrode by using a partially isotropic etch . the present invention process provides a means to maximize the electric field e s and drive current i d and optimize device performance . in regards to total gate capacitance c g , the optimal location of the interface 520 in relation to the edge of the gate electrode 640 is a function of device design and performance requirements . in particular , the total gate capacitance c g will decrease as the distance between the interface 520 and the edge of the gate electrode 640 increases , while , as noted above , the drive current i d will simultaneously decrease . performance optimization will require tradeoffs in drive current i d and total gate capacitance c g , which can be more controllably provided by the teachings of the present invention . for example , by using a partially isotropic etch of the present invention , the location of the interface 520 in relation to the edge of the gate electrode 640 can be provided such that the tradeoffs in gate capacitance c g and drive current i d are optimized . by using the techniques of the present invention , the following , but not limited to , benefits occur . first , the partially isotropic etch step provides additional fabrication control of the precise location of the schottky or schottky - like contact placement below the gate electrode . the resulting schottky or schottky - like contact position can therefore be controllably placed at a lateral position below the gate electrode to maximize drive current , minimize total gate capacitance and optimize device performance . the second benefit is that by etching below the gate electrode , the effective channel length is reduced . it is appreciated that shorter channel length further improves drive current . the present invention is particularly suitable for use in situations where short channel length mosfets are to be fabricated , especially in the range of channel lengths less than 100 nm . however , nothing in the teachings of the present invention limits application of the teachings of the present invention to these short channel length devices . advantageous use of the teachings of the present invention may be had with channel lengths of any dimension . although the present invention has been described with reference to preferred embodiments , persons skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention . the present invention may be used with any of a number of channel , substrate and well implant profiles . the present invention applies to any use of metal source drain technology , whether it employs soi substrate , strained silicon substrate , sige substrate , finfet technology , high k gate insulators , and metal gates . this list is not limited . any device for regulating the flow of electric current that employs metal source - drain contacts will have the benefits taught herein . while , the present invention is particularly suitable for use with sb - mos semiconductor devices , it may also be applied to other semiconductor devices . thus , while this specification describes a fabrication process for use with sb - mos devices , this term should be interpreted broadly to include any device for regulating the flow of electrical current having a conducting channel that has two or more points of electrical contact wherein at least one of the electrical contacts is a schottky or schottky - like contact .	7
various embodiments of the invention concern utilizing collective behavior to improve identification results . in various illustrated embodiments an effort is made to identify regions of interest within an audio , video or other consumable / accessible data ; the phrase “ consumable data ” will be used to collectively refer to such data , and it is intended to refer to data that is stored in any state preserving media or medium and that may be singly or multiply or simultaneously accessed . consumable data may represent , for example , stored and / or streamed video or audio data , as well as individual frames , sections , portions , cuts , etc . of such audio , video , etc . data . it will be appreciated by one skilled in the art that audio and video data are presented for exemplary purposes and any data collection in which portions of interest may be identified by one or more entities are intended to be within the scope of the recited embodiments . it will be appreciated that “ interest ” is a relative term that may have a different meaning depending on the intended audience , e . g ., what is interesting to an adult audience may be very different than what is interesting to a young adult audience . thus , even if not specifically called out below , it should be appreciated by one skilled in the art the same techniques described herein may give different results depending on the nature of the audience performing the described operations , and that results from diverse audiences may be selectively combined as desired . in the illustrated embodiments , it is assumed interactive behaviors of a target audience ( or audiences ) are monitored as members of the audience interact with consumable data . this monitoring may be performed in real or near - real time as audiences interact with consumable data . or , monitoring may occur after the fact based on data accumulated with respect to a particular viewing or data consumption experience . for convenience in describing various features of the inventive concepts presented herein , it will be assumed an audience is interacting with a video , such as a recorded ( or buffered ) video broadcast or electronically accessible movie . however , as discussed above , the principles herein apply to any consumable data . through monitoring collective audience interaction , a collective intelligence can be harnessed to identify meaningful regions within consumable data , e . g ., audio , video , etc . meaningful regions for a video could be , for example , segments of a video ( typically referred to as video highlights ) identified as being interesting . the phrase “ interactive audience analysis ” or iaa , may be used to refer to analysis performed on the actions of the target audience ( s ). iaa differs from , for example , current automated video analytics technologies such as those that attempt to extract video highlights based on automated computer vision , machine learning and other artificial intelligence technologies . it will be appreciated automated video analytics technology and the disclosed embodiments need not be mutually exclusive , e . g ., the disclosed embodiments may be utilized in conjunction with video analytics . it will be appreciated video analytics may be performed before , during or after the iaa , e . g ., video analytics may be a pre , post , or interim processing stage depending on the needs and / or goals of the iaa . fig1 illustrates according to one embodiment monitoring one audience member input with which interactive audience analysis ( iaa ) may be employed to prepare a collective cut from the activity of one or more audience members . the phrase collective cut ( ct ) may be used to generally refer to identified regions of interest within consumable data . as discussed above , in some embodiments ( not illustrated ), video analytics may be used to facilitate determining the ct . in the illustrated embodiment , it is assumed audience members are being monitored as they interact with streamed consumable data . this is a simplification assumption since it is typically easier to monitor access to streamed data , e . g ., attempts to seek within a data stream can be determined by watching the commands to move within a stream that needs to be provided from an external source , however , it will be appreciated existing / stored content may be similarly monitored through use of hardware and / or software enabled devices configured to monitor data corresponding to seeking within a stream , and providing , e . g ., by way of sending ( pushing ) the monitored data or allowing it to be accessed ( pulled ), the monitored data to an external entity , such as a cable television or satellite broadcast head end , internet server ( which may also provide streamed consumable data ), etc . as illustrated in fig1 , there is a timeline 100 organized such that t 0 & lt ; t n and therefore to represents a moment in time before t n . the amount of time between t 0 and t n is arbitrary , but the figure illustrates presentation of consumable data over a certain period of time , e . g ., it may represent the entire presentation of the consumable data or only one or more subsets thereof . for increased simplicity , the t 0 and t n markers are left off the remaining figures . as shown , there are timing markers 102 - 110 . in the illustrated embodiment , it is assumed at any given time there is a current play position indicating where in the consumable data a certain audience member is currently viewing the consumable data . timing markers 102 - 110 represent various moments in time that at some point in time were the current play position . for example , after initiating streaming of consumable data , an audience member may drag the current play initially to position 102 and consume the consumable data for some arbitrary region 112 of time as desired by the audience member , where viewing was stopped at marker 104 , e . g ., by way of stopping viewing , skipping ahead , dragging the current play position from marker 104 to another location , etc . one consecutive ( or relatively consecutive ) consumption time of the consumable data is , as noted above , represented with the illustrated region 112 . region 112 has a width representing a length of time of consuming the consumable data . it is expected the length of time is less than ( t n − t o ), otherwise the audience member would have consumed the entire consumable data . it will be appreciated that if the consumable data is video data , then the region 112 represents the amount of time of the video that has been watched , and if the consumable data is audio data , it represents the amount of time to which the audio data was listened . in the illustrated embodiment , it is expected the audience member may use a “ fast forward ” type of control , skip button or feature , or directly drag a currently play position marker , to move consumption of the consumable data from timing marker 104 indicating the end of the consumed region 112 to some other marker location , such as to marker 106 , to skip over content within the consumable data considered less interesting , and allow accessing more interesting content . in the illustrated embodiment , movement of the current play marker within the consumable data represents a judgment or opinion of an audience member on whether a particular section of the consumable data is worth consuming , e . g ., worth viewing , listening , reading , etc . as determined by the type of consumable data . as with region 112 , in the illustrated embodiment , marker 106 identifies the start of another region 114 representing more interesting content . at some point in time ( not illustrated ) the consumable data consumer moves the current play marker and skips to timing marker 108 and again watches or otherwise consumes another region 116 of consumable data . this repeats again where the current play jumps to timing marker 110 , at which point the consumable data must have been interesting because a larger region 118 ( larger with respect to the other regions 112 - 116 ) of the consumable data is viewed or otherwise consumed . fig2 illustrates according to one embodiment continuing to monitor audience member input with which interactive audience analysis ( iaa ) may be employed to prepare a collective cut ( ct ). it will be appreciated when people watch an interesting video , re - listen to music , or otherwise re - consume consumable data , they may desire to repeat the data consumption , but will have a focus on portions of the consumable data considered particularly interesting during the previous consuming . in the illustrated embodiment , it is assumed a consumer utilizes a fast forward / rewind , skip feature or button , or other technique to change the current play position . when access to the consumable data is for a subsequent , e . g ., 2 nd , 3 rd , etc . time , it is assumed the consumer &# 39 ; s judgment on what is an interesting region , e . g ., a “ highlight ”, within the data is more accurate . service providers may track the collective behaviors of a large group of consumers , and use the subsequent consumptions to refine what is considered interesting within a particular consumable data . for example , the most popular movie on youku . com ( a chinese video streaming site ) is usually watched by more than 3 , 000 , 000 times , representing an enormous number of consumers that may be monitored , the service provider may monitor and learn how consumers extract highlights , and determine a collective judgment for the consumption . in selected embodiments determining a collective judgment is an iterative and adaptive process . in the illustrated embodiment , after consumption has identified the larger region 118 , the consumer continues to consume the data , such as by skipping the current play marker to locations 202 - 206 and respectively watching or otherwise consuming data portions 210 - 214 . fig3 illustrates , according to one embodiment , a consumer seeking the next interesting region ( e . g ., the next highlight ) of the consumable data . the embodiment represents the consumer , after watching or otherwise consuming for some period of time as illustrated in fig2 , the consumer concludes some interesting regions of the consumable data have been missed . as illustrated , the consumer has obtained fig2 portions 212 , 214 and then decides to move 302 the current play marker back to a time marker 304 before time marker 206 that will be determined to be an interesting region within the consumable data . this highlight 306 includes the fig2 region 214 previously considered an interesting region of the consumable data . as with fig1 - 2 , the consumer skips around within the consumable data , moving from the end of interesting region 306 to time marker 308 , consumes some data and skips to time marker 310 and then again to time marker 312 . these actions define the illustrated interesting regions 314 , 316 , 318 having varying lengths of time for their consuming based on factors deemed pertinent to the consumer , e . g ., based on likes , dislikes , curiosity , requirement , work , etc . completes his / her annotation of highlights ( e . g . four segments of highlights below ). as discussed above , interactive audience analysis may be used to analyze consumer activity in preparing a ct . fig4 illustrates in part , according to one embodiment , the cumulative effect of the fig1 - 3 highlighting of interesting regions 116 , 306 , 318 of a consumable data . assume in the fig4 embodiment regions 116 , 306 , 318 were determined by a first consumer ( or multiple aggregated or related consumers ); these regions are all filled with the same cross pattern . the illustrated regions 402 - 408 are also interesting regions identified as in fig1 - 3 , but by monitoring a second consumer &# 39 ; s traversal across timeline 100 and the viewing regions identified by time markers 410 - 416 ; these regions share the same left - diagonal pattern . with such multiple consumer inputs , a service provider or other entity can combine the input to perform interactive audience analysis ( iaa ). note that while the fig4 embodiment only illustrates two collections 418 , 420 of regions from two consumers , e . g ., respectively regions 116 , 306 , 318 and regions 402 - 408 , it will be appreciated an arbitrary number of consumer inputs can be utilized to perform the iaa . in one embodiment , iaa includes creating a weighted value for regions , where the overlapping portions of regions are given a cumulative weight of the values assigned to the individual overlapping regions , e . g ., overlapping is cumulative , regions with highest values after monitoring and analyzing multiple consumptions can be considered more reliably interesting to the target audience ( s ) being monitored . in one embodiment , this weighting can be defined with respect to a set such that : {[ t 1 , duration 1 , weight 1 ], [ t 2 , duration 2 , weight 2 ], . . . , [ t n , duration n , weight n ]}, where after determining the first region collection 418 , n = 3 and the value for the regions 116 , 306 , 318 are pre - assigned to be 1 for the first consumer of the consumable data , e . g ., the first viewer of a video . in one embodiment , when a second consumer accesses the consumable data and generates the second collection 420 of interesting regions , each of the second consumer &# 39 ; s regions are also assigned a value of 1 for the second consumer &# 39 ; s consumption , but an overlapping regions , e . g ., the portion 422 identified by dashed brackets , assuming simple addition , that region would be assigned a value of 2 . over time , after many consumers access the consumable data , there will be certain regions of the consumable data that are statistically considered significantly more interesting to the aggregate audience that consumed the data . in one embodiment , region weightings will be f ( n ) if the consumer has consumed the entire consumable data n times , e . g ., watched a “ full - length ” video n times , where n & gt ; 1 and f ( n )& gt ;& gt ; 1 ( much greater than 1 ) so as to give great weight to the presumed accuracy of interesting region identification by consumers having knowledge of the entire consumable data from multiple entire consumption , e . g . from having watched an entire video multiple times . it will be appreciated that a service provider may offer some incentive , discount , coupon , or the like , e . g ., a microeconomic stimulus , to encourage complete consumption and interesting region identification . fig5 illustrates a data flow diagram 500 , according to one embodiment , for pre - annotating consumable data in the fig1 - 4 embodiments , it can been assumed region weightings were initially zero because there were no regions defined and hence the first consumption , e . g . first video watching , resulted in an initial , e . g ., 1 , weighting for a first consumer &# 39 ; s identified regions . however , a first consumer need not start with a blank timeline . a service provider , intermediary device along a transmission path or data path to the consumer , endpoint device utilized by the consumer , or other device , may pre - annotate a timeline 100 with interesting regions , e . g ., provide pre - existing highlights . for example , if the consumable data includes a publicly released video such as a movie , one can acquire 502 data identifying interesting portions of consumable data , which for a movie would typically include trailers and other advertising regarding the movie . the acquired data can then be mapped 504 against the consumable data to identify 506 interesting regions within the consumable data . the phrase “ exemplar data ” will be used herein to refer to any data concerning the consumable data that may be mapped 504 to identify 506 interesting regions within the consumable data . for the movie , exemplar data includes the trailers and other advertising regarding the movie , and video analytics may be employed to match exemplar data to the movie to identify the region or regions within the consumable data corresponding to the exemplar data . movie trailer type of exemplar data are typically a “ director &# 39 ; s cut ” of highlights , but they are usually combined into a single end - to - end presentation . in one embodiment , the entity or device pre - annotating the timeline may employ video analytics to detect 508 changes , such as scene changes , within the exemplar data and distinguish 510 multiple interesting sub - regions within the exemplar data . video searching and / or video matching technologies may be applied 512 to identify longer versions of the distinguished 510 highlights within the exemplar data . similarly , if the consumable data includes audio data such as a song or soundtrack , audio analytics ( not illustrated ) may be employed to identify where exemplar data may be found within the consumable data , as well as to find similar “ sounds like ” matches . after identifying 506 interesting regions , in one embodiment , “ fuzzy ” matching may be performed 514 to allow finding portions of the consumable data that is “ like ” the exemplar data , and thus increase the number of identified interesting regions . to do so , for example , content analysis of video or audio data may be used to find other portions of the consumable data that is like the exemplar data . it will be appreciated fuzzy matching typically has an associated relevance rating to reflect a degree of relevance between a candidate match and the exemplar data . in one embodiment a required minimum degree of relevance , which can be arbitrarily set or determined with respect to the exemplar data , can be required for the candidate match to be considered an additional interesting region to be added to the identified 506 interesting regions . once interesting regions have been identified 506 , 514 within the consumable data , these can be used to define the collective cut ( ct ), and they can be used to pre - annotate 516 the timeline for the consumable data . in one embodiment , the initially identified 506 regions are associated with a heavy weighting because the director &# 39 ; s cut is considered to have high accuracy as to what is interesting . fig6 illustrates , according to one embodiment , continuing to apply multiple consumer access of consumable data to identify interesting regions for the collective cut ( ct ). as illustrated there are interesting region collections 622 , 624 corresponding to the combined input from fig4 from monitoring at least two consumers . illustrated regions 622 include regions 602 , 606 , 608 , 612 , 614 , 616 , 620 and these correspond to interesting region identification from a single consumer &# 39 ; s input . regions 622 includes regions 604 , 610 , 618 and these correspond to overlapping interesting regions from the two consumers &# 39 ; inputs . as discussed in fig5 , the single - input regions 602 , 606 , 608 , 612 , 614 , 616 , 620 may have an assigned weighting of 1 , where the combined input regions 604 , 610 , 618 may have an assigned weighting of at least 2 . it will be appreciated these weightings do not take into account any pre - annotation values or extra weighting assigned from consumers that access the entire consumable data . regions 624 include additional interesting regions 626 - 630 which may be identified by a consumer as discussed above in the other illustrated embodiments . in the fig6 embodiment , regions 624 were identified by an additional consumer over those identifying regions 622 . in the illustrated embodiment , the additional consumer is aware of the existing identified regions 622 and that selected regions 604 , 610 , 618 represent regions determined to have better reliability as being an interesting region . such awareness can be presented in a variety of ways , such as graphically through the user interface of the device by which the additional consumer is accessing the consumable data , in one embodiment , the additional consumer is provided a user interface allowing adjustment to existing identified regions 602 - 620 , or creation of new identified regions as discussed with respect to fig1 - 4 . thus , for example , the additional consumer may elect to refine existing annotations by way of adjusting start and / or end positions for the existing identified regions 602 - 620 , or simply define new interesting regions . either way , regions 624 may represent the end result of the additional user adjusting and / or creating new interesting regions 626 - 630 , and these regions may be assigned a weighting ( e . g ., + 1 for the additional consumer &# 39 ; s effort ) and the weightings combined with existing ratings . fig7 illustrates the result of all consumers of fig1 , 6 identifying interesting regions and / or modifying regions identified by other consumers . illustrated are regions 702 - 724 of which regions 704 , 710 , 716 , and 722 represent regions of the consumable data that have been repeatedly identified by consumers as being interesting regions , where , in comparison , regions 702 , 706 , 708 , 712 , 714 , 718 , 720 and 724 represent regions that remain singly identified by consumers are being interesting . in one embodiment , regions that receive a sufficiently high weighting will be considered “ true ” interesting regions that will , for example for a movie , be presented to a consumer as movie highlights . in one embodiment , a consumer receiving a movie with such pre - determined highlights could opt to simply skip through the video and just watch the highlights . this consumer would rely on the collective consumer input having appropriately determined a good set of interesting regions to be consumed . as more consumers contribute their refined and / or original identification of interesting regions within consumable data , the collection of interesting regions will continue to acquire more regions , each having varying weights . in one embodiment , a service provider , intermediary device along a transmission path or data path to the consumer , endpoint device utilized by the consumer , or other device , may elect to periodically condense region collections to reduce the number of regions being managed . in one embodiment , if two adjacent interesting regions have the same weight , they can be coalesced into one region . it will be appreciated consumer identification of interesting regions will not be precise , hence a tolerance may be applied when determining whether regions are adjacent . in one embodiment , multiple service providers may share interesting region identification consumable data common to the service providers to increase accuracy . in one embodiment , when service providers have enough confidence in the collection of interesting regions , they may publish some or all of the identified regions , e . g ., the service provider may elect to only release interesting regions that have been selected by a certain percentage of a targeted audience . further , it will be appreciated that with the current ability to track a consumer &# 39 ; s age and social , economic , religious , political , geographic , ethnic , food , etc . interests , a sufficiently large collection of interesting regions may be defined for and presented to specific audiences , e . g ., a specific set of consumers sharing one or more desired characteristics . in one embodiment , service providers may provide customized annotations for specific customers having known interests and time availability , e . g ., by way of questionnaires and / or monitored behavior or other meta data known about the consumer . the data known about the consumer can be used to select interesting regions relevant to the consumer and presented as the annotations for the consumable data . regarding time availability , different consumers may have different amounts of available time to consumer data , such as the length of a bus or train ride to / from work , or other known time duration , and this may be a factor in the selection of regions for an annotation . for example , if one is short of time , an annotation may be defined such that it has only the highest rated region that fit within the time available to the consumer . fig8 and the following discussion are intended to provide a brief , general description of a suitable environment in which certain aspects of the illustrated invention may be implemented . as used herein below , the term “ machine ” is intended to broadly encompass a single machine , or a system of communicatively coupled machines or devices operating together . exemplary machines include computing devices such as personal computers , workstations , servers , portable computers , handheld devices , e . g ., personal digital assistant ( pda ), telephone , tablets , etc ., transmitters , receivers and / or other devices for accessing a d / or manipulating audio , visual , or other consumable data , as well as transportation devices , such as private or public transportation , e . g ., automobiles , trains , cabs , etc . typically , the environment includes a machine 800 that includes a system bus 802 to which is attached processors 804 , a memory 806 , e . g ., random access memory ( ram ), read - only memory ( rom ), or other state preserving medium , storage devices 808 , a video interface 810 , and input / output interface ports 812 . it will be appreciated that while elements of the machine 800 may be referenced in the singular , multiple elements not illustrated may be present . the machine may be controlled , at least in part , by input from conventional input devices , such as keyboards , mice , etc ., as well as by directives received from another machine , interaction with a virtual reality ( vr ) environment , biometric feedback , cooperative or aggregate learning or other input source or signal . the machine may include embedded controllers , such as programmable or non - programmable logic devices or arrays , application specific integrated circuits , embedded computers , smart cards , and the like . the machine may utilize one or more connections to one or more remote machines 814 , 816 , such as through a network interface 818 , modem 820 , or other communicative coupling machines may be interconnected by way of one or more physical and / or logical networks 822 , such as an intranet , the internet , local area networks , wide area networks , cloud network , distributed network , peer - to - peer network , and the like . one skilled in the art will appreciated that communication with network 822 may utilize various wired and / or wireless short range or long range carriers and protocols , including radio frequency ( rf ), satellite , microwave , institute of electrical and electronics engineers ( ieee ) 802 . 11 , bluetooth , optical , infrared , cable , laser , etc . in some embodiments , multiple ones of networks 822 may be simultaneously utilized , and metrics such as cost , efficiency , preferences , power , etc . may be applied to control how particular ones of networks 822 are selected and how data is apportioned across multiple active networks . the invention may be described by reference to or in conjunction with associated data including functions , procedures , data structures , application programs , etc . which when accessed by a machine results in machine 800 components performing tasks or defining abstract data types or low - level hardware contexts . associated data may be stored in , for example , volatile and / or non - volatile memory 806 , or in storage devices 808 and their associated storage media , including hard - drives , floppy - disks , optical storage , tapes , flash memory , memory sticks , digital video disks , biological storage , etc . associated data may be delivered wholly or in part over transmission environments , including network 822 , in the form of packets , serial data , parallel data , propagated signals sent and / or received by a tangible component , etc ., and may be used in a compressed or encrypted format . associated data may be used in a distributed environment , and stored locally and / or remotely for access by single or multi - processor machines . thus , for example , with respect to the illustrated embodiments , assuming machine 800 embodies a device utilized by a fig4 consumer for consuming the consumable data , then remote machines 814 , 816 may respectively be a cable television or satellite broadcast head end , internet server , or other entity or device providing consumable data to the consumer , it will be appreciated remote machines 814 , 816 may be configured like machine 800 , and therefore may include many or all of the elements discussed for machine 800 . having described and illustrated the principles of the invention with reference to illustrated embodiments , it will be recognized that the illustrated embodiments can be modified in arrangement and detail without departing from such principles . and , though the foregoing discussion has focused on particular embodiments , other configurations are contemplated . in particular , even though expressions such as “ in one embodiment ,” “ in another embodiment ,” or the like are used herein , these phrases are meant to generally reference embodiment possibilities , and are not intended to limit the invention to particular embodiment configurations . as used herein , these terms may reference the same or different embodiments that are combinable into other embodiments . consequently , in view of the wide variety of permutations to the embodiments described herein , this detailed description is intended to be illustrative only , and should not be taken as limiting the scope of the invention . what is claimed as the invention , therefore , is all such modifications as may come within the scope and spirit of the following claims and equivalents thereto .	6
embodiments of the present disclosure as described herein can be combined in many ways to treat one or more diseases of a patient such as a disease of the eye . the embodiments as described herein are well suited to treat patients with a therapeutic agent for an extended time , such as may be provided with a device that can be at least partially implanted into the eye . although specific reference is made to ophthalmic treatment of the eye , the methods and apparatus to place a therapeutic fluid in implantable device can be used with many implantable devices and treatments of one or more of many diseases , such as systemic medication to treat systemic disease , orthopedic treatment to treat orthopedic disorders , or dental treatment , for example . the exchange apparatus and methods as described herein are well suited for use with many drug delivery devices , such as refillable diffusion based devices , and can be exceptionally well suited for diffusion devices having a porous drug release structure configured for extended release in which the porous structure inhibits flow of fluid during exchange . the exchange apparatus and methods as described herein are well suited for diagnoses and treatment of the eye , for example with diagnosis and treatment of the eye based on the implantable device fluid received with the exchange apparatus with the fluid is injected . the implantable device can be combined with one or more known methods of analysis of biomarkers , for example commercially available beads and arrays to detect and measure biomarkers . the methods and apparatus as described herein are well suited for combination with analysis of samples as described in u . s . pat . app . ser . no . 61 / 538 , 736 , entitled “ diagnostic methods and apparatus ”, filed : sep . 23 , 2011 ( attorney docket no . 93161 - 821804 ( 000140us ), the full disclosure of which is incorporated herein by reference . examples of injector apparatus , therapeutic devices , valves and mechanisms to provide the bolus injection are described in u . s . patent application ser . no . 12 / 696 , 678 , filed on jan . 29 , 2010 , entitled “ posterior segment drug delivery ”, publication no . 2010 / 0255061 ; and u . s . pct pat . app . no . pct / us2011 / 046812 , filed aug . 5 , 2011 , entitled “ injector apparatus and method for drug delivery ”, the entire disclosures of which are incorporated herein by reference . pct patent application no . pct / us2012 / 049654 , filed aug . 3 , 2012 entitled “ small molecule delivery with implantable therapeutic device ” is also incorporated herein by reference in its entirety . as used herein like numerals and / or letters denote like elements in the drawings and text as will be apparent to a person of ordinary skill in the art . fig1 shows an eye 10 suitable for incorporation of the therapeutic device . the eye has a cornea 12 and a lens 22 configured to form an image on the retina 26 . the cornea extends to a limbus 14 of the eye , and the limbus connects to a sclera 24 of the eye . a conjunctiva 16 of the eye is disposed over the sclera 24 . a tenon &# 39 ; s capsule 17 extends between the conjunctiva 16 and the sclera 24 . the lens can accommodate to focus on an object seen by the patient . the eye has an iris 18 that may expand and contract in response to light . the eye also comprises a choroid 28 disposed between the sclera 24 and the retina 26 . the retina comprises the macula 32 . the eye comprises a pars plana , which comprises an example of a region of the eye suitable for placement and retention , for example anchoring , of the therapeutic device as described herein . the pars plana region may comprise sclera 24 and conjunctiva 16 disposed between the retina 26 and cornea 12 . the therapeutic device can be positioned so as to extend from the pars plana region into the vitreous humor 30 to release the therapeutic agent . the therapeutic agent can be released into the vitreous humor 30 , such that the therapeutic agent arrives at the retina 26 and choroid 28 for therapeutic effect on the macula 32 . the vitreous humor of the eye 30 comprises a liquid disposed between the lens 22 and the retina 26 . the vitreous humor 30 may comprise convection currents to deliver the therapeutic agent to the macula 32 . fig2 shows a therapeutic device 100 implanted under the conjunctiva 16 and extending through the sclera 24 . fig3 a shows an exemplary embodiment of the therapeutic device 100 . the device 100 is configured to release a therapeutic agent 110 into vitreous humor 30 of the eye 10 so as to treat the retina of the eye . the therapeutic device 100 may comprise a retention structure 120 such as a smooth protrusion configured for placement along the sclera 24 and under the conjunctiva 16 , such that the conjunctiva 16 can cover and protect the therapeutic device 100 . when the therapeutic agent 110 is inserted into the device 100 , the conjunctiva 16 may be lifted away , incised , or punctured with a needle to access the therapeutic device 100 . the eye 10 may comprise an insertion of the tendon of the superior rectus muscle to couple the sclera of the eye to the superior rectus muscle . the device 100 may be positioned in many locations of the pars plana region , for example away from tendon and one or more of posterior to the tendon , anterior to the tendon , under the tendon , or with nasal or temporal placement of the therapeutic device . while the implant can be positioned in the eye in many ways , work in relation to embodiments suggests that placement in the pars plana region 25 can release therapeutic agent into the vitreous 30 to treat the retina 26 , for example therapeutic agent comprising an active ingredient composed of large molecules . therapeutic agents 110 suitable for use with device 100 include many therapeutic agents , for example as listed in table 1a , herein below . the therapeutic agent 110 of device 100 may comprise one or more of an active ingredient of the therapeutic agent , such as a formulation of the therapeutic agent , a commercially available formulation of the therapeutic agent , a physician prepared formulation of therapeutic agent , a pharmacist prepared formulation of the therapeutic agent , or a commercially available formulation of therapeutic agent having an excipient . the therapeutic agent may be referred to with generic name or a trade name , for example as shown in table 1a . the therapeutic device 100 can be implanted in the eye to treat the eye for as long as is helpful and beneficial to the patient . for example the device can be implanted for at least about 5 years , such as permanently for the life of the patient . alternatively or in combination , the device can be removed when no longer helpful or beneficial for treatment of the patient . the therapeutic agent 110 can be placed in the therapeutic device 100 in many ways . in many embodiments , a therapeutic fluid 260 ( fig2 ) comprising therapeutic agent 110 is exchanged with an implantable device fluid 262 contained within therapeutic device 100 , as shown in fig2 . an exchange apparatus 200 can be configured to place the therapeutic fluid 260 and to receive the implantable device fluid displaced from the implantable device when the therapeutic fluid is placed . with reference to fig2 , an exemplary embodiment of the exchange apparatus 200 comprises an elongate structure 201 that can be placed substantially within the implantable device . the elongate structure 201 comprises an opening to place the therapeutic fluid in the reservoir chamber of the implantable device and one or more openings to receive the implantable device fluid from the reservoir chamber . the exchange apparatus 200 may comprise the therapeutic fluid 260 and the receiver container 250 to receive fluid 262 of the implantable device . the therapeutic device 100 may comprise a reservoir chamber to store an amount of the therapeutic agent 110 . the reservoir chamber may comprise a fluid 262 of the implantable device 100 . the fluid 262 of the implantable device can be displaced when the therapeutic fluid 260 is injected , for example , and a receiver container 250 can be provided to receive the implantable fluid 262 from the implantable device . the reservoir chamber of the implantable device may comprise a substantially rigid walls and a substantially fixed volume , for example . the exchange apparatus 200 can be configured in many ways , and may be coupled to a syringe 300 with one or more of many connectors , such as a luer connector , a luer - lok ™ connector , for example . alternatively or in combination , the exchange apparatus may comprise syringe 300 , for example . the exchange apparatus 200 may comprise an elongate structure 201 to for insertion into the reservoir chamber of the implantable device , and a stop 240 to limit a depth of insertion of the elongate structure 201 into the reservoir chamber of the implantable device . the exchange apparatus 200 may comprise a receiver container 250 to receive the implantable device fluid from the reservoir chamber of the implantable device , and the elongate structure may comprise a plurality of openings coupled to the receiver container so as to receive the fluid of the implantable device through the plurality of openings when the fluid is injected . alternatively , the therapeutic fluid may be drawn into the reservoir chamber of the implantable device with aspiration of the implantable device fluid into chamber 310 of the syringe , such that the therapeutic fluid placed in chamber 250 can be drawn into the reservoir chamber of the implantable device , for example . fig3 a shows a therapeutic device 100 comprising a container 130 having a penetrable barrier 184 disposed on a first end , a porous structure 150 disposed on a second end to release therapeutic agent for an extended period , and a retention structure 120 comprising an extension protruding outward from the container to couple to the sclera and the conjunctiva . the container 130 may comprise an axis 100 a . the inner surfaces of the container 130 may define a reservoir chamber having a volume sized to provide therapeutic amounts of the therapeutic agent for the extended time . the extending protrusion of the retention structure may comprise a diameter 120 d . the retention structure may comprise an indentation 120 i sized to receive the sclera . the container may comprise a tubular barrier 160 that defines at least a portion of the reservoir , and the container may comprise a width , for example a diameter 134 . the diameter 134 can be sized within a range , for example within a range from about 0 . 5 to about 4 mm , for example within a range from about 1 to 3 mm and can be about 2 mm , for example . the container may comprise a length 136 sized so as to extend from the conjunctive to the vitreous along axis 100 a to release the therapeutic agent into the vitreous . the length 136 can be sized within a range , for example within a range from about 2 to about 1 4 mm , for example within a range from about 4 to 10 mm and can be about 7 mm , for example . the volume of the reservoir may be substantially determined by an inner cross sectional area of the tubular structure and distance from the porous structure to the penetrable barrier . the retention structure may comprise an annular extension having a retention structure diameter greater than a diameter of the container . the retention structure may comprise an indentation configured to receive the sclera when the extension extends between the sclera and the conjunctive . the penetrable barrier may comprise a septum disposed on a proximal end of the container , in which the septum comprises a barrier that can be penetrated with a sharp object such as a needle for injection of the therapeutic agent . the porous structure may comprise a cross sectional area 150 a sized to release the therapeutic agent for the extended period . the porous structure 150 may comprise a control release mechanism . the porous structure 150 can be configured in many ways to provide controlled sustained release , for example with a release rate index , or a size and number of openings , for example . the porous structure 150 may comprise a first side 150 s 1 coupled to the reservoir and a second side 150 s 2 to couple to the vitreous . the first side may comprise a first area 150 a 1 and the second side may comprise a second area 150 a 2 . the porous structure may comprise a thickness 105 t . the porous structure many comprise a diameter 150 d . the porous structure 150 may comprise one or more of a release control element , a release control mechanism , permeable membrane , a semipermeable membrane , a material having at least one hole disposed therein , channels formed in a rigid material , straight channels , nano - channels , nano - channels etched in a rigid material , laser drilled holes , laser etched nano - channels , a capillary channel , a plurality of capillary channels , one or more tortuous channels , sintered material , sintered rigid material , sintered glass , sintered ceramic , sintered metal , tortuous micro - channels , sintered nano - particles , an open cell foam or a hydrogel such as an open cell hydrogel . additional examples of porous structures are described in u . s . patent application ser . no . 12 / 696 , 678 , filed on jan . 29 , 2010 , entitled “ posterior segment drug delivery ”, publication no . 2010 / 0255061 ; and u . s . pct pat . app . no . pct / us2011 / 046812 , filed aug . 5 , 2011 , entitled “ injector apparatus and method for drug delivery ”, the entire disclosures of which have been previously incorporated herein by reference . the volume of the reservoir chamber may comprise from about 5 μl to about 2000 μl of therapeutic agent , or for example from about 10 μl to about 200 μl of therapeutic agent . the reservoir may comprise an axial length 136 c extending between the penetrable barrier 184 and the porous structure 150 . the therapeutic agent stored in the reservoir of the container comprises at least one of a solid comprising the therapeutic agent , a solution comprising the therapeutic agent , a suspension comprising the therapeutic agent , particles comprising the therapeutic agent adsorbed thereon , or particles reversibly bound to the therapeutic agent . for example , reservoir may comprise a suspension of a cortico - steroid such as triamcinolone acetonide to treat inflammation of the retina . the reservoir may comprise a buffer and a suspension of a therapeutic agent comprising solubility within a range from about 1 μg / ml to about 100 μg / ml , such as from about 1 μg / ml to about 40 μg / ml . for example , the therapeutic agent may comprise a suspension of triamcinolone acetonide having a solubility of approximately 19 μg / ml in the buffer at 37 ° c . when implanted . the release rate index may comprise many values , and the release rate index with the suspension may be somewhat higher than for a solution in many embodiments , for example . the release rate index may be no more than about 5 , and can be no more than about 2 . 0 , for example no more than about 1 . 5 , and in many embodiments may be no more than about 1 . 2 , so as to release the therapeutic agent with therapeutic amounts for the extended time . the release rate index can be at about 0 . 01 , for example . the therapeutic device , including for example , the retention structure and the porous structure , may be sized to pass through a lumen of a catheter . the porous structure may comprise a needle stop that limits penetration of the needle . the porous structure may comprise a plurality of channels configured for the extended release of the therapeutic agent . the porous structure may comprise a rigid sintered material having characteristics suitable for the sustained release of the material . fig3 b shows a porous structure comprising a plurality of substantially straight channels 150 sc extending substantially straight through a disk . the channels 150 sc can extend from a first side 150 s 1 to a second side 150 s 2 a distance comprising thickness 150 t of the porous structure . each of the channels comprises a cross - sectional dimension across , for example a diameter , and a corresponding area across the cross section . the combined cross - sectional area of the plurality of channels , the thickness 150 t , the diffusion coefficient of the therapeutic agent , the concentration of therapeutic agent within the reservoir chamber and the volume of the reservoir chamber determine substantially the release rate profile of the therapeutic agent . the size and number of the plurality of channels 150 sc and thickness of the porous structure can be configured so as to provide the release rate profile . the porous structure 150 may comprise the control release mechanism having one or more straight channels 150 sc through which material ( e . g ., fluid that contains therapeutic agent ) can pass . there can be at least 3 , for example at least 6 and even more typically at least 10 channels . there may be fewer than 1000 channels , for example no more than 200 and in many embodiments no greater than 50 of the channels 150 sc . material , particularly ophthalmic pharmaceutical composition and aqueous humor fluid , is typically allowed to freely flow and / or diffuse into and out of the reservoir chamber 140 ( fig3 a ) with the size of the openings of channels 150 sc assisting in controlling the rate of flow and / or diffusion into and out of the reservoir chamber 140 . the openings of the plurality of channels 150 sc , particularly for a passive system , have a cross - sectional area that controls the rate at which material , particularly therapeutic agent , flows out of the reservoir and into the eye . that cross - sectional area can be at least 8 μm 2 , more typically at least 15 μm 2 and even more typically at least 50 μm 2 . that same cross - sectional area can also be no greater than 4000 μm 2 , for example no greater than 2000 μm 2 and in many embodiments no greater than 500 μm 2 . the cross - sectional area of the opening may comprise any sectional area of the opening wherein the outer perimeter of the opening is fully defined by the material of the control release mechanism and wherein , for fluid to pass through the opening into or out of the reservoir chamber 140 , it also passes through the cross - sectional area . in the illustrated embodiments , as shown in fig3 b , the porous structure 150 comprising the control release mechanism can be a plate 150 pl . the plurality of channels 150 sc extends through the plate 150 pl . the plate 150 pl may have opposing substantially parallel surfaces through with the channels extend to the opening on each surface . in the embodiments shown , the channels 150 sc are cylindrical shape although they may be shaped otherwise as well . the channels 150 sc may have a diameter of at least about 0 . 2 microns , for example at least about 2 microns and in many embodiments at least about 8 microns . the diameter of the openings may be no greater than about 100 microns , for example no greater than 40 microns and in many embodiments no greater than about 25 microns . while it is understood that a generally uniform distribution of the openings over the surface of the plate 150 pl is desirable , other non - uniform distribution of opening the openings are also possible . a suitable thickness for the plate will typically be at least about 0 . 05 mm , more typically at least about 0 . 08 mm and will typically no greater than 0 . 5 mm and more typically no greater than 0 . 3 mm . the porous structure 150 comprising the control release mechanism may comprise a plate 150 pl . the plate 150 pl may be formed of a variety of materials such as metals or polymeric materials . in many embodiments , the plate 150 pl is formed of an etchable material such as silicon , which allows the channels 150 sc to be etched into the material . the number and size of each of the openings provides a combined cross - sectional surface area for the plate 150 pl . the combined cross - sectional surface area of the channels 150 sc may be no more than about 100 , 000 μm 2 , so as to provide sustained release of the therapeutic agent for an extended time . while the combined cross - sectional surface area can be within a range from about 1000 μm 2 to about 100 , 000 μm 2 , in many embodiments the combined cross - sectional area is within a range from about 2 , 000 μm 2 to about 30 , 000 μm 2 , for example about 2 , 000 to about 10 , 000 μm 2 . the combined cross - sectional area can be determined based on one or more of the thickness of the plate 150 pl , the diffusion coefficient of the therapeutic agent , the volume of the reservoir chamber , the concentration of the therapeutic agent placed in the reservoir chamber , or the targeted release rate profile of the therapeutic agent above a minimum inhibitory concentration for a predetermined amount of time , or combinations thereof , for example . fig4 shows an exemplary apparatus 200 to exchange fluid of a device implanted in an eye . the apparatus 200 may comprise or be coupled to a syringe 300 to inject a therapeutic fluid comprising a therapeutic agent in to the device implanted in the eye . the apparatus 200 comprise an elongate structure 201 comprising a distal portion 210 , and intermediate portion 220 and a proximal portion 230 . the elongate structure 201 extends along an axis 202 from a stop 240 to position the distal portion 210 , the intermediate portion 220 , and the proximal portion 230 corresponding locations of the reservoir chamber . the distal portion 210 comprises a distal tip 212 to penetrate tissue and the penetrable barrier of the implantable device and an opening 214 to inject therapeutic fluid into the implantable device . the intermediate portion 220 comprises a tapered section 224 to gradually increase a size of the channel formed in the penetrable barrier when the needle is advanced through the penetrable barrier , so as to maintain integrity of the penetrable barrier and inhibit damage to the penetrable barrier . in many embodiments , the tapered portion 224 may extend along axis 202 without holes so as to decrease pressure to the penetrable barrier that may otherwise occur near the edge of a hole . the proximal portion 230 may comprise a plurality of openings 236 to receive the fluid from the reservoir chamber of the implantable device . the proximal portion 230 may comprise an extension 238 extending from the stop 240 . the extension 238 may extend from the stop 240 without holes to inhibit leakage when the fluid is exchanged and the stop 240 engages the conjunctiva . fig5 shows the apparatus 200 coupled to an implantable device 100 . the stop 240 is positioned to engage the conjunctiva 16 , and the elongate structure 201 extends through the conjunctiva 16 and penetrable barrier 184 into the reservoir chamber 140 of the implantable device 100 when the apparatus 200 is coupled thereto . the elongate structure 201 can be sized so as to place distal tip 212 at a location within the reservoir chamber of the implantable device when the surface of the stop contacts the conjunctiva , for example . the distal tip 212 can be located on elongate structure 201 so as to place the distal tip 212 at a location from the penetrable barrier within implantable device 100 that is no more than a desired length , such as about ¾ of the length 136 of the implantable device , and in some embodiments no more than about half of the distance 136 c of the reservoir chamber . the plurality of openings 236 is located near the penetrable barrier 184 so as to receive fluid contacting the reservoir chamber . the extension 238 extends substantially through the penetrable barrier 184 , for example at least about half way through the penetrable barrier so as to position the plurality of openings away from an external surface of the penetrable barrier and to inhibit leakage . fig6 shows an enlarged view of the elongate structure 201 of the apparatus 200 . the elongate structure 201 extends along axis 202 between the distal tip 212 and stop 240 . the distal portion 210 may comprise an extension 211 having a substantially constant cross - sectional size extending between the tip 212 to penetrate tissue and the intermediate portion 220 . in many embodiments , the extension 211 comprises a portion of a needle 270 extending between the stop 240 and the tip 212 to penetrate tissue , which tip may comprise the tip of the needle to penetrate conjunctival tissue . the tip to penetrate tissue 212 and the opening 214 can be located a distance 204 from the stop and the plurality of opens to provide efficient exchange of the fluid within the reservoir chamber of the implanted device . in many embodiments , the opening 214 is placed within the reservoir chamber at a distance from the stop 240 greater than the plurality of openings 236 to inhibit mixing of the injected therapeutic fluid with the fluid within the reservoir chamber of the implanted device . the opening 214 can be separated from the plurality of openings with a distance 208 , such that the opening 214 can be located below the plurality of openings when the therapeutic fluid is injected . the therapeutic fluid may comprise a density greater than the fluid of the implanted device and opening 214 can be placed below the plurality of openings 236 when the therapeutic fluid is injected to inhibit mixing . the axis 100 a ( see fig3 a ) of the implantable device and the corresponding axis of the reservoir chamber can be oriented away from horizontal , such that porous structure 150 may be located below the penetrable barrier 184 when the therapeutic fluid is injected . the axis 202 can oriented away from horizontal such that opening 214 can be placed below the plurality of openings 236 . the therapeutic fluid comprising the greater density can flow toward the distal end of the therapeutic device and the displaced fluid of the implantable device having the lesser density can be received by the plurality of openings 236 located above the opening 214 . examples of therapeutic agents and corresponding formulations and fluids that may have a density greater than the density of the fluid within the chamber of the implanted device are listed in table 1a . for example , one or more of the therapeutic agent or a stabilizer can increase the density of the therapeutic fluid . in many embodiments the therapeutic fluid having the greater density comprises a stabilizer , such as trehalose , and the therapeutic agent such as a protein comprising an antibody fragment . alternatively or in combination , the therapeutic formulation may comprise an amount of therapeutic agent sufficient to provide a density greater than the fluid of the implanted device . the difference in density can be within a range from about 1 % to about 10 % and can depend on the density of the fluid within the reservoir chamber of the therapeutic device and density of the therapeutic fluid placed in the reservoir chamber with the exchange apparatus . the density of the therapeutic fluid may correspond to a density of the therapeutic agent and a density of the stabilizer ( when present ). in many embodiments , the density of the fluid of the reservoir chamber may correspond to a density of phosphate buffered saline , or plasma , or an amount of therapeutic fluid remaining in the reservoir from a prior exchange , or combinations thereof , for example . when injected into a device implanted within the patient , the distance 204 may correspond to no more than approximately the distance of the reservoir chamber of device 140 . the distance 204 may correspond substantially to the length of the reservoir chamber so as to place the distal tip near the porous structure , and the elongate structure of the exchange apparatus can be aligned with an elongate axis of the implantable device . in many embodiments , the distance 204 may correspond to no more than about half the distance of the reservoir chamber , such that the elongate structure 201 can be readily aligned with the implantable device . work in relation to embodiments suggests than a distance providing a tolerance for angular alignment error of the axis 100 a with the axis 202 can facilitate exchange and improve efficiency of the exchange . the distance 204 from stop 240 to tip 212 comprising no more than about half of the axial distance of the implantable device can facilitate alignment during injection . the intermediate portion 220 may comprise an extension 222 extending between tapered portion 224 and the distal portion 210 . the extension 222 may comprise a cross - sectional size that is smaller than the tapered portion 224 . the extension 222 may comprise a smooth outer surface to penetrate tissue . the tapered portion 224 may comprise a smother outer surface to penetrate tissue and the penetrable barrier . the outer surface of the tapered portion can extend at an angle of inclination relative to the axis , and the tapered portion 224 may comprise a conic section having an angle with the axis such that the outer surface extends at the angle of inclination relative the axis . the angle of inclination of the tapered portion 224 can be no more than about 25 degrees , for example . the angle of inclination can be about 1 degree , about 2 degrees , about 5 degrees , about 10 degrees , about 15 degrees , about 20 degrees , or about 25 degrees , for example . the extension portion 216 may comprise a first cross - sectional dimension , and the portion having the plurality of openings may comprise a second cross sectional dimension greater than the first dimension , such that tapered portion having the angle of inclination extends there between to connect the extension portion 216 with the portion having the plurality of openings 236 . the proximal portion 230 may comprise the plurality of openings 236 spaced apart along the axis 202 and distributed circumferentially around the proximal portion to receive fluid from a plurality of circumferential and axial locations when the stop 240 engages the conjunctiva to place the plurality of openings within the reservoir chamber . at least one 237 of the plurality of openings can be separated from the stop 240 with a distance 206 corresponding substantially to the thickness of the penetrable barrier 184 , such that the at least one 237 of the plurality of openings 236 can be placed near the inner surface of the penetrable barrier to receive fluid contacting the inner surface of the penetrable barrier . in many embodiments , the thickness of the penetrable barrier is within a range from about 0 . 25 to about 2 mm , for example within a range from about 0 . 5 to about 1 . 5 mm , such that the thickness of the penetrable barrier is substantially greater than a thickness of the conjunctiva which can be approximately 100 μm . the distance 206 corresponding substantially to the thickness of the penetrable barrier may correspond substantially to the thickness of the penetrable barrier and the epithelium of the patient . a sheath 280 can be configured to extend over at least a portion of needle 270 . the sheath 280 may extend along the intermediate portion 220 and the proximal portion 230 , and the needle 270 can extend through the sheath . the sheath 280 may comprise the plurality of openings 236 and provide one or more channels extending along needle 270 to pass the fluid of the implantable device through the septum . the sheath 280 may comprise portions corresponding to the intermediate and proximal portions of the elongate structure 201 . the extension 222 may comprise a distal portion sheath 280 having an inner surface sized to engage an outer surface of the needle , and the diameter of the portion to engage the needle may comprise an inner cross sectional diameter less than the needle to engage the needle with at least one or of pressure or friction . the tapered portion 224 may comprise an intermediate portion of sheath 280 , in which the sheath 280 comprises tapered surface to penetrate the tissue and penetrable barrier 184 . the proximal portion 230 may comprise a proximal portion of the sheath 280 comprising the plurality of openings 236 and the extension 238 . a channel 239 can extend along an outer surface of the needle to the plurality of openings 236 . the channel 239 can extend proximally along extension portion 238 toward a container 250 ( see fig8 a ) to receive the fluid of the implantable device . the channel 239 may couple the plurality of openings to the container to receive the fluid of the implantable device . fig7 shows a cross - sectional view of an elongate structure of the apparatus exchange fluid comprising the sheath 280 over the needle 270 . the needle may comprise channel 219 , for example a lumen , extending distally to the opening 214 ( see fig6 ) and proximally to a connector to couple the channel 219 to a syringe , for example . a wall 252 of container 250 comprises sufficient strength to resist deformation when the stop 240 engages the tissue , and the stop 240 may comprise a deformable stop to couple to the tissue ( see fig8 a ). an outlet channel 254 extends from container 250 to at least one vent opening 258 to atmospheric pressure ( see fig8 a ). fig7 a shows an exchange apparatus comprising a locking connector to couple to a syringe . the connector 290 may comprise a locking connector having an extension 292 sized to fit in a channel of connector 320 of syringe 300 , for example ( see fig8 b ). the exchange apparatus 200 may comprise components of a standard locking needle assembly , for example a standard locking needle such as a luer - lok ™ fitting . the wall 252 that defines container 250 and sheath 280 can fit over the needle 270 which may comprise a standard needle assembly . the wall 252 can extend a substantial distance from stop 240 to opening 258 , for example , so as to define container 250 and channel 254 extending between the locking needle assembly and the wall . fig7 b shows the elongate structure 201 and receiver container 250 of the exchange apparatus 200 of fig7 a . the wall 252 can extend around a distal portion of receiver container 250 . the needle 270 and sheath 280 may extend through the wall 250 . the stop 240 can be located on a distal portion of wall 252 and may comprise a soft material , for example a soft elastomeric material such as silicone elastomer . the stop 240 may fit within a recess formed on the surface of wall 252 , and the needle 270 and the sheath 280 may extend through the soft elastomer stop 240 , for example . the sheath 280 may comprise the tapered portion 224 proximal to the plurality of openings 236 . the needle 270 can extend from tip 212 through chamber 250 to the connector 290 ( see fig7 a ), for example . the sheath 280 can extend from a first end 281 distal of the tapered portion 224 to a second end 283 . the second end 283 may comprise an opening 285 into chamber 250 . the outflow path of the displaced fluid from the implantable device may extend through the plurality of openings 236 to channel 239 , along channel 239 to opening 285 , and through opening 285 and into receiver container 250 . fig7 c shows sheaths suitable for combination with the exchange apparatus of fig7 a and 7b . the sheath 280 can be configured in many ways ( see 280 a through 280 k ), and may comprise a wall thickness from about 0 . 0001 inches to about 0 . 01 inches , for example about 0 . 001 inches ( 1 / 1000 inch , 25 μm ). the sheath 280 may comprise an inside diameter sized larger than the outside diameter of needle 270 so as to provide an annular channel extending axially between the needle and the sheath from the plurality of openings 236 to the opening 285 . the diameter of each of the holes can be within a range from about 0 . 0001 inches to about 0 . 1 inches , for example within a range from about 0 . 001 inches to about 0 . 01 inches . the plurality of openings 236 may comprise one or more of many shapes and can be arranged in many ways . each row may comprise from about 2 to about 20 holes , for example , and may comprise circular , oval , elliptical or other shapes , for example . the sheath 280 may comprise a sheath 280 a having four rows of circular holes . each of the holes may have a diameter of no more than about one half of the thickness of the outside diameter of the sheath 280 , for example , and may be located circumferentially at 90 degrees to each other , for example . each of the four rows may extend axially along the sheath 280 . the rows can be spaced angularly at 90 degrees to each other , for example . the sheath 280 may comprise sheath 280 b having about two rows , each row comprising about four holes , each hole having a diameter of no more than about one eighth of the diameter of the outside diameter of the sheath 280 . the two rows may be spaced apart circumferentially at 180 degrees , and the holes may comprise holes cross - drilled through both sides of the sheath , such that each hole has a corresponding hole on the other row on an opposite side of the sheath . the sheath 280 may comprise sheath 280 c comprising about four cross drilled holes , each hole having a diameter of no more than about three quarters of the diameter of the outside diameter of the sheath 280 , for example . the holes may comprise pairs of holes , in which the holes of each pair have corresponding axial locations . the holes can be arranged in two rows spaced circumferentially at 180 degrees . the sheath 280 may comprise sheath 280 d comprising at least about three rows of at least about 3 holes , each hole having a diameter of no more than about one quarter of the diameter of the outside diameter of the sheath 280 . the rows can be spaced apart circumferentially at about 120 degrees , for example . the sheath 280 may comprise sheath 280 e comprising at least about 40 holes , each hole having a diameter of no more than about one tenth of the diameter of the outside diameter of the sheath 280 . the sheath 280 may comprise sheath 280 f comprising slots . each of the slots may comprise a narrow dimension across and a long dimension across . the long dimension can extend axially along the sheath 280 and may extend a distance greater than the narrow dimension across . the long dimension can extend a distance greater than the outside diameter of the sheath 280 where the slots are located , for example . the narrow dimension across each slot may comprise no more than about half of the outside diameter of the sheath , for example . the sheath 280 may comprise sheath 280 g comprising staggered rows of holes . the plurality of openings 236 may comprise a first row and a second row of cross drilled holes 236 a , in which the holes of the first row are paired with the holes of the second row at a common axial location for each pair . a third row of holes and a fourth row of holes may comprise cross drilled holes 236 b located at 180 degrees to each other and 90 degrees to the first row and the second row . the axial locations of the third and fourth rows of holes can be staggered from the first and second rows of holes , such that the axial locations of the holes 236 a of the first row and second row correspond to axial locations away from the holes 236 b of the first row and the second row , for example . the sheath 280 may comprise sheath 280 h comprising oval holes having a long dimension and a short dimension , with the long dimension extending transverse to the axis of the sheath 280 and the short dimension extending along the axis of the sheath 280 . the oval holes can be spaced apart and located in rows extending along the axis of the sheath as described herein , for example . the sheath 280 may comprise sheath 280 i comprising elongate oval holes having the long axis of the oval extending along the axis of the sheath and the narrow dimension of the oval extending transverse to the long axis of the sheath , for example . the sheath 280 may comprise sheath 280 j comprising at least about three rows of at least about 3 oval holes , each oval hole having a maximum dimension across of no more than about one quarter of the diameter of the outside diameter of the sheath 280 . the rows can be spaced apart circumferentially at about 120 degrees as described herein , for example . the sheath 280 may comprise sheath 280 k comprising at least about 40 holes , each hole having a diameter of no more than about one tenth of the diameter of the outside diameter of the sheath 280 . the holes can be located on opposite sides of the sheath 280 , and may comprise cross drilled holes , for example . fig7 d shows one of the sheath openings 236 having a beveled channel surface 284 to inhibit degradation of the penetrable barrier . the thickness 286 of the sheath wall may be within a range from about 0 . 0001 to about 0 . 01 inches , for example . the corner of 282 of the beveled channel surface of the opening may comprise an angle to inhibit degradation of the penetrable barrier , such as tearing with repeated injections . fig7 e shows one of the sheath openings 236 having a rounded channel surface of the opening and edge to inhibit degradation such as tearing of the penetrable barrier with repeated injections , in accordance with embodiments of the present disclosure ; fig7 f shows a schematic illustration of the parallel outflow paths from the reservoir chamber 140 . the first outflow path 140 p 1 extends from the reservoir chamber 140 to the receiver container 250 , and the second outflow path 140 p 2 extends from the reservoir chamber 140 across the porous structure 150 to the vitreous humor 30 of the eye . as the intraocular pressure of the eye may be substantially less than the pressure of the implantable device during exchange , the intraocular pressure of the eye approximates atmospheric pressure . the second outflow path 140 p 2 extends comprises a pressure drop dp across the porous structure 150 . the first outflow path 140 p 1 comprises the pressure drop dp across the plurality of openings 236 , along the one or more channels 239 extending from the plurality of openings to the opening 285 , and through the one or more openings 285 into the receiver container 250 . in many embodiments , the channel 254 and the opening 258 each comprise air , such that the resistance to flow 254 r of the channel 254 and the resistance to flow 258 r of the opening such that the pressure drop across channel 254 and the opening 258 can be substantially less than the pressure drop dp , for example negligible . in many embodiments , a valve 256 v can be provided , so as to vary the resistance to flow of the outflow path to provide a bolus . the valve 256 v may comprise a porous structure 256 , for example , or a stop , plunger or other mechanism so as to increase pressure and provide the bolus when the exchange apparatus 200 has received a predetermined amount of displaced liquid from the reservoir container 140 . the porous structure 256 may comprise a gas such as air initially , and be configured to contact the liquid from the reservoir chamber when the predetermined amount of fluid has been received and provide a substantial increase in the resistance to flow 156 r , such that the bolus is passed through porous structure 150 . examples of valves and mechanisms to provide the bolus injection are described in u . s . pct pat . app . no . pct / us2011 / 046812 , filed aug . 5 , 2011 , entitled “ injector apparatus and method for drug delivery ”, the entire disclosure of which has been previously incorporated herein by reference . the pressure drops can be configured in many ways so as to inhibit a bolus release into the eye when the therapeutic fluid is exchanged with the implantable device fluid , or so as to release a bolus of therapeutic fluid through the porous structure of the implantable device , for example . the therapeutic fluid 260 comprising therapeutic agent 110 is injected through needle 270 into the reservoir chamber 140 of the implantable device , so as to pressurize the implantable device chamber with a force sufficient to pass a substantial portion of the implantable device fluid 262 into the receiver container 250 . a pressure drop dp extends from the reservoir chamber of the implantable device through the plurality of openings 236 , along channel 239 extending to opening 285 , and through opening 285 , such that the implantable device fluid 262 is received in receiver container 250 . the outflow path from the reservoir chamber of the implantable device to the receiver container 250 comprises a resistance to flow corresponding to a resistance to flow 236 r of the plurality of openings 236 , the resistance to flow 239 r of the channel 239 , and the resistance to flow 285 r of opening 285 , for example . the resistance 150 r to flow of the porous structure corresponds to an amount of therapeutic fluid 260 passed from the reservoir chamber of the implantable device to the chamber of the eye containing vitreous humor , for example . the amount of fluid into the receiver container such as the chamber 250 relative to the amount of fluid through the porous structure is related to the resistances based on parallel flow . the amounts of flow to the receiver container 250 and through the porous structure 150 correspond substantially to the following equations : ( amount through porous structure )/( amount through receiver )=( resistance 236 r + resistance 239 r )/( resistance 150 r ) ( amount through porous structure )=( amount through receiver )( resistance 236 r + resistance 239 r )/( resistance 150 r ) ( amount to receiver container )=( amount through porous structure )( resistance 150 r )/( resistance 236 r + resistance 239 r ) the resistance 150 r corresponding to extended release of the therapeutic agent can be substantially greater than the resistance of the outflow path to the receiver container 250 comprising resistance 236 r and resistance 239 r , such that the amount of bolus of therapeutic fluid 260 and implantable device fluid 262 through the porous structure 150 can be less than about 1 μl combined , for example . alternatively , the resistance to flow of the outflow path can be sufficient such that a substantial amount of therapeutic agent 110 is released through porous structure 150 with a bolus during exchange . the resistance to flow along the outflow path may comprise one or more of the resistance to flow 236 r of the plurality of openings 236 , the resistance to flow 239 r of the channel 239 extending from the plurality of openings to the opening 285 , or the resistance to flow 285 r of the opening 285 , for example , or combinations thereof . the size and number of the plurality of openings 236 and the thickness 286 of the sheath can determine substantially the resistance 236 r of the plurality of openings . the length of the channel 239 extending from the plurality of openings 236 to the opening 285 , and the transverse dimensions of the channel can determine substantially the resistance to flow 239 r . for example the channel 239 may comprise a plurality of channels extending from the plurality of openings opening 236 to the reservoir container 250 . the resistance to flow 150 r can vary with the rri of the porous structure 150 . in many embodiments , the resistance to flow 150 r of porous structure 150 is inversely related to the rri of the porous structure . for example , experimental testing with syringes and test therapeutic devices has shown that a bolus can be achieved through a porous structure 150 having an rri of about 0 . 06 when the resistance to flow of outflow path is sufficiently large and device 100 is constructed such that chamber 140 can be pressurized to at least about one atmosphere , for example . however , porous structures having lower rris can provide a substantial resistance to flow so as to inhibit release of a substantial bolus . for example a porous structure 150 having an rri of about 0 . 02 has a resistance to flow 150 r such that an attempt to pass a substantial bolus amount through the porous structure 150 with a clinically acceptable injection time of 30 seconds or less may result in substantial pressure , for example greater than about four atmospheres . the resistance to flow 150 r of the porous structure 150 comprising the plurality of straight channels 150 sc varies with one or more of the combined cross - sectional surface area of the channels 150 sc , the number of openings , the size of each of the openings , or the thickness 150 t , and combinations thereof . the combined cross - sectional surface area of the channels 150 sc may be no more than about 100 , 000 μm 2 , so as to provide a resistance to flow 150 r of the porous structure 150 sufficient decrease flow through the porous structure and provide exchange as described herein . the combined cross - sectional surface area can be within a range from about 1000 μm 2 to about 100 , 000 μm 2 , for example , so as to provide a resistance to flow 150 r greater than the resistance to flow of the outflow path 140 p 1 . for example , the combined cross - sectional area within a range from about 1 , 000 μm 2 to about 30 , 000 μm 2 may provide a substantial resistance to flow 150 r , which may be substantially greater than the resistance to flow of the outflow path . in many embodiments , the combined surface area is within a range from about 1 , 000 μm 2 to about 10 , 000 μm 2 , and the resistance to flow 150 r is substantially greater than the resistance to flow of the outflow path so as to inhibit bolus release through the porous structure ( see also fig3 a and 3b ). the resistance to flow of the outflow path comprising resistance 236 r and 239 r may comprise about 5 per cent of the resistance 150 r to flow of the porous structure 150 , such that about 5 μl of fluid flows through the porous structure and about 95 μl flows through the plurality of openings 236 and channel 239 . the size and number of the plurality of openings and dimensions of channel 239 can be determined by a person of ordinary skill in the art based on the teachings described herein so as to provide a target amount of bolus for a target amount of injected therapeutic fluid . as the therapeutic fluid 260 can be denser than the implantable device fluid 262 , a substantial portion of the fluid through the porous structure 150 may comprise the therapeutic fluid 260 , for example . fig8 a shows a cross - sectional view of the apparatus to exchange fluid as in fig5 and 6 coupled to a syringe . the channel 239 extends from the plurality of openings 236 to a container 250 to receive the fluid of the implantable device . the distal portion 210 comprising tip 212 and opening 214 comprise a distal portion of needle 270 . the channel 219 extends along an axis 202 from the opening 214 to a connector 290 . the connector 290 is configured to couple to a connector 320 of an injector . the injector may comprise a syringe 300 ( not to scale ). the injector may comprise a container 310 comprising a therapeutic fluid for injection , and the container 310 can be fluidically coupled to the opening 214 on distal tip 212 when the connector 320 engages the connector 290 . the sheath may comprise an annular configuration shaped for placement over the substantially annular needle , such that the sheath and needle comprise a substantially concentric configuration extending along axis 202 . the connector 290 of the exchange apparatus and the connector 320 of the injector can be configured in many ways . for example , the connector 290 and the connector 320 may comprise a standard connector such as a luer connector or a pressure fit connector . alternatively , the connector 290 may comprise a non - standard connector to limit access to the exchange apparatus 200 . for example the connector 290 may comprise a star connector or other connector , and connector 290 may comprise a lock and key mechanism . the lock and key mechanism may comprise a lock on the exchange apparatus configured to receive a key of the injector , such that the lock of connector 290 can receive the key of connector 320 to couple the injector to the exchange apparatus and permit injection from chamber 310 through opening 214 . alternatively , the syringe 300 may be affixed to exchange apparatus 200 , and syringe 300 provided with a single dose of therapeutic agent . the container 250 of the exchange apparatus may have a volume to limit and amount of fluid received from the implantable device and to limit use of the apparatus to a single use . for example , the volume of the container may comprise no more than about 100 μl , for example no more than about 50 μl , so as to limit and amount of fluid exchanged with the implantable device and inhibit reuse of the exchange apparatus from patient to patient . the implantable device can be provided to a health care provider with an amount of gas , such as air within the receiver container 250 , and the receiver container may comprise a structure along a vent path to limit the amount of fluid that can be received by the container 250 . the exchange apparatus 200 may comprise a porous structure 256 to inhibit passage of the fluid of the implantable device and limit the amount of fluid exchanged . the porous structure 256 may comprise a material to pass a gas , such as air and inhibit flow of a liquid , such as the fluid of the implantable device . the material may comprise one or more of a fabric , a porous fabric , a semipermeable membrane , an air permeable material , a moisture vapor transfer waterproof fabric , a hydrophilic porous material , or a porous sintered material , for example . the channels extending through the porous structure 256 may comprise a gas , such as air and a lower resistance to flow of the gas and a substantially greater resistance to flow of a liquid , such as the therapeutic fluid , such that the exchange is substantially inhibited when receiver container 250 is substantially filled with fluid of implanted device and the fluid exchanged with the implanted device contacts the porous structure 256 . the porous structure 256 may comprise one or more of a fabric , a porous fabric , a semipermeable membrane , an air permeable material , a moisture vapor transfer waterproof fabric , a hydrophilic porous material , or a porous material or a porous sintered material , for example . the exchange apparatus may comprise a structure 259 composed of a material penetrable with a needle to draw a sample from the receiver container . the structure 259 may comprise one or more materials suitable for penetration with a needle such as one or more of rubber or silicone elastomer , for example . the structure 259 may comprise the porous structure 256 , for example , and the material penetrable with the needle may comprise one or more of a fabric , a porous fabric , a semipermeable membrane , an air permeable material , a moisture vapor transfer waterproof fabric , a hydrophilic porous material , or a porous material or a porous sintered material , for example . fig8 b shows an embodiment of an implantable therapeutic device 100 comprising a lock and key mechanism 850 to place a therapeutic agent in the implantable device . the lock and key mechanism 350 comprises a lock 360 and a key 370 . the lock 360 can be located on the implantable device to inhibit access to the reservoir chamber of the implantable device . the exchange apparatus 200 comprises the key 370 to access the reservoir chamber to place the therapeutic agent 110 as described herein . the lock can be configured in many ways and may comprise one or more of a deflected channel , a curved channel , a helical channel , a serpentine channel , engagement structures , a magnet , a door , a movable door , a tumbler , a cylinder , pins or a shear line , for example . the key can be configured in many ways so as to correspond to the lock and may comprise one or more of a deflectable elongate structure , a curved elongate structure , a helical elongate structure , a serpentine elongate structure , engagement structures sized to engage engagement structures of the lock , for example . in many embodiments , the lock 360 inhibits access with a straight rigid needle , so as to inhibit placement of the therapeutic agent which may be ineffective or inappropriate when placed in the therapeutic device . for example , the exchange apparatus 200 can be delivered to the physician with a predetermined therapeutic agent formulation and key , and the implantable device has the lock configured to receive the key to place the therapeutic agent , such that access to the implantable device can be limited substantially . in many embodiments , the lock 360 comprises the deflected channel 364 , which may comprise one or more of a bent channel , a curved channel , a helical channel , or a serpentine channel , for example . the lock 360 may comprise a stiff substantially non - penetrable biocompatible material , for example one or more of rigid plastic , polymethylmethacrylate ( hereinafter “ pmma ”), polycarbonate , metal , or titanium , for example . the key 370 may comprise one or more of many components and structures of elongate structure 201 as described herein . the key 370 may comprise one or more of a deflectable key or a deflected key configured to extend along the deflected channel 364 to deliver the therapeutic fluid 260 and receive the implantable device fluid 262 . the lock comprises an engagement structure 362 to engage an engagement structure 372 of the key . the engagement structure 362 may comprise an inner surface of the channel 364 , and the outer surface of the deflectable key engages the inner surface of the channel so as to deflect the elongate structure 201 to advance along channel 364 . fig8 b 1 shows an embodiment of a deflectable elongate structure 201 in an unloaded configuration prior to insertion in the lock 360 of fig8 b . the elongate structure comprises an axis 202 , and the elongate structure may extend substantially along the axis 202 so as to provide column strength to the elongate structure 201 to penetrate the penetrable barrier 184 of access port 180 . the elongate structure 201 may comprise a resistance to deflection sufficiently low so as to advance along channel 364 and a column strength sufficient to penetrate tissue and the penetrable barrier . the deflectable elongate structure 201 can be deflected substantially away from axis 202 when advanced into the lock 360 . the lock 360 may comprise a rigidity sufficient to inhibit penetration with a straight needle , and the channel 364 can be extend internally with lock 360 . the key 370 comprising the elongate structure 201 can extend through tissue such as the conjunctiva and epithelium to reach the lock 360 , and the key can be configured to penetrate the tissue . the penetration of the tissue and penetrable barrier 184 inhibits contamination of the reservoir chamber as the barrier function of the conjunctiva 16 and tenon &# 39 ; s capsule 17 can be substantially maintained . the deflectable elongate structure 201 can be made of one or more of many components and may comprise sheath 280 and needle 270 . the needle and sheath can be configured to deflect together when advanced along channel 364 . the deflectable needle may comprise a metal , for example nitinol , and the sheath may comprise a polymer such as polyimide , for example . fig8 b 2 shows an embodiment of a deflected elongate structure 201 in an unloaded configuration prior to insertion in the lock of fig8 b . the key 370 comprising deflected elongate structure may comprise one or more of many materials providing a stiffness sufficient to retain the deflected shape in the unloaded configuration . in the unloaded configuration , the deflected elongate structure 201 of key 370 extends away from axis 202 . the deflected elongate structure 201 may comprise a preformed deflection profile corresponding to the path of channel 364 extending through the lock 360 from a first side of the lock toward the conjunctiva to a second side of the lock toward the reservoir chamber 140 . fig8 c 1 shows an embodiment of an implantable therapeutic device 100 comprising a lock 360 and an exchange apparatus 200 comprising a rotatable key 370 to the lock 360 . the exchange apparatus 200 can be advanced toward the implantable device 100 and rotated as shown with arrows 374 . the engagement structures 372 of the key couple to the engagement structures 362 of the lock , such that the lock 360 opens to allow access of the elongate structure 201 . the engagement structures may comprise one or more of many structures , for example magnets , teeth , or notches , and the engagement structures can be spaced apart at appropriate distances such that the engagement structures of the lock are keyed to the engagement structures of the key to allow access . for example the engagement structures 372 of the key may comprise magnets , and the engagement structure of the lock may comprise a magnetic material such that the key can be opened with the lock and the magnetic field extending through the conjunctiva 16 and the tenon &# 39 ; s capsule 17 , for example . alternatively , the conjunctiva and / or tenon &# 39 ; s capsule can be displaced and the engagement structures 372 of the key can contact the engagement structures 362 of the lock to allow access to the reservoir chamber . fig8 c 2 shows an embodiment of the implantable therapeutic device 100 of fig8 c 1 in a unlocked configuration in which the elongate structure 201 extends through the open lock and penetrable barrier 184 to access the reservoir chamber 140 of the implantable device 100 . the exchange apparatus can place the therapeutic fluid 260 in the implantable device 100 and receive the implantable device fluid 262 in the receiver container 250 as described herein . fig8 d 1 shows an embodiment of an implantable therapeutic device comprising 100 a slide lock 360 and exchange apparatus 200 comprising a slidable key to engage the slide lock . the exchange apparatus 200 can be advanced toward the implantable device 100 and slid as shown with arrows 374 . the engagement structures 372 of the key couple to the engagement structures 362 of the lock , such that the lock 360 opens to allow access of the elongate structure 201 . the engagement structures of the slide lock 360 and slide key 370 may comprise structures similar to the rotatable key and lock described with reference to fig8 c 1 . fig8 d 2 shows an embodiment of an implantable therapeutic device 100 in an unlocked configuration in which the elongate structure 201 extends through the open lock 360 and penetrable barrier 184 to access the reservoir chamber 140 of the implantable device . the exchange apparatus can place the therapeutic fluid 260 in the implantable device 100 and receive the implantable device fluid 262 in the receiver container 250 as described herein . fig8 e shows an embodiment of an implantable therapeutic device 100 comprising a lock 360 and the elongate structure 201 of the exchange apparatus 200 comprising the key 370 . the elongate structure 201 can be configured in many ways so as to comprise the key 370 . the engagement structures 372 of the key 370 can be located near a distal end 212 of the elongate structure 201 , for example . the engagement structures 272 can be affixed to the needle 270 and may comprise annular structures extending around the needle . alternatively or in combination , the sheath 280 of the elongate structure may comprise the engagement structures . for example , the one or more openings 289 of the sheath 280 can be sized and located so as to comprise the engagement structures 372 of the key 370 . the lock can be configured in many ways to receive the key , and the engagement structures 362 of the lock may comprise pins aligned to a shear plane 368 when the key is inserted , for example . fig9 shows a container 400 to receive and store the exchange apparatus 200 . the container 400 may comprise a barrier material 410 to inhibit evaporation from within the container to the outside environment , a cap 430 and a base supporting a soft penetrable material 420 . the cap 430 may comprise a protrusion such as an annular protrusion 432 to seal around an outer portion of the wall of the container . the cap 430 may comprise a retention structure to hold the injector apparatus , for example a second protrusion , such as an annular protrusion 434 to receive and hold the exchange apparatus 200 . the cap 430 may comprise a soft barrier material , such as an elastomer , for example . fig1 shows an exchange apparatus 200 having the implantable device fluid 262 comprising a fluid sample 264 within the receiver container 250 . the receiver container 250 can be coupled to the elongate structure 201 . the channel 254 can extend from the container to 250 to opening 258 . the receiver container 250 may comprise a combination of one or more of the therapeutic fluid 260 , the implantable device fluid 262 comprising sample fluid 264 . depending on the exchange apparatus and orientation , the implantable device fluid 262 comprising sample fluid 264 may comprise a substantial majority of the fluid of the receiver container 250 . fig1 shows the exchange apparatus 200 having the fluid sample 264 placed partially within the storage container 400 . the cap 430 is shown over but not yet covering the vent channel 254 extending from the receiver container 250 to the opening 258 . fig1 shows a cap 430 of the storage container placed over the outlet channel opening 258 of channel 254 coupled to the receiver container 250 of the exchange apparatus , so as to inhibit one or more of leakage or evaporation from container 250 . fig1 shows an elongate structure 201 of the exchange apparatus placed within a soft penetrable material 420 near the bottom of the storage container and the cap placed over the container so as to seal the exchange apparatus container . the soft penetrable material 420 may comprise a soft material capable of sealing , for example a soft elastomeric material such as silicone elastomer . fig1 shows an apparatus 500 to remove the sample fluid from the receiver container 250 of the exchange apparatus 200 . the apparatus 500 comprises a sample container 400 , a plug 520 , a syringe 540 to pressurize the receiver container 250 , and a coupling 530 to couple the syringe to the receiver container of the exchange apparatus 200 . the coupling 530 may comprise a receptacle 536 to receive the proximal end portion of the exchange apparatus 200 . the receptacle 536 may comprise a structure 532 to couple the syringe to the coupling , for example a luer connector , a luer - lok ™ connector , or other known connector , for example . the retention structure 532 to retain the exchange apparatus 200 and a contact structure 534 to contact the outer wall of the exchange apparatus and fluidly couple the syringe to the opening 528 when the exchange apparatus 200 is retained with the coupling 530 . the contact structure 534 may inhibit flow of injection fluid from syringe 540 , such as air , between the retention structure 532 and wall 252 of the exchange apparatus , for example with a seal between the retention structure 532 and the wall 252 of the exchange apparatus 200 . fig1 shows a cap 520 placed on the connector 290 to couple the syringe to the exchange apparatus , so as to inhibit fluidic flow from syringe 540 through the needle of the elongate structure 201 . fig1 shows the exchange apparatus placed within receptacle 536 of the coupling 530 so as to couple the receiver container 250 with the syringe 540 . the syringe 540 can pressurize the channel 254 so as to displace the implantable device fluid comprising the sample fluid 264 from the receiver container 250 into a sample container 400 for analysis . the annular protrusion 534 can engage the outer wall 252 of the exchange apparatus 200 form a seal and pressurize chamber 250 when the plunger of syringe 540 is depressed . the pressurization of chamber 250 urges the implantable device fluid 262 fig1 shows an exchange apparatus 200 coupled to a removable receiver container 250 . the removable container 250 may comprise a penetrable barrier , for example a septum . the exchange apparatus 200 can be coupled to a syringe 300 . the exchange apparatus can be coupled to a device 100 implanted in an eye with the elongate structure 201 configured to extend through the conjunctiva 16 and the penetrable barrier 184 . the exchange apparatus may comprise a first channel coupled to the plurality of openings to receive the fluid from the implantable device , and a second channel coupled to a vent . the first channel 239 may extend to a first needle 710 to puncture container 250 and the second channel may extend to a second needle 720 to puncture the container 250 . the first needle may have a first opening 712 , and the second needle may have a second opening 722 . the first opening can be located below the second opening , such that the second opening allows air to pass when liquid passes through the first opening . fig1 shows the exchange apparatus 200 coupled to the implanted device 100 so as to exchange fluid and receive sample fluid 264 from the implanted device . the container 250 can be coupled to the exchange apparatus during exchange . fig1 shows the exchange apparatus 200 removed from the implanted device 100 and the receiver container 250 detached from the exchange apparatus 200 . the sample fluid 264 from the implantable device can be contained within the container 250 . fig2 a shows components of a container 400 to remove a sample fluid 264 from exchange apparatus 200 . the container 400 may comprise a sealable container having a wall composed of a barrier material 410 to inhibit evaporation , a cap 430 and an annular protrusion 432 . a support 450 can be placed within container to receive and hold the exchange apparatus 200 within the container . the support 450 may comprise a piece of soft elastomeric tubing such as silicone tubing , for example . fig2 b shows an exchange apparatus 200 placed in the container 400 having components as in fig2 a . the exchange apparatus is placed such that the wall 252 of container 250 rests on the support 450 . the elongate structure 201 extends below the support 450 . the container 400 comprises an axis 400 a , which axis may be aligned with the axis of exchange apparatus 200 . the opening 258 coupled to container 250 with channel 254 is exposed to air . fig2 c and 20d show removal of implantable device fluid 262 comprising sample fluid 264 from exchange apparatus . the sample fluid 264 may be drawn into the container 400 with aspiration . a syringe 300 can be coupled to the exchange apparatus 200 with a connector 320 such as a locking connector , for example . the syringe 300 may comprise a piston 302 connected to a plunger 304 which allows the piston to be advanced and pulled back . the syringe 300 comprises a chamber 310 having a volume defined with the location of piston 302 . the piston of the syringe can be drawn outward to draw air from chamber 440 , which chamber draws sample fluid 264 into chamber 440 . fig2 shows a method 1800 of removal from an exchange apparatus with a removal container as in fig2 a to 20d . a step 1810 removes the exchange apparatus 200 from the syringe after injection of the therapeutic fluid . the implantable device fluid comprising the sample fluid is contained in the receiver container 250 . a step 1810 removes therapeutic fluid 260 from the needle of the elongate structure 201 with injection of a gas comprising air from a syringe 300 . a step 1830 places the exchange apparatus 200 on the support 450 of container 400 with the exchange apparatus coupled to syringe 300 . the support 450 coupled to exchange apparatus 200 may define a chamber 440 . the support 450 can be shaped to inhibit air flow between and outer surface of the exchange apparatus and an inner surface of the support 450 , for example with a seal formed between the outer surface of the exchange apparatus 200 and the inner surface of the support 450 . the support may comprise a soft material , such as a soft elastomeric material , for example . a step 1840 draws air from chamber 440 with syringe 300 through the injection needle of the elongate structure extending into chamber 440 . the implantable device fluid 262 comprising sample fluid 264 is displaced from the receiver container with air drawn into the receiver container 250 through opening 258 of channel 254 . the implantable device fluid 262 comprising sample fluid 264 falls to the lower end of chamber 440 and is contained on an inner surface of container 400 . a step 1850 removes the exchange apparatus 200 and syringe 300 from the sample container 400 . the cap 430 is placed on the container 400 , so as to inhibit evaporation of the implantable device fluid 260 comprising sample fluid 264 . fig2 shows an exchange apparatus 200 having a receiver container 250 comprising a penetrable barrier structure 259 on a side port to remove a sample from the receiver container with a needle and syringe . the syringe can draw implantable device fluid 262 comprising sample fluid 264 from the receiver container 250 through a needle 330 passing through the penetrable barrier structure 259 on the side port . fig2 a shows an exchange apparatus 200 having a receiver container 250 coupled to a sample container 400 and a syringe 300 to displace fluid from the receiver container 250 . the sample container 400 is placed over the plurality of openings 236 and a needle 330 of a syringe 300 extends into a chamber 440 the sample container . the syringe 300 can draw fluid from chamber 440 so as to displace fluid from the receiver container 250 . the channel 254 extends from container 250 to opening 258 . fluid drawn through needle 330 into syringe 300 urges the implantable device fluid 262 comprising sample fluid 264 through the one or more openings comprising the plurality of openings 236 , and air can move inward through opening 258 and along channel 254 to displace the implantable device fluid 262 comprising sample fluid 264 . the needle 270 extends through the sample container 400 such that the distal end of the needle extends beyond sample container 400 . the plurality of openings 236 may comprise a plurality of openings of sheath 280 . fig2 b shows the sample container 400 of fig2 a placed over the plurality of openings 236 of the exchange apparatus . the sample container 400 may comprise a first penetrable barrier comprising penetrable barrier material 420 and a second penetrable barrier comprising penetrable barrier material 420 . a first septum 422 can be located opposite a second septum 422 , for example . the elongate structure 201 can extend through the first penetrable barrier and the second penetrable barrier so as to position the one or more openings between the first penetrable barrier and the second penetrable barrier . the sample container 400 may comprise a wall composed of a barrier material 410 , and the wall may comprise an amount of rigidity sufficient to resist deflection when the sample is drawing with needle 330 . the wall may comprise an annular shape , for example a tubular geometry . the needle 270 may extend through the second penetrable barrier so as to inhibit fluidic coupling of the syringe 300 and needle 330 with the opening on the distal end of needle 270 . the sample container 400 can be shaped in many ways , for example with a spherical ball or other shape having a walls composed of penetrable barrier material 410 such that the needle tip can extend through both side of the container 400 . fig2 a and 24b show an exchange apparatus having a receiver container 250 coupled to a syringe 300 with a sample container 400 placed over openings 236 of the exchange apparatus 200 so as to remove a sample fluid 264 from the receiver container 250 . the sample container 400 comprises a chamber 440 enclosed with a wall comprising a barrier material 410 and a penetrable barrier material 420 , in which the penetrable barrier material may comprise a septum , for example . the wall of the container 400 may comprise one or more of many shapes such as annular , spherical , cubic , ellipsoidal or oval , for example . the elongate structure 201 comprising needle 270 and sheath 280 can be advanced into the container 400 so as to place at least one opening of the plurality of openings 236 within the chamber 440 and the distal needle tip comprising the opening to place therapeutic fluid within the chamber 440 . the needle can be coupled to syringe 300 , and fluid drawn from chamber 440 with syringe 300 through an opening in the distal tip of needle 270 . the fluid drawn through the needle 270 is replaced with the fluid passed through the plurality of openings 236 . the receiver container 250 comprising the implantable device fluid 262 comprising sample fluid 264 is fluidically coupled to the plurality of openings as described herein such that the implantable device fluid 262 comprising the therapeutic fluid 264 is passed through the plurality of openings . the channel 254 extends from the receiver container 250 to the opening 258 such that air may be drawn into the receiver container 250 to replace the volume of the displaced implantable device fluid 262 comprising sample fluid 264 . in many embodiments , the implantable device fluid 262 comprising the sample fluid 264 comprises a liquid comprising water as described herein . fig2 a shows an exchange apparatus 200 comprising a removable receiver container 250 comprising a removable sheath 280 placed over a needle 270 . the receiver container 250 may comprise the sample container 400 . the wall 252 of container 250 and needle 270 can be configured for removal and separation from the needle 270 so as to provide the sample container 400 . the sheath 280 may be supported on a distal end of the wall 252 of container 250 , such that the sheath 280 can be supported with the wall 252 of container 400 when removed . a plug 960 comprising penetrable barrier material 420 can be placed over the sheath 280 needle 270 prior to removal of the needle to inhibit leakage of the implantable device fluid 262 comprising sample fluid 264 . fig2 b shows the removable container 400 of fig2 a with a plug 960 comprising penetrable barrier material 420 placed over the sheath 280 and the needle 270 removed , such that the sheath 280 is supported with the container 400 . the implantable device fluid 262 comprising sample fluid 264 remain in the receiver container 250 comprising sample container 400 subsequent to removal of the needle 200 . fig2 c shows the removable container of fig2 a and 25b with plug 960 placed over the sheath 280 and a cap 430 over the removable receiver container . the cap 430 can inhibit one or more of evaporation or leakage of the implantable device fluid 262 comprising sample fluid 264 . fig2 a to 26e show a centrifuge used to remove the fluid sample from the receiver container of the exchange apparatus . fig2 a shows the exchange apparatus 200 comprising the receiver container 250 having the implantable device fluid 262 comprising the sample fluid 264 contained therein , in which the exchange apparatus is configured for placement within the sample container 400 . the sample container 400 may comprise a centrifuge tube having a support 450 as described herein . the exchange apparatus 200 may comprise a channel 254 extending from receiver container 450 to opening 258 , so as to couple the opening 258 to the plurality of openings 236 . as the implantable device fluid 262 comprising sample fluid 264 contained within receiver container 250 comprises a density greater than air , the fluid within the receiver container can be displaced through the plurality of openings 236 of the exchange apparatus 200 . air can pass through opening 258 and channel 254 into the receiver container 250 to replace the volume of implantable device fluid 262 comprising sample fluid 264 displaced from receiver container 250 and through the plurality of openings 236 . fig2 b shows the exchange apparatus 200 placed in the sample container 400 . fig2 c shows the exchange apparatus 200 in the sample container 400 configured for placement in a centrifuge 500 . fig2 d shows the exchange apparatus 200 in the sample container 400 placed in a centrifuge 500 . fig2 e shows the exchange apparatus 200 within the sample container 400 subjected to force within the centrifuge 500 , such that the force of the centrifuge 500 is sufficient to displace the implantable device fluid 262 comprising sample fluid 264 from the receiver container 400 through the plurality of openings 236 as described herein . the implantable device fluid 262 comprising sample fluid 264 is deposited on the lower end portion of an inner surface the sample container 400 . fig2 f shows an embodiment comprising exchange apparatus 200 placed in a sample container 400 comprising a centrifuge tube . the container 400 may comprise a barrier material 410 to inhibit evaporation from within the container to the outside environment , a cap 430 and a base supporting a soft penetrable material as described herein . the cap 430 may comprise a protrusion such as an annular protrusion 432 to seal around an outer portion of the wall of the container , for example . when the cap 430 is placed on the top of the tube , the chamber 440 can be sealed so as to inhibit evaporation , for example . the barrier 410 may comprise sufficient strength so as to inhibit penetration with the needle of the elongate structure 201 when placed in a centrifuge , for example . fig2 g shows an embodiment comprising an exchange apparatus 200 placed in a sample container 400 comprising a centrifuge tube , in which the centrifuge tube comprises a support 450 comprising an annular shoulder 450 s of the tube to engage and hold the exchange apparatus . the support 450 can engage the exchange apparatus 200 to support the exchange apparatus in a centrifuge , for example , with a gap extending between the lower surface of the tube and the distal tip of the needle of the exchange apparatus so as to inhibit penetration of the sample container with the needle . the container 400 may comprise additional structures as described herein . fig2 h shows an embodiment of an exchange apparatus 200 placed in a sample container 400 comprising a centrifuge tube , in which the centrifuge tube comprises a support 450 comprising restricted portion to hold the exchange apparatus . the support 450 may comprise a rib to engage the exchange apparatus 400 , for example . the rib 450 r can be formed with a recess in the outer surface of the container 400 . the support comprising the rib can engage and support the exchange apparatus such that a gap extends between the distal end of elongate structure 201 and the lower surface of the tube fig2 a shows an embodiment of a collapsible fluid separator 510 for use with a therapeutic device . the collapsible fluid separator 510 may comprise a plunger and can be penetrable with a needle and configured to form a seal around the outer perimeter . the fluid separator 510 may comprise a distal shape profile corresponding to the distal portion of the reservoir chamber so as to displace fluid from the distal portion near the porous structure 150 as described herein . the fluid separator 510 may be penetrated with a needle and may comprise a septum , for example . the penetrable fluid separator can be penetrated with a needle for fluid removal and refill . in many embodiments , the fluid separator 510 is configured to expand and contract so as to contact the inner wall of the reservoir chamber 140 and form a seal with wall of the reservoir chamber . the fluid separator 510 can be configured to expand and contract to maintain contact with a wall having a varying cross - sectional dimension such as a varying diameter . in many embodiments , the fluid separator 510 is configured to contract so as to decrease the volume of the fluid separator such that the volume of the reservoir chamber available to receiver therapeutic fluid 260 can be substantially maintained . fig2 b shows an embodiment of plunging structure 520 comprising an exchange needle 522 and an engagement structure comprising shoulder 524 suitable for use with the collapsible fluid separator as in fig2 a and a therapeutic device . the needle 522 comprises an internal channel to receiver fluid to remove the implantable device fluid and place the therapeutic fluid in the reservoir chamber . the plunging structure may comprise an engagement structure , for example shoulder 524 , so as to engage the collapsible separator and advance the fluid separator 510 distally toward the porous structure with a thrusting movement . fig2 c shows an embodiment of the collapsible fluid separator as in fig2 b placed within a reservoir chamber 140 of a therapeutic device 100 . the collapsible separator 510 is shown near the proximal end of the implantable therapeutic device 100 , which comprises the access port 180 and retention structure 120 . the access port 180 may comprise a penetrable barrier 184 capable of penetration with the needle of the plunging structure , or a removable structure such as a cap , plug or the like which can be removed to introduce the plunging structure . fig2 d shows an embodiment of the plunger 520 comprising the exchange needle and shoulder as in fig2 b advanced into the access port 180 of the therapeutic device having the collapsible fluid separator 510 placed within the reservoir chamber 140 of the therapeutic device as in fig2 c . fig2 e shows an embodiment of the plunging structure 520 and collapsible fluid separator 510 advanced within the reservoir chamber 140 of the therapeutic device as in fig2 d so as to displace the implantable device fluid 562 from the reservoir chamber through the needle . the collapsible fluid separator 510 has expanded from a first cross - sectional dimension across , for example a first diameter , to a second cross - sectional dimension across , for example a second cross - sectional diameter larger than the first . the expandable and collapsible fluid separator 510 can expand or collapse so as to contact the side wall of the reservoir chamber 140 and inhibit flow between a lower side and an upper side of the expandable and collapsible fluid separator 510 . the inhibited flow around the outer perimeter of the fluid separator can provide pressurization of the implantable device fluid near the tip of exchange needle 522 so as to drive implantable device fluid into the exchange needle . alternatively or in combination , suction can be applied to the exchange needle so as to draw implantable fluid from the exchange needle 522 and advance the separator 510 toward the porous structure 150 . in many embodiments , the porous structure 150 comprises a resistance to flow sufficient to inhibit flow of one or more of the implantable device fluid or the therapeutic fluid through the porous structure during the exchange as described herein . fig2 f shows an embodiment of the collapsible fluid separator 510 advanced within the reservoir chamber to a location near the distal end of the reservoir chamber so as to displace most of the implantable device fluid from the reservoir chamber through the needle 522 . the needle 522 may contact porous structure 150 , which may comprise a rigid porous structure as described herein . fig2 g shows an embodiment of the collapsible fluid separator 510 moved from the distal end of the reservoir chamber comprising porous structure 150 . the collapsible fluid separator 510 can be moved in one or more of many ways to place the therapeutic fluid in the distal portion of the reservoir container . the therapeutic fluid can be injected through the needle 522 , or another needle for example , so as to place the therapeutic fluid 260 in the distal portion of the container . alternatively or in combination , the expandable and collapsible fluid separator can be pulled toward the proximal end of the reservoir chamber so as to draw therapeutic device fluid through the needle and into the reservoir chamber from an external container of the exchange apparatus as described herein . fig2 h shows an embodiment of the collapsible fluid separator 510 moved from the distal end of the reservoir chamber to the proximal end of the reservoir chamber so as to fill substantially the reservoir chamber with therapeutic fluid 260 . the collapsible fluid separator 510 comprises a substantially decreased size and volume so as to fit substantially within the neck of the reservoir chamber such that a substantial amount of the volume of the reservoir is filled with therapeutic fluid 260 . fig2 i shows an embodiment of a substantially non - collapsible fluid separator 510 placed within the reservoir chamber 140 of therapeutic device 100 having a substantially fixed cross sectional size . the container 130 comprising reservoir chamber 140 may comprise a substantially cylindrical tubular barrier 160 . the fluid separator may comprise a piston slidable within the tubular barrier 160 , for example . fig2 a shows an embodiment of an exchange apparatus 550 comprising a balloon 560 supported on a elongate tubular member 580 capable of introduction into an implantable therapeutic device 100 as to exchange the implantable device fluid 262 with a therapeutic fluid 260 . the exchange apparatus 550 may comprise an elongate tubular structure 570 shaped to penetrate tissue , for example a needle . the elongate tubular structure 570 shaped to penetrate tissue can be advanced into access port 180 through penetrable barrier 184 , followed by balloon 560 and the distal end of elongate tubular member 580 , such that balloon 560 is placed in the reservoir chamber . the balloon 560 may comprise a highly compliant balloon . as the balloon 560 is inflated , implantable device fluid is displaced out of the reservoir chamber . the balloon 560 may comprise pebax ™ or another highly elastic material such as silicone , for example , or a non - elastic material capable of being one or more of folded , rolled or compressed , for example . the balloon 560 may comprise a tubular structure and supported on the outside diameter of the needle or a sheath over the needle prior to inflation . the balloon may be designed to inflate proximally to distally , e . g . top down , to contact the inner wall of the reservoir chamber and displace fluid toward the vent needle opening . the balloon may be inflated with therapeutic fluid 260 . the balloon may be retractable within a sheath , for example . a sheath may be provided to deliver the balloon through the penetrable barrier , for example with the sheath penetrating the penetrable barrier to protect and place the balloon in the reservoir chamber without substantial contact of the balloon to the penetrable barrier when the balloon is placed . the exchange apparatus 550 comprises components and structure to inflate balloon 560 and remove implantable device fluid 262 from the reservoir chamber 140 . the elongate tubular structure 570 shaped to penetrate tissue may comprise a channel 572 to fluidically couple the reservoir chamber 140 with an external container , for example . the elongate tubular member 580 may comprise a first lumen 582 and a second lumen 584 , for example . the elongate tubular member 580 can be connected to one or more containers , syringes , or pumps , for example . the elongate tubular member 580 may comprise a first connector 588 fluidically coupled to first lumen 582 , and a second connector 586 fluidically coupled to the second lumen 584 , for example . the first lumen 582 of the elongate tubular member 580 can fluidically couple to channel 572 and external connector 588 , for example , such that the implantable device fluid 262 can be received in a receiver container as described herein . the second lumen 584 can fluidically couple the connector 586 to balloon 560 , so as to allow inflation of the balloon , for example with a syringe . the connector 586 and the connector 588 may each comprise standard known connectors as described herein , for example . the exchange apparatus 550 may comprise one or more catheter components known to a person of ordinary skill in the art in the field of catheter design and suitable for combination in accordance with the teachings described herein , for example . fig2 b shows an embodiment of the balloon 260 as in fig2 a inflated within the therapeutic device to displace the implantable device fluid 262 . the balloon 560 may be inflated with the therapeutic fluid 260 as described herein , for example . the therapeutic fluid 260 , or another fluid , can be injected into the balloon with a syringe coupled to connector 586 such that the injected fluid travels along lumen 584 to inflate the balloon 560 . the implantable device fluid 262 can be displaced with the balloon so as to urge the implantable device fluid 262 into channel 572 of the elongate structure 260 shaped to penetrate tissue . the porous structure 150 may comprise a substantial resistance to flow to inhibit flow of implantable device fluid 262 through the porous structure . fig2 c shows an embodiment of the balloon 560 deflated within the therapeutic device 100 to provide space for the therapeutic fluid 260 . in many embodiments , the receiver container as described herein , for example a bag , can be disconnected from connector 588 , and a syringe comprising therapeutic fluid 560 coupled to connector 580 . the syringe or other fluid source used to fill balloon 560 can be decoupled from lumen 582 , and the therapeutic fluid 560 can be injected into elongate structure 570 to place therapeutic fluid 260 in reservoir chamber 140 such that the fluid within balloon 560 is displaced and the size of balloon 560 decreased . when the size of balloon 560 has decreased sufficiently , the balloon 560 and elongate structure 570 can be removed from the implantable device 100 by passing through the penetrable barrier 184 . the balloon 560 and elongate structure 570 can be removed in many ways , for example by one or more of pulling on elongate tubular member 580 or injecting therapeutic fluid 560 into reservoir chamber 140 , so as to displace balloon 560 and elongate structure 570 from the reservoir chamber 140 . in many embodiments , reservoir chamber 140 can be pressurized with injection of therapeutic fluid 260 so as to displace the balloon 560 and elongate structure 570 through the penetrable barrier 184 with pressure . fig2 d shows an embodiment of the balloon 560 punctured within the therapeutic device 100 so as to release the therapeutic fluid 260 from the balloon to the reservoir chamber 140 of the therapeutic device 100 . the therapeutic 100 may comprise internal structures 590 to puncture the balloon and release the therapeutic agent . the internal structure 290 may comprise a sharp tip , for example a needle tip to penetrate the balloon 560 and release the therapeutic agent . the internal structure 590 can be supported on the wall of the reservoir chamber , for example . fig2 a shows an embodiment of a deflectable fluid separator 600 placed within an implantable therapeutic device 100 . the deflectable fluid separator 600 inhibits mixing of the implantable device fluid 262 with the therapeutic fluid 260 . the deflectable fluid separator 600 can separate portions of the reservoir chamber so as to define a first portion 141 on a first side of the chamber and a second portion 143 on a second side of the reservoir chamber . the first portion 141 of the reservoir chamber 140 may be coupled to a first porous structure 151 to provide sustained release from the first portion and the second portion 143 of the reservoir chamber 140 may be coupled to a second porous structure 153 to provide sustained release from the second portion . the porous structures can be substantially similar to porous structure 150 as described herein . the deflectable fluid separator 600 may comprise a barrier material to inhibit flow of the therapeutic agent , and may comprise one or more of a bladder , diaphragm , a membrane , or a sheet of distensible material , for example . the deflectable fluid separator may comprise an expandable bladder capable of deflection to either side of the reservoir chamber , for example . the deflectable fluid separator may be used with exchange apparatus 200 as described herein . the elongate structure 201 of the exchange apparatus may comprise a bi - needle design as described herein , for example with a first needle to advance fluid into a first side of the bladder and a second needle to receiver fluid from a second side of the bladder , in no particular order , or simultaneously , for example . fig2 b shows an embodiment of the deflectable fluid separator as in fig2 a displaced to the second side of the reservoir chamber to remove fluid from the second portion 143 of the reservoir chamber . the removal of fluid from portion 143 can be achieved in many ways . for example , the deflectable fluid separator can be displaced with injection into first portion 141 so as to displace implantable device fluid 262 from second portion 143 . a first needle 611 and a second needle 613 can be advanced so as to extend through penetrable barrier 184 into first portion 141 and into second portion 143 , respectively . the first needle can inject fluid into first portion 141 to displace fluid from second portion 143 . alternatively or in combination , the second needle 613 can be aspirated to draw fluid from second portion 143 with suction , and a fluid may be drawn into first portion 141 through first needle 611 . fig2 c shows an embodiment of the deflectable fluid separator 600 as in fig2 b displaced to the first side of the reservoir chamber with a therapeutic fluid 260 placed in the second portion 143 of the reservoir chamber 140 . the therapeutic agent 110 contained within second portion 143 can be released through porous structure 153 in a manner similar to porous structure 150 as described herein . when a sufficient amount of therapeutic agent has been released from second chamber 143 for an extended time through porous structure 153 , the fluid can be removed from second portion 143 as described herein and a second amount of therapeutic fluid 260 placed in first portion 141 for sustained release for another extended time through porous structure 151 . the removal and placement of fluid with the deflectable separator can be repeated as many times as is helpful to treat the patient . fig3 a shows an embodiment of an exchange apparatus 200 comprising a valve 700 to direct flow toward a second receiver container 704 when a sample 264 of the implantable device fluid 262 has been placed in a first receiver container 702 . the valve 700 can inhibit mixing of the implantable device fluid 262 with the therapeutic fluid 260 , such that sample fluid 264 may comprise no substantially amount of therapeutic fluid 260 . the sample fluid 264 can be removed used for one or more assays as described herein . the valve 700 may comprise one or more of a porous structure , a float valve , an annular float valve , a ball float valve , a flap valve , a flap valve with a float , a duckbill valve , or a stopcock . the valve 700 may comprise a manual valve , or may comprise one or more structures to automatically close or open when a sufficient amount of fluid has been placed in the first receiver container . the receiver container 250 may comprise the first receiver container 702 and the second receiver container 704 . the exchange apparatus 200 may comprise one or more of the elongate structure 201 , needle 270 , sheath 280 , receiver container 250 , at least one opening 258 , connector 290 , syringe 300 , piston 302 , plunger 304 , chamber 310 , or connector 320 as described herein , for example . the valve 700 may be configured in many ways to provide sample 264 of implantable device fluid 262 . with elongate structure 301 introduced into therapeutic device 100 , an initial amount of implantable device fluid 262 can be placed in first receiver container 702 with valve 700 comprising a first configuration . the first configuration of valve 700 can fluidically couple one or more openings 236 of elongate structure 201 with the first receiver container 702 and inhibit fluidic coupling of the one or more openings of elongate structure 201 with second receiver container 702 . when a sufficient amount of implantable device fluid 262 has been placed in the first receiver container 702 , the configuration valve 700 can change from the first configuration to the second configuration . the second configuration of valve 700 can fluidically couple the one or more openings 236 with the second receiver container 704 and inhibit flow to the first receiver container 702 , such that a majority of the therapeutic fluid 260 mixed with implantable device fluid 262 is placed in second receiver container 704 . the valve 700 may comprise a manual valve 710 operable by a user , and may comprise one or more of many valves known to a person of ordinary skill in the art , for example a stopcock or other manual or automatic valve , for example . the sample 264 within first container 702 can be removed for analysis with one or more of many methods or structures as described herein . fig3 b shows an embodiment of an exchange apparatus 200 having a valve 700 comprising a porous structure 720 to direct flow toward a second receiver container 704 when sample 264 of the implantable device fluid 262 has been placed in first receiver container 702 . the valve 720 may comprise a substantially dry porous structure in an initial open configuration and a gas such as air can be situated within first receiver container 702 . implantable device fluid 262 accumulates in the first receiver container 702 and rises inside the first container 702 from a distal end near the elongate structure to a proximal end of the first container . when a sufficient amount of implantable device fluid 262 is placed on first container 702 , the valve 720 contacts the implantable device fluid 262 comprising liquid and the resistance to flow of the valve 720 increases substantially . the wetted valve 720 comprises a substantially closed configuration such that the implantable device fluid 262 passes through a flow resistance structure 722 . the flow resistance structure 722 comprises a resistance to flow when wet that is greater than the resistance to flow of valve 720 in the dry configuration and substantially less than the resistance to flow of valve 720 in the wet configuration , such that the dry valve 720 corresponds to a substantially open configuration and the wet valve 720 corresponds to a substantially closed configuration . the valve 720 and the flow resistance structure 722 may each comprise a porous structure similar to the porous structure for sustained release of the therapeutic agent as described herein , for example . the valve 720 and flow resistance structure 722 can be configured in many ways to provide sample 264 of implantable device fluid 262 with no substantial portion of therapeutic fluid 260 . the relative resistance to flow of the porous structure 720 when we can be substantially greater than the resistance to flow of the resistance structure 722 when wet , for example at least about twice , and in many embodiments at least about five times the resistance to flow of the flow resistance structure . the flow resistance structure 722 may comprise a valve that opens under pressure such as a duckbill valve or flap with a spring , for example . a baffle 728 , a channel , or other internal structure can be provided to inhibit mixing of the therapeutic fluid 260 and implantable device fluid 262 with the sample fluid 264 when valve 720 is wet and comprises the closed configuration . fig3 c shows an embodiment of an exchange apparatus 200 in which valve 700 comprises a float valve 730 . the float valve 730 comprises a float ball 732 to direct flow toward a second receiver container 704 when a sample 264 of the implantable device fluid 262 has been placed in a first receiver container 702 . the valve 732 can slide along first container 702 . a valve 736 such as a flap valve or duckbill valve , for example , can be provided to provide a resistance to flow and drive fluid into the first receiver container 702 . when the implantable device fluid 262 advances into container 702 , float ball 732 rises in the first container 702 until the float ball contacts a seat 734 and inhibits flow into the first container . when float ball 732 contacts seat 734 additional flow into first container 702 is inhibited and valve 736 opens to allow implantable device fluid 262 into the second receiver container 704 . the received implantable device fluid 262 mixed with therapeutic fluid 260 may displace a gas such as air through opening 258 . a flow resistance structure 738 such as a second duck bill valve or baffle can be provided near the opening to the first container to inhibit mixing of sample 264 of the first receiver container 702 , for example . fig3 d shows an embodiment of an exchange apparatus 200 having a valve 700 comprising a float valve 740 . the float valve 740 comprises a sliding annular structure 744 to direct flow toward a second receiver container 704 when a sample 264 of the implantable device fluid 262 has been placed in first receiver container 702 . the sliding annular structure 744 may comprise an annular float ring 742 coupled to a tube having an opening 745 to pass fluid when the valve 740 is open . the sheath 280 can extend over needle 270 upward from the first receiver container 702 to the second receiver container 704 . the sheath 280 may comprise one or more openings 236 to pass the implantable device fluid 262 into the first receiver container 702 through opening 745 . as the first receiver container 702 receives implantable device fluid 262 , valve 740 rises and slides axially along sheath 280 such that a portion 747 of annular structure 744 slides over one or more openings 236 to inhibit flow to the first receiver container 702 . in the closed configuration , valve 740 directs flow of the implantable device fluid 262 and therapeutic fluid 260 into second receiver container 704 through holes 748 in sheath 280 . the exchange apparatus may comprise connector 290 to couple to a syringe as described herein . fig3 e shows an embodiment of an exchange apparatus 200 in which valve 700 comprises a float valve 750 to direct flow toward a second receiver container when a sample of the implantable device fluid has been placed in a first receiver container . float valve 750 comprises a flap 752 . the flap 750 allows sample fluid 262 to enter the first receiver container 702 through openings 757 of sheath 280 , and when a sufficient amount of sample fluid has been received with sample container 702 , float valve 750 closes to inhibit flow through openings 757 . the implantable device fluid 262 is passed through opening 758 into second receiver container 704 when the float valve 750 is closed . fig3 a 1 shows an embodiment of an exchange apparatus 200 having a receiver container 250 comprising a fluid separator 800 comprising an internal channel 822 sized to support the implantable device fluid 262 with a pocket of air . the fluid separator 800 may comprise a tubular structure 820 , for example a column , having an internal dimension such as a diameter sized to support the implantable device fluid with an immiscible separator fluid . the immiscible separator fluid may comprise one or more of an oil , a hydrophobic liquid , a gas , or air , for example . the exchange apparatus may comprise one or more of many structures as described herein such as connectors to couple to a syringe and an elongate structure comprising a sheath and needle . the internal channel 822 of fluid separator 800 can be fluidly coupled to openings 236 to receive implantable device fluid 262 as described herein . the fluid received from the implantable device can be received in receiver container so as to separate the implantable device fluid 262 from the therapeutic fluid 260 . the internal channel 822 may initially comprise a gas such as air which can be displaced through opening 258 of receiver container 250 . while the exchange apparatus can be used in many ways with an immiscible separator fluid such as a gas comprising air , in many embodiments the therapeutic fluid 260 is first drawn into a syringe 300 , and then the immiscible separator fluid such as air drawn into syringe 300 . the syringe 300 can be coupled to the exchange apparatus 200 with the therapeutic fluid supported with the immiscible separator fluid such as air within the container , for example . in many embodiments , the barrel of the syringe comprises an inner diameter sized such that the therapeutic fluid 260 can remain free standing within the barrel of the syringe and may be supported with air , such that the air can be injected into the implantable device before the air is injected . the implantable device may comprise a maximum cross - sectional dimension , for example a maximum diameter , such the implantable device fluid can be supported and displaced with the immiscible separator fluid 810 placed in the lower portion of the reservoir chamber 140 near porous structure 150 . injection of the immiscible separator fluid 810 displaces implantable device fluid 262 through one or more openings 236 of sheath 280 and upward into channel 822 . when a substantial portion of the implantable device fluid has been displaced from the reservoir chamber , for example with air , the therapeutic fluid 260 can enter the reservoir chamber such that the implantable device fluid 262 remains substantially separated from the therapeutic fluid 260 introduced into the reservoir chamber 140 . the separator fluid 810 may comprise a miscible separator fluid , for example saline or other liquid capable of mixing with the therapeutic fluid 260 and the implantable device fluid 262 , and the separator fluid 810 may comprise a sufficient volume so as to inhibit mixing of the therapeutic fluid 260 with the implantable device fluid 262 . in many embodiments , the separator fluid 810 comprises a fluid not miscible with the therapeutic fluid 260 and implantable device fluid 262 , each of which may comprise substantial amounts of water . the immiscible separator fluid 810 can inhibit mixing of the implantable device fluid 262 and the therapeutic fluid 260 with the separator fluid 810 , such that the separator fluid 810 may comprise a barrier and inhibit mixing of the components of the implantable device fluid 262 with components of the therapeutic fluid 260 . fig3 a 2 shows an embodiment of the exchange apparatus 200 of fig3 a 1 having the implantable device fluid 262 supported with a pocket of immiscible separator fluid 810 such as air 812 , so as to separate the implantable device fluid 262 from the therapeutic fluid 260 . an interface 818 extends between the immiscible separator fluid 810 and the implantable device fluid 262 . an interface 814 extends between the immiscible separator fluid 810 and the therapeutic fluid 260 . in many embodiments , immiscible separator fluid 810 comprises a gas , and implantable device fluid 262 and therapeutic fluid 260 each comprise liquid such that interface 814 comprises a meniscus and interface 818 comprise a meniscus . fig3 b 1 shows an embodiment of an exchange apparatus 200 having a fluid separator 800 comprising an internal channel having a first portion 852 sized to support the implantable device fluid with a pocket of an immiscible separator fluid air and a second portion 854 sized to pass an immiscible separator fluid such as air through the implantable device fluid . the first portion may comprise a volume approximating the volume of the reservoir chamber , for example . the exchange apparatus may comprise one or more of the structures of the exchange apparatus 200 as described herein , for example receiver container 200 and container wall 252 may have dimensions so as to define the first portion 852 and the second portion 854 . fig3 b 2 shows an embodiment of the exchange apparatus of fig3 b 1 having the first portion 852 supporting the implantable device fluid 262 with the immiscible separator fluid 810 such as air 812 . the tip 212 of needle 270 may extend to the distal end of the reservoir chamber 140 such that the bubble forms at the distal end of the reservoir to increase exchange efficiency , for example . the reservoir chamber 140 and the first portion 852 may comprise immiscible separator fluid 810 such as air 812 . fig3 b 3 shows an embodiment of the exchange apparatus of fig3 b 1 and 31 b 2 having the first portion 852 supporting the implantable device fluid 262 with the pocket of immiscible separator fluid 810 and therapeutic fluid 260 , and the second portion containing the implantable device fluid . as additional gas such as air moves upward from the first portion 852 to the second portion 854 , the immiscible separator fluid comprising a gas such as air forms bubbles in second portion 854 having the increased inner dimensions and the bubble can travel upward to escape through opening 258 . the first portion 852 and the second portion 854 may each comprise an annular channel having an inner dimension determined by the outside diameter of needle 270 , for example . the increased outer dimension of the annular channel of the second portion 854 allows bubbles to form in the implantable device fluid 262 contained in the second portion such that the bubbles can rise and escape through valve 258 . fig3 c shows an embodiment of exchange apparatus 200 coupled to a syringe 300 comprising a separator structure 860 to inject a separation fluid 810 and a therapeutic fluid into therapeutic device 100 to collect a sample 264 of implantable device fluid 262 . the separator structure 860 may comprise one or more of a piston 862 , a plunger , a disk or a plug having one or more holes 862 . the holes 864 may comprise a sufficient resistance to flow such that the piston 864 moves downward toward the elongate structure 201 when the piston 302 is advanced . the piston 864 can displace the immiscible separator fluid 810 comprising air , such that the immiscible separator fluid 810 is displaced into reservoir chamber 140 and forms an interfacial boundary 816 . the interfacial boundary 816 moves toward sheath 280 as the implantable device fluid is displaced with the immiscible separator fluid 810 . when the piston 810 has advanced a sufficient distance , movement of piston 864 along the cylinder barrel is inhibited , and the therapeutic fluid 260 is displaced through the one or more holes 862 with piston 302 . the displaced therapeutic fluid 260 is placed in reservoir chamber 140 , for example with injection through needle 270 . the immiscible separator fluid 810 is displaced with therapeutic fluid 260 such that the immiscible separator fluid 810 enters receiver container 250 . in many embodiments the receiver container 250 comprises a volume that is at least the volume of the injected material comprising therapeutic fluid 260 and immiscible separator fluid 810 , such that the volume of the receiver container 250 is sufficient to retain the implantable device fluid 262 and the immiscible separator fluid 810 . the volume of immiscible separator fluid 810 injected with the therapeutic fluid can be less than , approximately the same as , or greater than the volume of the therapeutic agent injected . in many embodiments , the immiscible separator fluid 810 comprises a volume sufficient to separate the therapeutic fluid from the implantable device fluid and which is substantially less than the volume of the reservoir chamber . for example , the amount of immiscible separator fluid 810 may comprise a volume that is sufficient to form a bubble within the reservoir chamber 140 and that is substantially less than the volume of the volume of reservoir chamber 140 . the receiver container 250 can be configured in many ways to receive the implantable device fluid 262 and the immiscible separator fluid 810 . for example , the receiver container 250 may comprise the inside dimension sufficient to support the implantable device fluid with the immiscible separator fluid along a majority of the length of the receiver container 250 . alternatively , the first portion 852 of the receiver container may comprise the inside dimension sufficient to support the implantable device fluid 262 and the second portion 854 of the receiver container may comprise the inside dimension sufficiently large so as to pass the immiscible separator fluid 810 through the implantable device fluid . a person or ordinary skill in the art can determine the internal dimensions of the first portion and the second portion based on the teachings of the present disclosure . fig3 shows an embodiment of an exchange apparatus coupled to syringe 300 to draw therapeutic fluid into the implantable device from the container 250 . the implantable device fluid 262 can be drawn from the reservoir chamber in one or more of many ways , for example with syringe so to provide aspirating suction of the implantable device fluid from the implantable device into the syringe . as the needle 272 extends through penetrable barrier 184 so as to provide a seal and the porous structure 150 comprises a resistance to flow of components of the eye , the movement of the implantable device fluid 262 into the chamber of syringe 300 results in therapeutic fluid 260 moving from chamber 250 through the one or more openings 289 in sheath 280 . air at approximately atmospheric pressure can move into container 250 to urge and displace the therapeutic fluid 260 into the reservoir chamber when the implantable device fluid 262 is drawn with the syringe . fig3 shows an embodiment of a curved needle 270 of an exchange apparatus to direct therapeutic fluid 260 toward a wall 260 of a container 230 of the reservoir chamber 240 . the curved needle can be placed near the porous structure 150 and may result in a reproducible flow pattern of the therapeutic fluid 260 placed in the container . the reproducible flow pattern provided by the curved needle 270 can provide a consistent flow pattern over porous structure 150 and may provide a more uniform amount of bolus through porous structure 150 . fig3 shows an embodiment of a covering 870 on a porous structure of a therapeutic device to inhibit bolus release when the therapeutic fluid is introduced . the covering 870 can inhibit bolus release when the needle is oriented toward the porous structure 150 and the covering 870 , for example . fig3 shows an embodiment of a first exchange apparatus 200 a coupled to a double barrel syringe 300 to exchange a first exchange fluid 900 with the implantable device fluid 262 , and a second exchange apparatus 200 b to exchange the first exchange fluid placed in the therapeutic device with therapeutic fluid 260 . the first exchange fluid 900 may comprise the separator fluid 810 as described herein . the first exchange fluid 900 may comprise water , for example phosphate buffered saline ( hereinafter “ pbs ”). alternatively , the first exchange fluid may comprise an immiscible separator fluid as described herein . the first exchange apparatus 200 a and the second exchange apparatus 200 b may each comprise many of the structures of exchange apparatus 200 as described herein . for example , the first exchange apparatus 200 a and the second exchange apparatus 200 b may each comprise the elongate structure 201 and receiver container 250 as described herein . the double barrel syringe 300 may comprise the therapeutic fluid and the first exchange fluid 900 . the double barrel syringe 300 may comprise a first chamber 910 containing the first exchange fluid 900 and a second chamber 920 containing the therapeutic fluid 260 . the first chamber 910 may be coupled to a first piston 912 and plunger 914 having a first length . the second chamber 920 may be coupled to a second piston 922 and plunger 924 having a second length . the first length can be longer than the second length to that the contents of the first chamber are injected before the second chamber . the first exchange apparatus 200 a can be connected to the syringe 300 and the elongate structure 201 inserted into the implantable device as described herein , and the first plunger advanced so as to displaced the implantable device fluid 262 from the reservoir chamber 140 with the first exchange fluid 900 . the first exchange apparatus 200 a can be removed from therapeutic device implanted in the eye . the first exchange apparatus 200 a can be disconnected from the syringe 300 , and the second exchange apparatus 200 b connected to the syringe 300 and advanced into the therapeutic device 100 . the second plunger 924 can be advanced to displace the first exchange fluid 900 from the reservoir chamber 140 of the implantable device with the therapeutic fluid 260 as described herein . in many embodiments , one or more of the components of the first exchange apparatus 200 a and the second exchange apparatus 200 b can be combined for use with the double barrel syringe so that the first exchange fluid and the therapeutic fluid can each be exchanged sequentially when the exchange apparatus 200 is placed in the implantable device and without removing the exchange apparatus from the implanted device . for example , the exchange apparatus 200 may comprise the first receiver 702 container to receive the implantable device fluid and the second receiver container 704 as described herein to receive the first exchange fluid , and the first receiver container and the second receiver container can be coupled to one or more valves as described herein such that the implantable device fluid 262 is directed to the first receiver container when the valve comprises a first configuration and the first exchange fluid is directed to the second receiver container when the valve comprises a second configuration as described herein . fig3 shows an experimental test apparatus . the test apparatus comprised an injector coupled to a bi - needle exchange apparatus 200 to inject a therapeutic fluid comprising a therapeutic agent into a test implantable device 100 . the therapeutic fluid comprised a 100 mg / ml formulation of ranibizumab prepared in accordance with u . s . pat . pub . no . 2010 / 0015157 , entitled “ antibody formulations ”, the full disclosure of which is incorporated by reference . the injected formulation comprised a density at least about 1 % greater than the fluid of the implantable device , which comprised saline . the therapeutic fluid was injected through the penetrable barrier comprising a septum of silicone elastomer . the injector needle was approximately 33 gauge and coupled to a syringe and positioned below the receiver needle . the receiver needle received liquid from the implantable device and extended upward to a receiver container . axis of the injector needle 202 and the axis of the implantable device 100 a were oriented to obtain samples . the reservoir chamber of the implantable device comprised about 25 μl , and about 50 μl were injected . the orientation of the axes varied from 0 degrees ( horizontal ) 45 degrees away from horizontal . at the − 45 degree orientation the penetrable barrier was located above the reservoir chamber and the opening to the receiver needle located above the opening to the injector needle . fig3 shows experimental results obtained with the test apparatus of fig3 . the refill efficiency corresponded to the amount of therapeutic fluid placed in the reservoir chamber of the implantable device when the 50 ul had been injected . for 0 degrees , the efficiency was about 80 %. the efficiency increased with the angle to about 95 % at − 45 degrees . table 2 shows device angles and fill efficiencies corresponding to the values in the graph of fig3 . a concentric needle device was also tested and provided similar results . pressure studies have been conducted with the injector apparatus having the plurality of openings . the sheath comprised polyimide placed over a 33 gauge needle . a first pressure gauge was coupled to a syringe on the input side of the needle , and a second pressure gauge was coupled to the implantable device reservoir chamber where the porous structure is shown above . the input pressure to the syringe of 12 n produced a pressure of 85 pounds per square inch ( hereinafter “ psi ”) into the needle and implantable device chamber had a pressure of about 45 psi . this amount of input pressure corresponds to a clinically acceptable exchange time of about 5 seconds , for example . additional experiments can be conducted by a person of ordinary skill in the art based on the teachings described herein , for example experiments with an exchange apparatus comprising a polyimide sheath comprising a plurality of openings over a needle as described herein . additional experiments can be conducted with one or more of many release control mechanisms to determine the resistance to flow of the release control mechanism suitable for use in accordance with embodiments described herein . for example , studies can be conducted with porous structures of varying dimensions , release rates , and manufacturing processes , in order to measure the flow through the frits with pressure so as to determine the resistance to flow . while the exemplary embodiments have been described in some detail , by way of example and for clarity of understanding , those of skill in the art will recognize that a variety of modifications , adaptations , and changes may be employed .	0
the servosystem for controlling and adjusting the voltage is comprised of the following main elements , in accordance with the block diagram of fig1 . this circuit picks up the alternating current voltage at the output of the brushes of the variable autotransformer , converts it to direct current voltage at a maximum level of 10 volts and uses it as a feedback in the first closed voltage loop of the system . it consists of three single - phase transformers ( t36 , t38 , t39 ), the primaries being y - connected and the terminals φ1 , φ2 and φ3 being connected to the brushes of the variable autotransformer . one of the two secondary windings of each transformer is y - connected and the other is delta - connected . these six outputs are connected to a twelve - phase rectifier , formed of the diodes cr26 to cr74 , which are graetz bridge connected , hexaphase individually and serially between both , to obtain a 12 - phase voltage looping whose main purpose is that of attenuating this looping with the least time constant . the output of the assembly of both rectifiers is added to the suitable ratio of transformation of both secondaries (√ 3 ) to obtain the same looping level and voltage in the two hexaphase rectifications . the variable resistor r75 permits voltage level shifts of both secondaries to be adjusted , which can be due to flaws in the manufacture of the secondary windings . the diode cr82 is used to attenuate the voltage shifts produced by the variation in temperature of the diodes of the twelve - phase rectifier . the time constant defined by the resistor r75 ( 500 ω ) and the capacitor c81 ( 0 . 33 μf ) is approximately of 0 . 2 milliseconds ; the main object of this filter being that of minimizing the high frequency noise . the filter r87 ( 204 kω ) and c79 ( 2 μf ), on the other hand , having a time constant of 5 milliseconds , has the object of attenuating the looping , the delay caused by this filter in minimal and represents 0 . 6 % of the total acceleration time . this circuit compares the demand signal ( point a ) with the feedback signal of the voltage loop and a signal is obtained at the output , which is the error or the difference between the two signals . this circuit is illustrated in fig2 . the demand of volts at the output , at the terminal of the resistor r57 ( point a ) and the feedback signal of the voltage loop is applied to the resistor r59 . at the same time , this signal is applied across the operational amplifier ic 56 to obtain a signal ( point b ) which can be compared with the demand signal ( point a ) to verify if the variable autotransformer has been correctly positioned within the permitted tolerance margin . the function of this circuit is to amplify the error signal of the preceding step , to produce a phase lead of the signal to compensate for the delay produced by the movement of the motor and the other mechanical operations and electric filters . this circuit is illustrated in figure 2 . the phase lead and dynamic compensation of the error takes place in conjunction with the second and third amplifiers a 2 and δ3 ; it is comprised of the resistor r54 ( 150 kω ) in parallel with the capacitor c47 ( 0 . 47 μf ) which are together in series with the resistor r51 ( 51 kω ), as a result of the practical optimization in conjunction with a stability analysis of the system . the dynamic compensation of the error circuit 3 in signals having a wide amplitude is improved by using the diodes cr64 - cr65 , whose object is to reduce the gain of the system for voltage error signals having a high value and to increase the gain in error signals having a small magnitude , particularly to improve the response to braking . point c of this circuit serves as a demand in the second closed current loop . fig3 illustrates this circuit which is comprised of the shunt r33 and r35 , consisting of two parallel resistors of 0 . 2ω each , which are anti - inductive and serially arranged with the motor m , and the feedback resistor r7 which acts on the current error amplifier . this compares the amplified and corrected voltage error signal with the current feedback signal of the motor , so that the current error signal acts on the power amplifier . the error amplifier a4 is likewise protected against excess currents and short - circuits by means of two resistors r23 - r25 ( 0 . 8ω ) which limit the intensity thereof at a permissible value , under any condition of saturation or damage of the transistors q80 - q32 . this is formed of the transistors q80 - q32 , class a configuration , which feed the direct current motor in both directions depending on the polarity of the error signal of the voltage loop . see fig3 . the system is protected against dynamic excess currents and short - circuits by the following protections : a current loop which acts , limiting the current . the absence of phase delays permits a very rapid response to speed which prevents the transistors of the power amplifier q80 - q32 from by - passing their safe operating area . the system for controlling and adjusting the voltage operates on a direct current motor ( m ) which is supplied with positive and negative voltages , depending on the direction thereof and the sequence of braking thereof . s1 and s2 are two switches limiting the left and right movement , serially arranged with the motor and which act by interrupting the current , when the brushes have by passed said limits . this is the instrument by means of which the desired variable voltage is obtained from a fixed network voltage . the assembly is formed ( in three - phase systems ) of three toroidal autotransformers whose outputs , through brushes which move along the toroidal disc , are mechanically fixed to a shaft which is directly joined to the shaft of the direct current motor . when the motor turns in any direction , the brushes turn therewith , obtaining at the output the desired voltage . the output of the variable autotransformer is applied to the primary of the high - voltage transformer with the purpose of transforming this low alternating current voltage to high voltage , and to be applied to the x - ray tube between the cathode and the anode . the transformation ratio between the coils of the primary winding and the secondary proportions the desired high voltage level . fig5 a , 6b , and 6c illustrate the results obtained with a servosystem for controlling the voltage in an x - ray generator . during the accelerating process of the motor ( see fig5 ) the error signal of the servo voltage reaches , at the beginning , saturation levels until the counterlectromotive force of the motor increases and the current is reduced . this gradual reduction of the current and , therefore , of the torque of the motor is produced while the error signal of the voltage loop is attenuated , since the servomotor approaches its demand equilibrium position . according to fig5 the input voltage to the motor ( a ) is of 10 volts / division and 0 . 1 seconds / division . the current ( b ) is of 2 amps / division . at the moment whereat the voltage error signal inverts its polarity in a very small value , due to the inertia of movement , the intensity demand signal is inverted , the power amplifier triggers the complementary transistors and the intensity changes direction , wherefore the electromagnetic torque has a higher gradient since the voltage applied and the counterelectromotive force have the same polarity . the intensity becomes zero and the motor is stopped in a damping oscillation about the equilibrium point , as can be seen for different demands in fig6 a to 6c . these three figures correspond to a change in demand from 50 kvp ( peak kilovoltage ) to 75 , 100 and 150 kvp respectively . amplitude of the current : 2 amps / division and time : 0 . 2 seconds / division . appendix 1 . calculation of the transfer function of a direct current motor fed by a voltage control or current injection a direct current motor , considered from the point of view of its transfer function , comprises a counterelectromotive force proportional to the speed plus an inductor and a resistor in series , as indicated in fig4 . other parameters are the inertia moment j and the friction torque f . on the other hand , the electromagnetic torque is proportional to the armature current and the electromotive force with respect to the speed of the motor . the ratio between the electromagnetic motor torque and the current of the armature is given by the following formula : the ratio between the counterelectromotive force and the angular speed is given by the following expression : the ratio between the voltage applied to the armature and the counterelectromotive force is as follows : ## equ1 ## if the control takes place by current injection , we can obtain the formula ( 4 ) ## equ4 ## from the equations 9 and 10 , it is deduced that the current injection system offers a more rapid speed of response than that of armature voltage , since in the first case the time constant of the system is reduced only to the electric constant of the motor . in practice , the transfer function is more complex , due to the non - linearities of the resistant torque and to the inertia of the load ( in this case negligible ).	6
referring now to fig1 a block diagram of a two - way radio communication system 100 is shown in accordance with a preferred embodiment of the present invention . the communications system 100 includes a central station 101 which is used with one or more mobile or portable communication units such as subscriber radio 103 . as is well known to those skilled in the art , the central station 101 is a repeater communications network or system which may be trunked with other repeaters in order to provide and greater and enhanced coverage area . the subscriber radio 103 include the capability of transmitting and receiving in a duplex mode and each preferable have an alphanumeric display and a digital tone multi - frequency ( dtmf ) keypad ( not shown ) capable of producing tones for accessing a telephone system integrated with the central station 101 . the central station 101 includes a caller identification system 105 having the capability of identifying the telephone number of an inbound caller to the central station 101 . as is also well known in the art , these calls are initiated from a standard telephone system 107 which is connected to a plurality of telephone users 109 . the telephone users initiate a telephone call that is processed by the telephone system 107 . the telephone system 107 establishes contact or communication with the central station 101 . the central station 101 is used as a node or central contact point between each of the subscriber radio 103 . in fig2 and 3 , a flow chart 200 shows operation at the central station 101 . initially , a call is placed by an outside party or landline caller 201 where it is then answered 203 by the central station . the caller &# 39 ; s telephone number is decoded 205 and subsequently identified where it is then momentarily stored 207 in the central station &# 39 ; s memory . the central station then transmits or sends 209 a first outbound signaling word ( osw ) to the addressed i . e . designated radio to which the call is directed . among other things , the osw contains the radio subscriber &# 39 ; s address and a first portion of the telephone number such as the area code . after this information is sent , the central station waits a predetermined time to receive 211 a first acknowledgment ack message from the subscriber radio . if a predetermined time to receive the first ack is exceeded , the first osw is subsequently retransmitted until a predetermined number of attempts 213 have occurred . after the expiration of the predetermined number of attempts , the central station ceases or terminates 227 all further attempts . thus , the central station no longer attempts to transmit to the subscriber radio when a first ack is received by the central station for the first osw , a second osw is sent 215 to the subscriber radio . similar to the first osw , the second osw includes among other things , the radio &# 39 ; s address and a second portion of the telephone number . the second portion also includes the remaining portion of the telephone number such as the telephone exchange and the four digit number as in a united states format . in similar fashion to the first osw , the central station anticipates or waits 217 for a second ack from the subscriber radio indicating the receipt of the second osw . if the second ack is not received , a predetermined number of additional attempts 219 are made to retransmit the second osw to the subscriber radio . after the predetermined number of attempts has expired , no more attempts to transmit the second osw to the subscriber radio occur and further communication is terminated 227 . when the second ack is received by central station , the central station transmits 221 a third osw to the subscriber radio . like the first osw and second osw , the third osw includes the radio &# 39 ; s address and a control signal for signaling or triggering the radio to enter a ring mode . the ring mode may be either an audio , visual , or tactile signal or indication to the user that an incoming call is available to be received at the subscriber radio . after transmitting the ring signal , the central station again waits 223 for a third ack from the subscriber radio that indicates the ring signal was received . in the event , the third ack is not received , the ring signal is retransmitted a predetermined number of times 224 . after the predetermined number is exceeded , no further attempts are made and the communication between central station and subscriber radio is terminated 227 . after the radio subscriber is signaled to ring , the user may then elect to receive the call 229 or store the telephone number locally where it can be retrieved at a later time . at the time of the ring mode , the user has the option to select or choose which inbound calls they wish to receive . additionally , when in a noisy environment where the subscriber radio is active yet cannot be heard by the user , the telephone number may be automatically stored and be reviewed at a later time . this feature prevents calls to be missed when the ambient environment is too loud be heard when it would be impossible to have a telephone conversation . with regard to fig4 and 5 , a flow chart is shown depicting the operation 300 of a subscriber radio 103 as seen in fig1 . initially the subscriber radio receives 301 it &# 39 ; s radio address as well as a first osw . the first osw from the central station includes at least a first portion of a telephone number . upon receipt of the first osw , the subscriber radio stores 303 this information in eeprom memory . the subscriber radio subsequently transmits 305 a first acknowledgment message to the central station . after transmitting the first acknowledgment message , a second osw is then received 307 for the central station which contains a second portion of the telephone number . this second portion of the telephone number is also stored 309 in eeprom memory . the subscriber radio then replies transmitting 311 a second acknowledgment message to the central station . once the subscriber radio has received the entire telephone number , it then displayed 313 to the user . the central station then transmits a third osw which includes a ring signal received 315 at the subscriber radio . the ring signal indicates to the user , either visually , audibly or tactically , that an incoming call is being received . after the ring signal is received , the subscriber radio transmits 317 a third ack to the central station . at this time the subscriber radio rings 319 i . e . enters a ring mode or ring state , the user must decide 321 to either respond and proceed 329 with the telephone call or store the telephone number within the radio for retrieval at a later time . it is important to note that the instant invention only operates when the radio is in an &# 34 ; on &# 34 ; and active state . unlike many other systems , if the subscriber radio is turned &# 34 ; off &# 34 ; or is inactivated , the telephone number information will be lost and is not stored at the central station for later transmission to the subscriber radio . accordingly , when the subscriber radio is turned &# 34 ; on &# 34 ; and a telephone number is received , the telephone number will be displayed 323 for a predetermined time . the instant system was developed with this feature in mind to avoid complexity and added features such as lists and additional software to store messages at a central location . when the telephone call has not been immediately accepted , the number can be retrieved 325 from memory and used by the subscriber radio at a later time to initiate or place 327 a telephone call using the stored number . once contact has been established with the central station , the user may then proceed 329 with the telephone call . while the preferred embodiments of the invention have been illustrated and described , it will be clear that the invention is not so limited . numerous modifications , changes , variations , substitutions and equivalents will occur to those skilled in the art without departing from the spirit and scope of the present invention as defined by the appended claims .	7
the personalized permanent hair color in accordance with the invention is formulated from a hair color stock palette comprising at least 5 groups of tonal series which are selected and mixed in accordance with the colormap of the person for whom the formulation is made . in a preferred embodiment , the hair color will be in the form of a creme gel having a viscosity that allows for brush / bowl or bottle application . in a preferred embodiment , color swatch taps and labels specify the color tone for determining parts of the colormap . the same color tone tabs appear on the swatches in the explanatory materials and as labels on the packaging materials for easy identification . as is well understood by those of ordinary skill in the art , hair color compositions work in combination with a developer . preferably , the combination of hair color and developer will provide : superior conditioning benefits , a creamy spreadable consistency , a stay - put moist consistency ( not too thin , not too thick ) for client comfort , and an appropriate viscosity for optional , convertible bowl and brush or bottle application . in a preferred embodiment , the developer also comprises several formulations to finely and precisely control the lifting and depositing action in the hair color formulations . further , these several formulations should be completely intermixable , providing even greater flexibility . for example , in a preferred embodiment , the developer is designated in accordance with the level of lift ; for example , developer may be designated as 10 , 20 , 30 , and 40 formulas , as described in table i , below . table i 10 volume developer formulated to reduce the lightening action of the permanent hair color . 10 developer is used whenever minimized lifting action and increased color depth is desired . 20 volume developer formulated as the standard developer for the permanent hair color . 20 developer is formulated to provide complete gray / white coverage and is used when standard lightening action and optimum color deposit and intensity are desired . 30 volume developer formulated to increase the lightening action of permanent hair color . 30 developer is use when additional lightening action and optimum color deposit is desired . 40 volume developer formulated for maximum lightening action of permanent hair color in a preferred example , the developers will vary in strength and concentration of hydrogen peroxide . thus , 10 developer is 3 % ( by vol .) hydrogen peroxide , 20 developer is 6 % ( by vol .) hydrogen peroxide , 30 developer is 9 % ( by vol .) hydrogen peroxide , and 40 developer is 12 % ( by vol .) hydrogen peroxide . the system and method of the present invention allows a colorist to formulate a personalized hair color based on the colormap for the person for whom the formulation is prepared . in use , the colorist first completes the colormap for the person whose hair they are coloring . in order to do this the colorist administers the colormapping assessment test , an example of which is attached as appendix a . the color assessment test can follow the steps of color - assessment process 10 in fig1 . the process proceeds from determining eye color in step 12 to determining flesh color , type of hair currently and preferred hair color in steps 14 - 20 . the current condition of the scalp is determined in step 20 , and the natural hair color prior to color or graying , the skin tone , freckles and lip color are determined in steps 24 - 30 respectively . the percentage of gray hair is determined in step 32 . the preferred embodiment and the maintenance preference are determined in steps 34 , 36 , respectively . in step 38 a determination is made how the hair is currently tinted . an example of applying color assessment process 10 to a selected individual is shown in appendix b . the results of the color assessment process 10 in appendix b are shown as color assessment vector 50 , shown in table ii . table ii green blue virgin blond ( light ) normal medium brown light none peach slightly gray 25 % natural high blond the color assessment vector 50 is then used to access an individual mix which is ideal for the person for whom the color assessment vector 50 pertains as determined by the color assessment test of appendix a . in order to do this the color assessment vector is applied to the color mapping matrix of appendix c . the individual would then contact colormapping customer services , or whoever was in possession of these results , and receive the hair color formula , based on packet numbers . for instance , they could be given the following directions . mix together the following packets , which can typically be divided into 25 ml packets or 60 ml tubes , for your colormapping custom hair color : 1 , 2 , 3 , 5 , 7 , 18 , 24 , 26 , 27 , 43 , 46 and 50 . the colormap also considers the effects of porosity and texture of the person &# 39 ; s hair . the person would then be directed to follow the directions inside their kit for application . generally , an application time of thirty ( 30 ) to forty - five ( 45 ) minutes is appropriate , however , for super light blonde , a time of forty - five ( 45 )- fifty ( 50 ) minutes is appropriate . the process of applying the hair color / developer formulation amount is as follows : ( 1 ) apply formula to the first one - half ( ½ ) inch section from the scalp ; ( 5 ) on overly porous ends , do not immediately work through ends ; ( 6 ) wait until hair is almost completely processed to avoid ends taking on too much tone ; ( 7 ) in applying retouch application with hair color : apply to new growth only ; ( 8 ) if necessary , when the processing time is almost through , replenish the previously colored hair . in accordance with the invention disclosed are novel personalized hair coloring compositions and methods of formulating that use a stock palette of permanent , semi permanent , and or staining hair color formulas consisting of different tones and levels with intensifiers . the shades in the palette are formulated to create mixtures of stock based on the individuals “ colormap ”. the palette of the stock permanent hair color formulas is divided into five ( 5 ) different groups of tonal series ; group 1 or “ perfect blondes ,” group 2 or “ perfect reds ,” and group 3 or “ perfect browns ”, group 4 , or “ perfect highlights ” group 5 , or “ colorstaining for men ”. an advantage of the system of the invention is that the hair colorist personalizes the shade selection based on the client &# 39 ; s own “ colormap ”. for the client , the resulting hair color will look more natural and for the colorist , the selection and the amount of mixing of the color for their client is simplified and more precise . the advantage of our method and system is that simplifies the selection of the proper shade for an individual by the hair colorist . a table of historic features is included as appendix d . while the invention has been described in detail and with reference to specific examples thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof . it will thus be seen that the objects set forth above , among those made apparent from the preceding description , are efficiently attained and , since certain changes may be made in carrying out the above methods and in the devices as set forth without departing from the spirit and scope of the invention , it is intended that all matter contained in the above description shall be interpreted as illustrative and not in a limiting sense . appendix d skin eyes lips hair nordic pink , violet gray , violet , blue pink , blue , 6 - 9 levels , blonde , ash , green , yellow pastel , non - existent irish pale with warm green , smoky blue , green purple , freckles brown orange melon , bright pink salmon black irish white ice blue straight full body , re - dark brown , dark auburn , and shape , pink black eastern europe - fair , golden with brown , black , dark blue , matte straight , dark brown , not black lebanese , russian , green underbase almond shape siberian , mongolian , iranian latin - hispanic light cafe , light and green , hazel , brown red , purple brown , brown golden underbase , never blue pink brown bronzed , tropical olive mediterranean greek , dark olive italian german pink , fair , salmon , hazel , blue , gray , brown - bright pink , level 3 - 6 , brown , warmer , pinch of black yellow undertones red peach french dark , more olive pigment dark rich , green full of color 2 - 4 levels intensity english - welch ash undertones , pink , light , light gray , aqua 7 levels , less pigment , limp , fair with veins blue , teal tellow , green , ashy brown african purple , green undertones dark red , black , curly brown east india - pakistan green undertones , dark , fair , red , dark brown smooth , smoky full body , black india midtone freckles west european pinky , slight ash , sallow with green 4 - 8 levels , yellow , blue undertones neutral , 6 level - auburn , brown , green north american indian brown , red dark red , brown , orange , terracotta straigh , black black asian yellow , green undertone , black , brown thin and neutral in color − 4 levels , coarse , straight , fairish black , brown	0
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . although the present invention is illustrated with respect to a mobile terminal , it is contemplated that the present invention may be utilized anytime it is desired to provide new transport configurations for establishing a connection between a mobile communication device and a network ( also referred to as a base station ). fig2 is a flowchart of a transmission power control method for r - cqich . referring to fig2 , a mobile terminal receives a signal transmitted from a base station ( s 11 ) and then estimates a current forward channel quality ( s 12 ). and , the mobile terminal computes an r - cqich transmission power using a cqich power gain to a reverse pilot power value rlgain_cqich_pilot received from the base station ( s 13 , s 14 ). it should be noted that the steps of estimating the current forward channel quality ( s 12 ) and receiving rlgain_cqich_pilot from the base station ( s 13 ) may be interchanged . preferably , the transmission power of r - cqich is computed using equation 1 . in equation 1 , the mean pilot channel output power is a mean power value of a reverse pilot channel , nominal_reverse_channel_quality_indicator_channel_attribute_gain is a gain value previously known to a base station and a mobile terminal , reverse_channel_quality_indicator_channel_attribute_adjustment_gain [ r - cqich ] is a gain value that the base station informs each mobile terminal via message if necessary , reverse_channel_adjustment_gain [ r - cqich ] is a gain value that the base station informs each mobile terminal via message if necessary , multiple_channel_adjustment_gain [ r - cqich ] is a gain value used when at least two code channels are assigned to the mobile terminal as well as the reverse pilot channel , and rlgain_cqich_pilot is a gain value of r - cqich power to a reverse pilot channel power that the base station informs the all mobile terminals in a cell via an overhead message . fig3 is a flowchart of a transmission power control method for r - ackch . referring to fig3 , data are preferably transmitted at high data rate between the base station and the mobile terminal in a following manner . a base station transmits a packet to a mobile terminal . and , the mobile terminal having received the packet ( s 21 ) performs decoding thereon ( s 22 ). if the decoding is successful ( s 22 ) ( i . e ., there is no error in the decoded data ), the mobile terminal transmits an acknowledgment ( ack ) signal to the base station to inform the successful decoding . the base station having received the ack signal transmits a next packet . if the decoding fails ( s 22 ), the mobile terminal transmits a non - acknowledgement ( nak ) signal to the base station to inform the decoding failure ( s 25 ). the base station having received the nak signal retransmits the packet . the ack / nak signal is transmitted via a r - ackch . the transmission power of r - ackch is computed using the ackch power gain to a reverse pilot power value ( rlgain_ackch_pilot ) received from the base station ( s 23 , s 24 ). and , the ack / nak signal is transmitted to the base station with the computed transmission power ( s 25 ). preferably , the transmission power of r - ackch is computed using equation 2 . in equation 2 , the mean pilot channel output power is a mean power value of a reverse pilot channel , nominal_reverse_acknowledgement_channel_attribute_gain is a gain value previously known to a base station and mobile terminal , reverse_channel_adjustment_gain [ r - ackch ] is a gain value that the base station informs each mobile terminal via message if necessary , multiple_channel_adjustment_gain [ r - ackch ] is a gain value used when at least two code channels are assigned to the mobile terminal as well as the reverse pilot channel , and rlgain_ackch_pilot as a gain value of r - ackch power to a reverse pilot channel power that the base station informs the all mobile terminals in a cell via an overhead message . fig4 is an exemplary diagram of an overhead message format including rlgain_cqich_pilot and rlgain_ackch_pilot values . such message is transmitted from a base station to a mobile station residing in a cell controlled by such base station . referring to fig4 , rlgain_cqich_pilot and rlgain_ackch_pilot values for computing the transmission powers of r - cqich and r - ackch , respectively , can be transmitted using one or more fields of espm ( extended system parameters message ), mcrrpm ( mc - rr parameters message ), uhdm ( universal handoff direction message ), and ecam ( extended channel assignment message ). the espm and mcrrpm are common channel messages which are provided to a plurality of mobile terminals in a cell . on the other hand , uhdm and ecam are dedicated messages which are provided to a specific mobile terminal in a cell . accordingly , the present invention efficiently controls the transmission powers of each of the r - cqich and r - ackch . and , the present invention reduces the amount of data being transmitted from the base station to the mobile terminal . referring to fig5 , a block diagram of a mobile communication device 400 of the present invention is illustrated , for example a mobile phone for performing the methods of the present invention . the mobile communication device 400 includes a processing unit 410 such as a microprocessor or digital signal processor , an rf module 435 , a power management module 405 , an antenna 440 , a battery 455 , a display 415 , a keypad 420 , a storage unit 430 such as flash memory , rom or sram , a speaker 445 , a microphone 450 , and , optionally , a sim card 425 . a user enters instructional information , such as a telephone number , for example , by pushing the buttons of the keypad 420 or by voice activation using the microphone 450 . the processing unit 410 receives and processes the instructional information to perform the appropriate function , such as to dial the telephone number . operational data may be retrieved from the storage unit 430 to perform the function . furthermore , the processing unit 410 may display the instructional and operational information on the display 415 for the user &# 39 ; s reference and convenience . the processing unit 410 issues instructional information to the rf section 435 , to initiate communication , for example , by transmitting radio signals comprising voice communication data . the rf module 435 includes a receiver and a transmitter to receive and transmit radio signals . the antenna 440 facilitates the transmission and reception of radio signals . upon receiving radio signals , the rf module 435 may forward and convert the signals to baseband frequency for processing by the processing unit 410 . the processed signals may be transformed into audible or readable information output , for example , via the speaker 445 . it will be apparent to one skilled in the art that the steps described in fig2 - 4 may be readily implemented using , for example , the processing unit 410 or other data or digital processing device , either alone or in combination with external support logic . although the present invention is described in the context of mobile communication , the present invention may also be used in any wireless communication systems using mobile devices , such as pdas and laptop computers equipped with wireless communication capabilities . moreover , the use of certain terms to describe the present invention should not limit the scope of the present invention to certain type of wireless communication system , such as cdma . the present invention is also applicable to other wireless communication systems using different air interfaces and / or physical layers , for example , tdma , fdma , wcdma , umts , etc . the preferred embodiments may be implemented as a method , apparatus or article of manufacture using standard programming and / or engineering techniques to produce software , firmware , hardware , or any combination thereof . the term “ article of manufacture ” as used herein refers to code or logic implemented in hardware logic ( e . g ., an integrated circuit chip , field programmable gate array ( fpga ), application specific integrated circuit ( asic ), etc .) or a computer readable medium ( e . g ., magnetic storage medium ( e . g ., hard disk drives , floppy disks , tape , etc . ), optical storage ( cd - roms , optical disks , etc . ), volatile and non - volatile memory devices ( e . g ., eeproms , roms , proms , rams , drams , srams , firmware , programmable logic , etc .). code in the computer readable medium is accessed and executed by a processor . the code in which preferred embodiments are implemented may further be accessible through a transmission media or from a file server over a network . in such cases , the article of manufacture in which the code is implemented may comprise a transmission media , such as a network transmission line , wireless transmission media , signals propagating through space , radio waves , infrared signals , etc . of course , those skilled in the art will recognize that many modifications may be made to this configuration without departing from the scope of the present invention , and that the article of manufacture may comprise any information bearing medium known in the art . the logic implementation shown in the figures described specific operations as occurring in a particular order . in alternative implementations , certain of the logic operations may be performed in a different order , modified or removed and still implement preferred embodiments of the present invention . moreover , steps may be added to the above described logic and still conform to implementations of the invention . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .	7
referring to the drawings generally and particularly with the waveforms of fig1 and the block circuitry of fig2 and 3 , the operation of the circuit in its entirety is described briefly . incoming waveforms from two channels a and b are shown as waveforms 20 , 21 , differing only in pulsewidth . these signals 20 , 21 are applied directly to pulse processor 52 , which alters the timing intervals between the two channels being received to produce output waveforms 22 and 23 . these waveforms are applied to comparator / integrator circuit 47 , and are further defined as waveforms 24 , 25 , both having been compared to a reference waveform level , resulting in outputs which significantly differ one from the other . additional processing by level transistor circuit 44 further separates the discrimination levels of the waveforms , resulting in waveforms 26 , 27 . these signals are then applied to the rf selection gates of fig7 which then readily discriminates between the two incoming channels h and v without error . selection of the desired channel is made by selective biasing of the pin diodes of the selection gate , and said desired channel is passed to the output port 101 of the overall switching circuit . the differential data line selector 10 is a pulse width discriminating radio frequency switch designed to select between two incoming radio frequency ports h and v dependent upon the pulse width or voltage iteration of the incoming signal pattern . the pulse processor 52 utilizes a standard timer circuit , such as model mc1455 manufactured by motorola semiconductor , inc ., and shown in detail in fig2 and 4 . the rc network of said timer defines the time difference between the incoming data channels , and increasing the time interval between the incoming serial data by a factor of 4 or more . referring to fig1 waveforms 20 and 21 illustrate two incoming signal channels , while waveforms 22 and 23 show the resulting outputs of timer circuit 52 . referring back to fig2 and 4 , the pulse processor includes timer circuit 52 and rc network 53 and 55 for defining the timing interval between incoming channels . capacitor 54 is for refinement of the timing of circuit 52 . the serial data input trains 20 , 21 arrive at pin # 2 of circuit 52 , and provide output waveforms 22 , 23 at pin # 3 . resistor 51 is used to pull up the output pin of timing circuit 52 , while the voltage applied to pin # 4 insures that timer 52 will not be reset . typical values of the elements in fig4 are listed below : table i______________________________________resistor 51 1 . 5k ± 5 % 1 / 4 watt carbon filmtimer 52 mc1455 ( motorola semiconductor , inc .) resistor 53 300k to 500k 1 / 4 watt carbon filmcapacitor 54 0 . 01 microfarad ± 20 % ceramic disccapacitor 55 0 . 01 microfarad ± 20 % ceramic disc______________________________________ the comparator / integrator section 47 of the invention is shown in fig5 . it provides for further differentiation between input channels following the timing changes resulting from pulse processor 52 . the output waveform 22 , 23 of pulse processor is applied to the non - inverting input of the comparator 47 at pin # 2 , and a fixed reference voltage derived from the voltage divider created by resistors 46 and 49 is applied to the inverting input of the comparator at pin # 3 . the point of comparison as defined by the inverting input reference equals the rms value of the processor output waveform 22 , 23 as adjusted by the output timing . for pulse processor output signal waveform 22 from fig1 this rms value is below the reference voltage , and for the output level of waveform 23 , the rms voltage is above this reference voltage . since the comparator 47 has a hysteresis region greater than the difference between the waveforms 22 and 23 , random output pulses could have an objectionable effect on circuit operation . these random pulses are filtered and integrated through capacitor 50 in fig5 therefore deriving a comparator output 24 , 25 which can be defined within the constraints of ttl logic definitions . referring again to fig1 the further defined outputs 24 and 25 illustrate the improved definition between the two incoming channels after processing by the comparator / integrator circuit 47 . resistor 51a pulls up the output of said comparator / integrator circuit 47 , while resistor 48 matches said output to the level translator section of the device . typical electrical values for the elements of this section are listed below : table ii______________________________________resistor 46 10k ± 5 % 1 / 4 watt carbon filmresistor 48 10k ± 5 % 1 / 4 watt carbon filmresistor 49 470 ± 5 % 1 / 4 watt carbon filmcapacitor 50 470 micro farrad ± 20 % electrolytic 6 vdcresistor . sup . 51 . sup . a 1k ± 5 % 1 / 4 watt carbon filmcomparator / 47 lm311 comparator ( motorolaintegrator semiconductor , inc .) ______________________________________ level translator 44 , shown in fig2 and in greater detail in fig6 is a hex inverter for translation of the comparator / integrator output signal 25 , 26 . this output signal 25 , 26 is applied to the input of the first inversion stage of the inverter 44 at pin # 3 , which input is inverted 180 ° and applied simultaneously to one rf selection gate ( fig7 ) and to the next hex inversion stage of inverter 44 . the output of this second inversion stage is again 180 ° inverted and also applied to the rf selection gates of fig7 . the net result is two signals a and b applied to the rf selection gates of fig7 whose polarity is always 180 ° out of phase . referring back to fig1 the results of processing by the level translator 44 further discriminates between the inputted waveforms 24 and 25 , producing simultaneous outputs at pins 5 and 6 ( fig6 ) as shown in waveforms 26 and 27 i . e ., b and a , respectively . typical electrical values for this section are listed below : table iii______________________________________level transistor 44 sn7404 hex inverterresistors 45 j . sub . 1 & amp ; j . sub . 2 consisting of approx . 1 / 2 &# 34 ; # 22 awg copper / nickel wire______________________________________ the rf selection gates illustrated in fig2 and 7 consist of a series of biased pin diodes to select the desired channel from among the incoming channels , and apply said desired channel to the output port 101 for reception . the selection process is independent of the dc path provided between the output port and rf input port # 2 . outputs from pins # 5 and # 6 ( fig6 ) of the level translator 44 are applied through radio frequency chokes 31 and 41 , respectively , to the anodes of pin diode arrays 30 and 35 , shown in detail in fig7 . paired resistors 32 and 33 act as bias current paths to ground for each port . capacitors 29 , 36 , 37 and 39 block dc bias current from the input and output apparatus . pin diode 38 is used in a steering configuration for rf port # 1 , or 101 and is biased through resistor 34 . inductors 40 and 42 block rf currents from entering the dc signal path between rf port 101 # 2 and the rf output port while capacitors 43 , 54 and 55 bypass stray rf currents to ground . the biasing system for the pin diodes , dependent upon the pulse processing section , selects an rf path which is wholly dependent upon the time relationship between the two differing data signal channels input to the device . that is , a pulse width common to a certain incoming data channel will be made to select a known rf input port , and a differing input data train will select the other rf input port . typical electrical values for this section are listed below : table iv______________________________________capacitor 29 100 pico farad npo ceramic ± 10 % 50 vdc chippin diodes 30abc in5767choke 31 10 micro henry 1 / 8 w ± 10 % hermetically sealedresistor 32 1k ± 5 % 1 / 4 w carbon filmresistor 33 1k ± 5 % 1 / 4 w carbon filmresistor 34 1k ± 5 % 1 / 4 w carbon filmpin diodes 35abc in5767capacitor 36 100 pico farad npo ceramic ± 10 % 50 vdc chipcapacitor 37 100 pico farad npo ceramic ± 10 % 50 vdc chippin diode 38 in5767capacitor 39 100 pico farad npo ceramic ± 10 % 50 vdc chipchoke 40 100 micro henry 1 / 8 w ± 10 % hermetically sealedchoke 41 100 micro henry 1 / 8 w ± 10 % hermetically sealedchoke 42 100 micro henry 1 / 8 w ± 10 % hermetically sealedcapacitor 43 . 01 pf ± 20 % 50 vdc ceramic disccapacitor 43a . 01 pf ± 20 % 50 vdc ceramic disccapacitor 56 . 01 pf ± 20 % 50 vdc ceramic disccapacitor 57 . 01 pf ± 20 % 50 vdc ceramic disc______________________________________ the universal data input modification circuit ( fig8 ) is a second configuration of the extraneous input wiring arranged in such a way as to render the invention useful for differing types of incoming input data . the circuit utilizes a three - position input terminal block 62 ad double pole double throw switch 61 to accomplish direct biasing of the pin diode arrays of the fig7 for rf energy selection . referring to fig8 non - differential data from an input source such as a satellite receiver as manufactured m / a com , inc ., is applied to input terminals v and h of terminal block 62 . these input terminals are connected through toggle switch 61 for distributing said non - differential data to the common connection point of level translator 44 shown in fig6 . thus , both differential and non - differential data are properly applied to level translator 44 for proper processing of both signal types . a second improvement to the basic differential data line selector 10 is the inclusion of the voltage regulator 60 shown in fig3 and 9 . this circuit is added for the purpose of refining incoming raw voltage fed to the switching circuit through the rf output port for powering of the different circuit sections previously described . referring to fig7 the incoming raw voltage is passed through choke 42 to rf output port 101 , and thence to pin # 1 of the regulator circuit . capacitors 58 and 59 shown in fig9 are parasitic suppressors to keep the regulator free of oscillation . operating voltage for the sections of the invention is distributed from pin # 3 of the regulator circuit 60 . typical electrical values for this section are listed below : table v______________________________________voltage regulator 60 mc7805tc ( motorola semiconductor , inc .) capacitor 58 . 1 micro farad 50 v ± 20 % ceramic disccapacitor 59 . 01 micro farad 50 v ± 20 % ceramic disc______________________________________ operation of the circuit in its entirey is described briefly below , with particular reference to the waveforms of fig1 . incoming waveforms from two channels a and b are shown as waveforms 20 and 21 , differing only in pulse width . these signals are applied directly to pulse processor 52 , which alters the timing intervals between the two channels being received to produce output waveforms 22 and 23 . these waveforms ae applied to comparator / integrator circuit 47 , and are further redefined as waveforms 24 and 25 , both having been compared to a reference waveform level , resulting in outputs which significantly differ one from the other . additional processing by level translator circuit 44 further separates the discrimination levels of the waveforms , resulting in waveforms 26 and 27 . these signals are then applied to the rf selection gates of fig7 which can then readily discriminate between the two incoming channels without error . selection of the desired channel is made by selective biasing of the pin diodes of the rf selection gate , and said desired channel is passed to the output port of the overall switching circuit . the circuitry and operation described above as that of the preferred embodiment , is merely exemplary of the basic operation of the circuit concept , and is not meant to be limiting to the scope of the invention .	7
referring now to the drawings by reference characters , there is shown an oven having a base box of generally rectangular structure , generally designated 7 , having a front wall 6 , sides 8 and 10 , a back wall 12 and a bottom 11 . the walls can be referred to as the south , east , west and north walls , respectively , since in the nothern hemisphere these are the general directions these walls would face near midday . the top edges of the east and west walls of the box , the east one of which has been designated 9 , make an angle of roughly 17 ° to the bottom 11 of the box . as will be later explained in detail , it has been found that 17 ° is about optimum for locations having the latitude of the united states , but , of course , the optimum angle will depend on the area to be served . the 17 ° angle enables the reflector assembly to have enough base member length at the rear ( n ) to allow the reflector assembly to extend to a position that will effectively utilize sunlight from 90 ° to 30 ° altitude ( altitude of most useful hours for persons living in the 30 °- 40 ° latitudes ). by placing wall 12 on the ground ( 11 then becoming the back n wall and 12 the bottom ) and moving gnomon 67 to the top of 49 , the sun &# 39 ; s rays may be effectively utilized from 60 ° to 0 °, i . e ., from sunrise to sunset . resting inside the base member 7 is rigid insulating material forming the front 13 , the bottom 15 and back 17 . side insulating panels are also employed but are not numbered . the tops of the front and back panels are beveled as at 14 and 18 to form a tight air seal with the glazing . preferably , there is a black paint and foil facing on the insulation . it will be noted that the back panel 17 does not fit tightly against the back 12 of the base box 7 , the reason for which will be explained shortly . box 7 is provided with a handle 19 for easy portability and has side retainers 20 to hold ends 53 and 55 as is later explained . if desired , a thermometer 21 can be provided which extends through the insulating panel 13 into the center 23 of the oven . at the top of the insulating panels is a double glazed heat - retaining member , designated 25 . this consists of a frame 27 of generally rectangular structure so that it will rest onto the insulating members ; the front and back surfaces 29 and 31 are composed of replaceable layers of a heat - resistant transparent plastic . these plastic sheets may be held in place by any suitable means and can be easily lifted by tab 33 . thus , a very inexpensive double glazed structure is provided . also , should any moisture condense on the inner surface , as might well happen when the box has been utilized as a refrigerator , it is only necessary to invert the member 25 to cause the moisture to evaporate rapidly . the glazing may be in the form of a plastic envelope having a closed end 30 and the open end may be sealed with tape , not shown . the reflector element , generally designated 35 , has a base which consists of the joined side members 37 and 39 , the front member 41 and the back member 43 . thus , the base resembles a box without a bottom . extending upward from the sides are the main reflective elements , namely 45 extending upwardly from 37 ; 47 extending upwardly from 39 ; 49 extending upwardly from 41 and 51 extending upwardly from 43 . each of these is of generally rectangular configuration and , assuming the base of the box 7 is square , these members would also be appropriately square . these elements extend from a base line 65 , although as a practical manner the fold line of each reflector is offset from the next so that they can be folded down in overlying relationship . in addition , four triangular reflective elements are provided , namely 53 and 55 extending from 51 , and 57 and 59 extending from 49 . the inner surfaces of these elements , namely 45 , 47 , 49 , 51 , 53 , 55 , 57 and 59 , are provided with a reflective coating . one way of accomplishing this would be to provide an inner coating of a metal foil such as aluminum . however , it is preferred that the inner surface of each of these reflective elements be provided with a thin film of a metalized plastic such as aluminized mylar . the metal surface , of course , would be next to the cardboard flaps so that the metal surface would be protected from scratching and oxidation . in order to hold the reflectors at the proper angle , metal or plastic clips or extrusions are provided at each of the junctions such as the metal clip 61 at the junction of the solar panels 45 and 53 . as is best seen in fig3 the base members of the reflective element tuck between the base box and the insulating material so that the front of the base 41 tucks between the insulating block 13 and the front wall , while the rear element bends around and 43 tucks between the insulating block 17 and the back wall . similarly , sides 37 and 39 tuck between the sides of the box and the sides of the insulating block of the oven . this provides a substantial amount of friction so that the entire reflective assembly 35 can be tilted to a desired elevation and will more or less stay in place . if it is desired to have a more secure means of holding the reflector to the correct elevation angle in which case a small wedge 63 can be used between the flap 31 and the back wall . in using such an oven , it is obvious that to secure optimum results the base of the reflective element 65 should be maintained with both elevation and aximuth so that the sun strikes the center of the reflective elements at an angle of about 90 ° with respect to base line 65 . further , in order to secure optimum effective reflection , it has been found that the reflective flaps should make an angle of about 120 ° to the plane of 65 when 65 is perpendicular to the path of the sun . thus , the angle 66 should ideally be about 30 °. in order to secure optimum utilization of the sun &# 39 ; s energy , the indicator 67 is provided . indicator 67 is formed to clip onto a flap such as 51 and has a gnomon 69 which casts a shadow on an indicating surface 71 . the indicating surface 71 is parallel to the base line 65 and is provided with an arc 73 and a central line 75 . with this indicator , one first corrects the elevation of the oven by sliding the flap 43 in and out until the shadow of the tip of the gnomon 69 falls on the arc 73 . at this point , the elevation may be locked in place utilizing the wedge 63 . now one rotates the box around to secure the correct azimuth , i . e . wherein the shadow of the pointer of the gnomon 69 falls on the line 75 . of course , during the course of the cooking , it is advantageous to correct the position of the reflection from time to time to agree with the changing position of the sun . the spatial ( geometric ) relationship of 69 , 71 and 75 is such that when 69 is clipped to the top edge of either 49 or 65 , the shadow of 69 will touch both 73 and 75 when 65 is perpendicular to the sun &# 39 ; s rays ( position for optimum reflection of sunlight into oven interior ). the oven of the present invention is very portable and also lends itself for service as an insulated container as was previously mentioned . when one wishes to disassemble the oven , the clips 61 and the indicator 69 are merely slid off of the flaps and can be placed in the bottom of the oven . now one folds the flaps 47 and 45 down ovr the glazing element 25 and pulls the flap 49 down towards the glazing element , engaging the triangular members 57 and 59 between the sides 37 and 39 and the sides of the box 7 . now one folds flap 51 down and tucks the flaps 53 and 55 into the side retainers 20 . thus , the structure is folded compactly for carrying by the handle 19 . it should be noted that by placing the thermometer 21 in the same side of the box structure as is the handle , there will be no tendency for the thermometer to fall out as the oven is being transported . although certain specific elements have been set forth in the specification , it should be understood that these are for purposes of illustration only and that many variations can be made in the exact structure shown without departing from the spirit of this invention .	8
the method of the present invention is a scheme to progressively achieve full jpeg decompression by factoring the inverse direct cosine transform (“ dct ”) of order eight ( 8 ) into three phases . at the end of the first phase two disjoint transforms of order four ( 4 ) are produced , and similarly , at the end of the second phase four transforms of order two ( 2 ) are produced . the third and final phase produces the original image data in the time or pixel domain , such as shown in fig4 . for exemplary purposes , an original image is defined to be a sampled still image , such as an original image shown in fig2 . as will be described , the data produced at the end of each phase contains progressively higher resolution information about the original image . in a preferred embodiment , the thumbnail images are computed directly by the inverse dct processor 29 as shown in fig1 ( a ) without necessarily producing the full resolution dct inversion , as will be described . as known , the dct matrix is widely used in image compression algorithms , and encompasses many forms . in the preferred embodiment of the invention , a form is used having the property that the transpose of the dct matrix is the inverse of the dct matrix . in the one - dimensional case , a dct matrix operator having this property has been derived in the feig and winograd reference . generally , the dct matrix of order n is defined in terms of cosines of multiples of an angle ω o = 2π / 4n , i . e ., cos ( mω o ) which is represented by y ( m ) with m being an integer . with matrix elements the normalized 8 - point dct matrix is set forth in equation ( 1 ) as follows : c 8 = [ γ  ( 4 ) γ  ( 4 ) γ  ( 4 ) γ  ( 4 ) γ  ( 4 ) γ  ( 4 ) γ  ( 4 ) γ  ( 4 ) γ  ( 1 ) γ  ( 3 ) γ  ( 5 ) γ  ( 7 ) - γ  ( 7 ) - γ  ( 5 ) - γ  ( 3 ) - γ  ( 1 ) γ  ( 2 ) γ  ( 6 ) - γ  ( 6 ) - γ  ( 2 ) - γ  ( 2 ) - γ  ( 6 ) γ  ( 6 ) γ  ( 2 ) γ  ( 3 ) - γ  ( 7 ) - γ  ( 1 ) - γ  ( 5 ) γ  ( 5 ) γ  ( 1 ) γ  ( 7 ) - γ  ( 3 ) γ  ( 4 ) - γ  ( 4 ) - γ  ( 4 ) γ  ( 4 ) γ  ( 4 ) - γ  ( 4 ) - γ  ( 4 ) γ  ( 4 ) γ  ( 5 ) - γ  ( 1 ) γ  ( 7 ) γ  ( 3 ) - γ  ( 3 ) - γ  ( 7 ) γ  ( 1 ) - γ  ( 5 ) γ  ( 6 ) - γ  ( 2 ) γ  ( 2 ) - γ  ( 6 ) - γ  ( 6 ) γ  ( 2 ) - γ  ( 2 ) γ  ( 6 ) γ  ( 7 ) - γ  ( 5 ) γ  ( 3 ) - γ  ( 1 ) γ  ( 1 ) - γ  ( 3 ) γ  ( 5 ) - γ  ( 7 ) ] ( 1 ) as known , this normalization produces an inverse matrix d 8 with the property that d 8 = c t 8 . the elements of the inverse matrix d has coefficients d i , j given by d i , j ={ square root over ( 2 )}/ n y ( j ( 2i + 1 )) for j & gt ; 0 , according to the principles of the invention , to achieve progressive decompression , a multi resolution factorization of da is required . thus , from the inverse matrix d 8 , a factorization is performed to generate two blocks of size four ( 4 ), then four ( 4 ) blocks of size two ( 2 ), and finally eight ( 8 ) blocks of size one , which form the original time samples or pixels . in a first level of inversion , a single discrete cosine component is first extracted from each 8 × 8 block and the resulting components are combined into a thumbnail sketch { fraction ( 1 / 64 )} th the size of the original image to result in the partially decompressed image of fig4 ( a ). after one level of inversion , the image will be composed of 4 × 4 blocks , and a thumbnail produced from these blocks will contain { fraction ( 1 / 16 )} th the original number of points as shown in the partially decompressed image of fig4 ( b ). the next level of inversion produces a thumbnail with ¼th the number of points as shown in the partially decompressed image of fig4 ( c ), and the last level of inversion produces the full decompressed jpeg image shown in fig3 . it can be seen in the thumbnail images of fig4 ( a )-( c ) that the larger details corresponding to the original image are still visible even at the lower resolution . in the multi resolution analysis just described , use is made of hadamard transforms hn , which lend themselves directly to multi resolution analysis as they exhibit the property that a matrix of order n can be built recursively from lower order hadamard matrixes , e . g ., hadamard matrix of order 2 . that is , a hadamard matrix h n can be recursively factored as h n = h 2 × h n / 2 . from this it follows that a matrix of order h 8 = h 2 × h 4 and thus , h can be factored in accordance with equation ( 2 ) as follows : h 8 =( h 2 33 i 4 ) ( i 2 ×( h 2 33 i 2 )) ( i 4 × h 2 ) ( 2 ) where i r is an identity matrix of rank r . note that h 2 is symmetric and unitary ( self inverse ). it can be shown that all hadamard matrices of rank 2 m are symmetric and unitary . note that each of three factors of h 8 are symmetric , unitary , and commute with each other . therefore , as set forth in equation ( 3 ), d 8 is factored in accordance with equation ( 1 ) as follows : d 8 = h 8 v = ( h 2 33 i 4 ) ( i 2 ×( h 2 × i 2 ))( i 4 × h 2 ) v ( 3 ) allowing for the solution of v as set forth in equation ( 4 ) as follows . v = h 8 d 8 =( h 4 × i 2 ) ( i 2 ×( h 2 × i 2 )) ( h 2 × i 4 ) d 8 ( 4 ) using equation ( 4 ) and making liberal use of the cosine relation cos ( a )+ cos ( b )= 2cos (( a + b )/ 2 ) cos (( a − b )/ 2 ), v has the structure : v = [ 1 0 0 0 0 0 0 0 0 γ  ( 2 )  γ  ( 7 ) 0 γ  ( 5 )  γ  ( 6 ) 0 γ  ( 3 )  γ  ( 6 ) 0 γ  ( 2 )  γ  ( 1 ) 0 γ  ( 6 )  γ  ( 1 ) 1 γ  ( 3 )  γ  ( 2 ) 0 - γ  ( 5 )  γ  ( 2 ) 0 - γ  ( 6 )  γ  ( 7 ) 0 0 0 0 1 0 0 0 0 γ  ( 2 )  γ  ( 1 ) 0 - γ  ( 3 )  γ  ( 6 ) 0 γ  ( 5 )  γ  ( 6 ) 0 - γ  ( 2 )  γ  ( 7 ) 0 0 γ  ( 6 ) 0 0 0 γ  ( 2 ) 0 0 0 γ  ( 2 ) 0 0 0 - γ  ( 6 ) 0 0 - γ  ( 6 )  γ  ( 7 ) 0 γ  ( 5 )  γ  ( 2 ) 0 γ  ( 3 )  γ  ( 2 ) 0 - γ  ( 6 )  γ  ( 1 ) ] which structure can be applied to directly invert an 8 - point dct in 20 multiply and 14 additions when implementing huffman decoding . as 24 addition operations are required to multiply by hs , the inversion of d 8 requires a total of 20 multiplication and 38 addition operations . the operation count can be lowered in many ways . by considering a 2 × 2 submatrix g 2 given by equation ( 5 ) as follows : g 2 = [ γ  ( 6 ) γ  ( 2 ) γ  ( 2 ) - γ  ( 6 ) ] ( 5 ) feig and winograd show that multiplying matrix g 2 with a 2 - vector and employing a standard “ rotator ” product will require three ( 3 ) multiplication and three ( 3 ) addition operations thus , enabling the sum and difference components of y ( 6 ) and y ( 2 ) to be precomputed and not counted as part of the algorithm . it should be understood that the costly part of multiplication by v when calculating the inverse dct in equation ( 3 ) above , is the multiplication of a 4 × 4 submatrix q 4 defined in equation ( 6 ) as follows : q 4 = [ γ  ( 2 )  γ  ( 7 ) γ  ( 5 )  γ  ( 6 ) γ  ( 3 )  γ  ( 6 ) γ  ( 1 )  γ  ( 2 ) γ  ( 1 )  γ  ( 6 ) γ  ( 2 )  γ  ( 3 ) - γ  ( 2 )  γ  ( 5 ) - γ  ( 6 )  γ  ( 7 ) γ  ( 1 )  γ  ( 2 ) - γ  ( 3 )  γ  ( 6 ) γ  ( 5 )  γ  ( 6 ) - γ  ( 2 )  γ  ( 7 ) - γ  ( 6 )  γ  ( 7 ) γ  ( 2 )  γ  ( 5 ) γ  ( 2 )  γ  ( 3 ) - γ  ( 1 )  γ  ( 6 ) ] ( 6 ) this sub - matrix can be factorized in either of two ways . in the first factorization approach , the rows and columns of q 4 are permuted by matrices p 1 , 4 and p 2 , 4 to create the matrix r 4 in accordance with equation ( 7 ). r 4 = p 1 , 4  q 4  p 2 , 4 =  [ 0 1 0 0 1 0 0 0 0 0 0 1 0 0 1 0 q 4 0 0 1 0 0 0 0 1 1 0 0 0 0 1 0 0 ] =  [ 1 0 γ  ( 2 ) / γ  ( 6 ) 0 0 1 0 γ  ( 2 ) / γ  ( 6 ) γ  ( 2 ) / γ  ( 6 ) 0 - 1 0 0 - γ  ( 2 ) / γ  ( 6 ) 0 1 ] =  [ γ  ( 6 )  [ γ  ( 1 ) - γ  ( 7 ) γ  ( 7 ) - γ  ( 1 ) ] 0 0 γ  ( 6 )  [ γ  ( 3 ) - γ  ( 5 ) γ  ( 5 ) - γ  ( 3 ) ] ] ( 7 ) the two blocks in the right - hand factor of equation ( 7 ) can each be rotated with 3 multiplication and 3 addition operations by the scheme such as described in feig and winograd . the left - hand factor of equation ( 7 ) produces 4 more multiplication and 4 more addition operations , bringing the total count to 10 multiplication and 10 addition operations . when combined with the 3 multiplication and 3 addition operations for g 2 , and the 24 addition operations for multiplication by h 8 , the entire computation requires 13 multiplication and 37 addition operations , and up to two normalization multiplications . six of the eight normalizations can be subsumed in the constants in v . the normalizations may also be subsumed within the image search operations or in color maps , depending on how the data are used . the operation count is reduced during the progressive factorization when calculating the thumbnails in the one - dimensional case . for instance , when calculating the thumbnail corresponding to the level 0 decompression level , the rows of r 4 ( equation ( 7 )) do not participate . at decompression levels 1 through 3 , the third row participates , then the first row , then rows two and four of equation ( 7 ). particularly , the progressive calculation starts the rotation , and holds the intermediate values for later iterations . thus , at decompression level 1 , the factorization starts two rotations . at decompression level 2 , it does the operations implied by two rows of the left - hand factor of equation ( 7 ). at decompression level 3 it completes the two partial rotations and does the operations implied by the two remaining rows of equation ( 7 ). the operation count for the progressive calculation of r 4 is thus 10 multiplication and 10 addition operations , which break down into 5 multiplication and 5 addition operations at level 1 decompression , 3 multiplication and 3 addition operations at level 2 decompression , and 2 multiplication and 2 addition operations at level 3 decompression . as demonstrated , early termination results in less work using the first sub - matrix factorization approach . in the second factorization approach , a sub - matrix g 4 is derived , such as demonstrated by feig and winograd and shown in equation ( 8 ) as : g 4 = [ γ  ( 5 ) γ  ( 7 ) γ  ( 3 ) γ  ( 1 ) - γ  ( 1 ) γ  ( 5 ) - γ  ( 7 ) γ  ( 3 ) - γ  ( 3 ) - γ  ( 1 ) γ  ( 5 ) - γ  ( 7 ) γ  ( 7 ) - γ  ( 3 ) - γ  ( 1 ) γ  ( 5 ) ] ( 8 ) in accordance with the factorization scheme demonstrated in feig and winograd , the sub - matrix q 4 can be set forth in accordance with equation ( 9 ). q 4 = [ 1 0 0 - 1 1 0 0 - 1 0 - 1 - 1 0 0 1 - 1 0 ]  g 4  [ 1 0 0 0 0 0 1 0 0 0 0 1 0 1 0 0 ] ( 9 ) it follows that q 4 can be factored in the same operations as g 4 with four more additions due to the left - hand factor of equation ( 9 ). thus , the final count for factorization of q 4 is 8 multiplication and 16 addition operations . when combined with the 3 multiplication and 3 addition operations for g 2 , and the 24 addition operations for multiplication by h 8 , the entire computation requires 11 multiplication and 43 addition operations with no other normalizations required for the full inverse . however , normalizations are necessary to produce the intermediate thumbnails . the thumbnail corresponding to level 1 decompression requires two shift operations and the thumbnail corresponding to level 2 decompression requires two multiplication operations . from equation ( 9 ), it follows that the second factorization approach also has a progressive realization . for instance , as shown in equation ( 9 ), the first two rows of the left - hand factor of q 4 depend only on the first and fourth rows of g 4 , and the last two rows of the left - hand factor q 4 depend only on the second and third rows of g 4 . this requires only a partial computation of the effect of the g 4 operation for the level 1 thumbnail , followed by computation of the remainder as required for the refined thumbnails . the operation count for the progressive calculation of equation ( 9 ) is 4 multiplication and 8 addition operations at level 1 decompression , 2 multiplication and 4 addition operations at level 2 decompression , and 2 multiplication and 4 addition operations at level 3 decompression , reducing the q 4 cost by a factor of 2 when the thumbnail search terminates at level 1 . it should be understood that the relative speed of the two factorization approaches described herein with respect to the one - dimensional case depends on the relative speed of multiplication and addition operations , with each approach being relatively equivalent in the instance of full decompression . however , the first factorization is likely to be the fastest when thumbnail images at decompression level 1 are calculated . the calculation of the inverse dct of equation ( 3 ) is now described for the two - dimensional case , which , as is understood , directly applicable to image processing applications . from equation ( 3 ) above , the 2 - d inverse dct is derived and set forth according to equation ( 10 ) as follows : d 8 × d 8 =( h 8 × h 8 ) ( v × v ) ( 10 ) the matrix v is computationally equivalent to the direct sum of i 2 , g 2 , and r 4 with g 2 defined above in equation ( 5 ) and r 4 defined above in equation ( 7 ). the computation of v × v breaks down into computations of all cross products for the direct sum components of v . table 1 is a summary of the operation counts per cross product . the cost of the matrix multiply by g 2 × g 2 is 2 multiplication operations , 10 addition operations , and 2 shift operations as derived from the feig and winograd reference . this doubles when taking the cross product with i 2 . the cost of each of the 2 × 2 blocks in equation ( 11 ) is 3 multiplication and 3 addition operations from the rotator operation described above . in this case , there are four rotations because of the cross product with i 2 resulting in a total cost of 16 multiplication operations , 32 addition operations , and 4 shift operations , as shown in table 1 . the matrix r 4 × r 4 can be written according to equation ( 12 ) as follows : r 4 × r 4 = s * p 16 ( i 2 × g 2 × g 2 × i 2 ) p 16 (( b 1 ⊕ b 2 )×( b 1 ⊕ b 2 )) ( 12 ) where the matrix s is the diagonal matrix whose diagonal is ( 1 , 1 , 1 − 1 , 1 , 1 , 1 ,− 1 , 1 , 1 − 1 ,− 1 ,− 1 ,− 1 , 1 ), the block matrices b 1 and b 2 are the sub - blocks found in the right - hand factor of r 4 from equation ( 7 ), and p 16 is the permutation matrix shown in equation ( 13 ) as : p 16 = [ i 4 0 0 0 0 0 i 4 0 0 i 4 0 0 0 0 0 0 ] ( 13 ) the factor of equation ( 12 ) containing g 2 requires four multiplications by g 2 × g 2 , which requires 2 multiplication operations , 10 addition operations , and 2 shift operations each , for a total of 8 multiplication operations , 40 addition operations , and 4 shift operations . the tensor products ( b 1 ⊕ b 2 )×( b 1 ⊕ b 2 )) of equation ( 12 ) breaks up into four cross products b 1 × b 1 , b 2 × b 2 , b 1 × b 2 and b 2 × b 1 . the first two of these factor in the same way that g 2 × g 2 factors to yield the identities shown in equations ( 14 ) and ( 15 ) as follows : b 1 × b 1 = [ 1 0 1 0 0 1 0 1 0 1 0 - 1 - 1 0 1 0 ]  [ γ  ( 3 )  γ  ( 5 ) - γ  ( 1 )  γ  ( 7 ) - γ  ( 1 )  γ  ( 7 ) - γ  ( 3 )  γ  ( 5 ) 0 0 0 0 ]  [ 0 0 1 0 0 - 1 0 0 0 1 1 0 1 / 2 0 1 0 0 1 0 1 / 2 0 1 - 1 0 ] ( 14 ) b 2 × b 2 = [ 1 0 1 0 0 1 0 1 0 1 0 - 1 - 1 0 1 0 ]  [ γ  ( 1 )  γ  ( 7 ) - γ  ( 3 )  γ  ( 5 ) γ  ( 3 )  γ  ( 5 ) γ  ( 1 )  γ  ( 7 ) 0 0 0 0 ]  [ 0 0 1 0 0 - 1 0 0 0 1 1 0 1 / 2 0 1 0 0 1 0 - 1 / 2 0 1 - 1 0 ] ( 15 ) each of these identities requires 3 multiplication operations , 11 addition operations , and 2 shift operations . the other two cross products can be computed by nesting the rotator relationship as described above . the final count for the full calculation of r 4 × r 4 breaks into 8 multiplication operations , 40 addition operations , and 4 shift operations for g 2 × g 2 , 6 multiplication , 22 addition and 4 shift operations for the first two cross products b i × b i , and 18 multiplication and 30 addition operations in the remaining two cross products . the total cost to multiply by v × v is thus 120 multiplication operations , 216 addition operations , and 22 shift operations . to produce the level 1 thumbnail , a further 128 addition and 128 shift operations are required after doing the v × v calculation . the level 2 and level 3 thumbnails each require 128 more addition and shift operations . the entire inversion requires 118 multiplication operations , 602 addition operations , and 402 shifts , as shown in table 1 . it should be understood that a computational trade - off exists and that skilled artisans may devise ways to lower the addition operation count by selecting approaches that increase the multiplication count . the factorization has various progressive forms that are more efficient when early termination is likely . the progressive form , as described herein , allows computational savings when early termination is possible . further computational savings is realized by computing the level 1 and 2 thumbnails directly , and terminating the computation at that point without producing the full resolution dct inversion . the level 0 thumbnail is already known as being directly available in the dct by extracting the zero frequency terms from each of the 8 × 8 blocks . the level 1 thumbnail is obtained in one dimension with only 4 multiplication and 5 addition operations as now described : letting t 1 be the matrix of equation ( 16 ): t 1 = [ 1 0 0 0 0 0 0 0 0 γ  ( 1 )  γ  ( 2 ) 0 - γ  ( 3 )  γ  ( 6 ) 0 γ  ( 5 )  γ  ( 6 ) 0 - γ  ( 2 )  γ  ( 7 ) ]   then  ( 16 ) t 1  c 8 = ( 1  8 )  [ 1 1 1 1 1 1 1 1 1 1 1 1 - 1 - 1 - 1 - 1 ]   and ( 17 ) ( 1 / 2 )  h 2  t 1  c 8 = ( 1  8 )  [ 1 1 1 - 1 ]  t 1  c 8 = ( 1 / 4 )  [ 1 1 1 1 0 0 0 0 0 0 0 0 - 1 - 1 - 1 - 1 ] ( 18 ) the normalization factor 1 /{ square root over ( 3 )} can be incorporated in the second row of t1 . however , the normalization of the first row will require one more multiplication operations if it cannot be absorbed elsewhere . to compute the level 2 thumbnail in the one - dimensional case , use is made of the level 1 thumbnail computation which is incorporated into the matrix w set forth in equation ( 19 ) as follows : w = [ 1 0 0 0 0 0 0 0 0 γ  ( 1 )  γ  ( 2 ) 0 - γ  ( 3 )  γ  ( 6 ) 0 γ  ( 5 )  γ  ( 6 ) 0 - γ  ( 2 )  γ  ( 7 ) 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 ] ( 19 ) the first two rows of w are the rows of t 1 and the remaining six rows permute components of a vector that it multiplies . two additional intermediate components of the level 2 thumbnail are obtained by using the matrix t 2 defined in equation ( 20 ) as follows : t 2 = [ 1 / 8 0 0 0 0 0 0 0 0 γ  ( 6 )  γ  ( 6 ) 0 0 0 0 γ  ( 3 )  γ  ( 6 ) - γ  ( 5 )  γ  ( 6 ) 0 1 / 8 0 0 0 0 0 0 0 0 γ  ( 2 )  γ  ( 4 ) / 2 0 - γ  ( 4 )  γ  ( 6 ) / 2 0 0 0 ] this matrix has the following property : t 2  wc 8 =  ( 1 / 8 ) =  [  1 1 1 1 1 1 1 1 1 1 - 1 - 1 1 1 - 1 - 1 1 1 1 1 - 1 - 1 - 1 - 1 1 1 - 1 - 1 - 1 - 1 1 1 ]   ( 1 /  4 )   ( h 2 × h 2 ) × [  1 1 ] ( 20 ) where h 2 is the hadamard matrix of order two ( 2 ) as described above . the level 2 thumbnail is computed from equation ( 20 ) and some operations can be saved because the level 1 thumbnail is already computed . to generalize the foregoing , given an eight ( 8 ) vector x whose dct is y , the matrix product is calculated as : 2  ( h 2 × h 2 )  t 2  wy =  2  ( h 2 × h 2 )  t 2  wc 8  x =  2  ( h 2 × h 2 )  ( 1 / 4 )  ( ( h 2 × h 2 ) × [ 1 1 ] )  x =  ( 1 / 2 )  [ 1 1 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 1 ]  x . ( 21 ) the reduced product follows directly from the fact that the h 2 is self inverse . equation ( 21 ) suggests that the operations required to compute the level 2 thumbnail are those in h 2 × h 2 and t 2 , however better results can be achieved because the level i thumbnail contains some operations within the matrix h 2 × h 2 . h 2 × h 2 factors into h 2 × h 2 =  ( h 2 × i 2 )  ( i 2 × h 2 ) =  ( h 2 × i 2 )  [ 1 0 0 0 0 1 0 0 0 0 1 1 0 0 1 - 1 ]  [ 1 1 0 0 1 - 1 0 0 0 0 1 0 0 0 0 1 ] =  ( h 2 × i 2 )  ( i 2 ⊕ h 2 )  ( h 2 ⊕ i 2 ) ( 22 ) equation ( 22 ) shows how the kronecker products break out into products of direct sums of h 2 and i 2 . the factor h 2 × i 2 in equation ( 22 ) also factors into similar products of row permutations of direct sums of h 2 and i 2 . when broken into four factors , the various pairs of the four factors of equation ( 22 ) commute , and allow for performance of the matrix multiplication with any specific factor performed first . one of the four factors is equivalent to the multiplication done in equation ( 18 ). the computation can be arranged to do this factor first , and because it is performed for the level 1 thumbnail its result can be reused for the level 2 thumbnail without repeating its operations . thus , only 6 addition operations are required to do the level 2 thumbnail . the additional cost of computing the level 2 thumbnail is 5 multiplication operations , 3 addition operations , and two normalization multiplications for the multiplication by t 2 and 6 addition operations for equation ( 22 ). the total for both thumbnails is 9 multiplication and 14 addition operations , and up to 3 additional normalization multiplications if they are required . for two dimensions , the level 1 thumbnail uses the matrix t 1 × t 1 , to create the four sums of the 4 × 4 disjoint subblocks of the 8 × 8 blocks of pixels . the four sums are the components of the column vector produced by multiplying the dct of a block of pixels by ( 1 / 4 )  ( h 2 × h 2 )  ( t 1 × t 1 ) = ( 1 / 8 )  [ 1 1 1 1 1 1 - 1 - 1 1 - 1 1 - 1 1 - 1 - 1 1 ]  ( t 1 × t 1 ) ( 23 ) expansion of t 1 × t 1 shows that it has 24 non unit multipliers so that only 24 multiplication operations are required . one row has 1 nonzero term , two rows have 4 nonzero , and one row has 16 nonzero , thereby requiring 21 addition operations . the left factor of equation ( 23 ) requires 8 more addition and 4 shift a operations to produce a total of 24 multiplication operations , 29 addition operations , and 4 shift operations for the level 1 thumbnail in two dimensions . the level 2 thumbnail computes ( h 2 × h 2 × h 2 × h 2 ) ( t 2 × t 2 ) ( w × w ) x , but the level 1 thumbnail has already produced most of the components of ( w × w ) x and some of the operations in ( h 2 × h 2 × h 2 × h 2 ). there are 39 multiplication and 27 addition operations required to complete ( w × w ) x . the remaining cost for the level 2 thumbnail are the operations in ( h 2 × h 2 × h 2 × h 2 ) and t 2 × t 2 . the factor t 2 × t 2 requires 25 multiplication and 21 addition operations because its four rows have 9 , 6 , 6 , and 4 nonzero , respectively . the factor ( h 2 × h 2 × h 2 × h 2 ) requires 64 addition operations , but by using a factorization similar to the one in equation ( 22 ), one can reuse the operations already performed to compute the level 1 thumbnail . this reduces the number of addition operations to 56 . thus , the level 2 thumbnail requires 64 multiplication and 104 addition operations after computing the level 1 thumbnail , and the two thumbnails require a total of 88 multiplication operation operations , 133 addition operations , and 4 shift operations , which is much less costly than the full inversion of the 2 - d dct . the foregoing merely illustrates the principles of the present invention . those skilled in the art will be able to devise various modifications , which although not explicitly described or shown herein , embody the principles of the invention and are thus within its spirit and scope .	7
the present invention discloses desirable laminate structures which have a biocide associated with the laminate such that it can be used as packaging material or as packaging tape with enhanced performance compared to laminates or tapes that do not contain a biocide . this renders the material eminently suitable for packaging food items or other perishable commodities while protecting them from attack or deterioration cause by various organisms . in this specification , the term “ organism ” is used to mean an animal , insect or other pest , bacterium , fungus , mold , mildew , virus or other biological contaminant that can detrimentally affect a food or similar perishable commodity , while the term “ biocide ” is used to refer to any agent such as an insecticide , pesticide , fungicide , moldicide , mildicide or viricide , which can eradicate , eliminate or ward off such organisms . organic biocides , such as alkali salts of organic acids such as benzoic , acetic and the like can be used , with sodium acetate and sodium benzoate being particularly preferred . also , inorganic biocides include the inorganic salts of oxidizing agents , such as sodium chlorate . arsenic compounds , organophosphorous compounds , heavy metal compounds , sulfur compounds and tin compounds are suitable as biocidal components . those of ordinary skill in the art can select the desired biocide for the intended use of the biocide containing laminate as well as for its intended incorporation in the final article . the biocide can be associated with the laminate in any one of a variety of ways , so that an amount is present which is effective to render the laminate resistant to attack by such organisms . the specific method for associating the biocide with the laminate will vary depending upon the form of the laminate . in one embodiment , a paper - plastic laminate is used . this laminate is formed by cold laminating a paper ply to a plastic film that has been treated by a corona discharge to render it receptive to adhesives . the paper that is used to form these laminates can be any kind of paper , which includes coated paper , kraft paper , or a higher quality paper such as bond or white paper . these papers generally have a thickness of from about 3 to 6 mils although other thicknesses can be used for certain specialty applications . a single plastic film is adhesively cold laminate to the paper to form the laminate . the plastic film that is used is preferably a polymer and is most preferably polypropylene , polyethylene or polyester . it typically has a thickness of from about 0 . 5 to about 3 mils although other thicknesses can be used without departing from the teachings of the invention . it is advantageous to use a plastic film that is oriented , and preferably biaxially - oriented , so that it can provide exceptional tensile and burst strengths . such orientation is effected by stretching the film along at least one and preferably both of their transverse and horizontal axes to molecularly orient the film structure . preferred plastic materials include polypropylene or polyester ( i . e ., mylar ). the resultant oriented films material have a sufficiently high tensile strength to easily and securely retain materials within the package or container during shipping and handling . in order to join the plastic film to the paper web , the surface of the plastic film that is to be laminated to the paper is corona - discharge treated . this treatment is applied to the plastic film immediately before the corona discharge treated surface is adhesively cold laminated to the paper web . this enables a strong bond to be achieved between the plastic and paper in the laminate . the cold lamination process enables the present laminate material to be manufactured at much higher speeds than when other adhesives , such as hot melt adhesives , are utilized , due to the additional time required for cooling of the hot melt adhesive before a secure bond is achieved . if hot melt adhesives were used instead of cold lamination for joining the plastic film to the paper , the heat of the adhesive could also cause the film to shrink , thus causing a loss of strength . also , hot melt adhesives do not achieve a final bond strength until the adhesive cools , and the plastic film can shrink before this happens . moreover , a wrinkled or curled product often results due to the difference in the high strength and low strength areas of the plastic film . the use of cold lamination is especially advantageous when an oriented or biaxially - oriented plastic film is utilized . it is known that at elevated temperatures , such films relax and lose molecular orientation and strength . for example , when two sheets of biaxially - oriented polyester film are seamed together , using an ultrasonically - activated sealing bar to create internal friction and heat within the film , the films soften and fuse , with a resultant sealing line that is weak , such that the sheets then tend to tear along this line . similar problems are encountered if an oriented film is exposed to high heat , such as if a hot melt adhesive would be used to join the film to the paper . accordingly , cold lamination utilizing a water - based adhesive is essential in order to produce a laminate that has high strength . the paper layer absorbs the water from this adhesive system so that a high strength lamination can be rapidly achieved . while any water - based adhesive can be used to make this type of high strength bond , it has now been found that a formulation that rapidly sets to provide initial tack to the adhesive is necessary . suitable initial tack means that the adhesive can hold an oriented plastic film in position against the paper web without slippage within 10 seconds of application of the adhesive , and preferably within about 5 seconds . essentially instantaneous tack is highly desirable , since this enables even faster production speeds to be utilized . u . s . pat . no . 5 , 244 , 702 provides further details on this cold lamination process , and is incorporated herein to the extent necessary to further understand this feature of the invention . if a rapidly setting adhesive is used , however , much higher production speeds can be achieved . in another embodiment , a plastic / paper / plastic laminate is used . the same paper layer described above is used , with a plastic film adhesively cold laminated to each side of the paper . the plastic films that are used to form the outer layers of these laminates is the same as those described above for the paper / plastic laminate . in yet another embodiment , two plastic films can be cold laminated together after the facing sides of each film are corona - discharge treated . these can be joined together as disclosed in u . s . pat . no . 6 , 348 , 246 , the entire content of which is expressly incorporated herein by reference . when two plastic films are present in the laminate , the cold lamination process is much more useful compared to other processes to make such laminates . for example , organic solvent based adhesives cannot be used because there is no outlet for the solvent to evaporate from the laminate . also , certain solvents can attack and soften the plastic films to cause loss of strength . the adverse health and environmental effects are avoided because such solvents are not used . also , additional costs for recovering or disposing of solvents are not incurred . in any of the embodiments that include a paper layer , the biocide can be applied to the paper layer before cold laminating it to the plastic film or films . an aqueous solution of the biocide can be made and the paper can be dipped into , or sprayed or brushed with the solution . the concentration of the biocide in the solution should be such that a sufficient amount is present in the paper to prevent attack by the organism . one of ordinary skill in the art can determine by routine testing as to how much of the biocide is needed depending upon the type and properties of the specific compound that is used . the particular amount to be used can be determined by routine testing , but would be on the order of about 1 ppm to about 5 % by weight of the laminate , and preferably about 100 ppm to about 1 % by weight of the laminate . the biocide does not have to be fully dissolved in the solution , as a suspension , dispersion or other mixture of the biocide is also suitable . whether the mixture of biocide and water is a solution , suspension or dispersion depends somewhat upon the solubility of the particular biocide compound that is used . if necessary , a surfactant or other dispersing agent can be used to assist in keeping the biocide dispersed or dissolved in the solution so that it can be relatively uniformly applied and distributed onto or into the paper . after application , it is preferable for the paper to dry before being laminated as it is advantageously used to absorb some of the water from the water - based adhesive that is used for the cold lamination step . another way of associating the biocide with the laminate is to include it in the water that is used to prepare the water - based adhesive that is used for cold laminating a paper ply to a plastic film or for laminating two plastic films together . again , the adhesive can be in the form of a solution , dispersion , suspension or other mixture , and surfactants or dispersing agents can be included if desired . in general , any of the adhesives disclosed in u . s . pat . nos . 5 , 244 , 702 or 5 , 686 , 180 can be utilized . the incorporation of the biocide in the paper layer or in the adhesive that is used to join the paper layer to the plastic film enables the biocide to be protected in a central portion of the laminate . when incorporated in the paper layer and the bonding adhesive that is used to attach the laminate to a package is applied to the paper layer , the biocide containing paper is protected by the water - based adhesive and plastic film on one side and by the bonding adhesive on the other side . when incorporated in the water - based adhesive , the biocide - containing adhesive is protected by the paper layer on one side and the plastic film on the other side . even when the bonding adhesive is applied to the plastic film and the biocide is incorporated into the paper , the exposed paper layer has better resistance to loss of biocide than if the biocide was applied to the bonding adhesive . this is particularly true when the biocide - containing paper is dried prior to formation of the laminate . the water - based laminating adhesive is applied at an amount of about 4 to 10 pounds per ream of paper . since the solids content of the adhesive is approximately 50 %, the adhesive introduces approximately 2 to 5 pounds of water per ream of paper . the paper layer absorbs such moisture and enables the laminate to be prepared by simultaneous lamination . also , the rapid setting and generation of tack by the preferred adhesives of the invention enables the oriented plastic films to adhere to the paper or each other without slippage or loss of stretch of the films . further details on the additional adhesives that can be utilized in this invention , along with their method of manufacture , can be found in u . s . pat . no . 5 , 686 , 180 , the content of which is expressly incorporated herein by reference thereto . the method of manufacturing of the plastic - paper laminate is advantageously conducted in one step , with the plastic film being exposed to ionization on the surface that faces the paper web , the water - based adhesive is applied to the activated surface of the film , and then the film is applied to the paper web as they pass between the pressure rolls . u . s . pat . no . 5 , 244 , 702 includes additional details about the manufacture of these type products , and is incorporated herein by reference to the extant necessary to understand such manufacturing details . additional layers or plies can be added to the laminate as taught therein , i . e ., that any plastic film surfaces to be joined are first corona - discharge treated while no special treatments are needed for the paper ply except to assure that it is somewhat dry before being laminated . in certain specialty applications , an additional paper layer can be applied to one or both of the outer surfaces of the plastic films of the laminate . as the additional paper layer ( s ) form the inner and / or outer sides of the laminate material , they can easily be printed with graphics or other indicia . this enables the laminate material to have one appearance on the outside of the envelope and another , different appearance on the inside of the envelope . furthermore , the formation of a plastic - paper - plastic laminate enables the biocide to be incorporated in the paper layer or in one of the water - based laminating adhesives while being protected by the two outer plastic films . if a decorative laminate material is desired , a metallization or aluminization step can be applied to one or both of the plastic films to provide a decorative finish . also , when clear plastic is used for one or both of the films , the metallization can be applied to one or both surfaces of the paper layer and be viewable through the clear plastic film ( s ). one or both of the plastic films also can be metallized on the surface that is bonded to the paper so that the decorative finish is visible through the clear plastic film . if a silver finish is desired , an aluminized surface is preferred . other metallizing treatments , e . g ., with copper , iron , or alloys , can be used when other colors are desired . also , the plastic films can be colored or tinted to provide additional color effects . it may be desirable that the laminate be provided with printable surfaces so that logos , messages , advertisements , emblems , trademarks or simply , addressee information etc ., may be printed on the exterior or interior surfaces of the laminate . in this regard , the paper ply layer includes printable surfaces . the laminate , if desired , may include a printable surface of metallized paper . further , one or both of the plastic films may include a second corona discharge treated surface to render it receptive to inks so that it may exhibit graphics that may be desired . the outer surface of one or both of the plastic films may be metallized as by vacuum deposition to provide a decorative finish or to further provide a printable , decorative exterior . after the laminate sheeting material is formed into the final product , an envelope for example , a flap can be provided with an adhesive band . the adhesive may be a standard starch adhesive or a pressure sensitive adhesive . also , the band may be a layer of cohesive material and , if so , a corresponding band of cohesive material is applied onto the portion of the envelope that is contacted by the flap . since the cohesive material only sticks to itself , the exposed bands of cohesive do not stick to other portions of the envelope . thus , the envelopes can be stacked or otherwise collected and collated without concern of the envelopes sticking together and no barriers are required to prevent the envelopes sticking to itself or other envelopes when a plurality of envelopes are stacked and packaged . the laminate sheeting material can be used as is as a packaging material and can be wrapped about an article or item to be shipped . the laminate can form a seal around the article if secured by tape . in particular , a tape made from the laminate of the invention is preferred since the article to be shipped would be sealed with biocide containing material wither in the form of a laminate or tape . when a tape product is to be made , the laminate is provided with an adhesive on one of its outer sides . if the outer side is a paper layer , no special treatment is needed , while if it is a plastic film , it will be corona - discharge treated as described herein before the adhesive is applied . any of a wide variety of adhesives can be used for this purpose , but water - moistenable , pressure - sensitive , or heat - activated adhesives are preferred . in some cases , a cohesive adhesive can be used if the material it be envelope a product and stick to itself . also , the laminate sheeting itself can be provided with an adhesive on selected portions or all of one of its outer sides so that it can be adhere to itself or the article during wrapping of the package . when multiple layer laminates are utilized , the biocide can be applied to any paper layer or to any water - based adhesive that is used to cold laminate the layers together . multiple applications of the biocide may be preferred for certain applications where the highest degree of protection is desired . when the laminate is used as a packaging material , a tear line or weakened portion can be provided to assist in opening the package . the laminate can also be provided in the form of a pouch that can retain a liquid or solid food therein . this pouch , though illustrative of a flexible container fabricated of laminate sheeting in accordance with the invention is by no means the only form of pouch that can be so produced . thus , the pouch may be shaped and dimensioned to store potato chips , or candy and other solid food substances . or the pouch or container formed of the laminate sheeting may be designed to envelop and protectively package other non - food products that are more or less perishable . in these constructions the plastic layers generally provide resistance to moisture and a smooth surface for introducing items into the pouch or envelope or for handling the package . the paper layer can be preprinted with written material , colors , or other indicia on one or both sides so that information regarding the origination or mailer of the package or its manufacturer can be readily observed either as an outer layer or through the plastic layer . the paper layer can also be metallized on one or both sides for an enhanced appearance . for products where it is important to securely maintain the product contents therein , the use of a container made form a laminate that has two layers of plastic and which is sealed by a laminate in the form of a tape is preferred . these can be used to retain foods that can be affected by biological contamination or to retain waste such as sanitary napkin or air sickness bags or bags used to convey medical wastes . the plastic films in the laminates prevent the entry or exit of liquid or moisture from the container as well as preventing the ingress or egress of biological organisms . there may be certain situations where it is undesirable to have exposed interior or exterior plastic surfaces . these situations can be avoided by laminating additional paper layers to one or both of the exposed surfaces of the plastic films . these additional paper layers can be applied as described above with any of the laminates disclosed herein to thus provide final laminates of paper - plastic - plastic ; paper - plastic - plastic - paper ; paper - plastic - paper - plastic ; or paper - plastic - paper - plastic - paper . this demonstrates the versatility of the invention in providing the most desirable form of the laminate for any particular use . these constructions provide even more locations where the biocide my be incorporated while being protected by outer layers of plastic or paper layers . the salient advantages of the laminate in accordance with the invention include the waterproof properties of the resulting laminate , and the fact that the laminate can be converted into products by conventional equipment for this purpose with minimum scrap in a range in a range comparable to the scrap rate encountered in making paper envelopes and other dilatable container products . as paper sheets have a high affinity for standard printing inks , when these are included , the resulting laminate can readily be printed and colored . also , when a paper layer or sheet is provided on the exterior surfaces , a standard starch or pressure - sensitive adhesive may be used on the flaps of envelopes formed of these laminates . certain food products require that the container in which they are shipped have some degree of breathability , and in those situations , the container is not made of the laminates of this invention . instead , a conventional cardboard box may be used to hold the food product , and the laminate of the invention is made into a tape product that is used to seal the box to prevent or reduce the possibility of entrance of the organism . for example , a standard box that has four top and bottom flaps can be closed by folding the flaps and then is sealed by the application of the tape of the invention . organisms cannot gain access to the food product through the spaces between the flaps as those are covered by the tape . in some instances , the laminate of the invention can be applied as an adhesive backed sheet to provide , e . g ., moisture resistance to the bottom of the box for additional protection as it is shipped . in this embodiment , the laminate can be applied to either the inside or outside of the box . thus , a wide range of container designs can be made combining conventional materials , such as cardboard , and laminates according to the invention . additional examples of products according to the invention include cardboard boxes of fruit , grains , vegetables or other foods where the boxes are sealed with a tape comprising one of the laminates of the invention that includes a pressure - sensitive adhesive backing . in addition , certain foods that are shipped in the box , e . g ., bananas , can also be placed in pouches formed of one of the laminates of the invention . this provides the most secure protection of the product from the attack of organisms . while embodiments of the invention have been shown and described , it will be appreciated that many changes may be made therein without departing from the spirit of the invention . for example , the plastic films themselves can be colored or clear . coloration of the films can be made over the entire film or only on selective portions . metallization of the films can be provided in the same manner . when clear plastic films are utilized alone in a plastic - plastic laminate , the contents of the envelope or pouch are visible so that the recipient can readily determine what is included therein . this can be used for safety or quality control purposes .	0
this invention relates to novel substituted aromatic diamines and the use of these diamines in the preparation of polyimide oligomers and high molecular weight thermoplastic polyimides . the distinction of the diamine of this invention over the prior art is due to the 2 , 2 &# 39 ;- or 2 , 2 &# 39 ;, 6 , 6 &# 39 ;- substituted biphenyl radicals in the diamine which exhibit noncoplanar conformation , that enhances the solubility of the diamine as well as the processability of the polyimides derived therefrom , while retaining relatively high glass transition temperatures and better mechanical properties . an example of preparing the substituted aromatic diamines of this invention is the following : ## str5 ## to a 1000 ml of flask , 2 , 2 &# 39 ;- dimethylbenzidine dihydrochloride ( 53 . 4 g , 10 . 15 mol ) ( 1 ) was added as wet cakes , containing 26 % moisture , as received along with 200 ml . of distilled water and 30 ml . of concentrated hcl . the resulting heterogeneous reaction mixture was stirred at 0 ° c . then a solution of sodium nitrite ( 22 . 77 g , 0 . 33mol ) in 40 ml . of water was added dropwise to the above solution over the period of 1 hour at 0 ° c . under nitrogen to form diazonium salts . separately , a two phase solution containing 75 ml . of sulfuric acid in 250 ml . of water and 125 ml of 1 , 2 dichloroethane in a 2000 ml . round - bottom flask was stirred vigorously into a one phase system at 85 - 90 ° c . then the diazonium solution was added dropwise to the above two phase solution with very efficient stirring for 1 - 2 hours until no more nitrogen was evolved due to the decomposition of diazonium slats . during the process , the diazonium salts were decomposed by aqueous sulfuric acid to form the biphenol and were immediately extracted to the organic layer . the reaction mixture was cooled down , and the organic layer was separated and dried over magnium sulfate . the solvent was concentrated to half of its original volume and then cooled in the refrigerator overnight to induce crystallization . the resulting solids were collected and washed with 1 , 2 - dichloroethane / hexane = 15 / 85 to remove the dark color impurities to afford 19 . 66 g ( 62 %) as the first crop . mp = 106 - 108 ° c . 2 , 2 &# 39 ;- dimethylbiphenol ( 2 ) ( 42 . 8 g , 0 . 2mol ) was dissolved in 250 ml of n , n - dimethylformaide ( dmf ), and then potassium carbonate ( 60 . 8 g , 0 . 44 mol ) and 4 - fluoronitrobenzene ( 59 . 22 g , 0 . 42 mol ) were added . the reaction mixture was heated to reflux for 20 hours overnight . the reaction mixture was filtered to remove potassium carbonate , then the solution was concentrated to 1 / 3 of its original volume in a rotary evaporator . subsequently , water was added to the dmf solution to precipitate out the product in quantitative yield , and then the product was washed with ethanol to remove trace of unreacted 4 - fluoro - nitrobenzene . the crude product ( mp = 146 - 147 ° c .) is pure enough for next step . 4 , 4 &# 39 ;- bis ( 4 - nitrophenoxy )- 2 , 2 &# 39 ;- dimethylbiphenyl ( 80 g ) was dissolved in 350 ml of dmf and added carefully to a hydrogenation bottle containing 8 gm of 5 % pt / c . the solution was subjected to hydrogenation at 100 ° c . for 3 hours . then 100 ml of water and 3 g of decolorizihg charcoal were added and heated for 5 min . the solution was then filtered through a celite pad and 1000 ml of water was added . the reaction mixture became a mixture of fluffy solid and a sticky resin and was stirred for 1 hour to give a tan colored solid . the solid was removed by filtration , crushed with a mortar and pestel and then stirred with 1000 ml of water for 1 hour . the solid was collected by filtration and dried to afford 59 . 2 g ( 85 %) of the product mp = 140 ° c . the following is an example of preparing a polyimide of this invention . 4 , 4 &# 39 ;- bis ( 4 - aminophenoxy )- 2 , 2 &# 39 ;- dimethylbiphenyl ( 0 . 99 g , 2 . 5mmol ) and 3 , 3 &# 39 ;, 4 , 4 &# 39 ;- benzophenonetetracarboxylic dianhydride ( 0 . 8 g , 2 . 5 mmol ) were mixed with 10 g of dry n - methyl - 2 - pyrrolidinone ( nmp ), and the reaction was stirred at room temperature overnight under nitrogen to obtain very viscous poly ( amic acid ) solution . the viscous solution was heated to reflux at 200 ° c . for 2 - 3 hours . the resulting polyimide solution was diluted with additional dry nmp to the consistency of a maple syrup , and then precipitated into ethanol to obtain colorless fibers . more specifically , the aromatic diamines of formula i can be polymerized with effective amounts of at least one aromatic tetracarboxylic acid , the anhydrides or the esters of said tetracarboxylic acid to obtain the corresponding polyimides . the process of preparing the thermoplastic , high molecular weight polyimides ( n = 2 to 100 ) of this invention is described by the reaction of a dianhydride and the aromatic diamine of formula ( 1 ) as follows : ## str7 ## the ar group indicates an aliphatic or aromatic radical having a valence of four . ## str8 ## an alternative embodiment of this invention includes the preparation of polyimide copolymers containing the aromatic diamine of formula i . for example , a mixture of two or more different dianhydrides or two different diamines can be used where at least one of them is the diamine of formula i . specific examples of the preferred anydrides which may be employed in this invention includes pyromellitic dianhydride , 4 , 4 &# 39 ;-( hexafluoroisopropylidene )- bis ( phthalic anhydride ), 3 , 3 &# 39 ;, 4 , 4 &# 39 ;- benzophenonetetracarboxylic dianhydride , 2 , 3 , 3 &# 39 ;, 4 &# 39 ;- benzophenonetetracarboxylic dianhydride , 3 , 3 &# 39 ;, 4 , 4 &# 39 ;- biphenyltetracarboxylic dianhydride , 2 , 3 , 3 &# 39 ;, 4 &# 39 ;- biphenyltetracarboxylic dianhydride , bis ( 3 , 4 - dicarboxyphenyl ) ether dianhydride , bis ( 3 , 4 - dicarboxyl ) sulfone dianhydride , 4 , 4 &# 39 ;-( p - phenylenedioxy ) diphthalic anhydride , 1 , 2 , 5 , 6 - naphthlenetetracarboxylic dianhydride , 2 , 3 , 6 , 7 - naphthlenetetracarboxylic dianhydride , 1 , 4 , 5 , 8 - naphthalenetetracarboxvylic dianhydride etc . and the corresponding tetracarboxylic acids or esters . in addition , the polyimide oligomers of this invention can be prepared with an aromatic dianhydride , its diester or diacid reacted with the diamine of formula i and a chain stopping reactant capable of further crosslinking . these reactants can be mixed in the ratios needed to obtain the polyimide oligomers of formula iii . the oligomers can undergo further crosslinking through the reactive units associated with endcap e as follows : ## str9 ## in the above reaction , e can be an unreactive chain blocker such as aniline or a phthalic ester or phthalic anhydride . e can also be a reactive unit wherein e further crosslinks with linear oligomeric chains to form a network iv . specific examples of some preferred reactive units or reactive endcaps ( e ) are as follows : ## str10 ## the use of the aromatic diamine of formula i improves the processability of the resulting polyimides while retaining a relative high tg , and thereby raises the usefuil temperature range . furthermore , higher t g generally translated into better mechanical properties over useful temperature ranges . specific examples of the preferred aromatic diamines of this invention for purposes of preparing the thermoplastic polyimides of this invention include : ## str11 ## one of the objects of this invention was to evaluate several resins for 500 - 550 ° f . applications , see table i , using a solvent assisted resin transfer molding ( rtm ) process . pmr - 15 , apdb - 20 and amb - 21 polyimide composites were prepared from 3 , 3 &# 39 ;, 4 , 4 &# 39 ;- benzophenone tetracarboxylic acid , dimethyl ester ( btde ) and each respective diamine ; namely , 4 , 4 &# 39 ;- methylene dianiline ( mda ), 4 , 4 &# 39 ;- bis ( 4 - aminophenoxy )- 2 , 2 &# 39 ;- dimethylbiphenyl ( apdb ) and 2 , 2 &# 39 ;- bis [ 4 -( 4 - aminophenoxy ) phenyl ] propane ( bapp ), using nadic acid ester ( ne ) as the endcap . alternately , bapa - 16 composites were prepared from bisphenol - a tetracarboxylic acid , dimethyl ester , p - phenylenediamine ( p - pda ) and nadic ester ( ne ). the glass transition temperature ( t g ), the thermo - oxidative stability and the mechanical properties of these polyimide / carbon fiber ( t650 - 35 ) composites were compared to pmr - 15 ; see the data in table ii . monomer solutions of the polyimides ( table i ) were prepared from 50 wt % methanol or methanol - acetone . the prepreg tapes were made by brush application of monomer solution onto drum - wound t650 - 35 carbon fibers , and subsequently dried . the laminates were then fabricated from 12 plies of unidirectional prepreg by a simulated autoclave preocess . the t g of these polyimide composites were measured by dynamic mechanical analysis ( dma ) on a rheometrics rms 800 and thermal mechanical analysis ( tma ). the dma and tma data ( table ii ) shows that apdb - 20 composites display higher t g than either amb - 21 or bapa - 16 , because the 2 , 2 &# 39 ;- dimethylbiphenyl moiety is more rigid than the isopropylidene [- c ( ch 3 ) 2 -] group present in amb - 21 and bapa - 16 . furthermore , the two methyl substituents on apdb - 20 forces the biphenyl rings into adopting a noncoplanr conformation , which enhances the solubility of the apdb - 20 diamine and the processability of the apdb - 20 oligomers . essentially , apdb - 20 polyimide can be processed like amb - 21 . the mechanical properties of pmr - 15 , apdb - 20 and amb - 21 composites at 550 ° f . follow the trend of higher t g &# 39 ; s leading to better mechanical properties in the order of pmr - 15 & gt ; apdb - 20 & gt ; amb - 21 . the isothermal aging study at 500 ° f . ( 288 ° c .) indicated that apdb - 20 exhibited higher weight loss , but still retained about 70 % of mechanical properties compared to pmr - 15 . this phenomenon is atibuted to the loss of methyl substituents on apdb - 20 due to thermo - oxidative degradation , however , the polymer backbone apparently still remains intact . when testing at 500 ° f . ( 260 ° c . ), apdb - 20 , amb - 21 and bapa - 16 all displayed comparable initial mechanical properties , except the flexural strength is slightly lower in bapa - 16 . table i - repeating endcap dimethyl esters diamine unit ( n ) molar 2 n n + 1 2 ratio apdb - 20 ## str12 ## ## str13 ## ## str14 ## amb - 21 ne btde ## str15 ## pmr - 15 ne btde ## str16 ## 2 . 087 bapa - 16 ne ## str17 ## ## str18 ## table ii______________________________________tg &# 39 ; s of polyimide composites by dma . sup . a and tma . sup . b property g &# 39 ; ( onset ). sup . c ° c . tan δ ° c . tma ° c . resin npc . sup . d apc . sup . e npc apc npc apc______________________________________apdb - 20 282 307 320 334 269 307 amb - 21 241 280 270 304 243 278 bapa - 16 277 281 306 308 252 273 pmr - 15 345 348 375 376 320 348______________________________________ . sup .. sup . a dma = dynamical mechanical analysis at a heating rate of 5 ° c ./ min by a rheometric rms 800 , using a torsional rectangular geometry at 1 hz and 0 . 05 % tension . . sup . b tma thermal mechanical analysis by expansion probe , with 5 g load and a heating rate of 10 ° c ./ min . . sup . c g &# 39 ; = onset decline of strorage modulus . sup . d npc = no postcure . sup . e apc = air postcure at 600 ° f . ( 315 ° c .) for 16h . in comparison , the apdb - 20 polyimide , which contains 2 , 2 &# 39 ;- dimethyl biphenyl moiety , exhibited higher t g and mechanical properties than amb - 21 or bapa - 16 , that consisted of the flexible isopropylidene group . although the ether linkages in these polyimides tend to improve the processability , they generally result in lower t g and poorer thermo - oxidative stability , in comparison to pmr - 15 . the polyimide and carbon fiber composites of this invention can be used as a lightweight replacement for metallic components in the aerospace field , due to their outstanding thermo - oxidative stability and mechanical properties . the polyimide matrices offer better property retention over epoxies or bismaleimides in high temperature environment . the polyimide composites are often fabricated using hand lay - up laminates by vacuum bag autoclave or compression molding methods , instead of injection or resin transfer molding ( rtm ). carbon fibers which can be used with polyimide include acrylic carbon fiber , rayon - based carbon fiber , lignin - based carbon fiber and pitch - based carbon fiber . the form of carbon fiber can be chopped strand , roving and woven fabric . in order to apply the polyimide to the carbon fiber , the diamine monomer is dissolved in a solvent such as methanol , acetone , n , n - dimethylacetamide , or n - methyl - 2 - pyrrolidione . the amount of carbon fiber and polyimide resin are mixed to make the composition of this invention ranges from 10 to 70 parts by weight of the carbon fiber to from 90 to 30 parts by weight of the polyimide resin additives that can be incorporated with the polyimide composition of this invention includes talc , calcium carbonate , mica , and other fillers , glass fiber , ceramic fiber and other fibrous reinforcements . these additives can be used in amounts depending on the quality and performance of the composition . the polyimide resin composition can be processed into desired articles by injection molding , extrusion forming , transfer molding , compression molding and other known processing methods . the polyimide resin compositions of this invention have excellent mechanical strength at high temperatures and therefore can be used for mechanical parts which requires high mechanical strength at high temperatures . while this invention has been described by a number of specific examples , it is obvious that there are other variations and modifications which can be made without departing from the spirit and scope of the invention as particularly set forth in the appended claims .	2
referring now to fig1 there is illustrated a schematic diagram of the electronic circuit in accordance with the preferred embodiment of the present invention . seen on the left are a pair of telephone lines 10 and 12 suitably connected to terminals designated l1 and l2 . across the lines will be seen a conventional dialing means 14 for purposes well understood ; that is , to provide a series of pulses over the lines to switching equipment at a central station or the like . on the right of fig1 there will be seen a corresponding pair of lines 16 and 18 connected to another pair of terminals l3 and l4 and also connected to a buzzer device 20 . such buzzer device is a conventional one and operates normally to signal or indicate that an incoming call has arrived . the several terminals l1 , l2 , l3 and l4 are included as part of a container or package 22 as shown in dotted lines in fig1 such container serving for purposes of surrounding the various components utilized in accordance with the invention . this package 22 is also seen in fig2 interposed between a terminal block 24 , to which lines 10 and 12 are connected from terminals l1 and l2 , and the buzzer device 20 ; connection also being provided from terminals l3 and l4 to the buzzer device 20 . inside the package 22 there is included a capacitor 26 , such capacitor being one that is conventionally or normally supplied in series with a typical bell or buzzer such as the buzzer device 20 . it is simply included as part of the package 22 for convenience of wiring and interconnection with a conventional telephone device . as will be appreciated , the buzzer device 20 is connected as part of an ac circuit which can be traced from incoming line 10 and , by way of capacitor 26 , through the buzzer device and return by line 12 . in other words , the buzzer device is so connected that it will operate in all respects the same way it would have operated if the arrangement in accordance with the present invention had not been included in the circuit and if , instead of interposing the circuit of the present invention , the l1 terminal had been connected directly to capacitor 26 . however , in accordance with the present invention , a discriminating means or circuitry is provided within the package 22 . thus it will be seen that the terminal l1 is connected to the upper apex of a bridge rectifier device 30 , the upper apex being designated a while the lower is designated b and the left and right apexes are designated c and d . included in the bridge rectifier means are diodes 32 , 34 , 36 , 38 connected in conventional fashion . because of the conventional bridge rectifier connections , whereby the bridge rectifier 30 operates to provide full wave rectification , the required discriminating function can be achieved by the present invention through the arrangement designated 40 which includes a voltage divider network comprising resistors 42 , 44 . in shunt with resistor 44 there is connected a capacitor 46 which in turn is connected at its upper end to gate electrode 48 of a latching device 50 . this latching device would preferably be a silicon controlled rectifier of well - known design . the anode and cathode of device 50 are designated 52 and 54 , respectively . the discriminating means or circuit of the present invention operates to fulfill the criteria stated at the outset , namely , to prevent or preclude dial pulses or the like , which are short duration pulses , from affecting the buzzer device and causing false ringing or annoying &# 34 ; dial tap &# 34 ;. this is accomplished because when a dial pulse or a series of dial pulses is initiated across the lines 10 and 12 , such pulses are transmitted through the bridge rectifier 30 and are transmitted to the discriminating means per se ; namely , to the time delay arrangement provided by resistor 42 and capacitor 46 . the rc time constant of this part of the network is so chosen that insufficient charge will build up , during the short dial pulse period , on capacitor 46 , whereby insufficient bias voltage will appear on gate 48 of scr device 50 . hence , this device will remain in the non - conducting state and therefore will act to block such dial pulses so that they cannot be transmitted through capacitor 26 to the buzzer device 20 . the aforesaid dial pulses have a total time period of the order of 100 milliseconds ; however , as will be seen by reference to fig3 a , the only part of the pulse wave form 60 that could cause actuation of the buzzer is the first 30 milliseconds . accordingly , the rc values , that is , the values of resistor 42 and capacitor 46 , are selected with this factor in mind to prevent a build - up of charge on the capacitor 46 sufficient to trigger scr 50 . thus , it is required that a voltage of 0 . 8 volts build up on capacitor 46 to trigger scr 50 and this will not occur unless an incoming signal is applied for at least 100 milliseconds . moreover , in the case of a series of dial pulses , as also illustrated in fig3 a , there will be no integrational build - up of charge on capacitor 46 because resistor 44 will function to discharge capacitor 46 during the interval between pulses . in the event , however , that ringing tone or signal , as illustrated in fig3 b , appears on lines 10 and 12 , this ringing signal will be appropriately modified ; that is , it will be converted to pulsating dc by reason of bridge rectifier 30 . the ringing signal , however , will persist for a second or more , and will be transmitted with the slight imposed time delay of 100 milliseconds to the buzzer device 20 . this happens because charge will now build up sufficiently on capacitor 46 such that it reaches the threshold voltage of the gate electrode of latching device 50 . consequently , this device 50 will go into its conductive state and , therefore , a substantially short circuit will exist across the bridge terminals or apexes c and d once this happens . although charge will leak off capacitor 46 , that is , the capacitor will tend to become discharged and even approach the zero level , nevertheless the latching device 50 once having been actuated will remain on and will provide a continuous path for the ringing signal . the only difference from a conventional operation when the ringing tone or signal appears is that , as noted previously , there will be the initial time delay until capacitor 46 has charged up sufficiently . otherwise , the operation of the buzzer device is the same as it would be normally without the circuit of the present invention connected to it . in order to provide the man skilled in the art with a detailed set of specifications for practicing the electrical circuit , the following is provided : what has been disclosed in accordance with the present invention is an extremely simple , low - cost and effective discriminating means or circuit that eliminates the problem encountered when dial pulses are sent out on certain lines , in particular , telephone systems . the discriminating means is able to block the ac pathway when such short period pulses appear and to close such pathway when the desired ringing signals appear on the telephone lines . while there has been shown and described what is considered at present to be the preferred embodiment of the present invention , it will be appreciated by those skilled in the art that modifications of such embodiment may be made . it is therefore desired that the invention not be limited to this embodiment , and it is intended to cover in the appended claims all such modifications as fall within the true spirit and scope of the invention .	7
referring to fig1 , a vehicle 10 such as a minivan , sport utility vehicle , or other vehicle having seats that may be folded into a cargo - carrying configuration is illustrated . the vehicle shown in fig1 has a first row of seats 12 , a second row of seats 14 , and a third row of seats 16 . the roof 18 and hatchback 20 of the vehicle 10 is partially cut - away in fig1 to reveal the third row of seats 16 . the third row of seats 16 is provided with a plurality of weight sensor arrays 24 . for example , the third row 16 , as illustrated , has three weight sensor arrays 24 that are disposed in the base 30 of the third row seat 16 . the back 32 of the third row seat 16 is shown in its generally upright or seating position . referring to fig2 , a third row of seats 16 is shown with a child seat 36 in the seat 16 . child seats 36 are provided for transporting children and infants in a vehicle . child seats 36 are generally left in a vehicle when not in use and may be forgotten if an operator is not careful when using a power - folding seat . with manual folding seats , the operator must unlock and release the seat parts to fold the seat and will ordinarily be able to observe foreign objects such as a child seat 36 as the seat is folded into a cargo - carrying position . with recently developed power - folding seats , the seat folding operation begins with a push of a button , but an operator may forget that a child seat or other foreign object is on the seat . if a power - folding seat engages a foreign object as it is moved , it may damage the seat , the seat folding mechanism , or the object . fig2 shows a third row seat 16 that includes a base 30 and a seat back 32 that are shown in solid lines in an upright position and is shown in dashed lines in a partially folded position , and phantom lines in a fully folded position . in the upright position , the child seat 36 is secured to the seat 16 . as the seat begins to fold , the seat back 32 rotates in a counterclockwise direction , as shown in fig2 , to a position that would cause interference with the child seat 36 unless the child seat 36 is removed . the seat folding operation continues with the seat back 32 rotated so that load floor segment 44 is in a horizontal and lowered position with the foam portion 42 of the seat back 32 disposed in the rear stowage well 40 . in this position , the load floor segment 44 forms part of the load floor 46 of the vehicle 10 . referring to fig3 , a rear row of seats 16 is shown to include a base 30 and a back 32 . the base 30 includes a foam bun that forms a supporting seat body that is covered by fabric , vinyl , or leather , as is well known in the art . two weight sensor arrays 24 , made according to one embodiment of the invention , include a seat base support panel 50 and a plurality of weight sensors 52 . the weight sensors 52 are supported on two trays that hold the weight sensors 52 in openings 58 formed in the seat base support panel 50 . the weight sensors 52 are operatively connected to electronic seat controller 60 . the electronic seat controller 60 is interfaced with the seat control system , as will be more fully described with reference to fig5 below . referring to fig4 , an alternative embodiment of the rear seat 16 is shown to include a seat base 30 and seat back 32 , as previously described . the alternative embodiment of a seat base support panel 62 shown in fig4 supports weight sensors 64 that are retained on two trays 66 . the weight sensors 64 are interfaced with seat controller 68 . in fig3 and 4 , the weight sensors 52 and 64 are used to sense the presence of a foreign object on the seat 16 . if a foreign object of more than a predetermined weight is placed on the seat base 30 , the weight sensor will provide a signal to the seat controllers 60 and 68 . if during a seat movement procedure a lightweight object is on the seat and pressed against the seat , a signal may also be sent to the seat controllers 60 and 68 . referring to fig5 , a seat control system 70 is shown diagrammatically . operation of the seat control system 70 begins by actuating a control switch 72 . control switch 72 may be provided on the vehicle in one or more locations to allow operation of the seat folding system 70 by pressing a button on the dash or near a door . the control switch 72 may also be provided on a key fob , if desired . a microcontroller 76 controls operation of the seat control system 70 to operate a seat control circuit 78 . seat control circuit 78 controls one or more motors 80 that drive linkages supporting different parts of the seat 16 . instead of an electric motor 80 , the motor could be a linear motor or cylinder , depending upon the design of the seat 16 . a plurality of seat sensors 82 that may be arranged in an array of weight sensors 24 sense the presence of a foreign object on the seat 16 . the seat sensors 82 may be load cells or may be spring - biased elements that provide an output signal when an object of more than a predetermined weight is placed on the seat 16 . the seat sensors 82 may also be actuated by a lightweight object that is not more than the predetermined weight required to trigger the sensors . the lightweight object when contacted , or pinched , by the seat folding mechanism may provide an indication of a foreign object on the seat . for example , if the seat back 32 pivots to the position shown in dashed lines in fig2 , a lightweight object may be pressed into engagement with the seat base 30 sufficiently to cause the seat sensors 82 to provide an indication of a foreign object on the seat . a passive rf receiver 84 establishes a limited area around the vehicle 10 in which rf communication with a transponder 90 may occur . the limited area is shown in fig1 as a cross - hatched area surrounding the vehicle and extending around the vehicle , for example , from 4 to 10 feet away from the vehicle . the microcontroller 76 is connected to the vehicle bus by a seat - to - vehicle bus interface 86 . bus circuitry 88 is provided in the seat control system to integrate the seat electronics with vehicle electronics . the transponder 90 may be part of a key fob - type device . the transponder 90 includes a coil and an integrated chip that provides rf communication with the passive rf receiver of the vehicle . whenever the transponder 90 is within the limited range of the rf receiver , the transponder may be turned on and provide a rf signal to the passive rf receiver 84 . while the transponder 90 is within range , the seat control system 70 permits the microcontroller 76 to operate the seat control circuit and the motors 80 that drive the seat folding mechanism . a feedback apparatus 92 is provided as part of the seat control circuit 78 to provide an operator perceptible output that can warn the operator that the seat folding operation was not completed . the feedback apparatus 92 may provide an indication that a foreign object is on the seat or another reason for the failure of the seat to complete its seat folding operation . for example , the feedback apparatus may provide information to advise the operator that the seat folding operation was interrupted because the transponder 90 was moved outside of the limited transmission zone of the passive rf system . the feedback apparatus 92 may be provided on the vehicle dash as a text message or warning light . alternatively , the feedback apparatus 92 may be part of the transponder 90 that can provide a message in the form of an icon or text message indicating the status of the seat control circuit 78 . the feedback apparatus 92 could also be an audio output such as a voice message that is transmitted over the vehicle audio system . in another alternative , the feedback apparatus 92 could be a telephone dialer that dials a telephone number of an operator &# 39 ; s cell phone to provide an audio or visual message as to the status of the seat control circuit 78 or position of the seat 16 . while embodiments of the invention have been illustrated and described , it is not intended that these embodiments illustrate and describe all possible forms of the invention . rather , the words used in the specification are words of description rather than limitation , and it is understood that various changes may be made without departing from the spirit and scope of the invention .	1
fig1 is a plan layout diagram showing a first embodiment of the filter circuit according to the present invention . fig1 shows a microstrip line type filter circuit . a conductor strip is formed in a pattern as shown in the figure on the surface of a dielectric substrate 110 ( e . g ., sapphire substrate , mgo substrate ) and a ground conductor is formed over the entire back surface of the dielectric substrate 110 . the conductor and the ground conductor ( conductor part of the microstrip line type filter circuit ) are made of a material having a limit value in a current per unit area that can flow in a superconducting state , for example , superconductor . this filter circuit is incorporated in , for example , a freezer . an example of the microstrip line type filter circuit is shown here , but it is also possible to apply the present invention to other type filter circuits such as a coplanar line type . the power of a signal inputted from an input line 101 is distributed to a first signal and a second signal by a power distributor 103 . the first signal is transmitted to resonators 105 and 107 configured as transmission lines ( microstrip lines ) via a line 121 a . the second signal is transmitted to resonators 106 and 108 configured as transmission lines ( microstrip lines ) via a line 121 b . the joint between the input line 101 and the lines 121 a and 121 b corresponds to the power distributor 103 . the resonators 105 , 106 , 107 and 108 have resonance frequencies of f 1 , f 2 , f 3 and f 4 . suppose these resonance frequencies have a relationship of f 1 & lt ; f 2 & lt ; f 3 & lt ; f 4 . that is , the resonators 105 , 106 , 107 and 108 resonate at resonance frequencies different from each other . external q of the resonators 105 and 108 at both ends of the filter band ( pass band ) ( suppose the external q is the same on the input side and on the output side of the resonator here for simplicity of explanation , but the present invention also naturally includes a case where they are different ) is set to be greater than that of the resonators 106 and 107 on the center side ( the amount of group delay of the resonators 105 and 108 is greater than that of the resonators 106 and 107 ), and for this reason , the line widths of the resonators 105 and 108 are set to be greater than those of the resonators 106 and 107 to increase the power handling capability of the resonators 105 and 108 . the resonance frequency of a resonator can be measured by placing a probe for detecting radio wave close to the upper part of the resonator and measuring the return loss characteristic of a network analyzer . this makes it possible to arrange a resonator using a wide line to an end of the filter band . the amount of group delay of resonators can also be measured through measurement using a network analyzer likewise . the signal which has passed through the resonators 106 and 108 having resonance frequencies f 2 and f 4 is given to a power combiner 104 via a line 131 . the signal which has passed through the resonators 105 and 107 having resonance frequencies f 1 and f 3 is given to the power combiner 104 via a delay circuit ( line ) 109 which has an electric length of approximately 180 degrees at a center frequency of the filter circuit . this delay circuit 109 realizes a phase difference of 180 degrees at a point of combination between the signal which has passed through the resonators 105 and 107 having resonance frequencies f 1 and f 3 and the signal which has passed through the resonators 106 and 108 having resonance frequencies f 2 and f 4 . that is , the delay circuit 109 realizes a phase difference of 180 degrees ( opposite phases ) between the signals which have passed through the resonators of neighboring resonance frequencies . as will be described later , the neighboring signals may have substantially opposite phases , if not completely opposite phases , that is , a phase difference within a range of ( 180 ± 30 )+ 360 × n degrees ( n is an integer equal to or greater than 0 ). the amount of delay by the delay circuit 109 can be determined by adjusting the arrangement relationship between the resonators 105 , 107 and delay circuit 109 ( for example , length of the parts parallel to each other or distance from each other ). the power combiner 104 combines power of the signals given from the resonators 105 to 108 , acquires a combined signal and outputs the combined signal from an output line 102 . the joint between the output line 102 and lines 131 , 109 corresponds to the power combiner 104 . impedance matching when performing signal distribution at the power distributor 103 and signal combination at the power combiner 104 can be realized by making up a matching circuit using an impedance conversion circuit with a changed line width and elements of l and c . that is , impedance matching is realized in the case of distribution by adjusting the width of the input line 101 and the widths of the two lines 121 a and 121 b which branch from the input line 101 . on the other hand , impedance matching is realized in the case of combination by adjusting the width of the output line 102 and the widths of the two lines 109 and 131 leading to the output line 102 . an equivalent circuit of the filter circuit in fig1 is shown in fig2 . the elements in fig2 corresponding to the elements shown in fig1 are assigned the same reference numerals . an input terminal 11 corresponds to the part of the input line 101 which combines the lines 121 a and 121 b in fig1 . an output terminal 12 corresponds to the part of the output line 102 which combines the lines 131 and 109 in fig1 . a power divider 103 is combined with resonators 105 to 108 and the resonators 105 to 108 are cascade - connected with phase adjustment units 109 ( 1 ) to 109 ( 4 ). the cascade - connected resonator 105 and phase adjustment unit 109 ( 1 ) are referred to as a block bl ( 1 ). likewise , the cascade - connected resonator 106 and phase adjustment unit 109 ( 2 ) are referred to as a block bl ( 2 ). the cascade - connected resonator 107 and the phase adjustment unit 109 ( 3 ) are referred to as a block bl ( 3 ). the cascade - connected resonator 108 and the phase adjustment unit 109 ( 4 ) are referred to as a block bl ( 4 ). the phase adjustment unit 109 ( 1 ) is set so as to cause the signal passing through the block bl ( 1 ) to have a phase substantially opposite to the phase of the signal passing through the bl ( 2 ). the phase adjustment unit 109 ( 2 ) is set so as to cause the signal passing through the block bl ( 2 ) to have a phase substantially opposite to the phase of the signal passing through the bl ( 3 ). the phase adjustment unit 109 ( 3 ) is set so as to cause the signal passing through the block bl ( 3 ) to have a phase substantially opposite to the phase of the signal passing through the bl ( 4 ). the configuration of fig1 is , for example , equivalent to that in the case where the phase adjustment units 109 ( 2 ) and 109 ( 4 ) are set to 0 degrees and the phase adjustment units 109 ( 1 ) and 109 ( 3 ) are set to −( 180 ± 30 ) degrees . the phase adjustment units 109 ( 1 ) and 109 ( 3 ) correspond to the delay circuit 109 of fig1 . in the filter circuit shown in fig1 and fig2 , the aspect that signals passing through resonators of neighboring resonance frequencies are provided with a phase difference between substantially opposite phases and the aspect that the line widths of the resonators 105 and 108 are set to be greater than the line widths of the resonators 106 and 107 will be explained in detail respectively . first , the aspect that signals passing through resonators of neighboring resonance frequencies are provided with a phase difference between substantially opposite phases will be explained . fig5 shows an example of a filter circuit which includes two general resonators . this filter circuit is provided with an input terminal 301 , a power divider 303 , two resonators ( resonance circuits ) 305 and 306 , a power combiner 304 and an output terminal 302 . the resonator 305 has a resonance frequency f 1 and the resonator 306 has a resonance frequency f 2 . coupling m 2 denotes coupling between the resonator 306 and the power combiner 304 , m 1 ( 1 ) denotes coupling between the resonator 305 and the power divider 303 , m 1 ( 2 ) denotes coupling between the resonator 305 and the power combiner 304 and m 2 denotes coupling between the resonator 306 and the power divider 303 . though inductive coupling is shown here , coupling may be any one or both of capacitative coupling and inductive coupling . fig6 shows a frequency response of the filter circuit in fig5 when it is assumed that coupling m 2 is opposite - phase coupling ( the phase is reversed by 180 degrees ) and m 1 ( 1 ), m 1 ( 2 ) and m 2 are in - phase coupling ( the phase does not change ). reference numeral 205 a denotes a frequency response of the resonator 305 , 205 b denotes a frequency response of the resonator 306 , 204 denotes a frequency response ( combined signal ) of the output terminal 302 . the frequency response 204 is a frequency response when the output signals of the two resonators 305 and 306 are combined as opposite - phase coupling , which is expressed as the sum of the single frequency responses 205 a and 205 b of the two resonators 305 and 306 . in this way , a desired frequency response ( combined signal ) can be obtained by combining the signals which have passed through the two resonators 305 and 306 so as to have phases opposite to each other . an amount of ripple 207 between the resonance frequencies f 1 and f 2 seen in the frequency response 204 can be adjusted to a desired value by setting the interval between the resonance frequencies f 1 and f 2 , coupling m 1 ( 1 ), m 1 ( 2 ), m 2 and m 2 of the respective resonators 305 and 306 to appropriate values . furthermore , when coupling m 1 ( 1 ), m 1 ( 2 ) and m 2 are assumed to be opposite - phase coupling , making coupling m 2 in - phase coupling causes the signals which have passed through the resonators 305 and 306 to be combined so as to have phases opposite to each other making it possible to realize a combination of sum likewise . fig7 shows a frequency response when coupling m 1 ( 1 ), m 1 ( 2 ) and m 2 are assumed to be in - phase coupling and coupling m 2 is also assumed to be in - phase coupling . reference numeral 205 a denotes a frequency response of the resonator 305 , 205 b denotes a frequency response of the resonator 306 , 206 denotes a frequency response ( combined signal ) of the output terminal 302 . the frequency response 206 is a frequency response when the output signals of the two resonators 305 and 306 are combined so as to have the same phase , which is expressed as a difference between single frequency responses 205 a and 205 b of the two resonators 305 and 306 . it is understandable that signal intensity in the vicinity of the center frequency in a target band decreases and it is no longer possible to obtain a desired signal . thus , a combination of difference results because the phases of signals before and after the respective resonance frequencies of the resonators 305 and 306 are inverted . even when all coupling m 1 ( 1 ), m 1 ( 2 ), m 2 and m 2 are assumed to be opposite - phase coupling , a combination of difference results likewise . in the case of fig6 , since the two signals which have passed through the resonators 305 and 306 have phases opposite to each other before being combined , the phase inversion produced in the resonators 305 and 306 is canceled out and a desired signal can be obtained . as described above , when the two signals to be combined have phases substantially opposite to each other if not completely opposite phases , that is , a phase difference within a range of ( 180 ± 30 )+ 360 × n degrees ( n is an integer equal to or greater than 0 ), it is possible to obtain a desired signal . based on the above described principle , the filter circuit shown in fig1 is provided with the delay circuit 109 to obtain a desired output signal so that the signals that have passed through the resonators having neighboring resonance frequencies have phases substantially opposite to each other . next , the aspect that the line widths of the resonators 105 and 108 in the filter circuit in fig1 are set to be greater than the resonators 106 and 107 will be explained . fig3 and fig4 show frequency characteristics of the filter circuit in fig1 . fig3 shows a graph 201 indicating a transmission characteristic ( s 21 characteristic ) and a graph 202 indicating a return loss characteristic ( s 11 characteristic ) and fig4 shows a graph 203 indicating a group delay characteristic . when a combination is performed as the filter characteristic as in fig2 , the resonance frequency of each resonator does not match the peak position of the return loss characteristic 202 in the strict sense of the word . this is because resonance frequencies are subject to perturbation under the influences of other resonators as a result of the combination of waveforms . however , their order never changes . to realize a steep skirt characteristic , as described above , the filter circuit in fig1 has greater external q at both ends of the filter band ( suppose the external q is the same on the input side and on the output side of the resonator here for simplicity of explanation , but the present invention also naturally includes a case where they are different ) than the external q of other resonators . that is , the total of the coupling amount of the resonators with the circuit placed on the input side of the resonator at both ends of the filter band ( the coupling amount is defined as the reciprocal of the external q ) and the coupling amount of the resonators with the circuit placed on the output side is smaller than the total of the coupling amount of the other resonators with the circuit placed on the input side of the other resonator and the coupling amount of the other resonators with the circuit placed on the output side . in this way , a higher current is obtained from the resonators at both ends of the filter band ( see parts 201 a and 201 b in the graph 201 in fig3 ). that is , when the external q of the resonator at both ends of the filter band is increased ( when the coupling amount is decreased ), the amount of group delay at both ends of the filter band increases as shown in fig4 and the value of current that can be extracted also increases in proportion thereto . more specifically , the greater the amount of group delay , the longer the signal stays in the resonator , and therefore the superimposition of waves produces a high current value . in this way , as a result of the increase in the amount of group delay of the resonators 105 and 108 , a high current stays in the resonators 105 and 108 , and therefore the resonators 105 and 108 are required to have greater power handling capability than the other resonators 106 and 107 . to put it the other way around , the resonators 106 and 107 are required to have not so large power handling capability as the resonators 105 and 108 . that is , it is not necessary to increase power handling capability of all the resonators and it is possible to obtain sufficient power handling capability for the filter circuit by increasing power handling capability of only resonators having a large amount of group delay . focusing on this point , the inventor has implemented a filter circuit with the smallest possible circuit area while maintaining high power handling capability by increasing only the line widths of the resonators 105 and 108 having a large amount of group delay more than the line widths of the other resonators 106 and 107 . that is , a filter circuit with a small circuit area having a steep skirt characteristic has been realized . hereinafter , the process through which the inventor has come up with the present invention will be explained in detail . fig8 shows the configuration of a general cascade connection type filter circuit . in this filter circuit , six resonators 401 to 406 are cascade - connected . the conductor parts of resonators 401 to 406 are made of superconductor . fig9 shows current values of the respective resonators 401 to 406 in this filter circuit . the current values of the respective resonators 401 to 406 are shown in graphs g 401 to g 406 . the graph in fig9 is obtained through a simulation whereby a signal is inputted to the filter circuit while sequentially changing the frequency of the input signal within the frequency range on the horizontal axis in the figure and the current value of each resonator at a time of each frequency is measured . as is understandable from fig9 , a current in a whole frequency band passes through the respective resonators 401 to 406 , and therefore a high current ( integral value in the graph ) flows through the resonators 401 to 406 . the graph g 403 shows that the current value of the third resonator 403 becomes a maximum . in order for a high current to flow through the resonators , it is possible to effectively decrease the peak current value by distributing the current over a wider range using a large resonator . however , using a large resonator increases the size of the filter circuit . fig1 shows the configuration of a general parallel connection type filter circuit . in this filter circuit , six resonators 411 to 416 are connected in parallel . the conductor parts of the resonators 411 to 416 are made of superconductor . the resonators 411 to 416 have the same power handling capability . the resonators 415 and 416 correspond to both ends of the filter band . fig1 shows current values of the respective resonators 401 to 406 of this filter circuit . current values of the respective resonators 411 to 416 are shown in graphs g 411 to g 416 . the graph in fig1 is obtained through a simulation similar to that in fig9 . since an input signal is distributed to the resonators 411 to 416 , a current ( integral value in the graph ) which flows through one resonator is smaller than that of the resonator in the cascade connection type filter circuit . therefore , the power handling capability of each resonator can be made smaller than that of the filter circuit in fig8 , and it is thereby possible to reduce the circuit area more in the parallel connection type filter circuit than the cascade connection type filter circuit . here , as is understandable from fig1 , the current values ( g 415 , g 416 ) of the resonators 415 and 416 at both ends of the filter band in the parallel connection type filter circuit are greater than those of the other resonators 411 to 414 . furthermore , in the parallel connection type filter circuit using superconductor , it is possible to use resonators having different power handling capabilities according to the current valued of the respective resonators . focusing on this point , the inventor has realized both high power handling capability and downsizing of the filter circuit by increasing the power handling capability using a line of a greater line width for only resonators through which a high current flows . here , specific numerical examples of the layout shown in fig1 are shown in fig1 . a dielectric constant ∈ r of the dielectric substrate 110 is 24 . the line length of the resonator 105 is 20 . 26 mm and the width is 0 . 8 mm . the line length of the resonator 106 is 20 . 18 mm and the width is 0 . 2 mm . the line length of the resonator 107 is 20 . 10 mm and the width is 0 . 2 mm . the line length of the resonator 108 is 20 . 02 mm and the width is 0 . 8 mm . therefore , the widths of the resonators 105 and 108 are 4 times those of the resonators 106 and 107 . the line length of the delay circuit 109 is 40 mm . the line length of the line 131 is 20 mm . fig1 shows a second embodiment of the filter circuit according to the present invention . this filter circuit is equipped with resonators 105 a , 106 a , 107 a and 108 a having resonance frequencies f 1 , f 2 , f 3 and f 4 . these frequencies have a relationship of f 1 & lt ; f 2 & lt ; f 3 & lt ; f 4 . the line lengths of the resonators 105 a and 108 a having f 1 and f 4 at the ends of the filter band are set to nd 1 times the half wavelength and the line lengths of the resonators 106 a and 107 a having f 2 and f 3 at the center side of the filter band are set to nd 2 times the half wavelength . here , nd 1 & gt ; nd 2 ( nd 1 is an integer equal to or greater than 2 , nd 2 is an integer equal to or greater than 1 ). fig1 shows an example with nd 1 = 2 , nd 2 = 1 . setting the line lengths of the resonators 105 a and 108 a to twice the half wavelength makes it possible to set power handling capability twice that in the case where the line lengths are set to the half wavelength . in the first embodiment , power handling capability has been improved by increasing the line width , but this embodiment improves power handling capability by increasing the line length . fig1 shows a first modification example of the filter circuit according to the first embodiment . this filter circuit uses resonators 105 b , 106 b and 107 b having resonance frequencies f 1 , f 2 and f 3 . these resonance frequencies have a relationship of f 1 & lt ; f 2 & lt ; f 3 . the line widths of the resonators 105 b and 107 b located at both ends of the filter band having a large amount of group delay are set to be greater than the line width of the resonator 106 b having a smaller amount of group delay and the resonators 105 b and 107 b are concentrated on one location . this facilitates the layout design of the filter circuit . fig1 shows a second modification example of the filter circuit of the first embodiment . this filter circuit uses resonators 105 c , 106 c , 107 c , 108 c , 111 c and 112 c having resonance frequencies f 1 , f 2 , f 3 , f 4 , f 5 and f 6 . these resonance frequencies have a relationship of f 1 & lt ; f 2 & lt ; f 3 & lt ; f 4 & lt ; f 5 & lt ; f 6 . the resonators 105 c and 112 c located at both ends of the filter band having a large amount of group delay are assumed to have a first line width , the resonators 107 c and 108 c located at the center side of the filter band having a small amount of group delay are assumed to have a second line width which is smaller than the first line width and the resonators 106 c and 111 c having a medium amount of group delay are assumed to have a third line width which is smaller than the first line width and greater than the second line width . incidentally , in the first embodiment ( see fig1 ), an arrangement in which the resonators 106 and 108 partially face the lines 121 b and 131 in parallel to each other is adopted in order to couple the resonators 106 and 108 with the lines 121 b and 131 . the same applies to the relationship between the resonators 105 and 107 , and lines 121 a and 109 . in contrast , this modification example adopts an arrangement in which the resonators 108 c , 111 c and 112 c face the lines 141 b and 151 at one end . the same applies to the arrangement between the resonators 105 c , 106 c , 107 c and the lines 141 a and 209 . fig1 shows an example of combination between the first embodiment and the second embodiment . this shows an example of the filter circuit when both the line width and line length are changed . this filter circuit uses resonators 105 d , 106 d , 107 d and 108 d having resonance frequencies f 1 , f 2 , f 3 and f 4 . these resonance frequencies have a relationship of f 1 & lt ; f 2 & lt ; f 3 & lt ; f 4 . the line widths of the resonators 105 d and 108 d located at both ends of the filter band having a large amount of group delay are set to be greater than those of the resonators 106 d and 107 d and the line lengths of the resonators 105 d and 108 d are set to twice the half wavelength . the line lengths of the resonators 106 d and 107 d are half wavelengths . fig1 shows a third modification example of the filter circuit of the first embodiment . the line widths of resonators 105 e and 108 e located on both sides of the filter band having a large amount of group delay are set to be greater than those of the first embodiment . in this way , a filter circuit having higher power handling capability is realized . the line widths of resonators 106 e and 107 e located at the center side of the filter band are the same as those of the first embodiment . furthermore , a delay circuit 309 is interposed between an input line 101 and the resonators 105 e and 107 e in this modification example . in this way , a delay circuit may be arranged on any one of the input side and the output side of the resonator . fig1 shows a fourth modification example of the filter circuit of the first embodiment . resonators 105 g and 108 g located on both sides of the filter band having a large amount of group delay correspond to a strip conductor in a microstrip line having a length of half wavelength which is made wider from both sides toward the center and have a substantially circular planar shape here . the resonance mode includes tm011 mode or tm010 mode . current concentrates more on parts which are closer to the center of the half wavelength . in this example , current concentrates most on the parts indicated by l1 and l2 . therefore , by increasing the line width for parts which are closer to the center of the half wavelength , that is , by changing the line width according to the degree of concentration of current , it is possible to realize high power handling capability and reduce the area occupied by the resonator . in the case of a resonator having a multi - wavelength structure ( half wavelength × n ( n is an integer equal to or greater than 2 ), since current is more concentrated on parts closer to the center of each half wavelength , it is possible to realize high power handling capability and reduce the area occupied by the resonator by widening the line width from both ends of the length of half wavelength toward the center . fig1 schematically shows the configuration of a radio communication apparatus as an embodiment of the present invention . more specifically , the configuration of a transmission unit of a radio communication apparatus is schematically shown . data 500 to be transmitted is inputted to a signal processing circuit 501 , subjected to processing such as a digital / analog conversion , coding and modulation and a transmission signal of a baseband or an intermediate frequency ( if ) band is generated . the transmission signal from the signal processing circuit 501 is inputted to a frequency converter ( mixer ) 502 and multiplied by a local signal from a local signal generator 503 and thereby converted to a signal of a radio frequency ( rf ) band , that is , up - converted . the rf signal outputted from the mixer 502 is amplified by power an amplifier 504 and then inputted to a band limiting filter ( transmission filter ) 505 . as the band limiting filter 505 , the filter circuit explained so far can be used . the signal whose band is limited by this band limiting filter 505 and whose unnecessary frequency component has been removed is supplied to an antenna and is radiated out into space as a radio wave .	7
in the following description , a design for a flexible array block ( fab ) is presented . an explanation of how an array of fabs can be used to create a 4n × 4m multiplier is given , followed by a proof of the functionality of the proposed design . the fab scheme is then compared to existing fixed size multipliers , the hwang reconfigurable multiplier , and multipliers implemented using fpgas . a possible modification to the fab scheme is then discussed , to allow simple implementation of multiplier accumulators and fir filters . fig1 a and 1 b schematically illustrate some “ building blocks ” used in an fab . fig1 a illustrates two functional units 10 , 20 formed of a full - adder and associated logic gates . for completeness , a logic circuit diagram of a full adder is provided in fig1 b . fig2 schematically illustrates a 4 × 4 flexible array block ( fab ) formed of a number of the functional units 10 , 20 , further associated logic gates and an adder 30 . the fab uses a modification of the array developed by baugh - wooley for two &# 39 ; s complement multiplication [ 8 ]. the fab consists of two parts : i ) a multiplier array which reduces the four bit multiplication of two 5 bit numbers , and ii ) the adder 30 to produce the final output . in use , the fabs are organised into arrays of fabs . this approach will be described further below . the adder 30 in an individual fab is unused unless the fab is in the last column of overall fab array ( i . e . it uses the most significant bit of the multiplicand a ). each fab is configured using the six configuration bits m a , m b , c l , c r , c t , and c b as shown in table i . the configuration of each fab will be denoted by fab ( ma , mb , cl , cr , ct , cb ) . the configuration determines which input signals are responded to by an fab . so , although all of the inputs are permanently connected to other fabs or buses within an fpga , whether an individual fab responds to a particular input is determined by the configuration state of the fab . the operation of the fab will be described further below , both in general terms and in conjunction with mathematical proofs . high if a0 is not the lsb of the multiplicand a ( the fab is high if a3 is not the msb of the multiplicand a ( the fab is high if b3 is not the msb of the multiplicand b ( the fab is high if b0 is not the lsb of the multiplicand b ( the fab is fig3 shows a general connection scheme for the fabs . the interconnection arrangement is both regular and scalable , allowing simple vlsi implementation and expansion to larger array sizes . each fab within an array is interconnected to receive signals from the fabs above , below , to the left and to the bottom left with respect to the position of that fab . the fab outputs signals to other fabs at positions above , above right , below and right of that fab . the configuration information ( m . . . , c . . . ) is supplied separately . such an array of fabs can be configured to perform a number of multiplications , with multiplicands of varying sizes . for example , a 4 × 4 array of 4 × 4 fabs is capable of performing a single 16 × 16 bit multiplication , or 16 4 × 4 bit multiplication ( unsigned , or two &# 39 ; s complement in either case ). to configure the array , the six configuration bits of each fab must be set appropriately , the correct multiplicands supplied to each fab , and the output ( s ) taken from the appropriate place . in the left - hand example , two five bit unsigned numbers are multiplied . this involves multiple “ shift and add ” operations , so that for each bit of a first multiplicand , the other multiplicand is shifted in a more significant direction . if the bit of the first multiplicand is 1 , the shifted version of the other multiplicand is added so as to contribute to the product . this is a well - used technique . the right - hand example shows a similar method for use with two &# 39 ; s complement ( signed ) binary numbers . it is similar except that on the last row of the addition ( i . e . multiplication by the msb ) the bits are all inverted and 1 is added . again , this is standard two &# 39 ; s complement arithmetic . the fab of fig2 mirrors the arithmetic of fig4 . comparing the two figures , a functional unit 31 calculates a partial product ( a 0 . b 0 ) corresponding to the product of the two lsbs , and a functional unit 32 calculates the partial product ( a 3 . b 3 ) corresponding to the product of the two msbs . the remaining functional units calculate respective partial products ( e . g . a 2 . b 1 ) between these extremes . each functional unit can receive data from other functional units so that cumulative sums of the partial products are generated . these correspond to summing operations down respective columns of the calculation of fig4 . the adder 30 adds all of the cumulative sums of partial products to create the 4 × 4 bit product . the fab can pass the output of the functional units to subsequent fabs ( e . g . using the signals top and right ), and can receive the output of functional units of preceding fabs ( e . g . by the inputs left and bottom ). in this way , multiple fabs can be linked together to form ( effectively ) a seamless array of the functional units , operating as a scaled - up version of the 4 × 4 array of functional units within a single fab . if multiple fabs are joined in this way , the adders are not used in fabs other than those on the extreme right hand column of the array of fabs . in the case of two &# 39 ; s complement arithmetic , if one or both of the multiplicands is signed then the bits to be multiplied by the msb of the other multiplicand can be inverted , and one added , using the additional logic present in the functional units 20 ( used in the bottom row and right hand column of the fab ), and 1 can be added to the output when necessary using the additional logic associated with the functional unit 32 . this feature is under the control of control bits m a ( to cause the right hand column to operate as for signed arithmetic ) and m b ( to cause the bottom row to operate as for signed arithmetic ). in this way , products with one or both of the multiplicands being signed can be accommodated . fig5 shows how four 4 × 4 fabs , as described above , can be configured to produce an unsigned 8 × 8 bit multiplier . here , the adders 30 in the two left hand fabs 40 , 50 are redundant , and the remainder of the array is configured so as to produce a composite circuit similar to a single fab but with an effective 8 × 8 array of functional units . similarly , fig6 shows the configuration necessary for six 4 × 4 fabs to generate an 8 × 12 bit two &# 39 ; s complement multiplier . the configuration bits m a , b for the fabs on the right hand column and on the bottom row of the array specify that the msb multiplications are treated differently ( as described above ) in those fabs to accommodate the two &# 39 ; s complement arithmetic . the fab has three modes of operation : i ) both multiplicands are unsigned , ii ) both multiplicands are signed , and iii ) one multiplicand is unsigned , the other signed . the proof for each case will be considered in this section . a and b are unsigned n and m bit binary numbers , respectively , as given by ( 1 ) ( both m and n must be multiples of 4 ) a = ∑ i = 0 n - 1  2 i * a i , b = ∑ j = 0 m - 1  2 j * b j ( 1 ) it can be easily shown that a * b is given by ( 2 ) a * b = ∑ i = 0 n - 1  ∑ j = 0 m = 1  2 i + j * a i · b j ( 2 ) when the array of fabs has been correctly configured for a n by m bit unsigned multiplication , an array of elements equivalent to that shown in fig7 exists . the output of this array is given by ( 3 ) out = 2 n  ( y n + x n ) + ∑ i = 0 n - 1  2 i * y 0 i + 1 ( 3 ) consider one column of the multiplier array , as shown in fig8 . the output of the column is given by ( 4 ). by using the appropriate boundary conditions it is easily shown that the output of the multiplier array is given by ( 5 ), which is equivalent to the required result , as derived in ( 2 ). 2  ( y i + 1 + x i + 1 ) + y 0 i + 1 = x i + y i + 2 m - 1  y m i - 1 + ∑ j = 0 m - 1  2 j * a i · b j ( 4 ) a and b are both two &# 39 ; s complement signed n and m bit binary numbers , respectively , as given by ( 6 ). a = ∑ i = 0 n - 2  [ 2 i * a i ] - 2 n - 1 * a n - 1 , b = ∑ j = 0 m - 2  [ 2 j * b j ] - 2 m - 1 * b m - 1 ( 6 ) therefore , it can be shown that a * b is given by ( 7 ). a * b =  ( ∑ i = 0 n - 2  ∑ j = 0 m - 2  2 i + j * a i * b j ) - a n - 1 * 2 n - 1 *  ( ∑ j = 0 m - 2  2 j * b j ) - b m - 1 * 2 m - 1 * ( ∑ i = 0 n - 2  2 i * a i ) + a n ( 7 ) when the array of fabs has been correctly configured for a n by m bit two &# 39 ; s complement signed multiplication , an array of elements equivalent to that shown in fig8 exists . the or gate , present in fig9 can be considered equivalent to an adder , because both inputs can never be high . the output of this array can be seen to be given by ( 8 ). out = 2 n  ( y n + x n ) + ∑ i = 0 n - 1  2 i * y 0 i + 1 + 2 m + n - 1 + 2 n - 1  a n - 1 ( 8 ) consider the i th column of this array as shown in fig1 . the output of this column is given by ( 9 ). 2  ( y i + 1 + x i + 1 ) + y 0 i + 1 =  x i + y i + 2 m - 1  y m i - 1 +  ∑ j = 0 m - 2  2 j * a i · b j + 2 m - 1 * a _ i · b m - 1 ,  ( i ≠ n - 1 )   2  ( y n + x n ) + y 0 n =  x n - 1 + y n - 1  ∑ j = 0 m - 2  2 j * a i · b _ j + 2 m - 1 *  ( a n - 1 · b m - 1 + b _ m - 1 + a _ n - 1 ) ,  ( i = n - 1 ) ( 9 ) using the appropriate boundary conditions , it is possible to calculate the output of the multiplier array as shown in ( 10 ). y 0 = x 0 = 0 , y i m = 0 ( i ≠ 0 ), y 0 m = b m − 1 c . one multiplicand unsigned , the other a two &# 39 ; s complement signed number a is an n bit two &# 39 ; s complement signed binary number , and b is unsigned m bit binary number as given in ( 11 ). a = ∑ i = 0 n - 2  [ 2 i * a i ] - 2 n - 1 * a n - 1 , b = ∑ j = 0 m - 1  [ 2 j * b j ] ( 11 ) therefore , it can be shown that a * b is given by ( 12 ). a * b = ( ∑ i = 0 n - 2  ∑ j = 0 m - 2  2 i + j * b j * a i ) - a n - 1 * 2 n - 1 * ( ∑ j = 0 m - 1  2 j * b j ) ( 12 ) when the array of fabs has been correctly configured for a n by m bit multiplication , with a and b defined as in ( 11 ), an array of elements equivalent to that shown in fig1 exists . the output of this array can be seen to be given by ( 13 ). out = 2 n  ( y n + x n ) + ∑ i = 0 n - 1  2 i * y 0 i + 1 ( 13 ) consider the i th column of this array as shown in fig1 . the output of this column is given by ( 14 ). 2  ( y i + 1 + x i + 1 ) + y 0 i + 1 =  x i + y i + 2 m - 1  y m i - 1 +  ∑ j = 0 m - 1  2 j * a i · b j , ( i ≠ n - 1 )   2  ( y n + x n ) + y 0 n =  x n - 1 + y n - 1 + 2 m - 1  y m n - 1  ∑ j = 0 m - 2  2 j * a i · b _ j ,  ( i = n - 1 ) ( 14 ) using the appropriate boundary conditions , it is possible to calculate the output of the multiplier array as shown in ( 15 ). it has been proven that the multiplier array will work correctly for unsigned , and signed two &# 39 ; s complement numbers , when properly configured . the fabs will now be compared to pams , as described by hwang , in terms of speed and gate count . it is also compared to two fixed operand size schemes , the baugh - wooley array , and the wallace / dadda to show that the cost of reconfigurability is small . the fab scheme is also compared to multipliers implemented using fpgas , to show that there is a significant reduction in the die area required . table ii shows that the delay of the fabs is much better than the hwang reconfigurable array , and is comparable to that of the baugh - wooley fixed size operand array . the delay of the pams is of o ( n 2 ), whilst the delay of the fabs is of o ( n ). the delay of the wallace / dadda multiplier is of o ( log 2 n ) ( assuming that full adders are used to implement the final addition stage in all cases ) table iii shows that , in terms of the number of gates required , the fabs are slightly most costly (= 3 %) than the existing hwang reconfigurable scheme . the fab scheme is more costly than either of the two fixed size operands schemes , with 50 % more gates being required . ( assuming that full adders are used to implement the final addition stage in all cases ) the price which must be paid for the significant increase in speed when using fabs , compared to the pams is the 50 % increase in the number of interconnects between the fabs , when compared with the pams , as shown in table iv . the fab scheme is compared to multipliers implemented using altera &# 39 ; s flex10k , and xilinx &# 39 ; s 4000 series fpgas , in terms of die area required . the number of transistors required has been chosen as the best metric for comparing the relative die area for each scheme . this is a valid assumption because most modern processes have a large number of metal layers , making routing less of a bottle neck . the number of transistors includes any required for the configuration , and routing of any cells used . for all the considered schemes the amount of hardware required to implement an n × n bit multiplier proportional to n 2 , for n & gt ; 4 and n a multiple of 4 . a xilinx 4000 fpga requires , on average , 1 . 14 * n 2 clbs ( configurable logic blocks ) to implement an n × n bit multiplier ( 73 clbs are needed for an 8 × 8 multiplier [ 9 ]). for the xilinx 4000 part each cell ( clbs in this instance ) requires 4 700 transistors . this figure includes all transistors required for configuration , routing , and clb logic . from extensive experimentation , we have found that the altera flex 10k part requires , on average , 0 . 41 * n 2 labs ( logic array blocks ) to implement a n × n multiplier . we have estimated that each lab requires about 13 700 transistors , for configuration , routing , and cell logic . using the fab scheme , each 4 × 4 cell requires approximately 2 600 transistors , with 0 . 0625 fabs being required per bit 2 . table v shows that the fab scheme requires about 35 times less die area than either the flex10k , or 4000 fpga . the 5 - bit adder in each fab is only used if the fab is on the far right hand side of the multiplier . therefore , if the size of either multiplicand is greater than 4 bits , there are a number of “ spare ” adders available . with minimal cost in terms of extra hardware and multiplier performance , it would be possible to extend these adders to 8 - bit adders , as shown by fig1 , and fig1 . this would require 4 more configuration bits to sign extend the inputs to the adders , and 2 additional vertical connections between each fab . this small alteration would enable simple implementation of structures such as multiply - accumulators ( macs ) and finite impulse response filters ( firs ) to be embedded within the multiplier array . fig1 shows how an 8 × 8 mac can be implemented using 4 fabs . the fabs should be connected as before . this section discusses the possible ways in which an array of fabs could be used . the key point is that the array of fabs can be of any size , the bigger the array the larger the number of multiplications that can be carried out , or the larger the size of the multiplicands can be . there are three basic methods which the array could be used , as a stand alone reconfigurable chip , for use within a system , incorporated in an fpga type architecture as a block , or as an array interspersed within an fpga architecture . the basic connection architecture is shown in fig1 . this is basically an extension of the schematic connection architecture of fig3 . using the array as a stand alone reconfigurable chip an array of fabs could be implemented using a custom asic , with appropriate i / o and control circuitry , as shown in fig1 . when the fab is incorporated into an fpga as a “ block ”, one or more particular areas of the fpga are devoted to the array of fabs , as shown in fig1 . the array of fabs could contain any number of fab units . more than one “ block ” of fabs could be used in an fpga , and they could operate either independently ( there are no fixed interconnects between the blocks ), or as one large array of fabs ( there is fixed interconnect between each block of fabs ). another method of using the fab array would be to intersperse the array throughout an fpga - type structure . this could allow the data to be generated and used locally , saving on reconfigurable interconnection . this is shown in fig2 . again , there could be any number of fab units in such a scheme , and any number of fpga configurable logic blocks could be placed in - between the fab units . in summary , embodiments of the invention provide a design for a reconfigurable flexible multiplier which can be considerably faster than existing reconfigurable multipliers reported previously in the literature . the speed improvements are gained at the cost of adding extra interconnects between the reconfigurable blocks . it is estimated that this design is approximately 35 more efficient in terms of silicon area / speed than using an fpga . such a design should enable substantial savings of resources in the fpga when used for image / video processing applications . an alternative embodiment of the invention is shown in fig2 and will be referred to as a modified flexible 8 × 8 multiplier block ( mfab ). the mfab block is based on the radix - 4 overlapped multiple - bit scanning algorithm as described in [ 10 ]. the blocks consist of four key parts : ( i ) a multiplier decoder block 100 , at the top of each column which each take two bits of the multiplicand and generate the necessary control signals for the column ( i . e . whether to add − 2 ,− 1 , 0 , 1 , or 2 times the multiplicand ). ( ii ) a main array 110 of 8 by 4 units which performs the bit reduction , and is used to form part of the larger bit reduction array required when the blocks are cascaded . ( iii ) extra units 120 which are required if the block is on the edge of a larger array ( i . e . it uses the msb of the multiplier or multiplicand ); these are necessary for the blocks to be able to cope with both signed and unsigned multiplication . ( iv ) adders 130 which produce the final output . the top adder is used when the block uses the lsb of the multiplicand , and the adder to the right of the array is used when the block utilises the msb of the multiplicand . each block is configured using the six configuration bits ma , mb , cl , cr , ct , and cb as shown in table vi . fig2 shows schematically how 4 mfab blocks can be used to construct a 16 × 16 two &# 39 ; s complement signed multiplier . the modified flexible array block ( mfab ), is compared to 8 × 8 pams , as described in [ 5 ], in terms of speed , and estimated transistor count . it is also compared the fab scheme . in order to give a fair comparison 8 × 8 fabs , and 8 × 8 pams have been used . in the case of both the fabs & amp ; mfabs carry - select adder schemes have been used to implement the final column adders , to yield improved multiplication times . table vii shows that , in terms of the numbers of transistors required , the mfab is more costly (≈ 30 %) than the pam reconfigurable scheme , this is largely due to the expensive carry - select adder scheme used in the final column . however , it is less costly then the fab scheme (≈− 7 %). table viii shows the total delay , in terms of full adders , for the pam , mfab , and fab schemes when 8 × 8 blocks are used to construct multipliers of varying sizes . the speed of the mfab is much better than the pam reconfigurable array ( 286 % faster , for a 32 × 32 multiplier ), and enjoys a considerable improvement over the fab scheme ( 52 % faster ). another very important figure of merit for the blocks is the number of reconfigurable connections required by each scheme , shown in table ix . it has been reported that the reconfigurable interconnection structure a typical fpga takes up ≈ 90 % of the silicon die area of the device [ 8 ]. indeed , this is the main reason why the mfab provides significant saving in silicon area over the conventional fpga implementation . it is therefore important that the number of reconfigurable interconnections be reduced , preferably to a minimum . for both the mfab and fab schemes the majority of the interconnect for each block connects to the adjacent blocks in a regular and scalable way , which means that dedicated interconnect can be utilised . this leaves only the actual data inputs and outputs to be routed to the reconfigurable interconnect ( 32 in the case of the fab and 40 in the case of the mfab , since it has an additional summing input ). the pam scheme requires 48 reconfigurable interconnects for an 8 × 8 block . the mfabs also have provision for an extra summing input ( labelled as σ7 : 0 in fig2 ), which is not available without additional circuitry using the fabs . this enables simple implementation of multiply - accumulate operations ( macs ), and fir filters . here the mfab scheme is compared to multipliers implemented using altera &# 39 ; s flex10k , and xilinx &# 39 ; s 4000 series fpgas , in terms of total silicon die area required . an estimate of transistor count has been chosen as the best metric for comparing the relative die area for each scheme . we believe this to be a reasonable assumption because most modem processes have a large number of metal layers , making fixed routing less of a bottle neck . in order to give a fair comparison , the number of transistors given in this section includes any required for the configuration sram , and reconfigurable routing required by the cells . for both conventional fpga architectures and the mfab scheme the amount of hardware required to implement an n x n bit multiplier is approximately proportional to n 2 , for n & gt ; 8 and n a multiple of 8 . using the mfab scheme , each 8 × 8 cell requires approximately 7000 transistors ( 2600 for the basic mfab + 4400 for the reconfigurable routing ), with 0 . 01563 mfabs being required per bit 2 . table x shows that the mfab scheme requires about 30 times less die area than either the flex10k , or xilinx 4000 fpga . this saving is largely due to the reductions in the reconfigurable interconnect required , which normally dominates the die area of a typical fpga . this idea is easily extended to arbitrary block sizes . although a design for a 8 × 8 block is given here , it would be trivial to extend the design to create any n by m block . the estimated transistor counts for the fab and mfab schemes if n by n blocks are used is given by : ( this assumes that a fast carry - select adder scheme is used in the final column in both cases ) this demonstrates that the mfab scheme uses fewer transistors than the fab scheme for n & gt ; 7 , and that the saving from using mfab blocks becomes larger the greater the size of the blocks used . of course the larger the block size the more inefficiency will result for some multiplier sizes . ( e . g . a 4 × 4 multiplier implemented in a 32 × 32 block is more inefficient than the same multiplier being implemented in a 8 × 8 block ) we suggest using dedicated connections between the flexible blocks for the left , right , top , and bottom connections . the large number of metal layers now used in modem vlsi processes means that this can be done with little cost . only the three inputs a7 : 0 , b7 : 0 , and σ7 : 0 , if used , with the output q15 : 0 need to be routed to the reconfigurable interconnect , giving a total of 40 reconfigurable connections for each mfab block . since the saving in silicon area has been estimated to be so significant (≈ 30 times ), even if only 4 % of the mfabs are used in the fpga , there will be a net saving in silicon area when compared to the conventional fpga architecture . 1 . p m athanas et al , “ real - time image processing on a custom computing platform ”, ieee computer , vol . 28 , no . 2 , pp . 16 - 24 , 1995 2 . altera corporation , “ ripple - carry adders in flex 8000 devices ”, application brief 118 , ver . 2 , may 1994 3 . o t albaharna et al , “ on the viability of fpga - based integrated coprocessors ”, ieee symposium on fpgas for custom computing machines , apr . 17 - 19 1996 4 . o t albaharna et al , “ area & amp ; time limitations of fpga - cased virtual hardware ”, ieee proceedings international conference on computer design : vlsi in computers and processors , pp . 184 - 189 , 1994 5 . k hwang , “ computer arithmetic principles , architecture , and design ”, john wiley & amp ; sons , 1 st edn ., pp . 194 - 197 , 1979 6 . c s wallace , “ a suggestion for fast multiplier ”, ieee trans . electronic computers , vol . ec - 13 , pp . 14 - 17 , february 1964 7 . a d booth , “ a signed binary multiplication technique ”, quarterly j . mechan . appl . math ., vol . 4 , pt . 2 , pp . 236 - 240 , 1951 8 . a r baugh et al , “ a two &# 39 ; s complement parallel array multiplication algorithm ”, ieee trans . computers , vol . c - 22 , no . 1 - 2 , pp . 1045 - 1047 , december 1973 9 . xilinx , “ the programmable logic data book ”, version 1 . 02 , chapter 4 , p . 7 , jun . 1 , 1996 10 . l p rubinfield , “ a proof of the modified booth algorithm for multiplication ”, ieee trans . computers , october 1975 , pp1014 - 1015	6
fig1 a and 1b depict a system 100 for tracking the position of a pipette 105 with respect to a well plate 110 that includes an array of well locations 115 defining an x axis and a y axis . system 100 includes a well designator 120 that selectively directs light to one or more well locations responsive to control signals ctrl . illuminated well locations 115 are highlighted using cross - hatching , which illumination indicates e . g . that the respective location was the subject of a prior pipetting operation . a sensor 125 along the periphery of well plate 110 is positioned above well locations 115 , from a perspective along a z axis normal to the x and y axes , to detect positions of pipette 105 with respect to the well locations . well plate 110 is a microplate with integrated vials in this example , but other types of well plates ( e . g ., microplates or racks that support discrete vials ) can also be used . well designator 120 is a touchscreen display in this embodiment , and is divided into a well area 127 and a user - interface ( ui ) area 129 . as detailed below , sensor 125 monitors pipette activity within area 127 and users of system 100 can enter commands via the touch - sensitive ui area 129 . control logic 130 , such as a central processing unit ( cpu ) or microcontroller , receives sensory signals snc from sensor 125 and ui signals input from ui area 129 . control logic 130 derives control signals ctrl from the sense and ui signals and feeds them to a display driver 135 . display driver 135 , in turn , issues conventional display signals dsp to control well designator 120 . sensor 125 , in this embodiment , includes arrays of infrared photodiodes 140 that produce beams of light 145 to photoreceptors 150 . in one embodiment sensor 125 is a light - based touchscreen of the type detailed in u . s . patent publication no . us 2009 / 0189878 to goertz et al . in such screens , light sources produce beams of light that can be broken to detect the presence of pipette 105 or e . g . a user &# 39 ; s finger . sensor 125 can determine the position of a pipette or finger relative to the x and y axes , and consequently relative to well locations 115 . some embodiments may support different arrangements of sensors , such as to support parallel planes of light 145 ( sensor planes ), to provide a measure of pipette angle , for example . incidence - angle sensitivity can be used to more precisely locate the tip of pipette relative to the well locations . some embodiments may only determine the position of a pipette or finger relative to the z axis , without determining the accurate position to the x and y axes . the z axis detection can be used to advance illumination to a next well or set of wells based on the preselected illumination pattern specifying a pipetting order . control logic 130 can be configured to ignore signals from sensor 125 that correspond to area 129 , leaving that “ user - interface ” area for touch - based user input . control logic 130 can also be configured to ignore signals from the touchscreen within well area 127 . sensor 125 omits unneeded lights and photoreceptors adjacent area 129 along the y axis adjacent in this embodiment . area 129 is shown to include “ buttons ” 133 , which are virtualized implementations of e . g . keys of a keyboard or other types of graphical user interfaces . area 129 can also provide user output , such as alarms 136 or other types of messages . ui area 129 can thus be used to calibrate and otherwise provide input for control logic 130 . system 100 additionally includes alignment mechanisms 142 that serve as indices for aligning well plate 127 relative to well designator 120 , and that may double as well spacers to establish a desired spacing between light beams 145 and the tops of well locations 115 . closer spacing renders system 100 less susceptible to location errors due to pipette angle . the spacing of sensor 125 is adjustable along the z axis in other embodiments to facilitate adjustment between beams 145 and the surface of well designator 120 . display 120 can react to sensor 125 , some other sensor ( e . g ., capacitive sensors in the display ), or both , as noted previously . in still other embodiments control logic 130 is equipped with an antenna 155 or wired connection that allows control logic 130 to communicate with pipette 105 . as discussed in more detail in connection with fig2 , antenna 155 allows control logic 130 to receive user input and other information a pipette signals from pipette 105 ( e . g ., dosage amounts , number of pipette channels , completion of a pipetting operation , and error messages ), and can allow control logic 130 to communicate information to pipette 105 . system 100 can also include e . g . a microphone and speaker to facilitate interaction between a user and control logic 130 . with reference to fig1 a , each cross - hatched well location 115 may be assumed to indicate a well that has been subjected to a pipetting operation , such as receiving a dose of a reagent , and that has consequently been illuminated ( e . g ., by green light ). the next well location 115 , at cartesian coordinate a12 , is not illuminated , or may be illuminated with a different color than the other well locations , to identify it as a “ next ” well location to receive a pipetting operation . the user would thus place the pipette in proximity to the next well location and e . g . provide the dose of reagent . system 100 would sense the proximity of pipette 105 to the well location 115 at location a12 and change the corresponding illumination to indicate receipt of the reagent . the illumination parameters can be modified to suit different needs . for example , some assays may be sensitive to certain lights . it will be desirable to illuminate wells that have not received the reagent , and turn off illumination on wells that have received the reagent . users can also illuminate only the wells subject to next pipetting step to minimize the overall light exposure , or choose certain light colors that will not interfere with the assays . the user may miss a well location , or may subject the same well location to multiple pipetting operations . in either case system 100 uses the sensed coordinate of pipette 105 to identify the error and provide appropriate user feedback . in embodiments in which pipette 105 is capable of transmitting indicia of a pipetting operation , such as a signal indicating depression of a plunger , control logic 130 can use this information along with the location information to identify a pipetting operation . well area 127 is the surface of a touchscreen in this embodiment , but may be e . g . a standard display or an array of lights ( e . g . light - emitting diodes ). in other embodiments well designator 120 can uniquely designate wells or collections of wells using by reference to row ( s ), column ( s ), or both . for example , the text “ b12 ,” or icons or lights adjacent row b and column 12 , may designate the next well location 115 in fig1 a . other means of uniquely designating well locations or collections of well locations will be evident to those of skill in the art . in still other embodiments the well designator can transmit light to well plate 110 from above , as by projecting an image or light beams that selectively illuminate well locations 115 . such illumination preferably impinges well plate 110 at an angle with respect to the z axis so the pipette does not overly interfere with the illumination . well designator 120 may be calibrated with control logic 130 for different sizes , numbers , and spacing of well locations 115 . illumination patterns specifying a pipetting order can then be illuminated to guide the user . other embodiments omit such calibration , as the sensing of pipetting operations automatically identifies the well locations . fig2 depicts an embodiment of pipette 105 , which includes a pipette body 200 and a thumb - activated plunger 205 . pipette 105 additionally includes a sensor 210 that communicates with plunger 205 to sense a pipetting operation and control logic 215 ( e . g ., a microcontroller ) that receive input from sensor 210 . pipette 105 additionally includes a transmitter / receiver txrx and an antenna 220 to facilitate communication between pipette 105 and control logic 130 ( fig1 b ). pipette 105 can thus communicate pipette signals to controller 130 to indicate e . g . completion of a pipetting operation , an amount of reagent , or an error signal ( e . g ., that a plunger operation failed to take on or release a desired reagent volume ). pipette 105 can also receive information from controller 130 ; in one embodiment , for example , controller 130 issues user feedback to pipette 105 to indicate completion or errors in pipetting operations . pipette can alert the user in such instances using e . g . light , sound , or vibration . in still other embodiments controller 130 may prohibit or initiate delivery or extraction of reagents from well locations based on the sensed proximity of pipette 105 . system 100 detects the tip of pipette 105 in the foregoing examples , but may similarly detect the reagent . in embodiments in which a stream of reagent is detected , sensor 125 can be used to time the stream to obtain a measure of volume . moreover , solid reagents , such as pills , can be counted for each well location . while the present invention has been described in connection with specific embodiments , variations of these embodiments are also envisioned . for example , when a multi - channel pipette is used , system 100 can detect and illuminate multiple locations or an area of locations . the system 100 can also detect multiple well plates with different styles e . g . 96 - well or 384 - well for plate - to - plate reagent transfer . these examples are in no way exhaustive , as many alternatives within the scope of the claims will be obvious to those of ordinary skill in the art . therefore , the spirit and scope of the appended claims should not be limited to the foregoing description . only those claims specifically reciting “ means for ” or “ step for ” should be construed in the manner required under the sixth paragraph of 35 u . s . c . section 112 .	6
fig1 shows a light transmissive device 1 including a substantially rectangular light transmissive panel 2 . in a preferred embodiment the panel 2 has a slim profile , so that the thickness of the panel 2 is much less than the width or length . the panel 2 comprises cavities 4 to house an appropriate light source 6 . the cavities 4 may extend fully ( fig7 ) or only partially through the thickness of the panel 2 . the cavities 4 may be formed by moulding , drilling , cutting , etching , routing or by any other appropriate means . the panel is made from an appropriate material such that light emitted from a light source in the cavity 4 propagating along the panel will be substantially internally reflected . one or both faces , or major surfaces , of the light transmissive panel 2 are patterned 8 or treated to produce regions of the surface that allow light to be emitted from the surface of the panel , as shown in fig3 . the patterning 8 on the faces of the panel 2 may be in the form of v - cut grooves , laser - etched areas , a printed pattern or similar . in a preferred embodiment the patterning 8 is in the form of dots or lines . the arrangement of the patterned 8 or treated regions on the face of the panel 2 is such that the light emitted from the panel is essentially even over the face of the panel . the result is that the entire panel acts as a substantially even light source . a light source 6 housed within a cavity 4 may be any suitable light source , and may be light emitting diodes ( leds ) or linear fluorescent lamps . furthermore , the light source may be designed to emit light only towards the centre of the light transmissive panel 2 , as shown in fig5 . in one embodiment , the light source may comprise one lamp 6 a emitting light towards the centre of the panel 2 , and a second lamp 6 b emitting light towards the edge of the panel 2 , as shown in fig6 . the lamps 6 a and 6 b may be chosen to be different colours or different types . additionally , the light source 6 may be programmed by a controller ( not shown ) to switch on and off to produce a desired lighting effect . the edges 13 of the panel 2 are such that light is emitted from the edges when a light source 6 contained within a cavity 4 is switched on . the panel 2 may have rounded or bevelled edges around all or part of the perimeter . additionally , an edge covering 14 may be provided around at least part of the perimeter of the light transmissive panel 2 . this edge covering 14 may be opaque or translucent . where the covering 14 is able to transmit light , it may be coloured or patterned to add to the aesthetic quality of the light emitting device 1 . the edge covering could be chosen to contain fluorescent pigments . the chosen edge covering 14 may be made from vinyl , polyethylene , rubber or other suitable material . to create a more diffuse light emission from the panel 2 , further translucent layers 10 may be provided adjacent to one or both of the faces of the panel 2 to cover the surface treatment or patterning 8 , as shown in fig4 . the translucent layers 10 may be attached to the faces of the light transmissive panel 2 or may form part of light transmitting sheets 12 placed over one or both faces of the panel 2 . the light transmitting sheets 12 comprise transparent or translucent material which permits the light from the panel 2 to pass through . the light transmitting sheets 12 may be coloured and may incorporate a graphic representation . the graphic representation may be in the form of an image or design or text and may be formed by regions of different coloured material or opaque material , printed areas on the surface of the sheets 12 , or similar . the light transmitting sheets 12 are attached to one or both faces of the light transmissive panel 2 , as shown in fig4 . in embodiments in which only one light transmitting sheet is used , the other face of the panel 2 may be covered by an opaque board ( not shown ) to block any light emitted from that face of the panel . in certain embodiments of the invention , additional blocking layers 16 may be provided between the light transmissive panel 2 and the light transmitting sheets 12 , immediately adjacent to the light source 6 , as shown in fig4 . these layers act to limit or block the amount of light emitted by the light source 6 that passes directly through the light transmitting sheets 12 which would otherwise create an area of increased brightness in the device . this blocking region may be provided on the surface of the panel 2 or may be provided by a printed area on a face of a light transmitting sheet 12 , or similar . in the embodiments shown in the figures , the light transmissive panel 2 and the light transmitting sheets 12 are substantially planar . however , it would also be possible for the light transmitting sheets 12 to be curved and attached to a planar light transmissive panel 2 , or for both the panel 2 and the sheets 12 to be curved in a complementary manner such that faces of the panel 2 and sheets 12 come into contact over the majority of the area of the faces . the panel 2 and sheets 12 may be curved using any conventional forming means , such as thermoforming . in embodiments of the invention including light transmitting sheets 12 , the edge covering 14 may be arranged to cover ( 14 a ) or enclose ( 14 b ) the perimeter of both the light transmissive panel 2 and light transmitting sheets 12 . in one embodiment of the invention , the light transmitting sheets 12 are attached to the light transmissive device 1 by magnetic plates 18 . as shown in fig1 and 12 , magnetic plates 18 are located at various points on the faces of the panel 2 , and suitable metal plates 20 are provided in corresponding positions on one face of the light transmitting sheets 12 , so that the magnetic plates 18 and metal plates 20 come into contact when the light transmitting sheets 12 are placed in the correct position in relation to the light transmissive panel 2 . other means of attachment may also be used such as screws , clips , adhesives or similar . therefore , embodiments of this invention provide a backlit lighting device and a compact and slim display . the incorporation of a light source in a cavity within the panel of the light - emitting device is an improvement over previous edge - lit displays as a separate light enclosure is not required . furthermore , the light - emitting device allows light to be emitted both from the centre of the display and from the edges . the edges may have illuminated light in any colour ; the colour given by either of the colour filter applied to a cavity close to the edge , the edge covering or the colour of the light source embedded in the cavity of the central panel .	8
the sirna molecule of the present invention is derived from a sirna molecule library prepared for conserved regions of open reading frames of the mitf gene . the sirna molecule technology used in the present invention is a patented technology of biomics biotech ( china patent application no . 200710024217 . 6 , titled “ preparation method for pcr high flux construction of sirna whole site molecule library ”), which has the advantages that , the prepared sirna is randomly distributed in a segment of mitf open reading frames and has a controlled length in the range of 19 - 23 bp , and the hit rate of effective target sites is improved . the sirna can be prepared in many ways such as chemical synthesis , in vitro transcription , enzyme cleavage of long - chain dsrna , vector expression of sirna , pcr synthesis of sirna expression elements . the presence of these methods provides a selection space for researchers and can be used to obtain better gene silencing efficiency . as an alternative expression form of the sirna molecule in cells , it can be prepared into a dna expression cassette form such as u6 promotor - sirna transcription template - h1 promotor . the sirna molecule of the present invention can be used as an active ingredient in freckle whitening cosmetics , and also used as an active ingredient in medicines for treating diseases associated with increased melanin . for use , the sirna molecule can be directly administered as a medicine onto a specific site ( for example , pigment plaque ) on a subject . preferably , the sirna molecule is used as an active ingredient in freckle whitening cosmetics . for use , the sirna molecule can be prepared with other auxiliary agents into any suitable formulation , as long as it is suitable for applications of the sirna molecule and the activity of the sirna molecule can be properly retained . optionally , any pharmaceutically acceptable auxiliary agent can be contained in the above - described pharmaceutical formulations , as long as it is suitable for an expected administration system and the activity of the sirna molecule can be properly retained . the following experimental scheme is designed to in order to achieve the design concept of the present invention and verify the effect of inhibiting melanin production by the selected sirnas : ( 1 ) construction of a sirna molecule library for open reading frames of an inhibitor of apoptosis mitf gene , the molecule library comprising sirna effector molecules targeting the mitf gene , having a length ranging from 19 - 23 bp . ( 2 ) preparation of a sirna expression cassette having a corresponding effect , having a structure of “ u6 promotor - sirna transcription template - h1 promotor ”, which facilitates in vitro screening . ( 3 ) use of real - time quantitative pcr , which determines inhibition of the mitf gene by the effector sirna molecule transcribed from the sirna expression cassette in cells . ( 4 ) chemical synthesis of sirna screened from the above - described method , in which real - time quantitative pcr is further used in vitro cell experiments to determine mrna expression level of the mitf gene . ( 5 ) determination of toxicity of the screened sirna on cells using cck8 method . ( 6 ) determination of the effect of the screened sirna on melanin production in cells using reported method . the following examples are intended only to illustrate the invention , not for limitation . 1 . obtaining mitf gene target sequence : there are eight transcript variant sequences in total for mitf gene in us ncbi database , and one representative transcript variant 1 ( ncbi database number : nm — 198159 ) open reading frame ( orf ) was synthesized by biomics biotech using full gene synthesis , giving the orf sequence of mitf having a length of 1563 bp ( the agarose gel electrophoresis profile of the full length gene is shown in fig1 ). two segments of conserved regions of mitf gene were prepared using pcr method , respectively using the following primers : the conserved regions were amplified as target sequence for constructing sirna molecule library , with an amplified length of 527 bp ( seq id no : 1 ) and 683 bp ( seq id no : 2 ), respectively . 2 . constructing sirna molecule library : the patented technology of biomics biotech was used to construct sirna molecule library ( patent application no . : 200710024217 . 6 , titled “ preparation method for pcr high flux construction of sirna whole site molecule library ”), with a construction schematic flow shown in fig2 . the sirna molecule library for conserved regions of mitf was successfully constructed , and clones were randomly chosen for sequencing , with a controlled length ranging from 19 - 23 bp , showing site diversity and length diversity . 1 . 1 instruments : pcr apparatus ( abi ); real - time quantitative pcr apparatus ( bio - rad ); agarose gel electrophoresis system ( beijing liuyi instrument factory ); cell incubator ( thermo ) etc . 1 . 2 reagents and materials : 1 kb plus dna ladder ( invitrogen ); pfu dna polymerase ( biomics biotech ); agarose ( bbi ); dntp ( sangon biotech ( shanghai )); agarose gel purification kit ( biomics biotech ), lipofectamin ™ 2000 ( invitrogen ), dmem medium ( gibco ), turbocapture mrna kit ( qiagen ), ezomics ™ one - step qpcr kit ( biomics biotech ) etc . other biochemical reagents were purchased from sangon biotech ( shanghai ), and formulated into working solutions by biomics biotech . 1 . 3 pcr primers ( synthesized by biomics biotech ) having the following sequences : 5 ′ u6 promoter primer : ( seq id no : 11 ) 5 ′- aaggtcgggcaggaagagggc - 3 ′; 3 ′ h1 promoter primer : ( seq id no : 12 ) 5 ′- tatttgcatgtcgctatgtgttct - 3 ′; mitf gene forward primer : ( seq id no : 13 ) 5 ′- catcaccttcaacaacaac - 3 ′; mitf gene reverse primer : ( seq id no : 14 ) 5 ′- atgctcatactgctcctc - 3 ′; gapdh gene forward primer : ( seq id no : 15 ) 5 ′- gaaggtgaaggtcggagtc - 3 ′; gapdh gene reverse primer : ( seq id no : 16 ) 5 ′- gaagatggtgatgggatttc - 3 ′. 2 . 1 pcr amplification to prepare sirna expression cassette “ u6 - sirna transcription template - h1 ”: with mitf sirna positive clone plasmid as template , the pcr amplification was performed using high - fidelity enzyme pfu dna polymerase ( the schematic diagram of the expression cassette is shown in fig3 ). each pcr reaction system was ( 50 μl reaction system ): 0 . 5 μl template dna ( 10 - 50 ng ), 1 μl 5 ′ u6 promoter primer ( 10 μm ), 1 μl 3 ′ h1 promoter primer ( 10 μm ), 1 μl dntp ( 10 mm ), 0 . 5 μl pfu dna polymerase , q . s . ddh 2 o to 50 μl , and the reation conditions were : 95 ° c . predenature for 1 min , 95 ° c . denature for 15 sec , 58 ° c . anneal for 30 sec , 72 ° c . extension for 30 sec , 20 cycles . the expression cassette obtained by pcr amplification was separated with 1 . 0 % agarose gel electrophoresis , and purified with the agarose gel purification kit . from 1 . 0 % agarose gel electrophoresis , the pcr product has a single band with a fragment size of about 380 - 384 bp , which meets the design requirements ( the agarose gel electrophoresis profile is shown in fig4 ). 3 . 1 cell culture : the melanoma cell a375 was cultured in the dmem medium containing 10 % fbs in a 37 ° c ., 5 % co 2 incubator . 3 . 2 cell plating and transfection : the cell was seeded in a 96 well plate at 1 × 10 5 / well , was cultured overnight in an antibody - free dmem medium containing 10 % fbs in a 37 ° c ., 5 % co 2 incubator . transfection was performed following the instructions with lipofectamin ™ 2000 , and the dna amount in the “ u6 - sirna transcription template - h1 ” expression cassette was added at 0 . 2 μg / well . 3 . 3 real - time quantitative pcr to determine mrna level of mitf gene : the cell rna was extracted and purified with the mrna extraction and purification kit turbocapture mrna kit , following the instructions of the kit , and rna was dissolved in 80 μl rnase - free water / well , and 4 μl rna was taken as template for real - time quantitative pcr reaction . the mrna expression level of mitf gene in samples was determined with gene - specific primers , and also the housekeeping gene gapdh was amplified as internal reference . each reaction was performed in triplicates . 25 μl reaction system was established below : 4 μl template rna , 12 . 5 μl 2 × master mix , 1 μl forward primer ( 6 μm ), 1 μl reverse primer ( 6 μm ), 0 . 5 μl 50 × sybr green i , q . s . rnase - free water to 25 μl . the reaction conditions were : 40 ° c . reverse transcription for 30 min , 95 ° c . predenature for 7 min , 95 ° c . denature for 20 sec , 60 ° c . anneal for 30 sec , 72 ° c . extension for 30 sec , 45 cycles , and the solubility curve was determined . 3 . 4 results analysis : the experimental results were analyzed by 2 − δδct method , and a column plot was drawn as shown in fig5 . the results show that sirna at multiple sites of mitf present good silencing effect , and in particular , m001 - 24 reaches 81 %, compared to non - transfected group . it is particularly noted that , m001 - 24 sense strand sequence corresponds to positions 1636 - 1658 ( underlined tccactcctttcctcagtgtccc ) in mitf gene conserved regions . 1 . 1 instruments : nucleic acid synthesizer ( ge ), pcr apparatus ( abi ); real - time quantitative pcrapparatus ( bio - rad ); cell incubator ( thermo ) etc . 1 . 2 reagents and materials : lipofectamin ™ 2000 ( invitrogen ), dmem medium ( gibco ), turbocapture mrna kit ( qiagen ), ezomics ™ one - step qpcr kit ( biomics biotech ) etc . other biochemical reagents were purchased from sangon biotech ( shanghai ), and formulated into working solutions by biomics biotech . 1 . 3 real - time quantitative pcr primers ( synthesized by biomics biotech ) having the following sequences : mitf gene forward primer : ( seq id no : 13 ) 5 ′ catcaccttcaacaacaac - 3 ′; mitf gene reverse primer : ( seq id no : 14 ) 5 ′ atgctcatactgctcctc - 3 ′; gapdh gene forward primer : ( seq id no : 15 ) 5 ′- gaaggtgaaggtcggagtc - 3 ′; gapdh gene reverse primer : ( seq id no : 16 ) 5 ′- gaagatggtgatgggatttc - 3 ′. rnas of sense strand and antisense strand of m001 - 24 were synthesized using a nucleic acid synthesizer ( akta oligo pilot ) owned by biomics biotech , respectively . purification was performed , and the sense strand and the corresponding antisense strand were annealed into a sirna duplex , aliquoted in 1od / tube , finally freeze - dried , and dissolved to 20 μm with rnase - free water befer transfection . 3 . 1 cell culture : the melanoma cell a375 was cultured in the dmem medium containing 10 % fbs in a 37 ° c ., 5 % co 2 incubator . 3 . 2 cell plating and transfection : the cell was seeded in a 96 well plate at 1 × 10 5 / well , and was cultured overnight in an antibody - free dmem medium containing 10 % fbs in a 37 ° c ., 5 % co 2 incubator . transfection was performed following the instructions with lipofectamin ™ 2000 , and the rna was added at 10 nm / well . 3 . 3 real - time quantitative pcr to determine mrna level of mitf gene : the cell rna was extracted and purified with the mrna extraction and purification kit turbocapture mrna kit , following the instructions of the kit , and dissolved in 80 μl rnase - free water / well , and 4 μl rna was taken as template for real - time quantitative pcr reaction . the mrna expression level of mitf in samples was determined with gene - specific primers , and also the housekeeping gene gapdh was amplified as internal reference . each reaction was performed in triplicates . 25 μl reaction system was established below : 4 μl template rna , 12 . 5 μl 2 × master mix , 1 μl forward primer ( 6 μm ), 1 μl reverse primer ( 6 μm ), 0 . 5 μl 50 × sybr green i , q . s . rnase - free water to 25 μl . the reaction conditions were : 40 ° c . reverse transcription for 30 min , 95 ° c . predenature for 7 min , 95 ° c . denature for 20 sec , 60 ° c . anneal for 30 sec , 72 ° c . extension for 30 sec , 45 cycles . 3 . 4 results analysis : the experimental results were analyzed by 2 − δδct method , and a column plot was drawn as shown in fig6 . the results show that m001 - 24 targeting mitf gene reaches silencing effect of 87 %. 1 . 2 reagents and materials : lipofectamin ™ 2000 ( invitrogen ), dmem medium ( gibco ), cck8 kit ( dojindo ) etc . other biochemical reagents were purchased from sangon biotech ( shanghai ), and formulated into working solutions by biomics biotech . 2 . 1 cell culture : the melanoma cell a375 was cultured in the dmem medium containing 10 % fbs in a 37 ° c ., 5 % co2 incubator . 2 . 2 cell plating and transfection : the cell was seeded in a 96 well plate at 1 × 10 5 / well , was cultured overnight in an antibody - free dmem medium containing 10 % fbs in a 37 ° c ., 5 % co 2 incubator . transfection was performed following the procedures with lipofectamin ™ 2000 ( invitrogen ), and the tested various rna molecules were added at 10 nm / well . 2 . 3 cck - 8 assay : the determination was performed at various time points . a volume of 1 / 10 medium of cck - 8 solution was added in each well in plate . it was further incubated for 0 . 5 - 4 h in a cell incubator . the absorbance at 450 nm was determined with the miroplate reader . 2 . 4 results analysis : according to measured a 450 values ( od values ), a growth curve was plotted as shown in fig7 . compared to normal group , m001 - 24 has a certain growth inhibition effect on melanoma cell , without significant toxic effects . 1 . 2 reagents and materials : lipofectamin ™ 2000 ( invitrogen ), dmem medium ( gibco ), trypsin ( gibco ), cck8 kit ( dojindo ) etc . other biochemical reagents were purchased from sangon biotech ( shanghai ), and formulated into working solutions by biomics biotech . 2 . 1 cell culture : the melanoma cell a375 was cultured in the dmem medium containing 10 % fbs in a 37 ° c ., 5 % co2 incubator . 2 . 2 cell plating and transfection : the cell was seeded in a 96 well plate at 1 × 10 5 / well , was cultured overnight in an antibody - free dmem medium containing 10 % fbs in a 37 ° c ., 5 % co 2 incubator . transfection was performed following the procedures with lipofectamin ™ 2000 ( invitrogen ), and the tested various rna molecules were added at 10 nm / well . 2 . 3 melanin content determination : the method of jones k et al ( jones k et al . pigment cell res 2002 ; 15 : 335 - 40 ) was modified for melanin content determination . a375 cell was transfected for 72 h , and then washed with pbs twice and digested with 0 . 25 % trypsin . the complete medium was added to terminate digestion . the cell was centrifuged at 1 , 000 rpm for 5 min , and the supernatant was discarded . the cell was resuspended by adding 1 ml pbs per well , counted with a hemocytometer , and then centrifuged at 1 , 000 rpm for 5 min , and the supernatant was discarded . the cell pellets were dried in a superclean bench , and cells were dissolved per 10 6 cells in 500 μl n naoh solution containing 1 % dmso . it was heated at 80 ° c . for 1 h and then cooled . the absorbance at 475 nm was determined with the miroplate reader . 2 . 4 results analysis : according to measured a 475 values ( od values ), a column chart was plotted as shown in fig8 . compared to normal group , in m001 - 24 treatment group , melanin content was decreased by 43 %, indicating that melanin production was significantly inhibited .	2
the accompanying drawings and the description which follows set forth this invention in its preferred embodiment . however , it is contemplated that persons generally familiar with water sports devices and airfoils will be able to apply the novel characteristics of the structures illustrated and described herein in other contexts by modification of certain details . accordingly , the drawings and description are not to be taken as restrictive on the scope of this invention , but are to be understood as broad and general teachings . referring now to the drawings in detail , wherein like reference characters represent like elements or features throughout the various views , the water sports device of the present invention is indicated generally in the figures by reference character 10 . turning to fig1 airfoil 10 is illustrated having a rider r standing thereon . airfoil 10 is connected to a tow device , generally t , by tow ropes , or lines , generally l . tow device t is illustrated as being a motorboat 12 having an upwardly extending tow bar 14 , having a tow ring , generally 16 connected thereto . in the fig1 illustration , airfoil 10 is being towed by towboat 12 at a speed sufficient for it to become airborne above the height of the surface of the water , generally w . in the embodiment of the present invention shown in fig1 tow connectors , generally 18 , are provided on airfoil 10 , and can include eyebolts 20 having ringed portions 22 to which tow lines l are connected . extending substantially the length of airfoil 10 is an elongated spar 24 . in one preferred embodiment , spar 24 is a polyvinyl chloride ( pvc ) pipe to which threaded ends of eyebolts 20 are received , with bolts 26 retaining eyebolts to spar 24 . encircling spar 24 is the airfoil support structure , generally s . support structure s , in the preferred embodiment , is polystyrene , commonly known as styrofoam ®. support structure s forms the basic aerodynamic profile of airfoil 10 and is preferably covered along its surfaces with a fiberglass skin 28 . however , other materials , such as fabric , neoprene , plastic and / or rubber or vinyl coatings could also be used if desired . further , support structure s , if constructed of a rigid material such as polystyrene , could be used without any skin 28 at all , if desired . it is to be noted that support structure s , although preferably constructed of a buoyant material such as polystyrene , could also be air , if airfoil 10 was made of airtight construction , such as blow molded plastic . further , airfoil 10 could be constructed of vinyl , plastic , rubber , or some other material such that it could be inflated for use , and then deflated for transport and / or storage . connected to airfoil 10 are attachment rings 30 to which handle ropes , generally 32 , are attached . handle ropes 32 are also provided with handles , generally 34 , which are grasped by the rider r during use . although handles 34 have been shown as being connected to airfoil 10 by ropes 32 , it is to be understood that handles 34 could be of a variety of configurations , and could be flexibly or rigidly attached to airfoil 10 by other means such as by plastic piping , plastic coated cables , etc . airfoil 10 defines a platform , generally p , on which rider r is shown standing in fig1 . rider r could also sit , kneel , or even lie down on platform p during use , if desired . an alternate embodiment of the present invention is illustrated in fig2 . in the fig2 embodiment , lines l are not fixedly tied to tow connectors 18 , but are instead allowed to freely pass therethrough . rider r , through grasping of handles 34 , and through his or her attachment to platform p of airfoil 10 by a releasable strap 40 , effectively connects airfoil 10 to the tow device . strap 40 could include a hook and fastener system , such as velcro ®, or could use snaps , buckles , clips or the like in order to fasten airfoil 10 to rider r . also provided on airfoil 10 is at least one pontoon , two pontoons , 42 , 44 being illustrated in the fig2 embodiment . pontoons 42 , 44 are connected to the underside of airfoil 10 by pylons 46 , 48 , respectively . pontoons 42 , 44 pylons 46 , 48 could be material such as polystyrene , fiberglass , rigid plastic , aluminum , etc . or some other suitable material . pontoons 42 , 44 can be used to raise airfoil 10 such that airfoil 10 is only partially , or entirely spaced above the surface of the water w . this allows a greater airflow beneath airfoil 10 , once airfoil 10 is towed . by allowing a greater airflow under airfoil 10 , airfoil 10 should experience lifting forces at lower tow speeds than perhaps would be expected without pylons 42 , 44 . pylons 42 , 44 could be configured such that they stayed with airfoil 10 during flight , or pylons 42 , 44 could be configured such that they can be jettisoned from airfoil 10 , when airfoil 10 becomes airborne , or when otherwise desired . in the fig2 embodiment , rider r will actually experience the towing force from the towing device t , since lines l are not secured to tow connectors 18 , but are instead held by the rider r . however , rider r will also be able to manipulate lines 52 independently of one another , if desired , to in effect turn air foil 10 , or otherwise maneuver it during flight . rider r could also extend his arms forward , while leaning back and holding lines 50 , 52 , and perhaps increase the angle of attack of airfoil 10 by raising the leading edge 54 thereof with respect to trailing edge 56 . rider r could also do the reverse , in order to lower leading edge 54 of airfoil 10 if he desired to cause airfoil 10 to enter a dive . fig3 illustrates a further embodiment of the airfoil of the present invention , and is designated generally as 10a . airfoil 10a includes at least one downwardly extending stabilizer fin , generally f , and in fig3 two stabilizer fins 58 , 60 are shown , each of fins 58 , 60 extending downwardly from a respective end 62 , 64 of airfoil 10a . elongated slots 66 are provided within each fin f to allow for adjustment of the length by which the end 68 of a fin 58 , 60 extends below airfoil 10a . enlarged head pins or screws 70 are provided in the ends 62 , 64 of airfoil 10a for receipt in slots 66 of fins 58 , 60 and allow for the fixing of a fin in the desired position after adjustment . airfoil 10a also includes at least one operable aileron , generally a . in the fig3 embodiment , ailerons 72 , 74 are illustrated adjacent trailing edge 56a of airfoil 10a . ailerons 72 , 74 can be connected by ropes or cords 76 , 78 , which pass downwardly through holes 80 through airfoil 10a , and then upwardly through holes 82 and extend outwardly therefrom . during use , rider r could pull up on cords 76 , 78 simultaneously , or independently of one another , to operate ailerons 72 , 74 . further , spoilers 84 , 86 are provided on forward portions of airfoil 10a and are similarly operable by cords 88 , 90 to further enhance the maneuverability of airfoil 10a during use . turning to fig4 a further embodiment of the present invention is shown . this embodiment , illustrated generally by reference numeral 10b , includes at least one rudder generally 92 to allow for steerage of airfoil 10b while in the water and in flight . in fig4 airfoil 10b is shown having two rudders , 94 , 96 . the rudder system in fig4 is shown in simplified form , and includes idler arms 98 , 100 being fixedly connected to the respective upper ends 102 , 104 of rudders 94 , 96 , respectively . tie rods 106 , 108 are connected to idler arms 98 , 100 , respectively , such that movement of tie rods 106 , 108 causes respective movement of idler arms 98 , 100 , and in turn , rudders 94 , 96 , respectively . an arm , such as a pitman arm 110 , is connected to both tie rods 106 , 108 , and a crank arm 112 is connected to pitman arm 110 , with an upstanding handle 114 connected to pitman arm 112 . handle 114 is moveable in the direction shown by arrows a and b in order to cause corresponding pivoting of rudders 94 , 96 . thus , the rider can cause airfoil 10b to be steered to the left and to the right while being towed in the water , and also while airborne . fig5 a and b are sectional views of variations of airfoil 10 , the difference between the views being the thickness of airfoil 10 . the thickness t 1 of the airfoil in fig5 a being less than the thickness t 2 of the airfoil profile illustrated in fig5 b . it should be noted that the profile of the airfoil of the present invention could be any number of a varieties of known aerodynamic profiles . for example , the chord length cl of the airfoils of the present invention could be between 3 and 4 feet and the length of the airfoils al ( fig4 ) is preferably between 8 and 12 feet , although both the dimensions of the cl and the al could be greater than or less than these lengths , depending on the application desired , the desired aerodynamic effects , costs , age and / or weight of the rider , the level of skill of the rider , etc . in one preferred embodiment , the maximum airfoil thickness is between 6 % and 18 % of the length of cl at a distance of between 20 % to 40 % of the length of cl aft of leading edge 54 . further , in general and to a limit , the more blunt leading edge 54 is , and the thickness of the airfoil , the greater lift , but also , correspondingly , the greater the drag . conversely , a thinner profile would typically yield less drag , but also , accordingly , less lift . from the foregoing , it can be seen that the present invention includes a water sports airfoil capable of a variety of configurations and variations . the airfoil could be of very simple , basic construction , such as shown in fig1 or could be much more elaborate and could include in a single embodiment , the pontoons , rudders , ailerons , spoilers , and fins , if desired , or , the present airfoil could have any combination of those features , if desired . while preferred embodiments of the invention have been described using specific terms , such description is for present illustrative purposes only , and it is to be understood that changes and variations to such embodiments , including but not limited to the substitution of equivalent features or parts , and the reversal of various features thereof , may be practiced by those of ordinary skill in the art without departing from the spirit or scope of the following claims .	1
in the disclosed embodiments , there is provided a wireless communications system comprising a transmitter and receiver in which the receiver periodically scans the band of operation to produce a representation of the frequency spectrum of the band of operation and conveys this information back to the transmitter and the transmitter uses this information to make decisions about the nature of the communications link . the receiver and transmitter may be synchronized so that the transmitter stops transmitting its signal when the receiver is scanning the band of operation . the receiver may scan both inside and outside its current channel of operation to produce a frequency spectrum covering a larger band than just its band of operation . the receiver may use an analog switch , a dispersive ( i . e . chirp ) filter , followed by an envelope detector to produce a frequency spectrum of the received signal . the band of operation of the dispersive filter may be smaller than the entire band of operation of the system , and the frequency scan consists of multiple frequency scans each with a different centre frequency . the information carrying signal in the communications system may include a chirp signal . the local representation of the frequency spectrum may be seen by each of a number of transceivers in a communications system , and the other transceivers may use this information to make decisions about the configuration of the communications network . all the transceivers in the system may be synchronized , so that no transceiver is transmitting a signal when all the transceivers are scanning the band of operation . the transceivers may scan outside of each of their current channels of operation to produce a frequency spectrum covering a larger band than just their individual bands of operation . fig1 shows a simple , two transceiver ( sometimes called “ peer - to - peer ”) radio network . each transceiver consists of a transmitter ( 14 , 20 ) and receiver ( 10 , 18 ) section , as well as a channel scan ( 12 , 22 ) block . the channel scan block ( 12 , 22 ) can be separate circuitry or contain pieces that are an integral part of the receiver ( 10 , 18 ). the job of the channel scan block is to periodically scan the band of operation of the transceiver , and produce data which is shows the amount of power seen at each frequency for all frequencies in the band of operation of the transceiver . when a scan is to take place , coordination between transceivers must occur across the wireless channel ( 16 ). at a prescribed time , both transmitter sections of each transceiver ( 14 , 20 ) shut off to allow both channel scanners ( 12 , 22 ) to perform their frequency sweep of the radio channel . when this is complete , regular communications can resume , and , at some point , each transceiver will transmit its scan information across the wireless channel ( 16 ) to the other . in this way , both transceivers will have a copy of the channel seen by the other transceiver . fig2 shows a block diagram of the detail of the channel scan block ( 12 ) from fig1 . this block also contains elements of the receiver block ( 10 ). the wireless signal is first picked up by the antenna ( 30 ) and fed into the receiver front end ( 32 ) which amplifies the signal and converts its centre frequency from the transmission frequency to the receiver &# 39 ; s intermediate frequency ( if ). the gain of the receiver front end ( 32 ) is controlled by a control line from the baseband portion of the radio ( 42 ). the signal at the receiver &# 39 ; s if is fed into an analog switch ( 34 ). it is the job of the analog switch to reduce the duty cycle of the incoming if signal to a time interval which is close to the sample time of the analog - to - digital converter ( 40 ). the analog switch is held on during normal transmission and reception of data , and is only switched during the channel scan . control of the analog switch ( 44 ) is also done by the baseband section . the duty - cycled if signal is then fed into a chirp ( i . e . dispersive ) filter , ( 36 ). the action of this chirp filter is to spread the frequency components of the duty - cycled signal out in time , effectively performing a fourier transform on the signal ( i . e . converting the signal from the frequency domain to the time domain ). the output of the chirp filter ( 36 ) is fed into an envelope detector ( 38 ) which converts rf power in the signal to a proportional dc voltage , independent of the frequency of the signal . this voltage is then read by the digital - to - analog converter ( 40 ) which converts the voltage into a digital signal which can be stored by the system . in this way , the input rf signal is converted to a frequency scan of the band of operation . fig3 shows a detailed description of how the channel scan block converts the incoming rf signal into a frequency scan . the incoming signal at the radio &# 39 ; s intermediate frequency ( if ) consists of a combination of many signals at different frequencies and at different power levels ( 60 ). this signal is first passed through an rf switch ( 62 ) which shortens its duty cycle so that its duration is on the order of the sample time of the analog - to - digital converter ( 70 ). this is an important step because it ensures that different frequencies will not overlap in the output when sampled by the analog - to - digital converter ( 70 ). if the if signal were not duty - cycled , then all the frequency components seen by the analog - to - digital converter would overlap , and the signal produced would not have the desired frequency - versus - time relationship . after duty cycling , the signal is then passed through a dispersive filter ( 64 ) which has a linear group delay function . this linear group delay function adds a delay in proportion to the frequency of the signal applied at the input of the filter . thus , for the input signal shown ( 60 ), the signal seen at f 1 would have a time delay t 1 applied to it , and the signal seen at f 2 would have a time delay t 2 applied to it . there will also be some insertion loss incurred through the filter . at the output of the dispersive filter ( 64 ), signals with various time delays and various centre frequencies are seen . from here the signal is applied to the envelope detector ( 66 ) which removes the frequency offset of the various signals and demodulates them down to baseband . thus at the output of the envelope detector ( 66 ) a time varying voltage whose amplitude is proportional to the power of the input signal is seen . this signal also scans from one end of the bandwidth of the dispersive filter to the other over time . thus a frequency sweep whose voltage is proportional to the input signal power has been produced . the output of the envelope detector ( 66 ) is applied to an analog - to - digital converter ( 70 ) which produces a digitally sampled copy of the frequency sweep . that way , the signal can be transmitted to other transceivers in the network , or simply stored in the transceiver and used to make intelligent decisions about its radio communications . fig4 shows a network of transceivers which are all completing local channel scans and transmitting the information to each other over a shared wireless channel ( 86 ). one of the transceivers ( 82 ) is designated as the coordinator and controls the behavior of all the other transceivers ( 80 , 86 , 84 ) sharing the wireless channel ( 86 ). when the network determines that a scan of the radio channel is to be made , the coordinator ( 82 ) signals the other transceivers ( 80 , 86 , 84 ) to not transmit so that the wireless channel ( 86 ) will be quiet and only contain interfering signals . during this quiet time , all transceivers will scan the radio channel and obtain local channel scans information . once this is achieved , each transceiver will in turn share its scan information with all the other transceivers so that radio reception can be optimized . fig5 shows a channel scan block in which the frequency band to be scanned is larger than the bandwidth of the dispersive filter . in this case , the channel scanner is designed to take multiple scans over a large frequency band and combine them together , to create a scan over a large band . the signal coming into the antenna ( 90 ) covers a band which is too large for the dispersive filter to cover at one time ( 100 ). the solution is to cover the band in two passes , one with a centre frequency of f 1 ( 102 ) and one with a centre frequency of f 2 ( 104 ). the two bands may be overlapping , as is the case in fig5 , or not . the procedure for completing multiple overlapping scans is as follows . the centre frequency of the first scan ( 102 ), is set by the receiver front end voltage controlled oscillator ( vco ) ( 94 ) to f 1 . the channel scanner produces a scan from t 1 to t 2 ( 108 ) at the digital - to - analog converter ( 98 ). after this first scan is complete , the receiver front end vco is tuned to f 2 , the centre of the second scan ( 104 ). after the channel scan system ( 96 ) completes the scan , the signal from t 3 to t 4 appears at the input to the digital - to - analog converter ( 98 ). the system can now combine these two scans to create a scan over a band which is much larger than the bandwidth of the dispersive filter . in this way , a band of arbitrary bandwidth can be scanned by the system over a very short period of time . operation of the methods disclosed here produce a profile of the band of operation that shows the relationship between each frequency and the amount of interference power at that frequency . this relationship may be used to identify a portion of the band of operation to transmit on in preference to other portions , such as a portion with lower or lowest interference . a transceiver may also send this information to some or all the other transceivers on the network , or transceivers in a specific group or locality , so that multiple transceivers on the network know the interference profile of other transceivers . when each transceiver knows the interference profile of other users , the transceivers may coordinate transmissions to reduce interference . since the nature of the interfering signals is not known a priori , and some interferers could change their characteristics ( i . e . centre frequencies , power , etc .) often , it would be advantageous for the radio to perform this frequency measurement regularly and over a very short period of time . a tabulation may then be kept of the dynamic behavior of the interferers and this may be checked against known radio standards . once identified , predictive algorithms may be used to estimate some of the future behavior of the interferers , further enhancing the radio &# 39 ; s performance . thus , a radio having the ability to produce a plot of frequency versus interference power for its band of operation is a useful feature in an operating network . furthermore , for such a system to be practical , this measurement ability should be a basic function of the radio without adding much complexity or severely increasing power consumption . what is disclosed here is a technique for performing this measurement function which meets those criteria . immaterial modifications may be made to the embodiments described here without departing from what is covered by the claims . in the claims , the word “ comprising ” is used in its inclusive sense and does not exclude other elements being present . the indefinite article “ a ” before a claim feature does not exclude more than one of the feature being present . each one of the individual features described here may be used in one or more embodiments and is not , by virtue only of being described here , to be construed as essential to all embodiments as defined by the claims .	7
the principal functional components comprising the incremental discharge , dual phase flushing toilet are depicted in fig2 - 9 and 12 - 15 . in the side schematic of fig1 , the toilet bowl 20 is provided at its base outlet with spring - loaded , air lock valves 22 , serving to permit water waste to gravitate below from bowel 20 and also to arrest sewer odors arising from below into the bowel . it comprises closet flange 24 and conduit trap 26 , both located below valve 22 . this conduit with an enlarged waste storage volume serves as an interim liquefied waste container . in the schematic of fig2 there is seen an internally compartmented water holding tank 28 , including the manual flushing mechanism , generically 30 , with the major elements being a horizontally - aligned , planar and generally rectangular traversing , flush control plate 32 , which plate is provided on its lower linear surface with a regular series of smooth arc - like indentations 34 ( regularly configured corrugations ) later to be detailed . such indentations are preferably over its entire length . this plate has its longer linear dimension positioned longitudinal of the tank configuration , which dimension ranges from six - to - ten times its planar traverse dimension . plate 32 is also provided with two spaced - apart , axially - aligned , linear slots 36l , 36r , which slots permit a limited range of lateral and reciprocal travel for the plate itself . plate 32 is partially supported upon the headed mounting pins , 38l , 38r , which project fixedly from holding tank rear wall ( seen in fig4 / 5 ). holding tank 28 is itself vertically separated into two compartments , 42l and 42r , via partition wall 44 , which extends from the bottom wall 46 of the holding tank almost to the top edge thereof , i . e ., to a point just below removable downward flanged edge tank cover 48 . ( an end view of partition wall 40 is presented in fig1 , depicting rounded spaced - apart , conduit apertures 50u and 50l .) external action arm 52 is pinned internally of tank 28 to one end of a flexible chain 54 , the other longitudinal end of which chain is pinned to the upper segment of pivotable , linear pin 56 , which segment initially rests in the left hand most underrecess 34l of the indentations 34 on traversing plate 32 . spaced apart from linear , spring - loaded pivotable pin 56 is a second similar spring - loaded pin 58 , the upper segment of which rests in the adjacent recess 34r of the indentation series 34 . a second flexible chain 60 depends from midway of plate 32 ( being anchored thereto ) running through larger water compartment 42l , to be pinned at its lower longitudinal end to the free edge of first float valve cover 62 hingedly secured ( and sealing ) over the first outlet orifice 63 . a third flexible chain 64 depends from a horizontal pin 65 nested in lower edge of plate 32 ( slot 34 ), and is pinned at its lower longitudinal end to the free edge of second float valve cover 66 , which is hingedly secured ( and sealing ) over the second inclined orifice outlet 68 . both orifices 63 and 68 conjoin to provide common conduit 70 , which as needed , carries flushing water from the holding tank compartments to toilet bowl 20 ( fig1 ). looking to fig2 in common conduit 70 there also is positioned an upward edge , flapper valve 71 serving to preclude water backflow from larger compartment 42l into the smaller compartment 42r when the latter is sporadically emptied . finally , a fourth flexible chain 72 extends from being anchored to the right hand vertical edge of plate 32 , over rotor 74 , terminating at its lower end in depending weight 76 , which biases the traversing plate to move rightwardly when other lever leftward forces are not dominant , to be described . normally , the spring - loaded pressure of lever 58 upon underedge indentations lock each incremental movement in place by exceeding the bias of weighted chain 72 tending to draw plate 32 in a retrogressive lateral direction . vertical column 77l serves as the water level control means for compartment 42r , directing any overflow via arcuate conduit 78l to vertical stand pipe 80 , which itself connects to its lower end with flushing common conduit 70 . similarly , any overflow from small compartment 42r flows via conduit 78s also to stand pipe extension 80s . thus , any inner holding tank overflow is directed to the main tank outlet conduit flowing to the toilet bowl . averting briefly again to fig1 , partition wall 44 presents an upper port 50u which admits of the diameter of side stand pipe 80s ( fig2 ), and the wall below also presents port 50l , which admits of the diameter of common conduit 70s ( fig2 ). also in the upper segment of fig1 , there is presented a horizontal linear solid bar 83 which serves as the cantilevered means for flushing water from small compartment 42s via chain 64 operatively connected to float valve 66 ( not seen ). looking to the broken out , enlarged schematic view of fig3 greater detail on the function of the traversing plate and associated actuation means is provided . the rightmost end position ( lower ) of the plate and its associated parts is depicted in solid lines , while the leftmost end position ( upper ) of the plate is seen in phantom lines . at the start of the incremental flushing cycle , the plate position is that depicted in solid lines . each push on external lever 30 ( fig2 ), shifts plate 32 one indentation 34 leftward , overcoming the rightward counterforce provided by weight 76 . adjacent pivoting pin 58 follows along . hinged swing pin 79 is functionally linked at its upper movable end to slot support pin 38l , initially located at the leftward end of left - side slot 36l . similarly , second hinged swing pin 81 is functionally linked at its movable end to the other slot support pin 38r , which is located at the leftward end of the right side slot 36r . note the projecting end of bar 83 in fig3 having alternate spots , dependent upon the lateral position of plate 32 . the full - view , horizontally - projecting cantilevered bar 83 ( of fig1 ) travels along an underside indentation ridge ( as shown ) when plate 32 is moving laterally , swinging bar 83 to uplift chain 64 , and release water from compartment 42r . the alternate other end position of plate 32 as it is shifted leftwardly , and somewhat upwardly is seen in fig3 with the latter upward shift being induced by the upward arcing of anchored levers 79 and 81 . the uplift of the bottom edge of plate 32 permits same to clear levers 56 / 58 , and retrogress to the starting position . the elevational , sectional side view of fig4 ( looking leftward from partition wall 44 ) is similar to that of fig1 , but denotes the flexible chain 64 which extends between cantilever 83 and smaller compartment float valve lid 66 . the vertical sectional side view of fig5 ( looking rightward from wall 44 ) shows that chain 60 extends between its intermediate fixed anchor point on plate 32 down to the horizontal float valve 62 of larger compartment 42l . in fig1 is a broken away , enlarged view of the manual flushing lever 30 of fig2 . the depending segment 30w is the weighted portion , that returns the manual lever to its original position after manual release . port 80 in the upper edge of lever segment 52 secures one free end of the flexible chain 54 ( fig2 ). threaded bolt 82 pins segment lever 30 to the holding tank front wall 40f , while its threaded nut 84 retains the bolt in place . main lever 30 is an integral to horizontal lever arm 52h ( fig2 ) that projects outside the tank for manual activation . in the broken - out , enlarged , detail vertical sectional view of fig1 is depicted an upper - end , spring - loaded , bottom weighted , first cantilever 56 of fig3 which is operatively tied via chain 54 to manual activation arm 52 . cantilever 56 ( front side seen in fig2 and 3 ), serves to bias traversing plate 32 in a leftward direction . note the functional elements of lever assembly 56 are disposed , generally vertically , are located between the tank back wall 40b and the planar vertical surface of plate 32 . upper rigid pin 90 is the horizontal element that rides along the lower edge , even indentations 34 of plate 32 , being secured at its inner end to the partly truncated upper lip , 92 of lever 56 by threaded bolt 94 . the upper segment of lever 56 is a cylindrical shell 96 , adapted to receive a toroidal spring 98 , the upper end of which spring is retained by pin 90 , and the lower end of which spring 90 is retained by horizontal pivot pin 100 . this spring - induced bias permits upper horizontal pin 90 to move vertically and reciprocally along the plate indentations 34 while axially pinned on lip 92 within the lever hollow shell 96 . disposed about lower support pin 100 is detachable collar 102 , which carries external washer - type guides 104 , located external of the middle segment ; collar 102 is axially pinned with retaining bolt 106 to pin 100 . the resulting assembly facilitates reciprocal movement of toroidal spring 90 and lever 56 responsive to the motion of plate 32 . the adjacent spring - loaded , weighted lever 58 serves to lock each incremental leftward movement of the plate 32 in place ( by virtue of its inclined angle leftward and the resistance of the adjacent indentation ridge ), as depicted in the sequential series of fig6 to 8 for adjacent swinging lever travel . then spring bias of levers 56 / 58 normally precludes the plate 32 from moving rightwardly ( laterally ) despite the bias imposed by the suspended weight 76 tied to plate 32 via chain 72 , until an event , to be described . second lever 58 is better seen in the vertical sectional view of fig1 . it is also offset from the tank back wall 40b , and being pivotally mounted on tapped horizontal pin 110 . lever 58 has a depending , weighted segment 112 , and an upper hollow cylindrical segment ( or shell ) 113 . the upper edge 114 of shell 113 is channeled and flared outwardly to facilitate sliding contact with the undulating ( corrugated ) lower edge of traveling plate 32 . a toroidal spring 116 is loaded into shell channel 114 , and this facilitates the reciprocal vertical movement of shell 114 on the indentations 34 of plate 32 . pin 110 retains lever 58 in vertical alignment via external retaining washers 118 and threaded end bolt 120 positioned for securing cantilever 58 to support pin 110 . in fig2 and 3 , there are also depicted top - side , two normally vertically - aligned , keeper levers 122l and 122r , that serve to maintain the traversing plate 32 in its lower level position during most of its lateral traverse ( fig3 -- solid lines ). when plate 32 reaches the end position of its leftward travel , it rises to its upper position , as directed by the slot - tracking , pivotable levers 79 and 81 . alternately , when plate 32 rises to its upper position ( fig3 -- phantom lines ), then the keeper levers 122l / 122r are swung to an angular or horizontal position by the rightward shift of the plate . the detailed linkage for movement of the described keeper levers and pivotable levers is better seen in fig9 . hinged lever segment 124 is in a vertically position secured via hinge 126 to detent 128 . keepr levers 122l / r are mounted laterally and offset on the face of tank back wall 40b . a cylindrical roller 130 is positioned to ride on an inward recess 132l located in the top edge of plate 32 ( fig3 ); the roller being contained by the flared outward walls of segment 124 . when roller 130 is located in this top recess 132l , then the lower section 124 of keeper lever 122l swings on its hinge to an angular position , whereby the plate 32 rises to its upper position moving leftward , to repeat the incremental flushing sequence . a second recess 132r is provided at the upper edge of the right side longitudinal end of plate 32 . as noted , slot - tracking , pivotable levers 79 / 81 ( 45 - 50 ) permit the plate 32 to reciprocate between its lower ( solid lines ) and its upper ( dotted lines ) positions , as selectively permitted by the keeper lever action ( fig9 ), just described . averting to fig1 , there is seen the broken - out , side view of rear - side ( back of plate 32 ) pivotable levers 79 / 81 . the linear slot 36l of plate 32 rides on a crank - shaped support arm 140 . the outward end 140e of support arm 140 has capped retaining washers 142 , and the other ( inward ) longitudinal end of arm 140 is mounted on the holding tank back wall 40b . when the flush lever 30 is manually depressed , the laterally traversing flush plate 32 , which is the primary component of the present incremental flushings mechanism is ( 26 ) shifted , displacing chain 64 , causing the water volume in the smaller compartment 42r to be flushed ; this occurs for successive multiple uses of the toilet . each such limited volume flushing contains sufficient water to cleanse the toilet bowl , and to wash the waste down into the trap zone ( 26 of fig1 ). as the traversing control plate is moved laterally and incrementally leftward , stepwise , the standard inflow valve mechanism ( not seen ) causes the smaller compartment to refill with water to a preset level . the traversing control plate 32 , as it continues to move incrementally , travels to an extended final position , whereupon its final levered action causes the larger tank compartment 42l to flush all waste from the toilet and from the trap below into the sewer line . the traversing flushing plate travels on levers 79 / 81 ( fig1 ) installed on the base plate tank wall . plate 32 is normally held in a lower horizontal position by vertical hinged keepers ( 122l / 122r ), equipped with rollers ( 130 ) disposed in the ends of mounted on the base plate ( see fig9 ). the traversing plate is first moved by a spring - loaded , weighted lever 56 being pulled by connecting chain 54 , which is activated when the weighted flush lever 30 is manually depressed . the vertical weighted lower end 30w of the flush lever causes it to return to a vertical position . as that movement takes place , a spring - loaded , weighted trip - lock lever 58 retains the traversing plate in place . the spring - loaded , weighted lever retracts around the adjacent protrusion of the corrugated grooves of the plate to become positioned in the next groove to allow flushing action to be repeated . when the traversing plate 32 travels to the final position ( phantom view -- fig3 ) it causes the larger compartment 42l to flush , then hinged keepers 122l / r pivot in the recesses ( 132l / r ) in the top of that plate , so that the lower part of those keepers are forced into a horizontal position , allowing that plate to be raised by the pivotable levers ( 79 / 81 ), which causes the plate to return to its original starting position by the bias of chain - attached weight 76 . upon reaching its original position , plate 32 is lowered by gravity and by the swivel levers , returning to its starting position , to again begin the series of multiple flushing of the smaller compartment . as the traversing plate reaches that lower position , the top - side hinged keeper levers return to a vertical position , again holding that plate in the lower position for the next traversing cycle . the incremental , reduced volume flushing process is then repeated as the toilet is used , until the final flush phase is achieved .	4
although not shown in the drawings , the present invention is preferably used in a passenger vehicle , such as a tow - along trailer or self - propelled ( motorhome ) recreational vehicle . the lift mechanism &# 39 ; s 10 robust framing and drive assembly allow it to be used advantageously to vertically elevate heavier loads , on the order of 1 , 000 - 2 , 000 pound loads , such as all terrain vehicle , motorcycles , and the like , and thereby clear floor space in the interior of the vehicle . fig1 shows the lift mechanism 10 inverted in what would be an elevated position if not inverted . the lift mechanism 10 can be mounted inside the main vehicle interior or within an extendable and retractable slide - out section of the vehicle to provide further space - saving benefits . such slide - out sections are well known to have a floor , ceiling , upright end wall and two upright side walls , which form a part of the vehicle exterior when extended . referring now to fig1 and 2 , the primary components of the lift mechanism 10 include a drive assembly 12 , a support platform 14 , an upright frame assembly 16 , a flexible drive assembly 18 and a guide assembly 20 . the support platform 14 is a framework of channel members including front 22 and back 24 runners and end channels 26 and 28 and inner channels 30 , 32 , 34 and 36 . the channels are joined in any suitable manner , such as by weldment or mechanical fasteners , using any standard joinery , such as overlapped or recessed joints . as shown in fig1 , the upright frame assembly 16 includes four vertical channel members 38 at the four corners of the support platform 14 . the open faces of these channels 38 receive the ends of the front 22 and back 24 channels allowing the support platform 14 to move up and down therein . wear pads ( not shown ) can be mounted to the channels , or any bushings , rollers or other friction reducing members , can be used at this junction to facilitate easier and smoother movement . the channels 38 of the upright frame assembly 16 are bolted or otherwise fixed to opposite side walls of the vehicle room or to the floor and / or the ceiling at opposite ends . the top and bottom ends of these channels 38 may be either capped , have clearance or run full height of the room so that the support platform 14 can not be decoupled readily . “ feet ” ( not shown ) at either the bottom , top or both ends of the vertical channels if the lift mechanism is mounted to the floor , ceiling or floor and ceiling , respectively . each foot can be a solid steel piece or a stack of steel pieces that are disposed between the vertical channels and the flooring or joists or other structural parts of the floor and ceiling . this can provide a more solid connection to the vehicle that mounting the vertical channels to the side walls of the vehicle room , which may have less robust tubular structural members . the height adjustment of the support platform 14 is accomplished by actuating the drive assembly 12 to move the flexible drive assembly 18 . as shown in fig1 and 2 , the drive unit 12 is preferably a suitable bidirectional electric motor and gear box drive unit 40 bolted to a motor mount flange that is welded to the support platform 14 between the innermost channels 32 and 34 . the motor drive unit 40 turns a long drive screw 50 that threads into a drive nut 52 mounted in a traveling pulley carriage 54 . to bear the force of heavier loads ( e . g ., 1 , 000 - 2 , 000 lbs . or greater ) carried by the support platform 14 , the drive screw 50 should mount via a spherical thrust bearing of tapered or cylindrical roller type and an angular compensating washer configuration 55 , which preferably includes a roller bearing , a spherical washer and a thrust bushing . this assembly allows the high thrust loading of the higher platform loads to be transferred successfully to the motor / gear box of the drive unit 40 . the drive unit 40 is mounted in fixed relation to the support platform 14 , and the carriage 54 translates with respect to the support platform 14 along the drive screw 50 as it is turned because the drive nut 52 is held in the carriage 54 against rotation so that the drive screw 50 turns relative to the drive nut 52 . as shown in fig7 , the carriage 54 has two support tubes 60 and 62 that extend between two end brackets 64 and 66 . the end bracket 66 mounts two double groove sheaves or pulleys 68 and 70 , which move along with the carriage 54 and can rotate about a vertical axis relative to the carriage 54 . as mentioned , operation of the drive unit 40 turns the drive screw 50 which moves the flexible drive assembly 18 . as shown in fig2 - 4 , in the preferred embodiment the flexible drive assembly 18 is an assembly of four cables , including two long cables 72 and 74 and two shorter cables 76 and 78 . one end of each cable 72 - 78 is fixed to a plate 79 mounted to the support platform 14 . the other end of each cable 72 - 78 is fixed either to an upper end of the upright frame assembly 16 or to the vehicle room frame ( such as ceiling joists ). rotation of the drive screw 50 by the drive unit 40 causes the carriage 54 to travel along the drive screw 50 toward the drive unit 40 , which has the effect of taking up cable and thereby raises the support platform 14 upward . the opposite rotation of the drive screw 50 causes the carriage 54 to travel along the drive screw 50 away from the drive unit 40 which lets out cable and lowers the support platform 14 . as the support platform 14 is raised and lowered , the cables 72 - 78 of the flexible drive assembly 18 move around the support platform 14 and upright frame assembly 16 as directed by the guide assembly 20 , and thereby raise or lower the support platform 14 . as shown in fig3 - 7 , the guide assembly 20 includes number of pulleys or sheaves , including both the movable position pulleys 68 and 70 as well as ten stationary pulleys 80 - 98 , all of which can be rotatable mounted on stub shafts 99 and retained by clip pins 101 ( see fig8 ). like the movable pulleys 68 and 70 , stationary pulleys 80 and 82 are double grooved , each engaging two of the cables . all of the other stationary pulleys 84 - 98 are single grooves , each engaging only one cable . the two double groove stationary pulleys 80 and 82 and single groove stationary pulleys 84 , 86 , 88 and 90 are mounted to the support platform 14 to rotate about vertical axes . singe groove stationary pulleys 92 - 98 are mounted to the support platform 14 to rotate about horizontal axes . the arrangement of the guide assembly 20 defines the cable pathway as shown in fig3 and 4 . the guide assembly 20 routes the cables 72 - 78 from the carriage 54 generally through the horizontal plane of the support platform 14 and then up vertically through the upright frame assembly 16 . in particular , all of the cables 72 - 78 extend from the fixed plate 79 and wrap 180 degrees around the two double groove movable pulleys 68 and 70 on the carriage 54 , with long 72 and short 76 cables engaging pulley 68 and long 74 and short 78 cables engaging pulley 70 . then , the cables engage the associated stationary double groove pulleys 80 and 82 and turn 90 degrees generally along member 24 of the support platform 14 . the long cables 72 and 74 engage pulleys 84 and 86 , and run back at an oblique angle to pulleys 88 and 90 , respectively , at the rear corners of the support platform 14 , then turn upward by wrapping 90 degrees around pulleys 96 and 98 , respectively . the short cables 76 and 76 run from the stationary double groove pulleys 80 and 82 and engage pulleys 92 and 94 , respectively , at two corners of the support platform 14 where they turn 90 degrees upwardly . in the preferred embodiment , translation of the pulley carriage 54 along the drive screw 50 causes the support platform 14 to be raised or lowered . the particular pulley arrangement described herein causes the support platform 14 to move about twice the distance that the carriage 50 travels . thus , an object can be raised up out of the way when not being used , which increases the effective living and floor space in the room inside the vehicle . when needed , it can be lowered into place for use . the operation can be performed using a simple wall switch mounted in a convenient location . the robust drive screw / nut and traveling pulley carriage arrangement allows the mechanism to lift heavier loads , such as an all terrain vehicle , motorcycles , and the like , items which are likely to be put into a recreational vehicle or trailer to more efficiently use the volume within the trailer or other vehicle . the lift mechanism of the present invention can include additional safety features designed to prevent the support platform 14 from inadvertently lowering , particularly when an object or person is located below the support platform 14 . various space monitoring devices , such as photo - sensors and the like , can be used to prevent the support platform 14 from being lowered when objects or people are in the space directly below it . as shown in fig1 , in the preferred embodiment described herein , the lift mechanism has a stop mechanism in which a compact light beam generator 100 , as know in the art , is mounted to one of the room walls at one side of the mechanism , and the reflector 102 is mounted to an opposite wall across from and at the same height , preferably 3 - 6 feet up from the floor , as the light beam generator 100 . this assembly creates a closed electrical path with the light beam passes unobstructed to the reflector 102 and back to an “ eye ” ( not shown ) on the light beam generator 100 . the light beam generator 100 is electrically coupled in series to the drive unit 40 . the electrical circuit of the drive unit 40 is opened when the light beam is obstructed by a person or object present across its path , which de - energizes the drive unit 40 and prevents it from being lowered . rather than being simply electrically in series with the drive unit 40 , the light beam generator 100 could be an input to a electronic controller ( not shown ) which monitors and processes the input as it controls the drive unit 40 . in that case , the input signal from the light beam generator 100 could be considered only when the drive unit 40 is lowering the support platform 14 , and ignored during when the support platform 14 is being raised . also , the input signal from the light beam generator 100 could be used by the controller to initiate another event , such as activating an emergency motor brake to immediately stop the support platform 14 or a reverse sequence in which the drive unit is controlled to stop downward movement and begin moving the support platform 14 upward . in any event , a manual override can be required to re - energize the drive unit 40 so that user input is provided to ensure that the area beneath the support platform has been cleared . as shown in fig9 - 11 , the lift mechanism also has a lock out mechanism that positively locks the support platform 14 in at a fixed height or vertical position . the lock out mechanism includes at least one , but preferably four , one at each corner , powered solenoids 110 , 112 , 114 and 116 that have a pin 118 that can be extended and retracted . each pin 118 is coupled to an arm 120 extending generally along the axis of the pin . the solenoids 110 - 116 are mounted along one side of the support platform 14 along a common axis and near opposite corners so that when extended the arms 120 can engage same height pairs of openings in the associated vertical channels 38 of the upright frame assembly 16 . the pairs of openings are part of a series of vertically spaced apart openings 130 in the vertical channels 38 . preferably , the arms 120 have tapered upper ends . the pins 118 of the four solenoids are normally extended by internal springs ( not shown ), thus the normal attitude of the solenoids are extended . this forces the arms 120 into the openings 130 and into engagement with the vertical channels . to raise the platform the arms 129 are left in the spring loaded out position and the taper on one side of the arms 120 allows them to “ cam ” or slide over the openings 130 in the vertical channels . the bottom of the arms 120 , which is flat , is the only contact area of the arm to the vertical channel , when the platform is at rest . the arms 120 makes a “ chunk , chunk , chunk ” sound when raising due to each arm 120 slapping into the openings 130 . this sound is used to fine tune the cable length when initially setting up the system . if the four cables are set to the correct length , ensuring the platform is level , the four arms 120 slapping against the vertical channel make one combined “ chunk ” sound . if the cables are of slightly different lengths , indicating an uneven platform the sound is of four distinct chunk sounds . the lock out mechanism can be activated electrically , either by user input via a button or other interface or via a control algorithm , to positively lock the support platform 14 at a given height . the controls for the lock out mechanism allows the support platform 14 to settle down when the desired height or position is achieved on the vertical channels . the controls “ know ” where the support platform 14 ( and thus the arms 120 ) are in relationship to the openings 130 in the vertical channels due to a hall sensor counting the revolutions of the motor . when the platform is raised to a position and the arms 120 snap into the opening 130 of the channels , or in the case of lowering when the solenoids withdraw the arms 120 and redeploy them when a lower switch is released , the controls reactivate the drive unit 40 and settles the platform via the arms 120 onto the bottom edge of the openings 130 . this removes loading from the cables and pulley carriage 54 of the system as well as optimizes the ability of the user to insert manual travel lock pins that captivate the upper movement of the platform for use when the vehicle / trailer is moving . this arrangement thus provides a positive , mechanical lock out supplemental to the drive unit 40 that better prevents unintended lowering of the support platform 14 , which is particularly advantages when lifting heavier loads . in addition , sensors can be added to the state of the support platform 14 and provide input to control the lock out mechanism . for example , tilt sensors or acceleration sensors that detect a non - level support platform condition or excessive change in travel speed can be used to rapidly deploy the arms 120 into engagement with same height or any other pair of openings 130 in the channels 38 , and thereby immediately stop movement , particularly downward movement , of the support platform 14 . it should be appreciated that merely a preferred embodiment of the invention has been described above . however , many modifications and variations to the preferred embodiment will be apparent to those skilled in the art , which will be within the spirit and scope of the invention . therefore , the invention should not be limited to the described embodiment . to ascertain the full scope of the invention , the following claims should be referenced .	1
the exemplary embodiment of the invention filters decoded hdtv signals which have been encoded according to the mpeg - 2 standard and in particular , the main profile , high level mpeg - 2 standard . the invention described herein , however , is not limited to down conversion filtering of decoded hdtv signals . the filtering method described below may also be used to filter other types of frequency - domain encoded digital signals which may be divided into sections , filtered , and then recombined . the mpeg - 2 main profile standard defines a sequence of images in five levels : the sequence level , the group of pictures level , the picture level , the slice level and the macroblock level . each of these levels may be considered to be a record in a data stream , with the later - listed levels occurring as nested sub - levels in the earlier listed levels . the records for each level include a header section which contains data that is used in decoding its sub - records . macroblocks are composed of six blocks , 4 luminance blocks y and 2 chrominance blocks , cr and cb . each block of the encoded hdtv signal contains data representing 64 respective coefficient values of a two dimensional discrete cosine transform ( dct ) representation of 64 picture elements ( pixels ) in the hdtv image . in the encoding process , the pixel data is subject to motion compensated differential coding prior to the discrete cosine transformation and the blocks of transformed coefficients are further encoded by applying run - length and variable length encoding techniques . a decoder which recovers the image sequence from the data stream reverses the encoding process . this decoder employs an entropy decoder ( e . g . a variable length decoder ), an inverse discrete cosine transform processor , a motion compensation processor , and an interpolation filter . fig1 is a high level block diagram of a typical video decoding system of the prior art . the video decoder of the prior art includes an entropy decoder 110 , which is usually a variable length decoder and a run length decoder , an inverse quantizer 120 , and an inverse discrete cosine transform ( idct ) processor 130 . the exemplary system also includes a controller 170 which controls the various components of the decoding system responsive to the control information retrieved from the input bit stream by the entropy decoder 110 . for processing of prediction images , the prior art system further includes a memory 160 , adder 140 , a motion compensation processor 150 , and a block to raster converter 180 . the variable length decoder 110 receives the encoded video image signal , and reverses the encoding process to produce control information including motion vectors describing the relative displacement of a matching macroblock in a previously decoded image . this matching macroblock corresponds to a macroblock of the predicted picture that is currently being decoded . the variable length decoder 110 also receives the quantized dct transform coefficients of the blocks of either the current video image , if intraframe encoding is used , or the difference between the current and the predicted video image which is referred to as the residual image , if interframe encoding is used . the inverse quantizer 120 receives the quantized dct transform coefficients and reconstructs the quantized dct coefficients for a particular macroblock . the quatization matrix to be used for a particular block is received from the variable length decoder 110 . the idct processor 130 transforms the reconstructed dct coefficients to pixel values in the spatial domain ( for each block of 8 × 8 matrix values representing luminance or chrominance components of the macroblock , and for each block of 8 × 8 matrix values representing the differential luminance or differential chrominance components of the predicted macroblock ). if the current macroblock is not predictively encoded , then the output matrix values are the pixel values of the corresponding macroblock of the current video image . if the macroblock is interframe encoded , the corresponding macroblock of the previous video picture frame ( a reference frame ) is stored in memory 160 for use by the motion compensation processor 150 . the motion compensation processor 150 receives the previous macroblock from memory 160 responsive to the motion vector which is received from the entropy decoder 110 . the motion compensation processor 150 then adds the previous macroblock to the current idct transformed macroblock ( corresponding to a residual component of the present predictively encoded frame ) in adder 140 to produce the corresponding macroblock of pixels for the current video image , which is then stored into the memory 160 . fig2 is a high level block diagram of an exemplary embodiment of a down conversion system . as shown in fig2 the down conversion system includes a variable length decoder ( vld ) 210 , a run - length ( r / l ) decoder 212 , an inverse quantizer 214 , and an inverse discrete cosine transform ( idct ) processor 218 . in addition , the down conversion system includes a down conversion filter ( dct filter ) 216 and down sampling processor 232 for filtering of encoded pictures . while the following describes the exemplary embodiment for a main profile , high level encoded input , the down conversion system may be implemented with any similarly encoded high resolution image bit stream . the down conversion system also includes a motion vector ( mv ) translator 220 , a high resolution motion block generator 224 including up - sampling processor 226 and half - pixel generator 228 and a reference frame memory 222 . in addition , the system includes a display conversion block 280 including a vertical programmable filter ( vpf ) 282 and horizontal programmable filter ( hzpf ) 284 . the display conversion block 280 converts downsampled images into images for display on a particular display having a lower resolution . the down conversion filter 216 performs a lowpass filtering of the high resolution ( e . g . main profile , high level dct ) coefficients in the frequency domain . the down sampling processor 232 eliminates spatial pixel values by decimation of the lowpass filtered main profile , high level picture to produce a set of pixel values which can be displayed on a monitor having lower resolution than that required to display a main profile , high level picture . the exemplary reference frame memory 222 stores the spatial pixel values corresponding to at least one previously decoded reference frame having a resolution corresponding to the down - sampled picture . for non - intra macroblock encoding , the mv translator 220 scales the motion vectors for each block of the received picture consistent with the reduction in resolution , and the low resolution motion block generator 224 receives the decimated low resolution motion blocks provided by the reference frame memory 222 , up - samples these motion blocks and generates half pixel values to provide motion blocks at the half pixel accuracy which exhibit good spatial correspondence to the decoded and filtered differential pixel blocks . the operation of this exemplary embodiment of a down conversion system for intra - macroblock encoding is now described . the main profile , high level bit - stream is received and decoded by vld 210 . in addition to header information used by the hdtv system , the vld 210 provides dct coefficients for each block and macroblock , and motion vector information . the dct coefficients are run length decoded in the r / l decoder 212 and inverse quantized by the inverse quantizer 214 . the vld 210 and r / l decoder 212 correspond to the entropy decoder 110 of fig1 . since the received video image represented by the dct coefficients is a high resolution picture , the dct coefficients of each block are lowpass filtered before decimation of the high resolution video image . the inverse quantizer 214 provides the dct coefficients to the dct filter 216 which performs a lowpass filtering in the frequency domain by weighting the dct coefficients with predetermined filter coefficient values before providing them to the idct processor 218 . in an exemplary embodiment , this filter operation is performed on a block by block basis . the idct processor 218 provides spatial pixel values by performing an inverse discrete cosine transform of the filtered dct coefficients . the down sampling processor 232 reduces the picture sample size by eliminating spatial pixel sample values according to a predetermined decimation ratio ; therefore , storing the lower resolution picture uses a smaller frame memory 222 compared to that which would be needed to store the higher resolution main profile , high level picture . the operation of this exemplary embodiment of a down conversion system for non - intra macroblock encoding is now described . in this exemplary embodiment , following the mpeg standard , the dct coefficients of the current received image represent the dct coefficients of the residual components of the predicted image macroblocks . the predicted image macroblocks can be forward , backward , and bi - directionally predicted . in a bi - directional case , for example , a forward predicted image macroblock and a backward predicted image macroblock may be averaged to provide the bi - directionally predicted image macroblock . the horizontal components of the motion vectors for a predicted frame are scaled since the down sampled low resolution reference pictures of previous frames stored in memory do not have the same number of pixels as the high resolution predicted frame ( main profile , high level ). referring to fig2 the motion vectors of the main profile , high level bit stream provided by the vld 210 are provided to the mv translator 220 . each motion vector is scaled by the mv translator 220 to reference the appropriate prediction block of the reference frame of a previous image stored in reference frame memory 222 . the size ( number of pixel values ) in the retrieved block is smaller than a block of the corresponding high resolution block used to encode the current image ; consequently , the retrieved block is up - sampled to form a prediction block having the same number of pixels as the residual block provided by the idct processor 218 . the forward or backward prediction block is up - sampled by the up - sampling processor 226 responsive to a control signal from the mv translator 220 to generate a block corresponding to the original high resolution block of pixels . then , half pixel values are generated , if indicated by the motion vector for the up - sampled prediction block in the half - pixel generator 228 , to ensure proper spatial alignment of the prediction block . in the bi - directional case , for example , the forward and backward predicted image macroblocks of upsampled pixels may be averaged to provide a bi - directionally predicted image macroblock . the up - sampled and aligned prediction block is added in adder 230 to the current filtered block , which is , for this example , the reduced resolution residual component from the predicted block . all the processing is done on a macroblock by macroblock basis . after the motion compensation process is complete for the current macroblock in the upsampling domain , the reconstructed macroblock is decimated accordingly in the down sampling processor 232 . this process does not reduce the resolution of the image but simply removes redundant pixels from the low resolution filtered image . once the downsampled macroblocks for an image are available , the display conversion block 280 adjusts the image for display on a low resolution television display by filtering the vertical and horizontal components of the downsampled image in the vpf 282 and the hzpf 284 respectively . since the reference frames of previous images are down sized , the received motion vectors pointing to these frames may also be translated according to the conversion ratio . the following describes the motion translation for the luminance block , for example , in the horizontal direction . one skilled in the art would easily extend the following discussion to motion translation in the vertical direction if used . denoting x and y as the current macroblock address in the original image frame , dx as the horizontal decimation factor and mv x as the half pixel horizontal motion vector of the original image frame , the address of the top left pixel of the motion block in the original image frame , denoted as xh in the half pixel unit , is given by ( 1 ): the pixel corresponding to the motion block starts in the down - sampled image , whose address is denoted as x * and y * in the pixel unit given in ( 2 ). x * = xh 2 · dx ; y * = y ( 2 ) because the exemplary dct filter 216 and down sampling processor 232 only reduce the horizontal components of the image , the vertical component of the motion vector is not affected . for the chrominance , the motion vector is a half of a luminance motion vector in the original picture . therefore , definitions for translating the chrominance motion vector may also use the two equations ( 1 ) and ( 2 ). motion prediction is done by a two step process : first , pixel accuracy motion estimation in the original image frame restored by up - sampling the down - sampled image frame in the up - sampling processor 226 of fig2 then the half - pixel generator 228 performs a half pixel motion estimation by averaging of nearest pixel values . subpixels in a decimated picture , which correspond to pixels in an original pixture , are interpolated , for example , using an up - sampling polyphase filter in the up - sampling processor 226 , which gives a motion prediction in the original picture . the motion prediction is added in adder 230 to an output of the idct processor 218 . since the output values of the adder 230 correspond to an image in the upsampled original picture format , these values may be downsampled for display on a display having a lower resolution . downsampling in the down sampling processor 232 is substantially equivalent to subsampling of an image frame , but adjustments may be made based upon the conversion ratio . for example , in the case of 3 : 1 downsampling , the number of horizontally downsampled pixels are 6 or 5 for each input macroblock , and the first downsampled pixels are not always the first pixel in the input macroblock . after acquiring the correct motion prediction block from the down - sampled image , up - sampling is needed to get the corresponding prediction block in the original picture . consequently , subpixel accuracy in motion block prediction is desirable in the down sampled picture . for example , using 3 : 1 decimation , it is desirable to have ⅓ ( or ⅙ ) subpixel accuracy in the motion prediction . the subpixel which is a first pixel required by the motion vector , in addition to the down - sampled motion block , is determined . then , subsequent subpixel positions are determined using modulo arithmetic as described in the following . the subpixel positions are denoted as x s as given in ( 3 ): x s = ( xh 2 )  %  ( dx ) ( 3 ) for example , the ranges of x s are 0 , 1 , 2 for 3 : 1 up - sampling and 0 , 1 for 2 : 1 up - sampling . fig3 a shows subpixel positions and corresponding 17 predicted pixels for the 3 : 1 and 2 : 1 examples , and table 1 gives the legend for fig3 a . although the exemplary coefficients in tables 2b and 2c are given for equi - ripple filters , other filters may be used for interpolating decimated pixels . for example , in section ii . c ., the design considerations regarding choosing an appropriate upsampling filter are disclosed . in particular , section ii . c . discloses a comparison of motion tracking characteristics between equi - ripple , bi - linear , and lagrangian upsampling filters . in a fixed point representation , the numbers in parenthesis of table 2b and table 2c are 2 &# 39 ; s complement representations in 9 bits with the corresponding double precision numbers on the left . depending upon the subpixel position of the motion prediction block in the downsampled reference image frame , one corresponding phase of the polyphase interpolation filter is used . also , in an exemplary embodiment , more pixels on the left and right are needed to interpolate 17 horizontal pixels in the downsampled image frame . for example , in the case of 3 : 1 decimation , there are a maximum of 6 horizontally downsampled pixels for each input macroblock . however , when up - sampling , 9 horizontal pixels are needed to produce the corresponding motion prediction block values because an up - sampling filter requires more left and right pixels outside of the boundary for the filter to operate . since the exemplary embodiment employs half pixel motion estimation , 17 pixels are needed to get 16 half pixels which can be either the first 16 integer pixels or the average values of nearest two pixel samples . a half pixel motion generator takes care of this . table 3 illustrates mapping between subpixel positions and polyphase filter elements , and a number of left pixels which are needed in addition for the up - sampling process . fig3 b summarizes the up - sampling process which is performed for each row of an input macroblock . first , in step 310 , the motion vector for the block of the input image frame being processed is received . at step 312 , the motion vector is translated to correspond to the downsampled reference frame in memory . at step 314 , the scaled motion vector is used to retrieve the coordinates of the prediction block stored in frame memory . at step 316 the subpixel point for the block is determined and the initial polyphase filter values for up - sampling are then retrieved at step 318 . the identified pixels for the prediction block of the stored downsampled reference frame are then retrieved from memory at step 320 . before the first pass at the filtering step 324 , the registers are initialized at step 322 , which for the exemplary embodiment entails loading the registers with the initial 3 or 5 pixel values . then , after filtering step 324 , the process determines at step 326 whether all pixels have been processed . in the exemplary embodiment 17 pixels are processed . if all pixels have been processed , the up - sampled block is complete . if all pixels have not been processed , the phase is updated at step 328 , and the phase is checked , for the 0 value . if the phase is not zero , the registers must be updated for the next set of polyphase filter coefficients . updating registers step 332 then simply updates the input pixels . in an exceptional case where the left - most pixel is outside of the block boundary , a previous pixel value may be repeated . with reference to fig2 described above in section ii . b ., the up - sampling processor 226 retrieves a block of down sampled pixels from the reference frame memory 222 . the up - sampling processor 226 then uses interpolation to generate pixels to provide a prediction block . this results in a prediction block with the same number of pixels as the reduced resolution residual block to which it is added in the adder 230 . the output of the adder 230 is then down sampled by the down sampling processor 232 , stored in the reference frame memory 222 , and then up sampled by the up - sampling processor 226 to generating the next prediction block . this cycle is repeated for each predicted frame , both p - frames and b - frames . since most coding schemes use multiple predicted frames between intra - coded frames , if image distortion is introduced by the up - sampling processor 226 , this image distortion is also cycled through this process . the image distortion may be accumulated by the up - sampling processor 226 during each cycle . if many consecutive predicted frames are coded between intra - coded frames , this distortion may be amplified to the point where it becomes visible . a source of such image distortion may be poor motion tracking characteristics of the up - sampling processor 226 . preferably , an up sampling filter in a down conversion system has both smooth low pass filtering and good motion tracking characteristics . depending on the particular coding structure and the number of forward predicted frames between intra - coded frames , in some applications , the motion tracking property may take precedence over the low pass filtering to prevent visible motion jerkiness in a reproduced image . fig4 shows the frequency response ( db vs . frequency , where π corresponds to half of the sampling frequency ) of three different upsampling filters in a 3 : 1 horizontal down conversion system : an equi - ripple filter frequency response 410 , a bi - linear filter frequency response 430 , and a lagrangian filter frequency response 420 . the cutoff frequency 440 is equal to π / 3 for the 3 : 1 decimation system ( π / 2 for a 2 : 1 decimation system ). the following example illustrates the motion tracking properties of these filters in a 3 : 1 down conversion system . these examples concern an image of a rectangular pulse moving one pixel per frame in the upsample domain . for the purposes of this example , the coding structure consists of all forward predicted frames after an intra - frame . the image is interpolated based on every third pixel since the other pixels were thrown out during down sampling . fig5 a , 5 b , and 5 c , show the interpolations 520 , 530 , 540 of the rectangular pulse by an equi - ripple filter , a bi - linear filter ,, and a third order , lagrangian filter , respectively . the dashed lines 510 ( not visible in fig5 b ) represent the rectangular pulse being interpolated . lagrangian interpolation is well known to those skilled in the art and is taught by atkinson , an introduction to numerical analysis , 107 - 10 ( 1978 ), which is incorporated hereinby reference . as shown in fig5 a - 5c , the equi - ripple filter interpolation 520 has the most overshoot and undershoot in comparison to the lagrangian filter interpolation 540 and the bi - linear filter interpolation 530 . fig6 a , 6 b , 6 c , 6 d , 6 e , and 6 f illustrate equi - ripple filter interpolations of the moving ( one pixel per frame ) rectangular pulse in predicted frame numbers 1 , 2 , 3 , 5 , 8 and 10 , respectively . the dashed lines 610 in fig6 a - 6f represent the original image . the solid lines 620 in fig6 a - 6f represent the equi - ripple interpolations of the downsampled original image 610 . in frame number 5 shown in fig6 d , the interpolated pulse 620 is distorted and has moved ahead of the original pulse 610 . in frame number 10 shown in fig6 f , the interpolated pulse 620 is even further ahead of the original pulse 610 than in frame number 5 shown in fig6 d . when the next intra - coded frame is displayed , the difference between the interpolated pulse 620 in fig6 f and the original pulse 610 will result in a “ snapping back ” problem . this is caused when the interpolated image in the predicted frames moves ahead of the motion of the original image and is then followed by an accurately represented intra - coded frame . since the motion of edges in predicted frames are ahead of the motion of the original image , the next intra - coded frame may give a viewer the impression that the motion is now going backward . for example , when the original image is an image of a person turning his head slowly to the left , the “ snapping back ” problem may result in the person &# 39 ; s head “ snapping back ” to the right at every intra - coded frame when an equi - ripple filter of the above example is used for up - sampling . the severity of this type of distortion depends on the actual coding structure . for example , when applied to an ibbp coding structure , which has two bi - directional frames between reference frames , the artifact is less noticable than in the example provided with reference to fig6 a - 6f where there were 10 consecutive forward predicted frames . fig7 and 8 show images interpolated using lagrangian and bi - linear interpolators , respectively , for predicted frame number 10 under the same conditions as in fig6 f for an equi - ripple interpolator . in comparison to the equi - ripple interpolation 620 of fig6 f , the lagrangian interpolation 720 in fig7 and the bi - linear interpolation 820 in fig8 provide better motion tracking since their interpolated pulses 720 , 820 are comparatively less ahead of the original image 610 . overshoot and undershoot are factors to consider when analyzing the predicted pulse distortion . the equi - ripple interpolation 620 of fig6 f has 16 % over / undershoot , the third order lagrangian interpolation 720 of fig7 has 6 % over / undershoot , and the bi - linear interpolation 820 of fig8 has no over / undershoot . comparison of fig6 f , 7 , and 8 , shows that both a lagrangian filter and a bi - linear filter provide better motion tracking characteristics than an equi - ripple filter . in an exemplary embodiment of the present invention , a bi - linear filter or a lagrangian filter is used in up - sampling processor 226 . in another exemplary embodiment of the present invention , a lagrangian filter is used in up - sampling processor 226 . the third order lagrangian filter has a better frequency response compared to a bilinear filter ( as shown in fig4 ) and has less over / undershoot than an equi - ripple filter ( as shown by comparing fig6 f and 7 ). it is shown that a bilinear filter is the same as a first order lagrangian filter . as known to those skilled in the art of numerical analysis , a lagrangian interpolator , which is a polynomial interpolation for giving data points , may be designed as follows . for giving ( n + 1 ) discrete data points , the n - th order lagrangian interpolator is in the form of : p n  ( x ) = ∑ i = 0 n  y i · l i  ( x ) where y i is a function value at x i and l i ( x ) is a n - th order polynomial and is in the form of : l i  ( x ) = ∏ n ≠ i  ( x - x n ) ( x i - x n ) from the above equations it is evident that l i ( x n )= 1 for n = i and l i ( x n )= 0 for n ≠ i . therefore , p n ( x n )= y n and the interpolation polynomial satisfies ( n + 1 ) discrete data points . the first order lagrangian interpolator is : p 1  ( x ) = ( x - x 1 ) ( x 0 - x 1 ) · y 0 + ( x - x 0 ) ( x 1 - x 0 ) · y 1 it is self - evident that the first order lagrangian interpolator is a bilinear . the second order lagrangian interpolator p 2 ( x ) and the third order lagrangian interpolator p 3 ( x ) shown below may be derived from the above equations . p 2  ( x ) = ( x - x 1 ) · ( x - x 2 ) ( x 0 - x 1 ) · ( x 0 - x 2 ) · y 0 + ( x - x 0 ) · ( x - x 2 ) ( x 1 - x 0 ) · ( x 1 - x 2 ) · y 1 + ( x - x 0 ) · ( x - x 1 ) ( x 2 - x 0 ) · ( x 2 - x 1 ) · y 2 p 3  ( x ) = ( x - x 1 ) · ( x - x 2 ) · ( x - x 3 ) ( x 0 - x 1 ) · ( x 0 - x 2 ) · ( x 0 - x 3 ) · y 0 + ( x - x 0 ) · ( x - x 2 ) · ( x - x 3 ) ( x 1 - x 0 ) · ( x 1 - x 2 ) · ( x 1 - x 3 ) · y 1 + ( x - x 0 ) · ( x - x 1 ) · ( x - x 3 ) ( x 2 - x 0 ) · ( x 2 - x 1 ) · ( x 2 - x 3 ) · y 2 + ( x - x 0 ) · ( x - x 1 ) · ( x - x 2 ) ( x 3 - x 0 ) · ( x 3 - x 1 ) · ( x 3 - x 2 ) · y 3 for 2 : 1 upsampling , we are interested in interpolating points that are at half pixel locations between pixels in the decimated image . for 3 : 1 upsampling , we are interested in interpolating points that are at one - third or two - third pixel locations between pixels in the decimated image . for example , for a half pixel in the 2 : 1 upsampling case , x - x 0 = ½ , x - x 1 − ½ and x 1 - x 0 = 1 . by substituting these values , filter coefficients can be derived . table 7 , below , shows the lagrangian filter coefficients for a 2 : 1 up - sampling filter . in tables 7 and 8 , phase 0 means integer pixel , phase 1 means a half pixel in the 2 : 1 case and one third point between pixels in the 3 : 1 case , and phase 2 means two third point between pixels in the 3 : 1 case . in the 2 : 1 case , input pixels are shifted for filtering at phase 0 , but in the 3 : 1 case input shifting does not always occur at phase 0 . as known to those skilled in the art , as the order of a filter increases , the frequency response of the filter improves . although many filter design methods are based strictly on improving the frequency response of a filter , in a down conversion system , the spatial response of the filter , which corresponds to its motion tracking characteristics , is an additional design consideration . table 9 below shows the percentage over / under shoot for different order lagrangian polyphase filters for a 3 : 1 down conversion system . human eyes are very sensitive to edge movement as long as it is traceable . the overshoot and undershoot of an upsampling filter deteriorates upsampling of a macroblock as more successive predicted frames are decoded and the results of previous upsample operations are recycled through the upsample filter . an upsampling filter design should be optimized to provide sufficient motion tracking characteristics while at the same time providing low pass filtering . in an exemplary embodiment of a 3 : 1 down conversion system , the up - sampling processor 226 uses the third order lagrangian filter for interpolation of a down - sampled image . this results in a balance between the motion tracking characteristics and the low pass filtering response . the 4 th order filter may have a better frequency response than the 3 rd order filter but the 3 rd order filter has better motion tracking characteristics . thus this particular design balances these factors and makes a tradeoff between them . as discussed above , the coding structure of a particular system determines where this balance should fall . the exemplary embodiment of the down conversion system includes the dct filter 216 processing the dct coefficients in the frequency domain , which replaces a lowpass filter in the spatial domain . there are several advantages in dct domain filtering instead of spatial domain filtering for dct coded pictures , such as contemplated by the mpeg or jpeg standards . most notably , a dct domain filter is computationally more efficient and requires less hardware than a spatial domain filter applied to the spatial pixels . for example , a spatial filter having n taps may use as many as n multiplications and additions for each spatial pixel sample value . this compares to only one multiplication in the dct domain filter . the simplest dct domain filter is a truncation of the high frequency dct coefficients . however , truncation of high frequency dct coefficients does not result in a smooth filter and has drawbacks such as “ ringing ” near edges in the decoded picture . the dct domain lowpass filter of the exemplary embodiment of the invention is derived from a block mirror filter in the spatial domain . the filter coefficient values for the block mirror filter are , for example , optimized in the spatial domain , and these values are then converted into coefficients of the dct domain filter . although the exemplary embodiment shows dct domain filtering in only the horizontal direction , dct domain filtering can be done in either the horizontal or the vertical direction or both by combining horizontal and vertical filters . one exemplary filter of the present invention is derived from two constraints : first , the filter processes image data on a block by block basis for each block of the image without using information from other blocks of the same picture or from previous pictures ; and second , the filter reduces visibility of block boundaries which occur when the filter processes boundary pixel values . according to the first constraint , in the dct based compression of an mpeg image sequence , for example , blocks of n x n dct coefficients yield blocks of n x n spatial pixel values . consequently , an exemplary embodiment of the present invention implements a dct domain filter which only processes blocks of the currently received picture . according to the second constraint , if the filter is simply applied to a block of spatial pixel values , there is a transition of filtering on the block boundary which is caused by an insufficient number spatial pixel values beyond the boundary to fill the residual of the filter . that is to say , the edge of a block cannot be properly filtered because the n - tap filter has respective input pixels for only n / 2 or for ( n / 2 )- 1 taps depending upon whether n is even or odd . the remaining input pixels are beyond the boundary of the block . several methods of supplying pixel values exist : 1 ) repeat a predetermined constant pixel value beyond a boundary ; 2 ) repeat the same pixel value as the boundary pixel value ; and 3 ) mirror the pixel values of the block to form previous and subsequent blocks of pixel values adjacent to the processed block . without prior information on the contents of the previous or subsequent block , the mirroring method is considered as a preferred method . therefore , an embodiment of the present invention employs this mirroring method for the filter and is termed a “ block mirror filter .” the following describes an exemplary embodiment which implements a horizontal block mirror filter that lowpass filters 8 input spatial pixel sample values of a block . if the size of the input block is an 8 × 8 block matrix of pixel sample values , then a horizontal filtering can be done by applying the block mirror filter to each row of 8 pixel sample values . it will be apparent to one skilled in the art that the filtering process can be implemented by applying the filter coefficients columnwise of the block matrix , or that multidimensional filtering may be accomplished by filtering of the rows and then filtering the columns of the block matrix . a block mirror filter in the spatial domain can be equivalently implemented in the dct domain by weighting dct coefficients , as taught by kim et . al ., “ dct domain filter for atv down conversion ”, ieee trans . on consumer electronics , vol . 43 ( 4 ) 1074 - 8 ( 1997 ). fig4 shows the correspondence between the input pixel values x 0 through x 7 ( group xo ) for an exemplary mirror filter for 8 input pixels which employs a 15 tap spatial filter represented by tap values h 0 through h 14 . the input pixels are mirrored on the left side of group x0 , shown as group x1 , and on the right side of group x0 , shown as group x2 . the output pixel value of the filter is the sum of 15 multiplications of the filter tap values with the corresponding pixel sample values . fig4 illustrates the multiplication pairs for the first and second output pixel values . one embodiment of the exemplary block mirror filtering of the present invention is derived as by the following steps : 1 ) a one dimensional lowpass symmetric filter is chosen with an odd number of taps , which is less than 2n taps ; 2 ) the filter coefficients are increased to 2n values by padding with zero &# 39 ; s ; 3 ) the filter coefficients are rearranged so that the original middle coefficient goes to the zeroth position by a left circular shift ; 4 ) the dft coefficients of the rearranged filter coefficients are determined ; 5 ) the dct filter coefficients are multiplied with the real number dft coefficients of the input block ; and 6 ) the inverse discrete cosine transform ( idct ) of the filtered dct coefficients is performed by multiplying by idct coefficients to provide a block of lowpass - filtered pixels prepared for decimation . the cutoff frequency of the lowpass filter is determined by the decimation ratio . for one exemplary embodiment , the cutoff frequency is π / 3 for a 3 : 1 decimation and π / 2 for a 2 : 1 decimation , where n corresponds to half of the sampling frequency . a dct domain filter in mpeg and jpeg decoders allows memory requirements to be reduced because the inverse quantizer and idct processing of blocks already exists in the decoder of the prior art , and only the additional scalar multiplication of dct coefficients by the dct domain filter coefficients is required . therefore , a separate dct domain filter block multiplication is not physically required in a particular implementation ; another embodiment of the present invention simply combines the dct domain filter coefficients with the idct processing coefficients . for the exemplary down conversion system of the present invention , the horizontal filtering and decimations of the dct coefficients were considered ; and the following are two exemplary implementations for : 1 . 1920h by 1080 v interlace to 640h by 1080 v interlace conversion ( horizontal 3 : 1 decimation ). 2 . 1280h by 720 v progressive to 640h by 720 v progressive conversion ( horizontal 2 : 1 decimation ) table 4 shows the dct block mirror filter ( weighting ) coefficients ; in table 4 the numbers in the parenthesis are 10 bit 2 &# 39 ; s complementary representations . the “” of table 4 implies an out of bound value for the 10 bit 2 &# 39 ; s complement representation because the value is more than 1 ; however , as is known by one skilled in the art , the multiplication of the column coefficients of the block by the value indicated by the can be easily implemented by adding the coefficient value to the coefficient multiplied by the fractional value ( remainder ) of the filter value . these horizontal dct filter coefficients weight each column in the block of 8 × 8 dct coefficients of the encoded video image . for example , the dct coefficients of column zero are weighted by h [ 0 ], and the dct coefficients of first column is weighted by h [ 1 ] and so on . the above discussion illustrates a horizontal filter implementation using a one - dimensional dct . as is known in the digital signal processing art , such processing can be extended to two - dimensional systems . for a two - dimensional system , the input sequence is now represented as a matrix of values , showing the sequence to be periodic in the column sequence with period m , and periodic in the row sequence with period n , n and m being integers . a two - dimensional dct can be implemented as a one dimensional dct performed on the columns of the input sequence , and then a second one dimensional dct performed on the rows of the dct processed input sequence . also , as is known in the art , a two - dimensional idct can be implemented as a single process . down sampling is accomplished by the down fling processor 232 to reduce the number of pixels in the downconverted image . fig5 a shows the input and decimated output pixels for 4 : 2 : 0 chrominance type for 3 : 1 decimation . fig5 b shows the input and decimated output pixels for 4 : 2 : 0 chrominance type 2 : 1 decimation . table 5 gives the legend identification for the luminance an chrominance pixels of fig5 a and fig5 b . the pixel positions before and after the down conversion of fig5 a and 5b are the interlaced ( 3 : 1 decimation ) and progressive ( 2 : 1 decimation ) cases respectively for down sampling of the interlaced image , which may be the conversion from a 1920 by 1080 pixel size to a 640 by 1080 pixel size , every third pixel is decimated on the horizontal axis . for the exemplary 3 : 1 decimation , there are three different macroblock types after the down conversion process . in fig5 a , original macroblocks ( mbs ) were denoted by mb 0 , mb 1 , mb 2 . the down sampled luminance pixels in mb 0 start at the first pixel in the original macroblock , but in mb 1 and mb 2 the down - sampled pixels start at the third and the second pixels . also the number of down - sampled pixels in each macroblock are not the same . in mb 0 , there are 6 down - sampled pixels horizontally , but 5 pixels in mb 1 and mb 2 . these three mb types are repeating , therefore modulo 3 arithmetic is to be applied . table 6 summarizes the number of downsampling pixels and offsets for each input macroblock mb 0 , mb 1 , mb 2 . while exemplary embodiments of the invention have been shown and described herein , it will be understood that such embodiments are provided by way of example only . numerous variations , changes , and substitutions will occur to those is skilled in the art without departing from the spirit of the invention . accordingly , it is intended that the appended claims cover all such variations as fall within the scope of the invention .	7
referring now to fig1 and 2 , a cooling system is generally indicated by the reference numeral 10 . the cooling system is used to cool a box - like enclosure 11 that is located within a building 12 . the cooling system 10 comprises an air intake system 14 for drawing cool air from outside the building 12 into the enclosure 11 . the intake system 14 includes piping 15 running from outside the building 12 into the enclosure 11 . the piping 15 is preferably made from polyvinyl chloride ( pvc ) for its desirable low heat transfer characteristics , although other commercially available materials may be used . air is pumped through the intake system 14 by means of a blower 16 which is attached intermediate the piping 15 . a valve unit 17 is mounted in the piping 15 between the enclosure 11 and the blower 16 to selectively prevent the flow of air through the intake system 14 . a filter unit 19 is also included in the air intake system and is connected to the piping 15 . the filter unit 19 is preferably located upstream from both the blower 16 and valve unit 17 to prevent foreign material from reaching the blower 16 and valve unit 17 . a vent hood 20 is provided at the end of the piping 15 extending from the building 12 to shield that end and prevent foreign material from entering the intake system 14 . an air diffuser grill 29 is provided on the opposite end of the piping 15 which opens into the enclosure 11 to diffuse the air introduced by the intake system . an exhaust system 22 is provided to withdraw air from the enclosure 11 as the intake system 14 draws cold air into the enclosure 11 . similar to the intake system 14 , the exhaust system 22 includes piping 23 that is connected to a blower 24 which forces air from the enclosure 11 to the outside of the building 12 . a valve unit 25 is also included in the exhaust system to prevent movement of air through the exhaust system when the cooling system 10 is not operating . the exhaust system 22 may also include a filter unit 27 which acts to filter air that may seep into the piping 23 when the system is not operational . the end of the piping 23 extending out of the building 12 is provided with a vent hood 28 to prevent foreign material from entering the exhaust system 22 . an air diffuser grill 29 is mounted on the end of the piping that opens into the enclosure to cover the end of the piping 23 . the cooling system 10 may be used on refrigerated enclosures used to hold food or other products requiring a sanitary environment . mechanical refrigeration systems used on cold boxes generally recirculate the air within the cold box . such systems are therefore substantially sealed from contaminants and humidity found in ambient air . since the cooling system 10 of the present invention circulates cool ambient air through the enclosure , contaminants and condensation in the system must be avoided if it is to be used with cold boxes requiring sanitary conditions . in sanitary environments it is generally desirable to prevent the accumulation of condensation . in cooling systems condensation can form at any place that warm moist air comes in contact with a surface that is cooler than the air . when the cooling system 10 is not in operation the valve units 17 and 25 are closed to prevent the escape of refrigerated air through the system . the valve units are preferably provided between the enclosure and the blower to minimize the volume of air that must be cooled on the enclosure side of the valve by the refrigeration system when the supplemental cooling system 10 is not in use . when the valve units 17 and 25 are closed , the refrigerated air on the enclosure side of the valve has the potential to cool the valve and create a cool surface upon which moisture in warm ambient air may condense and accumulate in the system . the structural parts of the valve units 17 and 25 are constructed of pvc or are otherwise insulated to reduce heat transfer therethrough . in humid environments it may be necessary to include a condensate blower in the system that is effective to evaporate any condensation forming on the valve units 17 and 25 . the condensate blower 30 is a small low horsepower blower that withdraws air from the piping 15 or 23 through a shunt opening 31 and blows it through a port 32 formed in the upstream end of the valve unit 17 and the downstream end of the valve unit 25 . the condensate blower 30 may also include a heating element to warm the air blown into the valve which in turn increases evaporation and warms the parts of the valve that may be cooled by the refrigerated air emitted from the enclosure 11 . as a further sanitation and safety feature , a smoke detector 34 may be mounted on the ceiling of the enclosure 11 to detect the presence of smoke in the enclosure 11 . smoke may be introduced into the enclosure by either a fire in the enclosure or a fire in the vicinity of the building 12 . in the unlikely event that a fire should start inside the enclosure it is desirable to shut down the cooling system 10 to seal off the enclosure and extinguish the fire . likewise , if a fire causes smoke in the vicinity of the building 12 that is drawn in by the intake system 14 it is desirable to turn off the cooling system 10 to prevent smoke from harming products stored in the enclosure 11 . the enclosure 11 is provided with a door 36 or other type of access cover . when the door 36 is open it is generally preferable to turn off the cooling system to prevent frigid air from being pumped into the building . a limit switch 37 is used to monitor the opening and closing of the door 36 . referring now to fig3 the control circuit generally indicated by the reference numeral 39 is shown . the control circuit generally uses 120 volt alternating current and includes a cooling system circuit 40 and a condensate blower circuit 41 . the cooling system circuit 40 controls both the intake system 14 and the exhaust system 22 . the control system circuit 40 in the disclosed embodiment includes an exterior thermostat 43 for sensing the temperature outside the building 12 and the enclosure thermostat 44 for sensing the temperature inside the enclosure 11 . exterior thermostat 43 has a contact &# 34 ; a &# 34 ; which closes when the temperature outside the building 12 is cold enough to be useful for cooling the enclosure 11 . in the disclosed embodiment the cooling system circuit includes the smoke detector 34 for shutting off the system upon sensing smoke inside the enclosure 11 . the cooling system circuit 40 also includes the limit switch 37 to shut off the system when the door 36 is opened . the cooling system circuit 40 activates the intake and exhaust blower motors 45 and 46 which operate the blower 16 of the intake system 14 and the blower 24 of the exhaust system 22 respectively . the valve units 17 and 25 are operated on 12 - volt dc power and require a transformer 48 to convert the 120 volt alternating current of the circuit to 12 volt direct current . the transformed current in turn operates at least one valve motor 49 in the intake system 14 and at least one valve motor 50 in the exhaust system 22 . the condensate blower circuit operates only when the cooling system 10 is not operating as a result of the air outside the building 12 being too warm to assist in cooling the enclosure 11 . each condensate blower 30 is positioned to blow air across the side of the valve unit 17 or 25 which is in contact with the ambient air when closed . the condensate blower circuit 41 includes the exterior thermostat contact &# 34 ; b &# 34 ; and intake and exhaust condensate blower motors 51 and 52 . exterior thermostat contact &# 34 ; b &# 34 ; closes when the temperature outside the enclosure is above the temperature at which the cooling system is useable . simultaneously , the exterior thermostat contact &# 34 ; a &# 34 ; in the cooling system opens to disable the cooling system circuit 40 . operation of the supplemental cooling system 10 is dependent on the presence of a supply of cold outdoor air . typically when the outside temperature is below 40 ° it will be used instead of the refrigeration system . in a typical installation , when the temperature outside the building drops to 40 ° or less the thermostat closes the contact in the cooling system circuit 40 . if the enclosure 11 warms to the point that it requires additional cooling the contact of the enclosure thermostat in the cooling system circuit 40 closes . at this point the blower motor 46 is energized and the valve motors 49 are operated to move the valves into their open position . air is then drawn through the outside intake vent , into the filter assembly to the blower , and pumped through the valve unit 17 and into the enclosure where it is diffused by the air diffuser grills . meanwhile , the exhaust system pulls warm air out of the enclosure and prevents pressure build - up in the enclosure 11 . when the enclosure is cooled to the lower limit of the safe temperature range the enclosure thermostat 44 opens the contact in the control system circuit to shut off the blower motors 46 and return the valve motors to their closed position . the cooling system operates preferentially to and totally independently of the refrigeration system of the enclosure . the two systems do not require electrical interfacing since the enclosure thermostat 44 is preferred by setting it slightly lower than the thermostat which controls the refrigeration system . this allows the cooling system 10 to be switched on to cool the enclosure , unless the air outside the building is too warm to be of assistance for cooling purposes . in that case the existing refrigeration system operates to cool the enclosure . the piping is preferably insulated by one and one half inches of fiberglass insulation , or other type of insulation , to prevent heat gain caused by heat transfer from the air inside the building 12 through the piping 15 that would reduce the effectiveness of the cooling system 10 . likewise , the air filter assembly , blower and valve unit are preferably insulated with fiberglass insulation . the piping 15 , 23 may be extended through either an exterior wall of a building or through the roof of a building depending upon the structure of the building 12 . referring now to fig4 and 5 , valve unit 17 is shown in detail . valve unit 17 includes a valve housing 53 comprising a rectangular box shaped member having an inlet port 54 at one end which is adapted to receive the piping 15 of the intake system 14 . the opposite end of the valve housing 53 has an outlet port 55 for receiving another segment of the piping 15 . air enters the valve housing 53 through the inlet port 54 and exits the valve housing through the outlet port 55 . in the disclosed embodiment the valve housing 53 includes first and second valves 56 and 57 which define an air lock or air pocket 58 therebetween when the first and second valves 56 and 57 are in their closed positions . the condensate blower 30 draws air through the shunt opening 31 in the piping 15 and blows air through the port 32 formed in the upstream end of the housing 53 . each of the first and second valves 56 and 57 include a valve flap 61 which is a planar rectangular member mounted on a pivotable shaft 62 . the shaft 62 is rotatably received in two openings 63 formed in the housing 53 . a 12 volt dc reversible motor is mounted at one end of the shaft 62 . the motor 64 is a quarter turn motor adapted to move the valve flap 61 90 ° from a closed position to an open position . as shown in fig5 the valve flap 61 is in its closed position in which it lays against a valve seat 66 . the open position is shown in phantom lines in fig5 . a gasket 67 may be included on the valve flap 61 to assure a tight seal between the valve seat 66 and the valve flaps 61 . the tight seal between the valve seat 66 and valve flaps is important to prevent escape of refrigerated air from the enclosure to the outside when the cooling system 10 is not being operated . valve unit 25 is also described with reference to fig4 and 5 since it is substantially similar to valve unit 17 . valve unit 25 includes a valve housing 53 comprising a rectangular box shaped member having an inlet port 54 &# 39 ; at one end which is adapted to receive the piping 23 of the exhaust system 22 . the opposites end of the valve housing 53 has an outlet port 55 &# 39 ; for receiving another segment of the piping 23 . air enters the valve housing 53 through the inlet port 54 &# 39 ; and exits the valve housing 53 through the outlet port 55 &# 39 ;. the valving mechanism is the same as that described above for valve unit 17 and therefore need not be repeated . the condensate blower 30 draws air through the shunt opening 31 in the piping 23 and blows air through the port 32 formed in the upstream end of the housing 53 and adjacent to the outlet port 55 &# 39 ;. insulation 68 is attached to the valve flap 61 and valve seat 66 to limit or prevent condensation from forming on the valve . the insulation 68 reduces the tendency of the cool air inside the enclosure from cooling any part of the valve exposed to unrefrigerated air which could cause condensation to form . filter units 19 and 27 are preferably provided in both the intake system 14 and exhaust system 22 . as shown in fig6 and 7 , each of the filter units includes a bifurcated filter housing 71 . the filter housing 71 includes an inlet opening 72 on one end and an outlet opening 73 on the opposite end . the inlet opening being on the upstream end of the filter and the outlet opening being on the downstream end of the filter . the filter housing 71 includes an inlet half 74 and an outlet half 75 . the inlet half 74 extends between the inlet opening 72 and a central frame 77 to create a plenum of air which allows a high efficiency , large cross - section filter to be used in the system . the outlet half 75 extends between the central frame 77 and the outlet opening 73 and functions as a funnel to direct the air after filtering back into the outlet opening 73 . the inlet half 74 and outlet half 75 are secured to opposite ends of the central frame 77 by means of fasteners 78 . a filter cartridge 80 is mounted in the central frame 77 to be easily changed after foreign material accumulates in the filter . the filter cartridge includes a filter frame 81 and a filter element 82 . the filter frame 81 is provided to retain the filter element in a rigid unflailing position when air flows therethrough . the filter element is a high efficiency filter preferably having an efficiency rating of 97 . 5 % at 9 microns , 95 % at 5 microns and 40 % at 1 micron . a filter having this degree of efficiency is able to remove a high percentage of the bacteria , atmospheric dust and other micro contaminants found in ambient air . after filtering the air is much cleaner than air typically found inside buildings . the filter element has an enlarged cross - sectional area to permit air flow without undue restriction . preferably the capacity of the filter is two to three times the cubic feet per minute capacity of the blower . for example and not by way of limitation , a typical filter used on a 400 cubic feet per minute system will have a maximum capacity of 1 , 100 cubic feet per minute . such a filter is commercially available . one example , is a filter identified by the trademark servodyn he - 40 - 6002 . the filter cartridge 80 is enclosed in the central frame 77 by a filter door 84 . the filter door 84 includes a seal 85 about its periphery for preventing air from leaking into the filter housing around the filter door 84 . the filter door 84 is preferably provided with a handle 86 for opening the filter door to remove the filter cartridge 80 . the vent hoods 20 and 28 are provided to protect the ends of the piping 15 , 23 extending from the building 12 . each vent hood includes a primary screen 89 having a fine mesh , for example and not by way of limitation , of sixteen wires per square inch , which is effective to exclude insects from the system 10 . a secondary screen 90 having a coarse mesh is also provided to support the primary screen 89 and to prevent entry into the cooling system 10 by rodents . since the vent hoods are mounted outside the building 12 they are preferably constructed of galvanized metal to resist corrosion . in operation , the cooling system 10 draws air into the enclosure 11 from outside the building 12 through the intake system 14 . the blower 16 draws air from outside the building through the filter unit 19 , into the blower 16 , through the valve unit 17 ( which is in its open position ), and into the enclosure 11 . as cool air is being drawn into the enclosure by the intake system , the exhaust system 22 is drawing warm air out of the enclosure 11 by means of the blower 24 . the blower 24 draws the air from inside the enclosure , through the valve unit 25 , into the blower 24 which forces the air through the filter unit 27 and vent hood 28 to the exterior of the building . thus , warm air is removed from the enclosure 11 as the cold air is drawn from the outside of the building 12 . when the cooling system 10 is not operative , the blowers 16 and 24 are turned off and the valve units 17 and 25 of the intake system 14 and exhaust system 22 are in their closed position , thereby preventing passage of air through the intake system and exhaust system . the filter units 19 and 27 filter ambient air currents that exist in the piping 15 and 23 to remove foreign material therefrom . the prevents the operative portions of the cooling system 10 from becoming contaminated when not in use . likewise , the vent hood assemblies 20 and 28 prevent entry of insects and rodents when the system is not operational . if the system is to be used in a high humidity area it may be desirable to include condensate blowers 31 in both the intake and exhaust systems 14 and 22 . the condensate blowers will be operated when the cooling system is not operational . the condensate blower 30 operates by drawing air through the shunt opening 31 in the piping and blowing it against the closed valve flap 61 to evaporate any condensation that may begin to form on that side of the valve . condensation may also be avoided by heating the air in the condensate blower 30 to warm the surface of the valve flap 61 so that condensation does not form . the supplemental cooling system is an energy saving device that operates entirely separately from existing refrigeration equipment when outside air temperature is sufficiently cool to assist in maintaining the enclosure temperature . the supplemental cooling system can reduce refrigeration costs by up to 90 % in cool climates since when the system 10 operates only a blower is necessary to maintain the temperature of the enclosure . this eliminates the need to operate the refrigeration compresser which typically uses the largest portion of energy in a given refrigeration system . the supplemental cooling system 10 of the present invention is safe and sanitary to use . foreign material is prevented from entering the system by means of the filter units 19 and 27 and the vent hoods 20 and 28 . an accumulation of condensation in the cooling system 10 is prevented by adequately insulating the system and , in particular , insulating the valve units 17 and 25 . in addition , a condensate blower 30 is disclosed which can eliminate condensation in the system when the cooling system 10 is not operational at the point the cool air from inside the enclosure is separated from the warm ambient air . by eliminating condensation , the accumulation of algae and bacteria is prevented by the system . the foregoing is a complete description of a preferred embodiment of the present invention . various changes and modifications may be made without departing from the present invention .	8
referring now to fig1 showing a lead frame of the prior art having a multiple integrated circuit units . a lead frame ( 2 ) of the prior art consists of a plurality of integrated circuits ( 20 ), each having a die pad ( 21 ) and a plurality of leads ( 22 ) projecting outwardly from the die pad ( 21 ). the integrated circuits ( 20 ) are connected together by connecting bars ( 23 ). at the outer periphery of the lead frame ( 2 ), there is an inactive portion of the lead frame ( 2 ) called a peripheral pad ( not shown ). when the lead frame ( 2 ) is moulded to form the mlp , about half of the peripheral pad is left unmoulded causing different expansions and thus delamination to the plurality of leads ( 22 ) adjacent to the peripheral pad . referring to fig2 showing a stress - free lead frame having a stress - relief means according to one embodiment of the present invention . the stress - free lead frame ( 1 ) comprises a lead frame ( 10 ) having a plurality of integrated circuit areas or integrated circuits ( 11 ) joined together by connecting bars ( 12 ). each of the integrated circuits ( 11 ) has a plurality of die pads ( not shown ) and leads ( not shown ) projecting outwardly from the die pads . a peripheral pad ( 14 ) surrounds the lead frame ( 10 ). the lead frame ( 10 ) is preferably of a metallic foil base , like copper or other suitable materials . the metallic foil is either etched or stamped to form the lead frame ( 10 ) that contain a plurality of integrated circuits ( 11 ). each of the integrated circuit ( 11 ) has a die pad ( not shown ) for attaching a die and a plurality of leads ( not shown ) projecting away from the die pads . the lead frame ( 10 ) is surrounded by a peripheral pad ( 14 ) that is an inactive part of the metallic foil . the peripheral pad ( 14 ) is provided with a plurality of stress - relief means and a plurality of interlocking means in the form of holes and slots . extensive research and experimentation has revealed that for best result , at least three rows of stress - relief means , a first row ( 15 ), a second row ( 17 ) and a third row ( 18 ), and a row of interlocking means ( 16 ) are needed . the first and the third row of the stress - relief means ( 15 and 18 respectively ) are provided with slots while the second row ( 17 ) is provided with holes , preferably square hole . the holes and slots are arranged side by side in equal intervals for equal expansion and compression distribution . for the interlocking means ( 16 ), a plurality of slots are arranged at equal intervals in between the second and the third row of the stress - relief means ( 17 and 18 respectively ). during moulding , the lead frame ( 10 ) and the peripheral pad ( 14 ) containing the stress - relief means ( 15 ) and the interlocking means ( 16 ) is moulded to form the mlp . the heat produced during this process causes the leads to expand and to compress when cooled . in prior art practice , this produces delamination that causes many of the resulting integrated circuits a reject . however , the provision of the stress - relief means ( 15 ) can easily accommodate the expansion and compression of the leads . further , the interlocking means ( 16 ) holds firmly the lead frame ( 10 ) to the moulded epoxy thus eliminating altogether delamination in the leads caused either by expansion and contraction of the metal lead frame or during handling of the mlp . while the preferred embodiment of the present invention and their advantages have been disclosed in the above detailed description , the invention is not limited thereto but only by the spirit and scope of the appended claim .	7
now , the present invention will be described below with reference to the accompanying drawings . fig1 a and fig1 b show a block diagram of an electrical control circuit in a mixture control apparatus for use in the carburetor of this invention and fig2 a , 2b and 2c show a flow chart for illustrating the operation of the electrical control circuit . the operation of the carburetor of this invention will be outlined below with reference to fig1 fig1 a and 1b , fig2 fig2 a , 2b and 2c . when an ignition switch ( not shown ) is turned on to start an engine , an ignition switch sensor 124 detects this fact and an edge sensor circuit 130 issues its output to set a first flipflop 145 . consequently , a first and gate 149 is opened . the fact that the first flipflop 145 has been set causes a memory selector 139 to select a fifth memory 137 . at this time , in step s1 illustrated in fig2 it is judged whether a home position switch ( not shown ) is in an opened state or a closed state . when the home position switch happens to be in a closed state , for example , a home position switch sensor 125 issues an output &# 34 ; 1 &# 34 ;. this signal is forwarded via the first and gate 149 and injected into an output controller 141 . in response to this input , the aforementioned output controller 141 issues a pulse for causing a stepping motor 142 to rotate in the reverse direction ( step s2 in fig2 ). as the stepping motor 142 thus rotated in the reverse direction passes a predetermined home position , the home position switch is opened . as the result , the output of the home position switch sensor 125 is changed to &# 34 ; 0 &# 34 ; to close the first and gate 149 . the output controller 141 is consequently caused to issue an output for starting the stepping motor 142 in the normal direction ( step s3 in fig2 ). output pulses of a clock oscillator 151 are divided by a frequency divider 152 to be supplied to the output controller 141 as driving pulses for the stepping motor 142 . this rotation of the stepping motor 142 in the normal direction results in detection of the time at which the home position switch is shifted from the opened state to the closed state ( step s4 in fig2 ). in the circuit of fig1 this change is sensed by a first differentiating circuit 131 . the resulting output from this circuit 131 resets the first flipflop 145 and closes the first and gate 149 . when the judgment made in step s1 fails to find the home position switch in its closed state , the output from the first and gate 149 is &# 34 ; 0 &# 34 ; and the stepping motor 142 is consequently rotated in the normal direction . when this motor 142 thus rotated in the normal direction reaches its home position , the aforementioned home position switch is shifted from the opened state to the closed state to cause the operation described above . in this while , the preset value ( for initial setting ) of the fifth memory 137 is set in an up - down ( u / d ) counter 143 at the same time that the first flipflop 145 is reset by the output from the first differentiating circuit 131 . in the manner described above , the initialization of the present apparatus is completed . this means that the home position of the stepping motor 142 is brought into exact agreement with the preset value ( initial value ) of the u / d counter 143 ( step s5 in fig2 ). at the same time , a hot flag is set in the step s5 in fig2 . when this initialization is completed , an engine &# 39 ; s rotational speed sensor 121 issues an output to a complete - firing sensing / delay circuit 126 so as to confirm that the state of complete - firing has not yet been assumed , namely the fact that the engine &# 39 ; s rotational speed ne is still smaller than the preset value ne 0 ( step s6 in fig2 ). further , the output from an engine temperature sensor 123 is compared with a fixed value t0 in a first comparator 127 to form a judgment as to whether the engine is in a cold state or in a hot state ( step s7 in fig2 ). when the engine is in the cold state and its temperature is lower than the fixed value t0 of the first comparator 127 , the output from the first comparator 127 is turned to &# 34 ; 0 &# 34 ; to reset a second flipflop 146 . in response to this resetting of the second flipflop 146 , the memory selector 139 selects a first memory 133 for cold starting ( step s8 in fig2 ). since the first memory 133 keeps in storage the data on the rotational position of the stepping motor 142 corresponding to the engine temperature , it feeds out the optimum data relative to the engine temperature as it exists at that moment . the output thus issued is forwarded to a third comparator 140 . the third comparator 140 effects comparison of the data from the first memory with the value of count taken by the u / d ( up - down ) counter 143 and issues an output corresponding to the difference between the two values , respectively as a normal - reverse signal and an up - down signal to the output controller 141 and the u / d counter 143 . consequently , the stepping motor 142 is rotated to a position which is indicated by the data read out of the first memory 133 . as the result , the cam plates ( not shown ) fixed to the output shaft of the aforementioned stepping motor 142 are proportionately rotated . a choke valve and a throttle valve ( neither shown ) are consequently moved by the rotation of their respective cams and set at the degrees of opening optimum for cold starting at the engine temperature as it exists at that moment ( steps s8 → s11 → s33 in fig2 ). a typical relation between the rotational position of the stepping motor 142 and the degrees of opening of the choke valve and the throttle valve is shown in fig3 . in the diagram , the horizontal axis represents the scale for the rotational position of the stepping motor 142 and the vertical axis represents the scale for the degree of opening th of the throttle valve and the degree of opening ch of the choke valve . as the stepping motor 142 is rotated in the reverse direction with its home position as the boundary , it moves the valves and sets them at the degrees of opening optimum for the cold state . as it is rotated in the normal direction , it moves and sets the valves at the degrees of opening optimum for the hot state . when the judgment in step s7 of the diagram of fig2 finds the engine temperature to be higher than the set value t0 of the first comparator 127 , the engine is in the hot state . in that case , the output from the first comparator 127 is &# 34 ; 1 &# 34 ; which causes the memory selector 139 to select the third memory 135 for hot starting , with the result that a hot flag is set up ( steps s9 → s10 in fig2 ). the third memory 135 keeps in storage the data on the rotational position of the stepping motor 142 for hot starting . it issues said rotational position data as its output to the third comparator 140 . consequently , in the same way as described above , the stepping motor 142 is rotated to a position which is indicated by the data read out of the third memory 135 ( steps s9 → s10 → s11 → s33 in fig2 ). when a starter switch ( not shown ) in status quo is closed , the engine is started and its rotational speed is increased . the rotational speed of the engine is detected by the engine &# 39 ; s rotational speed sensor 121 and , in the complete - firing sensing / delay circuit 126 , it is judged whether or not the engine has assumed the complete firing state . as indicated in step s6 of the diagram of fig2 it is judged whether or not the engine &# 39 ; s rotational speed ne is larger than the detected value ne 0 of the stall . the processing is repeated through the loop of steps s6 → s7 → s8 → s11 → s33 or the loop of steps s6 → s7 → s9 → s10 → s11 → s33 until the complete firing state is assumed . when the complete firing state is assumed , the judgment in step s6 gives an affirmative result and , consequently , the processing is advanced to step s21 . when the delay time after complete firing has elapsed , the processing moves on to step s22 , there to induce formation of a judgment as to whether the hot flag is set up or not . when the engine is started while it is in the cold state , since the hot flag is not set , the processing advances to step s24 , there to induce formation of judgment whether the engine temperature has risen above the boundary temperature t0 , between the temperatures of the cold and hot states . when the engine temperature does not exceed the aforementioned boundary temperature t0 , the processing proceeds to step s25 , there to select the second memory 134 for warming . this particular operation is caused by the fact that the memory selector 139 selects the second memory 134 on the two conditions that in the apparatus of fig1 the complete - firing sensing / delay circuit 126 should issue its output and that the output from the first comparator 127 should be &# 34 ; 0 &# 34 ;. as is clear from fig1 the second memory 134 receives the outputs of the inlet air temperature sensor 122 and the engine temperature sensor 123 and , based on these outputs as parameters , the data on rotational position of the stepping motor 142 are read out of the second memory . then in the same manner as described above , the stepping motor 142 is operated according to the data so read out , to effect the control of the degrees of opening of the choke valve and the throttle valve ( step s33 in fig2 ). as the engine continues its rotation , the temperature of the engine is gradually raised . when the engine temperature rises to a point where the judgment in step s24 of fig2 gives an affirmative result , the processing advances to step s26 and induces formation of a judgment as to whether the acceleration switch is closed or not . when the judgment does not find the acceleration switch in a closed state , the processing proceeds from step s25 to step s33 to repeat the aforementioned operation . when the acceleration switch is found to be in a closed state , the processing advances to step s27 , there to induce formation of a further judgment as to whether the rotational speed ne of the engine is greater than the prescribed value ne 1 or not . when the judgment gives a negative result , the processing similarly advances to step s25 and step s33 and executes the cycle for warming . when the judgments in steps s26 and s27 both give affirmative results , the processing advances to step s28 . to be specific , the initial value of idling stored in a sixth memory 138 of fig1 is read out , a hot flag is then set up in step s29 , and the rotational position of the stepping motor is controlled in step s33 . the operation described above is effected in the apparatus of fig1 as follows . as the engine temperature rises , the output from the engine temperature sensor 123 increases and , consequently , the output from the first comparator 127 is reverted to &# 34 ; 1 &# 34 ;. in the meantime , as the rotational speed of the engine increases , the output from the engine &# 39 ; s rotational speed sensor 121 is proportionately increased and , consequently , the output from the second comparator 132 is reverted to &# 34 ; 1 &# 34 ;. as the result , a second and gate 144 issues an output &# 34 ; 1 &# 34 ; to set the second flipflop 146 when the output from an acceleration switch sensor 128 is &# 34 ; 1 &# 34 ;. consequently , the memory selector 139 selects a fourth memory 136 for compensation of the rotational speed of idling . an address converter 129 converts the output of engine &# 39 ; s rotational speed sensor 121 or engine r . p . m . into an address in the fourth memory 136 . the selective output from the aforementioned memory selector 139 is fed also to a second differentiating circuit 148 . in response to the output issued from this circuit 148 , a third flipflop 147 is set . the output from the aforementioned flipflop 147 is inverted and then fed to a third and gate 150 to close this gate 150 . for this reason , the read - out data of the aforementioned fourth memory 136 are not fed to the output controller 141 . in the meantime , by the output from the third flipflop 147 , the sixth memory 138 for setting the initial value of idling is actuated and the read - out data of this memory 138 are fed to the third comparator 140 . in this manner , the stepping motor 142 is driven to the angle of rotation for setting the initial value of idling which is memorized in the aforementioned sixth memory 138 . when the stepping motor 142 is actually rotated to reach the aforementioned initial value of idling , the third comparator 140 issues an output , which resets the third flipflop 147 . as the result , the third and gate 150 is opened and the data from the fourth memory 136 are allowed to be fed to the output controller 141 . since the fourth memory 136 keeps in storage , as described above , the data for compensation of the rotational position of the stepping motor 142 with the engine &# 39 ; s rotational speed as a parameter , it feeds to the output controller 141 the output indicating either the amount of rotation of the stepping motor or the number of drive pulses required for compensation where the engine &# 39 ; s rotational speed deviates from the prescribed rotational speed for idling . even when the degrees of opening of the choke valve and the throttle valve are adjusted by the operation of the stepping motor 142 , no immediate change in the rotational speed is obtained because of the inertia of the engine , for example . in due consideration of this situation , it is desirable that the following control should be suspended for a certain length of time after a change has been made in the rotational position of the stepping motor . step s31 of fig2 is intended to allow time for this suspension of the control . until the time so prescribed for the suspended control elapses , the processing returns to step s6 instead of proceeding to execute the compensation of the rotational angle of the stepping motor in step s33 . in the apparatus of fig1 similar allowance of time can be attained by controlling the operation timing of the output controller 141 and / or the third and gate 150 with a proper timer or sequencer ( not shown ). as the elapse of the prescribed time is sensed in step s31 , the timer for measuring the aforementioned prescribed time is cleared in step s32 and the processing advances to step s33 . then , the stepping motor is driven according to the data of the fourth memory 136 which has been read out in step s30 . in the manner described above , transition from the cold state control to the idle operation is effected . as is evident from the foregoing description , in the mixture control apparatus for the carburetor according to this invention , the transition from the cold region , past the home position , to the hot region or the idle operation region is carried out while the acceleration switch is on . the open position of the throttle valve , therefore , is set at the initial value of idling in the hot region instead of being approximated to the lowest value near the home position . this special adaptation removes the possibility that , during the aforementioned transition , the degree of opening of the throttle valve will become so insufficient as to entail excessive decline of the rotational speed or total stop of the engine . thus , in the mixture control apparatus for the carburetor of this invention , the rotational frequency of the idling operation can be notably stabilized because the direction and the quantity of the rotation of the stepping motor 142 are directly read out of the relevant memories according to the deviation of the rotational speed of the engine from the prescribed value and the rotational speed during the idling operation is controlled based on the data so read out . further , simplification of construction and decrease in cost can be materialized because the control of the degrees of opening of the throttle valve and the choke valve is accomplished by monoaxial driving . there is another advantage that the warming of the engine can be effected quickly because the electric motor cannot return to the status of cold - stage control after the engine has been changed to the hot state and unless the engine is stopped . optionally , the mixture control apparatus for the carburetor according to this invention may be embodied in a form modified as indicated below . ( 1 ) the initial setting of the u / d counter 143 is effected at the time that the home position switch is turned from its closed state to its opened state . ( 2 ) the first memory 133 for cold starting is caused to memorize the degree of opening of the throttle valve by using , as a parameter therefor , at least either of the outputs from the inlet air temperature sensor 122 and the engine temperature sensor 123 . ( 3 ) the second memory 134 for warming is caused to memorize the degree of opening of the throttle valve by using , as parameters therefor , at least two of the outputs from the engine &# 39 ; s rotational speed sensor 121 , the inlet air temperature sensor 122 , and the engine temperature sensor 123 . ( 4 ) the third memory 135 for hot starting is caused to memorize the degree of opening of the throttle valve by using , as a parameter , at least either of the outputs from the inlet air temperature sensor 122 and the engine temperature sensor 123 . ( 5 ) the sixth memory 138 for setting the initial value of idling is caused to memorize the degree of opening of the throttle valve by using , as a parameter therefor , at least either of the outputs from the inlet air temperature sensor 122 and the engine temperature sensor 123 . also , the aforementioned sixth memory 138 is caused to memorize the degree of opening of the throttle degree of opening by using , as parameters therefor , the rotational position of the stepping motor 142 and the data of the fourth memory 136 immediately before transition to the idle operation . ( 6 ) the detection of the operation of the acceleration switch is replaced by the detection of the fact that the throttle lever is not meshed with the interlocking lever . ( 7 ) the following two conditions may be adopted as the requisites for the transition from the cold region to the hot region . ( a ) that the engine temperature should be higher than the prescribed value . ( b ) that the ratio of increase of the engine &# 39 ; s rotational speed should be higher than the prescribed value . ( 8 ) the stepping motor is prevented from undergoing the phenomenon of hunting near the boundary between the cold state and the hot state of the engine by conferring the characteristic of hysteresis upon the set value ( either the boundary temperature between the cold and hot states or the ratio of increase of the engine &# 39 ; s rotational speed ) for discriminating between the cold state and the hot state of the engine .	5
one embodiment of this invention will be explained with reference to the accompanying drawings : referring to fig1 - 4 , an assembling station 1 is provided in the middle of a conveying line for a vehicle body a . a set jig 2 is provided on each side portion of the station 1 so that a rear door opening portion b and a front door opening portion b &# 39 ; of the vehicle body a set on the station 1 may be assembled with a rear door c and a front door c &# 39 ;, in order , through the set jig 2 . additionally , a pair of fastening heads 3 , 3 &# 39 ; for the rear door c and the front door c &# 39 ; are disposed in front and rear relationship on a front side of each set jig 2 in the longitudinal direction of the conveying line , so that these doors c , c &# 39 ; may be bolted at their door hinges d , d &# 39 ; to respective portions of the vehicle body a by means of a plural nut runners 3a , 3a &# 39 ; provided on the respective fastening heads 3 , 3 &# 39 ;. more in detail , each set jig 2 is supported on a shift table 4 which is shiftable in the vehicle length direction and is movable in three directions , that is , in the vehicle length direction , in the vehicle width direction and in the vehicle height direction , by a first three dimensional right - angled coordinates type robot mechanism 5 , operated by a control means ( not shown ). additionally , the two fastening heads 3 , 3 &# 39 ; are able , through a second three dimensional right - angled coordinates type robot mechanism 6 on the shift table 4 located at a front position of the set jig 2 , to be driven to be moved inwardly , that is , in the vehicle width direction , by respective feeding cylinders 3b , 3b &# 39 ;. additionally , a machine frame 7 located in front of the shift table 4 has a door introducing means 8 comprising a pair of inner and outer slide frames 8a , 8b having a booster mechanism so that the following operation can be performed . namely , by operating the introducing means 8 , the rear door c which is held by the outer slide frame 8b thereof ready to be set in position by a door receiver 8c and a clamp member 8d which are provided on the slide fram 8b is conveyed to a predetermined door introducing position facing the set jig 2 located at its door receiving position as illustrated . the rear door c is held by the set jig 2 so as to be set in position while received and attracted respectively by a door receiver 2a and a vacuum pad 2b which are provided on the set jig 2 . thereafter , by a rearward movement of the shift table 4 and an operation of the robot mechanism 5 , the set jig 2 is moved to be set in position at its position corresponding to the rear door opening portion b . thereafter , the set jig 2 is advanced inwardly , that is , in the vehicle width direction so that the rear door c may be inserted into the rear door opening portion b . under this condition , the fastening head 3 for the rear door c which is previously set in position by the robot mechanism 6 , at its position corresponding to a portion to which the door hinge d is to be bolted , is driven forward by the feeding cylinder 3b . the door hinge d is then bolted to a center pillar portion of the vehicle body a , as shown clearly in fig8 by the nut runner 3a provided on the fastening head 3 . next , in almost the same manner as above , the front door c &# 39 ; introduced by the introducing means 8 is inserted into the front door opening portion b &# 39 ; through the set jig 2 , and the door hinge d &# 39 ; of the front door c &# 39 ; is bolted to a front pillar portion of the vehicle body a by the nut runner 3a &# 39 ; provided on the fastening head 3 &# 39 ; for the front door c &# 39 ;. referring to the drawings , air driven units 3c , 3c &# 39 ; for the nut runners 3a , 3a &# 39 ; are provided on the respective fastening head 3 , 3 &# 39 ;, and magnets 3d , 3d &# 39 ; for bolt attraction are provided in socket portions of the forward ends of the respective nut runners 3a , 3a &# 39 ;. the foregoing robot mechanism 6 comprises a first slide frame 6a movable to advance and retreat in the vehicle width direction , a second slide frame 6b provided on the frame 6a so as to be movable to advance and retreat in the vehicle length direction , and an elevating frame 6c provided on the second slide frame 6b so as to be movable upwards and downwards in the vehicle height direction . each of the fastening heads 3 , 3 &# 39 ; is supported on a guide frame 6d which is provided on the elevating frame 6c and can extend longitudinally in the vehicle width direction . if the respective fastening heads 3 , 3 &# 39 ; are provided on their forward end portions with jaw means for being inserted with the respective nut runners so that bolts may be supplied thereto directly from a parts feeder , it would often happen that the jaw means becomes a hindrance especially when an interval between the front end edge of the rear door c and the portion to which the door hinge d is to be bolted is narrowed , as shown in fig8 in view of the relation of the rear door c with the width of the center pillar or the like . consequently , the desired bolting cannot be carried out . accordingly , in the illustrated embodiment , according to the characteristic features of this invention , a bolt receiving and supplying means 9 is provided on the machine frame 7 located in front of the fastening heads 3 , 3 &# 39 ; so that bolts supplied from a parts feeder ( not illustrated ) may be set on the respective nut runners 3a , 3a &# 39 ; through the foregoing means 9 . then the desired bolting may be carried out reliably , without using the jaw means , even when the foregoing clearance 1 is narrowed to that corresponding to the radius of the nut runner 3a itself . the bolt receiving and supplying means 9 comprises a bolt supplying head 10 which is to be connected to a parts feeder and a bolt transferring head 11 . the supplying head 10 is fixedly provided on the machine frame 7 . the transferring head 11 is attached to a slide frame 12 provided on the machine frame 7 so that , by an operation of a driving cylinder 12a for the slide frame 12 , the transferring head 11 may be moved reciprocally between its frontward bolt receiving position facing the supplying head 10 and its rearward delivering position facing the foregoing fastening head 3 , 3 &# 39 ;. additionally , as shown in fig5 and 6 , the supplying head 10 is provided with a plurality of bolt supplying openings 10a for being connected to bolt pressure feeding tubes 13 connected to a parts feeder . the bolt supplying openings 10a , 10a may be disposed in accordance with the disposition of the nut runners 3a , 3a of the respective fastening head 3 , 3 &# 39 ;. the transferring head 11 is also provided , in the similar manner as above , with a plurality of bolt receiving openings 11a for receiving bolts supplied through the supplying openings 10a . in addition , each receiving opening 11a is provided with a clamp cylinder 11b for firmly holding the bolt inserted therein , and an air introducing opening 11c for both cleaning the bolt receiving opening 11a and pushing - out the bolt . next , the operation of the foregoing example will be explained as follows : prior to introducing the rear door c to the set jig 2 , a bolt e is set , through the bolt receiving and supplying means 9 , to each of the nut runners 3a , 3a &# 39 ; of the two fastening heads 3 , 3 &# 39 ; for the rear door and the front door , respectively . more in detail , each bolt receiving opening 11a of the bolt transferring head 11 is supplied , through each bolt supplying opening 10a of the bolt supplying head 10 , with a bolt e charged from the parts feeder . then the transferring head 11 is moved to the bolt delivering position with each bolt e fixed in the corresponding receiving opening 11a by the operation of each clamp cylinder 11b . then the two fastening heads 3 , 3 &# 39 ; are slightly advanced towards the transferring head 11 and each of the nut runners 3a , 3a &# 39 ; is inserted in each receiving opening 11a while being rotated , whereby the head of each bolt e is brought into engagement with the forward end socket portion thereof . after the engagement thereof , each clamp cylinder 11b is released from its holding operation . at the same time , the two fastening heads 3 , 3 &# 39 ; are retreated , whereby each bolt e is drawn out from each receiving opening 11a under the condition that the same is attracted by each magnet 3d , 3d &# 39 ; provided on each nut runner 3a , 3a &# 39 ;. thereafter , the respective fastening heads 3 , 3 &# 39 ; are operated as mentioned above so as to effect the bolting of the door hinge d of the rear door c and the bolting of the door hinge d &# 39 ; of the front door c &# 39 ;. alternatively , instead of assembling the rear door and the front door by the single common set jig 2 as in the foregoing example with the vehicle body , the rear door and the front door are intended to be assembled by their individual set jigs mounted on individual robot mechanisms , then the fastening head for the rear door and the fastening head for the front door are mounted , individually one from another , on individual robot mechanisms provided in parallel with the foregoing robot mechanisms . in this case , the bolt receiving and supplying means 9 for the rear door and that for the front door are provided separately one from another . thus , according to this invention , the bolt receiving and supplying means is provided on one side of the fastening means so that a bolt supplied from a parts feeder may be set on the nut runner provided on the fastening head by way of the bolt transferring head provided on the bolt receiving and supplying means . thus , it is not required that the fastening head is provided with a jaw means for holding a bolt supplied from a parts feeder . the bolting can be carried out reliably even if the interval between an end edge of a door and a portion to which a door hinge is to be bolted is narrow , so far as there exists the interval for allowing the nut runner to pass therethrough . thus , a degree of freedom in a vehicle design can be increased . the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the presently disclosed embodiments are , therefore , to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims , rather than the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are , therefore , to be embraced therein .	1
in fig2 the preferred embodiment of the invention is shown installed for use with a tubular or plug flow reactor 31b , although the invention is particularly suitable for use as embodied in a trc apparatus as disclosed in the above mentioned u . s . pat . nos . 4 , 061 , 562 and 4 , 097 , 363 , the disclosures of which are incorporated herein by reference . referring to fig1 in the prior art trc process and system , thermal cracker feed oil or residual oil , with or without blended distillate heavy gas , entering through line 10 and hydrogen entering through line 12 pass through hydrodesulfurized zone 14 . hydrosulfurization effluent passes through line 16 and enters flash chamber 18 from which hydrogen and contaminating gases including hydrogen sulfide and ammonia are removed overhead through line 20 , while flash liquid is removed through line 22 . the flash liquid passes through preheater 24 , is admixed with dilution steam entering through line 26 and then flows to the bottom of thermal cracking reactor 28 through line 30 . a stream of hot regenerated solids is charged through line 32 and admixed with steam or other fluidizing gas entering through line 34 prior to entering the bottom of riser 28 . the oil , steam and hot solids pass in entrained flow upwardly through riser 28 and are discharged through a curved segment 36 at the top of the riser to induce centrifugal separation of solids from the effluent stream . a stream containing most of the solids passes through riser discharge segment 38 and can be mixed , if desired , with make - up solids entering through line 40 before or after entering solids separator - stripper 42 . another stream containing most of the cracked product is discharged axially through conduit 44 and can be cooled by means of a quench stream entering through line 46 in advance of solids separator - stripper 48 . stripper steam is charged to solids separators 42 and 48 through lines 50 and 52 , respectively . product streams are removed from solids separators 42 and 48 through lines 54 and 56 , respectively , and are then combined in line 58 for passage to a secondary quench and product recovery train , not shown . cokeladen solids are removed from solids separators 42 and 48 through lines 60 and 62 , respectively , and combined in line 64 for passage to burner 66 . if required , torch oil can be added to burner 66 through line 68 while stripping steam may be added through line 70 to strip combustion gases from the heated solids . air is charged to the burner through line 69 . combustion gases are removed from the burner through line 72 for passage to heat and energy recovery systems , not shown , while regenerated hot solids which are relatively free of coke are removed from the burner through line 32 for recycle to riser 28 . in order to produce a cracked product containing ethylene and molecular hydrogen , petroleum residual oil is passed through the catalytic hydrodesulfurization zone in the presence of hydrogen at a temperature between 650 ° f . and 900 ° f ., with the hydrogen being chemically combined with the oil during the hydrocycling step . the hydrosulfurization residual oil passes through the thermal cracking zone together with the entrained inert hot solids functioning as the heat source and a diluent gas at a temperature between about 1300 ° f . and 2500 ° f . for a residual time between about 0 . 05 to 2 seconds to produce the cracked product and ethylene and hydrogen . for the production of ethylene by thermally cracking a hydrogen feed at least 90 volume percent of which comprises light gas oil fraction of a crude oil boiling between 400 ° f . and 650 ° f ., the hydrocarbon feed , along with diulent gas and entrained inert hot gases are passed through the cracking zone at a temperature between 1300 ° f . and 2500 ° f . for a residence time of 0 . 05 to 2 seconds . the weight ratio of oil gas to fuel oil is at least 0 . 3 , while the cracking severity corresponds to a methane yield of at least 12 weight percent based on said feed oil . quench cooling of the product immediately upon leaving the cracked zone to a temperature below 1300 ° f . ensures that the ethylene yield is greater than the methane yield on a weight basis . again referring to fig2 in lieu of the system of the prior art ( see fig1 ) wherein the stream of solids plus fluidizing gas contact the flash liquid - dilution steam mixture entering reactor 28 , structurally the apparatus 32b of the subject invention comprises a solids reservoir vessel 33b and a housing 34b for the internal elements described below . the housing 34b is conically shaped in the embodiment of fig2 and serves as a transition spool piece between the reservoir 33b and the reactor 32b to which it is flageably connected via flanges 35b , 36b , 37b and 38b . the particular geometry of the housing is functional rather than critical . the housing is itself comprised of an outer metallic shell 39b , preferably of steel , and an inner core 40b of a castable ceramic material . it is convenient that the material of the core 40b forms the base 41b of the reservoir 33b . set into and supported by the inner core 40b is a gas distribution chamber 42b , said chamber being supplied with gaseous feed from a header 43b . while the chamber 42b may be of unitary construction , it is preferred that the base separating the chamber 42b from reaction zone 44b be a removable plate 45b . one or more conduits 46b extend downwardly from the reservoir 33b to the reaction zone 44b , passing through the base 41b , and the chamber 42b . the conduits 46b are in open communication with both the reservoir 33b and the reaction zone 44b providing thereby a path for the flow of solids from the reservoir 33b to the reaction zone 44b . the conduits 46b are supported by the material of the core 40b , and terminate coplanarly with a plate 45b , which has apertures 47b to receive the conduits 46b . the region immediately below the plate 45b is hereinafter referred to as a mixing zone 53b which is also part of the reaction zone 44 . as shown in fig3 an enlarged partial view of the intersection of the conduit 46b and the plate 45b , the apertures 47b are larger than the outside dimension of conduits 46b , forming therebetween annular orifices 48b for the passage of gaseous feed from the chamber 42b . edges 49b of the apertures 47b are preferably convergently beveled , as are the edges 50b , at the tip of the conduit well 51b . in this way the gaseous stream from the chamber 42b is angularly injected into the mixing zone 53b and intercepts the solids phase flowing from conduits 46b . a projection of the gas flow would form a cone shown by dotted lines 52b the vertex of which is beneath the flow path of the solids . by introducing the gas phase angularly , the two phases are mixed rapidly and uniformly , and form a homogeneous reaction phase . the mixing of a solid phase with a gaseous phase is a function of the shear surface between the solids and gas phases , and the flow area . a ratio of shear surface to flow area ( s / a ) of infinity defines perfect mixing ; poorest mixing occurs when the solids are introduced at the wall of the reaction zone . in the system of the present invention , the gas stream is introduced annularly to the solids which ensures high shear surface . by also adding the gas phase transversely through an annular feed means , as in the preferred embodiment , penetration of the phases is obtained and even faster mixing results . by using a plurality of annular gas feed points and a plurality of solid feed conduits , even greater mixing is more rapidly promoted , since the surface to area ratio for a constant solids flow area is increased . mixing is also a known function of the l / d of the mixing zone . a plug creates an effectively reduced diameter d in a constant l , thus increasing mixing . the plug 54b , which extends downwardly from plate 45b , as shown in fig2 and 3 , reduces the flow area , and forms discrete mixing zones 53b . the combination of annular gas addition around each solids feed point and a confined discrete mixing zone greatly enhances the conditions for mixing . using this preferred embodiment , the time required to obtain an essentially homogeneous reaction phase in the reaction zone 44b is quite low . thus , this preferred method of gas and solids addition can be used in reaction systems having a residence time below 1 second , and even below 100 milliseconds . in such reactions the mixing step must be performed in a fraction of the total residence time , generally under 20 % thereof . if this criteria is not achieved , localized and uncontrolled reaction occurs which deleteriously affects the product yield and distribution . this is caused by the maldistribution of solids normal to the flow through the reaction zone 44b thereby creating temperature and or concentration gradients therein . the flow area is further reduced by placing the apertures 47b as close to the walls of the mixing zone 53b as possible . fig4 shows the top view of plate 45b having incomplete circular apertures 47b symmetrically spaced along the circumference . the plug 54b , shown by the dotted lines and in fig7 is below the plate , and establishes the discrete mixing zones 53b described above . in this embodiment , the apertures 47b are completed by the side walls 55b of gas distribution chamber 42b as shown in fig3 . in order to prevent movement of conduits 46b by vibration and to retain the uniform width of the annular orifices 48b , spacers 56b , are used as shown in fig6 . however , the conduits 46b are primarily supported within the housing 34b by the material of the core 40b as stated above . referring to fig7 the plug 54b serves to reduce the flow area and define discrete mixing zones 53b . the plug 54b may also be convergently tapered so that there is a gradual increase in the flow area of the mixing zone 53b until the mixing zone merges with remainder of the reaction zone 44b . alternatively , a plurality of plugs 54b can be used to obtain a mixing zone 53b of the desired geometric configuration . referring again to fig2 the housing 34b may preferably contain a neck portion 57b with corresponding lining 58b of the castable ceramic material and a flange 37b to cooperate with a flange 38b on the reaction chamber 31b to mount the neck portion 57b . this neck portion 57b defines mixing zone 53b , and allows complete removal of the housing 34b without disassembly of the reactor 31b or the solids reservoir 33b . thus , installation , removal and maintenance can be accomplished easily . ceramic linings 60b and 62b on the reservoir 33b and the reactor walls 61b respectively are provided to prevent erosion . the solids in reservoir 33b are not fluidized except solids 63b in the vicinity of conduits 46b . aeration gas to locally fluidize the solids 63b is supplied by nozzles 64b symmetrically placed around the conduits 46b . gas to nozzles 64b is supplied by a header 65b . preferably , the header 65b is set within the castable material of the core 40b , but this is dependent on whether there is sufficient space in the housing 34b . a large mesh screen 66b is placed over the inlets of the conduit 64b to prevent debris and large particles from entering the reaction zone 44b or blocking the passage of the particulate solids through the conduits 46b . by locally fluidizing the solids 63b , the solids 63b assume the characteristics of a fluid , and will flow through the conduits 46b . the conduits 46b have a fixed cross sectional area , and serve as orifices having a specific response to a change in orifice pressure drop . generally , the flow of fluidized solids through an orifice is a function of the pressure drop through the orifice . that orifice pressure drop , in turn , is a function of bed height , bed density , and system pressure . however , in the process and apparatus of this invention the bulk of the solids in reservoir 33b are not fluidized . thus , static pressure changes caused by variations in bed height are only slowly communicated to the inlet of the conduit 46b . also the bed density remains approximately constant until the point of incipient fluidization is reached , that is , point &# 34 ; a &# 34 ; of fig5 . in the present invention , however , it is essential that the amount of aeration gas be below that amount . any aeration gas flow above that at point &# 34 ; a &# 34 ; on fig5 will effectively provide a fluidized bed and thereby lose the benefits of this invention . by adjustment of the aeration gas flow rate , the pressure drop across the nonfluidized bed can be varied . accordingly , the pressure drop across the orifice is regulated and the flow of solids thereby regulated as shown in fig5 . as gas flow rates below incipient fluidization , significant pressure increases above the orifice can be obtained without fluidizing the bulk of the solids . any effect which the bed height and the bed density variations have on mass flow are dampened considerably by the presence of the non - fluidized reservoir solids and are essentially eliminated as a significant factor . further the control provided by this invention affords rapid response to changes in solids mass flow regardless of the cause . together with the rapid mixing features described above , the present invention offers an integrated system for feeding particulate solids to a reactor or vessel , especially to a trc tubular reactor wherein very low reaction residence times are encountered . fig8 and 9 depict an alternate preferred embodiment of the control features of the present invention . in this embodiment the reservoir 33b extends downwardly into the core material 40b to form a secondary or control reservoir 71b . the screen 66b is positioned over the entire control reservoir 71b . the aeration nozzles 64b project downwardly to fluidize essentially these solids 63b beneath the screen 66b . the bottom 41b of the reservoir 33b is again preferably formed of the same material as the core 40b . a plurality of clean out nozzles 72b are preferably provided to allow for an intermittent aeration gas discharge which removes debris and large particles that may have accumulated on the screen 66b . porous stone filters 73b prevent solids from entering the nozzles 72b . headers 65b and 74b provide the gas supply to nozzles 64b and 72b respectively . the conduits 46b communicate with the reservoir 71b through leading section 46 &# 39 ; b . the leading sections 46 &# 39 ; b are formed in a block 75b made of castable erosion resistent ceramic material such as carborundum alfrax 201 . the block 75b is removable , and can be replaced if eroded . the entrance 75b to each section 46 &# 39 ; b can be sloped to allow solids to enter more easily . in addition to being erosion resistent , the block 75b provides greater longevity because erosion may occur without loss of the preset response function . thus , even if the conduit leading sections 46 &# 39 ; b erode as depicted by dotted lines 77b , the remaining leading section 46 &# 39 ; b will still provide a known orifice size and pressure drop response . the conduits 46b are completed as before using erosion resistent metal tubes 51b , said tubes being set into core material 40b and affixed to the block 75b . fig9 is a plan view of fig8 along section 9 -- 9 showing an arrangement for the nozzles 64b and 72b , and the headers 65b and 74b . gas is supplied to the headers 65b and 74b through feed lines 79b and 80b respectively , which extend out beyond the shell 34b . it is not necessary that the headers be set into the material of the core 40b , although this is a convenience from the fabrication standpoint . uniform flow distribution to each of the nozzles is ensured by the hydraulics of the nozzles themselves , and does not require other devices such as an orifice or venturi . the gas supplied to feed lines 79b and 80b is regulated via valve means not shown . fig1 and 11 show the pertinent parts of an alternate embodiment of the invention wherein a second gas distribution assembly for feed gas is contemplated . as in the other embodiments , a gas distribution chamber 42b terminating in annular orifice 48b surrounds each solids delivery conduit 46b . however , rather than a common wall between the chamber 47b and the conduit 46b , a second annulus 83b is formed between the chamber 42b and the conduit 46b . walls 81b and 51b define the chambers 83b . feed is introduced through both the annular opening 48b in the chamber 42b and the annular opening 84b in the annulus 83b at an angle to the flow of solids from the conduits 46b . the angular entry of the feed gas to the mixing zone 53b is provided by beveled walls 49b and 85b , which define the openings 48b and beveled walls 50b and 89b which define the openings 84b . gas is introduced to the annulus 83b through the header 86b , the header being set into the core 40b if convenient . fig1 is a plan view of the apparatus of fig1 through section 11 -- 11 showing the conduit openings and the annular feed openings 48b and 84b . gas is supplied through feed lines 87b and 88b to the headers 43b and 86b and ultimately to the mixing zones through the annular openings . uniform flow from the chambers 42b and 83b is ensured by the annular orifices 48b and 84b . therefore , it is not essential that flow distribution means such as venturis or orifices be included in the header 43b . the plug 54b is shaped symmetrically to define discrete mixing zones 53b . mixing efficiency is also dependent upon the velocities of the gas and solid phases . the solids flow through the conduits 46b in dense phase flow at mass velocities from preferably 200 to 500 pounds / sq . ft ./ sec ., although mass velocities between 50 and 1000 pounds / sq . ft ./ sec ., may be used depending on the characteristics of the solids used . the flow pattern of the solids in the absence of gas is a slowly diverging cone . with the introduction of the gas phase through the annular orifices 48b at velocities between 30 and 800 ft ./ sec ., the solids develop a hyperbolic flow pattern which has a high degree of shear surface . preferably , the gas velocity through the orifices 48b is between 125 and 250 ft ./ sec . higher velocities are not preferred because erosion is accelerated ; lower velocities are not preferred because the hyperbolic shear surface is less developed . the initial superficial velocity of the two phases in the mixing zone 53b is preferably about 20 to 80 ft ./ sec ., although this velocity changes rapidly in many reaction systems , such as thermal cracking , as the gaseous reaction products are formed . the actual average velocity through the mixing zone 53b and the reaction zone 44b is a process consideration , the velocity being a function of the allowed residence time therethrough . by employing the solid feed device and method of the present inventions , the mixing length to diameter ratio necessary to intimately mix the two phases is greatly reduced . this ratio is used as an informal criteria which defines good mixing . generally , an l / d ( length / dia .) ratio of from 10 to 40 is required . using the device disclosed herein , this ratio is less than 5 , with ratios less than 1 . 0 being possible . well designed mixing devices of the present invention may even achieve essentially complete mixing at l / d ratios less than 0 . 5 .	2
the present invention uses a comparison of the returns of a single investment to determine how long the periodic contributions should continue and whether they should start up again after being stopped . positive returns are generated by a dca strategy when purchases are made at prices lower than a sell price . over time , accumulation of shares in a stock or fund should result in an asset value that no longer is affected by the periodic contributions . the size of the asset becomes so large that the small periodic investment regardless of the purchase price has minimal effect on the rate of return . this happens when the compound average annual rate of return of the investment exceeds the internal rate of return ( irr ). at this point , the return comparison is telling the investor that the time value of money contribution to the investment return is ending , future contributions should be terminated and the investor should start over with a new fund / investment . this allows for greater diversification and another round of time value of money benefits . clearly , the point is not to stop investing but to reallocate the investments into another fund . these comparisons are best shown by plotting the annual returns and identifying crossover points . the table below identifies the type of data and calculations used in the development of the present invention . yearly out of pocket ( oop ) investment = the amount of money that was added to the investment in the time period . it does not include reinvested dividends or capital gains . cumulative oop investment = the sum of the yearly oop investment over the investment &# 39 ; s lifetime . year end market value = the market value of the investment at the end of the year . it includes all reinvested dividends and capital gains . because of ease of reporting , the calendar year was used here and in all other examples . however , any fiscal year end could also be used . in fact , the tool can be used anytime throughout the year provided that the appropriate adjustments are made . annual return = the percent return on the investment over a single time period calculated as follows : year end market value minus the sum of previous year end market value plus yearly oop investment all divided by the sum of previous year end market value plus yearly oop investment . for period 6 in the table : total return = the percent return on the investment from its beginning to the time period in question calculated as follows : year end market value minus the cumulative oop investment divided by the cumulative oop investment . for period 6 in the table : average annual return = the average of the individual annual returns calculated as follows : the sum of the individual annual returns divided by the number of periods . for period 6 in the table : compound average annual return = the average of the total return for a given period calculated as follows : the total return for a given period divided by the period number . for period 6 in the table : irr ( internal rate of return )= the rate of discount which makes the net present value ( npv ) equal to zero . the solution is usually determined by trial and error and for this reason computer programs or special functions in computer spreadsheets are normally used . for reference purposes formulas are shown below : npv = c 0 + c 1 /( 1 + irr )+ c 2 /( 1 + irr )̂ 2 + . . . + ct /( 1 + irr )̂ t = 0 c0 = initial cash flow ( in or out ). for the purposes of the present invention , it is the initial period oop investment . it is negative because it is an outflow . c1 = oop contribution in period 2 . c2 = oop contribution in period 3 . ct = year end market value in last time period . it should be a positive number because it is an inflow . t = number of time periods net present value ( npv ) can be used instead of irr and the decision indicator is when the npv curve crosses zero ( becomes negative ). the discount rate used in each periodic calculation is the compounded average annual return for that time period . these results compared favorably to the irr but may be slightly different because of the way they are calculated . one advantage of using npv is that if there have been outflows from the investment , then there are more than two sign changes . this could give misleading results using irr . use of the irr and npv calculations take into account the time value of money and the share prices of buying and selling . the compound average annual return also takes into account the buy and sell prices but completely excludes the time value of money , assuming that the entire amount invested was contributed at the beginning . the difference between these two calculations results in the value of the time element of the investment . when the compound average annual return exceeds the irr ( or when the npv is negative ), the time value benefit has been exhausted . this signals the investor to reallocate the periodic contributions to another investment . if returns are negative during the investment lifetime , there may be negative ( invalid ) crossover points . these could be eliminated by using the absolute value of the return calculations or only accepting crossovers if they occur in a time period in which the total return is positive . however , depending on the type and life of the investment , being aware of these points could help the investor . the average annual return is the average of the separately calculated annual returns . since each annual return calculation includes the out of pocket contribution during the year , which is a negative cash flow , it captures some of the time value . that is why the average annual return somewhat tracks the irr . therefore , the present invention could also use a comparison of the average annual return with the compounded average annual return to determine when contributions should cease . however , as shown later , this method identifies more invalid crossover points , may miss valid ones and should not be used . fig2 shows a block diagram of a system 10 for implementing the present invention . the system 10 includes one or more administrative computers 12 and one or more investment management computers 14 . ( only one administrative computer 12 is shown in fig2 .) each investment management computer 14 includes client / investor account information 16 . each investment management computer 14 may be associated with an investment company or other type of investment entity . each investment management computer 14 is in communication with one or more of the administrative computers 12 . each administrative computer 12 includes a data processor 18 and client / investor purchase execution instructions 19 . the data processor 18 receives the client / investor account information 16 which constitutes the “ investment ,” and periodically calculates various items related to the investment as shown in fig2 , such as internal rate of return ( ror ) 20 , compound average annual ror 21 , total ror 22 , and npv 23 . the data processor 18 also includes the functionality to take the absolute value 24 and 25 of the internal and compound average annual rors respectively . these two outputs are then compared in comparator 29 so as to determine when investments should be stopped . comparator 26 is used for making the appropriate comparisons between the internal ror 20 and the compound average annual ror 21 . comparator 27 is used to compare the total ror 22 to zero . the outputs from these two comparators 26 and 27 is then analyzed in a logical and unit 30 so as to determine when investments should be stopped . comparator 28 is used to compare the npv to zero . logical and unit 31 analyzes the outputs from comparators 27 and 28 to determine when investments should be stopped . the client / investor purchase execution instructions 19 include information such as the amount of the dollar cost averaging investment , and the conditions for determining whether to stop making investments . as long as no such conditions have occurred , investments are periodically made according to the dollar cost averaging amounts in instructions 19 . in one preferred embodiment of the present invention , the contributions to an investment are started and stopped automatically based on instructions output from the administrative computers 12 . if a particular investment is stopped , the investor may pre - designate an alternative investment to receive new contributions , such as the monthly contributions within a 401 ( k ) plan , or the investment may stop altogether . in another preferred embodiment , investments are not automatically started or stopped . instead , the administrative computers 12 send messages to investors informing them of the detected start / stop conditions , and the investors have the option of acting on the messages by sending instructions to the administrative computers 12 to stop making contributions to an investment , or to restart making contributions to an investment that was previously stopped . in one preferred embodiment of the present invention , the elements and functions of the administrative computer 12 are located in , and performed directly by a financial entity such as a 401 ( k ) administrator , with the assistance of a software program . in another preferred embodiment of the present invention , the elements and functions of the administrative computer 12 are located in , and performed directly by the investor with the assistance of a software program . alternatively , some or all of the elements and functions of the administrative computer 12 may be located in , and performed directly by , the one or more investment management computers 14 . the software programs may be standalone or integrated with other software . they may be made available via hard medium such as computer discs ( cds ), or via internet downloads . they may also be web - based programs . systems for processing and managing investments are well - known in the art , and thus are not described in further detail herein . for example , u . s . pat . no . 6 , 014 , 642 ( el - kadi et al .) discloses a system for benefits processing that may implement the investment management computer 14 . u . s . pat . no . 5 , 193 , 056 ( boes ) discloses a data processing system for an investment company that may implement the investment management computer 14 . u . s . pat . no . 5 , 819 , 238 ( fernholz ) discloses apparatus and methods for executing trades associated with buying and selling securities that may implement purchase instructions 19 . each of these patents is incorporated by reference herein . such a tool is valuable to independent investors , financial planners , mutual fund companies , banks , 401 ( k ) and other retirement plan custodians and administrators , asset managers , brokerage firms , insurance companies , stock and fund transfer agents , financial websites , web portals , and the like . it may be marketed and sold to individuals , the makers of financial planning software ( e . g ., microsoft , intuit ), and various financial service companies described above . it may be added to the websites of financial service companies and others as a standalone tool or integrated with dollar cost averaging and / or other asset accumulation strategy simulation tools and other software . fig2 - 28 are self - explanatory flowcharts of preferred embodiments of methods for implementing the present invention . the flowchart steps shown in fig2 - 28 may be performed at periodic intervals , such as once per year , to determine if investments should be stopped , restarted , or stopped again . by periodically performing the steps , an investor will have numerous opportunities to receive the recommended investment advice . for example , if the process indicates that contributions should be stopped but an investor decides not to stop making contributions , the process can be repeated the following year . if the same conditions exist , the investor will be informed again that contributions should be stopped . fig1 - 23d provide examples that illustrate the invention details described above for four sample funds . fig1 shows a graph of the average annual returns and the compound average annual returns for fund # 1 over time . when viewed in this way , year 12 identifies a crossover point and signals the investor that the time value element has been exhausted and reallocation of the periodic investments should be considered . fig2 shows a graph of the internal rate of return ( irr ) and the compound average annual returns for fund # 1 over time . note that the crossover point using the irr doesn &# 39 ; t occur until year 13 . the differences between the use of the average annual returns and the irr for determining the time value element can be seen in fig3 . this graph shows the average annual returns minus the compound average annual returns and the internal rate of return ( irr ) minus the compound average annual returns for fund # 1 over time . the above crossover point equivalent is when the differences become negative . this occurs in year 12 for the average annual return and year 13 for the irr . fig4 shows a graph of the net present value ( npv ) of fund # 1 over time . the equivalent to the above crossover point is when the npv becomes negative . this also occurs in year 13 and compares favorably with the use of the irr . fig5 shows a graph of the average annual returns and the compound average annual returns for fund # 2 over time . a crossover point is identified in year 2 but it clearly does not signal the investor to stop the contributions . at this point in time the asset size is not large enough , when compared to the contributions , to stop . this type of false indicator may occur following a sign change in the total return calculation . it tends to happen early in the investment lifetime . it is not abnormal . however , it is advantageous to monitor the investment because if it persists or shows up again after a number of years it may signal the investor to sell the position . it is telling the investor that more money has been put in than what can be taken out and unless comparison indices show the same results , the fund selected is a poor performer . this may be acceptable to the investor , especially if the fund provides a hedge against a certain situation or if it is not diversified . it may be geographically or industry specific . this is why it is important that the investor know what he or she is invested in and why . according to fig5 , no meaningful crossover point occurs and the investor should continue with the yearly out of pocket contributions . fig6 shows a graph of the internal rate of return ( irr ) and the compound average annual returns for fund # 2 over time . note that a crossover point is reached at year 14 . this is shown again in fig7 which plots the differences between the use of the average annual returns and the irr for determining the time value element . the average annual returns show a false positive in year 2 and nothing following , while the irr shows a crossover in year 14 . fig8 confirms the crossover at year 14 by use of the npv calculation . these figures illustrate that irr and npv calculations are better tools for determining the time value element of an investment than using the average annual returns . final confirmation of a crossover point can be made by a sanity check . the investment has been funded for 14 years . the monthly contributions are $ 125 and the market value is $ 63 , 645 . asset size is large compared to the contributions . it is reasonable to believe that the $ 125 contributions no longer have a time element of value . fig9 shows a graph of the average annual returns and the compound average annual returns for fund # 3 over time . a crossover point is identified in year 3 but it clearly does not signal the investor to stop the contributions . this is similar to the situation shown in fig5 . however , unlike fig5 , a legitimate crossover point is shown to occur in year 11 . this is confirmed in fig1 showing the irr and the compound average annual return , fig1 showing the average annual returns minus the compound average annual returns and the internal rate of return ( irr ) minus the compound average annual returns , and fig1 showing a graph of the net present value ( npv ) of fund # 3 over time . fig1 shows a graph of the average annual returns and the compound average annual returns for fund # 4 over time . this fund happens to be geographically specific and is very volatile . a crossover point is identified in year 5 but it clearly does not signal the investor to stop the contributions . this is similar to the situations shown in fig5 and fig9 . a legitimate crossover point is shown to occur in year 12 . as shown in fig2 a - 22b , there are four time periods in which the total return is negative ( time periods 1 , 2 , 5 , 9 ). these four periods where the cumulative out of pocket investment is greater than the year end market value result in five total return sign changes occurring in time periods 3 , 5 , 6 , 9 and 10 . fig1 showing the irr and the compound average annual returns for fund # 4 identifies five crossover points as a result of the five sign changes . additionally a sixth crossover point is identified . only the sixth one in year 12 is legitimate . note that after nine years of investment , the year end market value of this fund was less than the out of pocket contributions . generally this would cause the investor to consider selling the investment . knowing the limitations and specifics of the fund allowed the investor to continue with contributions until year 12 . the multiple crossover points are identified in fig1 which shows the average annual returns minus the compound average annual returns and the irr minus the compound average annual returns . these points are confirmed in fig1 which shows the npv of fund # 4 over time . the false indicators are generated when the year end market value is less than the cumulative out of pocket contributions , when the total return is negative . it is the changing of the sign from positive to negative and vice - versa that generates the crossover points . they can be eliminated by taking the absolute value of the average annual returns or the irr and the compound average annual returns . this is demonstrated in fig1 . fig1 a - 18b : spreadsheet 1 — fund # 1 shows the following information : a . data section — this section includes the time period , the out of pocket annual contributions and the end of period market value of the investment . the spreadsheet is set up with time periods 1 - 26 used as headings for 26 columns , occupying row one . in the next two rows , each time period then has a value for the out of pocket annual contributions and the end of period market value . b . cash flow calculations — in order to use the irr and npv functions built into microsoft ® excel ®, the cash flows ( in and out ) need to be in the same row or column . this section simply moves the yearly out of pocket investment and year end market values for each time period to a single row . c . rate of return calculations — this section includes the calculations needed for determining the various investment rates of return . each column has an entry ( row ) for the cumulative out of pocket annual contributions ( investment ), annual return , total return , average annual return , compound average annual return , internal rate of return ( irr ), and compound average annual return . the compound average annual return is included twice so that when the graphs with average annual return and irr are created , there is consistency with line colors and symbols . d . rate of return comparisons — this section includes the calculations needed for determining the differences between various rates of return . specifically , it shows the difference between the average annual return and the compound average annual return for each time period in one row and the difference between the irr and the compound average annual return in the next row . e . net present value calculations ( npv )— this section includes the calculations needed for determining the npv of the investment at the end of each time period . the calculations were performed using the built in npv ( and also irr ) function of the microsoft excel spreadsheet . the discount rate used is the compound average annual rate of return . the information below is taken from microsoft excel help . note that the first year out of pocket contribution was added to the npv assuming that the first payment was made at the beginning of the first time period . f . npv ( as calculated using excel 2003 )— calculates the net present value of an investment by using a discount rate and a series of future payments ( negative values ) and income ( positive values ). value 1 , value 2 , . . . are 1 to 29 arguments representing the payments and income . i . value 1 , value 2 , . . . must be equally spaced in time and occur at the end of each period . ii . npv uses the order of value 1 , value 2 , . . . to interpret the order of cash flows . be sure to enter your payment and income values in the correct sequence . iii . arguments that are numbers , empty cells , logical values , or text representations of numbers are counted ; arguments that are error values or text that cannot be translated into numbers are ignored . iv . if an argument is an array or reference , only numbers in that array or reference are counted . empty cells , logical values , text , or error values in the array or reference are ignored . i . the npv investment begins one period before the date of the value 1 cash flow and ends with the last cash flow in the list . the npv calculation is based on future cash flows . if your first cash flow occurs at the beginning of the first period , the first value must be added to the npv result , not included in the values arguments . for more information , see the examples below . ii . if n is the number of cash flows in the list of values , the formula for npv is : npv =( value1 /( 1 + rate )̂ 1 )+( value2 /( 1 + rate )̂ 2 )+ . . . ( value n /( 1 + rate )̂ n ) iii . npv is similar to the pv function ( present value ). the primary difference between pv and npv is that pv allows cash flows to begin either at the end or at the beginning of the period . unlike the variable npv cash flow values , pv cash flows must be constant throughout the investment . for information about annuities and financial functions , see pv . iv . npv is also related to the irr function ( internal rate of return ). irr is the rate for which npv equals zero : npv ( irr ( . . . ) . . . )= 0 . g . logical and functions — this section includes the various comparisons for determining when to stop contributions . the first row compares the compound average annual return ( caar ) to the irr and the total return to zero . a true result is obtained when the caar is greater than the irr and the total return is greater than zero . the next row compares the npv and the total return to zero . a true result is obtained when the npv is less than zero and the total return is greater than zero . contributions should be stopped when a true result is obtained . including the comparison of the total return to zero eliminates the invalid crossover points . note that it is possible to obtain an invalid true result in time period one for the comparison of the caar to the irr when the total return is positive . in time period one all of the return calculations provide the same result , as shown to two decimal places . however , depending on how the calculations are made there may be a slight difference . in microsoft excel 2003 the irr for time period one is actually 10 . 399999999970900 % while the caar is 10 . 400000000000000 %. for the purposes of the present invention they are equal but when excel does the comparison the caar is greater than the irr and an invalid true result is obtained . this problem can be eliminated by adding a very small number ( insignificant in terms of the invention ) to the irr so that it is greater than the caar . the number chosen here is 0 . 00000001 . such an increment has no effect on the invention and could be added to the irr in time period one . the comparisons were performed using the logical and function of the microsoft excel spreadsheet . the information below is taken from microsoft excel help . returns true if all its arguments are true ; returns false if one or more argument is false . logical 1 , logical 2 , . . . are 1 to 30 conditions you want to test that can be either true or false . i . the arguments must evaluate to logical values such as true or false , or the arguments must be arrays or references that contain logical values . ii . if an array or reference argument contains text or empty cells , those values are ignored . iii . if the specified range contains no logical values , and returns the # value ! error value . spreadsheet 1 is a template of what was used for the analysis of fund # 1 , fund # 2 , and fund # 3 . fig1 a - 19f : spreadsheet 2 — formulas is a copy of spreadsheet 1 — fund # 1 , except that it shows the formulas used in the calculations rather than the results . fig2 a - 20c : spreadsheet 3 — fund # 2 shows the same information described above for fund # 2 . fig2 a - 21d : spreadsheet 4 — fund # 3 shows the same information described above for fund # 3 . fig2 a - 22b : spreadsheet 5 — fund # 4 shows the same information described above for fund # 4 . additionally , it includes the calculations for the absolute value of the irr and absolute value of the compound average annual return for fund # 4 . the calculations were performed using the built - in absolute value ( abs ) function of the microsoft excel spreadsheet . fig2 a - 23d : spreadsheet 6 — fund # 4 formulas is a copy of spreadsheet 5 — fund # 4 , except that it shows the formulas used in the calculations rather than the results . the identification of the crossover points , which indicate whether investments should be stopped , restarted , or stopped again , may occur by many different pathways , as described above . in one scheme , the investment data is plotted out and the investor visually inspects the plots to identify the crossover points . in another scheme , a computer program outputs a message to the investor that a crossover point has occurred , and the investment data that supports the outputted message may be shown to the investor with or without a graph , if desired . the computer program may be associated with an investor &# 39 ; s personal financial software or it may be hosted by a service provider that may or may not have access to the investor &# 39 ; s financial data . although a dollar cost averaging strategy was used to accumulate assets in the examples described above , the scope of the present invention includes other embodiments that use an asset accumulation strategy that makes purchases at regular or intermittent intervals . such strategies include share averaging , value averaging , and random purchases . they also include purchases of individual stock through direct investment programs and the like . the present invention may be implemented with any combination of hardware and software . if implemented as a computer - implemented apparatus , the present invention is implemented using means for performing all of the steps and functions described above . the present invention can be included in an article of manufacture ( e . g ., one or more computer program products ) having , for instance , computer useable media . the media has embodied therein , for instance , computer readable program code means for providing and facilitating the mechanisms of the present invention . the article of manufacture can be included as part of a computer system or sold separately . it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof . it is understood , therefore , that this invention is not limited to the particular examples disclosed , but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims .	6
this invention relates to assemblies for processing paper tape which is punched to provide indicia of data . punched paper tape is processed in a punch assembly which selectively establishes patterns of holes and spaces laterally across a substantially opaque paper tape to create words of data . punched paper tape is generally encoded in a 5 level code or an 8 level code . in the 5 level code there is the possibility of punching a maximum of 5 holes laterally across the tape and in the 8 level code there is the possibility of punching a maximum of 8 holes laterally across the tape . additionally , punched paper tape is provided with drive holes which comprise spaced apart drive apertures longitudinally disposed on the tape . the assemblies which process such punched paper tape include toothed drive wheels which engage the drive apertures in the tape to advance the tape in fixed increments through the assembly . paper tape which is encoded by a paper tape punch assembly to store data is read from the punched paper tape by a reader assembly . the reader assembly comprises a plurality of light sources laterally disposed across a portion of the reader assembly which is traversed by the paper tape as it is passed through the reader assembly and a corresponding plurality of light receptors which are aligned with the light sources . since the tape is substantially opaque , light from the light sources will impinge upon the corresponding light receptors only in those positions in which data holes have been punched in the tape . the tape is advanced through the reader assembly by a sprocket wheel which is arranged to advance the tape such that the positions on the tape at which holes have been or may have been punched are aligned between the corresponding light sources and light receptors . a paper tape punch and the paper tape reader each have independent utility , however , it is common to associate a paper tape punch and a reader in a single assembly . such an assembly serves to create a local punched tape in response to incoming data signals from a distant station or in response to local signals from a keyboard or other input arrangement . the paper tape punch and reader may be physically arranged in a serial manner such that the paper is advanced through the two assemblies in unison and a loop is provided in the tape between the output of the punch and the input of the reader . accordingly , when incoming signals are received from a line , a tape is created by the punch assembly and this tape is then read by the reader assembly . the output signals of the reader assembly typically are used to operate a printer to create a hard copy of the message . in accordance with the present invention , periodic motion for drive assemblies of a paper tape punch and reader assembly is generated by an adjustable eccentric assembly . the eccentric assembly comprises a shaft 33 and a pulley plate 32 which includes a groove for receiving an elastic drive belt 23 . a circular body 44 has a flat surface which engages one face of the pulley plate 32 and includes a hole centered within the circle . the hole in the body is larger than the outside diameter of the shaft and the body is adapted to be adjustably positioned relative to the shaft and to the shaft opening in the pulley plate . the relative position of the pulley plate and the body is established by a selectively positionable eccentric which engages a first hole in the pulley plate and the established position of the pulley plate is secured by a holding screw . fig1 is an overall perspective view of a paper tape punch and reader assembly arranged to mount on a flat surface such as a table ; fig2 is a perspective view of a paper tape punch and reader assembly with the cover shown in fig1 removed ; fig3 illustrates an arrangement for effecting intermittent motion of the paper tape as it proceeds through the punch assembly ; fig4 shows an arrangement for adjusting the eccentric drive of fig3 ; fig6 illustrates the paper tape feed wheel assembly for both the punch and reader assemblies ; fig8 through 10 illustrate further details of the feed wheel assembly for the punch and reader assemblies ; fig1 is a top view of the paper tape feed and the chad chute in the punch assembly ; fig1 and 15 are views of a chad box and a chad chute extender ; and in fig1 there is shown an overall punch and reader assembly 1 which comprises the punch assembly 2 and the reader assembly 3 . the supply reel for the paper tape and the paper tape is not shown in fig1 however , it is to be understood that the paper tape is stored on a reel which may be supported from the assembly 1 or may be supported separately . the tape enters the guide 5 , passes through the punch assembly and exits under the cover plate 7 . the material which is punched from the tape as it passes through the punch assembly is called &# 34 ; chad &# 34 ;, and the chad exits through the chad chute 6 and into the chad container 10 . the assembly of fig1 has a flat bottom surface , and thus may be mounted on a flat surface such as a desk or table in close proximity to a keyboard and printer assembly . in the event that the punch and reader assembly is to be located on a pedestal , the chad receptacle 10 may be replaced by an extender assembly ( not shown ) to permit the chad to be delivered to a larger receptacle which may be located on the floor or supported from the pedestal . as the punched paper tape exits from the punch assembly under the cover 7 , it is permitted to form a short loop and then to enter the reader assembly over the guide 8 and under the cover 9 . the reader guide 8 is arranged to accommodate both 5 level and 8 level tape without change . the paper which exits from the reader assembly may be stored for future use or future reference . in fig1 the lower surface 11 of the reader assembly is displaced vertically upward relative to the lower surface 12 of the remainder of housing . this relief permits the punched paper tape at the exit of the punch assembly to be routed under the reader assembly and to storage without processing by the reader . the assembly 4 in fig1 comprises switches for controlling the punch and reader assembly and associated electronics are not shown in fig2 . fig2 illustrates the principal elements of the punch and reader assembly with the cover 1 removed . paper tape is advanced through the punch and reader assemblies in unison by the corresponding feed wheels in these assemblies . the feed wheels are driven by the drive assemblies 25 and 27 respectively . these drive assemblies operate generally in accordance with the teachings of u . s . pat . no . 3 , 995 , 504 . a general description of the drive assembly will be given later herein with respect to fig3 . the drive assemblies 25 and 27 rely upon the application of periodic motion to rocker plates which form an integal part of each of the assemblies . the periodic motion is provided by the eccentric assembly 24 which is driven by the belt 23 . the motor 21 and the pulley 22 serve to linearly drive the belt 23 . the periodic motion is transmitted from the eccentric assembly 24 to the drive mechanism 25 by means of the arm 29 . the drive mechanism 25 and the drive mechanism 27 are coupled by the link 26 so that substantially identical periodic movement occurs in the two drive mechanisms 25 and 27 . as seen in fig2 the punch assembly , the reader assembly and the common drive motor 21 are all mounted serially in line on a common l shaped plate 13 and this plate is secured to the base of the housing ( not shown in fig2 ) by the flexible mounting 14 . accordingly , proper alignment of the paper tape and of the drive mechanisms is assured while retaining physical vibration isolation between the active assemblies and the housing . fig3 shows the drive assembly 25 of the punch assembly and the eccentric 24 in somewhat greater plan detail . in fig3 there is a rocker plate 41 which is driven by the link 29 . a coil assembly 40 and an associated armature 39 are mounted on the rocker plate 41 , and these serve to effect selective engagement between the armature 39 and the toothed wheel 38 . the magnet coil assembly 40 is activated to disengage the armature 39 from the toothed wheel 38 . timing for the operation of the magnet coil 40 is obtained by a timing wheel ( not shown ) which is coupled to the shaft 33 . the timing wheel generates signals which occur at or near zero velocity of the rocker plate 41 . the toothed wheel 38 is coupled to the shaft 42 and as will be seen with respect to fig6 the shaft 42 is coupled to the feed wheel for engaging the paper tape . the detent 36 is held in engagement with the toothed wheel 38 by the spring 37 . the rocker plate 41 is driven between two extreme limits and the direction of travel of the shaft 42 is determined by the timing of the engagement of the armature 39 with the toothed wheel 38 . if the armature 39 is allowed to engage the toothed wheel 38 at one limit of motion of the rocker plate 41 , the toothed wheel 38 will be driven in a first direction ; and if the armature 39 engages the toothed wheel 38 when the rocker plate is at the second extreme limit there will be motion of the toothed wheel in the opposite direction . the application of the drive mechanism 25 in a practical environment requires tight manufacturing tolerances to assure accurate timing between the timing signals derived from the timing arrangement attached to the shaft 33 and the periodic motion applied to the drive mechanism from the eccentric 24 via the link 29 . in order to compensate for deviations in manufacturing , a novel adjustable eccentric assembly 24 is utilized . the adjustable eccentric is shown in plan detail in fig4 . in fig4 the plate 32 is rigidly fixed to the shaft 33 by a pin or set screw 51 . this plate includes a groove for receiving the drive belt 23 and apertures to receive the locking screw 31 and the adjusting elements 34 and 35 . the link 29 has a circular opening therein which engages the retainer ring 45 of a ball bearing assembly . the further elements of the ball bearing assembly are the balls 47 and the race 48 . the race 48 at the inside thereof engages the body 44 . the lateral position of the body 44 relative to the plate 32 is determined by the rotational position of the element 35 which is secured by the screw 34 . the eccentric assembly 24 of fig3 and 4 is adjusted by loosening the locking screw 31 and the locking screw 34 and rotating the element 35 to obtain the desired lateral relation of the body 44 and the plate 32 . once the desired lateral position has been achieved , the locking screw 34 and locking screw 31 are tightened . as seen in fig4 the nut 46 engages a threaded portion of the eccentric body 44 to secure the ball bearing assembly to the body 44 . fig5 is an edge view of the arrangements of fig4 . fig4 illustrates how the nut 46 secures the race 48 of the ball bearing assembly to the body 44 . fig5 illustrates how the set screw 51 serves to secure the plate 32 to the shaft 33 . additionally , fig5 illustrates how the link 29 is mounted on the outer surface of the retaining ring 45 of the ball bearing assembly . the broken extension of the shaft 33 to the right of fig5 extends into the body of the punch assembly . fig6 illustrates the feed wheel assembly and the manner of achieving lateral adjustment thereof relative to the lateral guide for the paper tape as the tape advances through the punch and reader assemblies . fig6 illustrates the arrangement of the feed wheel assembly in the punch , however , lateral adjustment is achieved in the same manner in the reader assembly . the feed wheel assembly comprises the shaft 42 , spacer 74 ( this maintains clearance between the drive assembly 25 and the side plate 73 ), ball bearing assemblies 65 and 75 , the spacers 68 and 69 , the feed wheel 70 , and the nut 76 . accordingly , the above referenced elements of the feed wheel assembly and drive mechanism e . g . 25 are all held on the shaft 33 in a fixed end - to - end relationship . the ball bearing assemblies 65 and 75 fit snugly within holes in the side plates 61 and 73 , however , the fit is such that the entire assembly may be laterally moved relative to the two side plates . the side plates 61 and 73 are held spaced apart in a fixed relationship by spacers which are not shown . at the right side of fig6 there is shown a spring assembly 71 which is secured to the side plate 73 by the post 72 . the post 72 serves as the support and pivot for the detent 36 which is illustrated in fig3 . the spring 71 is arranged to bear inwardly against the retaining ring of the ball bearing assembly 75 . at the left side of fig6 there is shown an adjusting detail 62 which is secured to the side plate 61 by the screw 64 and is held in a spaced apart relationship from the side plate 61 by the set screw 63 . fig7 is an end view of the paper tape guide assembly for the punch assembly . the guide assembly comprises a cover 7 and a body 28 . the body 28 has two downwardly extending projections 66 and 67 which have a curved surface which corresponds to an arc of the exterior surface of the ball bearing retainer rings 65 , 75 . the length of the arc slightly exceeds half the circumference of the outer surface of the retainer ring of the ball bearing assembly . accordingly , the paper guide body is held in a fixed relationship to the ball bearing assembly and thus to the surface of the feed wheel 70 . as seen in fig6 the body 28 fits snugly between the side plates 61 and 73 and is thus held in fixed lateral relationship to the side plates . the curved surfaces of the body 28 which engage the retainer rings of the ball bearing assemblies 65 , 75 are dimensioned such that the feed wheel assembly may be laterally moved in the same manner that the ball bearing assemblies may be laterally moved through the apertures in the side plates 61 and 73 . in summary , the paper guide body 28 by virtue of the curved surface within the downward depending legs 66 and 67 is held in a fixed relationship with regard to the axis of the shaft 33 and thus with regard to the driving surface of the feed wheel 70 . paper tape which is being processed by a punch assembly is held in engagement with teeth of the feed wheel 70 by the cover 7 and is generally guided through the assembly between the bottom surface of the cover 7 and the upper surface of the body 28 . a pointed tongue 78 protrudes downwardly from the cover 7 to provide a convenient way for removing a section of tape at the exit of the punch assembly . the cover 7 of the paper guide assembly is held in spaced apart relation with the body 28 by the protrusions 77 which extend upwardly from the guiding surface of the body 28 . further details of the feed wheel assembly and paper guide assembly of fig6 and 7 are illustrated in fig8 and 10 . fig8 shows in plan view the arrangement shown at the left side of fig6 ; fig9 shows in plan view the arrangements shown at the right side of fig6 and fig1 specifically shows how the body 28 of the paper guide assembly engages the retaining ring of the ball bearing assembly 65 , 75 . as shown in fig8 and fig1 , the paper feed cover 7 is rotatably movable about a pivot from an open position ( as illustrated in fig8 ) to a closed position ( as illustrated in fig1 ). the cover 7 and the body 28 are arranged such that pin 83 in the cover 7 engage the slot 84 to hold the cover firmly in the closed position illustrated in fig1 . the paper feed assembly body 28 is secured to the punch assembly by the screw 82 which engages a spacer bar 85 . the spacer bar 85 is secured to the side plate 61 by a screw 81 . fig1 illustrates more clearly how the ball bearing assembly 65 is retained in the curved portion of the body 28 to provide a fixed physical relation between the outer surface of the feed wheel 70 and the surface of the body 28 which is utilized to guide the paper tape through the punch assembly . the top view of the paper tape punch assembly shown in fig1 illustrates the tapered paper guide at the entrance to the punch block of the punch assembly , and the relation of the feed wheel 70 and the cover 7 . the chad chute 6 serves to convey chad which is punched from the paper tape as it is processed to a chad receptacle . as seen more clearly in fig1 , the top of the chad chute is open . accordingly , in the event that the chad box becomes filled to capacity , newly generated chad is merely released through the opening at the top of the chute . fig1 illustrates how the chad chute 6 is arranged to fit snugly over the punch block 131 such that the chad is isolated from the remainder of the assembly . fig1 is a cross - sectional view of the chad chute 6 . the internal surfaces of the chad chute are appropriately curved to effect separation of columns of chad to assure their disposal into the chad box 10 . fig1 is a perspective view of a chad box 10 which is employed in the table top version of the combined punch and reader assembly of fig1 . in the event that the combined punch and reader assembly is to be mounted on a pedestal , the chad box of fig1 may be replaced by the chad chute extender 151 shown in fig1 . the chad chute extender has an outward appearance which generally follows the appearance of chad box fig1 . however , the chad chute extender 151 of fig1 has a membrane 152 for directing the chad into the output tube 153 . the output tube 153 is connected to a chad box which may be mounted on the pedestal or alternately on the floor . in fig1 there is illustrated a section of 8 level punch paper tape which illustrates the longitudinally placed feed holes 161 and an illustrative pattern of 8 level codes .	8
[ regarding structure of power supply device 1 according to embodiment of present invention ] as shown in fig1 , a power supply device 1 according to an embodiment of the present invention is configured with a battery protection circuit 2 , a battery 3 , a discharge switch 4 , a charge switch 5 , diodes 6 and 7 , a ground potential line 8 , terminals 9 and 10 , an alarm terminal 11 , and a load 12 or a charger 13 . the power supply device 1 is , for example , configured as a battery pack which includes the battery 3 . a structure of the battery protection circuit 2 is explained later in detail by using fig2 . the battery 3 is , for example , a lithium - ion battery . the battery 3 may be configured with a plurality of cells even through the battery 3 is shown in the figures as a single cell . the discharge switch 4 turns on ( connected )/ off ( disconnected ) power supplied from the battery 3 to the load 12 . the charge switch 5 turns on / off charging current supplied from the charger 13 to the battery 3 . the diode 6 prevents reverse current from flowing from the load 12 to the battery 3 . the diode 7 prevents reverse current from flowing from the battery 3 to the charger 13 . the ground potential line 8 provides “ 0 ” ( v ) internally to the power supply device 1 . the terminals 9 and 10 are connected to either the load 12 or the charger 13 . the alarm terminal 11 outputs an alarm signal from the battery protection circuit 2 . for example , a managing device ( not shown ) of an administrator is connected to the alarm terminal 11 . or , when the load 12 has an input terminal ( not shown ) that receives the alarm signal of the battery protection circuit 2 , the output of the alarm terminal 11 can be connected to the load 12 . note that both the discharge switch 4 and the charge switch 5 are normally in the turned on condition . even though the discharge switch 4 and the charge switch 5 are in the on condition , the reverse current of the discharging current and charging current are blocked by diodes 6 and 7 . the discharge switch 4 and the charge switch 5 are controlled to an off condition by the battery protection circuit 2 at the time of over discharge or overcharge . the battery protection circuit 2 is configured with a voltage measuring part 20 , a control part 21 , a power switch 22 , and a resistor 23 as shown in fig2 . the voltage measuring part 20 measures a voltage value of the battery 3 and outputs a signal to the control part 21 . the control part 21 controls the turning on / off of the charge switch 5 , the turning on / off of the power switch 22 , and the turning on / off of the discharge switch 4 depending on the voltage value output from the voltage measuring part 20 . the control part 21 also controls an alarm output depending on the voltage value output from the voltage measuring part 20 . the power switch 22 turns on / off power supplied to the battery protection circuit 2 . the resistor 23 has an extremely large resistance value compared to a resistance value of the load 12 , and draws only a small part of current that is supplied to the load 12 by the battery 3 into the battery protection circuit 2 . operation of the control part 21 is explained with reference to the flow diagram in fig3 . note that an explanation for charge control is omitted because it is the same as conventional technology , so that discharge control is primarily explained hereafter . start : when the load 12 is connected to the power supply device 1 , power is supplied from the battery 3 to the load 12 . the control part 21 recognizes that the power supply to the load 12 from the battery 3 has started based on a change of a voltage value measured by the voltage measuring part 20 , and shifts to the processing of s 1 . s 1 : the control part 21 determines whether or not the voltage value measured by the voltage measuring part 20 is equal to or less than a threshold value th # 1 . the control part 21 shifts to the processing of s 3 when the voltage value measured by the voltage measuring part 20 is equal to or less than the threshold value th # 1 ( yes at s 1 ). on the other hand , the control part 21 shifts to the processing of s 2 when the voltage value measured by the voltage measuring part 20 is more than the threshold value th # 1 ( no at s 1 ). s 2 : the control part 21 maintains the discharge switch 4 on and returns to the processing of s 1 . s 3 : the control part 21 not only turns the discharge switch 4 off but also outputs an alarm , and then shifts to the processing of s 4 . s 4 : the control part 21 determines whether or not the voltage value measured by the voltage measuring part 20 is equal to or less than the threshold value th # 2 . the control part 21 shifts to the processing of s 5 when the voltage value measured by the voltage measuring part 20 is equal to or less than the threshold value th # 2 ( yes at s 4 ). on the other hand , the control part 21 returns to the processing of s 1 when the voltage value measured by the voltage measuring part 20 is more than the threshold value th # 2 ( no at s 4 ). s 5 : the control part 21 not only turns the charge switch 5 off , but also turns the power switch 22 off , and then ends the processing ( end ). fig4 is an explanatory diagram of two threshold values , th # 1 and th # 2 , of the control part 21 . as shown in fig4 , two threshold values , th # 1 and th # 2 , are provided in the control part 21 with respect to a discharge curve of the battery 3 . for example , when the battery 3 is a lithium - ion battery , a maximum voltage value at the time of a full charge is approximately 4 . 1 v ; the threshold value th # 1 is set at around 2 . 1 v ; and the threshold value th # 2 is set at around 1 . 1 v . as shown in fig4 , when the voltage value of the battery 3 is equal to or less than the threshold value th # 1 , the discharge switch 4 is turned off , and a charge alarm is output to a user . at this time , because the battery protection circuit 2 is being operated , the battery 3 is chargeable by connecting the charger 13 to the terminals 9 and 10 . a period discussed above is referred to as a “ charge alarm period .” in other words , just after completion of a full charge through the end point of the “ charge alarm period ” is referred to as a “ chargeable period .” during the “ charge alarm period ,” when a user does not charge , the voltage value of the battery 3 will be further decreased . when the voltage value of the battery 3 is equal to or less than the threshold value th # 2 in due time , and when there is a possibility that the voltage value becomes to the extent that it might cause degradation of the battery 3 , the control part 21 turns the charge switch 5 and the power switch 22 off to cut the power supply to the control part 21 itself . accordingly , charging to the battery 3 is no longer possible . however , a period until abnormal heating occurs due to completely discharging the battery 3 can be extended compared to the conventional technology ( shown in dashed line form ). the period from time in which the voltage value of the battery 3 is equal to or less than the threshold value th # 2 through the time in which the battery 3 is completely discharged is referred to as a “ complete discharge extending period .” as discussed above , when the discharge condition of the battery 3 is lowered to the voltage value that could cause degradation of the battery 3 , the progress of degradation of the battery 3 can be slowed by cutting off all of the discharge paths of the battery 3 . and , when the period of time from when the voltage value of the battery 3 is equal to or less than the threshold value th # 2 through when the battery 3 is completely discharged is short as the “ conventional technology ” shown with the dashed line in fig4 , a value of the threshold value th # 2 has to be set as a higher value in view of safety . in other words , the threshold value th # 2 is set as 1 . 1 v in the control part 21 ; however , this value is required to be set as a higher value in the conventional technology . in contrast , in the power supply device 1 , because the “ complete discharge extending period ” is longer than the conventional technology , the threshold value th # 2 can be set as a lower value . as a result , the “ charge alarm period ” can be set longer so that the “ chargeable period ” can be set longer with respect to the battery 3 . the embodiments of the present invention can be modified in various ways so long as such variations are not to be regarded as a departure from the sprit and scope of the invention . for example , it is explained that the alarm output is output only at the “ charge alarm period ” shown in fig4 and is stopped at the “ complete discharge extending period .” this is because , at the “ complete discharge extending period ,” the power consumption is required to be none . accordingly , when there are any alarm means in which power is not consumed , the alarm output can be continued since the voltage value of the battery 3 is equal to or less than the threshold value th # 1 . for example , as for the alarm means that does not consume power , an alarm output device with a display content retention type is contemplated . when an input signal is received for a short period of time , magnetic energy occurs on an electromagnet . as a result , the alarm output device mechanically switches the display content “ from normal to alarm ” by moving a piece of iron that is drawn by the magnetic energy as a trigger . moreover , at the processing of si in the flow diagram in fig3 , it is possible to substitute the determination processing of “ the voltage value is less than the threshold value th # 1 ? for “ the voltage value is equal to or less than the threshold value th # 1 ?.” similarly , at the processing of s 4 in the flow diagram in fig3 , it is possible to substitute the determination processing of “ the voltage value is less than the threshold value th # 2 ?” for “ the voltage value is equal to or less than the threshold value th # 2 ?” the battery protection circuit , the method for protecting the battery , the power supply device , and the program being thus described , it will be apparent that the same may be varied in many ways . such variations are not to be regarded as a departure from the sprit and scope of the invention , and all such modifications as would be apparent to one of ordinary skill in the art are intended to be included within the scope of the following claims .	7
fig1 shows an electronic unloader 2 , a multi - circuit protection or control valve 3 , and an air - drier 4 integrated with one another in a common housing 1 . unloader 2 comprises an inlet 5 connected with a compressor , not shown , for providing pressurized air via air line 6 . the inlet 5 opens into a chamber 7 , and is connected with a controlled outlet valve 8 having an outlet 9 to the atmosphere . the controlled outlet valve 8 comprises a valve body 10 , a corresponding valve seat 11 formed on housing 1 , and is supported on a spring 12 . a piston 13 having a control rod 14 is also provided as a part of valve body 10 . piston 13 is provided with a pressure chamber 15 connected to an air line 16 , in which a 3 / 2 - way - solenoid valve 17 is positioned . housing 1 also includes an air - drier 4 from which chamber 7 branches into a pellet chamber 18 , and through which pressurized air flows in the direction of arrow 19 during the load - phase of the compressor . a check valve 20 is located at the end of pellet chamber 18 . the check valve 20 is an element of unloader 2 , and marks its end , within housing 1 . a bypass 21 , having a check valve 22 , is provided for use when the pellet chamber 18 is full of dirt preventing the pass of air . the check valve 22 has the same function as the check valve 20 , but only for emergency conditions , in which pressurized air flows through a coarse filter 23 rather than through pellet chamber 18 . the check valve 20 is a normal check valve , i . e . its valve body is supported on a relatively weak spring ( not illustrated ). check valve 20 opens into an inlet chamber 24 formed as a part of the multi - circuit protection valve 3 . the air line 16 , leading to the solenoid valve 17 and also to the pressure chamber 15 of piston 13 of controlled outlet valve 8 of unloader 2 , is connected with the inlet chamber 24 . an air pressure sensor 25 detects the pressure in air line 16 and thus in the inlet chamber 24 . the multi - circuit protection valve 3 of fig1 is designed for several pneumatic circuits . each circuit has a branch line 26 leading to a connection 27 on the housing 1 , and from here to an air line 28 ending in an air reservoir 29 for each circuit . a control and monitor unit 30 is provided for each circuit , comprising an overflow valve 31 in air line 26 . the overflow valve 31 has a membrane formed as the valve body , received on a valve seat 32 formed on housing 1 , and supported on a spring 33 . the spring 33 is located in a pressure chamber 34 connected to the inlet chamber 24 via a control line 36 , in which a solenoid valve 35 is arranged . solenoid valve 35 is a 3 / 2 - way - solenoid valve , i . e . it has 3 connections and 2 positions . one of the connections is an outlet 37 connected with a line 38 leading to the atmosphere . the solenoid valve 35 of fig1 is shown in the non - excited state , in which the outlet 37 is closed and the pressure of the inlet chamber 24 is in the pressure chamber 34 . thus , the overflow valve 31 is held closed , its membrane being loaded with the same air pressure on both sides , and where one side of the membrane the spring 33 acts additionally . a pressure sensor 40 with air line 39 is provided to detect the pressure downstream of the overflow valve 31 , and thus in the air reservoir 29 . an air line 41 is positioned in parallel to air line 26 , air line 41 also leading from the inlet chamber 24 to the connection 27 . a check valve 42 is located in air line 41 in the direction shown , the valve body of which is supported on a spring 43 . spring 43 is a relatively strong spring adapted to an opening pressure of 7 bar , for instance , thus acting as a safety valve in addition to being a check valve also . in case of air pressure failure , emergency air service for the vehicle can thus be maintained during driving . as illustrated in fig1 - 6 the above described elements are arranged in four separate air circuits . the numbered elements of the second circuit are indicated by one stroke , for example the control and monitor unit 30 &# 39 ; of circuit ii . the numbered elements of the third circuit show two strokes , and the numbered elements of the fourth circuit show 3 strokes . thus , four circuits are provided , circuits i and ii being the service brake circuits , circuit iii being adopted to the secondary braking system , and circuit iv is provided for further pneumatic devices . these four circuits are positioned in housing 1 parallel to one another , each circuit being similarly designed and equipped . in addition , housing 1 includes a connection 44 and an air line 45 leading to an air reservoir 47 via an overflow valve 46 . the bellows of an air suspension system of the vehicle may be connected to reservoir 47 , for example . in this circuit , essentially a fifth circuit , there is no control line 36 , no overflow valve 31 , and no control and monitor unit 30 . reservoir 47 is directly loaded by the compressor . an air line 48 leads from inlet chamber 24 to a solenoid valve 49 having an exhaust opening 50 , to which , in the non - excited state of the solenoid valve 49 , air line 38 is connected . the regeneration phase of the air - drier 4 is controlled via this solenoid valve . if solenoid valve 49 is excited , exhaust opening 50 is closed and the air under pressure in reservoir 47 flows backwards through the pellet chamber 18 via air lines 48 and 38 , and a check valve 51 , and thus removes the humidity from the pellets in the pellet chamber 18 . in this regeneration phase of the air - drier 4 , the solenoid valve 17 is excited by an electronic control unit 52 , and outlet valve 8 is opened so that the compressor ( not illustrated ) pumps its air to the atmosphere , i . e . non - load condition . the electronic control unit 52 , shown schematically in fig1 controls the solenoid valve 17 of the electronic unloader 2 and the solenoid valves 35 , 35 &# 39 ;, 35 &# 34 ;, 35 &# 34 ;&# 39 ; and 49 of the multi - circuit protection valve 3 . control unit 52 is connected with a monitor unit 54 via an electric line 53 . the monitor unit 54 will typically be placed in the cab of the vehicle on which the unloader is used . the pressure sensors 25 , 40 , 40 &# 39 ;, 40 &# 34 ; and 40 &# 34 ;&# 39 ; transform air pressure into voltage , i . e . an appropriate electrical signal , so the pressures can be indicated in the cab on the monitor unit 54 . each control and monitor unit 30 , 30 &# 39 ;, 30 &# 34 ;, 30 &# 34 ;&# 39 ;, and each solenoid valve 17 , 35 , 35 &# 39 ;, 35 &# 34 ;, 35 &# 34 ;&# 39 ;, and 49 is separately controlled . this allows for the possibility of setting reduced air pressures in the individual circuits in a very simple manner . the reduction in air pressure depends only on the exciting of the solenoid valve , which is controlled by the respective pressure sensors . the embodiment of the unloader shown in fig2 is designed in a manner similar to the embodiment of fig1 . only the control and monitor units 30 , 30 &# 39 ;, 30 &# 34 ;, 30 &# 34 ;&# 39 ; are modified . the overflow valves 31 , 31 &# 39 ;, 31 &# 34 ;, and 31 &# 34 ;&# 39 ; are integrated with the check valves 42 , 42 &# 39 ;, 42 &# 34 ;, and 42 &# 34 ;&# 39 ;. similar to the design of piston 13 and control bar 14 of the unloader , there are provided pistons 55 , 55 &# 39 ;, 55 &# 34 ;, and 55 &# 34 ;&# 39 ;, having control rods 56 , 56 &# 39 ;, 56 &# 34 ;, and 56 &# 34 ;&# 39 ;. the solenoid valves 35 - 35 &# 34 ;&# 39 ; in the air lines 36 - 36 &# 34 ;&# 39 ; are closed when not excited , as shown , and thus the pressure chambers 34 - 34 &# 34 ;&# 39 ; are vented to the atmosphere via air line 38 . the controlled outlet valves 31 , 42 - 31 &# 34 ;&# 39 ;, 42 &# 34 ;&# 39 ; are thus closed . the valve bodies of the check valves 42 - 42 &# 34 ;&# 39 ; are loaded with the pressure of each air reservoir , respectively , and the force of spring 43 - 43 &# 34 ;&# 39 ; also . if there is an air consumption in one circuit and the air pressure decreases , this will be detected by the pressure sensor 40 - 40 &# 34 ;&# 39 ;, the exciting of the respective solenoid valve being controlled by the control unit 52 . the respective air circuit will be filled with pressurized air via the opened check valve . a separate reverse line 57 is provided connecting the chambers on the rod side of the pistons 55 - 55 &# 34 ;&# 39 ;, over which air flows backward in the regeneration phase of the air - drier , but which normally has the function of exhausting the chambers on the rod side of the pistons . the elements of the electronic unloader 2 and of the multi - circuit protection valve 3 are designed in a similar manner . here connection 9 leads to the atmosphere . the connections 27 - 27 &# 34 ;&# 39 ; are connected to the reservoirs 29 - 29 &# 34 ;&# 39 ; respectively . in the unloader 2 of fig2 each air circuit and the unloader 2 are also separately controlled by the common electronic control unit 52 . third embodiment of the unloader is illustrated in fig3 with the modification of only four solenoid valves 35 , 35 &# 34 ;, 35 iv , and 49 belonging to the multi - circuit protection valve 3 . the first two brake circuits with their connections 27 and 27 &# 39 ; are commonly controlled via the solenoid valve 35 . the two remaining circuits with their connections 27 &# 34 ; and 27 &# 34 ;&# 39 ; are commonly controlled via the solenoid valve 35 &# 34 ;. a humidity sensor 58 is connected with the inlet chamber 24 , the humidity sensor controlling the regeneration phase of the air - drier 4 . regeneration takes place when the drying effect of the air - drier is no longer sufficient . a pressure sensor 59 is connected with the chamber 7 via an air line 60 , detecting the flow resistance of the air - drier 4 by the common electronic control unit 52 . the reservoir 47 of the air suspension of the vehicle may be connected with connection 27 iv . thus , an overflow valve 46 ( fig1 ) is formed in a similar manner as in the preceding circuits , and this overflow valve is arranged in the housing 1 of the unloader 2 . in the embodiment of the unloader 2 and integrated multi - circuit protection valve 3 shown in fig4 air - drier 4 is omitted . only two circuits are realized . it is the intention of the drawing to show the analogous elements of the unloader 2 and of the multi - circuit protection valve 3 side by side to illustrate the same design . the chamber 7 is only separated from the inlet chamber 24 by the check valve 20 . of course , it is possible to provide more than two circuits in this manner . controlling of the unloader is done with common electronic control unit 52 , which can be programmed depending on the special conditions and desires of the operator , for example priority charging , pressure reduction , or the like . fig5 is a partial detailed view of the combined unloader / air - drier / multi - circuit protection valve . this is a modification of the embodiments of fig2 or 3 . a safety valve 61 - 61 &# 34 ;&# 39 ;, opening into the atmosphere , is positioned downstream of each check valve 42 - 42 &# 34 ;&# 39 ;, except for check valve 42 iv . in this fifth circuit , normally connected with the air suspension system of the vehicle , a separate safety valve is not needed because here this function is effected by the outlet valve 8 . the arrangement of the safety valves 61 , 61 &# 39 ;, 61 &# 34 ; and 61 &# 34 ;&# 39 ; is necessary only in those cases in which different pressures have to be maintained in the circuits i to iv . for example , circuits i and ii may be provided for service pressures of 10 bar , and circuits iii and iv for 8 . 5 bar . the air suspension circuit v may need 12 . 5 bar and the outlet valve 8 may be adjusted to 13 . 5 bar . in this case , the safety valves 61 and 61 &# 39 ; are adjusted to 11 bar and the safety valves 61 &# 34 ; and 61 &# 34 ;&# 39 ; to about 9 . 5 bar . a further detail illustrated in fig5 . is the provision of throttle 62 in connection 27 iv , arranged parallel to the check valve 42 iv . there is permanent connection through the throttle 62 between inlet chamber 24 , with its relatively small volume , to the air suspension circuit , with its comparatively large volume . when the compressor is running idle and there is air consumption in a circuit , the pressure in the inlet chamber 24 , having the enlarged volume by the connection via the throttle 62 to the suspension circuit , advantageously decrease not sufficiently to switch the compressor to the loading phase . without the throttle 62 the volume of inlet chamber 24 is relatively small and an air consumption in a circuit immediately effects a decrease of pressure in the small inlet chamber under the switching point of the unloader . as a result the compressor is switched on and off by the unloader in a very rapid cycle making the noise of a machine gun and not working proper . but with the throttle 62 , at all times air exchange is possible through throttle 62 . the advantage of this possible air exchange is , that the cycle in which the compressor loads the reservoirs and in which the compressor is running idle , i . e . the duration of the loading phase and the duration of the idle phase , is extended . the embodiment of the unloader apparatus shown in fig6 is a modification of the embodiments shown in fig2 or 3 , dealing with the regeneration phase . a 3 / 2 - way - valve 63 , having a stepped piston 64 sealingly and slidingly arranged in the housing , is controlled by the solenoid valve 49 . the stepped piston 64 is biased with air under pressure on its large surface via the solenoid valve 49 . its piston rod cooperates with the valve body 65 suspended in the manner shown in inlet chamber 24 , forming an inlet valve for air under pressure from inlet chamber 24 to the reverse line 57 . a sufficiently large cross section may be provided by designing the gap between the piston rod and the opening in the housing . this cross section is larger than the cross section of the solenoid valve 49 . in the regeneration phase the large volume of the suspension circuit , in connection with the enlarged cross section between the piston rod and the opening in the housing , is used to shorten the duration of the regeneration phase . this regeneration phase is controlled by the electronic control unit 52 , especially via the humidity sensor 58 shown in fig3 .	8
the construction and operation of the present are described with reference to fig1 below . a created scenario should be coded in a computer - understandable language . for makeup languages for writing voice notice scenarios , there are a variety of markup languages , including voice extensible markup language ( voicexml ), speech application language tag ( salt ), call control extensible markup language ( ccxml ), speech synthesis markup language ( ssml ) and speech recognition grammar specification ( srgs ). each of the markup languages has unique features . for example , voicexml is most widely used . ssml is capable of assigning a gender and an age for voice when a scenario is reproduced in tts , so that scenarios can be reproduced in various voices suitable for genders and ages through the use of ssml . ccxml has a function of calling a plurality of persons and delaying a conference between the plurality of persons . srgs has a semantic interpretation function that , for example , can know “ the place ” to be “ seoul ” in the case where a customer says “ seoul ” previously and says “ the place ” later during the conversation between an ars server and the customer . hereinafter , the present invention is described based on the case where voicexml is employed as a representative markup language . a relay service company 2 groups user companies 1 , creates lists of basic notice messages suitable for respective groups , and stores each list of basic notice messages in the database ( db ) 3 of the website thereof with respect to each of the groups . additionally , scenarios corresponding to respective notice messages are stored in the db 3 . each of the user companies 1 accesses the website of the relay service company 2 , contracts for ars voice notice , selects an appropriate group , reviews a list of basic notice messages prepared for the group , and select one ( for example , a notice message for a demand for payment ) from the list of basic notice messages . thereafter , a scenario ( for example , “ hi ! mr . a . your current balance is b us dollars ”) corresponding to the selected notice message is retrieved from the db 3 and , then , transmitted to the user company 1 , and the scenario is settled if the user company accepts the scenario . if the appropriate notice message does not exist in the list of basic notice messages , or a corresponding scenario needs to be modified , the user company 2 creates basic data for a desired notice message and provides the basic data to the relay service company 2 . the relay service company 2 having received the basic data prepares a scenario based on the basic data , and obtains the user company &# 39 ; s consent to the scenario . if the scenario , for which consent is obtained from the user company , is achieved and the scenario has the content “ hi ! mr . a . your current balance is b us dollars ,” the user company 1 transmits data ( a : name , and b : balance ) corresponding to changeable parts and phone number data ( c : phone number ), which are previously created and stored in the db 4 of the user company 1 , to the relay service company 2 at step s 1 . the relay service company 2 having received the constant parts of the scenario , a list of data a and b for the changeable parts of the scenario and a list of phone number data c creates voicexml code based on the list of data a and b , the list of phone number data c , and the settled scenario . the voicexml code created as described above is transmitted to the communication network company 5 via the internet or a dedicated line at step s 2 . the communication network company 5 interprets the voicexml code transmitted from the relay service company 2 because it is provided with a voicexml interpretation server 6 , dials the phone number c of a customer using the transmitted data a , b and c , and performs ars voice notice using tts , asr and dual tone multi - frequency ( dtmf ; which allows the customer 7 to make inputs to the ars voice notice system ) at step s 3 . the communication network company 5 having performed the ars voice notice hands over the results of the ars voice notice ( for example , the numbers of successful calls and unsuccessful calls , or the results of a questionnaire ) to the relay service company 2 at step s 4 . the relay service company 2 transmits the results of the ars voice notice to the user company 1 , bills the user company 1 for the results at step 5 , or uses the results of the ars voice notice as information for improvement in work . in particular , when the customer 7 wants to call the call center of the user company 1 while the server of the communication network company 5 is performing ars voice notice or finishes ars voice notice , the communication network company 5 may call the call center of the user company 1 via another line and make the customer be connected to the call center . with the above - described scheme , the user company 1 can perform ars voice notice at low costs based on a contract with the relay service company 2 , so that high costs required for each user company to construct and maintain an ars voice notice system can be reduced . furthermore , since voicexml is used , the relay service company 2 can easily modify voicexml code according to the change of a scenario and a variety of services can be provided through the above - described various functions of voicexml . meanwhile , although the user company 1 has been described as contracting for relay service and performing the selection of a scenario and the provision of related information while accessing the website of the relay service company 2 on - line via the internet , some or all of the service contact , the selection of the scenario and the provision of related information can be handled in an off - line manner , such as through a direct visit . in the meantime , there can be used the method in which a dedicated program , which includes a list of basic notice messages and a list of scenarios and software connecting the user company 1 to the relay service company 2 via the internet , is installed in the computer of the user company 1 , the program is made to run , a notice message and a scenario are selected or created , data on changeable parts and the name of a file including phone numbers are input , the user company 1 is allowed to access the relay service company 2 , and the above - described data are transmitted to the relay service company 2 . meanwhile , in the present invention using voicexml , for the constant parts , tts is made not to be used by using a previously recorded file . alternatively , for the constant parts , tts is made to be used by inputting data in text in the same way as for the changeable parts . although the preferred embodiment of the present invention has been disclosed , the present invention is not limited to this embodiment , but it should be noted that various modifications are possible without departing from the spirit of the invention as disclosed above . for example , although voicexml has been described as being used as a representative markup language , a scenario can be constructed by using voicexml together with ssml , ccxml and srgs . for example , if the scenario “ press buttons 1 , 2 and 3 if you want the oral narration of a fairy tale , hotel reservation and a telephone conference , respectively ” that is written in voicexml exists during ars voice notice , the relay service company 2 may prepare a scenario related to the narration of a fairy tale in ssml , a scenario related to the hotel reservation in srgs , and a scenario related to the telephone conference in ccxml . the communication network company 5 has an ssml interpretation server , an srgs interpretation server and a ccxml interpretation server , together with a voicexml interpretation server . accordingly , when the scenario is transmitted to the relay service company 5 , a voicexml code corresponding to the scenario “ press buttons 1 , 2 and 3 if you want the oral narration of a fairy tale , hotel reservation and a telephone conference , respectively ” is interpreted by the voicexml server , a customer is called and a ars voice notice corresponding to this scenario is performed . if a customer having listened to the ars voice notice presses button 1 , the scenario prepared in ssml is interpreted by the ssml interpretation server and the fairy tale is narrated . if the customer presses button 2 , the scenario prepared in srgs is interpreted by the srgs interpretation server and the hotel reservation is performed . if the customer presses button 3 , the scenario prepared in ccxml is interpreted by the ccxml interpretation server and the telephone conference is performed . as described above , in accordance with the present invention , respective user companies 1 can perform ars voice notice based on contacts with the relay service company 2 , so that mass costs required to construct and maintain respective ars voice notice systems can be reduced .	7
it is to be understood that the figures and descriptions of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the present invention , while eliminating , for purposes of clarity , many other elements which are conventional in this art . those of ordinary skill in the art will recognize that other elements are desirable for implementing the present invention . however , because such elements are well known in the art , and because they do not facilitate a better understanding of the present invention , a discussion of such elements is not provided herein . the present invention will now be described in detail on the basis of exemplary embodiments . fig1 shows a schematic block circuit diagram of a headphone or a headset according to a first embodiment . the earpiece or the headset has an audio input 110 for receiving an audio signal to be reproduced , a rectifier unit 120 for rectifying the audio signal received by way of the audio input 110 , a dc / dc converter unit 130 , an audio unit 140 , at least one electroacoustic reproduction transducer 150 , an power control unit 160 , an power storage unit 170 and an electronic unit 180 . the audio signal can be output by an external audio source 200 ( for example a media player , a smartphone etc ). the audio signal which is to be reproduced and which is produced or output by the external audio source 200 represents an audio signal substantially without direct component dc . that audio signal can optionally have no bias but can represent a normal audio signal to be reproduced . the rectifier 120 converts the audio signal at the audio input 110 from the external audio source 200 into a dc signal . the output signal of the rectifier 120 can be converted to a higher or lower level by the dc / dc converter 130 . the audio unit 140 can effect audio signal processing , for example active noise cancellation , and the corresponding signal can be output by way of the electroacoustic reproduction transducer 150 . as the input signal the power control unit 160 has the voltage value of the audio signal and / or the current value of the audio signal and optionally the voltage value of the power storage means 170 . the power control unit 160 can output as its output signal a control signal to the unit 180 or to the audio unit 140 and can control the functioning of the electronic unit 180 or the audio unit 140 . according to the first embodiment power is extracted from the input audio signal by means of the rectifier unit 150 and / or the dc / dc converter 130 and the extracted power can be put into intermediate storage in the power storage unit 170 or used for the power supply to the audio unit 140 , the power control unit 160 and / or the electronic unit 180 . if it should not be possible to extract sufficient power from the input audio signal then components of the electronic unit 180 and / or the audio unit 140 can be at least temporarily deactivated . for that purpose the power control unit 160 can be coupled to the audio unit 140 to be able to establish whether the audio unit 140 is receiving sufficient power from the audio signal to be able to suitably reproduce the audio signal on the electroacoustic reproduction transducer 150 , to be able to effect active noise cancellation or to be able to effect other audio signal processing . according to the invention the dc / dc converter 130 can use the power from the power storage unit 170 to supply an electronic system of the earpiece with a suitable voltage . according to the invention the dc / dc converter 130 is so controlled that the input resistance r l is kept substantially constant . power adaptation can be achieved by means of a variation in the input resistance for example by voltage maximization . it is possible in that way to provide for improved adaptation to the audio source . the dc / dc converter 130 also serves to feed the power storage unit 170 . according to the invention the power which can be used for the system is proportional to the voltage u q1 , wherein the voltage is controlled at the power storage unit by the power control unit . thus the efficiency of the earpiece or the headset can be improved in comparison with the state of the art which uses a linear regulator or a linear amplifier . by virtue of the fact that a part of the power required for the earpiece or the headset is not extracted from a power storage means in the earpiece / headset , for example in the form of a battery or an accumulator , but is extracted from the input audio signal the power storage means ( the battery / accumulator ) can be dispensed with or at least the service life thereof is considerably increased . fig2 shows a schematic block circuit diagram of an earpiece or a headset according to a second embodiment . the earpiece or the headset 100 has a first dc / dc converter 121 connected to an external voltage supply 300 by way of a connection 111 , wherein the external voltage supply represents a microphone feed voltage or a feed voltage of a mobile device . the first dc / dc converter 121 converts the input voltage into an output voltage which can be higher or lower than the input voltage . a second dc / dc converter 130 is coupled to the first dc / dc converter 121 . the second dc / dc converter 130 serves to supply the audio unit 140 which for example can have an active noise cancellation unit or another audio processing unit with a suitable ( for example constant ) output voltage . the first dc / dc converter 121 can serve to feed the storage unit 170 . the storage unit 170 can be for example in the form of a capacitor , for example an ultra - cap . the earpiece or the headset according to the second embodiment further has a first microphone 191 and a second microphone 192 . the first microphone 191 serves as a microphone for active noise cancellation and the second microphone 192 can be in the form of a boom microphone supplied with a microphone feed voltage by way of the input 111 . the earpiece or the headset further has a power control unit 160 which provides for voltage monitoring of the storage unit 170 . the power control unit 160 can optionally also be adapted to limit the operation of the audio unit or the electronic unit 180 if there is not sufficient power in the storage unit 170 . for example the level of active noise cancellation can be reduced to reduce the power consumption . if however the storage unit 170 has for example a very great deal of power then that power can be used for example for the electronic unit 180 . the first dc / dc converter 121 has for the target parameter a variable microphone voltage as a reference in order thus to achieve a voltage - dependent load resistance together with the first dc / dc converter . according to the second embodiment a maximum possible amount of power can be extracted from the microphone feed for the boom microphone 192 by the first converter unit 121 . the power which can be used for the earpiece or the headset is proportional to the voltage at the storage unit 170 . the advantages of the earpiece or the headset according to the second embodiment correspond to the advantages of the earpiece or the headset of the first embodiment . depending on the audio source involved a differing amount of energy can be extracted from the audio signal . an aviation microphone connection provides for example a voltage of between 8 and 16 v with an output resistance of 470 ohms , that is to say the connection can provide at least 60 mw . an analog audio stereo signal with a 32 ohm load can provide 1 vrms , that is to say a power of 62 . 5 mw . a microphone connection on a cellular phone or a mobile device can provide for example 3 . 3 v with an output resistance of 1 kohm , that is to say the mobile device can provide 5 mw . an analog audio stereo signal with a load of 8 ohms can provide a voltage of 150 mvrms and a power of 5 . 6 mw . optionally an ultra - cap can be used as the power storage means . according to the invention between 0 and 100 % of the power from the audio signal can be at least partly fed to the power storage means . while this invention has been described in conjunction with the specific embodiments outlined above , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , the preferred embodiments of the invention as set forth above are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the inventions as defined in the following claims .	7
the present invention , the conversion and coking method and product is comprised of several components . such components in their broadest context include blending or mixing the components , heating the blended components and cooling the heated components . more specifically , the present invention is a conversion and coking method for converting used or waste tires to a coke product , a clean burning fuel which may be used by utilities and other industrial applications . the conversion is done by driving off the volatile matter contained in the tire rubber . the first step is to obtain a quantity of ground tire rubber . although the process would work on non ground rubber , having the rubber ground into pieces makes it easier to apply and obtain a coverage of the tire rubber with chemical change agent and motor oil as further explained in the foregoing steps . the next step is providing a quantity of chemical change agent . such agent is selected from the class of chemical change agents including : ( a ) sodium silicate ( b ) national 33 - 9012 starch , commercially available from the national starch and chemical company ( c ) national 13 - 2216 starch , commercially available from the national starch and chemical company . it should be noted that other chemicals containing sodium will also make the reaction work in varying degrees . the quantity of the chemical change agent to be used also varies depending on the factors of 1 ) the quantity of tire rubber which is to be converted and 2 ) the chemical change agent chosen to perform the conversion . the greater the quantity of rubber to be converted , the more chemical change agent that will be needed to perform the conversion . generally , it takes three ( 3 ) times as much starch to perform the reaction as sodium silicate . next is the step of mixing the chemical change agents with motor oil in preparation for blending or mixing with the ground tire rubber . while motor oil is suggested because it will enhance the baking process , other oils would also serve to allow the reaction to occur . the quantity of the motor oil to be used would also vary depending on the quantity of tire rubber to be converted . the mixing should be done to obtain a substantial and general and complete coverage of the ground tire rubber . thereafter , the method includes the step of blending or mixing the provided quantity of ground tire rubber and chemical agent . such blending is preferably in a ratio of about 1 ton of ground tire rubber plus or minus ten percent , about 25 gallons of oil plus or minus ten percent , and about ½ gallon to 4 gallons of sodium silicate plus or minus ten percent or 1½ gallons to 12 gallons of starch plus or minus ten percent to obtain a substantial and general coverage of the material . the next step is then baking the mixture in a reducing , heated , oxygen - free environment , including a heating element , at a temperature of about 1 , 400 to 1 , 850 degrees fahrenheit for a period of time of 3 to 4 hours . lastly is the step of cooling the resultant baked product by air or with a water quench . the invention also includes the coke product formed by the method as described herein above . there are various typical examples of the method steps of the present invention . 16 cups ( approximately ten ( 10 ) pounds ) of ground tire rubber , and a mixture of 2 ounces of sodium silicate and ½ gallon of motor oil as required to obtain a substantial and general and complete coverage of the ground tire rubber . the mixture was heated in a reducing environment for approximately 3 to 4 hours at 1 , 400 degrees fahrenheit then air cooled . the resulting product was porous coke having the following analysis : 16 cups ( approximately ten ( 10 ) pounds ) of ground tire rubber , and a mixture of 6 ounces of national 33 - 9012 starch and ½ gallon of motor oil as required to obtain a substantial coverage of the ground tire rubber . the mixture was heated in a reducing environment for approximately 3 to 4 hours at 1 , 400 degrees fahrenheit then air cooled . the resulting product was porous coke having the following analysis : as to the manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	2
the rate of release of danazol from the present preparations will be described hereinbelow . the rate of release was tested in two different ways , i . e ., by in vitro tests and by clinical tests . a number of preparations made in accordance with the present invention were each suspended in 2 to 3 liters of distilled water and held at 37 ° c . for 8 to 44 days with stirring of the water . the amount of danazol released into the water per day was determined by liquid gas chromatography . during the test period , the distilled water was replaced every day . the amount of danazol released per day was about 250 to 400 μg for intrauterine preparations and about 1000 to 3000 μg for vaginal preparations . a number of preparations made in accordance with the present invention were each inserted into the uterus or vagina of 50 patients with endometriosis , aged 28 to 39 , and retained therein for 2 to 30 weeks . the amount of release of danazol per day was determined by calculating the difference between the danazol contents of the preparation at the beginning and the end of the insertion , and dividing it by the number of days of insertion . the danazol content of each preparation was determined by extracting the preparation with chloroform and measuring the amount of danazol present in the extract by absorption photometry . the amount of danazol released per day was about 150 to 300 μg for intrauterine preparations and about 900 to 3000 μg for vaginal preparations . ( i ) a vessel placed in a clean bench was charged with 20 g of danazol , 75 g of silastic 382 and 5 g of polysorbate 80 . after the addition of 1 . 2 g of a tin catalyst , these ingredients were mixed at room temperature for 20 minutes . the resulting mixture was poured into three types of molds and solidified by allowing the molds to stand at room temperature for one day . thus , there were obtained a total of 6 single - layer annular vaginal preparations as described below , two for each type . ( ii ) the same procedure as described in paragraph ( i ) above was repeated , except that the amount of danazol was increased from 20 g to 30 g , the amount of silastic 382 was decreased from 75 g to 70 g , and the addition of polysorbate 80 was omitted . thus , there were obtained a total of 6 single - layer annular vaginal preparations as described below , two for each type . using a mixture composed of 55 g of mdx - 4 - 4210 ( containing a cross - linking agent ) and 0 . 5 g of a platinum catalyst , core rings having an outer diameter of 48 . 5 mm and a thickness of 5 . 5 mm were prepared in advance . thus , 15 g of danazol , 38 . 5 g of mdx - 4 - 4210 ( containing a cross - linking agent ) and 0 . 35 g of a platinum catalyst were mixed at room temperature for 30 minutes . the resulting mixture was poured into molds and the previously prepared core rings were embedded therein . the mixture was solidified by allowing the molds to stand at room temperature for one day . thus , there were obtained 6 two - layer annular vaginal preparations as described below . these preparations had an outer layer of 2 . 0 mm thickness . ( i ) in a vessel placed in a clean bench , 3 . 00 g of danazol , 11 . 25 g of silastic 382 and 0 . 5 g of polysorbate 80 were mixed . after the addition of 0 . 18 g of a tin catalyst , the mixing was continued for 15 minutes . the resulting mixture was poured into molds and solidified by allowing the molds to stand at room temperature for one day . thus , there were obtained 20 single - layer t - shaped intrauterine preparations as described below . a nylon monofilament was attached when the mixture was poured into each mold . ( ii ) the same procedure as described in paragraph ( i ) above was repeated , except that the amount of danazol was increased from 3 . 00 g to 4 . 5 g , the amount of silastic 382 was decreased from 11 . 25 g to 10 . 5 g , and the addition of polysorbate 80 was omitted . thus , there were obtained 20 single - layer t - shaped intrauterine preparations as described below . ( iii ) the same procedure as described in paragraph ( ii ) above was repeated , except that a core comprising a piece of silascon rod having a length of 20 mm and a diameter of 1 . 6 mm was embedded in the mixture poured into each mold . thus , there were obtained 20 two - layer t - shaped intrauterine preparations as described below . 1 . 5 g of danazol , 3 . 5 g of silastic 382 and an appropriate amount of a tin catalyst were mixed at room temperature for 10 minutes . the resulting mixture was poured into molds in which a core ring comprising a ring of silascon rod having an outer diameter of 20 . 5 mm and a thickness of 1 . 6 mm was placed . the mixture was solidified by allowing the molds to stand for one day . thus , there were obtained 10 two - layer ota &# 39 ; s ring - like intrauterine preparations as described below . the effects of the present preparations on endometriosis will be more fully described hereinbelow . the description will be separately given with respect to cases of pelvic endometriosis ( external endometriosis ) and cases of adenomyosis ( internal endometriosis ). in 46 patients , aged 28 - 37 , who had been diagnosed as cases of pelvic endometriosis , a vaginal preparation made in the same manner described in example 1 was inserted into the vagina for purposes of treatment . these 46 cases included 32 cases in which oral administration of danazol had been found to be ineffective . the period of treatment was up to 30 weeks and the site of insertion of the preparation was around the opening of the uterus . in all of the 46 cases , a marked decrease of endometriosis tissue in the uterine cul - de - sac was noted . specifically , in 12 cases in which the size ( or area ) of the tissue was 10 - 12 cm 2 at the start of the treatment , it was reduced to 2 - 3 cm 2 in the 2nd week . similarly , 31 cases showed a reduction from 6 - 8 cm 2 to 0 . 5 - 3 cm 2 in the 4th to 8th week , and 1 case showed a reduction from 3 cm 2 to 1 cm 2 in the 4th week . in the 12th to 17th weeks , the size of the tissue was reduced to 0 - 0 . 5 cm 2 in all of these 44 cases . in the other 2 cases ( in which the size of the tissue was 8 cm 2 or 6 cm 2 at the start of the treatment ), the size of endometriosis tissue in the cul - de - sac was not reduced to 0 . 5 cm 2 or less by the 12th to 17th week . the reason why no improvement was observed in these cases seems to be that , since they had adhesive retroflexion of the uterus due to endometriosis in the cul - de - sac and the treatment brought about shrinkage and softening of the endometriosis tissue , the fundus of the uterus could be directly touched by bimanual examination , resulting in an increased volume of palpable tissue . the degree of effectiveness was 100 %. an improvement of tenderness in the cul - de - sac was noted in all of the 46 cases . a complete cure was achieved in 33 cases , and the average time required for the complete cure was 17 . 2 weeks . in the other 13 cases , the tenderness was not completely cured , but ameliorated . in one case observed for 17 weeks , pregnancy resulted from homologous artificial insemination ( aih ). the degree of effectiveness was 100 %. menstrual pain was completely cured in 32 out of the 46 cases and ameliorated in 11 cases . the average time required for the amelioration of pain was 5 . 3 weeks and the average time required for the complete disappearance of pain was 14 . 3 weeks . the degree of effectiveness was 93 . 5 %. ( 4 ) effect on non - menstrual pain in the lower abdomen or loins . of the 46 cases , 20 complained of non - menstrual pain in the lower abdomen or loins at the start of the treatment . in all of these cases , the pain disappeared in an average of 6 . 7 weeks . the other 26 cases did not complain of such pain at the start of the treatment . the degree of effectiveness was 100 %. of the 46 cases , 11 became pregnant during insertion of the vaginal preparation of the present invention . the pregnancy resulted from sexual intercourse in 10 cases and from homologous artificial insemination in the other one . it is quite surprising that , in contrast to oral administration of danazol during which the patient never becomes pregnant , the vaginal preparations of the present invention allowed the patient to become pregnant even during treatment . in consideration of the above - described results and the fact that these patients had failed to conceive for the past several years , it is evident that ( 1 ) the patients being treated with the present preparations are not only able to conceive , but more likely to conceive than before treatment and ( 2 ) even during treatment , ovulation is not suppressed and spermatozoa are not prevented from passing through the cervical mucus . the degree of effectiveness was 24 %. just after confirming the establishment of pregnancy , the vaginal ring was removed . they all delivered normal babies with no congenital anomaly . in all of the 46 cases , neither suppression of ovulation nor decrease in blood fsh or lh was noted during treatment . moreover , the present preparations did not show such side effects as are encountered in the oral administration of danazol , including a weight gain , an aggravation of acne , an increase of got and gpt , and the like . in 4 patients , aged 34 - 39 , who had been diagnosed as cases of uterine adenomyosis , an intrauterine preparation made in the same manner described in example 3 was inserted into the uterus for purposes of treatment . these 4 cases included one case in which oral administration of danazol had been found to be ineffective . the period of treatment was up to 4 months and the site of insertion of the preparation was within the uterus . in all of the 4 cases , a marked reduction in size of the corpus of the uterus was noted . the length of time required for the onset of shrinkage of the corpus of the uterus was within 2 weeks in all cases . the degree of effectiveness was 100 %. in all of the 4 cases , an amelioration of menstrual pain was noted in an average of 7 weeks after the start of the treatment . of these case , 3 were completely cured ( i . e ., the pain disappeared completely ) in an average of 14 . 6 weeks . the degree of effectiveness was 100 %. ( 3 ) effect on non - menstrual pain in the lower abdomen or loins at the start of the treatment , 3 out of the 4 cases complained of non - menstrual pain in the lower abdomen or loins . in all of these 3 cases , the pain disappeared in an average of 6 . 6 weeks . the degree of effectiveness was 100 %. of the 4 cases , 2 became pregnant immediately after removal of the intrauterine preparation of the present invention . the degree of effectiveness was 50 %. as described above , the present preparations are more effective than oral administration of danazol in the shrinkage of endometriosis tissue , the induction of pregnancy , and the like . moreover , they do not show any side effects that have been encountered in the oral administration of danazol . accordingly , it may safely be said that the present preparations are novel and very useful remedies for endometriosis .	8
fig1 shows a hand - held vacuum cleaner 10 . the hand - held vacuum cleaner 10 has a main body 12 which houses a motor and fan unit ( not shown ). the main body 12 also includes a power source 14 such as a battery . a handle 16 is provided on the main body 12 for manipulating the hand - held vacuum cleaner 10 in use . cyclonic separating apparatus 100 is attached to the main body 12 . an inlet pipe 18 extends from a portion of the cyclonic separating apparatus 100 remote from the main body 12 . a dirty air inlet 20 is formed at the distal end of the inlet pipe 18 . a brush tool 22 is slidably mounted on the distal end of the inlet pipe 18 . a set of exhaust vents 24 are provided on the main body 12 for exhausting air from the hand - held vacuum cleaner 10 . the cyclonic separating apparatus 100 forming part of the hand - held vacuum cleaner 10 is shown in more detail in fig2 and 3 . the cyclonic separating apparatus 100 comprises a cyclone 102 which has a longitudinal axis x - x and a wall 104 . the wall 104 comprises a first portion 106 and a second portion 108 . an inlet 110 is formed in the wall 104 and arranged so that the first portion 106 of the wall 104 is located between the inlet 110 and the second portion 108 of the wall 104 . the inlet 110 is in communication with the dirty air inlet 20 and forms a communication path between the inlet pipe 18 and the interior of the cyclone 102 . the air inlet 110 is arranged tangentially to the cyclone 102 so that the incoming air is forced to follow a helical path around the interior of the cyclone 102 . the first portion 106 of the wall 104 is substantially cylindrical and is in two parts . this is so that the parts can be separated to allow cleaning of the interior of the cyclone 102 . however , this is not material to the invention . the second portion 108 of the wall 104 is spaced further from the longitudinal axis x - x than the first portion 106 of the wall 104 . the second portion 108 of the wall 104 includes a shoulder 112 and a cylindrical part 113 . a lip 114 extends from the first portion 106 of the wall 104 into the space surrounded by the second portion 108 of the wall 104 of the cyclone 102 . the lip 114 forms a substantially straight extension of the first portion 106 of the wall 104 . the function of the lip 114 will be described later . a base 116 closes one end of the cyclone 102 . the base 116 is pivotably mounted on the lower end of the second portion 108 of the wall 104 by means of a hinge 118 . the base 116 is retained in a closed position ( as shown in fig1 to 3 ) by means of a catch 120 . a shroud 121 is located inwardly of the wall 104 of the cyclone 102 . the shroud 121 comprises a cylindrical wall 122 having a plurality of through - holes 123 . the shroud 121 surrounds an outlet 124 from the cyclone 102 . the outlet 124 provides a communication path between the cyclone 102 and a further cyclone assembly 126 . a lip 128 is provided at the base of the shroud 121 . the lip 128 has a plurality of through - holes which are designed to allow air to pass through but to capture dirt and dust . the further cyclone assembly 126 comprises a plurality of further cyclones 130 arranged in parallel . in this embodiment , six further cyclones 130 are provided . each further cyclone 130 has a tangentially - arranged air inlet 132 and an air outlet 134 . each air inlet 132 and air outlet 134 is located at a first end of the respective further cyclone 130 . a cone opening 136 is located at a second end of each further cyclone 130 . the cone opening 136 of each further cyclone 130 is inclined with respect to a longitudinal axis ( not shown ) of the respective further cyclone 130 as can be best seen in fig3 . the cone openings 136 of each of the further cyclones 130 are in communication with a passageway 138 defined by a wall 140 located inwardly of the shroud 121 . a collector 142 is located at the lower end of the passageway 138 . the collector 142 comprises a frustoconical first portion 144 and a cylindrical second portion 146 . the interior of the collector 142 is surrounded by the base 116 and the sides of the first and second portions 144 , 146 of the collector 142 . a further lip 148 extends into the portion of the collector 142 surrounded by the cylindrical second portion 146 . the further lip 148 comprises a frustoconical portion 148 a and a cylindrical portion 148 b which extends substantially parallel to the sides of the second portion 146 of the collector 142 . the function of the further lip 148 will be described later . each of the air outlets 134 of the further cyclones 130 is in communication with a duct 150 . the duct 150 provides an airflow path from the cyclonic separating apparatus 100 into other parts of the hand - held vacuum cleaner 10 . located at the downstream end of the duct 150 is a pre - motor filter 152 . the pre - motor filter 152 comprises a porous material such as foam . in use , the motor and fan unit draws a flow of dirt - laden air into the dirty air inlet 20 , through the inlet pipe 18 and into the cyclonic separating apparatus 100 . dirt - laden air enters the cyclonic separating apparatus 100 through the inlet 110 . due to the tangential arrangement of the inlet 110 , the airflow is forced to follow a helical path around the interior of the wall 104 . larger dirt and dust particles are separated by cyclonic motion around the wall 104 . these particles are then collected at the base 116 of the cyclone 102 . separation of larger particles will occur in the region of the cyclone 102 surrounded by the first portion 106 of the wall 104 and also the portion of the cyclone 102 surrounded by the lip 114 . separated particles gather in the portion of the cyclone 102 surrounded by the second portion 108 of the wall 104 . the partially - cleaned airflow then flows back up the interior of the cyclone 102 and exits the cyclone 102 via the through - holes in the shroud 121 . once the airflow has passed through the shroud 121 , it enters the outlet 124 and from there is divided between the tangential inlets 132 of each of the further cyclones 130 . each of the further cyclones 130 has a diameter smaller than that of the cyclone 102 . therefore , the further cyclones 130 are able to separate smaller particles of dirt and dust from the partially - cleaned airflow than the cyclone 102 . separated dirt and dust exits the further cyclones 130 via the cone openings 136 . thereafter , the separated dirt and dust passes down the passageway 138 and into the collector 142 . the separated dirt and dust eventually settles at the base of the collector 142 . cleaned air then flows back up the further cyclones 130 , exits the further cyclones 130 through the air outlets 134 and enters the duct 150 . the cleaned air then passes from the duct 150 sequentially through the pre - motor filter 152 , the motor and fan unit , and a post - motor filter before being exhausted from the vacuum cleaner 10 through the air vents 24 . it is likely that , in use , the hand - held vacuum cleaner 10 will be held in a variety of orientations . it may even be held upside down in use . when the cyclonic separating apparatus 100 is tilted away from the vertical , a large proportion of the separated dirt and dust that may otherwise move towards the inlet 110 and the shroud 121 is caught in an annular pocket created between the lip 114 and the second portion 108 of the wall 104 . further , the presence of the above - described pocket may assist in the creation of stagnation points and eddy - currents within the lower portion of the cyclone 102 . this may further prevent re - entrainment of separated dirt and dust into the return airflow . regarding the collector 142 , a pocket is created between the second portion 146 of the collector 142 and the further lip 148 . the pocket will prevent a proportion of the separated dirt and dust which may potentially block the cone openings 136 or other parts of the further cyclones 130 from re - entering the passageway 138 when the hand - held vacuum cleaner 10 is tilted away from the vertical . the cyclone 102 and collector 142 can be emptied simultaneously by releasing the catch 120 to allow the base 116 to pivot about the hinge 118 so that the separated dirt and dust can fall away from the cyclonic separating apparatus 100 . both the lip 114 and the further lip 148 may take different configurations or shapes from those shown in the first embodiment . fig4 to 11 illustrate schematically eight further alternative configurations of the lip or lips which fall within the scope of the invention . in these illustrations , all detail will be omitted other than the general shape of the lip and adjoining wall portions . these configurations of lip may be applied to either the lip in the cyclone or to the further lip in the collector . fig4 shows a second embodiment of the invention . in this embodiment , the cyclonic separating apparatus 200 includes a lip 202 which extends from a first portion 204 of a wall into a region surrounded by a second portion 206 of the wall . the lip 202 has a plurality of through - holes which allow air to pass but block larger particles of dirt and dust . otherwise , the lip 202 is the same as the lip 114 described above . fig5 shows a third embodiment of the invention . in this embodiment , the cyclonic separating apparatus 250 includes a lip 252 which extends from a frustoconically - shaped first portion 254 of a wall into a region surrounded by a second portion 256 of the wall . the second portion 254 of the wall is partly frustoconical - shaped and partly cylindrical . fig6 shows a fourth embodiment of the invention . in this embodiment ( which is not shown to scale ), the cyclonic separating apparatus 300 has a longitudinal axis x ′- x ′ and includes a lip 302 which extends from a cylindrically - shaped first portion 304 of a wall into a region surrounded by a second portion 306 of the wall . the lip 302 extends inwardly from the first portion 304 of the wall at an angle to the longitudinal axis x ′- x ′. fig7 shows a fifth embodiment of the invention . in this embodiment ( which is also not shown to scale ), the cyclonic separating apparatus 350 has a longitudinal axis x ″- x ″ and includes a lip 352 which extends from a cylindrically - shaped first portion 354 of a wall into a region surrounded by a second portion 356 of the wall . the lip 352 extends outwardly from the first portion 304 of the wall at an angle to the longitudinal axis x ″- x ″. fig8 shows a sixth embodiment of the invention . in this embodiment , the cyclonic separating apparatus 400 includes a lip 402 which extends from a cylindrically - shaped first portion 404 of a wall into a region surrounded by a second portion 406 of the wall . the lip 402 comprises two parts — a first part which forms a substantially straight extension of the first portion 404 of the wall and a second part which forms an inwardly - extending annular part at right angles to the first part . fig9 shows a seventh embodiment of the invention . in this embodiment , the cyclonic separating apparatus 450 includes a lip 452 and first and second portions 454 , 456 of a wall . this embodiment is the same as the sixth embodiment except that the annular part extends outwardly . fig1 shows an eighth embodiment of the invention . in this embodiment , the cyclonic separating apparatus 500 includes a lip 502 extending from a cylindrically - shaped first portion 504 of a wall into a region surrounded by a second portion 506 of the wall . the lip 502 comprises two parts — a first part which extends inwardly and a second part which extends parallel to the first portion 504 of the wall . fig1 shows a ninth embodiment of the invention . in this embodiment , the cyclonic separating apparatus 550 includes a first portion 552 of a wall which has a cylindrical part and an annular part . a lip 554 extends from the annular part of the first portion 552 into a region surrounded by a second portion 556 of the wall . the arrangements illustrated in fig4 to 11 are intended to show that the number , shape and configuration of the lip or lips can be varied . it will be understood that other arrangements are also possible . for example , the further cyclone assembly may comprise any number of cyclones . alternatively , the further cyclone assembly need not be present and a filter or other separating media may take its place . there need not be a collector or a lip on the collector . what is important is that there is one cyclone which has a wall with two portions of different sizes , and a lip extends from the smaller portion into the larger portion . the lips in the above - described embodiments all extend around the whole of the circumference of the wall of the cyclone . however , this need not be so . the lip may extend around only part of the circumference of the wall of the cyclone . alternatively , a plurality of lips may be provided , each of which extends partly around the circumference of the wall of the cyclone . the lip may extend into a small part of the region surrounded by second portion of the wall of the cyclone or , alternatively , the lip may extend further into the cyclone . any number of lips may be provided ; for example , several concentric lips may be provided .	8
fig1 shows a 3d model 10 , which is rendered from 3d data . as shown in fig1 , 3d model 10 is comprised of a polygon mesh 12 . the polygons are triangles in this embodiment ; however , other types of polygons may be used . polygon mesh 12 define the “ skin ” surface of 3d model 10 . the 3d data for model 10 also includes bone data . the bone data defines a rigid skeletal structure 14 of model 10 ( fig2 ). the skeletal structure corresponds to the bones of a living being . in this embodiment , the “ bones ” in the skeletal structure are cartesian xyz - space vectors . the bones of model 10 are linked together in a tree - like hierarchical structure , with higher - resolution “ child ” bones branching off from lower - resolution “ parent ” bones . fig3 shows an example of the hierarchical structure . in more detail , root bone 16 , which may represent the body of a 3d model , branches down to left upper arm bone 18 and right upper arm bone 20 . these bones , in turn , branch down to left forearm bone 22 and right forearm bone 24 , respectively , and so on . bones at the bottom of the hierarchy , such as finger bones 26 and 28 are referred to as “ higher resolution ” bones than bones that are further up in the hierarchy , such as finger bones 30 and 32 . this is so because bones further down in the hierarchy provide higher resolution for the 3d model . that is , the additional bones provide added detail . each vertex of a polygon 12 ( fig1 ) is associated with one or more bones of the 3d model . this association is defined in the 3d data that makes up 3d model 10 . a polygon deforms around a bone that the polygon is associated with , much the same way that skin surrounding living bone deforms in response to an applied force . the bones may change location in response to such force , but do not change shape . referring to fig4 , a process 34 is shown for modifying a 3d model to reduce its resolution . process 34 constructs ( 401 ) the 3d model , including a bones infrastructure . this may be done manually , automatically ( i . e ., without user intervention ), or a combination of manually and automatically . in more detail , a user ( author ) creates a high - resolution 3d polygon mesh . this may be done using conventional 3d graphics generation tools . the author also creates a high - resolution bones infrastructure underneath the 3d polygon mesh and associates ( 402 ) individual bones with vertices of the mesh . that is , the author stores data that relates each bone to one or more vertices of polygons in the 3d mesh . the association may be made using a standard 3d graphics tool ( i . e ., computer program / application ) that operates automatically or interactively in response to user input . process 34 reduces ( 403 ) the resolution of the 3d polygon mesh . one technique that may be used to reduce the resolution is the multi - resolution mesh ( mrm ) technique . this technique involves removing edges of polygons , particularly edges that are interior to a 3d model , and then connecting unconnected vertices to form new , larger polygons . by way of example , as shown in fig5 , edge 38 of polygon 40 is interior to 3d model 42 . consequently , its removal will not have a dramatic effect either way on the resolution of the 3d model . accordingly , edge 38 can be removed , along , e . g ., with edges 42 and 44 to combine the smaller polygons and produce a larger polygon 50 . any vertices that are unconnected ( no unconnected vertices are shown ) may be connected to other vertices . it is noted that multi - resolution mesh is but one example of a process that may be used to reduce the resolution of the 3d polygon mesh . other such processes may be used instead of , or in addition to , the multi - resolution mesh . furthermore , the resulting output of the polygon reduction process ( 404 ) may be modified manually by a user , if desired . process 34 reduces ( 404 ) the resolution of bones in the 3d polygon mesh . generally , the reduction in resolution of the bones is commensurate with the reduction in resolution of the 3d polygon mesh ; however , this is not a requirement . process 34 may reduce the resolution of the bones either manually , automatically or a combination of the two . taking the manual case first , the user selects bones to be removed from the hierarchical bones infrastructure . for example , referring to hand 40 of fig3 , the user may select to remove finger bones 28 and 32 for one of its fingers . the resulting reduced - resolution 3d model is shown in fig8 . as shown in fig8 , the lower - resolution finger bones 28 and 32 are removed , resulting in a “ one - bone ” finger 42 . assuming that the reduced - resolution 3d model is far enough away from the virtual camera , or that it is not the focus of a scene , the resulting visual should not be significantly affected . process 34 may achieve the same effect as in fig8 using an automatic ( or interactive ) bone reduction technique . in more detail , process 34 may provide the user with a graphical display that allows the user to “ dial down ” the number of bones in the 3d model . that is , process 34 receives an instruction from the user to reduce the resolution of the bones and reduces their resolution in response to the received instruction . for example , the user may be given the opportunity to reduce the number of bones in the 3d model by a certain percentage . a linear or logarithmic scale may be used to reduce the number of bones in the 3d model . for example , if the reduction is 50 %, only 50 % of the bones down each path ( e . g ., arm 24 ) are used . as another alternative , if the number of polygons in the 3d polygon mesh has been reduced by a certain percentage , the number of bones in the 3d model may also be reduced by that same percentage . alternatively , the reductions in polygons and bones in the 3d model may be related by another mathematical formula . instead of removing the lowest resolution bone / bones ( e . g ., bones 28 and 32 of fig3 ) from a 3d model , lower resolution bones may be retained , while still reducing the overall resolution of the 3d model . that is , referring to fig3 , the bones of a 3d model are arranged hierarchically such that a lower - resolution bone 40 branches down to two or more succeeding bones 42 , 32 , and 28 and such that each of the succeeding bones ( e . g ., bone 32 ) has a higher - resolution than its predecessor ( e . g ., bone 42 ). in this embodiment , process 34 reduces the number of bones in the 3d model by connecting one of the succeeding , higher - resolution bones to the lower - resolution bone and removing the remaining intervening ( i . e ., “ in between ”) high - resolution bones . finally , the vertices of the polygons associated with the old bone structure are re - mapped to the new , lower resolution bone structure . by way of example , process 34 may connect high - resolution bone 28 to lower - resolution bone 40 . once those two bones are connected , process 34 removes the remaining intervening bones 32 and 42 . this way , process 34 essentially retains the same level of resolution in the 3d model , while still reducing the number of bones . removing the intervening high - resolution bones may have an effect on the mobility of the 3d model . however , depending upon the placement and scale of the 3d model in the 3d environment , this effect may be relatively insignificant in comparison to the reduction in data . process 34 may remove both highest - resolution bones and intervening bones . for example , referring to fig4 , process 34 may connect bone 32 to bone 40 and then remove highest - resolution bone 28 and intervening bone 42 . which bones that are to be removed may be selected automatically , using a mathematical reduction process , or manually using an interactive graphics tool . in this regard , the user may allow the automatic process to take place , and then go back and make changes to the resulting 3d model manually . any number of contingencies are within the scope of process 34 . process 34 associates ( 405 ) the reduced - resolution 3d polygon mesh with the reduced - resolution bones infrastructure . that is , process 34 conforms the 3d polygon mesh to the bones infrastructure . for example , process 34 checks all associations between polygon vertices and bones and assigns or removes such associations , where necessary . thereafter , process 34 stores 3d data for the modified 3d model in memory . using this data , 3d animation that includes the model may be generated . process 34 has particular applicability to 3d models that are in the “ background ” of a 3d environment or that are far from a virtual camera . for example , fig6 shows a 3d environment 46 , with plane 48 corresponding to the location of a virtual camera ( not shown ). thus , object 50 is closer to the virtual camera than is object 52 . reducing the resolution of object 52 using process 34 will have less of an effect on the resulting 3d animation / display than reducing the resolution of object 50 , since object 52 is farther away from the virtual camera than object 50 . thus , process 34 may be performed only on objects that are greater than a predetermined distance from the virtual camera . however , process 34 may be used to reduce the resolution of any and / or all objects in a given 3d environment . reducing the resolution of 3d objects by removing bones reduces the amount of data required to render those objects . since less data is required , 3d animation can be rendered more quickly and with less powerful microprocessors . moreover , reductions in the amount of data for a model facilitates transmission over limited - bandwidth transmission media . process 34 may be performed only once on a set of data for a particular 3d model . process 34 may also be performed for each keyframe of an animation sequence . a keyframe , in this context , is a frame of animation where significant movement of 3d model 10 has occurred . keyframes thus provide a snapshot of 3d model 10 at a moment in time . interim animation is obtained by interpolating between the keyframes . in the “ manual ” case described above , process 34 downloads additional keyframes for later segments of animation . the additional keyframes are used to interpret additional steps of animation . for the “ automatic ” case described above , process 34 uses one set of keyframes . in this case , higher - resolution bones are automatically associated with lower - resolution bones when bones are removed or not yet downloaded . fig7 shows a computer 54 for reducing the resolution of 3d models using process 34 . computer 54 includes a processor 56 , a memory 58 , and a storage medium 60 ( e . g ., a hard disk ) ( see view 62 ). storage medium 60 stores 3d data 64 , which defines a 3d model , and machine - executable instructions 66 , which are executed by processor 56 out of memory 58 to perform process 34 on 3d data 64 . process 34 , however , is not limited to use with the hardware and software of fig7 ; it may find applicability in any computing or processing environment . process 34 may be implemented in hardware , software , or a combination of the two . process 34 may be implemented in computer programs executing on programmable machines that each includes a processor , a storage medium readable by the processor ( including volatile and non - volatile memory and / or storage elements ), at least one input device , and one or more output devices . program code may be applied to data entered using an input device , such as a mouse or a keyboard , to perform process 34 and to generate output information . each such program may be implemented in a high level procedural or object - oriented programming language to communicate with a computer system . however , the programs can be implemented in assembly or machine language . the language may be a compiled or an interpreted language . each computer program may be stored on a storage medium or device ( e . g ., cd - rom , hard disk , or magnetic diskette ) that is readable by a general or special purpose programmable computer for configuring and operating the computer when the storage medium or device is read by the computer to perform process 34 . process 34 may also be implemented as an article of manufacture , such as a machine - readable storage medium , configured with a computer program , where , upon execution , instructions in the computer program cause the machine to operate in accordance with process 34 . other embodiments not described herein are also within the scope of the following claims .	6
with reference now to the figures and in particular with reference to fig1 there is depicted a pictorial representation of a distributed data processing system 8 or enterprise , which may be utilized to implement the method and system of the present invention . as may be seen , distributed data processing system 8 may include a plurality of networks , such as local area networks ( lan ) 10 and 32 , each of which preferably includes a plurality of individual computers 12 and 30 , respectively . of course , those skilled in the art will appreciate that a plurality of intelligent work stations ( iws ) coupled to a host processor may be utilized for each such network . as is common in such data processing systems , each individual computer may be coupled to a storage device 14 and / or a printer / output device 16 . one or more such storage devices 14 may be utilized , in accordance with the method of the present invention , to store the various data objects or documents which may be periodically accessed and processed by a user within distributed data processing system 8 , in accordance with the method and system of the present invention . in a manner well known in the prior art , each such data processing procedure or document may be stored within a storage device 14 which is associated with a resource manager or library service , which is responsible for maintaining and updating all resource objects associated therewith . still referring to fig1 it may be seen that distributed data processing system 8 may also include multiple mainframe computers , such as mainframe computer 18 , which may be preferably coupled to local area network ( lan ) 10 by means of communications link 22 . mainframe computer 18 may also be coupled to a storage device 20 which may serve as remote storage for local area network ( lan ) 10 . a second local area network ( lan ) 32 may be coupled to local area network ( lan ) 10 via communications controller 26 and communications link 34 to a gateway server 28 . gateway server 28 is preferably an individual computer or intelligent work station ( iws ) which serves to link local area network ( lan ) 32 to local area network ( lan ) 10 . as discussed above with respect to local area network ( lan ) 32 and local area network ( lan ) 10 , a plurality of data processing procedures or documents may be stored within storage device 20 and controlled by mainframe computer 18 , as resource manager or library service for the data processing procedures and documents thus stored . of course , those skilled in the art will appreciate that mainframe computer 18 may be located a great geographical distance from local area network ( lan ) 10 and similarly local area network ( lan ) 10 may be located a substantial distance from local area network ( lan ) 32 . that is , local area network ( lan ) 32 may be located in california while local area network ( lan ) 10 may be located within texas and mainframe computer 18 may be located in new york . as will be appreciated upon reference to the foregoing , it is often desirable for users within one portion of distributed data processing network 8 to access a data object or document stored in another portion of data processing network 8 . in order to maintain a semblance of order within the documents stored within data processing network 8 it is often desirable to implement an access control program . this is generally accomplished by listing those users authorized to access each individual data object or document , along with the level of authority that each user may enjoy with regard to a document within a resource manager or library service . in this manner , the data processing procedures and documents may be accessed by enrolled users within distributed data processing system 8 and periodically &# 34 ; locked &# 34 ; to prevent access by other users . the system shown in fig1 constitutes an enterprise in that each computer system is commonly associated with a particular business or enterprise . since they are all similarly associated , a unique identification ( id ) number is assigned to the enterprise . the id may be any number mutually agreed to by the software vendor and the enterprise owner . since keys are normally based on system serial numbers ( to restrict installation of the keys to that system ), one convention is to base the id on the serial number of some system in the enterprise , but to modify it in such a way as to indicate that it is an enterprise key . on the as / 400 system implementation , for example , an enterprise id may be xx - 55346 where the 55346 is the serial number of an as / 400 system in the enterprise and xx indicates that it is an enterprise key . next , for each licensed program ( lp ) covered by an enterprise licensing agreement , a key is issued that ties that particular lp to that enterprise &# 39 ; s id . for example , if an enterprise needed licenses for three lps on 1000 systems , it would need only one key for each lp ( instead of the 1000 for each lp if each key was based on a unique system serial number ) with each key based on the enterprise id . in order to direct the license manager in each system to accept enterprise id - based keys , a software license enterprise enabler program ( sleep ) 40 is provided . as shown in fig2 the sleep 40 itself is key protected and will only run in the presence of a sleep key 42 that ties it to a particular system . when sleep 40 runs on that system , it creates an enterprise key based on the serial number of the system it runs on and on the enterprise id . this key 42 can then be installed on any system in the enterprise and its presence on any system will indicate to the license manager 44 that licenses for other lps ( based on that enterprise key ) should also be honored . another way of looking at this design is to say that license manager 44 has dormant ( or ` sleeping `) support for enterprise licensing and only needs sleep - created key 42 to unlock that support . the actual use of enterprise key 42 by license manager 44 is depicted in the flowchart of fig3 . license manager 44 in step 310 , receives a request to use the license for a licensed program for a ( lp ). next , in step 312 , the system searches for keys 42 for the licensed program that are based on a local system serial number . next , in step 314 the system determines whether a valid key has been found , and if so , in step 316 returns an okay status . otherwise , if no valid key is found , the system , in step 318 searches for the enterprise key . if the system finds the enterprise key , as depicted at step 320 , the system proceeds to step 322 ; otherwise , if no enterprise key is found , the system sends an error status of no key found in step 324 as illustrated at reference numeral 46 in fig2 . in step 322 , the system searches for keys for the licensed program that are based on the serial number in the enterprise key . in step 326 , the system determines if a valid key has been found and , if so , in step 328 returns an okay status of &# 34 ; key found .&# 34 ; if no valid key has been found , the system in step 330 return an error status of &# 34 ; no key found .&# 34 ; one advantage of the enterprise key is that it is marked as having been generated on a particular system . this mark , or serial number of the system , is proof of when and where the key was generated and is used to determine if and how the software was stolen in such an event . additionally , the enterprise key does not require a complete network connection ( the same key can be installed on every system in the enterprise ) in order to access a licensed product from anywhere within the enterprise . this minimizes the number of unique licenses that must be managed . the next area of concern in the license management method is to be able to enforce both usage control and access control via the software keys . typically , an operating system can support usage control or access control , but not both . for example , the prior art operating system typically used in the enterprise shown in fig1 did support key based usage control . the invention , as discussed below , also extends the key based usage control to support access control with the same license keys and user interface . this allows both the software developer and the customer to deal with just a single method and key format to obtain access control , rather than several or at least two different methods . usage control is where the operating system protects itself by making calls to a license manager to determine if the software is running on the correct system or within certain usage limits as determined by a license key , or both . access control is where the data on the distribution media are encrypted and can only be decrypted by &# 34 ; installing &# 34 ; software via information in a license key . access control is often used for non - executing software , such as priced on - line books , fonts , and dictionaries . in order to provide both access control and usage control , encryption and decryption considerations must be addressed . therefore , the operating system as used in the present invention is built so as to include encryption / decryption support , which is available to the enterprise components via a cipher machine interface ( ml ) instruction set . the term &# 34 ; cipher &# 34 ; is well known in cryptography . both the encryption and decryption elements are illustrated in the flow diagram of fig4 . fig4 is a flow diagram showing the use of the cipher ml set of encryption and decryption techniques as used by the vendor and the customer . on one side is the vendor &# 39 ; s development system while on the other side is the customer &# 39 ; s system , and between the two are the encryption and decryption techniques according to the present invention . in block 50a , data are provided that are information that is ready to be written into the distribution media 56a . in block 52 , a proprietary key is generated that is known only by the vendor . the key is used to decrypt the data via the cipher machine interface ( ml ) instruction set in block 54 . the resultant decrypted data is then written to the distribution media in block 56 . on the customer side , the same distribution media 56 is now ready to be installed on another system as shown in block 56b . this information is encrypted via cipher ml instruction set 58 using the same key of block 52 . the resultant data 50b is the same data as originally provided in data 50a . to minimize performance degradation during installation , the data are sparsely decrypted . that is , for example , only 64 of every 2 , 048 bytes are to be decrypted . this is consistent with other access protection schemes . to provide access control for licensed programs , the licensed programs are packaged according to a system management services ( sms ) packaging method used in the operating system of the enterprise in fig1 . the sms packaging is required of licensed programs in order to make them installable and serviceable . the block diagram in fig5 further illustrates the hierarchy of the operating system including sms packaging method . to begin , a licensed product 62 consists of various operating system objects 64 such as programs , files and commands . the developer ties these objects together into a package via a product packaging information routine 66 , which is one of the system objects of the operating system . the packaging information 64 describes the product name , id , options , and other information needed to be able to install , service , and protect the licensed product . the packaging information is created via commands shown in routine 66 . the addliclnf command defines basic licensing information such as the vendor password , which is used in validating keys , and whether it is usage controlled , access controlled , or both . the chgprdobjd ( change product object description ) is used to mark objects for inclusion in the package . this command is also modified to mark which objects are to be accessed protected . for performance reasons , it is not reasonable to protect all the objects in a package , so the developer marks just enough objects to protect the product . next , the save license program ( savlicpgm ) command 70 writes the product to media 72 in the appropriate operating systems save / restore format . if the developer specifies encryption , via a parameter in savlicpgm , then those objects marked in the previous step are decrypted just prior to writing them to the media . the product packaging information object , however , is then written to the media in non - encrypted form and &# 34 ; access header &# 34 ; file is then written to media 72 as an indicator of what objects were decrypted . once the product packaging information object has been written to media 72 , license key manager 74 then generates a key , up to n keys , for the number of licensed programs that are used in the system . add license key ( addlickey ) program 76 performs the keying operation which is based on the restored licensed program ( rstlicpgm ) 78 sent from media 72 . fig6 is a sample list of an add license information list as prepared by the add product license information ( addprdlicl ) command within the operating system of the enterprise . this command adds license information to the product or feature and adds a new &# 34 ; protection type &# 34 ; parameter . in completing the add product license information , the vendor provides a product id , release level , feature , and usage type . additionally , the vendor provides registered information such as what type of compliance is required , whether it is keyed or not . additionally , a warning is provided , which may be keyed and distinguishes the protection type being either usage of access . further , both protection types may be used as noted by the default usage limit and the license term . additionally modifications are also provided , such as a feature message id , allow license release , a vendor password , and a grace period , which may be for a number of days or for a default usage and limit . the protection type added in the add license information of fig6 allows that a product can be packaged to support access control , usage control , or both . further , the access control is always key - based and the compliance type parameter applies only to usage control . likewise , the following parameters have no meaning for products that are only access controlled ; these are usage type , allow license release , default usage limit and grace period . next , fig7 shows the field for the genlickey command . within the generate license key command , the product id and license term are provided . the license term can be either for version ( vx ), version / release ( vxry ), or a version / release / mode ( vxrymz ) level . the system serial number is important in that the product is keyed to a system serial number , meaning that the program can only be installed on the system with that particular serial number . the processor field group assures that the software is being installed on the correct processor group . this is useful for software that is tier priced . a usage limit field is also provided , which is ignored for products that are only access protected . two more commands used during installation , as shown in fig5 as well , are save license program ( savlicpgm ) 70 and restore license program ( rstlicpgm ) 78 . the save license program 70 includes an access protect parameter , that if set to yes , allows those objects marked for access control to be decrypted prior to writing them to media 72 . this command also writes &# 34 ; access header &# 34 ; file to the media . this file contains a list of the objects that were decrypted . and the list is then used by the restore license program to determine which objects need to be encrypted at installation time . the restore license program ( rstlicpgm ) 78 command restores the product packaging information object and the &# 34 ; access header &# 34 ; file from the media . next , the program then determines which objects in the product need to be encrypted prior to restorating or installation . the key data is protected in that the information on the media can only be installed on a given serial - numbered system . the customer must have a key for each system on which the media is to be used . if the customer attempts to restore objects by bypassing the rstlicpgm interface , which can be done via the rstlib and rstobj commands , the objects will not restore correctly because they will be in decrypted form and those particular commands do not support encryption . moreover , once the software is installed on the particular host enterprise system , there is nothing that can stop the customer from saving the information to other media and installing the software on another system . likewise , if the software is really client coded that is downloaded to a pc , there is nothing that can stop the customer from using a portable , copyable media to distribute the client code . the next area of concern addressed by the present invention is that of providing grace period support . the license management functionality further supports a vendor specified grace period for the situation where there is no key and the usage limit has been exceeded . the vendor need only indicate the grace period within the application vital product data and monitor for messages or return codes for the license manager . all counting , reporting , administration is handled by the license manager . this is easily integrated by the application developer since it is already required for the key based license management application described above . fig8 is a block diagram illustrating the grace period features according to the present invention . in fig8 an application program 80 contain vital product data 82 that describes application 80 . vital product data 82 consists of the product id , version , installation directions , and basic license information such as the grace period . vital product data 82 is collected and stored in storage means 84 when application 80 is installed . when application 80 requests the right to run according to reqlic command 86 , the request is sent to the license manager 88 . license manager 88 checks the presence of a key 90 and if no key 90 is found , license manager 88 starts a timer 92 within license manager 88 for that application 80 and then responds 94 back to application 80 . if vital product data 82 for that application 80 indicates a 30 - day grace period , then response 94 would indicate that the user has 30 days in which to install a key for the application . license manager 88 decrements timer 92 every day for 30 days and any attempt to use the application during that time will result in a response 94 that indicates how many days are left in the grace period . at the end of the grace period , the response from license manager 88 changes to an error response , at which time , application 80 would reject further requests for use . in effect , the grace period allows the application developer to institute a shareware try and buy policy . the customer is free to try an application during the grace period and can purchase a key for continued use later once the grace period has ended since a license key has been added for license management . in the event of a valid key being found , the steps followed are the same as previously described . in this example , the usage limit , which is protected by the key , has been exceeded . in other words , a fifth person , for example , has invoked the application whose key entitles only four users . for this case , license manager 88 starts a timer and responds back to the application . the response indicates that the user has 30 days in which to install a new , larger key for the application . the timer is decremented every day and additional requests during that time will indicate how many days are left in the grace period . at the end of the grace period , the response changes to an error response , at which time , the application then rejects further requests for use beyond the keyed limit . this allows the enterprise to have increased use of an application for a controlled period until such a time as that which the customer needs to obtain a key . while the invention has been particularly shown and described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention .	6
the term “ membrane ” as used herein includes permeable and semi - permeable three dimensional structures with or without particles , having a porosity suitable for the desired application . the term “ composite structure ” as used herein includes filled membranes . in the first preferred embodiment of the present invention , those skilled in the art will recognize that many different particles can be used in the composite structures , depending upon the desired objectives of the resulting device . in the case or adsorptive devices , the ideal device will have rapid adsorption kinetics , a capacity and selectivity commensurate with the application , and allows for elution of bound analyte with an appropriate desorption agent . suitable adsorptive composite structures are polymer bound , particle laden adsorptive membrane structures , such as those comprised of chromatographic beads which have been adhered together with a binder . a suitable polymer bound particle laden adsorptive membrane is illustrated in fig4 . this membrane is comprised of about 80 % w / w silica and 20 % w / w polysulfone binder , and is produced by millipore corporation . a similar membrane is shown in fig1 a cast - in - place in a pipette tip 50 . functional composite structures comprising other micron - size ( e . g ., 1 – 30 microns ) resin particles derivatized with other functional groups are also beneficial , including styrenedivinyl - benzene - based media ( unodified or derivatized with e . g ., sulphonic acids , quaternary amines , etc . ); silica - based media ( unmodified or derivatized with c 2 , c 4 , c 6 , c 8 , or c 18 or ion exchange functionalities ), to accommodate a variety of applications for peptides , proteins , nucleic acids , and other organic compounds . those skilled in the art will recognize that other matrices with alternative selectivities ( e . g ., hydrophobic interaction , affinity , etc .) can also be used , especially for classes of molecules other than peptides . the term “ particles ” as used herein is intended to encompass particles having regular ( e . g ., spherical ) or irregular shapes , as well as shards , fibers and powders , including metal powders , plastic powders ( e . g ., powdered polystyrene ), normal phase silica , fumed silica and activated carbon . for example , the addition of fumed silica into a polysulfone polymer results in increased active surface area and is suitable for various applications . polysulfone sold under the name udel p3500 and p1700 by amoco is particularly preferred in view of the extent of the adherence of the resulting composite structure to polyolefin housing , including polypropylene , polyethylene and mixtures thereof . other suitable polymer binders include polyethersulfone , cellulose acetate , cellulose acetate butyrate , acrylonitrile pvc copolymer ( sold commercially under the name “ dynel ”), polyvinylidene fluoride ( pvdf , sold commercially under the name “ kynar ”), polystyrene and polystyrene / acrylonitrile copolymer , etc . adhesion to the housing can be enhanced or an analogous effect achieved with these composite structures by means known to those skilled in the art , including etching of the housing , such as with plasma treatment or chemical oxidation ; mechanical aids such as rims inside the housing ; and inclusion of additives into the housing material that promote such adhesion . adhesion allows uniform precipitation during casting . devices in accordance with the present invention may incorporate a plurality of composite structures having resin materials with different functional groups to fractionate analytes that vary by charge , size , affinity and / or hydrophobicity ; alternately , a plurality of devices containing different individual functional membranes may be used in combination to achieve a similar result . similarly , one or more membranes can be cast in a suitable housing and functionality can be added before or after casting . in accordance with the present invention , the structures of the present invention can be formed by a polymer phase inversion process , air casting ( evaporation ) and thermal inversion . for those systems with minimal or no adhesion , the formed structures can be separately prepared and inserted into the appropriate housing and held in place by mechanical means . in the preferred method , the formed structures are cast in situ in the desired housing . this results in the ability to include large amounts of media in the polymer matrix while still maintaining a three - dimensional porous structure . the membrane substructure serves as a support network enmeshing the particles , thus eliminating the need for frits or plugs , thereby minimizing or even eliminating dead volume ( the adsorptivity of the membrane may or may not participate in the adsorption process ). however , porous frits plugs could be added if desired . preferably the membranes or composite structures formed have an aspect ratio ( average diameter to average thickness ) of less than about 20 , more preferably less than about 10 , especially less than 1 . for example , for adsorptive pipette tips , aspect ratios of two or less , more preferably less than 1 are preferred , especially between about 0 . 005 – 0 . 5 . an aspect ratio within this range provides for suitable residence times of the sample in the composite structure during operation . in the polymer phase inversion process , the solvent for the polymer must be miscible with the quench or inversion phase . for example , n - methyl - pyrolidone is a suitable solvent for polysulfones , polyethersulfones and polystyrene . in the latter case , polystryene pellets can be dissolved in n - methyl - pyrolidone and case - in - place . the resulting structure shows good adhesion to the walls of a polyolefin - based housing , and has adsorption characteristics similar to polysulfone . dimethylsulfoxide ( dmso ), dimethylform - amide , butyrolactone , and sulfalane are also suitable solvents . n , n - dimethylacetamide ( dmac ) is a suitable solvent for pvdf . water is the preferred precipitant . the polymer phase inversion process generally results in an expansion of the structure to about two to three times its casting solution volume in the housing . in the air casting process , a volatile solvent for the polymer binder is used . for example , in the case of cellulose acetate , acetone is a suitable volatile solvent . air casting generally results in a structure which is smaller than the casting solution volume . with this method , particles in the filled structures should be at least about 30μ to allow flow through the interstitial spaces after shrinkage without having to apply higher driving force . the upper limit of particle amounts is dictated by casting solution viscosity . depending on particle type , up to 40 % ( w / w ) of particles can be added to the polymer without resulting in a casting solution too viscous to draw into the housing . higher particle loadings may be achieved using higher temperature . suitable particle sizes include particles in the range of from about 100 nanometers to about 100 microns in average diameter with or without porosity . suitable housing materials are not particularly limited , and include plastics ( such as polyethylene and polypropylene ), glass and stainless steel . polyolefins , and particularly polypropylene , are preferred housing materials in view of the chemical adhesion that is created with the composite structure when the composite containing polysulfone , and in particular udel p3500 and p1700 polysulfones available from amoco , is cast - in - place therein . fig1 b illustrates such adhesion with a polypropylene pipette tip housing having a cast - in - place membrane therein prepared with spherical silica gel and polysulfone . suitable housing configurations are also not particularly limited , and include pipette tips , wells , multi - well arrays , plastic and glass cavities , sample preparation devices such as the microcon ® microconcentrator , commercially available from millipore corporation , etc . the preferred housing configuration is substantially cylindrical , as the flow vectors during operation are substantially straight , similar to chromatography , thereby minimizing or avoiding dilutional washing that might occur with non - cylindrical configurations . although housings with volumes between about 0 . 1 μl and about 5 mls . can be used for casting - in - place , volumes less than about 100 μl are preferred , with volumes of from about 0 . 1 – 50 μl , preferably from about 0 . 2 – 20 μl , are especially preferred . pipette tip geometries having volumes as small as about 5 microliters can be used . when chemical adhesion of the composite structure to the housing walls is desired but is insignificant or non - existent , mechanical means can be used to maintain the composite structure in the housing , such as crimping , press fitting , heat shrinking the housing or a portion thereof , plasma treating the housing or a portion thereof , or chemically treating , such as etching , the housing or a portion thereof to promote adhesion . an advantage of adhesion to the housing wall is the ability to “ seal ” the composite structure to the housing without mechanical means . such sealing ( by whatever method ) prevents the sample from channeling or bypassing the composite during operation . preferably the structures of the present invention have a final bed height of from about 0 . 05 to about 5 mm . this allows for good washing , good density per unit volume , and results in a uniform precipitation during formation of the plug . the structures of the present invention also can be cast - in - place in conventional multi - well arrays having suitable geometries . alternatively , as shown in fig5 a – 5d , multi - well arrays 10 can be used as the housing , such as by casting the structures 11 of the present invention in place in the well 12 . alternatively , fig5 b shows an underdrain subassembly 13 having a plurality of wells 12 ( enlarged in fig5 d ) with cast - in - place structures contained therein . the underdrain 13 can be adapted to be permanently or removably coupled to the reservoir array 10 by any suitable means , such as by snapping , so as to form removable “ boot ” assemblies containing the structures of the present invention . for convenience , each underdrain 13 can contain a polymer matrix having particles with different chemistry , so that the user chooses the appropriate underdrain 13 depending upon the application . alternatively or in addition , the particle laden polymer matrix can differ from well to well . the reservoir housing 10 can be a plurality of open bores , or can include a membrane . the composite structures and the micro sample preparation devices of the present invention containing the composite structures have a wide variety of applications , depending upon the particle selection . for example , applications include peptide and protein sample preparation prior to analysis , peptide removal from carbohydrate samples , amino acid clean - up prior to analysis , immobilized enzymes for micro - volume reactions , immobilized ligands for micro - affinity chromatography , isolation of supercoiled and cut plasmids , clean - up of pcr and dna products , immobilized oligo dt for rna isolation , dye terminator removal , sample preparation for elemental analysis , etc . those skilled in the art will be able to choose the appropriate particles , polymer binder , particle chemistry and form geometry depending upon the desired application . in some cases , a mixture of particles can be used in the same devices . alternatively or in addition , a multi - well device could have different chemistries for each separate well . in the embodiment where the structures of the present invention are not filled with particles , symmetrical or asymmetrical semi - permeable structures , or a combination of symmetrical and asymmetrical semi - permeable structures , can be formed . in this embodiment , the preferred method of formation is casting in situ in the appropriate housing to form a self - retaining , self - supporting structure suitable for separations based on size or adsorption ( depending on polymer identity ). functionality can be added to such a membrane to perform adsorption separations without the use of particles . for example , cellulose acetate can be treated with base to form cellulose , followed by an oxidant to render it reactive . in the in situ formation process ( either with filled or unfilled structures ), the preferred method of formation involves precipitation by means of solvent exchange , such as by introducing the casting solution into the housing by any suitable means , such as where pressure is the driving force , for example by capillary action or by using a vacuum source . in the embodiment in which the housing is a pipette tip , a preferred driving force is a hand - held pipettor . once the desired volume in the housing is filled with casting solution , the casting solution in the housing is contacted with a liquid in which the polymer is insoluble , preferably water , so that the polymer precipitates in the housing . this can be accomplished by immersing the housing in the liquid , and / or drawing the liquid into the housing with a driving force such as by means of a vacuum . through the exchange of water for the solvent , the structure precipitates . those skilled in the art will appreciate that the solvent used to prepare the casting solution and the non - solvent can contain a variety of additives . at the first contact of the polymer with the precipitant , there is virtually instaneous precipitation , thereby forming a semi - permeable barrier or “ skin ”. such a barrier is illustrated in fig1 as element 60 in a housing 62 . this barrier slows the rate of further precipitation of the substructure . once precipitation is complete , the initial semi - permeable barrier 60 can be removed , such as by cutting the housing at a point above the barrier at a point above the barrier or by abrading exposed polymer . the semi - permeable barrier 60 can be optionally left in place to carry out size - based separations with unfilled structures , as the barrier acts as a micro - filtration membrane . the cast in - place structure assumes the shape of the housing and results in a self - retaining homogeneous structure akin to a chromatographic column , providing a large surface area suitable or bind / elute chromatography ( e . g ., when particles are included in the polymer matrix ) or for other analytical or biochemical techniques . suitable driving forces include centrifugation , gravity , pressure or vacuum . without limitation , the following examples illustrate the objects and advantages of the present invention . in a suitable small vessel , 5 grams of a 7 % ( w / w ) pvdf solution ( pennwalt corp , kynar 761 ) was prepared in n , n - dimethyacetamide . to this , 1 gram of scx , 200 å , 15 μm ( millipore , pn 85864 ) spherical silica was added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . a 20 μl fluted polypropylene disposable pipette tip was affixed to a common p - 20 pipetman ( gilson , ranin , etc .) and the volume adjustment was set to 20 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 0 . 5 – 1 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the pipette tip was removed and dipped into a bath of deionized water @ 60 ° c . for ca . 5 seconds . after this brief period , pressure was released on the polymer . when the water level was ca . 0 . 5 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to occur for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was abraded off . the tip was re - affixed to the pipettor and the liquid expelled . if the flow is poor , ca . 0 . 25 mm can be cut off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 5 to 20 μl of deionized water was drawn in and expelled several times . in a suitable small vessel , 5 grams of a 6 % ( w / w ) polysulfone solution ( amoco , p3500 ) was prepared in n - methyl - 2 - pyrrolidone . to this 2 grams of c18 , 200 å , 15 μm spherical silica ( millipore , pn 85058 ) was added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at rt ., then mixed again . a 200 μl fluted polypropylene disposable pipette tip was affixed to a common p - 200 pipetman ( gilson , ranin , etc .) and the volume adjustment was set to 200 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 2 – 5 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed and dipped into a bath of deionized water at room temperature for ca . 5 seconds . after this brief period , pressure on the plunger was released and water was drawn into the tip to precipitate the polymer . when the water level was ca . 0 . 5 – 1 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to occur for ca . 5 minutes . the tip was removed form the water bath and any precipitated polymer located on the exterior was twisted off . the tip was re - affixed to the pipetter and the liquid expelled . if the flow is poor , ca . 0 . 5 mm can be cut off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 50 to 200 μl of deionized water was drawn in an expelled several times . 60 å , 10 μm normal phase silica in wide bore 1000 μl pipette tips in a suitable small vessel , 6 grams of a 6 % ( w / w ) cellulose acetate solution ( eastman kodak , 398 – 60 ) was prepared in n - methyl - 2 - pyrrolidone . to this , 1 gram of 60 å , 10 μm granular silica gel ( davison , grade 710 ) was added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . a wide bore 1000 μl polypropylene pipette was affixed to a common p - 1000 pipetman ( gilson , ranin , etc .) and the volume adjust was set to 1000 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 10 – 25 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed and dipped into a bath of deionized water for ca . 5 seconds . after this brief period , pressure on the plunger was released and water was drawn into the tip to precipitate the polymer . when the water level was ca . 1 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to take place for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was abraded off . the tip was re - affixed to the pipettor and the liquid expelled . if the flow is poor , cut ca . 0 . 5 mm off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 200 to 1000 μl of deionized water was drawn in and expelled . in a suitable small vessel , 8 grams of a 7 . 5 % ( w / w ) polysulfone solution ( amoco , p3500 ) was prepared in n - methyl - 2 - pyrrolidone . to this , 0 . 5 grams of fumed silica ( degussa , aerosil 200 ) were added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . a 200 μl wide bore polypropylene pipette was affixed to a common p - 200 pipetman ( gilson , ranin , etc .) and the volume adjust was set to 200 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 10 – 25 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed and dipped into a bath of deionized water for ca . 5 seconds . after this brief period , pressure on the plunger was released and water was drawn into the tip to precipitate the polymer . when the water level was ca . 1 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to take place for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was abraded off . the tip was re - affixed to the pipettor and the liquid expelled . if the flow is poor , cut ca . 0 . 5 mm off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 200 to 1000 μl of deionized water was drawn in and expelled . in a small vessel , 5 grams of a 6 % ( w / w ) polysulfone solution ( amoco , p3500 ) was prepared in n - methyl - 2 - pyrrolidone . to this , 2 grams of c18 , 200 å , 15 μm silica ( millipore , pn 85864 ) was added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . using a pipette or eye dropper , 25 – 50 μl of casting solution was dispensed into a suitable fixture . examples of such devices include ( but are not limited to ) an millipore microcon or the wells of a 96 well filter plate . when preparing devices by this method , each chamber must contain a permeable barrier which will retain the solution ( e . g . polypropylene fabric , membrane , etc .). once added , the unit was gently tapped to ensure that the solution covered the entire barrier surface . the device was immersed in water for ca . 2 hours , and was gently stirred every 15 mins to promote solvent exchange . after this period , the units were removed and placed in either a centrifuge or vacuum manifold , as appropriate . the cast in place structure was flushed with 500 to 1000 μl of deionized water to ensure solvent removal . cast porous end plug in wide bore 1000 μl pipette tips containing loose 30 μsilica in a suitable small vessel , 5 grams of a 7 . 5 % ( w / w ) polysulfone solution ( amoco , p3500 ) was prepared in n - methyl - 2 - pyrrolidone . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . a 1000 μl wide bore polypropylene pipette was affixed to a common p - 1000 pipetman ( gilson , ranin , etc .) and the volume adjust was set to 1000 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 2 – 10 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , the tip was removed and dipped into a bath of deionized water for ca . 5 seconds . after this brief period , pressure on the plunger was released and water drawn into the tip to precipitate the polymer . when the water level was ca . 0 . 5 cm above the polymer height , the tip was ejected into the bath and solvent exchange allowed to take place for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was abraded off . the tip was re - affixed to the pipettor and the liquid expelled . if the flow is poor , cut ca . 0 . 5 mm off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 100 to 500 μl of deionized water was drawn in and expelled . the pipette was detached and any excess water in the upper chamber was removed with a cotton swab . 5 – 10 mg of ( 250 å ) 30 μm silica gel was weighed out and carefully added to the back end of the pipette . the pipette was tapped so that the silica rested on top of the cast - in - place barrier . if necessary , affix a suitable porous plug ( cotton or polypropylene ) in the upper chamber to prevent particle loss . in a suitable vessel , 5 grams of 7 . 5 % ( w / w ) polysulfone solution ( amoco , p3500 ) in n - methyl - 2 - pyrrolidone was prepared . the mixture is allowed to equilibrate for 2 hours at room temperature , and is then mixed again . a 1000 μl wide bore polypropylene pipette is affixed to a common p - 1000 pipetman pipettor ( gilson , ranin , etc .) and the volume adjust is set to 1000 μl . the plunger is depressed to the bottom and the end of the pipette is placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 2 – 10 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed , excess polymer solution was wiped off , and the tip was dipped into a bath of deionized water for about 5 seconds . after this brief period , pressure was released on the plunger and water was drawn into the tip to precipitate the polymer . when the water level was about 0 . 5 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to take place for about 5 minutes . the tip was re - affixed to the pipettor , the liquid expelled , and washed with 100 – 200 μl of deionized water . when cast in this manner , the precipitated polymer had a semi - filtration medium . in a suitable vessel , 5 grams of a 10 % ( w / w ) cellulose acetate solution ( eastman kodak , 398 - 60 ) in acetone was prepared . to this , 1 gram of methanol , 0 . 5 grams of deionized water and 1 gram of 250 å , 30 μm silica was added . the mixture was allowed to equilibrate for 2 hours at room temperature , and was then mixed again . a 1000 μl wide bore polypropylene pipette was affixed to a common p - 1000 pipetman pipettor ( gilson ) and the volume adjust was set to 1000 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . the plunger was then slowly raised to fill the tip with about 5 – 10 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed , excess fluid was wiped off , and the tip was placed in a rack to allow solvent to evaporate for about 16 hours . after this period , the tip was washed with about 10 μl of distilled water . 30 μl silica end plugs in porous polyethylene prepared by thermal phase inversion in a suitable vessel , 5 grams of beaded polyethylene and 100 grams of mineral oil are added . the mixture is heated to 250 ° c . on a hot plate with agitation . when the plastic liquifies , 4 grams of 250 å , 30 μm silica is added and mixed thoroughly . using a 1 ml graduated glass pipette with filler bulb , 50 – 100 μl of the melt is drawn . once the tip contains sufficient liquid , equal pressure is maintained , and the tip is removed , excess plastic is wiped off , the tip is allowed to cool to room temperature . the pipette is transferred to a methylene chloride bath for 1 hour to extract the mineral oil . it is then removed , and the methylene chloride is expelled and allowed to air dry . approximately 2 . 5 μg of each peptide from a mixture consisting of glytyr ( 1 ), valtyrval ( 2 ), methionine enkephalin ( 3 ), leucine enkaphalin ( 4 ) and angiotensin ii ( 5 ) ( in 100 μl 0 . 1 % tfa ) was adsorbed to a p200 pipette tip containing ca . 5 μl of cast c18 , 200 å , 15 μm spherical silica . the solution was drawn up and expelled 4 times . the tip was then washed with 200 μof 0 . 1 % tfa . bound peptides were eluted with 80 % acetonitrile in 0 . 1 % tfa / water . the eluted peptides were diluted with 4 parts of 0 . 1 % tfa and analyzed by reverse phase hplc ( linear acetonitrile gradient 5 – 30 % over 20 min ). the resulting chromatogram was then compared to that of the original mixture . ( see fig6 and 7 ). as expected , the glytyr , valtyrval , which are small and relatively hydrophilic , did not bind to the c 18 . the recoveries of the remaining 3 ( adsorbed ) peptides subsequent to elution ranged from 70 – 85 %. approximately 2 . 5 μg of each solute from a mixture consisting of a five peptides ( see example 10 ) ( in 100 μl in 10 % glacial acetic acid ) were adsorbed to a p200 pipette tip containing ca . 5 μl of cast , styrene sulfonate coated , 300 å , 15 μm spherical silica . adsorption was performed during 4 complete uptake - withdraw cycles followed by a 100 μl flush with 20 % methanol / 10 mm hcl . bound sample was eluted with two 25 μl volumes of 1 . 4 n ammonium hydroxide / 50 % methanol . the eluted sample was analyzed by reversed phase hplc and the resulting chromatogram was compared to that of the original mixture . ( see fig6 and 8 ). the strong cation exchange tip bound all sample components , except glytyr . such performance is consistent with the selectivity of sulfonic acid ion - exchange resins . trypsin was covalently coupled to an aldehyde activated 300 å , 15 μm spherical silica and cast ( 20 μl ) into p200 tips for protein digestion in situ . trypsin activity within the tip was assessed by monitoring the digestion of cytochrome via hplc . a sample of cytochrome c ( 10 μg in 100 μl of 100 mm tris , 1 mm cacl 2 , ph 8 @ 37 c ) was taken up into the tip for 15 minutes . the reaction was mixed 4 × with a expel / draw cycle into an eppendorf tube . the digest was analyzed by hplc using a linear gradient of acetonitrile from 5 – 45 % over 30 minutes ( see fig1 ). the resulting chromatogram showed that greater than 90 % of cytochrome c was digested after 15 minutes ( see fig9 for undigested cytochrome c ). recombinant protein a was coupled to precast p200 tips containing aldehyde - activated 300 å , 15 μm spherical silica for the isolation of rabbit immunoglobulin ( igg ). a 100 μl sample of 1 mg / ml igg and bsa in rip buffer ( 150 mm nacl , 1 % np - 40 , 0 . 5 % doc , 0 . 1 % sds , 50 mm tris , ph 8 . 0 ) was cycled six times through a tip containing 40 μl of cast volume containing protein a immobilized beads . the tip was then washed with 5 volumes of rip buffer prior to the elution . desorption of bound igg was performed with ( two 25 μl volumes ) of 6m urea . the desorbed sample was diluted with 50 μl of 2 × sds laemmli sample buffer and boiled for 3 min prior to electrophoretic analysis . this protocol was also performed on a blank tip containing just polysulfone without beads which served as a background control . electrophoresis was performed in a 10 – 16 % acrylamide gel shown ( see fig1 ). samples are as follows : lane 9 : ( mw marker ); lanes 1 – 4 : increasing amounts of protein a tip eluted sample ; and lanes 5 – 8 : increasing amounts of eluted igg / bsa from the blank polysulfone tip . these results indicate selective binding of igg to the protein a tip with minimal nonspecific adsorption . furthermore , the blank tip ( lanes 5 – 8 ), in the presence of detergents ( rip buffer ), did not exhibit adsorption of either igg or bsa . 60 å , 10 μm 1000 μl pipette tips for supercoiled dna escherichia coli strain jm109 containing plasmid puc19 was grown in 3 – 5 ml of luria broth containing 100 μg / ml ampicillin at 37 ° c . for 12 – 16 hours . 1 . 5 ml of the overnight culture was pelleted in a microfuge tube spun at a maximum g - force for 30 sec at room temperature . residual growth medium was removed while leaving the bacterial pellet intact . plasmid dna was then isolated using a modification of the alkaline lysis procedure of birnboim and doly ( birnboim , h . c . and doly , j . ( 1979 ). nucleic acids res 7 ., 1513 ). briefly , the bacterial pellet was resuspended by vortexing in 50 μl of 50 mm glucose , 25 mm tris - hcl ( ph 8 . 0 ), 10 mm edta , and 10 μg / ml rnase a . next 100 μl of 0 . 2 n naoh , 1 % sodium dodecyl sulfate was added . the resulting suspension was incubated at room temperature for 2 min . following the addition of 100 μl of 3 m sodium acetate solution ( ph 4 . 8 ), the suspension was mixed by vortexing then spun in a microfuge at maximum g - force for 2 min . the cleared lysate was transferred to a fresh microfuge tube to which 7 m guanidine hydrochloride ( guhcl ) in 200 mm 2 -( n - morpholino ) ethane sulfonic acid ( mes ) at ph 5 . 6 was added to a final concentration and volume of 4 . 4 m and 700 μl , respectively . the resulting solution was drawn into a 1000 μl polypropylene pipette tip with ca . 60 μl of cast membrane containing ca . 60 å , 10 μm silica gel using a p - 1000 pipettor . the solution was pipetted in - and - out for 2 – 2 . 5 minutes to allow extensive interaction between the dna solution and the silica membrane matrix . the tip was then flushed once with 400 μl of 80 % reagent grade alcohol . residual alcohol is removed by repeated expulsion onto a paper towel . plasmid dna was eluted from the tip in 100 μl of 10 mm tris - hcl ( ph 8 . 0 ), 1 mm edta ( te ) by in - and - out pipetting 3 ×. eluate fractions were adjusted to a final volume of 100 μl with te . six tips were evaluated . to quantitate plasmid dna recovery , 20 % of the eluate , as well as 20 % of the unbound filtrates , were analyzed by agarose gel electrophoresis ( see fig1 ). included on the gel were samples of puc19 plasmid dna of known concentrations . ( lanes 1 – 4 ) results of these experiments indicate that on average 2 . 5 mg of supercoiled plasmid was recovered ( lanes 5 , 7 , 9 , 11 ). 60 å , 10 μm silica in wide bore 200 μl pipette tips for linear dna the ability of 200 μl polypropylene wide bore pipette tips containing ca . 20 μl of cast 60 å , 10 μm silica - laden membrane to bind linearized dna fragments ( pbr322 digested with either bstni or mspi , to generate dna fragment ladders ) or plasmid pbr322 dna restricted with psti and bamhi ( generates large linear restriction fragments ) was assessed . five μg of linearized plasmid dna was combined with guhcl , ph 5 . 6 in mes to a final concentration of 0 . 5 m and volume of 150 μl . prior to use , p - 200 tips containing the silica membrane were pre - equilibrated in ( 2 ×) 200 μl of 0 . 5 m guhcl , ph 5 . 6 in mes . the dna / guhcl solution was drawn into a pipette tip and cycled in - and - out for 1 . 5 – 2 . 0 min to allow extensive interaction between the dna binding mixture and the silica - laden membrane matrix . the tips were then washed with 125 μl of 80 % reagent grade alcohol to remove salts and other contaminants . bound dna was eluted from the tip matrix in 100 μl te , by in - and - out pipetting 3 ×. to measure dna recovery , eluates and filtrates were analyzed by agarose gel electrophoresis ( see fig1 ). in order to quantitate the amount of dna recovered , samples representing 100 %, 75 %, 50 %, and 25 % of the starting material were run in lanes 1 – 4 . lanes 5 , 7 , 9 , & amp ; 11 are the eluants . estimate of band intensities indicate recoveries in excess of 95 %. fumed silica in wide bore 200 μl pipette tips for pcr amplified dna the ability of 200 μl wide bore polypropylene pipette tips containing ca . 20 μl of fumed silica immobilized in a polysulfone matrix was assessed for the purification of pcr amplified dna ( 500 bp ). prior to use , tips were flushed 2 × with 100 μl of te buffer and then equilibrated with 500 μl of 3 m nai in 200 mm mes buffer ( ph 6 . 4 ). 50 μl samples from the pooled pcr stock ( ca . 3 μg of dna ) were then combined with 7 m nai to a final nai concentration of 3 . 0 m . the total volume following addition of the nai solution was 150 μl . the sample was drawn in and expelled from the p - 200 tips containing the cast fumed silica - laden membrane for 2 – 3 minutes allowing for extensive contact with the matrix . each tip was then washed with 125 μl of 80 % reagent grade alcohol to remove salts and other contaminants . residual alcohol was removed by expelling the tip contents onto a paper towel . bound pcr product was eluted in 50 μl te ( ph 8 . 0 ). to estimate dna recovery , eluates and filtrates were analyzed by agarose gel electrophoresis ( see fig1 ). loads representing 100 %, 75 %, 50 %, and 25 % of the starting material were run in lanes 1 – 4 as controls . note the presence of the lower band which indicates a slight primer - dimer contamination . the use of immobilized fumed silica along with nai appears to give an amplified dna recovery in excess of 90 %. in addition , there appears to be a reduction in the primer - dimer contaminant . ( see lanes 5 , 7 , 9 , 11 ). cast porous end plug with loose 30 micron silica in a 200 μl pipette tip for dna isolation 200 μl pipette tips containing ca 5 – 10 μl of cast ( 7 . 5 %) polysulfone as a porous end plug and 2 – 4 mg of loose 250 å , 30 μm silica was assayed for the ability to bind linear and supercoiled plasmid dna . regarding linear dna , approximately 5 μg of pbr322 was first digested with mspi in 45 μl te ( 10 mm tris - hcl , 1 mm edta ), ph 8 . 0 , and then combined with 100 μl of 7 m guanidine hydrochloride ( guhcl ) in 200 mm mes buffer at ph 5 . 6 . the final concentration of guhcl in the solution was 4 . 7 m . the resulting solution was drawn ( once ) into a 200 μl pipette tip and allowed to extensively contact the silica by inverting the pipetman with the affixed tip for approximately 2 min . the dna adsorbed to the tips was then washed and eluted as described in example 15 . loads representing 100 %, 75 %, 50 %; and 25 % of the starting material where run in lanes 1 – 4 as controls . results from experiments using this format indicate at dna recoveries of better than 75 % can be achieved ( see fig1 , lanes 5 and 7 ).	1
in fig1 the reference numeral 100 refers to a system for accessing and downloading software that comprises , among other elements , one or more advertisement modules . software generically represents various types of digital content , including an application program , a movie , a phone list , audio or music , a game , or combinations thereof . an advertisement module is one or more pieces of software used to facilitate the advertising of a good , service , event , and the like . the combination of software and advertisement modules hereafter shall be referred to by the product name “ adware program .” authors of the software ( also referred to as “ software developers ”) use the system 100 to make their programs available to computer users . because of the presence of the advertisements , the cost of the software is subsidized by advertisers and can be acquired without any cost to the computer user . the system 100 includes a computer server 102 that resides connected to the internet 104 . it should be noted that in an alternate embodiment the internet 104 can be any computer network used by consumers to access and purchase goods and services . the server 102 is a typical internet server currently known by those familiar with the art . servers such as server 102 are used on the internet in a configuration commonly referred to as a “ client / server ” architecture . with a client / server architecture , the “ server ” computer receives and responds to commands from a plurality of client computers . server computers can respond to a variety of commands , e . g ., transferring copies of files or programs to a client computer . the commands are usually transmitted from the client computer to the server computer in a protocol known as hypertext transfer protocol ( or http ). the server 102 can be one of several types of computers , including a personal computer , mini - computer or a main frame computer . among other elements , the server 102 comprises a data storage medium 106 such as a hard disk , an array of hard disks , or a tape drive . software authors upload software , such as the programs used with the advertisement modules , to be stored on the data storage 106 . the server 102 also comprises at least one directory 108 for recording the names and descriptions of the software stored on the data storage 106 . computer users are able to access the directory 108 and read titles and descriptions of the various software packages . the directory 108 can also contain names and descriptions of software packages stored on other servers 102 connected to the internet . these titles and descriptions would contain hyperlinks that would enable users to readily access the alternative servers 102 . the server 102 can be connected to one or more external data bases ( not shown ). for example , the server 102 can be connected to a billing data base which authorizes ( or validates ) billing card information for credit or debit card purchases . the server 102 can also be connected to a data base comprising customer purchasing preference information or it can store this information within the data storage 106 . the purchasing preference information can be accessed and used when selecting which advertisements to transmit with the adware package to a given software user , selecting the advertisements based on the past purchasing preferences of the user . for example , advertisements for clothing companies could be attached to software for a user who purchases clothing over the internet 104 . a plurality of computers , represented by computers 110 , 112 and 114 , are connected to the internet 104 via the public switched telephone network 116 and an internet gateway 118 . it should be noted that the computers 110 - 114 are the “ client ” computers referenced above . currently millions of personal computers and private computer networks are connected to the internet 104 and the number continues to grow . the internet gateway 118 is one of a plurality of gateways to the internet 104 operated by internet service providers . in an alternative embodiment , the computers 110 - 114 could be connected to the internet gateway 118 via a private network or via a non - switched network . for example , a network of computers 110 - 114 could be connected to an internet gateway 118 by a direct trunk connection . the computers 110 - 114 can be either personal computers ( pcs ), personal digital assistants ( pdas ), mp3 players , wireless telephones , pagers , networked personal computers , computer work stations or any other computer that is able to access the internet . typically , the users of computers 110 - 114 contract with an internet gateway 118 provider , who then provides the internet access service for a fee . although not shown , the server 102 and the computers 110 - 114 transmit data via standard protocols such as the hypertext transfer protocol ( http ). this is a client / server protocol commonly used to access data on the world wide web . further it is important that any transfers of billing data to the server 102 or the transfer of software from the server 102 to the computers 110 - 114 be secure data transfers . for example , a format known as secure sockets transfer ( sst ) could be used to establish a secure transmission channel and prohibit the interception or corruption of billing data or of the adware software package . the computers 110 - 114 may be used by software developers to post their software on the server 102 . typically , once the server 102 has been accessed , the developers register their program by inputting their names , addresses and other identification information , system requirements for their software , and a description of their software , including key words . legal certifications such as a certification of authorship and liability waivers are also obtained . after this preliminary input of information , the software authors then upload their program software to the server 102 . developers can use e - mail , http , or file transfer protocol ( ftp ) for transmitting the software package to the server 102 . software developers can also use the server 102 to obtain the software modules necessary to attach the advertisements to their programs . in this case , the software developers access the server 102 using a computer 110 - 114 and register their intent to post adware software on the server 102 . the developers are also assigned an account number which they will use to identify both the developer and the program when it is uploaded onto the server 102 . the account number is also used for accounting so that the developers can be appropriately compensated when their software package is downloaded by a consumer . after registration , the developers download a system development kit ( sdk ) module which contains the software modules necessary to attach and update advertisements . these modules are described by the figures that follow below . sdk modules typically are software modules written in either c ++, java or some other commonly used software language . the developers then write their programs using standard development processes , typically in c ++, java , or some other commonly used software language , and the sdk modules are linked into the program . alternatively , developers can edit existing programs by linking in the sdk modules . developers may also receive sdks via a temporary storage medium such as on floppy disks or cd rom disks . after transmission to the server 102 , the adware software package is then stored on data storage medium 106 . in addition , the software program name and description are stored in appropriate files for the user directories 108 . key words and other information for identifying a particular software program are also stored in a directory 108 . if not already assigned , an account number is then transmitted from the server 102 to the software programrners &# 39 ; computer 110 - 114 . the account number is used to identify the developer for program updates , for an accounting of the number of users who download the authors &# 39 ; programs and for disbursement of payments . in the preferred embodiment , the software module for the advertisements already has been added to the program software by the software author before the software has been downloaded . the advertisement software module can be downloaded from the server 102 , or from some other server accessible via the internet 104 , by the author or it can be received via direct modem connection , by u . s . mail on a compact disk or on some other storage medium or by some other means . as an alternative embodiment , the adware advertisement software modules can be added to the program software as the program is being downloaded to the data storage medium 106 . with this embodiment , the author could actually choose from a list of advertisers who have agreed to sponsor the particular type of program while registering the software . for example , the author of a sports related computer game could choose from sporting goods advertisers . in another embodiment , the advertisement software module can be added to the program software after the software is stored on the data storage medium 106 . for both of these alternative embodiments , algorithms within the server &# 39 ; s 102 operating software would choose an appropriate advertisement software module to connect to the program based on the description of the program and key words input by the author during registration . as an alternative , the server 102 could check a purchasing preference data base ( not shown ) in order to determine and attach advertisements that would most likely appeal to a given user . it should be noted that adware programs can be loaded onto the server in ways other than described above . for example , the program software can be stored on data storage media such as a floppy disk or a compact disk and can be loaded onto the server by a human server administrator . as another alternative , instead of providing software programs , the server 102 can make data available to computer users . the data can take many forms , including graphic , audio and / or video data . for example , the data could be a digitized cartoon or video clip or could be financial research data compiled by a securities firm . with all embodiments described above , computers 110 - 114 can be used by consumers to access the server 102 in order to shop for and down load software . a user will locate a desired adware program by using key words and directories 108 . after making a selection , the adware program is downloaded to the user &# 39 ; s computer 110 - 114 . it should be noted that currently established protocols and error correction and security techniques are used when transmitting the adware program data from the server 102 to the user &# 39 ; s computer 110 - 114 . [ 0051 ] fig2 is a block diagram illustrating in more detail the functions with which an adware program is installed and operates within a user &# 39 ; s computer . for the sake of example , this disclosure will assume that the adware program is being installed on computer 110 . actually any computer that can access the internet 104 , and has sufficient storage and processing capability to store and run the software can successfully download the adware program . the network 204 and modem 202 are the preferred embodiment for accessing adware programs . the network 204 is representative the public switched telephone network 116 , internet gateway 118 , the internet 104 and numerous servers 102 in fig1 . the modem is a standard “ off the shelf ” modem that resides either internal or external to the computers 110 - 114 . as described in fig1 the adware programs are stored on data storage media 106 of the servers 102 . with alternative embodiments , an adware program is stored on one or more floppy disks 206 or on a read only memory compact disk ( cd rom ) 208 and a floppy disk drive or cd rom drive is used to input the program data . the adware program software package can also be stored on a floppy disk 206 or a cd rom disk 208 . installation package 210 represents the program installation module of the adware program . this module contains the instructions and routines necessary to write the program onto the storage medium ( not shown ), typically a hard disk drive , of the computer 110 . the installation package 210 creates a temporary working directory 212 wherein adware files from the installation package 210 needed for installing the adware program are temporarily stored . the installation package 210 then creates a user directory 214 where it records the characteristics and location on the hard disk of the program files . next the adware program files 216 are written to the hard disk . in addition the installation package 210 creates an adware run - time directory 218 as a separate directory or as a sub - directory of the of the user directory 214 . the directory 218 serves as a directory for the program &# 39 ; s dynamic - link library files 220 , that is , files with executable routines used to run the adware program . the run - time directory 218 also serves as the directory for the files for the adware advertisement . in addition , the installation package 210 adds the program identification and the storage location of adware program files 216 for the adware program onto a list of adware programs and plug - ins 224 within the directory for the web browser program , i . e ., the browser directory 226 or within the system registry . the browser program is one of several commercially available programs that enables computer users to view html and other internet or world wide web document types . most browser programs show document texts , and also display graphic and video files , play audio files and execute small programs , such as java applets . browser programs allow users to follow hyperlinked texts and transfer files . microsoft &# 39 ; s internet explorer ™ and netscape &# 39 ; s navigator ™ are well known and readily available browser programs . the installation package 210 also installs the adware plug - in module 228 . typically , plug - in modules are applications or programs designed to assist the operation of the web browser . as will be described in fig4 the adware plug - in module 228 executes advertisement update routines and transmits advertisement viewing data to the server 102 . it should be noted that the plug - in module 228 can serve multiple adware software programs . the plug - in module 228 is not installed if a plug - in module 228 is already resident on the computer 110 &# 39 ; s hard disk due to the prior installation of another adware software program . as an exception , if the newer plug - in module 228 is an upgrade of the existing one , then it would replace the older module 228 . in an alternative embodiment , the adware software is downloaded to a network computer ( nc ). typically , network computers do not comprise their own hard disk drives and receive all application software from remote servers . likewise , with this embodiment , the adware software is installed on the memory ( e . g ., hard disk drive ) of the remote server . ncs then are able to access the software from the remote server . with each access , the remote server would transmit an advertisement to be displayed on the nc . [ 0055 ] fig3 is a flow chart is an illustrative example of the operation of the adware software program . specifically , the flow chart describes the execution adware advertisement module 222 in relation to the other elements of the adware and browser directories and files . it should be noted that operations and characteristics common to loading and running software programs may not be described below . execution begins with step 300 and immediately proceeds to step 302 . in step 302 , the adware software program 216 is invoked . there are a number of ways in which a program can be invoked , each depending on the operating system and user graphical user interface of the computer storing the adware program . typically , with a windows based graphical user interface , a program is invoked by clicking on a graphical icon with the computer mouse . in response to the command , the program files are loaded into the random access memory ( ram ) of the computer . then executable files begin executing routines for running the program . in these routines , the adware program files 216 and the adware advertisement module files 222 are loaded into the random access memory ( ram ) of the computer . once these files are loaded into ram , execution proceeds to step 304 . at step 304 , determination is made whether the software package has been copied to a different computer . a routine to check the unique identity of the computer is executed , thus verifying that the software has not been downloaded and installed in a different computer . if the unique identity of the computer does not match the identity stored in the adware file list during installation , a “ no ” determination is made and execution proceeds to step 306 . at step 306 , execution proceeds directly to fig4 and advertisements are downloaded ( e . g ., installed ) on the computer 110 hard disk . execution then proceeds to step 308 . alternatively , advertisement modules that are dormant when the software package is purchased can be activated when the unique identity check indicates that the software has been copied to another computer . it should be noted that a “ no ” determination is only made if the user purchased the software package , either by traditional means , e . g ., a retail establishment , or over the internet as described if fig5 . it is anticipated that , if the user pays for the program , then the advertisements may be disabled ( see fig5 ). if the unique identity of the computer matches the stored identity , or if the user has not paid for the advertisement ( and the advertisements have not been disabled , then a “ yes ” determination is made and execution proceeds to step 308 . at step 308 , a determination is made whether the files in the advertisement module 222 or any other files in the adware program have been altered or contain errors of any type . an embedded and encrypted identifier containing a checksum routine for the adware program may be executed . the checksum routine includes a calculated value that is used to identify the presence of errors in the program or , more important to this application , identify whether the adware program or advertisement modules have been altered or modified in any way . if the encrypted identifier checksum does not match the calculated checksum of the program , a “ no ” determination is made and the execution proceeds to step 310 . at step 310 , the program will cease to run . at this point , the computer user will have to reinstall the software package ( described with fig2 ) onto his or her computer 110 in order to use the program . if at step 308 , the identifier checksum matches the calculated checksum , execution then proceeds to step 312 . at step 312 , the executable files within the adware module 222 invoke the executable files stored in the dynamic - link library ( dll ) 220 by a unique identifier . in an alternative embodiment , instead of invoking dynamic - linked files , a shared library is invoked . in the preferred embodiment , the dll 220 files begin a routine that , at step 314 searches the browser plug - in directory 226 for the adware file list . the adware file list is an encrypted data file containing data on software usage and advertisement assignments , i . e ., data that keeps track of which advertisements have been shown and which advertisement will be shown next . the file list is unique to each computer 110 - 114 and changes after each use of an adware software package . execution then proceeds to step 316 , wherein a determination is made whether the adware file list has been located , i . e ., whether the file list is present on the hard disk . if the list is not found , typically this means that the program was not properly or completely installed or that the program has been altered . if this the case , a “ no ” determination is made and execution proceeds to step 318 . at step 318 , a determination is made whether the correct environment , i . e ., the correct specifications for program operations , is present . if not , the absence of the file list and environment indicate that the program has not been properly installed or activated . if the adware program environment is not present , a “ no ” determination is made and execution proceeds to step 320 and text and / or graphic instructions are output to the computer monitor . these instructions explain to the user how to activate the adware program . execution then proceeds to step 322 where a determination is made whether the computer user wants to use the adware program . instructions displayed in step 320 typically will include a yes - no type question asking the user if they want to use the program and requiring the user to input an answer . if the answer is “ no ”, a “ no ” determination is made and execution proceeds to step 310 and the program is closed . if a “ yes ” determination is made , execution proceeds to step 324 , wherein execution proceeds to fig4 . in the execution described in fig4 the server 102 is accessed and appropriate adware advertising modules are downloaded and installed with the entire advertisement module 222 intact . if the environment is present at step 318 , or after installation of the advertising modules in fig4 execution proceeds to step 326 of fig3 . at step 326 , the adware program name and a list of the advertisements are added to the file list of adware programs . likewise , returning to step 318 , if the adware environment is present , and a “ yes ” determination is made , execution proceeds to step 326 and the program name and a list of the advertisements are added to the file list . note that at step 318 , the only instance in which the environment is present and the program had not been added to the file list is if the program had not yet been run , or if it had been improperly installed . upon completion of step 326 , or upon a positive (“ yes ”) determination at step 316 , execution then proceeds to step 328 . at step 328 , the data in the file list is updated . for example , the data showing the number of times the adware program has been “ used ” is increased by one . there are many different ways to “ use ” an adware program , such as playing back a song , accessing a database , loading an application program into ram , or playing a game . for some embodiments , such as the application program , usage may be incremented for various reasons , such as each time the application is loaded , each time a certain routine is performed , every hour , or combinations thereof . if multiple advertisements are present in the advertisement module 222 , then the identity of the advertisement that is going to be displayed is also recorded . after recording this and other relevant data in the file list , execution proceeds to step 330 . at step 330 , a routine is executed where the current date is checked . this date is compared to the date that the adware software program was installed on the computer 110 or is compared with the date when new advertisements were last received by the advertisement module 222 . after checking these dates and making these comparisons , execution proceeds to step 332 . at step 332 , a determination is made whether new advertisements are needed to replace the advertisements currently stored within the advertisement module 222 . this determination may be based on either usage or date comparison of data in the file list . for example , the software module can contain an algorithm that causes the advertisements to be replaced with new ones after the software module for each advertisement has run a certain number of times ( e . g ., five times ). alternatively , the advertisements could be replaced after a certain amount of time has elapsed , either from the date the software was installed , or from the date when the advertisements were last replaced ( e . g ., 20 days ). if a determination is made that the advertisements should be replaced ( a “ yes ” determination ), then execution proceeds to step 334 . at step 334 execution proceeds to fig4 where usage data is transmitted , or “ posted ,” to a handling system . for example , a routine may be activated to load the computer &# 39 ; s internet software . the internet software is loaded and a connection is made with the server 102 as described in fig1 . usage data is transmitted to the server 102 and is stored therein to be accessed later by the advertiser . in this manner , the advertiser can correctly determine how many times the advertisement has been viewed because the usage data acts as a meter for the end - user &# 39 ; s pc . in another example , the usage data may be transmitted to an accounting system , a check writing system , the author of the software , the owner of the software , an advertising agency , or any other appropriate system . for the sake of simplicity and clarity , only the server 102 will be discussed as the handling system . the server 102 can then transfer appropriate data to other systems , as necessary . after this transmission , the server downloads the new advertisements . these advertisements are saved to the hard disk of the computer 110 , replacing the old advertisements . this process is described in more detail with fig4 . after the advertisements have been replaced , execution returns from fig4 to step 336 . if at step 332 , a determination is made that the advertisements are not to be replaced , execution then proceeds to step 336 . at step 336 , an advertisement module is loaded into ram to be displayed on the computer 110 &# 39 ; s monitor . the advertisement modules are self contained files or modules within the advertisement module 222 . they can contain text , graphics , video , animation , and / or sound . these advertisements also can be interactive and can contain hyperlinks . if the advertisement is interactive or does contain hyperlinks , execution proceeds to step 338 . at step 338 a determination is made whether the advertisement is an interactive advertisement . if it is , a “ yes ” determination is made and execution proceeds to step 340 wherein execution proceeds immediately to fig5 . after the interactive session with the advertisement is completed , execution returns from fig5 to step 340 where execution proceeds to step 342 . likewise , if in fig5 the user chooses to purchase the software and the advertisement module is disabled , execution proceeds from fig5 to step 340 , wherein execution then proceeds to step 342 . if a determination is made that the advertisement is not interactive , a “ no ” determination is made and after the advertisement has been completed , execution proceeds to step 342 . it should be noted that , if interactive advertisements are not used , execution can skip steps 338 and 340 with execution proceeding directly from step 336 to 342 . at step 342 , the advertisement module 222 becomes passive and the software program begins to run . it should be appreciated that , although not shown in fig3 the advertisement modules can remain dormant in the ram and when the program encounters a busy thread , that is , when the program is saving a file , performing a calculation , etc ., an advertisement module can be activated and displayed on the computer monitor . in this case , an alternative version of fig3 is executed , with an advertisement module selected for viewing , and the usage statistics updated . though technically possible , it would be disruptive to refresh the advertisement modules during busy threads , and the system should instead wait until the next time the program is invoked . it would also be advantageous to use shorter advertisements during the busy threads or have the advertisement terminate once the busy thread is completed . it is possible for a software package to have several different types of advertisements . for example , the software package could contain interactive advertisements for use as the program is being loaded and short static graphic advertisements for use during busy threads . it is also possible to have a “ last frame shown ” structure within the advertisement wherein any animation used by the advertisement module ends with a suitable static screen display after the busy thread is completed . after displaying the static screen , the advertisement is terminated . [ 0068 ] fig4 is a continuation of fig3 illustrating how the adware advertisements within the advertisement module 222 are periodically replaced by advertisements from the server 102 ( fig1 ). as described above , by changing the content of the advertisements , this feature helps prevent a user of adware programs from losing interest and ignoring the advertisements . this feature also enables statistics kept on advertisement viewing to be downloaded from a computer 110 - 114 to a server 102 . these statistics inform advertisers concerning both the frequency their advertisements are being viewed and the number of computers on which their advertisements reside . in instances when the user has downloaded more than one adware program , statistics also are kept on the number of times each program has been run . all these statistics will help advertisers judge the value of their advertisements and select the type of computer programs they may choose to sponsor . fig4 can also be a continuation of fig5 . fig5 presents users with the opportunity of downloading and viewing advertisements other than the advertisements 222 . in fig3 based on the data provided by the file list at step 332 , if a “ yes ” determination is made , execution proceeds to step 334 . at step 334 , execution proceeds to step 400 of fig4 and then proceeds directly to step 402 . likewise , in fig5 if a “ yes ” determination is made , execution proceeds to step 400 and then proceeds directly to step 402 . at step 402 , the internet browser program is invoked by the adware dynamic link library and the browser program is then loaded into the ram . once the browser is loaded , execution proceeds to step 404 . at step 404 , the computer 110 modem out dials and connects the computer 110 to the server 102 as illustrated in fig1 . the adware server 102 &# 39 ; s world wide web page is then transmitted over network 116 and downloaded into the ram . execution then proceeds to step 406 wherein a determination is made whether the plug - in module 228 is present on the hard disk in the browser directory 226 . it is possible that the plug - in module 228 was not properly installed during the installation illustrated in fig2 ; that the computer user attempted to remove the plug - in module 228 ; or that a newer version of the plug - in has subsequently been made available . if the plug - in module 228 is not present or a newer plug - in module is available from the adware server 102 , then a “ no ” determination is made and execution proceeds to step 408 . at step 408 a browser routine is initiated wherein a request for the plug - in software module is transmitted to the server 102 and the plug - in module 228 is downloaded over network 106 from the server 102 . the software module is then installed on the hard disk within the browser directory 226 as described in fig2 . execution then proceeds to step 410 . likewise , if at step 406 a determination is made that the plug - in module 228 is present , a “ yes ” determination is made and execution proceeds directly to step 410 . at step 410 , the browser plug - in software is loaded into ram and begins to operate . among other functions , the plug - in module 228 opens the adware file list described in step 314 of fig3 and accesses the various data stored therein . execution then proceeds to step 412 where the plug - in module 228 initiates a routine wherein the data stored in the adware file list is transmitted via the modem 202 to the server 102 to be stored within data storage 106 . as described above , this data can then be made available to server 102 administrators and to advertisers . execution then proceeds to step 414 wherein the computer 110 receives the download of new advertisement modules and their accompanying security codes . these advertisements are installed onto the computer 110 hard disk in the adware advertisement module 222 . it is then preferred that the existing advertisements in the adware advertisements module 222 are then deleted . however , the old advertisements can be saved if desired by either the computer user or the program &# 39 ; s author . it should also be noted that the order for steps 412 and 414 can be reversed with the advertisement modules downloaded before the file list data is uploaded . execution then proceeds to step 416 wherein the plug - in module 228 updates the adware file list . the file lists are re - set to begin receiving new statistics . execution then proceeds to step 418 . at step 418 the flow chart returns to step 334 of fig3 wherein execution proceeds to step 336 and an advertisement is loaded into ram for display on the computer 110 monitor . as an alternative embodiment , a user operating a computer 110 - 114 can access the server 102 and browse the advertisements stored therein or can browse the stored advertisements once the web browser is connected to the server 102 as illustrated with fig4 . similarly , the advertisements can be updated before the expiration date . this would be accomplished in an instance when a user is browsing the server 102 &# 39 ; s world wide web page or browsing the directory 108 for additional software , or browsing the advertisements stored within the server 102 . the plug - in unit is loaded into ram when the world wide web page is first accessed , and the advertisements then are summarily refreshed as described above . this method avoids the inconvenience of programs temporarily expiring until new advertisements are downloaded . this method also insures that the adware server 102 will be frequently accessed by computer users , thus making the server 102 &# 39 ; s web pages ideal sites for displaying additional advertisements . the adware plug - in also can transmit usage statistics and program information to the server 102 while the computer 110 is still accessing the server 102 . based on the information received from the user &# 39 ; s computer 110 , the server 102 may then advise the user of any updated version of the installed adware programs that may be installed for free by selecting the program name from the informative world wide web page or from the directory 108 described in fig1 . it should be noted that , in the preferred embodiment , if the computer does not have a modem , if the modem has been disconnected or removed from the computer , or if the modem &# 39 ; s link to the public network 116 is disconnected , the adware program will not run once the internal timer designates that the advertisements should be refreshed or replaced . it is preferred , though not necessary , that the adware software be designed only to continue to operate as long as advertisements are being shown , and new advertisements periodically replace existing advertisements . however , this would not be the case if the user has purchased the software , either on - line , from a retail store , or from some other source . then the advertisements would be disabled , if so desired by the user , and would not be reactivated unless the program is copied to another computer . as described herein , when the software is copied to a second computer , if the advertisements have been disabled , they are reactivated . an exception to this is an instance when an owner of the software first disables the original copy of the software residing on a hard disk of computer 110 in order to legally install the software on a second computer ( if the user intends to run the software on more than one computer , and has only paid for the software once , then the advertisements are shown on the second computer ). the user may re - register the software , either by accessing a particular customer service server 102 via the internet 104 or by using a telephone to access a customer service center . ideally , the user may submit the id number from the original license agreement and inform the server 102 or the customer service assistant that he or she has purchased the program , disabled the program on the initial computer , and now wants to disable the advertisements . after checking a data base to insure that the software has indeed been purchased and the advertisements disabled , the server 102 transmits a command to the plug - in unit 118 to disable the advertisements . alternatively , a customer service assistant gives the command to the user to enter into the computer manually using the computer key board . [ 0073 ] fig5 is a continuation of fig3 illustrating various system responses to user input to interactive advertisements . it should be noted that not all adware advertisements will be or should be interactive . advertisements will be comprised of any combination of print text , graphics , audio , video , and / or animation and may or may not provide for or require user interaction . advertisements may also include hyperlinks with which the user is able to directly access internet servers such as the server 102 . user interaction does however provide a value to advertisers by accumulating data and by creating an environment in which the user is more likely to purchase the advertised product . interactive advertisements also provide a value to the user . interactive advertisements can provide interested users with additional product information and can present the user with the option of immediately purchasing a product . interactive advertisements can also be made more interesting that regular advertisements . in addition , interactive advertisements can also provide the user with the option to purchase the adware program and disable the advertisement module . at step 338 in fig3 a determination was made whether the advertisement was an interactive advertisement . if a “ yes ” determination was made , execution proceeded to step 340 , wherein execution proceeded to fig5 and step 500 . execution then immediately proceeds to step 502 . at step 502 , a determination is made whether data is input by the user in response to the advertisement . it is known in the art that computer users can input data via a number of different input devices , such as a computer keyboard , mouse , joy stick , or some other input device . these devices are used to collect user inputs in response to on - screen prompts that are created and presented by the interactive advertisement . if the user fails to respond to the interactive advertisement , then a “ no ” determination is made and execution progresses to step 504 . at step 504 , the program closes because a response to the interactive advertisement is required before the program runs . in an alternative embodiment , interaction with the advertisement is optional and the execution returns to fig3 at step 340 where the execution proceeds to step 342 and program is executed . in yet another alternative , text , graphics or some other media is output to the monitor explaining to the user that he or she can respond to the advertisement in order to access the program . if at step 502 a determination is made that the user has responded to the advertisement , then execution progresses to step 506 . it should be noted that there are numerous ways that an interactive advertisement can be constructed and that a user may interact with that advertisement . for example , the advertisement may contain hyperlinks that will connect the user to an on line server or to other advertising modules . as another example , the advertisement may contain a survey and the user provides answers to questions such as , “ what color automobiles do you prefer ?” in this instance , the user could manipulate an image of the product with the answers to the survey . using the example above , the user could manipulate an image of the product with the answers to the survey , i . e ., the image of the automobile would turn sky blue in response to the user &# 39 ; s response . the interactive advertisement could also output print data to a printer connected to the computer 110 that could print one or multiple coupons or rebate offers . as an incentive , with this option , the advertisement software could postpone printing the coupon or rebate offer until the user answers all the questions in the survey or until the data accumulated in response to the survey is transmitted to a server 102 . at step 506 , a determination is made as to whether the user wants to purchase the software in order to disable the advertisement functionality . this determination could be made by answering the question in a survey or by activating a hyperlink with a “ yes / no ” type answer . if a “ no ” determination is made , execution proceeds to step 508 . providers of the adware software or the author of the software may choose to omit this option , in which case execution proceeds to step 508 . the interactive software could also give users the opportunity to disable this step , thus making an ongoing decision to view the advertisements rather than purchase the program . at step 508 , a determination is made whether the user wishes to purchase the advertised product . as with step 506 , this determination may be made by one of several methods , most likely by activating a hyperlink . if the user decides to purchase the product and responds with the appropriate data input , then a “ yes ” determination is made and execution proceeds to step 510 . if however , a “ no ” determination is made , execution proceeds to step 512 . at step 512 a determination is made whether the user desires additional information about the advertised product . for example , the advertisement could be for a new hard drive for a personal computer or for a new adware software package . the additional information could contain specifications for the hard drive or a sample of the software &# 39 ; s functionality . typically the user responds by activating a hyperlink . if a “ yes ” determination is made , execution proceeds to step 510 . if the user indicates that he or she does not desire additional information , then a “ no ” determination is made and execution proceeds to step 514 . at step 514 a determination is made whether the user wishes to view other advertisements or replace the advertisements currently saved on the hard disk of the computer 110 . if a “ yes ” determination is made , execution proceeds to step 516 wherein execution then proceeds to fig4 . at fig4 as described above , a routine is initiated for downloading new advertisements and the present interactive routine is closed . as an alternative embodiment ( not illustrated ), the user can be linked to the server 102 or to some other server connected to the internet 104 and can view advertisements without having them installed onto the computer 110 hard disk . having accessed other advertisements , options such as those represented in step 508 and 512 can be presented again . if a “ no ” determination is made , execution proceeds to step 518 . step 518 is representative of all other types of responses possible with an interactive advertisement . these responses primarily represent data that can be helpful to the advertisers , i . e ., answers to surveys , consumer opinions on new or existing products , etc . the data may also be used by the advertiser in the future to assist in selling the advertised product or some other product to the user . it should be noted that any of the interactive determinations 506 , 508 , 512 , 514 and 518 may be included in the execution as described herein or may be omitted . it is also possible that the determinations may be made in a different order , i . e ., determination 508 made first and 506 made last . after data input in response to the interactive advertisement is completed , execution proceeds to step 510 . at step 510 a determination is made whether the web browser is running and whether a link to the internet 104 is established . if the browser is running and a link is established , a “ yes ” determination is made and execution proceeds to step 520 . however , if the browser is not running or a link to the internet 104 is not established , a “ no ” determination is made and execution proceeds to step 522 . at step 522 a determination is made whether the user wants to immediately transmit the interactive data to the server 110 or to another server connected to the internet 104 or whether the user desires instead to store the data to be transmitted at a later time . if the user determines to store the data , a “ no ” determination is made and execution proceeds to step 524 . at step 524 , the response data is saved to the hard disk in a user directory such as the adware user directory 214 . a link is also stored in the browser plug - in 228 or in the browser directory 226 . when the browser is loaded and the modem 202 establishes a connection with the server 102 , the response data is loaded into ram and then transmitted via the modem 202 to the server 102 . an example of how this is accomplished is that the response data is stored in the plug - in program 228 in the browser directory 226 or is stored as an email message and is then placed in the email outbox ( not shown ). when the browser 226 or email program ( not shown ) is activated , the response data is transmitted to the appropriate server 102 connected to the internet 104 . likewise , the user may use interactive responses to request additional product information , but may choose to view the information after use of the adware program . the request for the data may be transmitted to the server 102 real time or may be transmitted via email . the user &# 39 ; s email address is also transmitted to the server 102 . additional product information is then transmitted to the user &# 39 ; s email address for the user to access at his or her convenience . if at step 522 the decision is made to immediately transmit the response data to an appropriate server 102 , a “ yes ” determination is made and execution progresses to step 526 . at step 526 , the internet browser 226 is loaded into the ram and the modem 202 dials the telephone number of the internet gateway 118 . once a connection is made to the internet 104 execution progresses to step 520 . likewise , at step 510 , if a determination is made that a link has been established with the appropriate server 102 or if the browser 226 is loaded into the ram and a connection is established to the internet 104 , a “ yes ” determination is made and then execution progresses to step 520 . at step 520 , the computer 110 is connected to an appropriate server 102 and the response data is uploaded to that server 102 . this server 102 can be the server from which the user originally downloaded the adware program . or instead , the server 102 could be a server operated by one of the product companies paying for the advertisements . for example , if the user has indicated that he or she wishes to purchase the advertised product , e . g ., a pc hard drive , the user is connected to a server 102 with the company &# 39 ; s product web page . typically this type of web page gives the user additional information about their hard drive products and can receive and record the sales data necessary billing and delivery of the purchased product . execution then proceeds to step 528 where execution returns to fig3 . returning now to step 506 , if the user decides to pay for the adware program rather than see or hear the advertisements , then a “ yes ” determination is made and the execution proceeds to step 530 . at step 530 the browser 226 is loaded into the ram and modem 202 dials the internet gateway 118 , thus connecting to the internet 104 . execution then proceeds to step 532 and the computer 110 is connected to a server 102 . after connection , execution proceeds to step 534 and the computer 110 transmits a request for the user to purchase the software outright and then receives a request from the server 102 for billing data . this data can be a bank card , credit card such as visa or american express , a debit card or some other card , with an account number , used to purchase goods and services . execution proceeds to step 536 and the user inputs the billing data ( name , address , account number of the billing card , and expiration date of the billing ) which is transmitted to the server 102 . the server 102 saves the billing data for later billing by a billing service . although not shown , the server 102 can be connected to a billing data base and the billing data can be authorized and validated to ensure that the card is valid and is authorized for use . execution proceeds to step 538 wherein the adware advertising module 222 is disabled . it should be noted however , that the advertisements residing within the advertising module are disabled only for execution on the purchasing user &# 39 ; s computer 110 . if the adware program is copied and installed on another computer 112 or 114 or is transmitted via the pstn 116 or the internet 104 and installed on another computer 112 or 114 , then the adware advertising module 222 is reactivated and the user will see the advertisements as disclosed herein . the software makes this determination by comparing the computer &# 39 ; s operating system serial number or the bios serial number with the number stored in the program &# 39 ; s memory during installation . once the module 222 is disabled , execution proceeds to step 528 and execution then proceeds back to fig3 . in an alternative embodiment , a user purchases the adware software package by some retail or mail order channel . the software is installed using known standard means , such as custom software scripts or a program such as install shield 5 , or is simply copied from a portable storage medium to the hard disk . the adware software routine functions as described herein , except that , as the software is evoked , a software routine is activated that stops the advertisement elements and browser plug - in from being evoked . in one embodiment , the user accesses the server 102 in order to register the adware software product . for example , during the act of registration , the user enters a software activation key that was packaged with the product . the server 102 recognizes that the key is unique and that the software has not been previously registered by another user . after validating the activation key , the server 102 instructs the plug - in 228 to enable an encrypted file to be activated that executes the routine to stop the advertisements from being shown . if , however , the server 102 determines that the supplied activation key has previously been presented , then the encrypted file is not activated and the adware software activates the advertisements as described above . for computers 110 - 112 without a modem 202 , the user can execute the same registration and activation of the encrypted by using a telephone to call a voice response unit ( vru ) or a live operator to register the software . the activation key is entered manually using the telephone &# 39 ; s dtmf key pad . after validation , the vru gives the user a code ( e . g ., numerical , alpha - numerical ) to enter into the computer as part of the registration process . the code is used to activate the encrypted file that stops the advertisements . in either case , each subsequent time the adware program is started , the program reads and validates the encrypted information that it contains before running the program . even though it has not been shown , it should be understood that interactivity may be provided simply to draw attention to the advertisement and make it interesting . unless the user actually decides to seek additional information or purchase the product , the adware advertising module would not need to transmit the interactive data to a server 102 . in this case , execution would proceed directly from step 518 directly to step 526 . in some embodiments , different aspects of a program can be treated differently . for example , a program may consist of a collection of songs , each song being considered an “ aspect ” of the program . a first song of the program may be used with a first set of advertisements , and a second song of the program may be used with a second set of advertisements , after posting . in another example , a program may be a computer game with various levels , with each level being considered an aspect of the program . in yet another example , an application program can perform various functions , with the different functions being aspects of the program . those of ordinary skill in the art can anticipate many different types of software being divided into different aspects requiring different levels of advertisements . this also allows the advertisements , if desired , to be directed to specific aspects of the larger software ( e . g ., specific advertisements can be directed to specific songs on software that includes several different songs ). in some embodiments , the computer 110 , such as a personal computer with dedicated internet access , stays connected to the server 102 . in other embodiments , the computer 110 , such as a portable mp3 player , continually links , un - links , and re - links to the server 102 . the step of linking to the server 102 can be performed by using a port on a computer connected to the internet , or by a wireless dial - up connection on the portable mp3 player . the link can later be interrupted (“ un - link ”) and re - established (“ re - link ”) as necessary . although illustrative embodiments of the invention have been shown and described , a latitude of modification , change and substitution is intended in the foregoing disclosure and in certain instances some features of the invention will be employed without a corresponding use of other features . for example , alternate transmission means can be used for transmission of data from a computer to the server 102 and for transmission of the adware software package from the server 102 to the computer 110 , including wireless transmissions . in one embodiment transmissions from a computer 110 to the server 102 would be over land based wires , but data transmission broadcasts from the server 102 to computers 110 - 112 could be carried by standard television signals by encoding the information in the vertical blanking interval of the television signal , a practice well known in the art . likewise , transmission to and from the server 102 could be over cellular or pcs data carrier networks . as yet another example , instead of providing software , the invention described above may be used for providing data or for providing data and software . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention .	6
referring now to the drawings and particularly to fig1 there is shown an antenna reflector assembly 10 including a reflector 12 , a reflector heating device 14 and a heater control module 16 . reflector 12 includes a reflecting surface 18 which must be kept clear of ice and snow for optimum performance . reflector heating device 14 is in the form of a resistance heating wire that is attached to reflecting surface 18 in order to melt any frozen precipitation thereon . heater control module 16 , shown schematically in fig2 includes input terminals 20 and 22 , voltage converter 24 , electrical processor or microcontroller 26 , ambient temperature / moisture sensor and interface 28 , trigger device 30 and switching device 32 . input terminals 20 and 22 are connected to a source of electrical power , such as a power line voltage . input terminal 20 is connected to vline1 , and input terminal 22 is connected to vline2 / neutral . heater control module 16 enables heating device 14 to efficiently heat a given size reflector 12 with any of the worldwide power line voltages , which range approximately between 100 and 240 volts ac , with a frequency of 50 or 60 hz . with the exception of 240 volt domestic operation , all power lines voltage sources have a grounded neutral . thus , vline1 is always live . vline2 / neutral is only live when operating from a domestic 240 volt service . voltage converter 24 transmits an analog voltage signal on line 34 that is indicative of the magnitude of the input power line voltage , i . e ., the voltage difference between vline1 and vline2 / neutral . in this sense , voltage converter 24 measures the magnitude of the line voltage and communicates the measurement to microcontroller 26 . voltage converter 24 converts the power line voltage into a scaled analog voltage signal having a magnitude that is appropriate for input into microcontroller 26 . voltage converter 24 is shown in more detail in the schematic diagram of fig3 . besides the analog voltage signal transmitted on line 34 that is indicative of the supply voltage , voltage converter 24 also outputs a v + signal on line 36 that is typically 5 volts . this v + signal can be used to power microcontroller 26 , sensor 28 and trigger device 30 . an optional 1 : 1 turns ratio power transformer 38 provides isolation from the power line for other components of voltage converter 24 . the reactance of capacitor 40 reduces the line voltage to a value required for proper circuit operation . using a reactance rather than a resistance has the advantage of dividing the line voltage without dissipating large amounts of power . the reactance of capacitor 40 is much greater than the equivalent resistance of the load of voltage converter 24 . thus , the circuit current is substantially a function of only the magnitude and frequency of the power line voltage and is substantially independent of the load resistance . this is critical for proper deicing system operation . at the instant of power application , resistor 41 limits circuit current to a safe value . resistor 41 performs the current limiting function during a fast rate of rise or fall voltage transient . a bridge rectifier 42 includes four diodes 44 . bridge 42 takes the absolute value secondary voltage of transformer 38 . the load for bridge 42 includes a zener diode 46 and a resistor 48 . a ground connection is made to the junction of resistor 48 and the anode of zener diode 46 . thus , the voltage drop across resistor 48 is negative with respect to ground and is a function of the magnitude and frequency of power line voltage . filter capacitors 50 and 52 reduce voltage converter ripple currents to insignificant levels . resistors 54 and 56 and voltage v + scale and shift the line voltage signal to a range of values appropriate for input to microcontroller 26 on line 34 . this positive voltage decreases with increasing line voltage , i . e ., the voltage on line 34 varies inversely with line voltage . microcontroller 26 includes an internal analog to digital converter to digitize the signal indicative of line voltage that is transmitted on line 34 . microcontroller 26 also includes a lookup table which associates the raw analog to digital output with one of the following possible approximate line voltage values : 100v , 120v , 200v or 230 / 240v . thus , microcontroller 26 interprets the output of its a / d converter as indicating that the power line voltage is at one of these voltage levels . these values correspond to the majority of the power line voltages available throughout the world . the 230 / 240 voltage value compensates for the higher reactance of current limiting capacitor 40 at 50 hz . microcontroller 26 includes an internal control device which controls switching device 32 through trigger device 30 dependent upon which magnitude of power line voltage has been identified . microcontroller 26 controls switching device 32 in such a way that it is ensured that a same , optimum heating power level is dissipated by heating device 14 regardless of the magnitude of the line voltage . as is well known , the power dissipated by a resistive load is proportional to the square of the voltage applied across the load . thus , to ensure that a same , optimum heating power level is dissipated by heating device 14 , the time average of the square of the applied voltage must be constant . the present invention achieves this by cyclicly connecting and disconnecting the line voltage to / from heating device 14 , with the time durations in which the line voltage is connected or disconnected varying with the measured magnitude of the line voltage . for example , with a minimum line voltage of 100v , the line voltage can be applied to heating device 14 continuously . with a line voltage of 200v , however , the instantaneous power dissipated by heating device 14 will be four times as great ( i . e ., 200 2 = 4 * 100 2 ). in order to ensure that the time average of the dissipated power is the same regardless of which of the two line voltages is present , the 200v line voltage can be applied to heating device 14 for only 25 % of the total time that heater 14 is operating ( i . e ., 0 . 25 * 200 2 = 100 2 ). the total time in which the line voltage is applied to heating device 14 , expressed as a fraction or percentage of the total time in which heating device 14 is operating or turned on , is defined as the duty cycle of heating device 14 . in the example discussed above , a duty cycle of 25 % with a line voltage of 200v produces the same dissipated power in heater 14 as a duty cycle of 100 % with a line voltage of 100v . these two duty cycles are shown in fig4 with the cycling having a period of t . the on / off cycling of switching device 32 is performed at a fixed frequency that is substantially less than the line voltage frequency of 50 or 60 hz . the time period t of the cycling can be approximately between 0 . 17 and 3 . 0 seconds , corresponding to cycling frequencies approximately between 0 . 3 and 6 hz . the long thermal time constant of heaters 14 ensures that there is substantially no temperature change in heaters 14 during this cycle period . the state of switching device 32 at any given moment determines whether the line voltage is applied to heater 14 at that moment . when switching device 32 is closed or turned on , i . e ., when it provides an internal conductive path therethrough , the line voltage is applied to heating device 14 . conversely , when switching device 32 is open or turned off , i . e ., when it does not provide an internal conductive path therethrough , the line voltage is not applied to heating device 14 . switching device 32 is shown in fig2 as being in the form of a bi - directional thyristor , also known as a triac . a snubber network 58 , including resistor 60 and capacitor 62 , reduces the time rate of change of voltage transients appearing across triac 32 to a safe value . this ensures commutation while preventing unintentional triggering . trigger device 30 is in the form of a photo - isolated trigger integrated circuit . trigger 30 protects microcontroller 26 from destructive voltage transients which may be present in the line voltage . an industry - standard siemens il - 420 has been found to be acceptable as trigger device 30 . it minimizes radio frequency interference by triggering triac 32 close to zero crossings of power line voltage vline1 . a resistor 64 is used to set the current through a light emitting diode portion of trigger 30 . heaters 14 are operated only when the ambient temperature is between two threshold temperatures . when the ambient temperature is below a lower one of the threshold temperatures , operation of heaters 14 would be ineffective . when the ambient temperature is above an upper one of the threshold temperatures , operation of heaters 14 is unnecessary . the threshold temperatures can be chosen , for example , as 0 ° f . and 38 ° f . ambient temperature / moisture sensor and interface 28 ascertains the ambient temperature , produces an ambient temperature sensor signal corresponding thereto , and converts the signal into an analog signal which is appropriate for inputting to the microcontroller 26 via a conductive line 66 . the duty cycle of heaters 14 can also be modified based upon the ambient temperature in order to ensure that an optimally efficient level of heating power is dissipated by heaters 14 . clearly , less heating power is required to melt the ice on reflecting surface 18 at higher ambient temperatures than at lower ambient temperatures . neglecting the effects of convection and radiation , the antenna temperature rise over ambient is substantially linearly proportional to heating power . for example , a heater producing a full power temperature rise of 32 ° f . will keep the antenna at or above freezing down to 0 ° f . less power is needed to keep the antenna at or above freezing at higher ambient temperatures . by reducing the heating power at higher ambient temperatures , operating costs are reduced and a higher load current is permitted for a given triac heat sink size . reducing the heat sink size permits a smaller enclosure , which in turn reduces manufacturing costs . in one embodiment of the present invention , the duty cycle of heaters 14 has an inverse linearly proportional relationship with the ambient temperature between the two threshold temperatures . that is , a &# 34 ; temperature factor &# 34 ; may be determined which varies linearly between a value of 1 . 0 at 0 ° f . and 0 . 0 at 38 ° f . whatever duty cycle that has been determined according to the magnitude of the line voltage would be reduced or multiplied by this temperature factor in order to arrive at a temperature compensated duty cycle . for example , a duty cycle corresponding to a line voltage of 200v would be determined to be 0 . 25 , as discussed above . at an ambient temperature of 19 ° f ., which is half way between the two threshold temperatures , the temperature factor would be determined to be 0 . 5 . the &# 34 ; line voltage factor &# 34 ; of 0 . 25 is then multiplied by the temperature factor of 0 . 5 to arrive at a temperature compensated duty cycle of 0 . 125 or 12 . 5 %. microcontroller 26 then controls the switching of switching device 32 according to this temperature compensated duty cycle . another lookup table may be provided in microcontroller 26 to establish any desired linear or nonlinear relationship between the temperature factor and the ambient temperature . it is also possible to operate heaters 14 only when snow and / or ice may be present , as determined by ambient temperature / moisture sensor 28 . in this embodiment , heaters 14 are operable only when sensor 28 senses that the ambient temperature is below a threshold temperature , such as 38 ° f ., and moisture is present . reflector heating device 14 is shown in the form of a heater wire attached to reflecting surface 18 . however , it is to be understood that heating device 14 can also be in the form of electrodes . further , heating device 14 can also be attached to a rear surface 68 of reflector 12 or embedded within reflecting surface 18 . it is also possible for heating device 14 to be used to heat a feedhorn 70 of reflector 12 . the embodiment of the present invention shown herein is applied to the electrical heater of an antenna reflector . however , it is also possible to apply the present invention to other types of snow melting control applications in loading docks , sidewalks , access facilities for the physically handicapped , etc . it is also possible to measure the frequency of the line voltage in addition to its magnitude . the scheme described herein has a power control uncertainty of ± 6 % depending upon whether the line frequency is 50 or 60 hz . the duty cycle can then be adjusted based upon the measured line voltage frequency . this permits greater accuracy and allows a shorter duty cycle period . while this invention has been described as having a preferred design , the present invention can be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the invention using its general principles . further , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims .	7
according to aspects of the present invention , rather than generating a malware signature based on the entire user - modifiable document , only a portion of a document is used as a basis for generating the signature . more particularly , a malware signature is generated based on certain , more permanent portions of a user - modifiable file . by basing the malware signature on those portions of a user - modifiable document that tend to be more permanent , the ability of malware creators and self - modifying malware to escape detection through simple , cosmetic alterations is substantially reduced , if not completely eliminated . those skilled in the art will appreciate that a user - modifiable document includes numerous elements , some of which tend to be more permanent than others . it is generally those more permanent elements / portions of the document upon which the present invention bases its signature . fig2 is a block diagram illustrating an exemplary user - modifiable document 200 and for discussing the various elements of the user - modifiable document . as shown in fig2 , the user - modifiable document 200 includes various elements / portions such as macros 202 , templates 204 , embedded objects 206 , such as active x and com objects , applied styles 208 , and the like . each of these elements tends to be more permanent , i . e ., is not modified each time a user edits the user - modifiable document . additionally , these are the types of document elements that contain the “ core ” of the malware . for example , malware creators embody their malicious designs in the form of macros or active x controls . these are then place in user - modifiable files , such as word processing documents , spreadsheets , or images . any information in the user data areas , such as user data areas 210 and 212 , typically have little or no effect on the malware per se , but often include information that would entice a user to activate and / or release the malware onto the unsuspecting user &# 39 ; s computer . thus , as already mentioned , due to the nature of current signature - based detection systems , variants of malware are easily produced through cosmetic changes to the document . it should be understood that while the present discussion may use the term “ user - modifiable ” file , it is for description purposes only , and represents only one type of file applicable for the present invention . as mentioned above , quite often malware , distributed as applications , will include data areas whose modification does not affect the functionality of the malware . these data areas will be referred to hereafter as superficial data areas . user - modifiable files include superficial data areas , i . e ., areas that a user ( or embedded malware ) may modify without affecting the embedded malware . accordingly , it should be understood that “ user - modifiable ” files or files with superficial data areas include all files that include data areas whose modification affects the functionality of the malware ( referred to generally as the more permanent portions of the file ) and areas whose modification has no functional effect on the malware ( referred generally as user - modifiable data areas or as superficial data areas .) fig3 is a block diagram illustrating the exemplary user - modifiable document 200 and further illustrating that only portions of the documents are used in generating a signature for the document . as mentioned above , according to the present invention , when generating a file signature , the more permanent portions of a user - modifiable document , such as , but not limited to , macros 202 , templates 204 , styles 208 , and embedded objects 206 , are identified and used . conversely , the user data portions , such as user data areas 210 and 212 , are filtered out of the signature generation process . as mentioned above , even when basing malware signatures on more permanent aspects of a user - modifiable file , malware detection does not always provide time - zero protection , i . e ., protection the moment a malware file is released . according to aspects of the present invention , in order to provide time - zero protection to a computer or network , files that are trusted not to be malware are identified on a so - called white list . as a file arrives at a computer , but before it can be utilized on the computer , a signature for that file is generated and compared against a white list of files that are known to be trusted . according to further aspects of the present invention , the signature of the file , if the file is a user - modifiable file , is based on its more permanent portions , as discussed above . in this manner , a user - modifiable file can be edited and easily distributed among computers with full confidence that distribution of the file is trustworthy . conversely , those files that cannot be matched against signatures in the white list are considered untrustworthy , and security policies can be carried out to protect the computer and / or network . in this manner , time - zero protection is realized . according to the present invention , a white list may be locally stored on a computer , on a trusted network location , or both . the present invention is not limited to any one configuration or arrangement . additionally , according to one embodiment , a computer may rely upon a plurality of white lists for a variety of reasons , including efficiency and redundancy . fig4 is a pictorial diagram illustrating one exemplary network configuration 400 of a white list available to a plurality of computers . as shown in fig4 , the exemplary network configuration 400 includes a white list service 408 that receives requests from computers , such as computers 402 - 406 , to identify whether a received file is white listed . the white list service 408 may be a web server connected to the internet 412 , but the present invention is not so limited . while the white list service 408 may be strictly a white listing service , i . e ., one that provides information as to files on a white list , alternatively , the white list service may provide information for both white listed files as well as black listed files , i . e ., known malware . the white list service 408 is illustrated as being coupled to a white list data store 410 . the white list data store includes those files that have been identified as trustworthy files . in one embodiment , the white list data store 410 is a database of white listed files . while the present illustration identifies the white list service 408 and white list data store 410 as separate entities , it is a logical separation for illustration and discussion purposes . in an actual embodiment , the white list data store and the white list service may be incorporated as a single entity , or as a service offered on a computer . while in one embodiment , the white list data store includes only signatures of white listed files , the present invention is not so limited . quite frequently , the level of trust that a number of files has varies between files . for example , a file known to have been created by a user may enjoy a high level of trust by that same user . similarly , a file created by a trusted party , accompanied by a digital signature attesting to its authenticity , may enjoy the highest level of trust . alternatively , a file that has been quarantined in a so - called “ sandbox ” for several days , and that has not exhibited any signs of possessing malware , may be “ trusted ,” but perhaps to a lesser degree than one digitally signed by a trusted source . yet another alternative is that a particular file may receive positive feedback from users that it can be trusted . such file may receive a trust level based on the volume of feedback regarding its trustworthiness , and be especially useful with regard to identifying spyware and adware . thus , according to aspects of the present invention , the white list data store includes more than just file signatures of “ trusted ” files . while the preceding discussion of the present invention has been made in reference to a computer , it should be understood that the present invention may be implemented on almost any computing device , including , but not limited to , computers that have a processor , a communications connection , memory for storing information , and being capable of performing file signature generation . for example , a suitable computing device may be a personal computer , a notebook or tablet computer , a personal digital assistant ( pda ), mini - and mainframe computers , hybrid computing devices ( such as cell phone / pda combinations ), and the like . fig5 is a block diagram illustrating exemplary fields that may exist in a white list data store 410 . in one embodiment , the white list data store 410 will store a record for each white listed filed in the data store , and each record includes one or more fields for storing information . as shown in fig5 , each record in the white list data store 410 includes a signature field 502 . the signature field stores the file signature , whether or not the file signature was generated based only on more permanent portions of a file . as mentioned above , it is frequently useful to identify the level of trust that a particular file enjoys . thus , the exemplary records also include a trust field 504 . as illustrated , the trust field includes a numeric value from 1 to 10 , with 10 representing the highest trust and 1 the lowest . however , it should be understood that this ranking is illustrative only , and should not be construed as limiting upon the present invention . as yet a further alternative , the trust field 504 could also be used to identify malware . for example , if a file is assigned a trust level of 0 , this could be an indication that the file is known to be malware . also shown in the white list data store 410 is an additional data field 506 . the additional data field 506 , as its name suggests , includes information that may be useful to a user with respect to the white listed file . as shown in fig5 , the additional data field could identify the reasoning behind the assigned trust level of a file , such as file originator or source , observed behaviors , lack of malware behaviors , and the like . almost any pertinent information could be stored in the additional data field 506 . similarly , in alternative embodiments , any number of fields could be included in the white list data store 410 . fig6 is a flow diagram illustrating an exemplary routine 600 for determining whether a file is white listed as a trusted file . beginning at block 602 , the computer receives an unknown / untrusted file , meaning that the computer does not yet know whether the file is malware , or whether it has been white listed . at block 604 , a signature is generated for the received file . generating a signature for the file is described below in regard to fig7 . fig7 is a flow diagram illustrating an exemplary subroutine 700 for generating a file signature according to aspects of the present invention , and suitable for use by the routine 600 of fig6 . beginning at decision block 702 , a determination is made as to whether the file is a user - modifiable file . if the file is not a user - modifiable file , at block 704 , the exemplary subroutine 700 generates a signature for the file based on the entire file . thereafter , at block 710 , the exemplary subroutine 700 returns the generated signature and terminates . if the file is a user - modifiable file , at block 706 , the exemplary subroutine 700 filters out the user - modifiable portions of the file . at block 708 , the subroutine 700 then generates the file &# 39 ; s signature based on the remaining , unfiltered portions of the file . after having generated the file &# 39 ; s signature , at block 710 , the exemplary subroutine 700 returns the generated signature and terminates . with reference again to fig6 , after having generated the file &# 39 ; s signature , at block 606 , the exemplary routine 600 connects with a white list service 408 . as discussed above , the white list service may be a local service / file installed on the computer or on a local area network , or alternatively , a remote white list service such as identified in fig4 . additionally ( not shown ), there may be a plurality of white list services . for example , a white list service installed on the computer may contain a small number of file signatures that are frequently encountered by the computer . if a signature is not found in the local white list service , the computer may turn to a network white list service that contains a larger number of signatures . still further , if a signature is not found on either the local or network white list services , a remote / global white list service , such as white list service 408 of fig4 , may be consulted . of course , the remote white list service 408 will likely include only files that are globally available , such as help or service documents from an operating system provider . according to one embodiment , the local white list service is aware of , and in communication with , the network white list service , and the network white list service is aware of , and in communication with , the remote white list service , such that a single request to the local white list service successively checks another if the file &# 39 ; s signature is not found . after connecting with a white list service , at block 608 , the routine 600 submits the signature and obtains a trust level corresponding to the file . at decision block 610 , assuming the white list service also identifies malware ( though the present invention is not so limited ), a determination is made as to whether the file was identified as malware . if so , at block 612 , the routine processes the malware according to established procedures . processing malware is well known in the art , and includes actions such as deleting the file , quarantining the file , or purging the malware from the file . thereafter , the routine 600 terminates . if the file is not identified as malware according to the trust level obtained from the white list service 408 , at block 614 , the routine 600 admits the file to the computer system according to established policies relating to the level of trust for the file . for example , if the trust level is at its highest , the computer user is likely satisfied that the file is completely trustworthy , and can admit the file to the system for any purpose . alternatively , if the trust level is fairly low , the computer system may be programmed to admit the file to the system with certain constraints , such as , but not limited to , quarantining the file for a period of time , executing the file within a so - called sandbox , disabling certain features network ability while the file operates , and the like . after admitting the file to the computer system , the exemplary routine 600 terminates . while the above described routine 600 includes a binary , i . e ., yes / no , determination in regard to whether the file is or is not malware , in an actual embodiment , a number of determinations may be made according to the trust level associated with the file . for example , a determination may be made as to whether the trust level is greater than a value of 8 , such that any file with that level , or greater , of trust is automatically admitted . similarly , files with trust levels between 3 and 7 may be required to execute within a so - called sandbox for some period of time . still further , files with trust levels below 3 must be quarantined before admittance to the computer system . accordingly , the exemplary routine 600 should be viewed as illustrative only , and should not be construed as limiting upon the present invention . as indicated above , irrespective of the ability to generate a signature on more permanent aspects of a file to identify potential malware , such signatures cannot always catch all malware . thus , a computer user must be cautious by visiting trustworthy web sites and only downloading files / content known or trusted to be malware - free . this is especially true as a tendency persists that once a file or content is downloaded to a user &# 39 ; s computer , the file / content is presumed to be trustworthy and may be displayed , executed , installed , or otherwise utilized on the user &# 39 ; s local computer system . this presumption is further exacerbated because after a file or content is obtained , there has been no legitimate way to determine its origin . in this light , according to one embodiment , when a file is obtained from an external source ( external to the local computer ), the file is “ tagged ,” i . e ., associated with information identifying its origin . tagging information may comprise a variety of forms and information including , but not limited to , a uniform resource locator ( url ) or uniform resource identifier ( uri ) of the file &# 39 ; s origin , the author of the file , the domain from which the file was obtained , and the like . while the following description is made with regard to obtaining files from external sources , it is for illustration purposes only and should not be construed as limiting in any manner . for example , the term “ file ” may be viewed to include files , content , modules , data streams , and the like . the term “ obtaining ” a file ( or content ) is used to denote more than user directed downloading of content from an external source / location . of course , a user may obtain a file by directing an application , such as a web browser application , to download a file to the user &# 39 ; s local computer ; but a user may also obtain files via e - mail , as a result of a file copy operation ( initiated locally or externally ), by recording a data stream , as a product of a system update operation , and the like . in other words , obtaining a file refers to the addition of the file from an external source to the local computer , irrespective of the action that initiated the addition of the file to the local computer . in regard to tagging obtained files , fig8 is a block diagram of exemplary components of a computer system 800 suitable for generating signatures for files ( as described earlier ) and / or for tagging obtained files with tagging information . as shown , the exemplary computer system 800 includes a processor 802 and a memory 804 communicatively connected via a system bus 806 . the computer system 800 also includes a file system 808 ( typically as part of an operating system , not shown ) storing one or more files 810 , including externally obtained files 812 . the computer system 800 is shown as including a white - list data store 410 and a black - list data store 814 . as discussed above , the white - list data store 410 includes signatures of trusted applications , and may further include tagging information corresponding to trusted locations , authors , sources , etc . in contrast , the block - list data store 814 includes signatures of known malware , and may further include tagging information of untrustworthy locations , authors , sources , etc . also shown , the computer system may include an obtained files tag store 816 and a rules data store 818 . the obtained files tag store 816 stores information regarding files and their origins . the rules data store 818 includes predetermined rules with regard to how to display or act upon downloaded files , based , of course , on its corresponding tagging information . also , an anti - malware application 820 may optionally be included with the computer system 800 to validate whether or not a file is malware and , as described in more detail below , to optionally maintain the various lists of tagging information , trustworthy and untrustworthy external locations / sources . tagging obtained files may be implemented in a variety of manners , by both high level applications and / or low level system functions . for example , in order take advantage of established rules in regard to obtained files , each application that “ obtains ” files from external sources could be made responsible for tagging the obtained file with origin information . thus , applications such as the web browser , e - mail application , data streaming applications . remote file copy applications , and the like would each be required to tag a file , typically according to predetermined tagging requirements , as a file is obtained . alternatively , file tagging may be embedded / incorporated into various operating functions such that file tagging is performed automatically when obtaining content . for example , operating system api functions that download or copy a file from a remote / external location could be enhanced to tag each file as part of the its download / copy process . similarly , each file attached to an e - mail could be tagged with the sender &# 39 ; s e - mail address when it is are retrieved from a remote location , or when the attached file is saved to the computer system . moreover , when applications use various methods to obtain files from remote locations , which methods bypass normal operating system functions to tag the file , they would be responsible for tagging the file . as mentioned above , the rules data store 818 contains rules with regard to displaying , executing , installing , or acting upon obtained files . for example , the rules may specify whether or not a particular image file downloaded from a specific web page may be displayed according to the web site &# 39 ; s trustworthiness as established by the white - list and black - list data stores . similarly , rules may specify whether or not a downloaded application can operate freely on the computer system , should be executed within a so - called “ sandbox ,” or should be completely quarantined on the computer system . of course , information in the white - list data store 410 and black - list data store 812 ( as well as the rules that use the information ) may be updated as a user &# 39 ; s confidence in a particular source ( origin , domain , author , etc .) increases or decreases , or as files from that origin prove to be trustworthy . similarly , information as to trustworthiness , including the information in the white - list data store 410 and black - list data store 812 , and the rules data store 818 , may be updated or maintained by a third party , such as an anti - malware service installed on the computer or a system administrator . still further , each of the various data stores ( white - list , black - list , and rules ) may be user - configurable to heighten or lower the levels of restrictions placed on certain obtained files , or selectively enabled / disabled by the user . of course , while various components of an exemplary system 800 have been illustrated and described , these components should be viewed as logical components , not necessarily actual components . it should be appreciated that in an actual embodiment , the illustrated components may be combined with one or more other components , and / or with other components of a typical computer system that are not shown in fig8 . similarly , the various data stores , including the white - list data store 412 , the black - list data store 814 , the rules data store 818 , and the obtained files tag store 816 , should be viewed as logical data stores , and in an actual embodiment , each of these may be implemented as one or more separate data stores , or may be combine into one or more larger data stores . in regard to how obtained files are tagged , in most instances it is important that the file / subject matter is not modified . frequently , but not always , modification of the obtained file will invalidate its suitability for its intended use . accordingly , in many instances tagging information is associated with the content , and this association may be implemented in a variety of fashions . to that end , on some file / operating systems , such as microsoft &# 39 ; s ntfs file system , a single file is actually comprised of multiple data streams . for example , fig9 a illustrates an exemplary file 900 in a file system where each file may be comprised of one or more data stream , such as data streams 902 - 906 . as illustrated in fig9 a , file 900 comprises at least three separate data streams : a subject matter data stream 902 , a security related data stream 904 , and a tagging information data stream 906 . in contrast to file systems supporting multiple streams for a single file , some file system are implemented as a database , where each files is comprises of records and / or fields . thus , in regard to fig9 b , in a database file system a given file 900 may be comprised of multiple records and / or fields , including a file content record 912 , an access control list record 914 , and a tagging information record 916 . the records and fields of each file may be stored as contiguous or non - contiguous data ( as shown ). still further , some file systems are not particularly well suited to easily associate tagging information with the file in the file system . thus , as shown in fig9 c and as an alternative to a data stream or database file system , tagging information 922 could be stored separately from the obtained file 900 , such as in an obtained files tag store 816 . the obtained files tag store 816 stores information associated an obtained file with tagging information for the obtained file . clearly , while various embodiments / implementations for storing tagging information have been described , there are numerous ways in which tagging information may be associated with an obtained . file . accordingly , the above described implementations should be viewed as illustrative only , and not construed as limiting upon the present invention . in regard to tagging obtained files and content , fig1 is a flow diagram illustrating an exemplary routine 1000 for tagging an obtained file and , optionally applying rules according to the file &# 39 ; s origin . beginning at block 1002 , a file is obtained from an external location , i . e ., external to the local computer system . at block 1004 , the obtained file is tagged with the source location of the file . as described above , this may be done by the high level application that initiates obtaining the file , or by low level functions ( i . e ., operating system services ) called by the high level application to obtain the content , or a combination of both . moreover , tagging information may be stored in an alternate data stream , as a field or record associated with the file in a database file system , or in a obtained file tag store 816 . not all obtained files are immediately acted upon ( beyond simply storing the file to the local computer system .) if no immediate action is required , the exemplary routine 1000 may terminate . however , quite frequently a file is obtained for immediate action , such as displaying a downloaded image or web page on the computer , or execution on the computer . thus , after tagging the file with its source information ( e . g ., a path , url , domain , author , etc . ), the exemplary routine 1000 optionally processes the obtained file according to predetermined rules from a rules data store 818 . more particularly , at block 1006 the exemplary routine 1000 determines the trustworthiness of the obtained file according to its tagging information and the information in the white - list data store 410 , the black - list data store 812 , and / or the anti - malware application 820 . once the trustworthiness ( or un - trustworthiness ) of the file is determined , at block 1008 , the obtained file is processed according a set of predetermined rules based on the trustworthiness particularly , and tagging information generally . for example , if , according to the tagging information , the obtained file originated from a source location known to frequently distribute malware , as defined in the black - list data store 814 or by the anti - malware application 820 , the predetermined rules may dictate that the obtained file be quarantined , or executed within a so - called sandbox to limit any potential ill effects its display , execution , or installation may cause on the local computer system . similarly , if the obtained file is identified as a trustworthy file , such as though information in the white - list data store 410 , displaying , executing , installing , etc ., may be carried out on the local computer system without restrictions . with regard to the trustworthiness of an obtained file , various means may be employed to rate or establish the trustworthiness of an origin . for example , a value may be associated with an origin of files that indicates the level of trustworthiness for files from that origin ( e . g ., uri , author , domain , stream , etc .) the gradation of these values may range from a simple trust / no - trust value on up . for example , a grading of values from 0 to 10 , with 0 representing a non - trusted origin while 10 represents a completely trusted origin . moreover , when an origin is unknown ( at least to its trustworthiness ), some value such as 3 or 4 may be used to indicate the unknown quality of this origin . of course , quite frequently , perhaps the majority of the time , an obtained file may not be identified as either trustworthy or untrustworthy according to information in the black - list data store 814 , the white - list data store 410 , or from the anti - malware application 820 . simply put , the origin of the file is unknown as to whether or not it is trustworthy . however , even though a file &# 39 ; s origin may not be evaluated as trustworthy or untrustworthy , predetermined rules from the rules data store 818 could be used to determine how , if at all , the obtained file ( whose origin is not known ) may be displayed , executed , or otherwise used on the local computer system . once the obtained file has been processed , the exemplary routine 100 terminates . as an alternative to the above described routine 1000 , an alternate exemplary routine 1100 for processing an obtained file is presented . beginning at block 1102 , a file is obtained from an external location . at block 1104 , the obtained file and its origin are delivered to the computer system &# 39 ; s anti - malware application 820 . similar to the process described in regard to fig1 , the high level application that initiated obtaining the content from the external location may call the anti - malware application 820 with the obtained file and its origin , or alternative , calling the anti - malware application 820 with the obtained file and its origin may be integrated into the operating system functions that are used to obtain the content . at block 1106 , the anti - malware application 820 persists / stores the obtained file &# 39 ; s origin ( i . e ., “ tags ” the obtained file ). of course , this may mean that the anti - malware application 820 stores the origin in an alternate data stream , as a record in the database file system , or in an obtained files tag data store 816 . alternatively , while not shown , the anti - malware application 820 may persist the obtained file &# 39 ; s origin in a data store accessible only to or by the anti - malware application 820 . in fact , placing the obtained file &# 39 ; s origin in a data store accessible only to the anti - malware application 820 could lead to greater security . for example , when tagging information is available generally , such as in an alternate data stream , a field in a database , or a record in an obtained files data store 816 , a particular malware process may target that information and corrupt it such that predetermined rules would allow that file &# 39 ; s execution when it would otherwise not be permitted . however , if the tagging information ( i . e ., the obtained file &# 39 ; s origin ) were located in a data store accessible only to the anti - malware application 820 , it would be that more difficult to corrupt and compromise the tagging information . assuming that immediate action is requested on the obtained file , the obtained file is optionally processed . at decision block 1108 , a determination is made as to whether the obtained file is malware . if the anti - malware application stores this information , determining the obtained file &# 39 ; s trustworthiness is a matter of querying the anti - malware application 820 regarding the obtained file . the anti - malware application 820 then returns the obtained files trustworthiness . if the obtained file is trustworthy , at block 1110 the file is processed according to the requested action , i . e ., execution , display , installation , etc . thereafter , or if the obtained file is not trustworthy , the routine 1100 terminates . as mentioned above , tagging an obtained file may be implemented at the operating system level such that when a file is obtained , it is automatically tagged . fig1 is a block diagram illustrating aspects of an exemplary operating system 1200 configured to automatically tag an obtained file with tagging information . the illustrated operating system includes typical logical components such as a file system component 1202 , a memory management component 1204 , an operating system kernel component 1206 , an application execution component 1208 , and a plurality of api functions 1210 that are callable by executing applications . key api functions , such as copy 1212 , url download 1214 , and the like are configured to automatically tag each file , i . e ., store the origin information for each obtained file , such as storing the tagging information in the obtained files tag store 816 , as indicated by arrow 1216 of fig1 . while a very simplified , logical set of operating system components have been shown in fig1 , it is for illustration purposes only , and should not be construed as limiting upon the present invention . clearly , those skilled in the art will appreciate that nearly all operating systems are very complex system . however , as operating systems are known in the art , the simplification shown in fig1 is to illustrate that various functions offered by the operating system are configured to automatically provide tagging information for each obtained file . while various embodiments , including the preferred embodiment , of the invention have been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention .	7
hereinafter , a method of preparing a desensitizing solution used in the present invention will be illustrated , and the present invention will be described in further detail with reference to examples thereof and to comparative examples . production examples 1 to 5 represent the method of preparing the desensitizing solutions according to the present invention , and production examples 6 to 8 represent the method of preparing the desensitizing solution according to the prior art . a desensitizing solution was prepared in accordance with the following recipe . ______________________________________water 685 parts50 % solution of polyaluminum 300 partschloride (&# 34 ; takivine # 1500 &# 34 ;, aproduct of taki chemical co .) d -(+)- glucosamine hydrochloride 5 partsglycerine 10 partstotal : 1 , 000 parts______________________________________ ph measurement value : 4 . 23 a desensitizing solution was prepared in accordance with the following recipe . ______________________________________water 795 parts50 % solution of polyaluminum 150 partschloride (&# 34 ; vannoltan white &# 34 ;, aproduct of taki chemical co .) d -(+)- glucosamine hydrochloride 30 partsmalonic acid 25 partstotal : 1 , 000 parts______________________________________ ph measurement value : 3 . 51 a desensitizing solution was prepared in accordance with the following recipe . ______________________________________water 690 parts50 % solution of polyaluminum 250 partschloride (&# 34 ; takivine # 1500 &# 34 ;, aproduct of taki chemical co .) glucosamine hydrochloride 50 parts ( a product of taiyo chemical co .) gum arabic 10 partstotal : 1 , 000 parts______________________________________ ph measurement value : 4 . 19 a desensitizing solution was prepared in accordance with the following recipe . ______________________________________water 410 parts50 % solution of polyaluminum 500 partschloride (&# 34 ; vannoltan white &# 34 ;, aproduct of taki chemical co .) glucosamine hydrochloride 60 parts ( a product of taiyo chemical co .) tartaric acid 30 partstotal : 1 , 000 parts______________________________________ ph measurement value : 3 . 37 a desensitizing solution was prepared in accordance with the following recipe . ______________________________________water 590 parts50 % solution of polyaluminum 150 partschloride (&# 34 ; pac300m &# 34 ;, a productof taki chemical co .) 50 % solution of polyaluminum 200 partschloride (&# 34 ; vannoltan white &# 34 ;, aproduct of taki chemical co .) d -(+)- glucosamine hydrochloride 30 partspotassium aluminum sulfate 30 partstotal : 1 , 000 parts______________________________________ ph measurement value : 3 . 65 a desensitizing solution was prepared in accordance with the following recipe . ______________________________________water 670 parts50 % solution of polyaluminum 300 partschloride (&# 34 ; takivine # 1500 &# 34 ;, aproduct of taki chemical co .) succinic acid 10 partsethylene glycol monoethyl ether 10 partsinositol 10 partstotal : 1 , 000 parts______________________________________ ph measurement value : 4 . 03 a desensitizing solution was prepared in accordance with the following recipe . ______________________________________water 910 partsphytic acid 30 partsmalonic acid 20 partsadipic acid 20 partsethylene glycol 16 partsedta - disodium 4 partstotal : 1 , 000 parts______________________________________ a desensitizing solution was prepared in accordance with the following recipe . ______________________________________water 889 partspotassium ferrocyanide 20 partsammonium phosphate 60 partsdiammonium citrate 30 partsedta - disodium 1 parttotal : 1 , 000 parts______________________________________ a printing test of each of the desensitizing solutions described above was carried out in the following way . a form plate was produced by the use of an electronic processing machine ( ap - 10ex ) manufactured by iwasaki tsushinki k . k ., a master paper ( el - 3 ) and a developing solution ( ap - 10 set ). the form plate thus produced was treated with the desensitizing solution prepared by the production example given above , and printing was made by an offset press ( ab dick 350 ) manufactured by ab dick co ., u . s . a . a printing ink &# 34 ; f gloss black # 85 &# 34 ; of dai - nippon ink & amp ; chemicals co . was used as the printing ink and a solution u ( diluted 10 times ) of iwasaki tsushinki k . k . as used as the solution . desensitizing was effected using a desensitizing processor ( an apparatus that automatically processes the offset master plate for desensitizing ) of ricoh co . in accordance with the following sequence : example number and printing results ( number of sheets in which stain occurred , and inking property ) are tabulated in table given below . ______________________________________examples and printing result printing resulttreating condition no . of inkingexample es - 1 es - 2 non - stained property______________________________________example 1 production production 5 , 000 or more ∘ example 1 example 7example 2 production production 5 , 000 or more ∘ example 2 example 7example 3 production production 5 , 000 or more ∘ example 3 example 7example 4 production production 5 , 000 or more ∘ example 4 example 7example 5 production production 5 , 000 or more ∘ example 5 example 7example 6 production production 5 , 000 or more ∘ example 2 example 8example 7 production production 5 , 000 or more ∘ example 3 example 8comparative production production from 1 , 500 δexample 1 example 6 example 7comparative production production from 2 , 000 δexample 2 example 6 example 8comparative production production from 100 xexample 3 example 7 example 7comparative production production from 750 δexample 4 example 8 example 8______________________________________ note : 1 ) inking property was evaluated as follows : ∘: good , δ not good , x : bad 2 ) es1 : primary desensitizing solution es2 : secondary desensitizing solution as can be understood clearly from the results tabulated in the table given above , excellent printed matter could be obtained in examples 1 to 7 using the desensitizing solutions ( production examples 1 to 5 ) containing the basic aluminum chlorides and their derivatives , and glucosamine and its derivatives . according to comparative examples 1 to 4 using the desensitizing solutions ( production examples 6 to 8 ) of the prior art consisting primarily of the basic aluminum chlorides and their derivatives , or the desensitizing solutions consisting primarily of phytic acid , the ferrocyanides and the ferricyanides , however , the strength of the hydrophilic coating was weak , and stain in the non - image portions was remarkable , so that satisfactory printed matter could not be obtained . as described above , the desensitizing solution according to the present invention does not contain the ferrocyanide and ferricyanide compounds which would otherwise result in the environmental pollution and are deteriorated by light and heat , can form a hydrophilic coating having a high physical strength under any desensitizing condition , particularly in processor desensitizing , and has an excellent inking property at the image portions .	1
typically , pulse width modulation is used to drive an inverter module for delivering power to a motor . the inverter module includes a set of solid state switches , such as insulated gate bipolar transistors ( igbts ) that are rapidly switched on and off to create an approximately sinusoidal waveform at the output of the inverter . because the motor is inductive , currents continue to flow even when the power module is disabled by the shutdown test pulse , which can result in the pulsed voltage output changing polarity instantaneously . at the end of the shutdown test pulse , when the power module is enabled , the voltage output can reverse polarity again . voltage polarity reversals in quick succession could result in a high voltage spike on the motor that may tend to damage motor winding insulation . to avoid this , present embodiments use a shutdown test pulse that is short enough in duration , that the output power from the inverter circuitry remains substantially unaffected . furthermore , the present embodiments may be adapted for motor drive systems having multiple inverter modules operating in parallel . for example , fiber optic components may be utilized to interface the control circuitry with the inverter circuitry of each of the multiple inverter modules . testing circuitry may be implemented on either side of the fiber optic interface in the control circuitry and in the inverter circuitry . as each of the inverters may include testing circuitry in communication with the control circuitry , such shutdown testing may be performed in parallel . fig1 represents a drive system 10 in accordance with aspects of the present disclosure . the drive system is configured to be coupled to a source of ac power , such as the power grid , as indicated by reference numeral 12 , and to deliver conditioned power to a motor 14 or any other suitable load . the system 10 comprises a plurality of individual drives coupled to one another in parallel to provide power to the load . in the example illustrated in fig1 , for example , a first drive 16 is illustrated as coupled to a second drive 18 and a further drive 20 which may be the third , fourth , fifth or any suitable terminally numbered drive . a presently contemplated embodiment may accommodate up to 5 parallel drives , although fewer or more may be configured in the same way . it should be noted that certain aspects of the techniques described herein may be used with a single drive . however , other aspects are particularly well - suited for multiple parallel drives . a controller 22 is coupled to the circuitry of each drive and is configured to control operation of the circuitry as described more fully below . in a presently contemplated embodiment , the controller may be housed in one of the drives or in a separate enclosure . appropriate cabling ( e . g ., fiber optic cabling ) is provided to communicate control and feedback signals between the controller and the circuitry of the individual drives . the controller will coordinate operation of the drives to ensure that the provision of power is shared and that operation of the drives is synchronized sufficiently to provide the desired power output to the motor . in the embodiment illustrated in fig1 , power filtration circuitry 24 may be provided upstream of the motor drives . such circuitry may be provided upstream of a line - side bus 26 or similar circuitry may be provided downstream of the bus in each of the drives . such circuitry may include inductors , capacitors , circuit breakers , fuses , and so forth that are generally conventional in design and application . the power bus 26 distributes three phases of ac power between the individual drives . downstream of this bus , each drive includes converter circuitry 28 that converts the three phases of ac power to dc power that is applied to a dc bus 30 . the converter circuitry 28 may be passive or active . that is , in a presently contemplated embodiment non - switched circuitry alone is used to define a full wave rectifier that converts the incoming ac power to dc power that is applied to the bus . in other embodiments the converter circuitry 28 may be active , including controlled power electronic switches that are switched between conducting and non - conducting states to control the characteristics of the dc power applied to the bus . continuing with the components of each drive , bus filtration circuitry 34 may be provided that conditions the dc power conveyed along the dc busses 30 . such filtration circuitry may include , for example , capacitors , inductors ( e . g ., chokes ), braking resistors , and so forth . in some embodiments common devices may be provided on the dc busses , which may be coupled to one another by links illustrated by reference numeral 32 . each drive further includes inverter circuitry 36 . as will be appreciated by those skilled in the art , such circuitry will typically include sets of power electronic switches , such as igbts and diodes arranged to allow for converting the dc power from the bus to controlled frequency ac output waveforms . the inverters thus create three phases of controlled frequency output , with each phase being shorted or combined along an output bus 38 . the combined power may be applied to output filtration circuitry 40 , which may include magnetic components that couple the output power between the phases . such circuitry may also be provided along the load - side bus 38 . the controller 22 will typically include control circuitry 42 that is configured to implement various control regimes by properly signaling the inverter circuitry ( and , where appropriate , the converter circuitry ) to control the power electronic switches within these circuits . the control circuitry 42 may , for example , include any suitable processor , such as a microprocessor , field - programmable gate array ( fpga ), memory circuitry , supporting power supplies , and so forth . in motor drive applications , the control circuitry may be configured to implement various desired control regimes , such as for speed regulation , torque control , vector control , start - up regimes , and so forth . in the embodiment illustrated in fig1 , various functional circuit boards 44 are linked to the control circuitry and may be provided for specific functions . for example , a wide range of options may be implemented by the use of such circuitry , including the control regimes mentioned above , as well as various communications options , safety options , and so forth . the controller will typically allow for connection to an operator interface , which may be local at the controller and / or remote from it . in a presently contemplated embodiment , for example , an operator interface 46 may be physically positioned on the controller but removable for hand - held interfacing . the interface circuitry ( e . g ., portable computers ) may also be coupled permanently or occasionally to the controller , such as via internet cabling , or other network protocols , including standard industrial control protocols . finally , the controller may be coupled to various remote monitoring and control circuitry as indicated by reference numeral 48 . such circuitry may include monitoring stations , control stations , control rooms , remote programming stations , and so forth . it should be noted that such circuitry may also include other drives , such that the operation of the system 10 may be coordinated , where desired , with that of other equipment . such coordination is particularly useful in automation settings where a large number of operations are performed in a coordinated manner . thus , the control circuitry 42 may form its control in coordination with logic implemented by automation controllers , separate computers , and so forth . fig2 illustrates certain of the components that may be included within the individual drives described above . for example , the control circuitry 42 is illustrated as being coupled to power layer interface circuitry 50 . such circuitry will be provided in each drive and will operate independently within the drive , but in a coordinated manner under the control of the control circuitry . the power layer interface circuitry may include a range of circuits , such as a dedicated processor , memory , and so forth . in a presently contemplated embodiment , the power layer interface circuitry 50 includes an fpga that implements programming for carrying out control of the power electronic switches within the individual drive . the power layer interface circuitry thus communicates with the power layer as indicated by reference numeral 52 , which is itself comprised of sets of power electronic devices , such as igbts and diodes . these switches are illustrated generally by reference numeral 54 . in a typical arrangement , the switches may be provided on a single support or on multiple supports . for example , in a presently contemplated embodiment separate supports are provided for each phase of power , with multiple igbts and diodes being provided on each support . these devices themselves may be constructed in any suitable manner , such as direct bond copper stacks , lead frame packages , and so forth . in general , one or several types of feedback will be provided in the circuitry as indicated by reference numeral 56 . such feedback may include , for example , output voltages , output currents , temperatures , and so forth . other feedback signals may be provided throughout the system , such as to allow the control circuitry to monitor the electrical parameters of the incoming power , the outgoing power , the dc bus power , and so forth . in addition to monitoring electrical parameters , present techniques may also provide power supply failure protection from conditions such as overvoltage due to source or component failures . in some embodiments , the control circuitry 42 may also be coupled to a safe torque off ( sto ) option board 76 configured to control safety functions related to the powering of the switches 54 . the structure and operation of the control circuitry may be substantially similar to those described in u . s . published patent application no . 20100123422 , entitled “ motor controller with deterministic synchronous interrupt having multiple serial interface backplane ,” filed by campbell et al . on nov . 17 , 2008 , which is hereby incorporated into the present disclosure by reference . fig3 illustrates an exemplary manner in which certain functional components of the individual drives may be coupled to provide coordinated operation of the drives within the system . as shown in fig3 , the control circuitry 42 is coupled to the inverter circuitry 36 by the intermediary of optical interfaces . as indicated above , the control circuitry will include any suitable processing circuitry , such as an fpga 58 in the embodiment illustrated in fig3 . this fpga may include its own memory or separate memory may be provided ( not shown ). as also mentioned above , the fpga 58 may perform various functions in cooperation with various function boards as indicated by reference numeral 60 . the fpga 58 is connected to an option board 76 , labeled in fig2 and 3 as the safe torque off ( sto ) board 76 , which may disable one or more of the drives based on certain detected diagnostic errors . the board 76 includes a processor 78 which can disable a device based on the logic levels of a power supply signal and an enable signal input to the power supply circuitry 80 and the enable circuitry 82 , respectively . the board 76 may be interfaced with the control circuitry 42 by a backplane board 84 . in some embodiments , the back plane board 42 may include dedicated lines between the control circuitry 42 and the board 76 , including lines for the power supply signal and the enable signal . as will be discussed , the power supply and enable signals may be generated for shutdown diagnostic tests conducted for each of the parallel motor drives which determine the shut - down capabilities of the drives . furthermore , in some embodiments , other circuitry may be used to conduct various diagnostic tests . such circuitry may also be interfaced with the control circuitry 42 by the backplane board 84 . for example , the backplane board 84 may have dedicated lines between the control circuitry 42 and a speed monitor board which may use pulse tests to monitor and / or control a switching speed of the switches 54 . such additional circuitry may be used in addition to or in place of the shutdown diagnostic circuitry found in the sto board 76 . the fpga 58 communicates with the various inverters by a fiber optic interface 62 which communicates with a mating fiber optic interface 64 . this interface distributes signals to series of fiber optics interfaces 66 for the individual drives . these components , in turn , communicate with a fiber optic interface 68 at the power level of each inverter . for example , the fiber optics interfaces 66 in the interface circuitry 50 may be coupled to transceivers 86 which receive and / or transmit signals from the fiber optics interfaces 66 to the fiber optic interface 68 of each inverter . while the present disclosure provides fiber optics technology as an example for communication between the control circuitry 42 and each of the parallel inverters 36 , other types of communication paths may be used . for example , suitable interfaces could be used for connecting the control circuitry 42 and the inverter 36 via a synchronous bus . the circuitry at the power level will typically include a further fpga 70 which may be provided on a common support ( e . g ., circuit board ) with a power circuit interface 72 . the support , which may be the present context termed the power layer interface , serves to receive signals from the control circuitry , to report signals back to the control circuitry , to generate drive signals for the power electronic switches , and so forth . the circuitry may also perform certain tests functions , such as to verify the one or more drives can be disabled when desired . the power circuit interface 72 may convert control signals to drive signals for driving the power circuitry as indicated generally by reference numeral 74 . the power circuitry 74 will include the power electronic switches as described above . the implementation of fpgas in both the control circuitry 42 and at the power level of the inverters 36 is generally referred to as a dual fpga configuration . the dual fpga configuration may provide diagnostic redundancy between the control circuitry 42 and the power layer interface circuitry 50 . for example , in some embodiments , the control circuitry and power level fpga 58 and 70 includes circuitry and state machines for performing tests to determine the shut - down capabilities of each motor drive connected at the series of fiber optics interfaces 66 . the fpga logic on both sides of the interface circuitry 50 includes processors capable of processing the power supply signal and the enable signal in a shutdown diagnostic test controlled by the control circuitry 42 . the shutdown diagnostic test may refer to one or more tests controlled by the control circuitry 42 to test the ability of an inverter 36 to shut down safely . for example , a shutdown diagnostic test may include an enable test which is conducted by the control circuitry and / or the power level circuitry as described below . for example , as illustrated in fig4 , the control circuitry fpga 58 and the fpga 70 of each of the parallel inverters 36 may each include enable circuitry 88 and vcc circuitry 92 , which may each be used to test various components of a motor drive as part of the shutdown diagnostic test . in one embodiment , the enable circuitry 88 is configured to provide an enable signal ( e . g ., + 24 vdc ) which drives the switching of the igbt gates of an inverter drive 36 . the enable circuitry 88 may conduct a pulse test to test the ability of the inverter drive 36 to shut down in response to a pulsed voltage signal applied at the igbt gates . similarly , the vcc circuitry 90 is configured to provide a vcc signal ( e . g ., + 24 vdc ) which powers a dc to dc converter in the inverter drive 36 . the vcc circuitry 90 may conduct a pulse test to test the ability of the inverter drive 36 to shut down in response to a pulsed voltage signal applied at the dc to dc converter . failing the pulse tests of either the enable circuitry 88 or the vcc circuitry 90 may indicate that the ability of the inverter drive 36 to shut down does not meet certain standards , and the enable signal and / or the vcc signal may be discontinued from a failing inverter drive 36 , such that the inverter drive 36 and / or the igbts may be inhibited . in certain embodiments , it may be desired that all parallel - connected drives be shut down in the event of any such drive failing either of the tests ( or other tests ). in some embodiments , the enable test and the vcc test conducted via the enable circuitry 88 and vcc circuitry , respectively , may provide redundancy in testing to increase the integrity of the motor drive system . furthermore , the fpga 58 and 70 of the motor drive system may also include additional circuitry 92 which may be capable of conducting additional tests to determine the ability of the inverter drives 36 to shut down . the structure and operation of the shutdown circuitry may be substantially similar to those described in 20100088047 , entitled “ power converter disable verification system and method ,” filed by campbell , et al . on oct . 6 , 2008 , which is hereby incorporated into the present disclosure by reference . that reference discloses a circuit capable of quickly performing a shutdown test and “ latching ” the results of the test without perturbing the output signals from an inverter used to drive a motor . as larger motors and / or larger loads typically use parallel motor drives , in accordance with the present techniques , shutdown diagnostic testing may also be performed in parallel . fig5 - 7 are flow charts which depict processes involved in parallel shutdown diagnostic testing for a multi - drive network . specifically , fig5 depicts a process 94 for determining the power block configuration in systems with multiple power blocks configured in parallel , fig6 depicts a process 106 for conducting an enable test once the power block configuration is determined , and fig7 depicts a process 122 for conducting a vcc test once the power block configuration is determined . beginning first with fig5 , the process 94 begins by supplying ( block 96 ) power to the different control components of the power drive system , including the control circuitry 42 , the interface circuitry 50 , and the inverter circuitry 36 . when the components are powered , the fiber optics transceivers 86 are read to determine ( block 98 ) which of the power blocks ( e . g ., which of n number of inverters 36 ) are configured or in operation . unused channels , or power blocks not in communication with the interface circuitry 50 , may be decoupled from its respective transceiver 86 . once the configured channels are determined , the power structure configuration may be defined ( block 100 ). the power structure configuration may be set ( block 102 ) internally to the fpga logic 58 and 70 and may be accessible by the control circuitry 42 , thus establishing the shutdown test configuration during shutdown diagnostic testing . though multiple channels may be available , and not all channels may be utilized at one instant , the power block configuration determination process 94 may allow shutdown diagnostic testing ( e . g ., pulsed enable test or pulsed vcc test ) to be conducted ( block 104 ) for only active channels . thus , inactive channels will not return error signals , as the shutdown test configuration does not include inactive channels and sets only the active channels to the logic in the fpga 58 and 70 . in one or more embodiments , shutdown diagnostic testing includes an enable test 106 provided in the flow chart of fig6 and a vcc test 122 provided in the flow chart of fig7 . each of the enable test 106 and the vcc test 122 are suitable for multi - channel power drive configurations and can be performed when the power block configuration is determined ( as in fig5 ). the enable test 106 may start by pulsing ( block 108 ) the enable input signal from a logical one ( which may provide + 25 vdc to the igbt gates of the tested inverter 36 ). the response to the enable input signal pulse , referred to as the enable return signal , may be detected ( block 110 ), and the duration of a change in logical states of the return signal may be measured . processors or circuitry in the inverter fpga 70 may determine ( block 112 ) whether the duration of the change in logical states of the return signal is less than 5 μs . a duration of the change in logical states of the return signal as less than 5 μs indicates a successful response in the enable test 106 . the inverter fpga 70 may communicate ( block 114 ) the response through the fiber optics interface circuitry 50 with the control circuitry 42 . the control circuitry fpga 58 may then communicate with the sto board 76 which may assert ( block 116 ) the safe enable input signal high to a logical one . if the duration of the change in logical states of the return signal is not less than 5 μs , the process 106 may determine that the enable test 106 did not return a successful result for the inverter 36 tested . the inverter fpga 70 may communicate ( block 118 ) through the fiber optics interface circuitry 50 with the control circuitry 42 . the control circuitry fbga 58 may then communicate with the option board 76 which may assert ( block 120 ) the enable input signal from the enable circuitry 82 low to a logical zero . in embodiments , the enable test 106 may be performed repeatedly at certain increments ( e . g ., every 100 ms , every 250 ms , etc .). in some embodiments , the control circuitry 42 may control and / or initiate the enable test 106 based on , for example , configuration changes in the parallel operating inverter drives 36 . turning now to fig7 , the vcc test 122 may begin by pulsing ( block 124 ) the vcc test input signal from a logical one ( which may provide + 25 vdc to the dc to dc bridge of the tested inverter 36 ). in some embodiments , the vcc test input signal may be generated to follow the enable test 106 . for example , the vcc test 122 may be initiated approximately 100 μs after the initiation of the enable test 106 . in other embodiments , the enable test 106 and the vcc test 122 can be implemented substantially simultaneously , or different lag times between the enable test 106 and the vcc test 122 can be implemented , depending on the function of the system 10 . the response to the vcc test input signal pulse , referred to as the vcc test return signal , may be detected ( block 126 ), and the duration of a change in logical states of the vcc test return signal may be measured . processors or circuitry in the inverter fpga 70 may determine ( block 128 ) whether the duration of the change in logical states of the vcc test return signal is less than 100 μs . a duration of the change in logical states of the vcc test return signal as less than 100 μs indicates a successful response in the vcc test 122 . the inverter fpga 70 may communicate ( block 130 ) the response through the fiber optics interface circuitry 50 with the control circuitry 42 . the control circuitry fpga 58 may then communicate with the option board 76 which may assert ( block 132 ) the vcc test input signal high to a logical one . if the duration of the change in logical states of the return signal is not less than 100 μs , the process 122 may determine that the vcc test 122 did not return a successful result for the inverter 36 tested . the inverter fpga 70 may communicate ( block 134 ) through the fiber optics interface circuitry 50 with the control circuitry 42 . the control circuitry fbga 58 may then communicate with the option board 76 which may assert ( block 136 ) the vcc test input signal from the vcc circuitry 80 low to a logical zero . in embodiments , the enable test 122 may be performed repeatedly at certain increments ( e . g ., every 100 ms , every 250 ms , etc .). in some embodiments , the control circuitry 42 may control and / or initiate the vcc test 122 based on , for example , configuration changes in the parallel operating inverter drives 36 . it should be noted that the foregoing verification tests may be run in parallel or sequentially , and are particularly designed to be run on multiple parallel inverter circuits , with coordinated reporting of the results of the tests . moreover , the tests may be run during operation of the parallel drives without perturbing their normal drive functionality . that is , in a presently contemplated embodiment , when an option board is present for initiating the test , such tests may be run every 250 ms . when an option board is not present , the common control circuitry itself may launch such tests , such as , in the same embodiment , every 400 ms . once initiated , the control circuitry prompts the power layer circuitry to actually perform the desired tests and then to report back the results to the control circuitry . the coordination of reporting may be accomplished in a number of ways , including by setting and changing logical flags as discussed above . in a presently contemplated embodiment , the option board ( if present ) or common control circuitry may execute code that effectively combines the received test results . for example , the circuitry may execute an algorithm that may be expressed : the logic summarized is indicated as relating to the enable test , although similar logic may be used for the vcc test ( or other tests performed ). as will be appreciated by those skilled in the art , this algorithm effectively checks to determine whether multiple drives are “ logged in ” to the system , and then logically combines results into an overall or composite result . that is , when each drive is started , the drive “ logs in ” to the control circuitry . the log - in check allow the same logic to be used for multiple drives without returning a false failure in the event that one or more drives is not present ( the logic here allows for the control circuitry to use the same test result combination logic for up to 5 drives . a result bit is then set to a default value , and the logic requires that all tests for all drives ( that have logged in ) be passed before the result bit will be changed to a “ pass ”. such logic may be implemented by analog or digital components . it is also be noted that , although the results of the combination may be a single value , the control circuitry ( and / or the option board ) will typically receive and store information that served as the basis for the combined result . thus , the system would have , store , and can report which drive failed , the particular test failed , the time of the failure , and so forth . furthermore , while the present disclosure discusses mechanisms such as the enable test 106 and the vcc test 122 for shutdown diagnostic testing , the present techniques include various other mechanisms involving a dual fpga configuration . as discussed , various modifications may be made to the enable test 106 and / or the vcc test 122 . moreover , other types of tests which use the parallel communication techniques between the fpga 58 of the control circuitry 42 and the fpga 70 of the inverter 36 may be suitable for conducting shutdown diagnostic testing . while only certain features of the invention have been illustrated and described herein , many modifications and changes will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention .	7
referring now in detail to the drawings and in particular to fig1 thereof , a garage door structure 10 , in accordance with one preferred embodiment of the present invention , is shown generally as comprising a plurality of coplanar arranged , generally horizontally disposed door sections 12 which are hingedly or pivotably connected to one another by means of hinge assemblies 14 ( best seen in fig5 ). as will be appreciated by those skilled in the art , the door structure 10 is normally disposed in a generally vertical orientation and is supported upon a plurality of rollers which cooperate with a door track assembly , whereby the entire structure may be moved upwardly from the position shown in fig1 to an elevated configuration providing access to the interior of an associated garage or the like . it is to be noted that while the principles of the present invention are described herein as being specifically applicable to the garage door structure 10 , the panel construction embodied in the door structure 10 may also find application to various types of building walls known in the art as post construction or the like , such as is employed in shed building and auxiliary building constructions . typically , the panels which are incorporated in the garage door structure 10 would be supported upon a suitable structural frame of such a building in a manner well known in the art . in such structures , it is often desired that the panels have substantial resistance to bending , for example , when subjected to high wind loading . it is also appropriate to have little or no sag in the panels when they are positioned horizontally , such as in the case with the garage door structure 10 depicted in fig1 . another desirable feature is to provide a baffle effect between adjacent panels , that is , the provision of a nesting or interfitting relationship between adjacent panel edges which inhibits or prevents the passage of air therebetween . this baffle effect should not interfere with the ability of the respective sections to pivot or rock relative to one another , as is typically necessary in connection with sectional - type garage doors , such as the door structure 10 . the panels should also be capable of stacking when shipping to provide for a minimum of noise and vibration , and finally , it is desirable that there be a minimum of heat conduction between the opposite faces or panels of each structural section so as to provide a &# 34 ; thermal break &# 34 ; and thereby minimize the transfer of heat therebetween . as will hereinafter be described in detail , all of these objectives are accomplished by the present invention which , as previously mentioned , will find application not only to the garage door structure 10 specifically discussed herein , but also to building panels of a similar or identical construction as applied to pre - existing building framework or the like . referring now to fig2 and 3 , it will be seen that the lower horizontal edge of each of the door sections 12 defines a recessed area 22 , and that the upper horizontal edge of each of the door sections 12 defines a tongue area 24 , the areas 22 , 24 being nestingly engageable with one another such that the tongue area 24 is insertable within the recessed area 22 for purposes hereinafter to be described . the recessed areas 22 , 24 , along with the exterior and interior sides of each of the door sections 12 are defined by a pair of panel members , hereinafter identified as p i and p o for the interior and exterior panel members , respectively . the members p i and p o are preferably fabricated of roll formed steel or sheet metal and in accordance with one of the principles of the present invention , are identical to one another . as will be appreciated by those skilled in the art , by having the panel members p i and p o of an identical construction , manufacturing costs , i . e ., inventory costs , tooling , etc ., is minimized to the extreme . the recessed area 22 of each of the door sections 12 is defined by the lower horizontal edges of the panel members p i and p o which are formed with a downwardly projecting flange 26 defined by a return bend portion 28 that terminates in an inwardly projecting portion 30 that is arranged at generally right angles to the plane of the panels p i and p o . the innermost terminal edge of the portion 30 is formed with a reverse bend portion 32 which defines a recess 34 which functions in a manner hereinafter to be described . the tongue area 24 of each of the door sections 12 is defined by the uppermost horizontal edges of the respective panel members p i and p o and in particular , by having the upper horizontal edges laterally inwardly offset and inclined inwardly , as seen at 36 , so as to define lateral shoulders 38 . the inclined portions 36 of each of the panels p i and p o is formed with a u - shaped upper portion 40 which is connected to a laterally inwardly extending portion 42 that is arranged at generally right angles to the plane of the panels p i and p o . as in the case with the portion 30 , the inward terminal end of the portion 42 is formed with a reverse bend portion 44 defining a recess 46 , for purposes hereinafter to be described . fig4 best discloses the provision of a pair of generally u - shaped end members that are provided at the opposite ends of each of the door sections 12 . the end member representatively shown in fig4 is identified by the numeral 48 and is identical to the end member at the opposite end of the associated door section 12 . the end member ( s ) 48 is of a generally u - shaped construction , as previously mentioned , and comprises a central web in a pair of flange portions which are adapted to be secured , as by spot welding or the like , to the interior edges of the associated panels p i and p o so as to close the longitudinally opposite ends of the door section 12 . by having the end members 48 disposed interiorly of the opposite ends of the door section 12 , the exterior surfaces of the panels p i and p o are continuous , whereby the sections 12 may be stacked for transportation and will not be subject to vibration , etc ., as will be appreciated by those skilled in the art . disposed between and laminated to the interior surfaces of the panels p i and p o is an internal core member , generally designated by the numeral 50 . the core 50 is preferably fabricated of a material such as expanded polystyrene and is preferably of a one - piece monolythic body which is coextensive of the interior of each of the door sections 12 . preferably , the core member 50 is of a relatively uniform thickness and is of generally rectangular shape , with the exception of recessed portions 52 along the upper inner and outer edges thereof which accommodate hinge reinforcement members hereinafter to be described disposed interiorly of the panel members p i and p o at longitudinal spaced positions along the door sections 12 corresponding to the hinge assemblies 14 . a layer of a suitable adhesive material , such as neoprene or a similar adhesive , as indicated at 54 , is provided interjacent the opposite sides of the core member 50 and the confronting surfaces of the panels p i and p o , the adhesive material 54 functioning to positively bond or laminate the panel members p i and p o and core member 50 into a rigid door section construction which will be found to be highly resistant to bending loads . adhesive material 54 may be of a heat reactivated type which has been found to provide for optimum strength , and the polystyrene core material has been found to exhibit extremely beneficial heat insulating characteristics to minimize heat transfer through the door sections 12 , as is well known in the art . in accordance with one of the principles of the present invention , the upper and lower edges of the panels p i and p o are secured to one another by a plurality of longitudinally spaced , generally c - shaped retaining clips , generally designated by the numeral 58 . in particular , and as best seen in fig2 and 5 , the clips 58 , which may be fabricated of metal or plastic , are adapted to be surmounted upon the return bend portions 32 and 44 at the lower and upper edges of the panels p i and p o and have the terminal ends of the clips 58 received within the recesses 34 and 46 , respectively . the clips 58 may be slid into position along the recesses 34 , 46 , and preferably the clips 58 are positioned longitudinally along the respective door sections 12 at the positions representatively shown in fig5 wherein the clips 58 are disposed interjacent the hinge assemblies 14 and interjacent the edges of the door sections 12 and conventional garage door rollers located therealong and the outermost of the hinge assemblies 14 . in accordance with one feature of the present invention , it is to be noted that when the upper and lower edges of the panels p i and p o are thus connected by the plurality of retaining clips 58 , there is no actual contact between the adjacent edge portions of the panels p i and p o , thereby providing a thermal break which minimizes to the extreme the conduction of heat between the panels p i and p o . operatively associated with each of the hinge assemblies 14 is a pair of hinge reinforcement members , generally designated by the numerals 60 and 62 , which are disposed within the upper and lower portions , respectively , of each of the door sections 12 . as shown in fig2 the lower hinge reinforcement member 62 , comprises a pair of spaced parallel side sections 64 interconnected by a laterally extending base or web portion 66 and is adapted to be nestingly received interiorly of the door section exterior panels p i and p o . suitable securing means , such as an appropriate adhesive bonding material , is utilized for operatively securing the reinforcement member 62 , as well as member 60 , in place . with reference again to fig2 it will be seen that the reinforcement member 60 associated with each of the members 62 is also of a generally c - shaped configuration and includes a pair of spaced parallel side portions 68 with a laterally interconnecting base or web portion 70 extending therebetween . in order to accommodate the laterally offset and inclined portions 36 and u - shaped bend portions 40 at the upper edges of each of the panels p i and p o , the hinge reinforcement members 60 are provided with laterally inwardly extending shoulders 72 which are formed with upper reverse bend portions 74 that are integrally connected to the web portion 70 , as illustrated . each of the hinge assemblies 14 comprises upper and lower pivotal hinge sections 78 and 80 , respectively , which are fixedly secured by any suitable means , i . e ., spot welding , sheet metal screws , bolts or the like , to the associated door sections 12 , with the hinge sections 78 , 80 of each of the assemblies 14 being pivotably connected by suitable hinge pins or pintles 82 in a manner well known in the art . as will be appreciated , the number of hinge assemblies 14 provided on the garage door structure 10 and in particular , interjacent each vertically adjacent pair of door sections 12 will depend upon the longitudinal length , i . e ., width , of the particular door structure 10 . typically , on a 16 foot wide door , three hinge assemblies 14 and their associated hinge reinforcement members 60 , 62 would be spaced longitudinally along the interconnection between each of the door sections 12 , whereas on an 8 or 9 foot wide door structure 10 , possibly only a single hinge assembly 14 would be utilized at the centerline of the door structure 10 , with the outer marginal edges of the respective door sections 12 being interconnected by the conventional roller hinge mechanisms used and known in the art . in accordance with one of the important features of the present invention and which contributes considerably to the energy effectiveness of the door structure 10 is the baffle effect provided by the operative relationship between the tongue area 24 at the upper longitudinal edge of each of the door sections 12 and the cooperative recessed or tongue receiving area 22 at the lower longitudinal edge of the next upwardly adjacent door section 12 . the tongue and recessed areas 24 , 22 , respectively , function to prevent drafts from passing directly through the door structure 12 yet permit the articulated or hinged interconnection between the sections 12 as is necessary to accommodate the sliding movement of conventional sectional - type doors . in order to supplement the baffle effect provided by the tongue and recessed areas 24 , 22 , a suitable weather seal element 84 is interposed between each of the door sections 12 , as is indicated in fig2 and 3 . the weather seals 84 preferably extend the entire width of each of the door sections 12 and may be operatively secured to either the underside of the upwardly adjacent door section 12 or the upper side of the shaped bend portion 40 of the next lower adjacent door section 12 . the weather seal 84 may be of any suitable construction , such as a suitable deformable or resilient polyolefin foam , having a pressure sensitive adhesive backing , as is well known in the art . a similar type sealing element 86 is preferably provided adjacent the longitudinally opposite edges of the door structure 10 and is adapted to sealingly engage the door structure 10 when the same is in its respective closed position , as is indicated in fig4 wherein the sealing element 86 is shown operatively associated with the door jamb 88 and in particular , mounted on the interior side of a suitable door framing member 90 , whereby to effectively preclude the passage of cold drafts , etc ., around the longitudinally opposite ends of the door structure 10 and its associated door frame . if desired , the door panels p o facing the exterior or outside of the associated garage structure , may have a plurality of decorative embossments or the like , representatively designated in fig1 and 7 by the numeral 92 . the embossments 92 are depicted as reverse raised panels and have a generally rectangular - shaped central depressed area 94 , although the embossments 92 may be of any other suitable design or configuration consistent with the aesthetic appearance which is to be achieved . it is to be noted that by virtue of the identical construction of the panels p i and p o and their resultant interchangeability , one set of door panels , for example , p o may be provided with the aforementioned embossments 92 , while the associated set of door panels p i may be provided with a different type of design , such as woodgraining or the like , whereby to provide for universality of installation , and also serve the secondary advantage of providing an aesthetically pleasant appearing interior surface on the subject door structure 10 , as will be appreciated by those skilled in the art . fig8 - 10 illustrate a slightly modified embodiment of the hinge reinforcement members hereinabove described and associated with each of the hinge assemblies 14 . in particular , fig8 - 10 illustrate the construction of upper and lower hinge reinforcements 100 and 102 associated with the upper and lower longitudinal edges of each of the door sections 12 . the members 100 , 102 may be similar or identical to the aforedescribed members 60 and 62 , respectively , insofar as comprising spaced parallel side portions 104 and 106 , respectively , and laterally extending base or web portions 108 , 110 , respectively ; however , the members 100 , 102 associated with each of the hinge assemblies 14 differ from the aforedescribed members 60 , 62 , as follows . the web portion 108 and 110 of the members 100 , 102 are formed with a plurality of alternately facing , generally l - shaped deformable fingers 112 which prior to assembly , are originally disposed in a position shown in fig1 and upon assembly , are adapted to be deformed downwardly to a position wherein the outer retaining lug portions 114 at the terminal ends of each of the fingers 112 moves into confining relationship with the return bend portion 32 and 44 at the upper and lower edges of the panels p i and p o , as best seen in fig8 whereby to cooperate in operatively securing the respective panels p i and p o together . the reinforcement members 100 , 102 may additionally be secured to the panels p i and p o , as by spot welding or the like or may be secured thereto by the same means in which the hinge sections 78 , 80 of each of the hinge assemblies 14 are secured in place , as will be appreciated by those skilled in the art . it will be seen from the foregoing that the present invention provides a novel building structure which is particularly , although not necessarily adapted for use as a sectional - type garage door . by virtue of the laminated construction between the inner core and outer or exterior metal panel members , a strong and highly energy efficient structure is provided which minimizes to the extreme , the tooling and attendant manufacturing expenses associated therewith . the baffle effect and thermal break achieved by the arrangement of the respective panel members p i and p o at the interconnection between the respective sections minimizes to the extreme the passage of cold drafts or the like between the sections and also minimizes the heat conduction directly therethrough by virtue of the fact that there is an air gap between the confronting edges of the panels p i and p o of each of the sections . another feature of the present invention resides in the highly improved aesthetic appearance of the building structure of the present invention which is achieved by having the structural reinforcement members , i . e ., hinge reinforcement members and end members , disposed interiorly of the panels p i and p o , which arrangement provides the additional advantage of minimizing the difficulties in storage and transport of the respective door sections . accordingly , the present invention will find considerable economies in production , will be easily installed and will have a long and effective operational life . while it will be apparent that the preferred embodiments of the invention disclosed are well calculated to fulfill the objects above stated , it will be appreciated that the invention is susceptible to modification , variation and change without departing from the proper scope or fair meaning of the subjoined claims .	4
explained below are embodiments of the invention in detail with reference to the drawings . fig2 a through 2e are cross - sectional views showing steps in a process for making a deep trench which has an aspect ratio of 10 or more according to the invention . the sample used here has a thermal oxide film ( 8 nm ), sin film ( 200 nm ) and bsg ( 700 nm ) stacked on a silicon substrate 1 . however , the thermal oxide film and the sin film are not shown in fig2 a through 2e . first , the silicon semiconductor substrate 1 undergoes thermal oxidation in an oxidizing atmosphere to form a thermal oxide film of 8nm thick on its surface . then a silicon nitride film is formed to the thickness of 200 nm . subsequently , a bsg film is formed thereon by cvd , for example . further , a resist 3 is coated on the bsg film by spin coating , for example ( fig2 a ). after that , using an exposure mask corresponding to a desired pattern , exposure and development are conducted to pattern the resist ( fig2 b ). thereafter , using the patterned resist 3 ′ as the etching mask , the bsg film 2 is etched to obtain a pattern as the hard mask ( fig2 c ). after that , the resist is removed , and baking of the patterned bsg film 2 ′ is executed ( fig2 d ). this baking is done for 300 sec , by supplying o 2 gas under the flow rate of 300 sccm and the pressure of 30 pa , and setting the temperature of the plate for supporting a wafer thereon at 250 ° c . as a result of the baking , moisture 4 is removed from the bsg film 2 ′. then , using the baked bsg film 2 ′ as the hard mask , the silicon substrate 1 is etched to make a deep trench ( fig2 e ). the bsg film is removed after the trench is made . thus , one of the features of the invention is that the bsg film is baked after etching thereof . in fig3 the upper graph shows a result of analysis of the gas coming off a bsg film made without baking when the temperature increases , and the lower graph shows the same about the bsg film baked in an atmosphere with a flow of n 2 gas at 250 ° c . for five minutes . the gas remarked here is water satisfying m / z = 18 . it is noted from these graphs that , when baking is executed , the quantity of the released moisture is effectively suppressed especially in the temperature range from 100 to 300 ° c ., and it is reduced also in the temperature range from 300to 550 ° c . since the release of moisture from bsg is in the range from 100 to 550 ° c ., it is effective to conduct baking of bsg at the highest possible temperature within that temperature range while satisfying conditions not inviting oxidization of individual material , not inviting deterioration of bsg and higher than the temperature during etching . fig5 through 9 are graphs showing experimental results of bsg films baked after etching and those made without baking . respective graphs shows , for individual items , data obtained by using bsg as the etching mask material and data obtained by using teos in a comparative manner . as explained below , by using the invention , remarkable improvement of the etching property was confirmed . in each of these drawings , data were taken at the center of the wafer , a position 10 mm distant from an edge of the wafer , and a position 25 mm distant therefrom . fig4 a and 4b are diagrams explaining the contents of individual dimensional used in fig5 - 9 . they define items about devices which were subjected to etching prior to trench etching in the status having formed the bsg film 2 ′ formed on the silicon substrate 1 and patterned as the hard mask as shown in fig4 a , and thereby obtained the trench 5 as shown in fig4 b . that is , dt depth shown in fig5 is the distance from the interface between the silicon substrate and bsg to the bottom surface of the trench . dt bottom diameter shown in fig6 is the diameter of the trench at the height of 0 . 5 μm above the bottom surface . selective ratio shown in fig7 is the ratio of the si etching rate relative to the mask material ( bsg or teos ). upper taper shown in fig8 is the slope angle at a top portion of the trench . lower taper shown in fig8 is the slope angle at a lower portion of the trench . as noted from these graphs , when a teos film is used , there is no difference in etching property between the case conducting baking and the case not conducting baking . however , when a bsg film is used , there is a difference in etching property between the case conducting baking and the case not conducting baking , and while the property is equivalent to that of the teos film when baking is conducted , deterioration appears about some items when baking is not conducted . more specifically , in the graphs showing the dt bottom diameter ( fig6 ), selectivity ( fig7 ) and lower tape angle ( fig8 ), only in case of non - baked bsg , they exhibit small values . a possible reason thereof is as follows . the bsg film as the mask material is also ablated during etching although the ablated amount is very small , and at that time , moisture contained in bsg is released into the chamber atmosphere from the ablated bsg film . additionally , since the wafer surface temperature rises to about 150 ° c . when the wafer is exposed to an electric discharge , also thereby , moisture is released from the bsg film into the atmosphere . once the moisture is released into the chamber atmosphere , oxygen is eventually supplied from water molecules . therefore , such release of moisture from the bsg film results in giving influences equivalent to those by adding oxygen to the etching gas . the taper angle in the etched configuration of the trench is normally adjusted by increasing or decreasing the quantity of oxygen to be added . this adjustment mechanism is similar to the mechanism by which the taper configuration is formed . that is , during etching , sibr 4 is generated as a main reaction product . at that time , if oxygen is added , sibr 4 generated as the reaction product couple with oxygen , and they form sibr x o y ( x and y are any arbitrary numbers ). since vapor pressure of sibr x o y is lower than that of sibr , it stacks on the wafer surface during etching . as a result , the stacked substance eventually accumulates onto side walls of the trench to make a taper on the etched configuration . if the quantity of oxygen to be added during etching is increased , the quantity of sibr 4 coupling with oxygen also increases , and more sibr x o y is produced . as a result , accumulation onto the side walls of the trench during etching also increases , and a more gentle taper angle is made . for the reasons explained above , when oxygen is added to the etching gas , the taper angle becomes gentler as the quantity of oxygen added increases . next made is a consideration about addition of moisture ( h 2 o ). in this case , moisture contains oxygen atoms , and under the existence of sibr 4 , sibr 4 is oxidized in the same process as that by addition of oxygen and generates sibr x o y . as a result , when moisture is added , it results in the same effect as that obtained by addition of oxygen , and the etched configuration exhibits a gentler angle . in the case where bsg is not baked , a larger quantity of moisture exits in bsg . therefore , as already explained , when the wafer temperature rises during etching , or bsg itself is etched , moisture contained therein is released during etching . as a result , moisture concentration in the etching gas atmosphere relatively increases , and it results in the same effect as that obtained by adding oxygen or moisture . as a result , the etched configuration is tapered , and the diameter of the trench decreases at its bottom . it has been explained heretofore that , because of the release of moisture from bsg , a large amount of sibr x o y is generated and increases the accumulation , and the etched configuration is therefore tapered . next explanation is made about the case where the tapered configuration having the narrower trench bottom after etching undergoes further progressive etching . in this case , there occurs a new phenomenon different from those reviewed above . etching reaction occurs at the trench bottom . however , as the diameter of the trench bottom is made narrower and smaller , the area of reaction decreases . therefore , quantity of sibr 4 produced by the etching reaction decreases as compared with the case having a larger trench diameter . at this step , since the quantity of sibr 4 itself which is the source of sibr x o y decreases , the quantity of accumulated substance decreases . accumulation onto the wafer surface also functions to suppress crumbling of bsg as the mask material due to etching . however , the decrease of the accumulation diminishes this effect , and hence results in increasing the crumbling amount of bsg as the mask material . according to an experimental result obtained this time , when the trench etching is progressed to the last , accumulation increases in the initial stage of the etching due to an increase of moisture , and the effect of making the tapered configuration appears . in the latter half of the etching , accumulation decreases due to a decrease of the quantity of the reaction product , and as a result , there appears the effect of increasing the clumping amount of bsg as the mask . regarding the other etching properties , i . e . trench depth ( fig5 ) and upper taper ( fig8 ), it is noted that , even when using bsg , there is no difference from the etching properties obtained by using teos when baking is conducted . regarding the etching rate of the bsg film by processing using nh 4 f + hf + h 2 o after making the trench , it has been confirmed that a high etching rate equivalent to that without baking is maintained . in this respect , as explained before , teos involves the problem that its ablation after making the trench is difficult . as explained heretofore , it has been confirmed that , by baking the bsg film , etching properties are improved as compared with the case without baking , and a high etching rate during processing by chemical liquids , which is a feature of the bsg film , can be maintained . in case of the teos film taken as a comparative example , since no difference is found in etching properties depending upon whether the baking is done or not done , changes in etching properties are caused by the use of bsg as the film . this directly evidences that those changes occur because the bsg film has a higher hygroscopic property . although the foregoing embodiment has been explained as using the bsg film as the hard mask material , the same effect of baking has been confirmed also when using bpsg and psg which are doped oxides having a high hygroscopic property like bsg . this effect is considered to derive high hygroscopic properties of bpsg and psg similar to that of bsg . since the purpose of baking is to remove moisture once absorbed by bsg , the length of time from baking of the bsg film to the etching is important . in a certain experiment , actually obtained was the result that the etching properties were not affected when the etching was conducted within 13 days after baking . however , the leaving time after baking cannot be determined definitely because the hygroscopic property of bsg may vary large depending upon its film quality . it is necessary to select an acceptable leaving time through experiments taking the environmental conditions and quality of the film into consideration . although the foregoing embodiment is directed to making a deep trench , the invention is also applicable to other processing including processing of bsg , bpsg , psg , etc . further , it is also applicable when using bsg as a hard mask material for making a shallow trench , for example . fig1 a through 10e are cross - sectional views showing process steps for forming an element isolation by a shallow trench which has an aspect ratio of less than 10 . first , the surface of a silicon substrate 21 is oxidized in an oxidizing atmosphere to make a 6 nm thick thermal oxide film 22 , followed by stacking thereon a silicon nitride film 23 to the thickness of 150 nm , bsg film 24 to 500 nm , and non - doped teos film 25 to 20 m , and coating thereon a resist 26 ( fig1 a ). then the coated resist 26 is patterned ( fig1 b ). using the patterned resist 26 ′ as a mask , the non - doped teos film 25 , bsg film 24 , silicon nitride film 23 and thermal oxide film 22 are selectively removed by etching ( fig1 c ). after that , the resist is removed from the surface of the wafer by electric discharge in an oxygen atmosphere to obtain the configuration shown in fig1 d . using the patterned non - doped teos film 25 ′ and bsg film 24 ′ as a mask , the silicon substrate is etched to make a shallow trench 26 . fig1 is a graph showing a result of comparison in terms of tapered angle of sti between samples prepared through or not through baking of bsg prior to silicon etching for making a shallow trench . for etching the silicon , cl 2 / o 2 gas was used . etching conditions were : 40 mtorr as pressure , 500 w as rf power , cl 2 = 100sccm and o 2 = 20 sccm as gas flow rates . as apparent from fig1 , the taper angle is 86 ° in the sample baked after silicon etching , but it is 82 ° in the sample prepared without baking . that is , sicl 4 generated as a reaction product of etching reaction during etching coupled with o to form sicl x o y , and it stacked and formed a taper on the etching configuration . without baking , however , since moisture in bsg was released during etching of the silicon and resulted in supplying excessive oxygen , the taper angle became steeper . the embodiment shown here is different from the first embodiment in making the non - doped teos film on the surface of bsg . however , after processing of bsg , the bsg surface is exposed , and moisture is absorbed into bsg from this portion . as a result , when bsg is baked , the moisture in bsg is removed , but without baking , moisture remains in bsg during etching . probably , this affected the etching properties . as reviewed above , even when another film exists on the bsg surface , in a process including a step which exposes the bsg surface , baking of bsg is effective . for the purpose of preventing absorption of moisture , it is generally employed to stack a thin film such as thin non - doped cvd sio film on the surface of a bsg , bpsg or psg film . if the process includes a step exposing bsg , bpsg , psg on the surface or a cross - sectional surface , moisture will be absorbed therefrom , and similarly causes changes of etching properties . in this case , by employing a baking process , etching properties can be improved . next explained is a case using bpsg as a part of an inter - layer insulating film . fig1 a and 12b are cross - sectional views under different steps of such an embodiment . first stacked sequentially on a silicon substrate 31 are a bpsg film 32 and a silicon dioxide ( sio 2 ) film 33 which is decomposed teos film . then , by using a resist ( not shown ) having formed a pattern of contact holes , the teos decomposed film and bpsg film are etched . as a result , side surfaces of the bpsg film are exposed ( fig1 a ). in this status , the bpsg film is baked at the temperature of 250 ° c ., and tungsten 34 as a contact wiring metal is filled in the contact holes as shown in fig1 b . as a result of evaluation of reliability of the contact wiring made in this manner , it was confirmed that the reliability was improved in the sample baked before filling the wiring material as compared with the sample prepared without baking . it is presumed that , without baking , moisture contained in bpsg gradually diffused , then interacted with tungsten as the wiring material to produce tungsten oxide , and the filled tungsten did not work as the wiring material . in contrast , when baking was conducted before burying the wiring material , moisture in bpsg was probably removed . probably , therefore , also in the later test , there was no diffusion of moisture from bpsg . this could be the reason why the reliability of the wiring was maintained . as explained above , when another film is formed on the surface , not only in a process including a step causing bsg , bpsg and psg to be exposed but also in a process in which bsg , bpsg or psg is never exposed but the thin film stacked thereon for the purpose of preventing absorption of moisture does not have a sufficient anti - hygroscopic property , baking proposed by the invention works effectively . baking conditions are not limited to those used in the embodiments , but they may be modified within an extent not departing from the concept of the invention , such as employing other gases , mixed gases , processing temperature , processing time , processing pressure , and so on . as described above , according to the invention , by baking a bsg , bpsg or psg film before etching or other processing , it is prevented from changing in configuration upon etching due to absorption of moisture .	7
a plasma reaction chamber typically consists of a vacuum chamber with an upper electrode assembly and a lower electrode assembly positioned therein . a substrate ( usually a semiconductor ) to be processed is covered by a suitable mask and placed directly on the lower electrode assembly . a process gas such as cf 4 , chf 3 , cclf 3 , hbr , cl 2 , sf 6 or mixtures thereof is introduced into the chamber with gases such as o 2 , n 2 , he , ar or mixtures thereof . the chamber is maintained at a pressure typically in the millitorr range . the upper electrode assembly is provided with gas injection hole ( s ), which permit the gas to be uniformly dispersed through the upper electrode assembly into the chamber . one or more radio - frequency ( rf ) power supplies transmit rf power into the vacuum chamber and dissociate neutral process gas molecules into a plasma . highly reactive radicals in the plasma are forced towards the substrate surface by an electrical field between the upper and lower electrodes . the surface of the substrate is etched or deposited on by chemical reaction with the radicals . the upper electrode assembly can include an inner electrode attached to a backing plate made of a different material from the inner electrode . the inner electrode is heated by the plasma and / or a heater arrangement during operation and may warp , which can adversely affect uniformity of processing rate across the substrate . in addition , differential thermal expansion of the inner electrode and the backing plate can lead to rubbing therebetween during repeated thermal cycles . rubbing can produce particulate contaminants that degrade the device yield from the substrate . to reduce warping of the inner electrode , described herein is a showerhead electrode assembly including a plurality of threaded fasteners such as bolts or cam locks engaged with the interior of a mounting surface of the inner electrode and a clamp ring around the edge of the inner electrode . the bolts or cam locks and clamp ring fasten the inner electrode to the backing plate at a plurality of positions distributed across the inner electrode . fig1 a shows a partial cross - sectional view of a portion of a showerhead electrode assembly 100 a of a plasma reaction chamber for etching semiconductor substrates . as shown in fig1 a , the showerhead electrode assembly 100 a includes an upper electrode 110 a , and a backing plate 140 a . the assembly 100 a also includes a thermal control plate 102 a , a temperature controlled upper plate ( top plate ) 104 a having liquid flow channels ( not shown ) therein . the upper electrode 110 a preferably includes an inner electrode 120 a , and an outer electrode 130 a . the inner electrode 120 a may be made of a conductive high purity material such as single crystal silicon , polycrystalline silicon , silicon carbide or other suitable material . the inner electrode 120 a is a consumable part which must be replaced periodically . the backing plate 140 a is mechanically secured to the inner electrode 120 a and the outer electrode 130 a with mechanical fasteners described below . the showerhead electrode assembly 100 a as shown in fig1 a is typically used with an electrostatic chuck ( not shown ) forming part of a flat lower electrode assembly on which a substrate is supported spaced 1 to 5 cm below the upper electrode 110 a . an example of such a plasma reaction chamber is a parallel plate type reactor , such as the exelan ™ dielectric etch systems , made by lam research corporation of fremont , calif . such chucking arrangements provide temperature control of the substrate by supplying backside helium ( he ) pressure , which controls the rate of heat transfer between the substrate and the chuck . during use , process gas from a gas source is supplied to the inner electrode 120 a through one or more passages in the upper plate 104 a which permit process gas to be supplied to a single zone or multiple zones above the substrate . the inner electrode 120 a is preferably a planar disk or plate . the inner electrode 120 a can have a diameter smaller than , equal to , or larger than a substrate to be processed , e . g ., up to 300 mm , if the plate is made of single crystal silicon , which is the diameter of currently available single crystal silicon material used for 300 mm substrates . for processing 300 mm substrates , the outer electrode 130 a is adapted to expand the diameter of the inner electrode 120 a from about 12 inches to about 17 inches ( as used herein , “ about ” refers to ± 10 %). the outer electrode 130 a can be a continuous member ( e . g ., a single crystal silicon , polycrystalline silicon , silicon carbide or other suitable material in the form of a ring ) or a segmented member ( e . g ., 2 - 6 separate segments arranged in a ring configuration , such as segments of single crystal silicon , polycrystalline silicon , silicon carbide or other material ). to supply process gas to the gap between the substrate and the upper electrode 110 a , the inner electrode 120 a is provided with a plurality of gas injection holes 106 a , which are of a size and distribution suitable for supplying a process gas , which is energized into a plasma in a reaction zone beneath the upper electrode 110 a . single crystal silicon is a preferred material for plasma exposed surfaces of the inner electrode 120 a and the outer electrode 130 a . high - purity , single crystal silicon minimizes contamination of substrates during plasma processing as it introduces only a minimal amount of undesirable elements into the reaction chamber , and also wears smoothly during plasma processing , thereby minimizing particles . alternative materials including composites of materials that can be used for plasma - exposed surfaces of the inner electrode 120 a and the outer electrode 130 a include polycrystalline silicon , y 2 o 3 , sic , si 3 n 4 , and aln , for example . in an embodiment , the showerhead electrode assembly 100 a is large enough for processing large substrates , such as semiconductor substrates having a diameter of 300 mm . for 300 mm substrates , the inner electrode 120 a is at least 300 mm in diameter . however , the showerhead electrode assembly 100 a can be sized to process other substrate sizes . the backing plate 140 a is preferably made of a material that is chemically compatible with process gases used for processing semiconductor substrates in the plasma processing chamber , has a coefficient of thermal expansion closely matching that of the electrode material , and / or is electrically and thermally conductive . preferred materials that can be used to make the backing plate 140 a include , but are not limited to , graphite , sic , aluminum ( al ), or other suitable materials . the backing plate 140 a is preferably attached to the thermal control plate 102 a with suitable mechanical fasteners , which can be threaded bolts , screws , or the like . for example , bolts ( not shown ) can be inserted in holes in the thermal control plate 102 a and screwed into threaded openings in the backing plate 140 a . the thermal control plate 102 a is preferably made of a machined metallic material , such as aluminum , an aluminum alloy or the like . the upper temperature controlled plate 104 a is preferably made of aluminum or an aluminum alloy . the outer electrode 130 a can be mechanically attached to the backing plate by a cam lock mechanism as described in commonly - assigned wo2009 / 114175 ( published on sep . 17 , 2009 ) and u . s . published application 2010 / 0003824 , the disclosures of which are hereby incorporated by reference . with reference to fig2 a , a three - dimensional view of an exemplary cam lock includes portions of the outer electrode 130 a and the backing plate 140 a . the cam lock is capable of quickly , cleanly , and accurately attaching the outer electrode 130 a to the backing plate 140 a in a variety of semiconductor fabrication - related tools , such as the plasma etch chamber shown in fig1 a . the cam lock includes a stud ( locking pin ) 205 mounted into a socket 213 . the stud may be surrounded by a disc spring stack 215 , such , for example , stainless steel belleville washers . the stud 205 and disc spring stack 215 may then be press - fit or otherwise fastened into the socket 213 through the use of adhesives or mechanical fasteners . the stud 205 and the disc spring stack 215 are arranged into the socket 213 such that a limited amount of lateral movement is possible between the outer electrode 130 a and the backing plate 140 a . limiting the amount of lateral movement allows for a tight fit between the outer electrode 130 a and the backing plate 140 a , thus ensuring good thermal contact , while still providing some movement to account for differences in thermal expansion between the two parts . additional details on the limited lateral movement feature are discussed in more detail , below . in a specific exemplary embodiment , the socket 213 is fabricated from high strength torlon ®. alternatively , the socket 213 may be fabricated from other materials possessing certain mechanical characteristics such as good strength and impact resistance , creep resistance , dimensional stability , radiation resistance , and chemical resistance may be readily employed . various materials such as polyamide - imide , acetals , and ultra - high molecular weight polyethylene materials may all be suitable . high temperature - specific plastics and other related materials are not required for forming the socket 213 as 230 ° c . is a typical maximum temperature encountered in applications such as etch chambers . generally , a typical operating temperature is closer to 130 ° c . other portions of the cam lock are comprised of a cam shaft 207 a optionally surrounded at each end by a pair of cam shaft bearings 209 . the cam shaft 207 a and cam shaft bearing assembly is mounted into a backing plate bore 211 a machined into the backing plate 140 a . in a typical application for an etch chamber designed for 300 mm semiconductor substrates , eight or more of the cam locks may be spaced around the periphery of the outer electrode 130 a / backing plate 140 a combination . the cam shaft bearings 209 may be machined from a variety of materials including torlon ®, vespel ®, celcon ®, delrin ®, teflon ®, arlon ®, or other materials such as fluoropolymers , acetals , polyamides , polyimides , polytetrafluoroethylenes , and polyetheretherketones ( peek ) having a low coefficient of friction and low particle shedding . the stud 205 and cam shaft 207 a may be machined from stainless steel ( e . g ., 316 , 316l , 17 - 7 , nitronic - 60 , etc .) or any other material providing good strength and corrosion resistance . referring now to fig2 b , a cross - sectional view of the cam lock further exemplifies how the cam lock operates by pulling the outer electrode 130 a in close proximity to the backing plate 140 a . the stud 205 / disc spring stack 215 / socket 213 assembly is mounted into the outer electrode 130 a . as shown , the assembly may be screwed , by means of external threads on the socket 213 into a threaded hole in the outer electrode 130 a . in fig3 , an elevation and assembly view 300 of the stud 205 having an enlarged head , disc spring stack 215 , and socket 213 provides additional detail into an exemplary design of the cam lock . in a specific exemplary embodiment , a stud / disc spring assembly 301 is press fit into the socket 213 . the socket 213 has an external thread and a hexagonal top member allowing for easy insertion into the outer electrode 130 a ( see fig2 a and 2b ) with light torque ( e . g ., in a specific exemplary embodiment , about 20 inch - pounds ). as indicated above , the socket 213 may be machined from various types of plastics . using plastics minimizes particle generation and allows for a gall - free installation of the socket 213 into a mating socket on the outer electrode 130 a . the stud / socket assembly 303 illustrates an inside diameter in an upper portion of the socket 213 being larger than an outside diameter of a mid - section portion of the stud 205 . the difference in diameters between the two portions allows for the limited lateral movement in the assembled cam lock as discussed above . the stud / disc spring assembly 301 is maintained in rigid contact with the socket 213 at a base portion of the socket 213 while the difference in diameters allows for some lateral movement . ( see also , fig2 b .) with reference to fig4 a , an exploded view 400 a of the cam shaft 207 a and cam shaft bearings 209 also indicates a keying pin 401 . the end of the cam shaft 207 a having the keying pin 401 is first inserted into the backing plate bore 211 a ( see fig2 b ). a pair of small mating holes ( not shown ) at a far end of the backing plate bore 211 a provide proper alignment of the cam shaft 207 a into the backing plate bore 211 a . a side - elevation view 420 a of the cam shaft 207 a clearly indicates a possible placement of a hex opening 403 a on one end of the cam shaft 207 a and the keying pin 401 on the opposite end . for example , with continued reference to fig4 a and 2b , the cam lock is assembled by inserting the cam shaft 207 a into the backing plate bore 211 a . the keying pin 401 limits rotational travel of the cam shaft 207 a in the backing plate bore 211 a by interfacing with a slot at the bottom of the bore 211 a . the cam shaft 207 a may first be turned in one direction though use of the hex opening 403 a , for example , counter - clockwise , to allow entry of the stud 205 into the cam shaft 207 a , and then turned clockwise to fully engage and lock the stud 205 . the clamp force required to hold the outer electrode 130 a to the backing plate 140 a is supplied by compressing the disc spring stack 215 beyond their free stack height . the cam shaft 207 a has an internal eccentric cutout which engages the enlarged head of the stud 205 . as the disc spring stack 215 compresses , the clamp force is transmitted from individual springs in the disc spring stack 215 to the socket 213 and through the outer electrode 130 a to the backing plate 140 a . in an exemplary mode of operation , once the cam shaft bearings 209 are attached to the cam shaft 207 a and inserted into the backing plate bore 211 a , the cam shaft 207 a is rotated counterclockwise to its full rotational travel . the stud / socket assembly 303 ( fig3 ) is then lightly torqued into the outer electrode 130 a . the head of the stud 205 is then inserted into the vertically extending through hole below the horizontally extending backing plate bore 211 a . the outer electrode 130 a is held against the backing plate 140 a and the cam shaft 207 a is rotated clockwise until either the keying pin reaches the end of the slot at the bottom of the bore 211 a or an audible click is heard ( discussed in detail , below ). the exemplary mode of operation may be reversed to dismount the outer electrode 130 a from the backing plate 140 a . with reference to fig4 b , a sectional view a - a of the side - elevation view 420 a of the cam shaft 207 a of fig4 a indicates a cutter path edge 440 a by which the head of the stud 205 is fully secured . in a specific exemplary embodiment , the two radii r 1 and r 2 are chosen such that the head of the stud 205 makes the audible clicking noise described above to indicate when the stud 205 is fully secured . fig5 a - g show details of the inner electrode 120 a . the inner electrode 120 a is preferably a plate of high purity ( less than 10 ppm impurities ) low resistivity ( 0 . 005 to 0 . 02 ohm - cm ) single crystal silicon . fig5 a is a bottom view of the inner electrode 120 a , showing the plasma exposed surface 120 aa . gas injection holes 106 a of suitable diameter and / or configuration extend from the mounting surface 120 ab to the plasma exposed surface 120 aa ( fig5 b ) and can be arranged in any suitable pattern . preferably , the diameter of the gas injection holes 106 a is less than or equal to 0 . 04 inch ; more preferably , the diameter of the gas injection holes 106 a is between 0 . 01 and 0 . 03 inch ; further preferably , the diameter of the gas injection holes 106 a is 0 . 02 inch . in the embodiment shown , one gas injection hole is located at the center of the inner electrode 120 a ; the other gas injection holes are arranged in eight concentric rows with 8 gas injection holes in the first row located about 0 . 6 - 0 . 7 ( e . g . 0 . 68 ) inch from the center of the electrode , 18 gas injection holes in the second row located about 1 . 3 - 1 . 4 ( e . g . 1 . 34 ) inch from the center , 28 gas injection holes in the third row located about 2 . 1 - 2 . 2 ( e . g . 2 . 12 ) inches from the center , 38 gas injection holes in the fourth row located about 2 . 8 - 3 . 0 ( e . g . 2 . 90 ) inches from the center , 48 gas injection holes in the fifth row located about 3 . 6 - 3 . 7 ( e . g . 3 . 67 ) inches from the center , 58 gas injection holes in the sixth row located about 4 . 4 - 4 . 5 ( e . g . 4 . 45 ) inches from the center , 66 gas injection holes in the seventh row located about 5 . 0 - 5 . 1 ( e . g . 5 . 09 ) inches from the center , and 74 gas injection holes in the eighth row located about 5 . 7 - 5 . 8 ( e . g . 5 . 73 ) inches from the center . the gas injection holes in each of these rows are azimuthally evenly spaced . fig5 b is a cross - sectional view of the inner electrode 120 a along a diameter thereof . the outer circumferential surface includes two steps . fig5 c is an enlarged view of the area a in fig5 b . an inner step 532 a and an outer step 534 a extend completely around the inner electrode 120 a . in a preferred embodiment , the silicon plate has a thickness of about 0 . 40 inch and an outer diameter of about 12 . 5 inches ; the inner step 532 a has an inner diameter of about 12 . 0 inches and an outer diameter of about 12 . 1 inches and ; the outer step 534 a has an inner diameter of about 12 . 1 inches and an outer diameter of about 12 . 5 inches . the inner step 532 a has a vertical surface 532 aa about 0 . 13 inch long and a horizontal surface 532 ab about 0 . 07 inch long and the outer step 534 a has a vertical surface 534 aa about 0 . 11 inch long and a horizontal surface 534 ab about 0 . 21 inch long . fig5 d is a top view of the inner electrode 120 a , showing the mounting surface 120 ab . the mounting surface 120 ab includes an annular groove 550 a ( details shown in fig5 e ) concentric with the inner electrode 120 a , the annular groove 550 a having an inner diameter of about 0 . 24 inch , an outer diameter of about 0 . 44 inch , a depth of at least 0 . 1 inch , a 45 ° chamfer of about 0 . 02 inch wide on the entrance edge , and a fillet of a radius between 0 . 015 and 0 . 03 inch on the bottom corners . the mounting surface 120 ab also includes two smooth ( unthreaded ) blind holes 540 a configured to receive alignment pins ( details shown in fig5 f ) located at a radius between 1 . 72 and 1 . 73 inches from the center of the inner electrode 120 a and offset by about 180 ° from each other , the blind holes 540 a having a diameter of about 0 . 11 inch , a depth of at least 0 . 2 inch , a 45 ° chamfer of about 0 . 02 inch on an entrance edge , and a fillet with a radius of at most 0 . 02 inch on a bottom corner . the mounting surface 120 ab also includes threaded blind holes arranged in an annular mounting hole zone which divides the mounting surface into a central portion and an outer portion . the mounting hole zone is preferably located on a radius of ¼ to ½ the radius of the inner electrode 120 a . in a preferred embodiment , a row of eight ¼ - 32 ( unified thread standard ) threaded blind holes 520 a , are located on a radius between 2 . 4 and 2 . 6 inches ( e . g ., 2 . 5 inches ) from the center of the inner electrode 120 a and azimuthally offset by about 45 ° between each pair of adjacent holes 520 a . each of the holes 520 a has a total depth of about 0 . 3 inch , a threaded depth of at least 0 . 25 inch from the entrance edge , and a 45 ° chamfer of about 0 . 05 inch wide on the entrance edge . one of the holes 520 a is azimuthally aligned with another one of the holes 540 a . as used herein , two objects being “ azimuthally aligned ” means a straight line connecting these two objects passes through the center of a circle or ring , in this embodiment , the center of the inner electrode 120 a . the mounting surface 120 ab further includes first , second and third smooth ( unthreaded ) blind holes configured to receive alignment pins ( 530 aa , 530 ab and 530 ac , respectively , or 530 a collectively ) ( details shown in fig5 g ) radially aligned at a radius between 6 . 0 and 6 . 1 , preferably between 6 . 02 and 6 . 03 inches from the center of the inner electrode 120 a . “ radially aligned ” means the distances to the center are equal . the holes 530 a have a diameter between 0 . 11 and 0 . 12 inch , a depth of at least 0 . 1 inch , a 45 ° chamfer of about 0 . 02 inch wide on an entrance edge , and a fillet with a radius of at most 0 . 02 inch on a bottom corner . the first hole 530 aa is offset by about 10 ° clockwise azimuthally from one of the unthreaded blind holes 540 a ; the second hole 530 ab is offset by about 92 . 5 ° counterclockwise azimuthally from the first hole 530 aa ; the third hole 530 ac is offset by about 190 ° counterclockwise azimuthally from the first hole 530 aa . referring to fig1 a , the inner electrode 120 a is clamped to the backing plate 140 a by a clamp ring 150 a engaging the outer step 534 a on the lower face and a plurality of bolts 160 a engaging the threaded blind holes 520 a in the mounting surface 120 ab . the clamp ring 150 a includes a series of holes which receive fasteners such as bolts ( screws ) threaded into threaded openings in an underside of the backing plate 140 a . to avoid contact of the clamp ring 150 a with the step 534 a on the inner electrode 120 a , a compression ring 170 a of a stiff material such as a hard polyimide material such as cirlex ® is compressed between opposed surfaces of the inner electrode 120 a and the clamp ring 150 a ( fig1 c ). fig6 shows an enlarged portion in fig1 a near one of the bolts 160 a . the bolts 160 a are of 8 - 32 size . during installation of the inner electrode 120 a , a plastic insert 610 a preferably made of torlon ® 5030 is threaded into each threaded blind hole 520 a . the plastic insert 610 a has an inner thread of 8 - 32 and an outer thread of ¼ - 32 . an 8 - 32 bolt 160 a is threaded into each plastic insert 610 a . during operation of the showerhead electrode assembly 100 a , the inner electrode 120 a is heated by a plasma and / or heating arrangement and this heating can cause warping in the inner electrode 120 a and adversely affect the uniformity of the plasma processing rate across the plasma chamber . the bolts 160 a in combination with the clamp ring 150 a provide points of mechanical support , reduce warping of the inner electrode 120 a , and hence reduce processing rate non - uniformity and thermal non - uniformity . fig7 a shows a top view of a thermally and electrically conductive gasket set . this gasket set comprises an inner gasket 7100 comprising a plurality of concentric rings connected by a plurality of spokes , an annular middle gasket 7200 with a plurality of cutouts on an outer and an inner perimeter , and an annular outer gasket 7300 with a plurality of cutouts on an outer perimeter and one cutout on an inner perimeter . the gaskets are preferably electrically and thermally conductive and made of a material compatible for semiconductor processing in a vacuum environment , e . g ., about 10 to 200 mtorr , having low particle generation , being compliant to accommodate shear at contact points , and free of metallic components that are lifetime killers in semiconductor substrates such as ag , ni , cu and the like . the gaskets can be a silicone - aluminum foil sandwich gasket structure or an elastomer - stainless steel sandwich gasket structure . the gaskets can be an aluminum sheet coated on upper and lower sides with a thermally and electrically conductive rubber compatible in a vacuum environment used in semiconductor manufacturing wherein steps such as plasma etching are carried out . the gaskets are preferably compliant such that it can be compressed when the electrode and backing plate are mechanically clamped together but prevent opposed surfaces of the electrode and backing plate from rubbing against each other during temperature cycling of the showerhead electrode . the gaskets can be manufactured of a suitable material such as “ q - pad ii ” available from the bergquist company . the thickness of the gaskets is preferably about 0 . 006 inch . the various features of the gaskets can be knife - cut , stamped , punched , or preferably laser - cut from a continuous sheet . the gasket set is mounted between the backing plate 140 a and the inner electrode 120 a and outer electrode 130 a to provide electrical and thermal contact therebetween . fig7 b shows the details of the inner gasket 7100 . the inner gasket 7100 preferably comprises seven concentric rings interconnected by radial spokes . a first ring 701 has an inner diameter of at least 0 . 44 inch ( e . g . between 0 . 62 and 0 . 65 inch ) and an outer diameter of at most 1 . 35 inches ( e . g . between 0 . 97 and 1 . 00 inch ). the first ring 701 is connected to a second ring 702 by eight radially extending and azimuthally evenly spaced spokes 712 . each spoke 712 has a width of about 0 . 125 inch . the second ring 702 has an inner diameter of at least 1 . 35 inches ( e . g . between 1 . 74 and 1 . 76 inches ) and an outer diameter of at most 2 . 68 inches ( e . g . between 2 . 26 and 2 . 29 inches ). the second ring is connected to a third ring 703 by four radially extending and azimuthally evenly spaced spokes . two of these four spokes 723 a and 723 b oppose each other about the center of the inner gasket 7100 and each has a width of about 0 . 5 inch and a rounded rectangular opening ( 723 ah or 723 bh ) of about 0 . 25 inch by about 0 . 46 inch . the other two of these four spokes 723 c and 723 d oppose each other about the center of the inner gasket 7100 and each has a width of about 0 . 25 inch . one spoke 723 c is offset azimuthally from one of the spokes 712 by about 22 . 5 °. the third ring 703 has an inner diameter of at least 2 . 68 inches ( e . g . between 3 . 17 and 3 . 20 inches ) and an outer diameter of at most 4 . 23 inches ( e . g . between 3 . 71 and 3 . 74 inches ). the third ring is connected to a fourth ring 704 by four radially extending and azimuthally evenly spaced spokes 734 . each spoke has a width of about 0 . 18 inch . one of the spokes 734 is offset azimuthally by about 45 ° from the spoke 723 c . the third ring 703 also includes two round holes 703 x and 703 y azimuthally offset by about 180 ° from each other and located at a radial distance between 1 . 72 and 1 . 74 inches from the center of the inner gasket 7100 . the round holes 703 x and 703 y have a diameter of about 0 . 125 inch . one round hole 703 x is offset azimuthally by about 90 ° from the spoke 723 c . the round holes 703 x and 703 y are configured to receive alignment pins . the fourth ring 704 has an inner diameter of at least 4 . 23 inches ( e . g . between 4 . 78 and 4 . 81 inches ) and an outer diameter of at most 5 . 79 inches ( e . g . between 5 . 19 and 5 . 22 inches ). the fourth ring 704 is connected to a fifth ring 705 by four radially extending and azimuthally evenly spaced spokes . two of these four spokes 745 a and 745 b oppose each other about the center of the inner gasket 7100 and each has a width of about 0 . 5 inch and a rounded rectangular opening ( 745 ah or 745 bh ) of about 0 . 25 inch by about 0 . 51 inch . the other two of these four spokes 745 c and 745 d oppose each other about the center of the inner gasket 7100 and each has a width of about 0 . 25 inch . one spoke 745 a is offset azimuthally by about 90 ° counterclockwise from the spokes 723 c . the fourth ring 704 also includes eight round holes 704 s , 704 t , 704 u , 704 v , 704 w , 704 x , 704 y and 704 z ( configured to receive bolts ) azimuthally offset by about 45 ° between each adjacent pair and located at a radial distance between 2 . 49 and 2 . 51 inches from the center of the inner gasket 7100 . these round holes 704 s , 704 t , 704 u , 704 v , 704 w , 704 x , 704 y and 704 z have a diameter of about 0 . 18 inch . one round hole 704 s is offset azimuthally by about 90 ° counterclockwise from the spoke 723 c . around each of the round holes 704 s , 704 u , 704 w and 704 y , the fourth ring 704 has a round protrusion on the inner periphery thereof . around each of the round holes 704 t , 704 v , 704 x and 704 z , the fourth ring 704 has a round protrusion on the outer periphery thereof . each protrusion has an outer diameter of about 0 . 36 inch . the fifth ring 705 has an inner diameter of at least 5 . 79 inches ( e . g . between 6 . 35 and 6 . 37 inches ) and an outer diameter of at most 7 . 34 inches ( e . g . between 6 . 73 and 6 . 75 inches ). the fifth ring 705 is connected to a sixth ring 706 by four radially extending and azimuthally evenly spaced spokes 756 . one of the spokes 756 is offset azimuthally by about 45 ° from the spoke 723 c . each the spokes 756 has a width of about 0 . 5 inch and a rectangular opening 756 h of about 0 . 25 inch by about 0 . 60 inch . the sixth ring 706 has an inner diameter of at least 7 . 34 inches ( e . g . between 7 . 92 and 7 . 95 inches ) and an outer diameter of at most 8 . 89 inches ( e . g . between 8 . 16 and 8 . 36 inches ). the sixth ring 706 is connected to a seventh ring 707 by four radially extending and azimuthally evenly spaced spokes . two of these four spokes 767 a and 767 b oppose each other about the center of the inner gasket 7100 and each has a width of about 0 . 5 inch and a rectangular opening ( 767 ah or 767 bh ) of about 0 . 25 inch wide . the openings 767 ah and 767 bh extend outward radially and separate the seventh ring 707 into two half circles . the other two of these four spokes 767 c and 767 d oppose each other about the center of the inner gasket 7100 and each has a width of about 0 . 25 inch . spoke 767 d is offset azimuthally by about 180 ° from the spoke 723 c . the seventh ring 707 has an inner diameter of at least 8 . 89 inches ( e . g . between 9 . 34 and 9 . 37 inches ) and an outer diameter of at most 10 . 18 inches ( e . g . between 9 . 66 and 9 . 69 inches ). each corner at joints between the rings and spokes in the inner gasket 7100 is rounded to a radius of about 0 . 06 inch . the middle gasket 7200 ( see fig7 a ) has an inner diameter of about 11 . 95 inches and an outer diameter of about 12 . 47 inches . the middle gasket 7200 has three small - diameter cutouts 708 a , 708 b and 708 c on its inner perimeter . the cutouts 708 b and 708 c are azimuthally offset from the cutout 708 a by about 92 . 5 ° clockwise and about 190 ° clockwise , respectively . the centers of the cutouts 708 a , 708 b and 708 c are located at a radial distance of about 6 . 02 inches from the center of the middle gasket 7200 . the cutouts 708 a , 708 b and 708 c face inward and include a semi - circular outer periphery with a diameter of about 0 . 125 inch and include an inner opening with straight radial edges . the middle gasket 7200 also has three large - diameter round and outwardly facing cutouts 708 x , 708 y and 708 z on its outer perimeter . the cutouts 708 x , 708 y and 708 z are azimuthally equally spaced and have a diameter of about 0 . 72 inch . their centers are located at a radial distance of about 6 . 48 inches from the center of the middle gasket 7200 . the cutout 708 x is azimuthally offset from the cutout 708 a by about 37 . 5 ° clockwise . when installed in the showerhead electrode assembly ( as described in details hereinbelow ), the cutout 708 a is azimuthally aligned with the hole 703 x on the third ring 703 in the inner gasket 7100 . the outer gasket 7300 has an inner diameter of about 13 . 90 inches and an outer diameter of about 15 . 31 inches . the outer gasket 7300 has eight semicircular outwardly facing cutouts 709 a equally spaced azimuthally on its outer perimeter . the centers of the cutouts 709 a are located at a radial distance of about 7 . 61 inches from the center of the outer gasket 7300 . the cutouts 709 a have a diameter of about 0 . 62 inch . when installed in the showerhead electrode assembly ( as described in details hereinbelow ), one of the cutouts 709 a is azimuthally aligned with the hole 703 x on the third ring 703 in the inner gasket 7100 . the outer gasket 7300 also has one round inwardly facing cutout 709 b on the inner perimeter thereof . the center of this cutout 709 b is located at a distance of about 6 . 98 inches from the center of the outer gasket 7300 . the cutout 709 b has a diameter of about 0 . 92 inch . when installed in the showerhead electrode assembly ( as described in details hereinbelow ), the cutout 709 b is azimuthally offset from the hole 703 x by about 22 . 5 ° counterclockwise . when the inner electrode 120 a is installed in the showerhead electrode assembly 100 a , an alignment ring 108 a ( fig1 a ), two inner alignment pins 109 a ( fig1 a ) and three outer alignment pins ( not shown in fig1 a ) are first inserted into the annular groove 550 a , holes 540 a and holes 530 a ( fig5 d ), respectively . the inner gasket 7100 is then mounted to the inner electrode 120 a . the holes 703 x and 703 y ( fig7 b ) correspond to the inner alignment pins 109 a ; and the center hole of the inner gasket 7100 corresponds to the alignment ring 108 a and the center gas injection hole in the inner electrode 120 a . rectangular and quarter - circular openings between the seven rings and in the spokes in the inner gasket 7100 correspond to the first row through the sixth row of gas injection holes in the inner electrode 120 a . the middle gasket 7200 is mounted onto the inner electrode 120 a . the cutouts 708 a , 708 b and 708 c correspond to the holes 530 ac , 530 ab and 530 aa , respectively . the seventh and eighth rows of gas injection holes fall in the opening between the inner gasket 7100 and the middle gasket 7200 . eight bolts 160 a with their corresponding inserts 610 a are threaded into the eight threaded blind holes 520 a to fasten the inner electrode 120 a to the backing plate 140 a , with the inner gasket 7100 and middle gasket 7200 sandwiched therebetween . the clamp ring 150 a is fastened onto the backing plate 140 a by a plurality of bolts threaded into threaded openings in the underside of the backing plate 140 a . the bolts 160 a and the clamp ring 150 a support the inner electrode 120 a at a location between the center and outer edge and at the outer edge , respectively , in order to reduce warping of the inner electrode 120 a caused by temperature cycling during processing of substrates . the outer gasket 7300 is placed on the outer electrode 130 a . the eight cutouts 709 a correspond to the eight cam lock mechanisms . the outer electrode 130 a is fastened against the backing plate 140 a by rotating the cam shaft 207 a of each cam lock . fig1 b shows a cross - sectional view of a portion of another showerhead electrode assembly 100 b of a plasma reaction chamber for etching semiconductor substrates . as shown in fig1 b , the showerhead electrode assembly 100 b includes an upper electrode 110 b , and a backing plate 140 b . the assembly 100 b also includes a thermal control plate 102 b , and a top plate 104 b having liquid flow channels therein . the upper electrode 110 b preferably includes an inner electrode 120 b , and an outer electrode 130 b . the inner electrode 120 b may be made of a conductive high purity material such as single crystal silicon , polycrystalline silicon , silicon carbide or other suitable material . the inner electrode 120 b is a consumable part which must be replaced periodically . an annular shroud 190 with a c - shaped cross section surrounds the outer electrode 130 b . the backing plate 140 b is mechanically secured to the inner electrode 120 b , the outer electrode 130 b and the shroud 190 with mechanical fasteners described below . during use , process gas from a gas source is supplied to the inner electrode 120 b through one or more passages in the upper plate 104 b which permit process gas to be supplied to a single zone or multiple zones above the substrate . the inner electrode 120 b is preferably a planar disk or plate . the inner electrode 120 b can have a diameter smaller than , equal to , or larger than a substrate to be processed , e . g ., up to 300 mm , if the plate is made of single crystal silicon , which is the diameter of currently available single crystal silicon material used for 300 mm substrates . for processing 300 mm substrates , the outer electrode 130 b is adapted to expand the diameter of the inner electrode 120 b from about 12 inches to about 17 inches . the outer electrode 130 b can be a continuous member ( e . g ., a single crystal silicon , polycrystalline silicon , silicon carbide or other suitable material in the form of a ring ) or a segmented member ( e . g ., 2 - 6 separate segments arranged in a ring configuration , such as segments of single crystal silicon , polycrystalline silicon , silicon carbide or other material ). to supply process gas to the gap between the substrate and the upper electrode 110 b , the inner electrode 120 b is provided with a plurality of gas injection holes 106 b , which are of a size and distribution suitable for supplying a process gas , which is energized into a plasma in a reaction zone beneath the upper electrode 110 b . single crystal silicon is a preferred material for plasma exposed surfaces of the inner electrode 120 b and the outer electrode 130 b . high - purity , single crystal silicon minimizes contamination of substrates during plasma processing as it introduces only a minimal amount of undesirable elements into the reaction chamber , and also wears smoothly during plasma processing , thereby minimizing particles . alternative materials including composites of materials that can be used for plasma - exposed surfaces of the inner electrode 120 b , the outer electrode 130 b and the annular shroud 190 include polycrystalline silicon , y 2 o 3 , sic , si 3 n 4 , and aln , for example . in an embodiment , the showerhead electrode assembly 100 b is large enough for processing large substrates , such as semiconductor substrates having a diameter of 300 mm . for 300 mm substrates , the inner electrode 120 b is at least 300 mm in diameter . however , the showerhead electrode assembly 100 b can be sized to process other substrate sizes . the backing plate 140 b is preferably made of a material that is chemically compatible with process gases used for processing semiconductor substrates in the plasma processing chamber , has a coefficient of thermal expansion closely matching that of the electrode material , and / or is electrically and thermally conductive . preferred materials that can be used to make the backing plate 140 b include , but are not limited to , graphite , sic , aluminum ( al ), or other suitable materials . the backing plate 140 b is preferably attached to the thermal control plate 102 b with suitable mechanical fasteners , which can be threaded bolts , screws , or the like . for example , bolts ( not shown ) can be inserted in holes in the thermal control plate 102 b and screwed into threaded openings in the backing plate 140 b . the thermal control plate 102 b is preferably made of a machined metallic material , such as aluminum , an aluminum alloy or the like . the temperature controlled top plate 104 b is preferably made of aluminum or an aluminum alloy . fig5 h - 5l show details of the inner electrode 120 b . the inner electrode 120 b is preferably a plate of high purity ( less than 10 ppm impurities ) low resistivity ( 0 . 005 to 0 . 02 ohm - cm ) single crystal silicon . fig5 h is a bottom view of the inner electrode 120 b , showing the plasma exposed surface 120 ba . gas injection holes 106 b of suitable diameter and / or configuration extend from the mounting surface 120 bb to the plasma exposed surface 120 ba ( fig5 i ) and can be arranged in any suitable pattern . preferably , the diameter of the gas injection holes 106 b is less than or equal to 0 . 04 inch ; more preferably , the diameter of the gas injection holes 106 b is between 0 . 01 and 0 . 03 inch ; further preferably , the diameter of the gas injection holes 106 b is 0 . 02 inch . in the embodiment shown , one gas injection hole is located at the center of the inner electrode 120 b ; the other gas injection holes are arranged in eight concentric rows with 8 gas injection holes in the first row located about 0 . 6 - 0 . 7 ( e . g . 0 . 68 ) inch from the center of the electrode , 18 gas injection holes in the second row located about 1 . 3 - 1 . 4 ( e . g . 1 . 34 ) inch from the center , 28 gas injection holes in the third row located about 2 . 1 - 2 . 2 ( e . g . 2 . 12 ) inches from the center , 40 gas injection holes in the fourth row located about 2 . 8 - 3 . 0 ( e . g . 2 . 90 ) inches from the center , 48 gas injection holes in the fifth row located about 3 . 6 - 3 . 7 ( e . g . 3 . 67 ) inches from the center , 56 gas injection holes in the sixth row located about 4 . 4 - 4 . 5 ( e . g . 4 . 45 ) inches from the center , 64 gas injection holes in the seventh row located about 5 . 0 - 5 . 1 ( e . g . 5 . 09 ) inches from the center , and 72 gas injection holes in the eighth row located about 5 . 7 - 5 . 8 ( e . g . 5 . 73 ) inches from the center . the gas injection holes in each of these rows are azimuthally evenly spaced . fig5 i is a partial cross - sectional view of the inner electrode 120 b along a diameter thereof . the outer circumferential surface includes two steps . fig5 j is an enlarged view of the area a in fig5 i . an inner step 532 b and an outer step 534 b extend completely around the inner electrode 120 b . in a preferred embodiment , the silicon plate has a thickness of about 0 . 40 inch and an outer diameter of about 12 . 5 inches ; the inner step 532 b has an inner diameter of about 12 . 00 inches and an outer diameter of about 12 . 1 inches and ; the outer step 534 b has an inner diameter of about 12 . 1 inches and an outer diameter of about 12 . 5 inches . the inner step 532 b has a vertical surface 532 ba about 0 . 13 inch long and a horizontal surface 532 bb about 0 . 07 inch long and the outer step 534 b has a vertical surface 534 ba about 0 . 11 inch long and a horizontal surface 534 bb about 0 . 21 inch long . the circular line of intersection between the surfaces 534 ba and 534 bb is rounded to a radius of about 0 . 06 inch . fig5 k is a top view of the inner electrode 120 b , showing the mounting surface 120 bb . the mounting surface 120 bb includes an annular groove 550 b ( details shown in fig5 e ) concentric with the inner electrode 120 b , the annular groove 550 b having an inner diameter of about 0 . 24 inch , an outer diameter of about 0 . 44 inch , a depth of at least 0 . 1 inch , a 45 ° chamfer of about 0 . 02 inch wide on the entrance edge , and a fillet of a radius between 0 . 015 and 0 . 03 inch on the bottom corner . the mounting surface 120 bb also includes two smooth ( unthreaded ) blind holes 540 ba and 540 bb configured to receive alignment pins ( details shown in fig5 f ) located at a radius between 1 . 72 and 1 . 73 inches from the center of the inner electrode 120 b . the blind hole 540 bb is offset by about 175 ° clockwise from the blind hole 540 ba . the blind holes 540 ba and 540 bb have a diameter between 0 . 11 and 0 . 12 inch , a depth of at least 0 . 2 inch , a 45 ° chamfer of about 0 . 02 inch on an entrance edge , and a fillet with a radius of at most 0 . 02 inch on a bottom corner . the mounting surface 120 bb also includes threaded blind holes 520 b arranged in an annular mounting hole zone which divides the mounting surface into a central portion and an outer portion . the mounting hole zone is preferably located on a radius of ¼ to ½ the radius of the inner electrode 120 b . in a preferred embodiment , eight 7 / 16 - 28 ( unified thread standard ) or other suitably sized threaded holes 520 b , each of which configured to receive a stud / socket assembly 303 , are circumferentially spaced apart on a radius between 2 . 49 and 2 . 51 inches from the center of the inner electrode 120 b and azimuthally offset by about 45 ° between each pair of adjacent threaded holes 520 b . each of the threaded holes 520 b has a total depth of about 0 . 2 inch , a threaded depth of at least 0 . 163 inch from the entrance edge , and a 45 ° chamfer of about 0 . 03 inch wide on the entrance edge . one of the holes 520 b is azimuthally aligned with the hole 540 ba . the mounting surface 120 bb further includes first , second and third smooth ( unthreaded ) blind holes configured to receive alignment pins ( 530 ba , 530 bb and 530 bc , respectively , or 530 b collectively ) ( details shown in fig5 k ) radially aligned at a radius between 6 . 02 and 6 . 03 inches from the center of the inner electrode 120 b . the holes 530 b have a diameter between 0 . 11 and 0 . 12 inch , a depth of at least 0 . 1 inch , a 45 ° chamfer of about 0 . 02 inch wide on an entrance edge , and a fillet with a radius of at most 0 . 02 inch on a bottom corner . the first hole 530 ba is offset by about 10 ° clockwise azimuthally from the unthreaded blind holes 540 ba ; the second hole 530 bb is offset by about 92 . 5 ° counterclockwise azimuthally from the first hole 530 ba ; the third hole 530 bc is offset by about 190 ° counterclockwise azimuthally from the first hole 530 ba . in the top view of the inner electrode 120 b in fig5 k ( the view of the mounting surface 120 bb ), a gas injection hole in the first row is azimuthally aligned with the hole 530 bc ; a gas injection hole in the second row is azimuthally aligned with the hole 530 bc ; a gas injection hole in the third row is azimuthally offset by about 3 . 2 ° counterclockwise from the hole 530 bc ; a gas injection hole in the fourth row is azimuthally offset by about 4 . 5 ° counterclockwise from the hole 530 bc ; a gas injection hole in the fifth row is azimuthally offset by about 3 . 75 ° counterclockwise from the hole 530 bc ; a gas injection hole in the sixth row is azimuthally offset by about 3 . 21 ° counterclockwise from the hole 530 bc ; a gas injection hole in the seventh row is azimuthally offset by about 2 . 81 ° counterclockwise from the hole 530 bc ; a gas injection hole in the eighth row is azimuthally offset by about 2 . 5 ° counterclockwise from the hole 530 bc . referring to fig1 b , the inner electrode 120 b is clamped to the backing plate 140 b by a clamp ring 150 b engaging the outer step on the lower face and a plurality of cam locks 160 b ( such as 4 to 8 cam locks ) engaging the threaded holes in the upper surface . the clamp ring 150 b includes a series of holes which receive fasteners such as bolts ( screws ) threaded into threaded openings in an underside of the backing plate 140 b . to avoid contact of the clamp ring 150 b with the step 534 b on the inner electrode 120 b , a compression ring 170 b of a stiff material such as a hard polyimide material such as cirlex ® is compressed between opposed surfaces of the inner electrode 120 b and the clamp ring 150 b ( fig1 c ). the cam locks 160 b in combination with the clamp ring 150 b provide points of mechanical support , improve thermal contact with the backing plate 140 b , reduce warping of the inner electrode 120 b , and hence reduce processing rate non - uniformity and thermal non - uniformity . in the embodiment shown , the outer electrode 130 b is mechanically attached to the backing plate by 8 cam locks and the inner electrode 120 b is mechanically attached to the backing plate by another 8 cam locks . fig2 c shows a three - dimensional view of an exemplary cam lock including portions of the outer electrode 130 b and the backing plate 140 b . the cam locks as shown in fig2 c and 2d include a stud / socket assembly 303 comprising a stud ( locking pin ) 205 mounted into a socket 213 , as described above and shown in fig3 . to allow simultaneous engagement of cam locks on the inner and outer electrodes , eight elongated cam shafts 207 b are mounted into backing plate bores 211 b machined into the backing plate 140 b . each cam shaft 207 b engages on a stud / socket assembly 303 of one cam lock on the outer electrode 1308 and a stud / socket assembly 303 of one cam lock on the inner electrode 120 b . referring now to fig2 d , a cross - sectional view of the cam lock further exemplifies how the cam lock operates by placing the outer electrode 130 b and the inner electrode 120 b in close proximity to the backing plate 140 b . the stud 205 / disc spring stack 215 / socket 213 assembly is mounted into the outer electrode 130 b and the inner electrode 120 b . as shown , the stud / socket assembly may be screwed , by means of external threads on the socket 213 into a threaded hole in the outer electrode 1308 or the inner electrode 120 b . with reference to fig4 c , an exploded view 400 b of the cam shaft 207 b also indicates a keying stud 402 and a hex opening 403 b on one end of the cam shaft 207 b . for example , with continued reference to fig4 c , 2 c and 2 d , the cam lock is assembled by inserting the cam shaft 207 b into the backing plate bore 211 b . the keying stud 402 limits rotational travel of the cam shaft 207 b in the backing plate bore 211 b by interfacing with a step on an entrance of the bore 211 b as shown in fig4 d . the cam shaft 207 b has two internal eccentric cutouts . one cutout engages an enlarged head of the stud 205 on the outer electrode 1308 and the other cutout engages an enlarged head of the stud 205 on the inner electrode 120 b . the cam shaft 207 b may first be turned in one direction though use of the hex opening 403 b , for example , counter - clockwise , to allow entry of the studs 205 into the cam shaft 207 b , and then turned clockwise to fully engage and lock the studs 205 . the clamp force required to hold the outer electrode 130 b and the inner electrode 120 b to the backing plate 140 b is supplied by compressing the disc spring stacks 215 beyond their free stack height . as the disc spring stacks 215 compress , the clamp force is transmitted from individual springs in the disc spring stacks 215 to the sockets 213 and through the outer electrode 130 b and the inner electrode 120 b to the backing plate 140 b . in an exemplary mode of operation , the cam shaft 207 b is inserted into the backing plate bore 211 b . the cam shaft 207 b is rotated counterclockwise to its full rotational travel . the stud / socket assemblies 303 ( fig3 ) lightly torqued into the outer electrode 130 b and the inner electrode 120 b are then inserted into vertically extending through holes below the horizontally extending backing plate bore 211 b such that the heads of the studs 205 engage in the eccentric cutouts in the cam shaft 207 b . the outer electrode 130 b and the inner electrode 120 b are held against the backing plate 140 b and the cam shaft 207 b is rotated clockwise until the keying pin is limited by the step on the entrance of the bore 211 b . the exemplary mode of operation may be reversed to dismount the outer electrode 130 b and the inner electrode 120 b from the backing plate 140 b . with reference to fig4 b , a sectional view a - a of the side - elevation view 420 b of the cam shaft 207 b of fig4 c indicates a cutter path edge 440 b by which the head of the stud 205 is fully secured . fig7 c shows a top view of another gasket set . this gasket set comprises an inner gasket 7400 comprising a plurality of concentric rings connected by a plurality of spokes , a first annular gasket 7500 with a plurality of cutouts on an outer and an inner perimeter , a second annular gasket 7600 with a plurality of holes and one cutout , and a third annular gasket 7700 with a plurality of cutouts . the gaskets are preferably electrically and thermally conductive and made of a material without excessive outgas in a vacuum environment , e . g ., about 10 to 200 mtorr , having low particle generation , being compliant to accommodate shear at contact points , and free of metallic components that are lifetime killers in semiconductor substrates such as ag , ni , cu and the like . the gaskets can be a silicone - aluminum foil sandwich gasket structure or an elastomer - stainless steel sandwich gasket structure . the gaskets can be an aluminum sheet coated on upper and lower sides with a thermally and electrically conductive rubber compatible in a vacuum environment used in semiconductor manufacturing wherein steps such as plasma etching are carried out . the gaskets are preferably compliant such that they can be compressed when the electrode and backing plate are mechanically clamped together but prevent opposed surfaces of the electrode and backing plate from rubbing against each other during temperature cycling of the showerhead electrode . the gaskets can be manufactured of a suitable material such as “ q - pad ii ” available from the bergquist company . the thickness of the gaskets is preferably about 0 . 006 inch . the various features of the gaskets can be knife - cut , stamped , punched , or preferably laser - cut from a continuous sheet . the gasket set is mounted between the backing plate 140 b and the inner electrode 120 b and outer electrode 130 b to provide electrical and thermal contact therebetween . fig7 d shows the details of the inner gasket 7400 . the inner gasket 7400 preferably comprises seven concentric rings interconnected by radial spokes . a first ring 7401 has an inner diameter of at least 0 . 44 inch ( e . g . between 0 . 62 and 0 . 65 inch ) and an outer diameter of at most 1 . 35 inches ( e . g . between 0 . 97 and 1 . 00 inch ). the first ring 7401 is connected to a second ring 7402 by eight radially extending and azimuthally evenly spaced spokes 7412 . each spoke 7412 has a width of about 0 . 125 inch . the second ring 7402 has an inner diameter of at least 1 . 35 inches ( e . g . between 1 . 74 and 1 . 76 inches ) and an outer diameter of at most 2 . 68 inches ( e . g . between 2 . 26 and 2 . 29 inches ). the second ring 7402 is connected to a third ring 7403 by four radially extending and azimuthally evenly spaced spokes . two of these four spokes 7423 a and 7423 b oppose each other about the center of the inner gasket 7400 and each has a width of about 0 . 56 inch and a rounded rectangular opening ( 7423 ah or 7423 bh ) of about 0 . 31 inch by about 0 . 46 inch . the other two of these four spokes 7423 c and 7423 d oppose each other about the center of the inner gasket 7400 and each has a width of about 0 . 125 inch . one spoke 7423 c is offset azimuthally from one of the spokes 7412 by about 22 . 5 °. the third ring 7403 has an inner diameter of at least 2 . 68 inches ( e . g . between 3 . 17 and 3 . 20 inches ) and an outer diameter of at most 4 . 23 inches ( e . g . between 3 . 71 and 3 . 74 inches ). the third ring is connected to a fourth ring 7404 by four radially extending and azimuthally evenly spaced spokes 7434 . each spoke has a width of about 0 . 125 inch . one of the spokes 7434 is offset azimuthally by about 22 . 5 ° counterclockwise from the spoke 7423 c . the third ring 7403 also includes two round holes 7403 x and 7403 y located at a radial distance between 1 . 72 and 1 . 74 inches from the center of the inner gasket 7400 . the round holes 7403 x and 7403 y have a diameter of about 0 . 125 inch . the round hole 7403 x is offset azimuthally by about 95 ° counterclockwise from the spoke 7423 c . the round hole 7403 y is offset azimuthally by about 90 ° clockwise from the spoke 7423 c . the round holes 7403 x and 7403 y are configured to receive alignment pins . the fourth ring 7404 has an inner diameter of at least 4 . 23 inches ( e . g . between 4 . 78 and 4 . 81 inches ) and an outer diameter of at most 5 . 79 inches ( e . g . between 5 . 19 and 5 . 22 inches ). the fourth ring 7404 is connected to a fifth ring 7405 by a set of 8 radially extending and azimuthally evenly spaced spokes 7445 a and another set of 8 radially extending and azimuthally evenly spaced spokes 7445 b . one of the spokes 7445 b is offset azimuthally by about 8 . 5 ° counterclockwise from the spoke 7423 c . one of the spokes 7445 a is offset azimuthally by about 8 . 5 ° clockwise from the spoke 7423 c . each spoke 7445 a and 7445 b has a width of about 0 . 125 inch . the spokes 7445 a and 7445 b extend inward radially and separate the fourth ring 7404 into eight arcs each of which has a central angle of about 28 °. the fifth ring 7405 has an inner diameter of at least 5 . 79 inches ( e . g . between 6 . 35 and 6 . 37 inches ) and an outer diameter of at most 7 . 34 inches ( e . g . between 6 . 73 and 6 . 75 inches ). the fifth ring 7405 is connected to a sixth ring 7406 by four radially extending and azimuthally evenly spaced spokes 7456 . one of the spokes 7456 is offset azimuthally by about 90 ° from the spoke 7423 c . each the spokes 7456 has a width of about 0 . 125 inch . the sixth ring 7406 has an inner diameter of at least 7 . 34 inches ( e . g . between 7 . 92 and 7 . 95 inches ) and an outer diameter of at most 8 . 89 inches ( e . g . between 8 . 16 and 8 . 36 inches ). the sixth ring 7406 is connected to a seventh ring 7407 by a set of four radially extending and azimuthally evenly spaced spokes 7467 a and another set of four radially extending and azimuthally evenly spaced spokes 7467 b . one of the spokes 7467 b is offset azimuthally by about 6 . 4 ° counterclockwise from the spoke 7423 c . one of the spokes 7467 a is offset azimuthally by about 6 . 4 ° clockwise from the spoke 7423 c . each spoke 7467 a and 7467 b has a width of about 0 . 125 inch . the seventh ring 7407 has an inner diameter of at least 8 . 89 inches ( e . g . between 9 . 34 and 9 . 37 inches ) and an outer diameter of at most 10 . 18 inches ( e . g . between 9 . 66 and 9 . 69 inches ). two cutouts 7407 ah and 7407 bh with a width of about 0 . 25 inch separate the seventh ring 7407 into two sections . the cutout 7407 ah is offset azimuthally by about 90 ° counterclockwise from the spoke 7423 c . the cutout 7407 bh is offset azimuthally by about 90 ° clockwise from the spoke 7423 c . the first annular gasket 7500 ( see fig7 c ) has an inner diameter of about 11 . 95 inches and an outer diameter of about 12 . 47 inches . the first annular gasket 7500 has three small - diameter cutouts 7508 a , 7508 b and 7508 c on its inner perimeter . the cutouts 7508 b and 7508 c are azimuthally offset from the cutout 7508 a by about 92 . 5 ° clockwise and about 190 ° clockwise , respectively . the centers of the cutouts 7508 a , 7508 b and 7508 c are located at a radial distance of about 6 . 02 inches from the center of the first annular gasket 7500 . the cutouts 7508 a , 7508 b and 7508 c face inward and include a semi - circular outer periphery with a diameter of about 0 . 125 inch and include an inner opening with straight radial edges . the first annular gasket 7500 also has three large - diameter round and outwardly facing cutouts 7508 x , 7508 y and 7508 z on its outer perimeter . the cutouts 7508 x , 7508 y and 7508 z are azimuthally equally spaced and have a diameter of about 0 . 72 inch . their centers are located at a radial distance of about 6 . 48 inches from the center of the first annular gasket 7500 . the cutout 7508 x is azimuthally offset from the cutout 7508 a by about 37 . 5 ° clockwise . when installed in the showerhead electrode assembly 100 b ( as described in details hereinbelow ), the cutout 7508 a is offset azimuthally by about 90 ° counterclockwise from the spoke 7423 c in the inner gasket 7400 . the second annular gasket 7600 has an inner diameter of about 13 . 90 inches and an outer diameter of about 16 . 75 inches . the second annular gasket 7600 has eight circular holes 7609 a equally spaced azimuthally . the centers of the holes 7609 a are located at a radial distance of about 7 . 61 inches from the center of the second annular gasket 7600 . the holes 7609 a have a diameter of about 0 . 55 inch . when installed in the showerhead electrode assembly 100 b ( as described in details hereinbelow ), one of the holes 7609 a is azimuthally aligned with the hole 7403 y on the third ring 7403 in the inner gasket 7400 . the second annular gasket 7600 also has one round inwardly facing cutout 7609 b on the inner perimeter of the outer gasket 7300 . the center of this cutout 7609 b is located at a distance of about 6 . 98 inches from the center of the second annular gasket 7600 . the cutout 7609 b has a diameter of about 0 . 92 inch . when installed in the showerhead electrode assembly 100 b ( as described in details hereinbelow ), the cutout 7609 b is azimuthally offset from the hole 7403 y by about 202 . 5 ° counterclockwise . the second annular gasket 7600 further has three circular holes 7610 , 7620 and 7630 configured to allow tool access . these holes are located at a radial distance of about 7 . 93 inches and have a diameter of about 0 . 14 inch . the holes 7610 , 7620 and 7630 are offset azimuthally by about 7 . 5 °, about 127 . 5 ° and about 252 . 5 ° respectively clockwise from the cutout 7609 b . the third annular gasket 7700 has an inner diameter of about 17 . 29 inches and an outer diameter of about 18 . 69 inches . the third annular gasket 7700 has eight round outwardly facing cutouts 7701 equally spaced azimuthally on the outer perimeter . the centers of the cutouts 7701 are located at a radial distance of about 9 . 30 inches from the center of the third annular gasket 7700 . the cutouts 7701 have a diameter of about 0 . 53 inch . when the inner electrode 120 b is installed in the showerhead electrode assembly 100 b , an alignment ring 108 b ( fig1 b ), two inner alignment pins 109 b ( not shown in fig1 b ) and three outer alignment pins ( not shown in fig1 b ) are first inserted into the annular groove 550 b , holes 540 ba / 540 bb and holes 530 b ( fig5 k ), respectively . the inner gasket 7400 is then mounted to the inner electrode 120 b . the holes 7403 x and 7403 y ( fig7 d ) correspond to the inner alignment pins 109 b ; and the center hole of the inner gasket 7400 corresponds to the alignment ring 108 b and the center gas injection hole in the inner electrode 120 b . openings between the seven rings and in the spokes in the inner gasket 7400 correspond to the first row through the sixth row of gas injection holes in the inner electrode 1208 . the first annular gasket 7500 is mounted onto the inner electrode 120 b . the cutouts 708 a , 708 b and 708 c correspond to the holes 530 bc , 530 bb and 530 ba , respectively . the seventh and eighth rows of gas injection holes fall in the opening between the inner gasket 7400 and the first annular gasket 7500 . eight stud / socket assemblies 303 are threaded into the eight threaded holes 520 b to fasten the inner electrode 120 b to the backing plate 140 b , with the inner gasket 7400 and first annular gasket 7500 sandwiched therebetween . the clamp ring 150 b is fastened onto the backing plate 140 b by a plurality of bolts threaded into threaded openings in the underside of the backing plate 140 b . the stud / socket assemblies 303 and the clamp ring 150 b support the inner electrode 120 b at a location between the center and outer edge and at the outer edge , respectively , improve thermal contact with the backing plate 140 b and reduce warping of the inner electrode 120 b caused by temperature cycling during processing of substrates . the second annular gasket 7600 is placed on the outer electrode 130 b . the eight holes 7609 a correspond to the eight cam locks threaded on the outer electrode 130 b . the outer electrode 130 b and the inner electrode 120 b are fastened against the backing plate 140 b by rotating the cam shafts 207 b . the c - shaped shroud 190 in fig1 b is fastened to the backing plate 140 b by a plurality of ( preferably eight ) cam locks . the third annular gasket 7700 is placed between the shroud 190 and the backing plate 140 b . the cutouts 7701 correspond to the cam locks between the shroud 190 and the backing plate 140 b . the rings 7401 - 7407 and the spokes in the inner gasket 7400 may be arranged in any suitable pattern as long as they do not obstruct the gas injection holes 106 b , the cam locks 160 b , alignment ring 108 b , or alignment pins 109 b in the inner electrode 120 b . fig7 e shows a top view of yet another gasket set . this gasket set comprises an inner gasket 7800 comprising a plurality of concentric rings connected by a plurality of spokes , a first annular gasket 7500 with a plurality of cutouts on an outer and an inner perimeter , a second annular gasket 7600 with a plurality of holes and one cutout , and a third annular gasket 7700 with a plurality of cutouts . this gasket set is identical to the gasket set shown in fig7 c and 7d , except that the inner gasket 7800 ( as shown in fig7 f ) does not have the seventh ring and spokes connecting the sixth and the seventh rings . the rings and the spokes in the inner gasket 7800 may be arranged in any suitable pattern as long as they do not obstruct the gas injection holes 106 b , cam locks 160 b , alignment ring 108 b , or alignment pins 109 b in the inner electrode 120 b . while the showerhead electrode assemblies , inner electrodes , outer electrodes and gasket sets have been described in detail with reference to specific embodiments thereof , it will be apparent to those skilled in the art that various changes and modifications can be made , and equivalents employed , without departing from the scope of the appended claims .	5
a drilling system according to a first embodiment of the present invention will be described with reference to fig1 through 4 . a drilling system 1 shown in fig1 mainly includes a drilling machine 2 and a compressor 30 . the drilling system 1 is used for drilling shallow holes in a concrete body or the like to which screws and the like are secured . throughout the specification , a drilling direction will be referred to as a front direction . the drilling machine 2 shown in fig2 has a housing 3 serving as an outer frame . a drill bit 22 extends from a front end of the housing 3 . a motor 4 serving as an engine for the drilling machine 2 is accommodated in the housing 3 . an output shaft 5 extends in the front direction from the motor 4 . a fan 6 for cooling the motor 4 is fixed to the output shaft 5 . a handle 7 integrally extends from a lower portion of a rear end of the housing 3 . the handle 7 is provided with a trigger 8 , and a switching circuit 9 connected to the trigger 8 is disposed within the handle 7 for controlling the rotation of the motor 4 in response to the operation of the trigger 8 . a power cord 10 connected to the switching circuit 9 extends from a lower end of the handle 7 . a first wall 11 is positioned in front of the motor 4 and within the housing 3 to rotatably support the output shaft 5 . a second wall 12 is positioned in front of the first wall 11 and within the housing 3 . a rotation shaft 15 extends through the second wall 12 and is rotatably supported by the second wall 12 through a bearing . the second wall 12 and the bearing maintain air - tight arrangement between front and rear sides of the second wall 12 . a first gear 13 a , an intermediate gear 13 b and a second gear 14 are disposed between the first and second walls 11 and 12 . more specifically , an intermediate shaft 25 is rotatably supported by the first and second walls 11 and 12 , and the first gear 13 a and the second gear 13 b are concentrically fixed to the intermediate gear 25 . the first gear 13 a is meshedly engaged with the output shaft 5 . the second gear 14 is concentrically fixed to the rear end portion of the rotation shaft 15 , and is meshedly engaged with the intermediate gear 13 b . a third wall 18 is provided at the front end of the housing 3 , and a front end portion of the rotation shaft 15 frontwardly extends through the third wall 18 . the rotation shaft 15 is rotatably supported by the third wall 18 through a bearing . an airtight state is maintained between the front and rear sides of the third wall 18 and the bearing . an air chamber 19 is defined by the housing 3 , second wall 12 , third wall 18 and output shaft 15 . an air passageway 16 is coaxially extends through a front end portion of the rotation shaft 15 , and is open at a front end face of the rotation shaft 15 . a male screw is formed at an outer peripheral surface of the front end portion of the rotation shaft 15 . an air hole 17 radially extends through the rotation shaft 15 for communication between an air chamber 19 and the air passageway 16 . thus , the air chamber 19 is in communication with the atmosphere only through the air hole 17 and air passageway 16 . a compressed air suction plug 20 is connected to the housing 3 at a position between the second wall 12 and third wall 18 to communicate with the air chamber 19 . an air hose 21 is attached to the compressed air suction plug 20 for supplying a compressed air . thus , the compressed air supplied via the air hose 21 is passed through the compressed air suction plug 20 and supplied into the air chamber 19 . then , the compressed air is passed through the air hole 17 and air passageway 16 and finally discharged to the atmosphere . the air horse 21 has a length shorter than that of the power cord 10 . the drill bit 22 has a front end provided with a diamond cutting edge , and has a rear end portion formed with a female screw threadably engagable with the male screw of the rotation shaft 15 . an air passageway 24 is concentrically extends along an entire length of the drill bit 22 . the front end of the air passageway 24 serves as a discharge port 23 , and the rear end of the air passageway 24 is in communication with the air passageway 16 formed in the rotation shaft 15 . thus , the compressed air supplied from the air passageway 16 is ejected out of the discharge port 23 . the compressor 30 mainly includes a main body 31 and an air tank 32 . the main body 31 accommodates therein a control circuit 33 including a microcomputer shown in fig3 . the air tank 32 stores compressed air . the compressor 30 can be easily hand - carried from one site to another in terms of its size and weight . the main body 31 includes a drill socket 37 to which the power cord 10 is connectable , a power switch 44 for the drilling machine 2 , and a compressor power cord 43 . an air discharge port 40 is formed at the main body 31 . the air hose 21 is to be coupled to the air discharge port 40 . an electromagnetic valve 38 ( fig3 ) is provided in the main body 31 to serve as a valve for the air discharge port 40 . further , an air compression motor 39 ( fig3 ) is disposed in the main body 31 for generating compressed air to be stored in the air tank 32 . as shown in fig3 , the air tank 32 is provided with a pressure sensor 41 for detecting a pneumatic pressure within the tank . the drill socket 37 is provided with a current detector 42 that detects a current . the above detection results are output to the control circuit 33 . the main body 31 further includes a drill relay 34 , a valve relay 35 and an air compression relay 36 , those connected to the control circuit 33 . thus , these relays 34 , 35 , 36 are controlled by the control circuit 33 . the drill relay 34 is adapted to turn on / off of the power supply to the drill motor 4 via the drill socket 37 . the valve relay 35 is adapted to turn on / off of the power supply to the electromagnetic valve 38 . the air compression relay 36 is adapted to turn on / off of the power supply to the air compression motor 39 . in operation , the drilling operation is started with the condition shown in fig1 . that is , the power cord 10 of the drilling machine 2 is connected to the drill socket 37 of the compressor 30 . the air hose 21 extending from the air discharge port 40 of the compressor 30 is connected to the compressed air suction plug 20 of the drilling machine 2 . the compressor power cord 43 of the compressor 30 is connected to a power source ( not shown ). in this state , an operator can perform the drilling operation within an imaginary circle centered on a power source ( not shown ) and having a radius corresponding to the length of the compressor power cord 43 without a need of changing the power source . in addition , the operator can perform the drilling operation within an imaginary circle centered on the compressor 30 and having a radius corresponding to the length of the air hose 21 without moving the compressor 30 . as a result , since the compressor 30 can be easily moved as described above , the operator can perform the drilling operation within a circle centered on the power source ( not shown ) and having a combined radius obtained by the length of the compressor power cord 43 plus the length of the air hose 21 without a need of changing the position of the power source . the power switch 44 is turned on in the state where the above - described connections are maintained . in this state , determination cannot be made whether compressed air has been stored in the air tank 32 , so that determination whether the drilling operation that requires the compressed air is possible or not also cannot be made . therefore , in the initial state , the drill relay 34 , valve relay 35 , and air compression relay 36 are all in off state so as to disable all works and operations . a pressure within the air tank 32 is then detected by the pressure sensor 41 . when the detected pressure is higher than a predetermined pressure , the drill relay 34 is turned on . when the trigger 8 of the drilling machine 2 is pulled in this state , the drilling machine 2 can be activated . on the other hand , if the detected pressure is lower than the predetermined pressure , the air compression relay 36 is turned on to activate the air compression motor 39 . a pressure within the air tank 32 is detected by the pressure sensor 41 at predetermined time intervals even in the state where the air compression motor 39 is activated . when the detected pressure becomes higher than the predetermined pressure , the air compression relay 36 is turned off to stop the sion relay 36 is turned off to stop the air compression motor 39 . thereafter , the drill relay 34 is turned on to allow the drilling machine 2 to be activated when the trigger 8 of the drilling machine 2 is pulled . if the trigger 8 is pulled under the condition that the air compression relay 36 is in off state and the drill relay 34 is in on state , the switching circuit 9 is turned on to allow a current to flow into the drill motor 4 , thereby activating the drilling machine 2 . at this time , a current flow is detected by the current detector 42 provided at the drill socket 37 . based on the detection result , the control circuit 33 turns the valve relay 35 on to allow a current to flow into the electromagnetic valve 38 to open the air discharge port 40 . thus , the compressed air in the air tank 32 is delivered to the air hose 21 , so that the air can be discharged out of the discharge port 23 through air passageways 16 and 24 . a current flowing through the drill socket 37 is detected by the current detector 42 at predetermined time intervals even in the state where the drill motor 4 is activated . when the drill motor 4 is stopped and the current detector 42 detects that a current does not flow through the drill socket 37 , the control circuit 33 turns the valve relay 35 off to stop the discharge of compressed air . thereafter , a pressure within the air tank 32 is again detected by the pressure sensor 41 . when the detected pressure is not greater than the predetermined pressure , the air compression relay 36 is turned on after the drill relay 34 has been turned off , so that compressed air is stored in the air tank 32 by the air compression motor 39 . at the time when a pressure within the air tank 32 becomes higher than the predetermined pressure , the air compression relay 36 is turned off . the drill relay 34 is then turned on to start the drilling operation . by repeating the above process , the drilling operation can be performed continuously . the above process will be described based on a flowchart shown in fig4 . firstly , the power switch 44 is turned on as a starting condition . the routine then advances to s 01 . in s 01 , initial setting is performed , that is , confirmation is made that the drill relay 34 , valve relay 35 , and air compression relay 36 are all in off state . after the confirmation , the routine proceeds into s 02 where a pressure within the air tank 32 is detected . based on the detection result in s 02 , determination is made in s 03 whether the pressure within the air tank 32 is higher than the predetermined pressure . when it has been determined that the pressure is not more than the predetermined pressure ( s 03 : no ), the routine advances to s 04 . in s 04 , the drill relay 34 is turned off . at the start time , since all the relays have been turned off in s 01 , the drill relay 34 is maintained in off state without change . the air compression relay 36 is then turned on in s 05 to activate the air compression motor 39 , thereby storing compressed air in the air tank 32 . thereafter , the routine returns to s 02 , where a pressure within the air tank 32 is again detected . a flow a including s 02 to s 05 is repeated until a pressure within the air tank 32 has become higher than the predetermined pressure . in s 03 , when the pressure within the air tank 32 is determined to be higher than the predetermined pressure ( s 03 : yes ), the routine advances to s 06 where the air compression relay 36 is turned off to stop the air compression motor 39 . after that , the routine advances to s 07 where the drill relay 34 is turned on to make the drill motor 4 ready for operation . at the time when the drill motor 4 is in ready condition , the routine advances to s 08 , where a current flowing through the drill socket 37 is detected . based on the detection result , determination is made in s 09 whether a current flows or not , in other words , determination whether the drilling operation of the drilling machine 2 is being performed by the operator or not is made . when it has been determined that the drilling operation is being performed ( s 09 : yes ), the routine advances to s 11 where the valve relay 35 is turned on to open the electromagnetic valve 38 , so that the compressed air is discharged from the air discharge port 40 into the drilling machine 2 . thereafter , the routine returns to s 08 where a current flowing through the drill socket 37 is again detected . while the drilling machine 2 is operated , a flow c including s 08 , s 09 , and s 11 is repeated . when the determination is made in s 09 that the drilling operation is not being performed , that is , a current does not flow through the drill socket 37 ( s 09 : no ), the routine advances to s 10 where the valve relay 35 is turned off . thereafter , the routine returns to s 02 . in s 02 , a pressure within the air tank 32 is again detected . in s 03 , when the pressure within the air tank 32 is determined to be not greater than the predetermined pressure , the routine advances to s 04 , where the air compression relay 36 is turned on after the drill relay 34 has been turned off . after that , the routine returns to s 02 . while the drilling machine 2 is not operated , a flow b including s 02 , s 03 , and s 06 to s 10 is repeated . a drilling system according to a second embodiment of the present invention will be described with reference to a flowchart shown in fig5 . the second embodiment is similar to the first embodiment in terms of a mechanical arrangement . an operational routine s 1 through s 11 is the same as that of s 101 to s 111 of the second embodiment . however , the second embodiment further includes steps s 111 through s 115 because of the following reason . since deep hole drilling is not assumed in the drilling system 1 according to the above embodiment , the case where a pressure within the air tank 32 falls below the predetermined pressure during drilling operation is not paid attention to . thus , as a modification to the first embodiment , the flowchart shown in fig5 includes the case where a pressure within the air tank 32 falls below the predetermined pressure during drilling operation . in the flowchart of fig5 , since the routine from s 101 to s 111 is the same as the routine from s 01 to s 11 in the flowchart of fig4 , the description thereof will be omitted . after the valve relay 35 has been turned on in s 111 , a pressure within the air tank 32 is detected in s 112 . based on the detection result , determination is made in s 113 whether the pressure within the air tank 32 is greater than a specified value that is sufficient for cooling the drill bit 2 . when the pressure within the air tank 32 is determined to be higher than the specified value ( s 113 : yes ), the routine returns to s 108 . when the pressure within the air tank 32 is determined to be not greater than the specified value ( s 113 : no ), the routine advances to s 114 , where the drill relay 34 is turned off . after that , the routine advances to s 115 where the air compression relay 36 is turned off to end the operation . if the drilling system 1 is to be operated again , the routine will be started from s 101 . according to the above - described embodiments , compressed fluid can automatically be supplied from the compressor 30 to the drilling machine 2 only at the time when the drilling machine 2 is operated , and an amount of the compressed fluid to be supplied can be adjusted depending on the operational state of the drilling machine 2 . further , since the drill motor 4 and air compression motor 39 , which are the driving units that consume the most electric power , are not operated simultaneously , maximum electric power consumption can be reduced , and reduced noise generation can result . further , the compressed air is not wastefully consumed in the compressor 30 , a satisfactory cooling effect can be expected in spite of an employment of a compact compressor . while the invention has been described in detail and with reference to specific embodiments thereof , it would be apparent to those skilled in the art that various changes and modifications may be made therein without departing from the spirit and scope of the invention . for example , in the above - described embodiments , whether the drilling machine 2 is running or not is confirmed by detection to the current flowing through the drill socket 37 . alternatively , however , the operation of the drilling machine 2 may be confirmed based on a voltage change , vibration of the drilling machine 2 , noise or the like .	8
turning now to the drawings , wherein like items are referenced as such throughout . fig1 illustrates a block diagram of one embodiment of the flow monitor 100 of the present invention . a signal source 102 is shown electrically coupled to a signal splitter 104 , through an attenuator 106 , such as a pin diode attenuator , a directional coupler 108 , and on to a sensor 110 . the directional coupler 108 is also coupled to a first amplifier 112 , and on to a detector 114 , a second amplifier 116 , and a differential operational amplifier 118 . a similar channel is shown for sensor 110 &# 39 ;. additionally , a switch 120 is coupled in parallel to the output signal of each of the amplifiers 116 , 116 &# 39 ;, for purposes of single channel measurement . the functional operation of the circuit of fig1 will now be described . an rf power signal from source 102 is split and coupled to electronic attenuators 106 ( 106 &# 39 ;), that are bias voltage controlled . the pin diode attenuator 106 ( 106 &# 39 ;) can be used to regulate the amplitude of the signal at the detector 114 ( 114 &# 39 ;) or to activate and deactivate the sensor 110 ( 110 &# 39 ;). the split signal may then be directed to either , or both of sensors 110 ( 110 &# 39 ;) via the previously described directional coupler . the directional coupler 108 ( 108 &# 39 ;) samples the reflected power from the sensor 110 ( 110 &# 39 ;). a portion of the reflected power signal is coupled to the detector 114 , and subsequently on to the operational amplifier 118 , and on to additional processing means 124 . fig2 illustrates a graphical illustration of a typical two dimensional curve 200 , of the reflected power signal to the signal frequency . the point on curve 200 , represented by 205 , is a frequency that can be used to measure the dielectric constant of the fluid in the sensor 110 ( 110 &# 39 ;) and is called the characteristic frequency . in order to diminish the effects of cross - talk interference between the sensors and detectors , the channels are alternatively activated at different time intervals . the reflected power , or characteristic frequency is measured for one sensor 110 , the circuit is switched , via switching means 120 , and the measurement is repeated on the other sensor 110 &# 39 ;. it is only necessary to store one data point for each channel . either the characteristic frequency , or the amplitude of the reflected power at a given frequency may be used as the single data point for each channel . if the characteristic frequency is used , it may be selected from the scan of the reflected power versus frequency , and only the single point value retained for correlation purposes . an alternate embodiment of the above configuration would be elimination of one of the channels , associated electronic circuitry and switching the signal between the sensors 110 and 110 &# 39 ;. this implementation would require the use of mechanical switches , that provide no directionality to power flow . such switches often prove less reliable than electronic switches when used for long periods of time , or after numerous switching events , and may be slow as contrasted to solid state devices . in addition to the increased speed of solid state switches , they typically provide superior isolation of the input from the output signal , such that power can only flow in one direction . consequently , a minimum of two directional couplers are recommended . by inserting a second solid state switch , the signal source 102 , detector 114 , amplifier 112 , could be common to both sensors . in such instances not requiring an rf amplifier , a detector could be used with each directional coupler and a low frequency switch rather than a high frequency device that could be inserted so that the low frequency components are common to both sensors 110 and 110 &# 39 ;. the sensor 110 described in fig1 may be implemented in a variety of ways as determined by application design requirements . fig3 and 4 are illustrative of alternate embodiments suitable for use in monitor 100 ( see fig1 ). the sensor 300 of fig3 is a slotted metallic pipe sensor of variable length , diameter , and wall thickness . a coaxial cable 305 is electrically coupled to tubular shell 310 of the sensor 300 at slot 315 . the slot 315 is filled with a dielectric material that exhibits low loss at the signal of interest . the purpose of the coaxial cable 305 coupled to the slot 315 is to inject a radio frequency signal into the tubular section 310 , which then acts as a waveguide to carry the signal for measuring the characteristics of the slurry flowing within it . fig4 depicts a metallic clamshell sensor 400 , also of variable dimensions , suitable for use in monitor 100 ( fig1 ). the sensor 400 is comprised of two symmetrical halves 410 , 411 having longitudinal seams 412 , 413 . each half 410 , 411 is electrically insulated from the other half , thereby only allowing tm mode signals to be propagated . by constructing the sensor 400 to only support tm mode signal propagation , signal interference from other modes are thereby eliminated . rf signal injection and slurry characteristics are determined as set forth below . the clamshell design permits the sensor to be used when the slurry is transported through a non - conductive pipe or tube such as plastic or glass . in this embodiment , the clamshell is place around the pipe containing the slurry . this permits the sensor to be installed without interrupting the fluid transport . for purposes of measuring mixture concentration , a single sensor may be used . the characteristic frequency 205 provides a measure of the concentration of one component of the slurry . as the concentration of the slurry changes , the entire curve 200 shifts to the right ( or left ) with respect to the x axis , depending upon the dielectric constants of the different components of the slurry and the resultant concentration . the calibration of the characteristic frequency for sensor 400 as a function of the slurry concentration will differ from the calibration of the slotted metallic pipe sensor 300 of the same diameter because of the selection of the tm mode and the presence of the pipe or tube . flow rate determinations , however , require that signals from both sensors 110 ( 100 &# 39 ;) be cross - correlated . either the characteristic frequency , or the amplitude of reflected power at a given frequency can be used for the correlation procedure . since the curve 200 changes position on the x axis , as the slurry concentration varies , in both the reflected power when measured at a fixed frequency , either parameter may be used for cross - correlation . if reflected power measurements are used for correlation , the frequency at which data is collected can be preset , or selected from the optimal range ( c - c &# 39 ;) of curve 200 . utilizing the amplitude of the reflected power at a selected frequency would provide greater dynamic range , but use of characteristic frequency may be easier to implement . additionally , if cross - talk is not a problem , then auto - correlating the difference between the detected reflected power from both channels may be measured with the differential amplifier 118 ( see fig1 ), thereby providing greater dynamic range and corresponding sensitivity . while particular embodiments of the present invention have been shown and described , it should be clear that changes and modifications may be made to such embodiments without departing from the true scope and spirit of the invention . it is intended that the appended claims cover all such changes and modifications .	6
fig1 shows a wood preform 11 , which maybe formed from one of several varieties of trees , e . g ., black walnut or maple . as shown in the figures , preform 11 is a rectangular solid , though preform 11 may be of any shape capable of withstanding the process described below . preform 11 has an upper surface 13 into which a recess 15 is machined , recess 15 having a rough , general shape of the desired negative mold , as shown in fig2 . the negative mold is machined to have undersized dimensions , allowing for machining to the desired dimensions of the finished mold after subsequent steps . as illustrated in fig2 the rough shape of recess 15 lacks the smooth contours of the desired shape ( shown in fig4 and 6 ). because wood is relatively soft when compared to normal tooling materials , such as invar alloy , machining preform 11 is quick and causes little wear on the tools used in the machining process . though not shown , a positive mold would require an oversized rough shape to provide for additional material to be machined in later steps . once recess 15 is cut into preform 11 , preform 11 is pyrolyzed in an inert atmosphere . to prevent combustion of preform 11 , an inert gas , preferably argon , is used within the furnace , the argon displacing oxygen - rich air . because preform 11 has moisture within it , preform 11 is first slowly dried to prevent cracking of preform 11 that could occur during pyrolyzation . the preferred method of drying preform 11 involves covering preform 11 with a vacuum bag , applying vacuum to the bag , then placing the bagged preform 11 in a pressurized autoclave and increasing the temperature within the autoclave . for example , the temperature in the autoclave is raised at up to 10 ° c . per minute to a temperature of 90 ° c . to 120 ° c ., where it is held for several hours , allowing for moisture to be removed without damage to preform 11 . the pressurized atmosphere minimizes the temperature gradients in the autoclave and in preform 11 , which reduces the chance of preform 11 warping during drying . also , the pressurized atmosphere within the autoclave , which may be up to 90 psi of nitrogen , applies pressure to the outer surfaces of preform 11 , reducing the amount of cracking occurring in larger preforms 11 . the vacuum bag allows for negative pressure to be applied to preform 11 , enhancing the process of moisture removal prior to the water turning to steam , which may cause cracking of preform 11 . the drying step may also be divided into two steps to avoid cracking in thick preforms 11 . for example , the autoclave may be raised to approximately 90 ° c . and held for 2 hours to 24 hours for an initial drying . for best results , vacuum should be applied to the bag at the beginning of the cycle . then the temperature can be raised at up to 1 ° c . per minute to between 100 ° c . and 120 ° c . and held for an additional 2 hours to 24 hours , ensuring a complete drying of preform 11 . the next step is to remove preform 11 from the autoclave , remove the vacuum bag , then replace preform 11 in the autoclave with a pressurized nitrogen atmosphere , preferably 15 psi to 90 psi . the pressure in the autoclave minimizes thermal gradients in the autoclave and provides increased hydrodynamic pressure to maintain the dimensional stability of preform 11 . the temperature within the autoclave is slowly increased again at up to 5 ° c . per minute to preferably between 100 ° c . and 120 ° c . and is held for 1 hour to 10 hours , then is preferably ramped upward to 220 ° c . at the rate of approximately 0 . 28 ° c . per minute . when preform 11 approaches 220 ° c ., an oily residue , referred to as bio - oil , and vapors begin to emerge from preform 11 . bio - oils are a mixture of chemicals resulting from the decomposition of organic matter within the wood of preform 11 . the vacuum bag is removed before this step to prevent bio - oil and vapors from entering vacuum lines and to obviate the need for providing bleed cloths within the bag to absorb the bio - oil as it is produced . once the temperature has reached 220 ° c ., the rate of increase of the temperature is preferably reduced to approximately 0 . 17 ° c . per minute until the temperature reaches between 375 ° c . and 425 ° c ., though the rate may be up to 1 ° c . per minute . preform 11 is preferably held at approximately 400 ° c . for 1 hour to 10 hours , the ambient pressure assisting in extracting the bio - oil . afterward , preform 11 is removed from the autoclave , cooled , then inserted into a furnace where preform 11 is heated to a higher temperature than in the autoclave . the furnace preferably has a constantly - flowing argon or nitrogen atmosphere at 1 psig to 10 psig . the temperature in the furnace is raised to approximately 400 ° c . at 1 ° c . to 5 ° c . per minute , then held from 1 hour to 10 hours . the temperature is then raised to between 900 ° c . and 1100 ° c . at a rate of up to 1 ° c . per minute , and preform 11 is held at that temperature for approximately 1 hour to 10 hours . preform 11 is then cooled to room temperature at a rate of approximately 1 ° c . to 5 ° c ., preferably under constantly flowing nitrogen or argon . at this point , all of the material within preform 11 is completely pyrolyzed . the entire pyrolyzation process may take approximately 90 hours , though the time may be longer or shorter for different woods , thicknesses , shapes , etc . a pyrolyzed preform 11 is shown in fig3 a lower corner having been removed to reveal the carbonaceous , foam - like material remaining in preform 11 . after pyrolyzing preform 11 , recess 15 in upper surface 13 is machined to net - shape dimensions . by machining again after the pyrolyzation , dimensional changes in recess 15 caused by the pyrolyzation can be accounted for while also removing the additional material in recess 15 due to the undersize dimensions . fig4 shows recess 15 as having the desired smooth contours of the finished mold . the machining of the pyrolyzed preform 11 requires very little effort and causes little to no wear on machine tools . to provide silicon and convert preform 11 into a sic material , pyrolyzed preform 11 is immersed in a tank 17 containing liquid silicon or silicon alloy 19 , shown in fig5 . preform 11 is held in tank 17 and at a temperature from approximately 900 ° c . to 1450 ° c . for 20 to 90 minutes . liquid silicon 19 is drawn into preform 11 by capillary action , filling the micropores of preform 11 . the infusion may also be assisted by vacuum . liquid silicon 19 readily infiltrates the pores of preform 11 , where the silicon reacts with the carbon of preform 11 to form sic . if a silicon alloy , such as silicon - refractory metal alloys , is used , refractory disilicide is precipitated as the silicon reacts with the carbon . in either case , the final result is a dense matrix comprising silicon carbide and some free silicon or , in the case of alloy infiltration , some additional precipitated disilicide . fig6 shows the finished tool 21 formed from preform 11 . a corner of tool 21 has been removed to illustrate the ceramic structure throughout tool 21 . while it is desirable for recess 15 to have net - shape dimensions after the immersion and heating steps , some machining may be required to dimension recess 15 to within desired tolerances . after typical tooling preparation , tool 21 maybe used to form components from composite materials . fig7 shows a flowchart containing the steps for creating a composite layup tool using the method described above . in addition , the method includes layup of a composite component as an optional last step of the method . the step of block 23 is the rough shaping of the preform , which is then vacuum bagged and heated in an autoclave , as described in block 25 . in the step of block 27 , the bag is removed , and the preform is heated to a higher temperature , preform releasing vapors and bio - oil . the preform is completely pyrolyzed in the step of block 29 , then preform is machined to net - shape dimensions in the step of block 31 . the step of block 33 is the immersion of the preform in liquid silicon at approximately 900 ° c . to 1450 ° c . to cause the formation of sic . these steps may be used to form any type of ecoceramic part , component , or tooling , and the step of block 35 provides for layup of composite parts on the tooling , as shown in fig7 and 8 . to prevent composite components formed on tool 21 from adhering to upper surface 13 and mold details such as recess 15 , a mold release , or mold sealant , is applied to upper surface 13 , as shown in fig8 . mold release may be a wax or other form of release that coats surface 13 to limit the difficulty of removal of a composite component after the resin in the component is cured . fig9 shows a composite component 37 being formed on tool 21 . component 37 is formed from composite materials , typically multiple layers of woven fabric , though other types of fiber layers maybe used , for example , fiber mats having short fibers in random orientations . the layers are preferably impregnated with an uncured resin prior to layup , but resin may be brushed on or otherwise applied to dry layers after each layer is placed on tool 21 . layers of component 37 are laid on surface 13 , conforming to the contours of recess 15 . a debulking process may be performed during layup to remove excess resin and to compact the layers . after the desired number of layers is applied , component 37 is cured while remaining on tool 21 , curing typically occurring within an autoclave or other type of oven . component 37 is then removed from tool 21 . the advantages of using the present invention to form large ecoceramic components , such as large tooling structures , is that limitations to the size of wood preforms are determined only by the size of the furnaces used , not by the cracking or warping problems of prior methods . furnaces exist which are large enough to accommodate any current composite tooling structure used in aerospace manufacturing . also , techniques have been developed for joining multiple sic components using the same heating process that converts the infused carbonaceous material to sic . therefore , very complex tooling structures can be formed from several pieces . there are several advantages to using ecoceramics for composite tooling . since all the machining is done in the wood or the carbonized state of the material , ecoceramics provide a faster and more economical alternative to machining tooling from metal , especially when considering the difficulty in machining invar alloy . silicon and silicon alloys are inexpensive materials , and heating costs are relatively insignificant . the ecoceramic material has other advantages over the traditional tooling materials in that it is more dent resistant , can be repaired , and has a capability of withstanding higher temperatures . while the invention has been shown in only one of its forms , it should be apparent to those skilled in the art that it is not so limited but is susceptible to various changes without departing from the scope of the invention . for example , wood particles , such as sawdust , can be mixed with binders and used to form the preform . the binders are carbonized along with the wood during the pyrolyzation step .	2
a first embodiment of master cylinder lever assembly 10 is illustrated in a perspective view in fig1 . the master cylinder lever assembly consists generally of a cylinder housing 12 having a bar clamp 14 at one end and a lever handle 16 pivotably attached at an opposite end . also seen in fig1 is a reservoir cover 18 which covers a “ backpack ” reservoir which will be described in greater detail below . also visible in fig1 is a contact point adjustment knob 20 which is also described in greater detail below . the master cylinder housing 12 is hydraulically connected to a slave cylinder which operates a hydraulic caliper ( not shown ) by hydraulic line 22 . fig2 is an exploded view of the “ backpack ” reservoir of the master cylinder lever of fig1 . the backpack reservoir consists of a reservoir chamber 28 defined in a rear facing portion of the master cylinder housing 12 . a cylinder wall 30 defining in part the cylinder of the master cylinder housing 12 extends into the reservoir chamber 28 and defines in part a first wall 31 . extending through the cylinder wall between the reservoir chamber 28 and the master cylinder is a timing port 32 and a compensating port 34 . a pair of bosses 36 extend axially of the cylinder wall 30 on opposite sides of the timing and compensating port 32 , 34 . a side wall 37 extends from the first wall . a diaphragm 38 made of an elastomeric material such as silicon rubber is made to overlay the side wall 37 and cover the reservoir chamber 28 . thus , the first wall 31 , the side wall 37 and the diaphragm 38 define the reservoir chamber 28 . the diaphragm 38 has an expansion protrusion 40 extending therefrom opposite the reservoir chamber . a reservoir frame 42 is configured to receive the periphery of the diaphragm 38 to maintain a tight seal between the diaphragm 38 and the reservoir chamber 28 . this seal is promoted and the assembled relationship maintained by four screws 44 received in corner holes of the reservoir frame 42 and diaphragm 38 and threadably engaged with corresponding holes in the master cylinder housing 12 . a vanity cover 46 snap fits over the diaphragm and frame to both provide an aesthetic appearance and to protect the diaphragm 38 . locating the timing and compensating ports 32 , 34 on the cylinder wall 30 as illustrated in fig2 essentially eliminates the possibility of air entering either of the timing or compensating ports regardless of the position of the master cylinder . as should be apparent to one skilled in the art , this is because air will always rise and the curved surface of the cylinder wall always cause air bubbles to be deflected away from the timing and compensating ports regardless of the position of the master cylinder . while in the preferred embodiment illustrated herein , the cylinder wall 30 is truly cylindrical , it could also have other configurations such as a triangular configuration with the ports located at the apex of the triangle which would have the same affect of preventing air bubbles from collecting in the vicinity of the timing or compensating ports . any other profile of the cylinder wall or location of the ports on the cylinder wall which prevents collecting of air bubbles in the vicinity of the timing and compensating ports is considered to be within the scope of the invention . the bosses 36 are provided to prevent the diaphragm 38 from covering and inadvertently sealing the compensation or timing ports as hydraulic fluid is drawn into the compensating and timing ports . as would be apparent to those skilled in the art , the bosses 36 could be replaced with similarly positioned posts or the like or other extensions to perform the same function of keeping the diaphragm spaced from the ports and such other configurations may have an additional advantage of minimizing the potential of air bubbles collecting in the vicinity of the ports . this structure facilitates a single lever being used on either a right or left portion of a handle bar without risk of bubbles entering the hydraulic fluid line . fig3 , a cross - section of the master cylinder , illustrates the piston train 49 operatively associated with the cylinder 50 of the master cylinder housing 12 . the cylinder 50 has a first end 51 and a second end 52 . fig4 illustrates the piston train 49 in an exploded view and the same reference numbers will be used to identify like elements in fig3 and fig4 . the piston train consists of a piston 54 received in the cylinder 50 having an annular cup or umbrella seal 56 abutting an internal portion of the piston 54 . a compression spring 60 biases the piston 54 toward the first or open end of the cylinder 51 . an “ o ” ring 62 forms a lower seal on the piston and is received within an annular recess in the piston . a hex spacer 64 has leading protrusion 66 with an annular detent that is snap fit into a corresponding female receptacle 68 in a trailing end of the piston 54 . this snap fit allows for relative rotational movement between the piston and the hex spacer 64 . the hex spacer 64 is in turn received in a hex hole 70 of contact point adjustment knob 20 . the knob 20 also has a leading externally threaded extension 72 which threadably engages a countersink 74 concentric with and external of the cylinder 50 . a male pushrod 76 having an externally threaded shaft 78 at its first end and a ball head 80 at its second end with posts 82 extending in opposite directions therefrom is snap fit received in a slotted socket 84 on an end opposite the protrusion 66 of the hex spacer 64 with the post 82 received in the slots 86 , as best seen in fig3 . the male pushrod 76 in turn is threadably engaged with a female pushrod 86 having an internally threaded cylinder 88 , again best viewed in fig3 . the female pushrod also includes a ball head 90 having oppositely extending posts 92 . a socket insert 94 has a leading ball socket 96 with opposite slots 98 for snap fit receiving the ball head 90 with the posts 92 received in the corresponding slots 98 . the socket insert 94 also includes locking posts 100 . referring to fig5 , these locking posts are received within a keyed orifice 102 in the lever handle 16 and then rotated 90 ° to lock the posts 100 in the annular slot 104 . referring back to fig3 , a dust cover 106 , which is preferably elastomeric , is engaged in an annular slot 108 of the knob 20 with a nipple end receiving the female pushrod 86 as shown . the basic operation of the master cylinder is well understood by those skilled in the art . referring to fig3 , pivoting the lever handle 16 upward from a rest position toward the cylinder housing causes the piston train 50 to drive the piston upward within the cylinder . as the piston moves upward in the cylinder the cup or umbrella seal 56 covers the timing port 32 which pressurizes the fluid within the hydraulic line 22 at the second end of the cylinder and which in turn actuates a slave cylinder within a hydraulically coupled brake caliper ( not shown ). when the lever handle 16 is released , the compression spring 60 biases the piston toward the first end of the cylinder to reassume the position shown in fig3 . the distance between the cup seal 56 and the timing port 32 is referred to as the “ dead - band .” during the part of lever actuation where the cup seal is between the timing port 32 and the first end of the cylinder , fluid in the reservoir between the seal and the timing port returns to the reservoir chamber 30 , perhaps causing expansion of the expansion protrusion 40 of the diaphragm 38 . during this part of lever actuation , the second end of the cylinder cannot be pressurized . it is highly desirable to be able to adjust the length of the dead - band in accordance with user preferences . rotation of the contact point adjustment knob 20 in a first direction allows for the dead - band to be taken up and reduced and rotation in a second direction increases the dead - band . in fig3 a maximum dead - band is shown because the knob is almost fully threaded from the countersink 74 . threading the knob into the countersink causes the piston to move upward , thus reducing the dead - band . obviously , the hex engagement between the hex spacer 64 and the knob 20 causes the hex spacer to rotate with the knob . however , the snap fit between the protrusion 66 and the female receptacle 68 of the piston prevents the piston from rotating relative to the knob , minimizing impairment of the seals . one highly advantageous aspect of this design is that as the knob is screwed inward in the first direction , the male pushrod rotates axially because of engagement between the posts 82 and the hex spacer . the threads between the male pushrod 76 and the female pushrod 86 are configured to cause the male pushrod to extend further from the female pushrod as a result of this axial rotation in the first direction . the respective threads of the knob and the pushrods are designed such that the net result is that the lever handle does not move relative to the housing as the knob is turned . this feature has the important advantage of maintaining a preselected start position of the lever resulting reach between the lever and the handlebar as the dead - band of the master cylinder is adjusted . in the event a user wishes to adjust the reach of the lever ( that is , the distance between a handle bar and the lever at the rest position ), this can be done independently of the dead - band adjustment by pivoting the handle away from the caliper housing to disengage the snap fit between the ball head 90 and the ball socket 96 of the socket insert 94 . once disengaged , the female pushrod 86 maybe rotated about its axis to extend or retract the female pushrod relative to the male pushrod to adjust the reach as desired . while the current embodiment may allow adjustment in 180 ° increments , other configurations allowing smaller increments of variation or perhaps event infinite variation of the lever reach are within the possession of those skilled in the art and within the scope of the invention . fig6 is an exploded view of the lever pivot assembly 110 of the first embodiment of the master cylinder lever of fig1 . the lever pivot assembly 110 consists of an axial bore 112 about which the lever handle 16 pivots . a threaded hole 114 perpendicularly intersects the bore 112 . a slotted bushing 116 ( preferably made of plastic ) which is part of a bushing plate 118 extends into each end of the bore 112 . a female bolt 120 is received through one slotted bushing while a male bolt 122 is received through the other slotted bushing so that they threadably engage within the bore 112 . as perhaps best seen in fig8 , the slotted bushings 116 each have annular camming tapers 124 between smaller and larger diameter portions of the bushing . a head of the female bolt 120 similarly has a camming taper which mates with the camming taper 124 of the bushing . likewise , the male bolt has a cammed surface which mates with a corresponding cammed surface of its corresponding bushing . referring to fig8 , as should be apparent to one skilled in the art , as the male bolt is threaded into the female bolt in the assembled configuration , the cam relationship causes the bushings to expand radially as the bolts are drawn axially together . this causes any “ slop ” in the pivotal connection between the lever handle and the caliper housing to be taken up . a lock screw 130 is threadably received in the threaded hole 114 and , as illustrated in fig8 , can be threadably inserted in the hole to lock the male and female bolts in their select position . as the pivot wears the lock screw 130 can be backed off and the female and male bolts more tightly threadably engaged to pickup any slop . fig9 is an alternate embodiment of the adjustable lever pivot assembly 110 ′. this embodiment differs in that the male bolt has a portion having an outer diameter equivalent to the outer diameter of the female bolt illustrated at 132 and the female bolt does not extend as far axially as the embodiment illustrated in fig8 . a gap 134 is provided between this enlarged diameter 132 of the male bolt 122 ′ and the female bolt 120 ′. in this embodiment , the lock screw 130 directly engages each of the male bolt 122 and the female bolt 120 which may provide more secure locking although it may not provide as much axial adjustment from either end of the lever . fig1 is a second embodiment of a master cylinder lever for a bicycle hydraulic disc brake 200 of the present invention . the second embodiment of the master cylinder lever assembly 200 consists of a cylinder housing 202 having a bar clamp 204 at one end and lever handle 206 pivotably attached to the housing at an opposite end . a reservoir housing 208 covers a hydraulic fluid reservoir 210 which will be discussed in greater detail below . also visible in fig1 is a worm knob 212 used to adjust the lever dead - band in a manner that will be discussed in greater detail below . the master cylinder housing 202 is hydraulically connected to a slave cylinder which operates a hydraulic caliper ( not shown ) by hydraulic line 214 . fig1 is an exploded view of a “ backpack ” reservoir of the master cylinder lever of fig1 . the backpack reservoir of fig1 is identical in its configuration to the backpack reservoir of fig2 except it is oriented substantially horizontally within the lever housing whereas the backpack reservoir of the first embodiment of the master cylinder lever of fig1 is oriented vertically . the same reference numbers are used to describe like elements and the detailed description of these elements is provided above with reference to fig2 . fig1 is a cross - section the master cylinder lever assembly of fig1 taken along line 12 - 12 of fig1 . fig1 illustrates a piston train 220 received within a cylinder 222 defined within the hydraulic cylinder housing 202 . the cylinder 222 has a first end 224 and a second end 226 . a threaded countersink 225 in the housing 202 abuts the second end 226 of the cylinder 222 , coaxial with a longitudinal axis of the cylinder . fig1 illustrates the piston train 220 in an exploded view and the same reference numbers will be used to identify like elements in fig1 and 13 . the piston train 220 consists of a piston 228 within the cylinder 222 . the piston 228 has a first annular cup or umbrella seal 230 near a leading end and a second annular cup or umbrella seal 232 near a trailing end . a push rod 234 has a threaded portion 236 at a first end and a head 238 at a leading second end . a leading portion of the head 238 defines a ball surface which is received in a corresponding cup surface 240 in a trailing end of the piston 220 . the threaded portion 236 of the push rod 234 is threadably engaged with the lever handle 206 in a manner that will be discussed in greater detail below . a hex orifice 241 is defined in the second end of the push rod and sized to fit an appropriate allen wrench . a plurality of radial ribs 242 extend axially from a rear surface of the head 238 opposite the ball surface ( see fig1 ). an externally threaded insert 244 has an externally threaded leading axial portion 246 and a trailing axial portion 248 having radially inclined gear teeth which are best viewed in fig1 and 14 . the threaded insert 244 further has an axial bore 250 having conical side walls . the bore 250 opens at the first end to an annular pocket 252 having axially extending teeth 254 configured to mate with the radial ribs 242 which extend axially from the rear surface of the head 238 ( see fig1 ). externally threaded insert 424 further includes a rearward facing pocket 256 receiving an elastomeric annular wipe seal 257 having a nipple which forms a seal with the push rod 234 . a worm 258 is received in the housing along an axis transverse an axis of the cylinder . the worm 258 has a threaded shaft 259 and a worm knob 212 . the threads 259 of the threaded shaft threadably engage the radially inclined teeth 248 of the externally threaded insert 244 . a c - clamp ( not shown ) or the like secures the worm 258 within the transverse bore in the housing by engaging an annular groove 261 in the distal end of the threaded shaft 259 . a coil spring 262 resides between a second end 226 of the cylinder and a leading end of the piston 228 to bias the piston toward the first end 224 . the coil spring also compresses the radial ribs 242 of the push rod head 238 into mated engagement with the axially extending teeth 254 of the threaded insert 244 so the push rod 234 rotates axially as the threaded insert is rotated . the lever handle 206 may be pivotably attached to the housing by lever pivot assembly described above with reference to fig6 and 8 . alternatively , a conventional pivot coupling may be used . spaced from the lever pivot assembly 110 , is a bore 264 in the lever along an axis parallel to the axis of the lever pivot assembly and transverse the axis of the cylinder 222 . a cross dowel 266 is received in the bore 264 . the cross dowel 266 includes a threaded bore 268 transverse the dowel axis . referring to fig1 , this threaded bore 268 threadably receives the threaded portion 236 at the first end of the push rod 234 . the basic operation of the master cylinder lever 200 of fig1 is similar to that of the first embodiment of the master cylinder lever 10 discussed above with reference to fig3 . the lever handle 206 is shown at a rest position in fig1 . as the lever is pivoted upward toward the bar clamp 204 and toward a fully actuated position , the push rod 234 is driven forward which in turn causes the piston 228 to move toward the second end 226 of the cylinder 222 . as the piston 228 moves toward the second end 226 of the cylinder 222 the leading cup or umbrella seal 230 covers the timing port 32 which prevents flow of fluid from the cylinder into the reservoir and causes build up of pressure in the second end of the hydraulic fluid cylinder which in turn pressurizes fluid within the hydraulic fluid line 22 and which in turn actuates a slave cylinder within a hydraulically coupled brake caliper ( not shown ). when the lever handle 16 is released , the compressing spring 262 biases the piston 228 toward the first end 224 of the cylinder to reassume the position shown in fig1 . pivoting of the push rod 234 about the head 238 by pivoting of the lever handle 206 is accommodated by the conical side walls of the axial base 250 . the distance between the cup seal 230 and the timing port 32 is referred to as the dead - band . as described above with reference to fig3 , during the part of lever actuation where the cup seal is between the timing port 32 and the first end of the cylinder , fluid in the reservoir between the seal and the timing port returns to the reservoir 30 . during this part of lever actuation , the second end of the cylinder cannot be pressurized . to adjust the length of dead - band , the piston can be advanced in the cylinder by rotating the knob 212 in a first direction which in turn causes rotation of the threaded insert to threadably advance the threaded insert within the threaded countersink 225 along the cylinder axis , thereby advancing the piston toward the second end of the cylinder . turning of the knob 212 in a second direction reverses the direction of the threaded insert to increase the dead - band . the ball and socket connection between the cup 240 at the trailing end of the piston and the ball at the leading end of the head 238 of the push rod 234 prevents the piston from rotating relative to the threaded insert which helps maintain the integrity of the seals . the second embodiment of the hydraulic cylinder lever of fig1 also includes a structure for compensating for movement of the push rod during dead - band adjustment to maintain the lever 206 in a select rest position . the threads between the threaded portion 236 of the push rod and the threaded bore 268 of the cross dowel 266 are configured to counteract pivoting of the handle that would otherwise occur about the lever pivot assembly 110 when the push rod 234 is moved by movement of the threaded insert 244 . in other words , as the threaded insert 244 is advanced toward the second end of the cylinder , which necessarily causes the advancement of the push rod 234 toward the second end of the cylinder and which would normally cause the lever handle 206 to pivot upward , the threaded engagement between the second end of the push rod and the cross dowel tends to move the lever handle 206 downward in an amount that corresponds to what would be the upward movement so as to maintain the lever handle 206 at a select start position . in the event a user wishes to adjust the reach of the lever , this can be done independently of the dead - band adjustment . insertion of an allen wrench into the hex orifice 241 allows for axial rotation of the push rod 234 . however , the worm connection between the threaded insert 244 and the worm 258 prevents rotation of the threaded insert 244 by the push rod 234 . because the threaded insert 244 is relatively fixed against rotation , turning of the push rod 234 causes disengagement between the radially extending ribs 242 of the head 238 and the complimentary axially extending teeth 254 in the externally threaded insert against the bias of the spring 262 and allows for pivotal movement of the lever handle 206 up or down in accordance with user preferences to provide a select reach . the teeth 254 and ribs 242 preferably have inclined , mating surfaces which define ramps facilitating this disengagement against the force of the bias of the spring 262 . disengagement can be aided by pushing axially on the allen wrench against the spring bias as the push rod 234 is rotated . in a highly preferred embodiment , the axis of the threaded bore in the cross dowel is provided to not intersect with the cross dowel axis . this has the effect of locking the push rod in place relative to the cross dowel when a load is placed on the lever handle 206 so as to prevent relative rotation between the push rod 234 and the cross dowel 236 . this feature thereby prevents inadvertent variation of the lever reach during lever actuation . an off - set of between 0 . 01 - 0 . 04 inches between the axes has been found to be sufficient . fig1 is a side elevation view of a master cylinder lever of fig1 . this figure is used to illustrate an embodiment of a lever geometry which has been found to provide significant advantages in lever operation . the bar clamp 204 is designed to receive a handle bar 280 along a clamp axis 282 . the lever handle 206 is pivotably connected by lever pivot assembly 110 about a pivot axis 284 . in a highly preferred embodiment , the pivot axis is 39 mm from the clamp axis . the lever handle 206 defines a finger receptacle 286 configured to receive at least one finger of a user . in the embodiment illustrated in fig1 , the finger receptacle 286 is configured to receive two fingers of a user and effective finger force point 288 is defined by approximately the center of a typical user &# 39 ; s two fingers . for the purpose of this application and the charts and calculations herein , the location of the finger force point is deemed to be 30 . 0 mm from the end of the lever when based on an estimate of an average user &# 39 ; s finger size . a select finger actuation path is defined by arrow 290 , and extends from the effective finger force point 288 at an “ engagement point ” of the lever . as used herein , the “ engagement point ” means a point along the arc of lever actuation where the pads of a caliper operatively associated with the master cylinder lever begin compressing a disc therebetween . in other words , a point where the lever handle drives the piston train against operative fluid resistance . the select ideal finger actuation path 290 is a design criteria intended to estimate a typical finger path of a user of the brake in typical operating conditions . based upon observations of users , the select ideal finger actuation path is at an angle θ 90 ° or greater . in fig1 the angle θ is 96 °, a best estimate of a typical average finger path . actual finger paths may range from 90 °- 108 °, or even greater than 108 °. an arc 292 is defined by movement of the effective force point 288 as a lever is actuated between the engagement point position shown in fig1 and a fully actuated position with the effective force point 288 at point 288 ′ in fig1 . in one embodiment of the invention illustrated in fig1 , the pivot axis 284 is preferably spaced from the clamp axis 282 a distance such that a chord between the points 288 and 288 ′ of the arc 292 substantially corresponds to the select ideal finger actuation path 290 . in this manner , a user experiences a mechanical advantage resulting from handle actuation that does not substantially decrease as the handle is pivoted between the at rest position and the fully actuated position . the angle of the chord between the point 288 and 288 ′ could actually be slightly less than the angle θ , but should be no less than 6 ° less than the angle θ so as to prevent an unacceptable loss of mechanical advantage . the desired chord defined by the arc between the rest position and the fully actuated position of the effective finger force point is able to meet the criteria of substantially corresponding to an ideal finger actuation path in the range of greater than 96 ° if the pivot axis 284 can be brought close enough to the clamp axis 282 . in the embodiment illustrated in fig1 , this geometry is facilitated by locating the reservoir 208 and the cylinder 222 of the master cylinder lever housing generally parallel to the clamp axis 282 , and the pivot 39 mm from the clamp axis . where the master cylinder is aligned vertically as with the first embodiment illustrated in fig1 - 5 , it would be very difficult to meet these design criteria because the cylinder and reservoir reside between the pivot axis 284 and the clamp axis 282 . this is illustrated in fig7 . here , the arc 292 ′ defined by pivotal movement of the effective finger force point 288 from the engagement point to the fully actuated position 288 ′ defines a chord 294 ′ that forms an angle less than 90 ° from the clamp axis 282 . however , the angle θ of the select ideal finger actuation path is greater than 90 °, again preferably greater than 96 °. as a result , a user would sustain a significant loss of mechanical advantage when trying to actuate the lever handle 206 along the select ideal finger actuation path 290 ′. fig1 - 19 illustrate the geometry of a highly preferred embodiment of the present invention as compared to representative hydraulic master cylinder levers on the market in 2002 . fig1 a is a brand b lever geometry . fig1 b is a brand a lever geometry . fig1 is a brand c lever geometry . fig1 is a lever geometry of a brand d hydraulic brake lever . beginning with fig1 , in a highly preferred embodiment of the present invention , the pivot axis 284 is 39 mm from the clamp axis 282 . for the purpose of this analysis , it is assumed that the engagement point is 50 mm from the clamp axis 282 , and is illustrated by the line 300 . the application of braking force from the engagement point to the conclusion of the lever movement is assumed to be 10 mm and is represented by the full actuation line 302 . finally , for the purpose of this analysis , the assumed ideal finger actuation pad 290 is an angle θ 96 ° from the clamp axis . the effective finger force point 288 is 30 mm from the bar end . the arc 304 represents the effective finger force point travel as the lever is actuated . a chord drawn between the engagement line where the effective finger force point is located at the beginning of brake actuation and the point that the full actuation line 302 intersects the arc 304 is at 96 °, equal to the ideal finger path angle θ . this provides for a minimal loss of mechanical advantage as the lever is actuated . in fig1 a the brand b lever has a pivot axis 284 53 mm from the clamp axis 282 . again , assuming an engagement point 300 beginning 50 mm from the clamp axis and a full actuation line 302 , 10 mm from the engagement point , it can be observed that the arc 304 of travel of the effective finger force point 208 deviates inwardly from the ideal finger path 290 . the same is true in fig1 b , where the brand a lever pivot axis is 50 mm from the clamp axis 282 . as will be illustrated in the figures discussed below , this results in an increasing loss of mechanical advantage over the lever stroke . fig1 and 19 represent the geometry of the brand c and brand d hydraulic brake levers respectively . like numbers are used to identify like elements of these figures . brand c , with the pivot axis located 63 mm from the clamp axis has a more pronounced deviation of the arc 304 from the ideal finger path 209 and thus , as will be illustrated below , has even a greater loss of mechanical advantage than the brand b lever . finally , the brand d levers , with a pivot point 65 mm from the clamp axis , produces an even greater loss of mechanical advantage . fig2 and 21 illustrate the respective mechanical advantage of the lever geometry of the present invention , designated as avid , and the brands a - d illustrated schematically above . referring first to fig2 , the geometry of brands a - d levers each will result in applying an additional amount of force to the lever along the ideal finger path over the course of the lever actuation . with respect to the avid lever of the present invention , it can be seen that the geometry actually produces an increasing mechanical advantage over the first 5 mm of lever travel and then a slight decrease of mechanical advantage ( less than 1 %) over the final 5 mm of lever travel . over the full range of lever travel , a net loss of mechanical advantage is zero . fig2 is essentially the inverse of fig2 . it illustrates that the geometries of the brand a - d levers result in a loss of power over the actuation stroke . again , the avid lever of the present invention actually provides improved power through the first 5 mm with slightly decreasing power over the final 5 mm of travel and no change in the net amount of power applied to the lever between the engagement point and full actuation of the lever . fig2 illustrates where the loss of power comes from by comparing how far from perpendicular to the clamp axis the finger force is over the lever actuation stroke . for the geometry of the present invention ( the avid lever ), the force begins 5 mm off , goes to perpendicular at about the center of the stroke and then returns to 5 mm off at the conclusion of the stroke . for brands a - d , a significant deviation from perpendicular is present at the beginning of the stoke and increases from there . as is apparent , the avid lever geometry provides an increasing range of mechanical advantage over at least a portion of the lever actuation . in its broadest sense , the present invention can be characterized as the selection of a lever geometry having a pivot axis of 50 mm or less that is always equal to or closer to the clamp axis than the engagement point . this geometry produces a lever having an increasing mechanical advantage over at least a portion of the actuation stroke but does not encompass the geometry of the brand a lever which is believed to be the lever having the pivot axis the closest to the clamp axis known in the art . fig2 is a cross - section of an alternate embodiment of the drive train of a master cylinder . the piston and cylinder of the embodiment of fig2 is essentially identical to that of the embodiment of fig1 , and like reference numbers followed by a prime (′) are used for like elements and described above in detail with respect to fig1 . the primary difference in the structures begins to the right of the surface 240 ′ in the trailing end of the piston 220 , which in fig2 is flat as opposed to a cup surface . the embodiment of fig2 has push rod 400 having a threaded portion 402 at a first end and head 404 at a second end . the head 404 has a bore receiving a pin 406 transverse the axis of the pushrod 400 . the head 404 is received in a socket 408 within a piston coupling 410 having a leading flat surface 412 abutting the cup 240 ′. referring to fig2 , the piston coupling 410 has axial slots 414 which receive the pins 406 to allow axial movement of the head 404 within the piston coupling 410 , but prevent axial rotation of the push rod 400 relative to the piston coupling 410 . the threaded portion 402 of the pushrod is threadably engaged with the lever handle 206 ′ in the same manner discussed above with respect to the embodiment of fig1 , including the off - center coupling with the cross - dowel . the piston coupling 410 has an annular flange 416 with sinusoidal florets 418 extending radially therefrom . an externally threaded insert 430 has an externally threaded leading axial portion 432 and a trailing axial portion 434 having radially inclined gear teeth which are best viewed in fig2 . threaded insert 430 further has an axial bore 436 having sinusoidal florets 438 configured to mate with the sinusoidal florets 418 of the piston coupling 410 . an elastomeric annular wipe seal 440 having a nipple 442 received in an annular groove 444 of the push rod 400 abuts the threaded insert 430 . the lever of fig2 also includes a worm 258 ′ essentially identical to that of the embodiment discuss above with respect to fig1 and which will not be re - described here . likewise , the pivot assembly 446 is similar to that described with reference to fig1 . the basic operation of the master cylinder of fig2 is identical to that of the master cylinder lever 200 of fig1 and this description will not be repeated . the embodiment of fig2 shares the features of independent reach adjustment and a dead - band adjustment that compensates for and prevents change of the reach adjustment during dead - band adjustment and is not re - described here . the reach adjustment differs slightly from the embodiment discussed above with respect to fig1 . in the embodiment of fig2 , insertion of an allen wrench into a hex socket 448 allows for reach adjustment . axial rotation of the push rod by an allen wrench will cause indexed axial rotation of the piston coupling 410 relative to the threaded insert 430 . the threaded insert 430 is prevented from axial rotation by the worm 258 ′. the axial slots 414 allow disengagement and relative movement of the florets and axial rotation of the piston coupling 410 relative to the push rod 400 is prevented by the pins 406 received in the slots 414 . in a preferred embodiment , each indexed rotation of the push rod causes a uniform movement of the lever end relative to the clamp axis ( e . g ., 1 mm ). the mating florets are illustrated in fig2 in a cross - section taken along line 25 - 25 of fig2 . the embodiment of fig2 also includes a feature to protect the piston train in the event of an accident causing movement of the lever handle 206 away from the clamp axis . in such an event , the head 404 of the push rod can axially disengage from the socket 408 of the piston coupling in a direction to the right . once a user recovers from such a mishap , the lever can be simply returned to its normal rest position which will cause the head 404 to pop back into the socket 408 .	1
as required , detailed embodiments of the present invention are disclosed ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention that may be embodied in various forms . the figures are not necessary to scale , and some features may be exaggerated to show details of particular components . therefore , specific structural and functional details disclosed are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention . where possible , like reference numerals have been used to refer to like parts in the several alternative figures . turning now to fig1 , in an embodiment used with , for example , a rolling steel door , impact bar assembly 2 comprises a bumper bar 4 translationally mounted at each end to an impact guide bracket assembly 6 . although only one end is shown , it is to be understood that the other end has the same geometry and , therefore , will not be separately described . fig2 - 5 more fully show the component parts of the impact guide bracket assembly 6 . a bumper bar engagement member , for example , guide block 8 is mounted to a first leg of a stationary bracket 10 . mounted to the second leg of the stationary bracket 10 is a resistance element , for example , a spring 12 , mounted via bolt 14 and spring shaft 16 . as shown in fig2 - 4 , a guide block 8 is retained within a hollow end of bumper bar 4 and translationally retains the bumper bar 4 to the impact guide bracket assembly 6 . a bolt 14 passes through the spring shaft 16 which in turn passes through the spring 12 and is received through bumper bar orifice 23 . a thrust plate 18 and retaining plate 20 are mounted outside and within the hollow end of the bumper bar 4 , respectively , to translationally fix the bumper bar 4 to the stationary bracket 10 . this permits an impact force directed against the bumper bar 4 to be dissipated by the spring 12 which subsequently returns the bumper bar 4 to its starting position , determined by the guide block 8 . the impact force is ultimately translated to the guide assembly 44 to relieve the impact force from the door curtain itself . the stationary bracket 10 is positioned such that the spring 12 is effectively located over the guide assembly 44 to protect the rolling steel door 26 throughout the opening and closing range of motion . the impact bar assembly 2 may be fixedly mounted to the rolling steel door 26 as shown in fig6 and 7 , or it may be repositionally mounted as shown in fig8 - 10 described in detail below . turning now to fig6 and 7 , the impact bar assembly 2 is fixedly mounted to the rolling steel door 26 , for example , at each end of the rolling steel door bottom bar 28 via bolts 30 which pass through the second leg of the stationary bracket 10 , a bottom bar adapter 32 , the bottom bar 28 , retaining plate 34 , and flat washer 36 to engage nut 38 . fig6 is drawn with the guide assembly 44 of fig7 removed for clarity . the bearing assembly 40 is mounted to the bottom bar 28 with button head cap screws 42 . the bearings counteract the moment created by the impact bar assembly 2 when the door 26 is in motion and reduce friction between the bottom bar 28 and the guide assembly 44 . an impact force is always absorbed by the spring 12 and transferred through the stationary bracket 10 and into the guide assemblies 44 . turning now to fig8 - 10 which show the repositional mounting of impact bar assembly 2 , an impact bar assembly retaining element , for example , a guide bracket 46 is mounted at each side of the rolling steel door 26 , for example , to each guide assembly 44 at a user determined height . described in detail below , the location of the guide brackets 46 permits retention of the impact bar assembly 2 at a closed door user defined location different from that of the fixedly positioned bottom bar 28 location shown in fig6 and 7 . a bottom bar retaining member , for example , a bottom bar bracket assembly 48 is mounted to the rolling steel door 26 , for example , mounted at each side of the bottom bar 28 . bottom bar bracket assembly 48 comprises a first 50 and second 52 leg with effective spacing therebetween to releasably engage the impact guide bracket assembly 6 . in use , with the rolling steel door 26 fully closed ( fig1 ), the impact bar assembly 2 is releasably mounted to the guide brackets 46 by releasably inserting the impact guide bracket assembly 6 into the guide brackets 46 . as the rolling steel door 26 is opened the bottom bar bracket assemblies 48 releasably engage the impact guide bracket assemblies 6 to lift the impact bar assembly 2 off the guide brackets 46 thereby raising the impact bar assembly 2 upward with the bottom bar 28 to allow passage through the door opening while continuing to provide rolling steel door 26 impact protection . when the rolling steel door 26 is closed , upon reaching the guide brackets 46 , the impact guide bracket assemblies 6 re - engage the guide brackets 46 and the impact bar assembly 2 is released from the bottom bar bracket assemblies 48 and is once again maintained in the guide brackets 46 as the rolling steel door 26 continues to close . optionally , an impact bar retainer , for example , an extension spring assembly 54 is employed to prevent the impact bar assembly 2 from lifting off the guide brackets 46 when not being engaged by the bottom bar bracket assemblies 48 . the extension spring assembly 54 ( fig9 ) comprises , for example , a plurality of fasteners , for example , eye bolts 56 mounted to the bottom bar 28 ( fig8 ). passing through the eye bolts 56 are steel cables 58 fixed at one end to an extension spring 60 with each cable other end engaging an impact guide bracket assembly 6 ( fig9 ). as shown in fig1 , when the rolling steel door 24 is closed and the impact bar assembly 2 is engaged within the guide brackets 46 , the steel cables 58 are deflected and in combination with the extension spring 60 maintain a retaining pressure on the impact guide bracket assemblies 6 to help retain the impact bar assembly 2 within the guide brackets 46 . as the rolling steel door 26 opens and the impact bar assembly 2 is lifted off the guide brackets 46 , the extension spring 60 in its retracted position pulls the cables 58 towards the center of the rolling steel door 26 to help retain the impact bar assembly 2 within the bottom bar bracket assemblies 48 . although the present invention has been described in connection with specific examples and embodiments , those skilled in the art will recognize that the present invention is capable of other variations and modifications within its scope . these examples and embodiments are intended as typical of , rather than in any way limiting on , the scope of the present invention as presented in the appended claims .	4
in fig1 - 8 , a suture bridge is shown as comprising a lower bridge member 21 and an upper bridge member 22 , the former including foot portions 23 interconnected by a bridge portion 24 . each foot portion 23 is provided with a slot 25 extending longitudinally of the bridge for passage therethrough of a suture . the bridge portion 24 includes a generally flat top section 26 and angular sections 27 that converge from the foot portions 23 toward the top portion 26 . the top and angular portions 26 and 27 are formed to provide a dove tail channel or recess 28 for reception of the intermediate portion of the upper bridge member 22 . the upper bridge member 22 is formed to provide cantilevered arms or end portions 29 having longitudinal slots 30 which overlie respective ones of the slots 25 and are adapted to receive and have tied therein opposite end portions of a suture , not shown . preferably , the arms 29 are resilient so as to maintain a suture under predetermined tension . the suture bridge , above described , does not in and of itself comprise the instant invention . the suture bridge is more specifically disclosed and claimed in our copending application filed aug . 6 , 1974 , ser . no . 500 , 689 and entitled &# 34 ; improved suture bridges &# 34 ;. a preferred embodiment of our protective cover is illustrated in fig1 - 3 and indicated generally at 31 , the same comprising wall structure including an outer or top wall 32 , opposite end walls 33 , and laterally spaced generally parallel side walls 34 , the cover having an open inner side or bottom . the several walls 32 - 34 are disposed to closely encompass the bridge members 21 and 22 above the foot portions 23 thereof , and to enclose the upper portions of sutures tied to the arms 29 of the upper bridge member 22 . the cover 31 may be made from any suitable material having flexibility and resilience , such as polyethylene or other suitable synthetic plastic material . as shown in fig1 - 3 , the cover 31 is formed to provide opposed snap fastener elements in the nature of detents 35 that are adapted to engage under the opposite sides thereof , the top ridge portion 26 to releasably hold the cover 31 in place on the bridge . preferably , and as shown in fig1 - 3 , the cover 31 has smooth outer surfaces and rounded corners , so as to slide smoothly over clothing , bed coverings , or other material which might come in contact therewith . the lower edges of the side walls 34 are upwardly arched , as indicated at 36 to avoid any contact with an underlying incision , should swelling occur at the incision . further , the arched portions 36 provide clearance between the incision and the lower edge of the cover for the tips of an operator &# 39 ; s fingers , for the purpose of spreading the side walls 34 to disengage the dentents 35 from the bridge and remove the cover therefrom when the incision has healed to the point where removal of the suture is desired . in the modified form illustrated in fig4 and 5 , a cover 37 is substantially identical in shape to the cover 31 , having a top wall 38 , opposite end walls 39 , one of which is shown , and opposite side walls 40 provided with opposed detents 41 . like the cover 31 , the cover 37 , when mounted on a suture bridge , is disposed to extend transversely of an underlying incision . in the form of cover illustrated in fig4 and 5 , the side walls 40 are formed to provide foot portions 42 that extend transversely outwardly from the walls 40 to overlie and protect portions of an incision at opposite sides of the bridge on which the cover 37 is mounted . preferably , the foot portions 42 are cross sectionally curved , and the corners and edges thereof are rounded so as to provide smooth outer surface portions that do not catch on clothing , bed sheets and the like . a pair of covers are illustrated in fig6 - 8 , these being identical in construction , and used in pairs , each cover being indicated generally at 43 . as shown , each cover 43 comprises top and bottom walls 44 and 45 respectively , opposite flat side walls 46 and outer end walls 47 , the inner ends of the covers 43 being open . the bottom walls 45 are provided with slot like openings 48 , each of which is adapted to overlie the slot 25 in an underlying foot portion 23 of the bridge , see particularly fig8 . like the covers 31 and 37 , the covers 43 are preferably made from flexible resilient material and have smooth outer surfaces and rounded edges and corners , the inner ends of the covers 43 having marginal edges . the side walls 46 have portions extending longitudinally beyond the marginal edges to provide snap fastener elements in the nature of latch hooks 49 that have latching engagement with the inner side surfaces of the angular portions 27 of the lower bridge member 21 . in the form of the invention illustrated in fig9 - 11 , a cover , indicated generally at 50 , comprises a pair of cooperating cover sections 51 and 52 each having an outer or top wall portion 53 , opposite end wall portions 54 and a side wall 55 . each side wall 55 has integrally formed therewith , adjacent its inner marginal edge 56 , a pair of spaced foot portions 57 that extend laterally outwardly and downwardly from the marginal edge 56 and decreasing in thickness to provide relatively thin flexible hinge portions 58 integrally formed with or anchored to foot portions 23a of a lower bridge member 21a . with the exception of the hinge portions 58 attached to the foot portions 23a , the lower bridge member 21a is identical to the bridge member 21 . as shown in fig1 , the cover sections 51 and 52 are movable on their hinge portions 58 between cover open positions shown by dotted lines in fig1 , and longitudinally abutting cover closed positions shown by full lines in fig1 . the cover sections 51 and 52 are releasably held in their cover closed positions by snap fastener buttons 59 integrally formed with the outer or top wall portions 53 of respective cover sections 51 and 52 . the snap fastener buttons 59 are preferably of the type found on the hinged closure portions of coin purses and ladies hand bags . in the modified arrangement illustrated in fig1 , a cover 60 is similar to the cover 50 differing therefrom only in the manner of hinging the same to the foot portions of the suture bridge , and in the design of the snap fastener . the cover 60 comprises cooperating cover sections 61 and 62 the side walls 63 of which are provided with downwardly projecting foot portions 64 that are mounted in socket forming heel and toe elements 65 and 66 respectively , integrally formed with foot portions 23b , one of which is shown , of a lower bridge member 21b , that is otherwise identical to the lower bridge member 21 . although only one foot portion 64 is shown as being associated with each side wall 63 and but one foot portion 23b is shown in fig1 , it will be understood that each side wall 63 is provided with a pair of foot portions 64 each associated with heel and toe elements 65 and 66 of both foot portions 23b of the suture bridge member 21b . the cover sections 61 and 62 have top wall portions 67 and 68 respectively , these being provided with cooperating snap fastener hooks 69 and 70 for releasably holding the cover sections 61 and 62 in cover closed positions shown by full lines in fig1 . the foot portions 64 are so disposed , relative to their respective side walls 63 that , when the hooks 69 and 70 are disengaged , the cover sections 61 and 62 assume a normally spread apart relationship as indicated by dotted lines in fig1 . when the cover sections 61 and 62 are moved in to cover closed relationship , as shown by full lines in fig1 , the sections are under yielding bias toward a cover open relationship . after the cover sections 61 and 62 are unlatched , they may be manually moved away from each other beyond their normally spread apart portions and the foot portions 64 pivotally moved out of engagement with their respective heel and toe portions 65 and 66 . thus , the cover sections 61 and 62 can be entirely disassociated from the suture bridge during the suturing operation , and can be thereafter quickly and easily applied to the suture bridge . while we have shown and described a preferred embodiment and several modified forms of protective cover for suture bridges , it will be understood that the same is capable of further modification without departure from the spirit and scope of the invention , as defined in the claims .	0
the abdominal bench of the present invention is shown in fig1 . generally , the abdominal bench has a lower frame , cushions , and a leg support . the instant invention differs from the standard abdominal benches in at least three main aspects , to be described herein . the variable resistance bench 1 , as best shown in fig1 includes a lower main frame 2 , as best shown in fig1 and 8 . the lower main frame 2 supports the front torso section 3 . as best shown in fig1 and 5 , the front torso section 3 of the instant invention includes a torso support 7 ( as shown in fig4 through 7 ) which supports a torso cushion 4 ′. as shown on fig1 this front torso section 3 is adjacent to a seat section 5 , which is also supported by the lower main frame . attached at the seat section 5 is a seat cushion 5 ′. the seat cushion 5 ′ is attached to the lower main frame 2 by bolts or other familiar attaching means . the variable resistance bench 1 also has an adjustable leg support system 6 . the front torso section 3 pivots upwardly , as shown in fig9 a , 9 b , and 9 c . the torso support 7 has at one end a torso support pivot cylinder 9 , and at the other end a cushion supporting member 4 , as best shown in fig4 and 5 . the torso support 7 is pivotably attached to the upper portion of the main frame 2 about torso support pivot holes 9 ′. the cushion supporting member 4 has torso cushion plates 8 . the torso cushion 4 ′ is attached to the torso cushion plate 8 by screws or other familiar fastening means . with the torso support 7 and cushion 8 pivotably attached to the lower main frame 2 , the torso section 3 may pivot in the fashion as shown consecutively in drawing fig9 a , 9 b , and 9 c . also attached to the lower main frame 2 are leg supports 10 as best shown in fig8 . the foot main lever tube 19 , as best shown in fig1 , is attached to the leg supports 10 as best shown in fig3 and 8 . also attached to the front torso section 3 of the bench are left 11 and right 11 ′ adjustable handles . one unique aspect of this invention is the adjustability of the handles , 11 and 11 ′. as best shown in fig1 , the handles are adjustable to three different angles relative to the torso support . the angle settings are determined by two slotted plates 12 located on each side of the cushion supporting member 4 of the torso support bar 7 . the angle setting is locked in place by a handle pin 13 that slides into a guided slot 14 in the cushion supporting member . a pin holder 13 a as shown in fig1 , slides over the handle - adjusting pin 13 so that the pin holder 13 a is in the longitudinal middle of the pin 13 . a rod 15 then secures the pin holder 13 a in place when it is screwed into the pin holder 13 a . the locking pin 13 is biased towards the leg support section 6 of the device . the locking pin 13 slides in the slots 14 . the locking pin , being biased forward by the spring 16 , thus holds the slotted plates 12 in position . the spring 16 is compressed by the screw plug 17 , which is in turn fastened to the rod 15 by the handle adjustment knob 18 . the handles 11 are maintained at a set angle by pulling the knob 18 , which in turn releases the locking pin 13 from the slotted plates 12 . the handles 11 and 11 ′ may thus be adjusted to the athlete &# 39 ; s size and preferences while using the variable resistance abdominal bench . turning next to fig1 and 12a , the adjustable leg and foot lever mechanism is shown . the leg lever mechanism allows for three different angle setting relative to the seat section . the leg lever mechanism includes a block 24 with two extending tabs 25 and 25 ′. these tabs are permanently attached to the main foot lever tube 19 . the extending tabs both have tapped holes forming the axis of the adjustable leg and foot lever 6 . the adjustable support block 22 has deep holes with a flat bottom that constrain a biasing spring 21 . this biasing spring keeps pressure on the locking pin 20 such that the locking pin remains locked in the leg adjustment holes 26 . these leg adjustment holes are shown on fig1 a . the adjustable support block 22 is held in place by two screws 23 having a precise diameter such that the support block 22 slides with a very small tolerance in the block pivot holes 27 . the support block 22 slides tightly in the adjustable leg lever 20 and is locked in place by the two screws 23 . by pulling upwards on the leg lever knob 28 , the adjustable leg lever 6 can be adjusted to various angles as desired . one unique feature of this invention is the adjustability of the leg and foot support 6 . a final and most important feature of this invention is the provision for a variable load resistance . this variable load resistance provides the athlete with three different settings for adjusting the amount of exertion required to do a sit - up or body crunchy on the abdominal bench . this unique variable load resistance system is best shown in fig1 and 13a . a weight 29 is adjustably and slidably attached to the pivotable torso support 7 . a weight slide shaft 34 is attached to the torso support 7 . the weight 29 has a shaft 38 non - symmetrically located along its longitudinal length as best shown in 13 a . the bottom portion 34 ′ of the weight slide shaft 34 is rounded as shown in fig1 and 13a . the weight 29 is adjustably and slidably attached to the weight slide shaft 34 when the rounded portion of the weight slide shaft 34 is inserted into the longitudinal shaft 38 of the weight 29 . this longitudinal shaft 38 is located in the upper portion of the cross section of the weight 29 , as shown in fig1 a . the weight 29 is locked in place at a desired setting along the length of the weight slide shaft 34 by a locking pin 30 . this locking pin 30 is biased towards the weight slide shaft 34 by a weight biasing spring 31 . the locking pin 30 and the biasing spring 31 are guided by a socket 32 . the lower cylindrical portion 34 ′ of the weight slide shaft 34 also has weight slide locking holes 33 . these locking holes 33 and are spaced at regular intervals along the longitudinal length of the weight slide shaft 34 . once the weight 29 is located at a desired position along the longitudinal length of the weight slide shaft 34 , the weight locking pin 30 is pushed through a small hole 39 located in the weight . the locking pin 30 has a weight adjustment knob 35 . by pulling the weight adjustment knob 35 , and hence the locking pin 30 , away from the weight slide shaft 34 , the weight 29 is free to move along the longitudinal length of the shaft . however , when the knob 35 is released , the biasing spring 31 pushes the pin 30 through the weight hole 39 and locks the weight 29 in place when the inner tip of the locking pin 30 is inserted through one of the weight slide locking holes 33 , as best shown in fig1 a . in this simple manner , the variable load resistance system can be adjusted to either increase or decrease the weight load required to do a sit - up by easily moving the weight 29 forward or backward to different resistance settings . this different resistance settings are best shown in fig1 a , 10 b and 10 c . the weight 29 may be adjusted such that the weight is positioned on either side of the torso pivot point 9 ′. locating the weight in the handle side of pivot point 9 ′ provides positive resistance ; locating the weight on the foot side of pivot point 9 ′ provides negative resistance . this variable resistance abdominal bench enables a user to shift easily to a ten percent ( 10 %) negative resistance ( fig1 c ) which has the effect of “ reducing ” the user &# 39 ; s body weight so that upward movement becomes easier to perform . as one slides the weight block towards the handles of the device , the resistance can be increased up to a maximum load of 45 pounds . as shown in fig1 a , this maximum load would increase the resistance required to do a sit - up . as shown in fig1 b , the weight can also be adjusted such that it will have no impact on the resistance ( either negative or positive ) of the device . also attached to the torso support 7 , as best shown in fig7 is a weight plate holder 36 . the plate holder is installed for the super athlete who might need a great deal of additional weight in addition to the maximum setting of the weight 29 as shown in fig1 a . although this weight plate would only be necessary in less than one percent of the athletes using this variable resistance abdominal bench , it has also been included as an added feature of this device . foot and ankle pads 37 are also attached to the adjustable leg support 6 , as shown in the drawing figures . these foot and ankle pads are standard for most abdominal or other exercise benches . the means for adjusting the handles disclosed herein are preferred , as is the means for adjusting the angle of the foot and leg support . further , the means for sliding the weight along the torso section is also preferred . however , other means for adjusting the handles and foot and leg support , as well as for locating the weight along the longitudinal axis of the torso support may be utilized while still keeping within the spirit and disclosure of the invention .	0
a suspension apparatus according to an embodiment of the present invention will be described with reference to the accompanying drawings . referring to fig1 reference symbol s fr denotes a right front wheel suspension unit ; s fl , a left front suspension unit ; s rr , a right rear wheel suspension unit ; and s rl , a left rear suspension unit . the suspension units s fr , s fl , s rr and s rl respectively comprise main air spring chambers 11a to 11d , sub air - spring chambers 12a to 12d , shock absorbers 13a to 13d , and coil springs ( not shown ) serving as auxiliary springs . reference numeral 14 denotes a compressor . the compressor 14 compresses air supplied from an air cleaner ( not shown ) and supplies compressed air to a reserve tank 17 through a check valve 15 and a drier 16 . compressed air stored in the reserve tank 17 is supplied to the main air spring chamber 11a through piping a and an inlet solenoid valve 18a , to the main air spring chamber 11b through the piping a and an inlet solenoid valve 18b , to the main air spring chamber 11c through the piping a and the inlet solenoid valve 18c , and to the main air spring chamber 11d through the piping a and an inlet solenoid valve 18d . the inlet solenoid valves 18a to 18d have the same construction and will be described later in detail with reference to fig2 . the compressed air in the main air spring chambers 11a to 11d is exhausted through exhaust solenoid valves 19a to 19d , an exhaust flow rate control solenoid valve 20 and an exhaust pipe 21 . the detailed construction of the exhaust flow rate control solenoid valve 20 will be described in detail later with reference to fig3 . the main air spring chambers 11a and 11b are coupled to each other through a communicating solenoid valve 22a , a communicating pipe b and a communicating solenoid valve 22b . the communicating solenoid valve 22a controls communication between the main spring chamber 11a and the sub air - spring chamber 12a . similarly , the communicating solenoid valve 22b controls communication between the main air spring chamber 11b and the sub air - spring chamber 12b . the main air spring chambers 11c and 11d are coupled to each other through a communicating solenoid valve 22c , a communicating pipe c and a communicating solenoid valve 22d . the communicating solenoid valve 22c controls communication between the main air spring chamber 11c and the sub air spring chamber 12c . similarly , the communicating solenoid valve 22d controls communication between the main air spring chamber 11d and the sub air spring chamber 12d . it should be noted that the inlet solenoid valves 18a to 18d and the exhaust solenoid valves 19a to 19d comprise normally closed valves , and that the communicating solenoid valves 22a to 22d comprise normally open valves . the solenoid valves 18a to 18d , 19a to 19d , 20 and 22a to 22d are controlled in response to control signals from a controller 23 . the controller 23 receives signals from a steering sensor 24 for detecting a steering wheel angle , a velocity sensor 25 for detecting vehicle velocity , and a height sensor 26 for detecting the height at front and rear ends of a vehicle . the solenoid valves 18a to 18d will be described with reference to fig2 . referring to fig2 reference numeral 31 denotes a valve body . a valve path 32 and a valve path 33 having a smaller diameter than that of the valve path 32 are formed in the valve body 31 . one end of the valve path 32 is coupled to the main air spring chambers 11a to 11d . the other end of the valve path 32 is coupled to the reserve tank 17 . the valve path 32 serves to supply a large amount of compressed air per unit time for position control . the valve path 32 is closed / opened under the control of a valve seat 35 mounted on a plunger 34 . the valve seat 35 is normally seated on a valve hole 37 by a biasing force of a return spring 36 to close the valve hole 37 . however , when a solenoid coil 38 is energized , the plunger 34 is moved to the left to separate the valve seat 35 from the valve hole 37 . in this manner , the valve hole 37 is opened . the valve path 33 serves to supply a small amount of compressed air per unit time for height control . the valve path 33 is opened / closed by a valve seat 40 mounted on a plunger 39 . the valve seat 40 is normally seated on a valve hole 42 by a biasing force of a return spring 41 to close the valve hole 42 . however , when a solenoid coil 43 is energized , the plunger 39 is moved to the right to separate the valve seat 40 from the valve hole 42 . in this manner , the valve hole 42 is opened . in the position control mode , the solenoid coil 38 is energized to open the valve hole 37 to supply a large amount of compressed air per unit time from the reserve tank 17 to the main air spring chambers 11a to 11d through the valve path 32 . however , in the height control mode , the solenoid coil 43 is energized to open the valve hole 42 to supply a small amount of compressed air per unit time from the reserve tank 17 to the main air spring chambers 11a to 11d through the valve path 33 . the construction of the exhaust flow rate control solenoid valve 20 will be described with reference to fig3 . referring to fig3 reference numeral 51 denotes a valve body . a valve path 52 is formed in the valve body 51 . one end of the valve path 52 is coupled to the main air spring chambers 11a to 11d . the other end of the valve path 52 is coupled to the exhaust pipe 21 . a partition wall 53 is formed integrally with the valve body 51 in the valve path 52 . a small hole 54 is formed in the partition wall 53 . the valve path 52 is opened / closed by a valve seat 56 mounted on a plunger 55 . the valve seat 56 is normally biased by a spring 57 to separate from a valve hole 58 having a larger diameter than that of the small hole 54 . in this manner , the valve hole 58 is normally opened . however , when a solenoid coil 59 is energized , the plunger 55 is moved downward to cause the valve seat 56 to sit on the valve hole 58 . therefore , the valve hole 58 is closed . in the position control mode , the solenoid coil 38 is deenergized to open the valve hole 58 , so that a large amount of compressed air per unit time from the main air - spring chambers 11a to 11d is exhausted to the exhaust pipe 21 through the valve hole 58 and the small hole 54 . however , in the height control mode , the solenoid coil 59 is energized to close the valve hole 58 , so that a small amount of compressed air per unit time from the main air - spring chambers 11a to 11d is exhausted to the exhaust pipe 21 through the small hole 54 . the operation of the suspension apparatus having the construction described above will be described with reference to fig4 a and 4b . when a driver turns an ignition key , the controller 23 performs the operation , as shown in the flow charts of fig4 a and 4b . in step s1 , a steering angle θ , a steering angular velocity θ , and a velocity v are cleared from a predetermined memory area in the controller 23 . in step s2 , a map memory t m is reset ( t m = 0 ). in step s3 , the controller 23 checks that the valve path 32 having a larger diameter than that of the valve path 33 for the solenoid valves 18a to 18d is opened , and that the larger valve hole 58 of the solenoid valve 20 is opened . in this case , if the valve path 32 and the valve hole 58 are not open , they are opened under the control of the controller 23 . the controller 23 checks in step s4 that the communicating solenoid valves 22a to 22d are opened . in this case , if the valves 22a to 22 d are not open , they are opened under the control of the controller 23 . in step s5 , the steering angle θ detected by the steering sensor 24 is supplied to the controller 23 . at the same time , a change in the steering angle as a function of time , i . e ., the steering angular velocity θ , is calculated by the controller 23 . furthermore , the velocity data detected by the velocity sensor 25 is supplied to the controller 23 . the controller 23 checks in step s6 whether or not the steering angle corresponds to a neutral position of the steering wheel , i . e ., θ ≦ θ0 . here , the neutral position indicates that the steering wheel is not turned clockwise or counterclockwise at an angle exceeding a predetermined angle . if yes in step s6 , the flow advances to step s7 . in step 7 , the controller 23 checks that the solenoid valves 18a to 18d and 19a to 19d are closed . if not , they are closed under the control of the controller 23 . however , if no is determined in step s6 , the roll control operation after step s8 is performed . in step s8 , the controller 23 closes the communicating solenoid valves 22a to 22d . the controller 23 checks in step 9 whether or not the current steering angular velocity θ exceeds the predetermined value θ0 . if no is determined in step s9 , the flow advances to step s10 . in step s10 , the controller 23 checks that the valve path 32 for the solenoid valves 18a to 18d , and the larger valve hole 58 for the solenoid valve 20 are closed . if not , they are closed under the control of the controller 23 . in step s11 , the controller 23 calculates a control time t p ( i . e ., a time for opening the solenoid valve ), in accordance with the graph shown in fig5 by using the steering angle and the velocity . the control time t p is determined by regions i to vii of the graph of fig5 and is represented in parentheses . however , if yes is determined in step 9 , the flow advances to step s12 . the controller 23 checks that the valve path 32 and the valve hole 58 are opened . if not , they are opened under the control of the controller 23 . in step s13 , the controller 23 calculates a control time t p ( i . e ., a time for opening the solenoid valve ), in accordance with the graph shown in fig6 by using the steering angular velocity θ and the velocity v . the control time t p is determined by regions i to vii of the graph of fig6 and is represented in parentheses . when the operation in steps s10 and s11 or steps s12 and s13 is completed , the controller 23 calculates a control time t (= t p - t m ) in step s14 . the controller 23 then checks in step s15 whether or not condition t & gt ; 0 is established . if no in step s15 , the flow returns to step 5 . in this case , vehicle position control is not performed . however , if yes in step s15 , the flow advances to step s16 . the on / off operation of the solenoid valves 18a to 18b and 19a to 19d is controlled in accordance with the control time t in step s16 , thereby performing vehicle position control . for example , when the driver turns the steering wheel clockwise , the left wheel solenoid valves 18b and 18d are opened for the control time t to supply compressed air to the main air spring chambers 11b and 11d under the control of the controller 23 . therefore , the shock absorbers at the left wheels are biased to increase the vehicle height . furthermore , the right wheel solenoid valves 19a and 19c are opened for the control time t to exhaust the compressed air from the main air spring chambers 11a and 11c under the control of the controller 23 . as a result , the shock absorbers at the right wheels are biased to decrease the vehicle height . in other words , when the driver turns the steering wheel clockwise , the decrease in the left vehicle height and the increase in the right vehicle height are reduced to prevent the vehicle from rolling . in this case , the controller 23 controls the flow rate of the compressed air through the solenoid valves 18b and 18d and solenoid valve 20 per unit time depending on judgement of step s9 to slowly perform position control by using a small amount of compressed air per unit time when the vehicle is normally turned . however , when the vehicle is quickly turned , the flow rate of the compressed air through the solenoid valves 18b and 18d and solenoid valve 20 per unit time is increased , thereby performing quick position control . when the operation in step s16 is completed , the flow advances to step s17 wherein the map memory is updated . in other words , let t m be t p . in this case , the flow returns to step s5 again . when turning is continuously performed in the same regions in the graphs of fig5 and 6 , or in the regions providing short control times , the control time t p calculated in step s11 or s13 is equal to or shorter than the stored control time in the map memory . in step s15 , condition t ≦ 0 is established , so that the flow returns from step s15 to step s5 . when straight travel is started afer turning is completed , step s6 is determined to be yes . the controller checks in step s7 that the solenoid valves 18a to 18d and 19a to 19d are closed . the solenoid valves 22a to 22d are opened in step s4 through steps s2 and s3 . therefore , the right and left spring chambers are kept at the same pressure . when the region in the graph changes to a region for a long control time , since the control time t p calculated in step s11 or s13 is longer than that stored in the map memory , the necessary control time t (= t p - t m ) is calculated in step s14 . in step s16 , the control is performed in accordance with the calculated control time t . according to this embodiment of the present invention , normal turning or quick turning is detected in accordance with a determination whether the steering angular velocity exceeds the reference value . when normal turning , which results in slow roll displacement , is performed , the amount of compressed air per unit time is decreased , and the corresponding control time t is obtained with reference to the graphs in fig5 and 6 , thereby performing relatively moderate control . however , when rapid turning , which results in abrupt roll displacement , is performed , the amount of compressed air per unit time is increased , and the corresponding control time t is obtained with reference to the graphs . optimal vehicle position control can be performed irrespective of normal or rapid turning . therefore , rolling of the vehicle can be prevented to improve driving stability . a vehicle suspension apparatus according to another embodiment will be described hereinafter . referring to fig7 reference symbol s fr denotes a right front wheel suspension unit ; s fl , a left front wheel suspension unit ; s rr , a right rear wheel suspension unit ; and s rl , a left rear wheel suspension unit . the suspension units s fr , s fl , s rr and s rl respectively comprise main air - spring chambers 61a to 61d , sub air spring chambers 62a to 62d , shock absorbers 63a to 63d , and coil springs ( not shown ) serving as auxiliary springs . reference numeral 64 denotes a compressor . the compressor 64 compresses air supplied from an air cleaner ( not shown ) and supplies compressed air to a reserve tank 68 through a joint 65 , a check valve 66 and a drier 67 . in addition , the compressor 64 compresses air supplied from an air cleaner ( not shown ) and supplies compressed air to a height control reserve tank 70 through the joint 65 and a drier 69 . the compressed air stored in the reserve tank 70 is supplied to the main air spring chambers 61a and 61b through a joint 74 , a front vehicle height control solenoid valve 75f and height control piping d . the compressed air from the reserve tank 70 is supplied to the main air spring chambers 61c and 61d through the joint 74 , the height control piping d and a rear height control solenoid valve 75r . the compressed air stored in the reserve tank 68 is supplied to the main air spring chamber 61a through a position control pipe e and an inlet solenoid valve 76a , to the main air spring chamber 61b through the position control pipe e and an inlet solenoid valve 76b , to the main air spring chamber 61c through the position control pipe e and an inlet solenoid valve 76c , and to the main air spring chamber 61d through the position control pipe e and an inlet solenoid valve 76d . the compressed air in the main air spring chamber 61a is exhausted to the atmosphere through an exhaust solenoid valve 77a , a joint 78 and an exhaust pipe 79 . similarly , the compressed air in the main air spring chamber 61b is exhausted to the atmosphere through an exhaust solenoid valve 77b , the joint 78 and the exhaust pipe 79 . the compressed air in the main air spring chamber 61c is exhausted to the atmosphere through an exhaust solenoid valve 77c , a joint 80 and an exhaust pipe 81 . similarly , the compressed air in the main air spring chamber 61d is exhausted to the atmosphere through an exhaust solenoid valve 77d , the joint 80 and the exhaust pipe 81 . the main air spring chambers 61a and 61b are coupled to each other through a communicating solenoid valve 82a , a communicating pipe f and a communicating solenoid valve 82b . the communicating solenoid valve 82a controls communication between the main air spring chamber 61a and the sub air spring chamber 62a . similarly , the communicating solenoid valve 82b controls communication between the main air spring chamber 61b and the sub air spring chamber 62b . the main air spring chambers 61c and 61d are coupled through a communicating solenoid valve 82c , a communicating pipe g and a communicating solenoid valve 82d . the communicating solenoid valve 82c controls communication between the main air spring chamber 61c and the sub air spring chamber 62c . similarly , the communicating solenoid valve 82d controls communication between the main spring chamber 61d and the sub air spring chamber 62d . it should be noted that the solenoid valves 76a to 76d and 77a to 77d comprise normally closed valves , and that the solenoid valves 82a to 82d comprise normally opened valves . the operation of the suspension apparatus having the construction described above will be described hereinafter . the operation is restricted to the prevention of rolling occurring when the vehicle turns right , and the left front and rear heights of the vehicle are lowered . the solenoid valve 82b is closed to disconnect the main air spring chamber 61b and the sub air spring chamber 62b , thereby increasing an air spring constant of the left front suspension unit s fl . in this state , the main air spring chamber 61a is disconnected from the main air spring chamber 61b . furthermore , the solenoid valve 82d is closed to disconnect the main air spring chamber 61d and the sub air spring chamber 62d , thereby increasing an air spring constant of the left rear suspension unit s rl . the main air spring chamber 61c is disconnected from the main air spring chamber 61d . the solenoid valves 76b and 76d are opened for a predetermined period of time to supply compressed air from the reserve tank 68 to the main air spring chambers 61b and 61d to increase the left front and rear heights . the solenoid valve 82a is closed to disconnect the main air spring chamber 61a and the sub air spring chamber 62a , thereby increasing the air spring constant of the right front suspension unit s fr . the main air spring chamber 61a is disconnected from the main air spring chamber 61b . in addition , the solenoid valve 82c is closed to disconnect the main air spring chamber 61c and the sub air spring chamber 62c , thereby increasing an air spring constant of the right rear suspension unit s rr . the main air spring chamber 61c is disconnected from the main air spring chamber 61d . subsequently , the solenoid valves 77a and 77c are opened for a predetermined period of time to exhaust the compressed air from the main air spring chambers 61a and 61c , thereby lowering the right front and rear heights . therefore , rolling occurring in the right turn of the vehicle can be prevented . when the vehicle turns right , the solenoid valves 82a to 82d are opened to decrease the air spring constants of the suspension units s fr , s fl , s rr and s rl . at the same time , the front air spring chambers 61a and 61b communicate with each other , and the rear air spring chambers 61c and 61d communicate with each other . in normal height control , the solenoid valves 75f and 75r are opened / closed to supply the compressed air from the reserve tank 70 to the main air spring chambers 61a to 61d or to exhaust the compressed air from the main air spring chambers 61a to 61d through the solenoid valves 77a to 77d and the exhaust pipe 79 or 81 . in the height control mode , the compressed air in the reserve tank 70 is supplied to the main air spring chambers 61a to 61d through the piping d having a smaller diameter than that of the pipe e . therefore , the amount of compressed air per unit time in the height control mode is smaller than that in the position control mode , and overshooting of the height in the height control mode can be prevented and passenger discomfort can be reduced . when the main air spring chamber 61c is disconnected from the chamber 61d , the air spring constants of the suspension units s fr , s fl , s rr and s rl can be increased . valves need not be arranged in the communication paths f and g , so the number of valves can be decreased , thus decreasing the installation space and providing an economical advantage . in the above two embodiments , the fluid is air . however , the fluid is not limited to air , but can be any safe and controllable medium . furthermore , the present invention is not limited to a suspension apparatus using an air spring , but can be extended to a hydropneumatic type suspension apparatus using a liquid and a gas . according to the second embodiment of the present invention , the reserve tank for storing compressed air and the air spring chambers of the respective suspension units are coupled through a vehicle position control pipe and a height control pipe having a smaller diameter than that of the vehicle position control pipe . in the vehicle position control mode , the compressed air is supplied to the air spring chambers through the position control pipe . in the height control mode , the compressed air is supplied to the air spring chambers through the height control pipe . therefore , height overshooting can be reduced . in addition , the number of valves is decreased to provide a compact and low - cost vehicle suspension apparatus .	1
the halogen - containing polymers to be cross - linked in accordance with this invention may be saturated or unsaturated and contain at least about 1 . 0 % and preferably at least about 5 . 8 % halogen by weight . typical halogen - containing polymers used in accordance with this invention are epichlorohydrin homopolymers , epichlorohydrin - ethylene oxide copolymers , epichlorohydrin - propylene oxide copolymers , epichlorohydrin - allylglycidyl ether copolymers , epichlorohydrin - ethylene oxide - allylglycidyl ether terpolymers , epichlorohydrin - propylene oxide - allylglycidyl ether terpolymers , epiflourohydrin homopolymers , epiflourohydrin - ethylene oxide copolymers , epiflourohydrin - propylene oxide copolymers , epiflourohydrin - ethylene oxide - allylglycidyl ether terpolymers , epiflourohydrin - propylene oxide - allylglycidyl ether terpolymers , poly ( vinyl chloride ), poly ( vinyl chloride )- ethylene oxide copolymer , chlorinated polyethylene , polychloroprene , chloronated butyl rubber and bromonated butyl rubber . typical aliphatic substituted thioureas used in accordance with this invention are trimethythioruea , ethylene thiourea , 1 , 3 - diethylthiourea , 1 , 3 - dibutyl - thiourea , and dimethylethylthiourea . ethylene thiourea is preferable . the inorganic bases used in accordance with this invention are group ia or iia oxides , hydroxides , or carbonates such as magnesium oxide , potassium hydroxide , calcium carbonate , or magnesium carbonate . the preferred inorganic base is magnesium oxide . thiuram sulfides used in accordance with this invention are of the formula ( r 2 nchs ) 2 s x wherein x is an integer greater than or equal to 1 , and r is an alkyl or aryl group such as methyl , ethyl , butyl or phenyl . typical of the thiuram sulfides are tetramethylthiuram disulfide , tetraethylthiuram disulfide , tetramethylthiuram monosulfide , tetrabutylthiuram monosulfide , dipentamethylenethiuram hexasulfide , and n , n &# 39 ;- dimethyl - n , n &# 39 ;- diphenylthiuram monosulfide . this invention can also be used to cross - link blends of halogen - containing polymers and blends of halogen - containing polymers and non - halogen - containing polymers . the only requirement is that a sufficient amount of halogen - containing polymer be present to effect cross - linking , i . e ., halogen must be present in an amount at least 1 % by weight based upon the total weight of the polymer blend . quantities of the cure system components , i . e ., accelerator , acid acceptor , and cross - linking agent , to be used in accordance with this invention can vary . based on the weight of the halogen - containing polymer , the quantity of the cross - linking agent varies between about 0 . 1 % and about 10 . 0 % and preferably between about 0 . 5 % and about 5 . 0 %, the quantity of the inorganic base varies between about 0 . 25 % and about 10 . 0 %, preferably between about 0 . 5 % and about 5 . 0 %, and more preferably between about 1 . 0 % and about 2 . 0 %, and the quantity of the accelerator varies between about 0 . 1 % and about 20 . 0 %, preferably between about 0 . 5 % and about 10 . 0 %, and more preferably between about 1 . 0 % and about 5 . 0 %. the extent of cross - linkage depends upon the cross - linking agent selected and the quantity of cross - linking agent used . the inorganic base may also be used as a filler . based on the weight of the halogen - containing polymer , the quantity of the inorganic base that is used as an acid acceptor and a filler varies between about 0 . 25 % and about 100 %, preferably between about 0 . 5 % and about 50 %, and more preferably between about 1 . 0 % and about 20 . 0 %. any state - of - the - art method can be used to blend the halogen - containing polymer with the cure system components . conventional rubber milling and mixing in a banbury mixer are methods that distribute the cure system components uniformly throughout the polymer and effect uniform cross - linking when the blend is heated . preferably , milling should be performed between 50 ° c . and 90 ° c ., but unless a large amount of accelerator is used , the blends remain scorch - resistant below about 125 ° c . other methods of combining the polymer with the cure system components are known to those skilled in the art . cross - linking of the halogen - containing polymer occurs between about 140 ° c . and about 260 ° c ., preferably between about 150 ° c . and about 225 ° c ., and more preferably between about 150 ° c . and about 205 ° c . the time needed to effect the cross - linking varies inversly with the temperature and ranges from about 5 seconds to about 10 hours . the cross - linking can occur in air in an open container , in a heat transfer medium at normal atmospheric pressure , or , preferably , in a metal mold under at least about 500 p . s . i pressure or in a steam autoclave at the desired pressure and temperature . other ingredients , e . g ., extenders , fillers , pigments , antioxidants , plasticizers , and softeners that are used in rubber vulcanization , can be added to this cure system . good results can be obtained , as in rubber compounding , by adding reinforceing agents , especially carbon black , which increase tensile strength , stiffness , and resistance to abrasion . processing agents such as sorbitan monostearate extend scorch safety , i . e ., the time available to work the polymer before cross - linking begins . the following examples illustrate the superior scorch safety and the good physical properties of cured vulcanizates obtained by using this invention as compared with other methods of curing . examples 2 , 7 , 8 and 9 - 15 represent the method of this invention , and examples 1 , 3 , 4 , 5 and 6 are for comparison . in the following examples , the ingredients are combined in the order listed in a banbury mixer . to determine cure rate , the combined ingredients are heated at 160 ° c . for 60 minutes in an oscillating disk rheometer ( odr ) ( american society for testing and materials , astm , d 2084 - 71 t ). the combined ingredients are prepared for tension testing and shore a hardness by curing at 160 ° c . in a typical astm mold and tested in accordance with astm , d 142 - 68 and astm , d 2240 - 68 respectively at time of curing and after ageing for 7 days at 125 ° c . mooney scorch is determined by using the shearing disk viscometer ( astm , d 1646 - 68 ). ______________________________________ examples 1 - 4 partsingredients ex . 1 ex . 2 ex . 3 ex . 4______________________________________epichlorohydrin - 100 . 0 100 . 0 100 . 0 100 . 0propylene oxidecopolymer ( 11 . 5 % chlorine by weight ) haf . sup . 1 carbon black 50 . 0 50 . 0 50 . 0 50 . 0 ( reinforcing agent ) sorbitan monostearate 5 . 0 5 . 0 5 . 0 5 . 0 ( processing aid ) nickel dibutyl 1 . 0 1 . 0 1 . 0 1 . 0dithiocarbamate ( antioxidant ) magnesium oxide 5 . 0 5 . 0 -- --( acid acceptor ) red lead ( pb . sub . 3 o . sub . 4 ) -- -- 5 . 0 5 . 0 ( accelerator ) dipentamethylenethiuram -- 1 . 0 -- 1 . 0hexasulfide ( accelerator ) ethylene thiourea 2 . 25 2 . 25 2 . 0 2 . 0 ( cross - linking agent ) ______________________________________ . sup . 1 high abrasion furnace black the crosslinked products from the above formulations have the following physical properties : ______________________________________ examples 1 - 4 ex . 1 ex . 2 ex . 3 ex . 4______________________________________mooney scorch (@ 121 . 11 ° c . )( astm d 1646 - 68 ) minimum viscosity 38 . 73 36 . 5 38 . 5 38 . 2 ( mooney units ) time in minutes for 3 7 . 5 12 . 5 5 . 0 7 . 0unit rise in viscositytime in minutes for 5 8 . 0 18 . 5 6 . 5 8 . 5unit rise in viscositytime in minutes for 10 9 . 6 24 . 0 8 . 0 10 . 0unit rise in viscositytension testing ( astm d 142 - 68 ) 100 % modulus ( tensile 210 330 290 260 ( strength @ 100 % elongation ) ( p . s . i . ) tensile strength 1480 1690 1790 1520 ( p . s . i . )% elongation 960 510 740 790shore a hardness 60 70 69 66 ( astm d 2240 - 68 ) tension testing ( aged 7 days @ 125 ° c . )( astm d 142 - 68 ) 100 % modulus ( tensile 340 620 550 510strength @ 100 % elongation ) ( p . s . i . ) tensile strength 860 1290 1260 1180 ( p . s . i . )% elongation 250 230 270 280shore a hardness 71 82 81 78 ( aged 7 days @ 125 °( astm d 2240 - 68 ) odr ( astm d 2084 - 71 t ) minimum torque 18 14 49 16 12 . 5 ( inch - pounds ) highest torque / type 35 / m . sub . h 78 / m . sub . h 64 / m . sub . h 52 / m . sub . h ( inch - pounds ) scorch time ( t . sub . s2 ) 3 . 5 3 . 0 2 . 5 3 . 0 ( minutes to torqueincrease of 2 inch - pounds ) cure time ( t . sub . c 90 ) 25 40 35 40 ( minutes to 90 % of fulltorque development ) ______________________________________ in the foregoing examples , the results of mooney scorch testing show that this invention ( example 2 ) has superior scorch safety over : the red lead and ethelene thiourea cure system ( example 3 ): a cure system similar to this invention , but without the thiuram accelerator ( example 1 ): and a cure system similar to this invention , but without the group ia or iia acid acceptor but with red lead ( example 4 ). also , the good physical properties obtained using the red lead / ethylene thiourea cure system are obtained using this invention . examples 5 - 9 , illustrate further the superior scorch safety realized by using this invention over other methods of curing , and the good physical properties of cured vulcanizates obtained thereby . __________________________________________________________________________ examples 5 - 9 partsingredients ex . 5 ex . 6 ex . 7 ex . 8 ex . 9__________________________________________________________________________epichlorohydrin - 100 100 100 100 100ethylene oxide copolymer ( 24 . 8 % chlorine by weight ) haf . sup . 1 carbon black 50 50 50 50 50 ( reinforcing agent ) stearic acid 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 ( processing aid ) nickel dibutyl 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0dithiocarbamate ( antioxidant ) magnesium oxide -- 5 . 0 5 . 0 5 . 0 5 . 0 ( acid acceptor ) red lead ( pb . sub . 3 o . sub . 4 5 -- -- -- --( accelerator ) dipentamethylenethiuram -- -- 1 . 0 1 . 0 -- hexasulfide ( accelerator ) tetramethylenethiuram -- -- -- -- 1 . 5disulfide ( accelerator ) ethylene thiourea 2 . 0 2 . 0 2 . 0 1 . 5 2 . 0 ( cross - linking agent ) the cross - linked products from the above formulationshave the following physical properties : mooney scorch (@ 121 . 11 ° c . )( astm d 1646 ) minimum viscosity 31 . 9 30 . 6 28 27 . 8 27 . 2 ( mooney units ) time in minutes for 3 point 4 . 0 5 . 2 12 . 0 12 . 6 12 . 5rise in viscositytime in minutes for 5 point 4 . 3 6 . 4 13 . 7 14 . 6 14 . 8rise in viscositytime in minutes for 10 point 5 . 8 8 . 0 15 . 5 17 . 25 17 . 6rise in viscositytension testing ( astm d 142 - 68 ) 100 % modulus 640 470 780 650 600 ( tensile strength @ 100 % elongation ) ( p . s . i . ) tensile strength ( p . s . i .) 2270 1450 1920 2130 1960 % elongation 400 390 240 360 360shore a hardness 77 70 77 75 74 ( astm d 2240 - 68 ) tension testing ( aged 7 days @ 125 ° c . )( astm d 142 ) 100 % modulus 1450 720 1180 1170 1120 ( tensile strength @ 100 % elongation ) tensile strength ( p . s . i .) 2760 1500 1460 1880 1650 % elongation 180 200 140 150 130shore a hardness 88 84 89 88 87 ( aged 7 days @ 125 ° c . )( astm d 2240 - 68 ) odr ( astm d 2048 - 71 t ) minimum torque 14 14 12 10 . 8 10 . 5 ( inch - pounds ) highest torque / type 105 / m . sub . h 67 / m . sub . h 130 / m . sub . h 102 / m . sub . h 94 / m . sub . h ( inch - pounds ) scorch time ( t . sub . 52 ) ( minutes 1 . 3 2 . 0 2 . 5 2 . 5 2 . 9to torque increase of 2 inchpounds ) cure time ( t . sub . c 90 ) ( minutes 28 30 30 29 25to 90 % of full torquedevelopment ) __________________________________________________________________________ . sup . 1 high abrasion furnace black examples 10 - 15 illustrate various formulas usable in accordance with this invention and the scorch safety and good physical properties of cured vulcanizated obtained thereby . __________________________________________________________________________ ex . 10 ex . 11 ex . 12 ex . 13 ex . 14 ex . 15__________________________________________________________________________epichlorohydrinethylene oxide 100 100 100 100 100 100copolymer ( 24 . 8 % chlorine by weight ) haf . sup . 1 carbon black 50 50 50 50 50 50 ( reinforcing agent ) stearic acid 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 ( processing aid ) nickel dibutyl 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0dithiocarbamate ( antioxidant ) magnesium hydroxide 0 . 5 -- -- -- -- --( acid acceptor ) magnesium oxide -- -- -- -- -- 5 . 0 ( acid acceptor ) barium carbonate -- 8 . 0 -- -- -- --( acid acceptor ) sodium hydroxide -- -- 0 . 3 -- -- --( acid acceptor ) dipentamethenethiuram 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 -- hexasulfide ( accelerator ) sodium oxide -- -- -- 3 . 0 -- --( acid acceptor ) sodium carbonate -- -- -- -- 6 . 0 --( acid acceptor ) ethylene thiourea 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 2 . 0 ( cross - linking agent ) tetramethylthiuram -- -- -- -- -- 2 . 0monosulfide ( accelerator ) __________________________________________________________________________ . sup . 1 high abrasion furnace black __________________________________________________________________________ ex . 10 ex . 11 ex . 12 ex . 13 ex . 14 ex . 15__________________________________________________________________________mooney scorch (@ 121 . 11 ° c . )( astm d 1646 ) minimum viscosity 28 29 . 5 28 28 29 . 3 29 ( mooney units ) time in minutes for 3 11 . 5 14 9 . 3 20 . 2 13 . 8 12unit rise in viscositytime in minutes for 5 12 . 8 16 . 3 11 . 1 12 . 5 15 . 2 14 . 1unit rise in viscositytime in minutes for 10 14 . 6 18 . 4 13 . 6 14 . 1 18 . 2 15 . 8unit rise in viscositytension testing ( astm d - 142 ) 100 % modulus ( tensile 640 600 680 620 640 620strength @ 100 % elongation ) ( p . s . i . ) tensile strength 2080 1940 2180 1960 2020 2100 ( p . s . i . )% elongation 350 380 350 370 340 360shore a hardness 75 72 76 74 75 74 ( astm d 2240 - 68 ) tension testing ( aged 7 days @ 125 ° c . )( astm d 142 ) 100 % modulus ( tensile 1160 1040 1280 1120 1110 1080strength @ 100 % elongation ) tensile strength 1410 1480 1360 1420 1620 1510 % elongation 140 160 120 138 150 145shore a hardness 87 86 91 88 87 88 ( astm d 2240 - 68 ) odr ( astm d 2084 - 71 t ) minimum torque 10 . 7 11 . 8 10 . 5 10 . 8 12 . 3 12 . 8 ( inch pounds ) highest torque / type 108 / m . sub . h 92 / m . sub . h 110 / m . sub . h 100 / m . sub . h 106 / m . sub . h 98 / m . sub . h ( inch pounds ) scorch time ( t . sub . s2 ) 2 . 4 3 . 1 2 . 4 2 . 5 2 . 6 2 . 5 ( minutes to torqueincrease of 2 inch pounds ) cure time ( t . sub . c 90 ) 25 31 24 26 26 27 ( minutes to 90 % offull torque development ) __________________________________________________________________________	2
a handle cover for delivery catheter typically includes a handle body region configured to cover a portion of the delivery catheter such as the proximal handle portion of the delivery catheter , and a control adapter that is configured to engage an implant release portion of the delivery catheter . a handle cover may be reusable or single - use , and may be constructed so that it can encase or sheath the proximal end of the delivery catheter while enhancing the function of the delivery catheter . for example , the handle cover may be formed of two or more interlocking parts that secure over the delivery catheter handle . for example , in one embodiment , a handle cover for an implant delivery catheter includes a handle cover body configured to cover and engage with a proximal portion of a delivery catheter . the handle cover also includes a control adaptor . a control adapter may be a knob , switch , slider , dial , button , etc . that can be manipulated by a user holding the handle to release an implant into a target region of a patient &# 39 ; s heart . the control adaptor typically activates an implant release control that is located on the proximal portion of the implant delivery catheter , enabling the release of the implant from the distal portion of the deliver catheter . a handle cover may be part of an implant deliver system that includes a delivery catheter , handle cover , and ( optionally ) an implant configured to be releasably secured at a distal portion of the delivery catheter . the delivery catheter typically includes an implant release control located at the proximal end of the delivery catheter that can be activated to release ( or in some variations , engage ) an implant by the distal end region of the delivery catheter . when the handle cover is secured to the delivery catheter , the implant release control may be activated by the control adaptor . the control adapter of the handle cover may also regulate the operation of the implant release control . for example , the control adapter may include a limiter that limits the rate and / or amount that the implant release control is activated . in some variations , the control adapter is lockable , to prevent release of an implant from the delivery catheter by activation of the implant release control until it is unlocked . in some variations , the handle cover includes an indicator of the activation state of the implant release control . an indicator may be visible ( e . g ., by a marking , text , color change , etc .) showing the amount of activation or release of an implant by the delivery catheter . in operation , a handle cover may be used with a delivery catheter to control the deployment of an implant from the delivery catheter . for example , a distal portion of an implant delivery catheter may be advanced near a target region of the patient &# 39 ; s heart , such as with the patient &# 39 ; s ventricle . an expandable implant may be attached to the distal end of the implant delivery catheter in a collapsed configuration . in variations of the handle cover including a lockable control adapter , the control adapter of the handle cover may then be unlocked . the control adapter can then be manipulated ( e . g ., by rotation ) to activate the implant release control . the activation of the implant release control causes release of the expandable implant . accordingly , the expandable implant may be released into the target region of the patient &# 39 ; s heart . releasing the expandable implant may involve partitioning the left ventricle of the subject &# 39 ; s heart into productive and non - productive regions . in some variations , the activation of the implant release control includes releasing an expandable implant by rotating a threaded region or coil at the distal end of the delivery catheter until the coil disengages from an implant . for example , an implant may have a threaded receiving region that engages the release mechanism on the distal end of the delivery catheter . an appropriate implant may be used with the delivery catheter and / or handle covers described herein . for example , refer to the implants described in the patent applications incorporated by reference above . in particular , expandable implants having a plurality of ribs to help secure the implant within the target region of the patient &# 39 ; s heart ( e . g ., ventricle ) are of particular interest . partition implants , which may include one or more membranes for partitioning a region of the heart , are also of interest . fig1 - 7 illustrate variations of handle cover and systems including handle covers . for example , fig1 illustrates an implant delivery system for improving cardiac function . the implant delivery system 100 includes a delivery catheter 102 , an implant release 104 , a handle cover 106 , an implant loader 114 and inflation port 112 . the implant delivery system 100 shown in fig1 includes an implant release 104 at a distal portion of the delivery catheter . the implant release 104 may be activated by an implant release control , as describe in greater detail below ( e . g ., see fig7 ). the implant release 104 may be connected to the implant release control of the delivery catheter ( not visible in fig1 ) by a wire ( e . g ., guidewire ) or another mechanism . the implant release 104 mechanism typically releases an implant . in addition , the delivery catheter may also be used to deliver material such as coils and / or a bioabsorbable materials within or behind the implant after it is positioned . for example , the delivery catheter may include a channel or passage for delivery of material through , behind or into the implant . for example , the delivery catheter may allow delivery of a bioabsorbable material such as collagen , gelatin , polylactic acid , polyglycolic acid , copolymers of polylactic acid and polyglycolic acid , polycaprolactone , mixtures and copolymers , or the like . in some variations this material may be delivered behind the device after it has been implanted . in some variations , the implant release control ( not visible in fig1 ) rotates the implant release mechanism 104 , enabling the implant release 104 to release an implant such as those depicted in u . s . patent application publication no . 2006 / 0281965 and u . s . patent application publication no . 2006 / 0264980 , which are herein incorporated by reference in their entirety . an implant delivery system 100 may also include an implant loader 114 . an implant loader 114 can collapse an implant . the implant loader may also engage with the delivery catheter 102 particularly when the implant loader is not in use ( e . g ., before or after collapsing the implant and loading to the delivery catheter ). the implant loader 114 may have a funnel or cone shape , as illustrated in the variation shown in fig1 . as mentioned above , any appropriate delivery catheter for delivering a collapsible implant may be used . for example , the delivery catheter 102 may take the form described in u . s . patent application publication no . 2006 / 0281965 or u . s . patent application publication no . 2006 / 0264980 . as describe in fig7 , a delivery catheter 102 may include two tubular members , attaching to an inflation port 112 and a coil delivery port 706 . as shown in fig7 , the inflation port 112 and the coil delivery port 706 are located at a proximal portion of the delivery catheter . the inflation port 112 may be configured to inflate a balloon to help secure the implant within the target region of the patient &# 39 ; s heart . the coil delivery port 706 may be used to release the implant and to rotate a coil at the distal end of the delivery catheter until the coil disengages from the implant . optionally , the coil delivery port may be replaced by another type of delivery port . as mentioned above , and illustrated in fig1 , a handle cover 106 may include a handle body 108 and a control adaptor 110 . the handle body 108 in this example is formed of two interlocking pieces . alternatively , the handle body 108 may be one complete piece or more than two interlocking pieces . the handle body 108 may be made of plastic , glass or other materials . as depicted in fig7 , the handle body 108 in this example forms an opening or passageway 702 generally configured to hold the proximal portion of the delivery catheter 102 . this opening or passageway 702 is formed of an elongate section 708 , a projecting section 710 and a base 712 . the elongate section 708 of the passageway 702 encases the proximal portion of the delivery catheter 102 . the projecting section 710 is configured to hold the portion of the delivery catheter 102 that is attached to a coil delivery port . the projecting section 710 also serves as a gripping mechanism for the implant delivery system 100 . the handle body 108 may also include gripping tabs , detents , attachment and projections to secure and / or engage portions of the delivery catheter 102 throughout the elongate section 708 , the projecting section 710 and the base 712 . thus , the delivery catheter may be secured within the handle cover so that it doesn &# 39 ; t rotate or slide with respect to the handle cover . as illustrated in fig1 - 3 , a control adaptor 110 may be attached to the handle body 108 and is configured to engage the implant release control of the delivery catheter 102 . in this example , the control adaptor 110 forms a knob that can be rotated to control the deployment . optionally , the control adaptor 110 may be a pumping , electrical , or other control mechanism to engage the implant release control of the delivery catheter 102 . a user may operate the control adaptor 110 to activate the release of an implant from the delivery catheter . activating the control adapter typically activates the implant release control ( 714 in fig7 ). fig2 shows a side perspective view of a handle cover including a control adapter 110 at the proximal end . fig3 shows a partial view of the handle body region of the handle cover shown in fig2 . the base 712 of the handle body 108 is shown separated from the control adaptor 110 . the base 712 includes a track 302 , a slot 304 and a ratchet 306 . fig4 illustrates a control adaptor 110 including a tab 402 . the control adaptor 110 shown in fig4 is configured to rotate in a counter clockwise direction ( and also in part in a clockwise direction ). the control adaptor 110 is also configured to be locked and unlocked . activation of the control adapter 110 causes the implant release control to activate the implant release , thereby enabling an implant to release from a distal end of the delivery catheter . the control adaptor 110 can be locked to prevent activation of the implant release control when manipulating the control adaptor 110 . when the control adapter 110 is locked , e . g ., when the tab 402 on the control adaptor 110 is locked into the slot 304 on the handle body 108 in the example shown in fig2 - 4 , the control adapter may be rotated but will not engage the implant release control and release the implant . this locking mechanism may prevent the control adaptor 110 from rotating , or may simply decouple rotation of the control adapter from the implant release control . as shown in fig5 , the control adaptor 110 may be held in the locked position by the annular snap feature 500 on the control adaptor 110 and the handle body 108 . in fig5 , the control adaptor 110 can be unlocked by a distal pull ; in some configurations the control adapter is unlocked by pushing distally , or by some combination of pushing / pulling and rotating . when the control adaptor 110 is put into the unlocked position , the annular snap feature 500 on the control adaptor 110 and the handle body 108 may hold the control adaptor 110 in the unlocked position . accordingly , the tab 402 can slide counterclockwise through the track 402 on the handle body 108 . as the control adaptor 110 is moved from the locked to the unlocked position , the ratchet 306 on the handle body 108 interferes with tab 402 so that the control adaptor 110 cannot be rotated in the clockwise direction . one side of the slot 304 is formed by the ratchet 306 on the handle body 108 . the ratchet 306 on the handle body 108 allows the tab 402 on the handle body 108 to pass in the counterclockwise direction , but not in the clockwise direction . after each full turn in the counterclockwise direction , the tab 402 snaps past the ratchet 306 and the control adaptor 110 is unable to make any subsequent turns in the clockwise direction . the control adaptor 110 may also provide feedback upon rotation or activation of the implant release control 104 . feedback may indicate that the control adapter is engaged ( or locked ), and may indicate the status of the control adapter / implant release control . for example , in some variations , the deployment of the implant may involve the removal of a threaded attachment member / deployment member . a feedback on the handle may indicate how far into the deployment ( e . g ., how unscrewed ) the implant is . for example the handle cover may indicate by audible ‘ clicks ’ how many turns of the deployment mechanism have been completed . the feedback may be visual , aural , tactile , or the like . for example , the control adaptor 110 may provide clicking sounds to the operator of the implant delivery system 100 . fig6 illustrates an implant loader detent 600 on a distal end of the handle body 108 . each interlocking piece of the handle body 108 includes the implant loader detent 600 to secure the implant loader 114 . when the implant delivery system 100 is not in use , the implant loader 114 is in the distal section of the handle body 108 . fig8 a and 8b show the distal end of an implant delivery catheter including a distal tip guard . in this variation , the distal tip guard may also be referred to as a screw guard , because the distal end of the delivery catheter has an implant release that includes a threaded region ( shown as a coil or screw ) projecting from the distal end , to which the implant may be releasably engaged . this screw region may be secured at or near the distal end of the implant delivery catheter along with an inflatable ( balloon ) region that also forms a portion of the implant release . distal to the implant release is a screw guard , as illustrated in fig8 a and 8b . in general , the distal tip guard is a cap , protrusion or projection from the distal end of the device that prevents the implant release portion at the distal end of the implant delivery catheter from damaging the heart wall . in fig8 a and 8b the distal tip guard is a screw guard that projects distally from the screw region of the implant release portion , and is a soft material ( e . g ., a material having a low durometer , such as low durometer pebax , etc .). the screw guard may be connected to the distal end of the device in any appropriate manner , including adhesively , ( e . g ., via an adhesive joint ), by crimping , sealing , welding , or the like . the distal end of the screw guard may be blunted or otherwise atraumatic . to the extent not otherwise described herein , the various components of the implants , applicators / delivery catheters , and handle covers may be formed of conventional materials and in a conventional manner as will be appreciated by those skilled in the art . while particular forms of the invention have been illustrated and described herein , it will be apparent that various modifications and improvements can be made to the invention . moreover , individual features of embodiments of the invention may be shown in some drawings and not in others , but those skilled in the art will recognize that individual features of one embodiment of the invention can be combined with any or all the features of another embodiment . accordingly , it is not intended that the invention be limited to the specific embodiments illustrated . it is intended that this invention to be defined by the scope of the appended claims as broadly as the prior art will permit .	0
throughout this description , a preferred embodiment and the examples shown should be considered as exemplars , rather than limitations on the apparatus and methods of the present invention . referring now to fig1 - 3 , there is shown an incentive spirometer 100 having a volume chamber portion 50 , carrying a movable piston 53 within , and a goal - recording counter ( grc ) which embodies the present invention . the volume chamber portion 50 provides a predetermined volume against which a patient &# 39 ; s respiratory system is exercised for a determinable volumetric capacity to obtain the benefits of respiratory therapy . the grc 60 is readily attachable and removable from the spirometer 100 , and informs a patient as to the number of times a predetermined breathing exercise , a proper event , has been properly performed . a monitoring portion 80 provides a visual display to the patient for determining the correct flow rate of inspiratory air to be applied by the patient &# 39 ; s respiratory system during therapy , and in cooperation with the grc 60 and volume chamber portion 50 , permits the patient to determine the quality of inspiratory air which has been drawn into the patient &# 39 ; s lungs at the desired correct flow rate . for further details of the incentive spirometer illustrated , reference is had to co - pending application , ser . no . 09 / 009 , 338 , filed jan . 20 , 1998 in the name of douglas m . crumb , et al , the disclosure of which is incorporated herein by reference . the volume chamber portion 50 of the incentive spirometer 100 includes a chamber 51 of a predetermined volume in which the piston 53 is carried . an air channel ( not shown ) forms a fluid connection between an inspiratory air inlet port 81 through which a patient draws inspiratory air , and the top ( not shown ) of the volume chamber 51 . in this manner , when a patient draws inspiratory air , the piston 53 is drawn upwardly . if a patient is drawing inspiratory air at the desired target flow rate as shown by an indicator 85 , the volume of air drawn into the patient &# 39 ; s respiratory system can be determined by observing the calibrations 56 marked on the chamber 51 . the grc is attached to a portion of the chamber 51 by means of a removable mounting bracket 61 , which releasably connects the grc 60 to the chamber 51 . an indicator 62 , formed on a portion of the mounting bracket 61 , is positioned at a preselected one of the volume calibration marks 56 which corresponds to the volume of air which is desired to be drawn into the patient &# 39 ; s lungs when using the device . a count of the number of occasions upon which a patient draws the desired volume of air into the lungs , a proper event , is visually displayed on a display panel 63 of the grc . when the patient inhales a sufficient volume of air to actuate the grc , a lamp or light emitting diode ( led ) 65 is flashed for a predetermined period of time “ coaching ” the patient to hold their breath during the time that the led is illuminated . the manner in which the grc 60 is actuated to record the number of occurrences in which a patient has successfully performed the proper event , the desired breathing exercise , and the manner in which the led 65 is flashed to coach the patient in the proper performance of the exercise , is described in detail hereinafter with reference to fig2 and 3 , and in co - pending application improved incentive spirometer , ser . no . 09 / 382 , 608 , filed in the names of lawrence a . weinstein , et al , which is incorporated herein by reference . the grc 60 includes an infra - red emitter / detector 67 , comprising an ir emitter 67 a and an ir detector 67 b , such as a sharp model no . gp2s40 , which is carried at the back side of the grc 60 to determine the presence of the piston 53 being raised to the position of the indicator 62 in the volume chamber 51 . the ir emitter / detector 67 is coupled into the electrical circuit illustrated in fig3 so that the grc will record only the movement of the piston 53 within the volume chamber 51 to the proper position as set at indicator 62 , without being falsely triggered by other occurrences such as electrical noise or spurious ir signals . to this end , when a patient withdraws inspiratory air from the volume chamber 51 , the piston 53 carried there within will rise . when the patient has withdrawn a sufficient amount of inspiratory air to raise the piston 53 to the desired level , marked by the indicator 62 , the piston 53 will reflect the ir signal emitted from the emitter portion 67 a into the detector portion 67 b of the ir emitter / detector 67 . upon verification of the presence of the piston 53 , the electrical circuit illustrated in fig2 and 3 will cause a display 63 to be stepped incrementally to show that the desired goal has been obtained by the patient . at the same time , the coaching lamp or led 65 will flash intermittently for a predetermined time period , preferably six seconds , to “ coach ” the patient to hold their breath until the light is extinguished . in this manner , the patient is informed that the desired goal has been obtained and maintained for the correct period of time . referring now to the logic block diagram or flow chart of fig2 the operation of the grc 60 will be described in more detail . a preferred embodiment of the electrical circuit of this invention which is incorporated into the grc 60 is illustrated in fig3 . initially , a power source such as 3 - volt coin type battery 201 , commonly available as a cr 2 032 , is connected to a high - performance , four - bit microprocessor or micro controller 200 , such as model w741c250 , available from windbon electronics corporation america , 2727 north first street , san jose , calif . 95134 . to operate the grc in the manner desired , and as illustrated in the preferred embodiment of fig3 power is supplied to the microprocessor 200 at all times . however , during some operation of the grc 60 , the “ sleep ” mode , it is desirable that power be supplied only to the microprocessor 200 , and not to the supporting devices such as a liquid crystal display ( lcd ) array 210 through which a number appears on the display panel 63 of the grc , the light emitting diode ( led ) indicator circuit 205 which includes the “ coaching ” lamp or led 65 , and the infra - red detector circuit 67 , supporting devices used in the operation of the grc . by shutting down all of the supporting devices and maintaining power to only the microprocessor 200 during a particular operational mode , the “ sleep ” mode , the battery 201 is conserved by reducing the current consumption to near zero . when power is supplied to the grc 60 by depressing an on / reset button 64 , the grc will have been in a “ sleep ” mode , wherein power is being supplied to the microprocessor 200 only , and not to the surrounding support devices . in the “ sleep ” mode , the grc retains the count of the previously completed exercises , or proper events . depression of the on / reset button 64 will either “ awaken ” the grc from the “ sleep ” mode to retain the count of the previously completed exercises , or will reset the grc to display a “ 0 ” in the display window 63 to indicate that the grc is in condition to record a new cycle of operation beginning with “ 0 ” and sequentially recording the number of successfully completed exercises from that point . if the on / reset button 64 is depressed for more than three seconds , the grc 60 will awaken and the input to the lcd array 210 will display a “ 0 ” to indicate that the grc is in condition to record a new cycle of operation beginning with the numeral “ 0 ” appearing in the window 63 . if the on / reset button 64 is depressed for less than three seconds , the grc 60 will awaken and the lcd array is energized to display in the display window 63 the retained count of how many times a patient has successfully completed an exercise since the last resetting of the grc to “ 0 ”. depression of the on / reset button 64 actuates a key press counter or reset shut down timer circuit within the microcontroller 200 to energize a timing circuit so that after a period of time the grc will again be placed in a “ sleep ” mode , in the event that the piston 53 is not elevated by a patient into the predetermined position within the time period set by this shut down counter / timer . if the shut down timer has completed its count down without receiving a proper signal corresponding to the occurrence of a proper event , the elevation of the piston 53 by a patient into the predetermined position , the shut down timer will shut off the power to the surrounding support devices by opening a common path to ground for all these devices , thereby power will be supplied only to the microcontroller 200 placing the grc again in the “ sleep ” mode . when the on / reset button 64 has been depressed , the grc is placed in condition to determine if a proper event signal has been received . when a proper event signal is received by the detector 67 b , the led indicator circuit 205 will be energized flashing the “ coaching ” led 65 and activating an increment counter 63 so that the patient will hold the inhalation for a predetermined time period , preferably six seconds , during which time the led 65 will remain flashing . at this time , the infra - red detector 67 b will be disabled , and an internal shut down timer energized . if the shut down timer expires before a proper event signal has been received to reset the shut down timer , the microcontroller 200 will place the grc in the “ sleep ” mode , thereby terminating power to all of the support devices such as the lcd array 210 , the led “ coaching ” circuit 205 and the infra - red detector circuit 67 by opening the system ground re 1 through the microcontroller 200 . power from the battery 201 will be maintained only to the microcontroller 200 without maintaining the surrounding support devices to reduce the current consumption or drain on the battery 201 to nearly zero . while this invention has been described in the specification and illustrated in the drawings which reference to a preferred embodiment , the structure of which has been disclosed herein , it will be understood by those skilled in the art to which this invention pertains that various changes maybe made , and equivalents maybe substituted for elements of the invention without departing from the scope of the claims . therefore , it is intended that the invention not be limited to the particular embodiment disclosed in the specification and shown in the drawings as the best mode presently known by the inventors for carrying out this invention , nor confined to the details set forth , but that the invention will include all embodiments , modifications and changes as may come within the scope of the following claims .	7
in fig1 which represents schematically and basically the approach according to the invention , numeral 1 denotes the sputtered surface of a cathode sputtering source , such as in particular a magnetron source , i . e . the target . offset from the cathode sputtering source 1 , a further plasma discharge path 3 is provided , as depicted schematically with source 5 , which is dc operated , ac operated up into the microwave range or operated with dc and superimposed ac in the most generally considered way . although in fig1 the further plasma discharge is depicted as being generated between two electrodes , i . e . capacitively , this further plasma discharge can in the most general case under consideration here , be generated in any manner known . a workpiece 7 is exposed according to the invention with its surface to be coated alternatingly to the cathode sputtering source 1 and the additionally provided plasma discharge on path 3 . this is depicted schematically in fig1 with the double arrow s . in fig1 the dashed lines indicate a vacuum receptacle 9 . into the receptacle 9 is introduced from a tank 12 via a control valve 11 , a gas to be ionized , such as argon . furthermore , a reactive gas or a reactive gas mixture is introduced , such as with a gas port arrangement 13 , preferably into the region of the cathode sputtering source 1 , from a tank arrangement 15 , controlled or adjusted by a valve arrangement 17 . consequently , the reactive coating process predominantly takes place in the region of the cathode sputtering source 1 . in the region of the further plasma discharge path 3 the deposited layer is &# 34 ; refined &# 34 ;. in preferred realizations the cathode sputtering process is regulated . as a sensor for the measured regulating variable x the sensing head of a plasma emission monitor is used , disposed specifically directly in the region of the cathode sputtering source 1 . its output signal is evaluated ( not depicted ) in the plasma emission monitor and compared in a difference unit 21 with a control signal w . as the manipulated variable preferably the mass stream of the reactive gas or its mixture ratio supplied to the receptacle 9 is acted upon by means of the valve arrangement 17 . this takes place potentially via a regulator 23 . but the cathode sputtering process can also be regulated in different ways , for example by measuring the sputtering rate by means of electrical probes or by means of a quartz layer thickness measuring instrument as the sensing device for the measured regulating variable . alternatively , or also additionally , to the adjustment intervention of the reactive gas , the electric operating voltage at the sputtering source can also be affected , in particular also the magnetic field generation of a magnetron source . in fig1 a shielding device 25 is depicted in dot - dash line , such as a controllable diaphragm , by means of which in the receptacle 9 a spatial region with the cathode sputtering source 1 can be shielded in a controlled way from a spatial region with the further plasma discharge path 3 . this is implemented in a preferred embodiment of the invention . if , according to fig3 the workpiece 7 is positioned in the region of the further plasma discharge 3 , the shielding 25 can be closed and the cathode sputtering source 1 , preferably a magnetron , can be sputtered free . when the workpiece surface 7 is exposed to the further plasma discharge 3 it can simultaneously be etched or heated or its surface can basically be plasma - treated . for this purpose the performance , for example the discharge current , of the further plasma discharge path is adjusted by means of the source 5 of fig1 . it is also possible to set specifically alternatively or additionally , the plasma density at the surface region of the workpiece 7 facing the discharge 3 by means of magnetic fields b , in the sense of a controlled focusing and , consequently controlled power density distribution of the further plasma discharge 3 . for the further control of the treatment process realized at said surface , as depicted schematically in fig1 the electrical potential φ 7 on the workpiece 7 is specifically set which , as is known to one skilled in the art , the ion bombardment density and the ion bombardment intensity on the workpiece 7 is set . φ 73 is preferably selected to be more negative than the plasma potential of the further plasma discharge 3 , preferably lower than + 10 v , preferably at most + 5 v , in particular at most - 5 v , preferably between - 5 v and - 300 v , typically approximately - 150 v . as depicted in particular in fig3 the inert gas , such as for example argon , is supplied to the receptacle volume in such a way that it is distributed a homogeneously as possible in said volume , while the reaction gas r is introduced primarily into the immediate region of the cathode sputtering source 1 . but , as is shown in dashed lines in fig3 a reactive gas can also be introduced through nozzles specifically into the region of the further plasma discharge 3 if , with the shielding 25 prefereably closed , a reactive process is to take place there . as is apparent , according to the invention the workpiece surface to be coated is alternatingly exposed to the cathode sputtering source with its target surface 1 or to the further plasma discharge 3 , as shown in schematic top view at the bottom of fig1 . it is entirely possible to choose the electric workpiece potential φ 7 in the region of the cathode sputtering source φ 71 so that it differs from that in the region of the further plasma discharge , denoted there by φ 73 . the alternating exposure of the surface to be coated of the workpiece 7 is realized according to fig2 in preferred manner through a pivoting motion or a rotating motion . the workpiece 7 is for this purpose either pivoted about a pivot axis a in such a way that its surface to be coated alternatingly faces the sputtering source 1 and the discharge path p of the further plasma discharge , depicted by ω 2 . the workpiece 7a can also be rotated about an internal workpiece axis a , ω 1 , for example a disk - shaped workpiece both of whose surfaces are to be coated . as alternating frequencies , low frequencies are useful , which leads to significant simplifications . the preferably used frequencies are maximally 30 hz , preferably lower than 10 hz , further preferably maximally 1 hz , and typically even approximately 0 . 1 hz . in the case of an arcuate surface to be coated a tangential plane e should be positioned on this surface in its central region , essentially parallel to a tangent t on the discharge path p of the further plasma discharge , in order to ensure the at least approximately uniform distribution of the plasma density on the surface . fig4 schematically depicts an apparatus according to the invention in longitudinal section . for the function units and parameters which have already been described in principle in conjunction with fig1 to 3 , the same reference symbols are used . two or more cathode sputtering sources 1 are mounted on the jacket of a vacuum receptable 9 , which is essentially constructed cylindrically about a central axis z , with an evacuation connection 27 for a vacuum pump . the sources 1 are electrically insulated from the jacket . they are preferably magnetic - field enhanced sputtering sources , such as are generally known by the term magnetron sources . as is also known , they are encompassed by anode rings 29 and comprise one target plate 31 each , of the solid material to be sputtered . as is known to the expert and not depicted here , at the preferably used magnetron sputtering sources , tunnel - shaped magnetic fields are generated statically or moving over the target surface to be sputtered . this significantly increases the plasma density , schematically at pl 1 , of the cathode sputtering sources plasmas . directly in the region of the target surface to be sputtered , the gas inlet arrangement 13 is provided for the reactive gas r which , for reasons of clarity , is only entered at the right magnetron of the magnetrons 1 depicted in fig4 . it is preferably formed by at least one tubing loop 33 which encircles the target periphery , with exit bores facing the target surface for the gas . through these bores , preferably essentially at an angle of 45 °, the reactive gas is introduced to the surface of the target 31 , through nozzles . an ionization chamber 35 is provided coaxially with the center axis z , which communicates via a diaphragm 37 with the inner volume of the receptable 9 . the diaphragm 37 is preferably electrically insulated by insulation 39 with respect to the wall of the receptacle 9 , as well as also with respect to the wall of the ionization chamber 35 . also electrically insulated , a hot cathode 41 is provided with heating current terminals 43 as an electron emission cathode in the ionization chamber 35 . coaxially with said axis z , an anode 45 opposing the diaphragm 37 is mounted in the receptacle 9 so as to be insulated with respect to the wall of receptacle 9 . a low - voltage plasma arc discharge is generated in known manner through the diaphragm 37 between ionization chamber 35 and anode 45 as the further plasma discharge 3 in the form of a plasma beam . further details for generating a low - voltage arc vaporization path are discussed , for example , in swiss patent no . 631 743 . a further gas inlet 11 for a gas to be ionized , such as argon , is provided on the ionization chamber 35 . coaxially with axis z are , moreover , provided one or several coils 47 by means of which an essentially axial magnetic field is generated in the receptacle 9 . by changing the magnetic field coupling through the coil 47 , the focusing of the plasma beam of the further discharge 3 is adjusted . about the anode 45 , a carrier arrangement 49 for workpieces is provided . it comprises a carrier ring 51 which rolls on rollers 53 and , consequently , circulates about the center axis z . as depicted schematically with motor 54 , least one of the rollers 53 distributed at the circumference of the ring 51 , is driven . on the ring 51 a multiplicity of rotary stands 55 projecting up in parallel with axis z , are rotatably supported so as to be electrically insulated . a driving roller 57 for purpose engages a stationarily mounted cylinder segment 59 on the wall of receptacle 9 and projecting upward coaxially with axis z . consequently , the rotary stands 55 rotate about their own axis , as represented by ω 55 , and simultaneously with the ring 51 about the central axis z , as represented by ω 51 . the rotary stands 55 are constructed like a tree , each having a multiplicity of projecting carriers 61 on which workpieces 7 are mounted either suspended or standing upright . consequently , the workpieces 7 are pivoted alternatingly through the rotational motion ω 55 into the region of the particular cathode sputtering sources 1 and into the region of the further plasma discharge 3 . they are simultaneously moved through the rotational motion ω 51 from one cathode sputtering source 1 to the next . moreover , 65 and 63 denote electric sources for operating the cathode sputtering sources 1 or for applying a potential to the electron emission cathode 41 , with respect to the anode 45 . furthermore , an adjustable source 67 is provided by means of which , for example via the drive shaft of motor 54 , rollers 53 , ring 51 , rotary stands 55 , the electric potential on the workpieces 7 is adjusted . the apparatus according to fig4 is depicted again in fig5 . but here further preferred measures are depicted which , for reasons of clarity , are not shown in the representation of fig4 . a pick - up sensor 70 is assigned to each cathode sputtering source 1 , preferably a sensing head of a plasma emission monitor . as schematically shown at 72 , it is shielded against the radiation of the further plasma discharge 3 by means of an appropriately formed and disposed shielding . after the appropriate evaluation , the output signal of each pickup sensor is compared with a given nominal or reference value , according to fig5 the same value w , formed in the reactive gas feed through controllable valves . the result of the comparison is supplied as the regulating difference δ to a final control element , preferably a final control element 74 , assigned to the cathode sputtering sources 1 . consequently , the coating process is preferably regulated at each cathode sputtering source 1 individually , which makes possible , in particular in the workpiece coating with layers which are electrically poorly insulated or not at all , as a reaction product of the solid material sputtered off the sources with the reactive gas , also setting operating points which , without the provided regulation , could not be stabilized , i . e . operating points with which the sputtered target surface would be poisoned through said poorly conducting or non - conducting reaction products in such a way that the coating process , if it did not come to a complete stop would , nevertheless , become uncontrollable through so - called &# 34 ; arcing &# 34 ;. furthermore , preferably between each cathode sputtering source 1 and the motion path of the workpiece carrier arrangement 49 , a controllably movable shielding 74 is provided , for example running in upper and lower guides . by means of a drive 76 each shielding 74 is inserted or removed from between target surface and gas outlet tubing 33 , on the one hand , and workpiece carrier 49 , on the other hand , in order to expose subsequently the appropriate workpieces to the cathode sputtering . the described method and the preferably employed apparatus is especially suited for coating workpieces , such as tools , with a mechanically resistant layer , in particular comprising titanium nitride , or with another layer known as mechanically resistant layers , such as a nitride , carbide or oxinitride layer or a mixed form thereof comprising tantalum , titanium , hafnium , zirconium or aluminum . as solid material is preferably sputtered the metal phase , such as titanium but it is readily possible to cathode - sputter a sub - nitride , oxide or carbide compound . the approach with an apparatus as depicted in conjunction with fig4 and 5 for coating drills , is explained in the following . the vacuum receptacle 9 is evacuated to 2 · 10 - 5 mbars . the workpiece carrier drive is set in motion and the hot cathode is heated with a heating current of 150 a . via connection 11 argon is introduced to a pressure of 3 × 10 - 3 mbars and , subsequently , the low - voltage arc discharge 3 is ignited . its discharge current is adjusted to 60 a . thereupon the argon pressure is reduced to 25 × 10 - 4 mbars and the rotating workpieces are plasma - heated for approximately 12 minutes . with unit 67 the electric potential of the workpieces is set with respect , for example here , to the grounded receptacle wall . the argon pressure in the receptacle is increased to 3 × 10 - 3 mbars and with coils 47 the plasma beam of the discharge 3 is increasingly focused . the discharge current of the discharge 3 is about 70 a . by lowering the electric potential at the workpieces with source 67 to approximately - 200 v , the ion acceleration voltage toward the workpieces is increased so that etching of the workpiece surface is initiated . during this etching process the diaphragms 74 are preferably closed so that in the central chamber part of the receptacle 9 the etching process is carried out while , simultaneously , the target surfaces of the cathode sputtering sources 1 can be sputtered free . the argon pressure is increased to 18 · 10 - 3 mbars , the discharge beam of the plasma discharge 3 is defocused by reducing the coil current in coils 47 . the discharge current of the discharge 3 is further reduced to approximately 50 a . with the cathode sputtering sources 1 switched on , the shieldings 74 are pulled back and now the workpieces are exposed by rotation according to ω 55 alternatingly to the particular cathode sputtering sources 1 and the central plasma beam of the further discharge 3 . with the method according to the invention and the apparatus according to the invention , mechanically resistant layers are produced which essentially meet the same requirements as layers produced in ion plating . according to the approach described under 3 . coating , with an apparatus according to fig5 mm drills comprising high - speed steel hss were coated with tin . the rotational speed ω 55 of the 16 provided trees in the apparatus according to fig5 was approximately 0 . 1 hz . in the following table the drill test results at varying coating process parameters are summarized as &# 34 ; number of holes &# 34 ; as the drill test was used a standard test for the quality assurance . the &# 34 ; hole number &# 34 ; specification , consequently , is a relative measure of the quality of the drills . __________________________________________________________________________ performan . plasma sputtering in drill beam magnetic power test current field , substrate ( 3 sputtering substrate substrate ( holetrial density coil voltage sources ) current temperature number ) __________________________________________________________________________1 90 a 0 a - 200 v 3 * 8 kw 8 a 310 ° c . 492 70 a 5 a - 200 v 3 * 8 kw 7 a 300 ° c . 623 40 a 5 a - 200 v 3 * 8 kw 5 . 9 a 280 ° c . 574 40 a 5 a - 150 v 3 * 8 kw 5 . 5 a 250 ° c . 555 30 a 10 a - 150 v 3 * 8 kw 6 a 285 ° c . 526 30 a 5 a - 150 v 3 * 8 kw 4 . 8 a 230 ° c . 507 30 a 0 a - 150 v 3 * 8 kw 3 a 230 ° c . 308 0 0 - 200 v 3 * 8 kw 2 a 225 ° c . 59 30 a 5 a - 150 v 3 * 12 kw 5 . 0 a 235 ° c . 1010 45 a 5 a - 150 v 3 * 12 kw 7 . 6 a 305 ° c . 23__________________________________________________________________________ sputtering with low - voltage center discharge ( nze ) at an arc current of 90 a . substrate current 4 times higher than no . 8 . thereby higher substrate temperature ( 310 ° c .). the high center plasma density at the workpieces leads to golden , shining and compact layers . the performance during the drill test is considerably better than for example in the case of no . 8 . sputtering with lower nze plasma beam current density . the ion bombardment on the workpieces and , consequently , the substrate temperature are lower . but the layers are still compact and shining . the performance in the drill test is even better than with no . 1 . lowering the coating temperature through low substrate voltage , without marked decrease of the drill performance . with increased coil current ( 10 a ) the degree of ionization of the argon is higher and with it the nze plasma density on the substrates ( substrate current ). the drill performance is slightly better , but the temperature is markedly higher in comparison to charge no . 6 . lowest coating temperature with good drilling results . optimum combination of magnetic field and arc current . the layers are compact and golden . practically without coil current the nze plasma density on the samples is insufficient , which causes a coarser layer structure and a deterioration of the drill performance . purely reactive sputtering ( without low - voltage center discharge ). lowest achievable temperature ( with 3 × 8 kw ) but drilling results comparable with those of uncoated drills . matt and brown layers with coarse , stalk - like structure . with a sputtering power of 12 kw the deposition rate is significantly higher . but with the parameters of charge no . 6 , the plasma density at the workpieces is too low to ensure a sufficient ion bombardment by ar ions . the layers are less compact and the drilling performance is significantly worse . only with an nze plasma beam current density of 45 a at a sputtering power of 3 × 12 kw is the ar ion bombardment sufficient to permit the deposition of compact layers . the drilling performance is better but the temperature is above 300 ° c .	2
an article support rack 10 of the present invention is shown in fig7 as being carried by a telescoping housing 11 which is mounted by a suitable mounting arrangement to a clothes support rod r which is conventionally found in a closet or wardrobe . it should be noted that the housing 11 may be supported to the underside of other supporting surfaces such as a shelf or overhang with the mounting components being altered to accommodate the suspension of the housing from such supporting surfaces . the telescoping housing 11 is shown as having a primary body or section 12 which is mounted in fixed relationship with respect to the clothing support rod or other support surface . extendably carried within the main or primary housing section 12 is an intermediate slider member 13 and an innermost slide member 14 . the telescoping members 13 and 14 are slidably moved with respect to the primary body or section 12 by either pulling or pushing on the outer handle or knob 15 which is secured to the outermost end portion of the innermost slider or telescoping member 14 . each of the housing sections 12 , 13 and 14 are shown as being of a rectangular tubular configuration with the intermediate member 13 being slidably received within the primary housing body 12 and the inner member 14 being slidably received within the intermediate member 13 . for purposes of the present invention , it is envisioned that other configurations of extendable housing sections may be utilized . in addition , although two telescoping members are shown in the drawings , the number of telescoping members may be increased or reduced and still provide the necessary utility for moving the article support rack 10 in a horizontal direction relative to a vertically oriented supporting surface . attached to and extending outwardly on either side of the primary housing section 12 are a pair of outwardly oriented flange members 16 which extend along the entire length of the primary section . the outwardly extending flange members 16 not only provide a cover for underlying articles which will be selectively mounted or carried by the article support rack 10 but also will insure that adjacent articles suspended from the closet support rod or other supporting surface are maintained in spaced relationship to the articles carried by the support rack 10 . in this manner , it is envisioned that the width w of the support rack 10 will be equal to or less than the width defined between the outer edges 17 of the flange members 16 . the article support rack 10 of the present invention is shown in a first embodiment in fig1 as having a suspension or hanger rod 20 having a central elongated section 21 and outermost upwardly extending mounting posts 22 and 23 . the hanger rod 20 is generally the same length as the inner telescoping slide member 14 of the housing 11 and the upstanding end portions 22 and 23 are mounted within the front and rear portions of the inner telescoping member 14 . as the hanger rod member 20 is carried by the inner telescoping member , the entire article support rack 10 will be movably carried with the inner telescoping member 14 as it is maneuvered with respect to the central body portion 12 of the telescoping housing 11 . the article support rack 10 includes a plurality of generally c - shaped support members 25 which are mounted to the central portion 21 of the hanger element 20 so as to be in generally equally spaced relationship with respect to one another along the length thereof . each of the c - shaped article support members includes an upper and lower article support bar 26 and 27 , respectively , which are integrally connected at one end by a u - shaped portion 28 . as shown , the upper support bar 26 is welded or otherwise attached to the central portion 21 of the hanger rod 20 so that the lower article support bar 27 extends in spaced vertical relationship beneath the central portion 21 . the number of article support members 25 may be varied depending upon the types of articles to be suspended from the article support rack , and therefore , the spacing therebetween may be adjusted accordingly . the article support members 25 are shown in greater detail in fig2 with various embodiments thereof being shown in fig3 - 6 . with particular reference to fig2 the article support members shown at fig1 are shown in enlarged front plan view . each of the article support members includes the upper support bar 26 and lower support bar 27 and innerconnecting u - shaped portion 28 . the outer end 29 of the upper support bar 26 is shown as terminating generally in alignment with the central portion 21 of the hanger member 20 . the outer portion 30 of the lower support bar 27 is shown as being extended outwardly generally perpendicularly with respect to the vertically spaced central rod portion 21 of the hanger member 20 . a recessed or u - shaped area 32 is provided along the outer portion 30 and is spaced inwardly from the outermost end 33 thereof . the outermost end 33 is shown as being upwardly oriented with respect to the major portion of the lower support bar 27 . the area between the ends 29 and 33 of the upper and lower support bars 26 and 27 , respectively , is open so as to permit articles to be selectively positioned over the lower support bar 27 without interference with the upper support bar 26 or hanger member 20 . the outer u - shaped portion 32 of the lower support bar 27 not only provides a suspension area for such articles as belts , chains and the like , but the upwardly extending end portion 33 of the lower bar element 27 also serves as a stop or restraining element for preventing articles from being slidably urged outwardly with respect to the support bar 27 when they are mounted thereon . it should be noted that the configuration of article support members 25 shown in fig2 provides an unique balancing with respect to a variety of clothing accessories which may be carried or stored on the support rack . specifically , the central portion 34 of the lower bar element 27 provides an elongated surface upon which such articles as wide scarfs and ties and the like may be selectively suspended while somewhat narrower ties and the like may be suspended from the upper support bar 26 . when utilizing only the upper support bar 26 and the central portion 34 of the lower support bar 27 , the loads are positioned so that the weight is directed to the left side of an axis defined along the central portion 21 of the hanger rod member 20 . this weight may be offset on the opposite side of the axis by suspending belts or chains and the like within the recessed portion 32 formed in the outer end portion 30 of the lower support bar 27 . in this manner , a balanced load may be suspended from each of the support members thereby insuring that the load carried by the extendable housing is equally distributed on either side thereof . as discussed above , the distance between the outer extreme of the u - shaped portion 28 between the upper and lower support bars and the outer end 33 of the lower support bar element is of a dimension w which is equal to or less than the overall width as taken between the outer edges 17 of the flanges of the main body section of the support housing . in addition , the intermediate u - shaped portion 28 functions to provide a restraining element for preventing the shifting of articles carried on the lower support bar element 27 to the left of the support elements as shown in fig2 . a modified form of support members 25 is shown in fig3 . in this embodiment , the innerconnecting portion 28 between the upper and lower support bars 26 and 27 is shown as being semi - circular in configuration so that the uppermost portion thereof shown at 37 is positioned above the upper support bar element 26 . in this manner , an upwardly tapered or inclined area 38 is formed integrally between the semi - circular portion 36 and the support rod element 26 . this upwardly inclined area 38 provides a positive restraint for preventing articles carried on the upper support rod 26 from being accidentally displaced outwardly with respect thereto . as opposed to the semi - circular configuration for the intermediate member , the support members 25 may be modified , as shown in fig4 by inclining the upper support bar element 26 . this incline is shown as being gradual from the outer or free end 29 thereof upwardly to the u - shaped connecting portion 28 . the slope of the upper bar 26 toward the central support rod 21 will have a tendency to urge articles carried thereon toward the central support rod thereby preventing their accidental displacement relative thereto as the article support rack is maneuvered relative to the housing 11 . a further embodiment of the invention is shown in fig5 wherein the article support members 25 are modified so that the upper support bar 26 has an outwardly extending portion 40 which overlies and is generally coextensive with the underlying outer end portion 30 of the lower support bar 27 . the outer extending portion 40 is integrally formed with the remaining portion of the support bar 26 and may include an upwardly extending outer end 42 for purposes of providing a barrier for preventing the accidental displacement of an article carried on the extended portion 40 of the upper support bar in a manner similar to that previously described with respect to the upwardly extending outer end 33 of the lower support bar element 27 . as with the prior embodiments , the intermediate portion 28 between the upper and lower support bars may be selectively configured as shown in fig3 or 4 so that articles carried on the inner portion of the upper support bar are also restrained from being accidentally displaced outwardly with respect thereto . another embodiment of the article support members of the present invention is shown in fig6 . in this embodiment of the invention , the outer end portion 30 of the lower support bar 27 has been modified by removing the u - shaped or recessed end portion 32 thereof and instead providing an upturned end portion as shown at 44 . with this configuration , there is greater planar supporting surface along the width of the article support bar 27 with the upturned end portion thereof providing an abutment surface for preventing the accidental lateral displacement of articles carried thereby . as with the prior embodiment , the intermediate u - shaped portion may be modified in shape as discussed above with respect to fig3 and 4 or further modified as shown in fig5 so as to make the upper support bar coextensive with the lower support bar . in the use of the article support racks of the present invention , the racks are mounted to the innermost telescoping member 14 of the telescoping housing 11 so as to be horizontally extendable therewith as the inner telescoping member is moved relative to the main support housing 12 . the shape of the article support members 25 is such as to insure a plurality of varying widths of clothing accessories may be carried by the upper and lower support bars . depending upon the modification of support members being utilized , either one or two articles may be suspended on the upper support bars 26 with such articles being positioned on either side of the central support rod 21 of the hanger member 20 . articles are securely retained and restricted from accidental displacement with respect to the upper support bars by providing upwardly inclined surfaces adjacent each end thereof as described above with respect to the several embodiments . the lower support bar can be utilized to support wider articles of clothing and simultaneously may be used to suspend chains or belts from the recessed areas 32 thereof . in this manner , a plurality of varying sizes and types of clothing and clothing accessories may be carried by each of the support members with the support members insuring that loads may be selectively balanced with respect to the telescoping housing in which the article support rack is mounted .	0
particular protecting groups contemplated for the terminal amino group on the above - defined modified peptide are carbobenzoxy ( z ), t - butoxycarbonyl ( t - boc ), tosyl or p - methoxybenzyloxycarbonyl . the term &# 34 ; lower &# 34 ; alkyl is intended to mean a straight or branched hydrocarbon chain having from 1 to 4 carbon atoms , such as methyl , ethyl , n - propyl , i - propyl , butyl , sec - butyl , or t - butyl . alkylene is intended to mean a straight hydrocarbon chain of 2 to 4 carbon atoms and , particularly , ethylene . wherein at least one [ ] represents a replacement for an amide bond by a group selected from ## str8 ## -- ch 2 -- nh --, -- ch 2 -- o --, -- ch 2 s --, -- ch 2 so --, -- ch 2 so 2 --, -- ch 2 ch 2 -- and -- ch ═ ch --, the other [ ] being -- co -- nh --; the terminal amino group may be unsubstituted or substituted as defined above , and the terminal carboxyl group may be a free acid , ester or amide as defined above . another modified peptide of the present invention is a compound of the formula wherein at least one [ ] represents a replacement for an amide bond by a group as defined above , the other [ ] being -- conh --; the terminal amino group may be unsubstituted or substituted as defined above , and the terminal carboxyl group may be a free acid , ester or amide as defined above . because of the amphoteric nature of the compounds of the invention and the existence of either a free carboxylic acid group or a free amino group , the modified peptides of the invention are useful in a neutral form , i . e ., amphoteric or zwitterionic where both a base and an acid group are present , a free acid form or a free base form or in the form of pharmaceutically acceptable salts thereof , both acid addition or base . appropriate pharmaceutically acceptable salts within the scope of the invention are those derived from mineral acids such as hydrochloric acid and sulfuric acid , and organic acids such as ethanesulfonic acid , benzenesulfonic acid , p - toluenesulfonic acid , and the like , giving the hydrochloride , sulfate , ethanesulfonate , benzenesulfonate , p - toluenesulfonate , and the like , respectively . the acid addition salts of said basic compounds are prepared either by dissolving the free base in aqueous or aqueous alcohol solution or other suitable solvents containing the appropriate acid and isolating the salt by evaporating the solution , or by reacting the free base and acid in an organic solvent , in which case the salt separates directly or can be obtained by concentration of the solution . appropriate pharmaceutically acceptable base salts are those derived from inorganic bases , metal cations , and organic bases , such as amines . metallic salts contemplated are , for example , sodium , potassium , magnesium , calcium , aluminium , zinc , iron , and the like . organic bases contemplated are positively charged ammonium ion and analogous ions of the formula : ## str9 ## wherein ra , rb , and rc , independently may be alkyl of from one to six carbon atoms , cycloalkyl of from about three to six carbon atoms , aryl , aralkyl of from about seven to about ten carbon atoms , hydroxyalkyl of from two to four carbon atoms , or monoarylhydroxyalkyl of from about 8 to about 15 carbon atoms . further , when taken together with the nitrogen atom to which they are attached , any two of ra , rb , and rc may form part of a 5 - membered or 6 - membered nitrogen heterocyclic aromatic or nonaromatic ring containing carbon or oxygen , said nitrogen heterocyclic rings being unsubstituted , monosubstituted or disubstituted with alkyl groups of from one to six carbon atoms . specific examples of organic amine cations contemplated as falling within the scope of the present invention include mono -, di -, and trimethylammonium , mono -, di -, and triethylammonium , mono -, di -, and tripropylammonium ( n - propyl and iso - propyl ), ethyldimethylammonium , benzylammonium , dibenzylammonium , benzyldimethylammonium , cyclohexylammonium , piperidinium , morpholinium , pyrrolidinium , 4 - ethylmorpholinium , 1 - isopropylpyrrolidinium , 1 , 4 - dimethylpiperazinium , 1 - n - butylpiperidininum , 2 - methylpiperidinium , 1 - ethyl - 2 - methylpiperidinium , mono -, di -, and triethanolammonium , ethyldiethanolammonium , n - butylmonoethanolammonium , tris ( hydroxymethyl ) methylammonium , phenylmonoethanolammonium , and the like . the modified peptides of the present invention possess one or more asymmetric carbon atoms and each center may exist in the r or s atom . the present invention contemplates all enantiomeric and epimeric forms as well as the appropriate mixtures thereof as falling within the scope of the invention . the present invention also includes novel compounds useful as intermediates in the manufacture of the modified tripeptides . novel dipeptides fall within the compounds of formula i and include : the modified peptides of the present invention may be prepared by a variety of methods known in the peptide field . several alternative approaches are described and illustrated below . these approaches are not intended to be exhaustive . thus , for example , the following flow chart illustrates the preparation of certain modified peptides of the instant invention . ## str10 ## ( s )- 2 -( 2 - methylpropyl )- aziridine ( 1 ), prepared as described in bulletin of the chemical society of japan , 35 , 1004 - 10 ( 1962 ), is reacted with hydrogen sulfide at - 78 ° c . in ethanol to give ( s )- 2 - amino - 4 - methyl - 1 - pentanethiol ( 2 ) which is then reacted with tertiary - butylbromoacetate in liquid ammonia to give compound ( 3 ). compound ( 3 ) may be condensed with an amino acid as defined above , 2 - nicotinic acid or 5 - methyl - 2 - thiophenecarboxylic acid in the presence of a condensation promoting agent , such as n , n - dicyclohexylcarbodiimide or with a reactive derivative of any of the above acids , such as their corresponding acid halides , e . g ., chlorides or bromides , or anhydrides . the tertiary butyl ester group in the resulting compound ( 4 ) may then be removed by treatment with trifluoroacetic acid . if resulting compound ( 5 ) contains further amino protecting groups , they may be removed by methods known in the art , such as hydrolysis or hydrogenolysis . compound ( 5 ) as a free acid may be further converted by methods known per se to corresponding esters and amides as defined above . a second method for preparing certain modified peptides of the instant invention is illustrated in flow chart b . ## str11 ## ( s )- 2 -( 2 - methylpropyl )- aziridine ( 1 ) is protected by a benzyloxycarbonyl group , then reacted with glycine t - butyl ester at reflux temperatures in absolute ethanol to yield products ( 7 ) and ( 8 ) which are separated by crystallization techniques or column chromatography . hydrogenolysis of compound ( 7 ) with hydrogen in the presence of palladium on carbon removes the benzyloxycarbonyl group . resulting compound ( 9 ) may be condensed with any amino acid above defined , 2 - nicotinic or 5 - methyl - 2 - thiophenecarboxylic acid or reactive derivatives thereof in a manner described above . the resulting free acids ( 13 ) may also be converted to esters or amides after removal of the tertiary - butoxycarbonyl group with trifluoroacetic acid . hydrogenolysis of compound ( 8 ) as described above affords a ring - closed compound ( 10 ) which may be condensed with the acids already described in like manner to produce the desired products ( 12 ) of the instant invention . certain modified peptides of the instant invention may be prepared by a third method comprising reacting an alcohol derived from an amino acid as defined above with an α - haloacetyl halide , preferably bromo or chloro , or an α - haloalkanoyl halide , wherein said alkyl is derived from the side chain of an α - aminoalkanoic acid , e . g ., leucine , in the presence of sodium acetate . the resulting amide containing both a hydroxyl group and halo atom may be ring - closed with sodium hydride to form a 3 - morpholinone derivative which , in turn , may be ring opened by acid hydrolysis , e . g . aqueous hydrochloric acid , to form a modified dipeptide hydrochloride which sole amino group may be protected by , for example , a carbobenzyloxy group and further condensed with an amino acid , e . g . glycine , in the presence of dicyclohexylcarbodiimide and 1 - hydroxybenztriazole . the following flow chart c illustrates this approach by way of example in preparing pro -[ ch 2 o ]- leu - gly . ## str12 ## a fifth method for the preparation of certain modified peptides of the instant invention comprises first the preparation of a dipeptide containing any two of the amino acids defined above according to known methods ; removing any blocking group on the terminal amino group and condensing the dipeptide with an aldehyde derived from a third amino acid , 2 - nicotinoic acid or 5 - methyl - 2 - thiophene carboxylic acid . the resulting schiff base is reduced with sodium cyanoborohydride . a sixth method for the preparation of certain modified peptides of the instant invention comprises reacting an alcohol derived from an amino acid whose amino group is protected , 2 - nicotinoic acid or 5 - methyl - 2 - thiophenecarboxylic acid with thioacetic acid in the presence of triphenylphosphine and diisopropyl azodicarboxylate to form the corresponding mercapto acetate which is treated with hydrazine hydrate to produce the mercaptan . the mercaptan is reacted with an α - halo , preferably bromo , acetic acid or an α - halocarboxylic acid derived from an amino acid such as , for example , lysine or leucine , in the presence of sodium hydride . removal of the amino protecting groups affords the desired product . a seventh method for preparing certain modified peptides containing -- ch ═ ch -- as the isostere comprises first the condensation of an amino blocked aldehyde of an amino acid with the ylide , 1 - trimethylsilylpropyne - 3 - triphenylphosphonium bromide in the presence of a base such as an alkyllithium compound or sodium hexamethyldisilazide . the resulting product is treated with a borane complex made from cyclohexene and diborane , then hydrolyzed with base and hydrogen peroxide to give the product of the formula wherein a is the residue of an α - amino acid bonded to the carbon which comprised the aldehyde group of the starting aldehyde of the amino acid used . this acid is then converted to an amide by known means , and , if desired , deblocking the amino acid end of the product for further coupling with other amino acids . the following flow chart d illustrates this series of reactions by way of example in preparing z - pro - leu -[ ch ═ ch ]- gly . ## str13 ## the modified peptides in accordance with this invention are effective in treating senility , in enhancing memory , or of reversing the effects of electroconvulsive shock - induced amnesia . the effectiveness of these compounds is determined by the test designed to show the compound &# 39 ; s ability to reverse amnesia produced by electroconvulsive shock . the test is more fully described in u . s . pat . no . 4 , 145 , 347 , issued mar . 20 , 1979 , the disclosure of which is herein incorporated by reference . the only deviation in the present instance is that the compounds tested are administered orally , and the duration of the electroconvulsive shock administered is 1 . 0 seconds . employing this test , the following criteria are used in interpreting the percent of amnesia reversal scores : 40 percent or more amnesia reversal ( active = a ), 25 to 39 percent amnesia reversal ( borderline activity = c ), and 0 to 25 percent amnesia reversal ( inactive = n ). the table below illustrates amnesia reversal of hexahydro - 3 , 5 - dioxo - 1h - pyrrolizine - 2 - carboxylic acid ethyl ester when administered to standard experimental laboratory animals in the above referenced test . table__________________________________________________________________________ dose dose ( mg / kg ) % amnesia ( mg / kg ) % amnesiacompound im reversal rats im po reversal mice__________________________________________________________________________zproleu [ ch . sub . 2 s ] gly 0 . 100 14 ( n ) 10 . 0 69 ( a ) 0 . 010 57 ( a ) 1 . 0 77 ( a ) 0 . 001 57 ( n ) 0 . 1 69 ( a ) zprophe [ ch . sub . 2 o ] glynh . sub . 2 0 . 100 0 ( n ) 100 71 ( a ) 0 . 010 0 ( n ) 10 59 ( a ) 0 . 001 11 ( n ) 1 20 ( n ) zpro [ ch . sub . 2 nh ] leuglynh . sub . 2 0 . 100 0 ( n ) 100 57 ( a ) 0 . 010 0 ( n ) 10 67 ( a ) 0 . 001 11 ( n ) 1 85 ( a ) ## str14 ## 10 . 0 1 . 0 0 . 1 29 ( c ) 90 ( a ) 82 ( a ) z4 - keto proleu [ ch . sub . 2 s ] gly 0 . 100 83 ( a ) 0 . 010 50 ( a ) 0 . 001 17 ( n ) z3 - ketoproleu [ ch . sub . 2 s ] gly 0 . 100 0 ( n ) 0 . 010 0 ( n ) 0 . 001 33 ( c ) zproleu [ ch . sub . 2 nh ] glynh . sub . 2 0 . 100 43 ( a ) 0 . 010 43 ( a ) 0 . 001 43 ( a ) ## str15 ## 0 . 100 0 . 010 0 . 001 60 ( a ) 0 ( n ) 40 ( a ) or ## str16 ## ## str17 ## 0 . 100 0 . 010 0 . 001 50 ( a ) 17 ( n ) 17 ( n ) tospro [ ch . sub . 2 nh ] dleuglynh . sub . 2 0 . 100 34 ( c ) 0 . 010 0 ( n ) 0 . 001 0 ( n ) __________________________________________________________________________ for preparing pharmaceutical compositions from the compounds described by this invention , inert , pharmaceutically acceptable carriers can be either solid or liquid . solid form preparations include powders , tablets , dispersible granules , capsules , cachets , and suppositories . a solid carrier can be one or more substances which may also act as diluents , flavoring agents , solubilizers , lubricants , suspending agents , binders or tablet disintegrating agents ; it can also be encapsulating material . in powders , the carrier is a finely divided solid which is in admixture with the finely divided active compound . in the tablet the active compound is mixed with carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired . the powders and tablets preferably contain from 5 to 10 to about 70 percent of the active ingredient . suitable solid carriers are magnesium carbonate , magnesium stearate , talc , sugar , lactose , pectin , dextrin , starch , gelatin , tragacanth , methylcellulose , sodium carboxymethylcellulose , a low melting wax , cocoa butter , and the like . the term &# 34 ; preparation &# 34 ; is intended to include the formulation of the active compound with encapsulating material as carrier providing a capsule in which the active ( with or without other carriers ) is surrounded by carrier , which is thus in association with it . similarly , cachets are included . tablets , powders , cachets , and capsules can be used as solid dosage forms suitable for oral administration . for preparing suppositories , a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted , and the active ingredient is dispersed homogeneously therein as by stirring . the molten homogeneous mixture is then poured into convenient sized molds , allowed to cool and thereby to solidify . liquid form preparations include solutions , suspensions , and emulsions . as an example may be mentioned water or water propylene glycol solutions for parenteral injection . liquid preparations can also be formulated in solution in aqueous polyethylene glycol solution . aqueous solutions suitable for oral use can be prepared by dissolving the active component in water and adding suitable colorants , flavors , stabilizing and thickening agents as desired . aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material , i . e ., natural or synthetic gums , resins , methylcellulose , sodium carboxymethylcellulose , and other well - known suspending agents . also included are solid form preparations which are intended to be converted , shortly before use , to liquid form preparations for either oral or parenteral administration . such liquid forms include solutions , suspensions , and emulsions . these particular solid form preparations are most conveniently provided in unit dose form and as such are used to provide a single liquid dosage unit . alternatively , sufficient solid may be provided so that after conversion to liquid form , multiple individual liquid doses may be obtained by measuring predetermined volumes of the liquid form preparation as with a syringe , teaspoon , or other volumetric container . when multiple liquid doses are so prepared , it is preferred to maintain the unused portion of said liquid doses at low temperature ( i . e ., under refrigeration ) in order to retard possible decomposition . the solid form preparations intended to be converted to liquid form may contain , in addition to the active material , flavorants , colorants , stabilizers , buffers , artificial and natural sweeteners , dispersants , thickeners , solubilizing agents , and the like . the liquid utilized for preparing the liquid form preparation may be water , isotonic water , ethanol , glycerine , propylene glycol , and the like as well as mixtures thereof . naturally , the liquid utilized will be chosen with regard to the route of administration , for example , liquid preparations containing large amounts of ethanol are not suitable for parenteral use . preferably , the pharmaceutical preparation is in unit dosage form . in such form , the preparation is subdivided into unit doses containing appropriate quantities of the active component . the unit dosage form can be a packaged preparation , the package containing discrete quantities of preparation , for example , packeted tablets , capsules , and powders in vials or ampoules . the unit dosage form can also be a capsule , cachet , or tablet itself or it can be the appropriate number of any of these in packaged form . the quantity of active compound in a unit dose of preparation may be varied or adjusted from 1 mg to 500 mg preferably to 5 to 100 mg according to the particular application and the potency of the active ingredient . the compositions can , if desired , also contain other compatible therapeutic agents . in therapeutic use as cognition activators , the mammalian dosage range for a 70 kg subject is from 1 to 1500 mg / kg of body weight per day or preferably 25 to 70 mg / kg of body weight per day . the dosages , however , may be varied depending upon the requirements of the patient , the severity of the condition being treated , and the compound being employed . determination of the proper dosage for a particular situation is within the skill of the art . generally , treatment is initiated with smaller dosages which are less than the optimum dose of the compound . thereafter the dosage is increased by small increments until the optimum effect under the circumstances is reached . for convenience , the total daily dosage may be divided and administered in portions during the day if desired . to enable one skilled in the art to practice the present invention , the following illustrative examples are provided . these examples should not be viewed , however , as limiting the scope of the present invention as defined by the appended claims , but as merely illustrative thereof . 8 . 99 g ( 0 . 09 mol ) of ( s )- 2 -( 2 - methylpropyl ) aziridine ( bulletin of the chemical society of japan , vol . 35 , pages 1004 - 1010 , 1962 ) is added in small portions to a solution of 27 g ( 0 . 79 mol ) hydrogen sulfide in 100 ml absolute ethanol at - 78 ° c . the solution is stirred as it slowly warms to room temperature . the solvent is removed on the rotary evaporator to give a light yellow liquid which crystallizes . the solid is chromatographed on 230 - 400 mesh silica gel , eluting with dichloromethane followed by 3 % methanol in dichloromethane . one obtains 6 . 63 g of ( s )- 2 - amino - 4 - methyl - 1 - pentanethiol ; [ α ] d 25 + 35 . 5 ° ( c 1 . 02 , methanol ). anal . calcd for c 6 h 15 ns : c , 54 . 08 ; h , 11 . 35 , n , 10 . 51 ; s . 24 . 06 . found : c , 53 . 77 ; h , 11 . 20 ; n , 10 . 32 ; s , 24 . 20 . 2 . 66 g ( 0 . 20 mol ) of ( s )- 2 -( 2 - amino - 4 - methyl - 1 - pentanethiol is added to 200 ml liquid ammonia . 3 . 95 g ( 0 . 20 mol ) tertiary butyl bromo acetate is added in portions and the solution is stirred until most of the liquid ammonia has evaporated . water is added to the reaction mixture and is then extracted with ether . the ether layer is dried over magnesium sulfate , filtered , and concentrated to a liquid . the liquid is chromatographed on 230 - 400 mesh silica gel , eluting with dichloromethane followed by 2 % methanol in dichloromethane . one obtains 2 . 11 g of ( s )- 1 , 1 - dimethylethyl [( 2 - amino - 4 - methylpentyl ) thio ]- acetate ; [ α ] d 25 + 46 . 7 ° ( c 0 . 95 , methanol ). anal . calcd for c 12 h 25 no 2 s : c , 58 . 26 ; h , 10 . 19 ; n , 5 . 66 ; s , 12 . 96 . found : c , 58 . 05 ; h , 9 . 85 ; n , 5 . 55 ; s , 12 . 85 . 7 . 51 g ( 0 . 03 mol ) of ( s )- 1 , 1 - dimethylethyl ester , [( 2 - amino - 4 - methylpentyl ) thio ]- acetic acid , 7 . 61 g ( 0 . 03 mol ) carbobenzyloxy - l - proline , and 4 . 08 g ( 0 . 03 mol ) 1 - hydroxybenzotriazole are dissolved in 100 ml dichloromethane . the solution is cooled to 0 ° c . and 6 . 34 g ( 0 . 03 mol ) of n , n - dicyclohexylcarbodiimide is added all at once . the reaction is kept at 0 ° c . for three days . the reaction mixture is filtered and the filtrate concentrated on a rotary evaporator . the residue is dissolved in ether , washed with 10 % aqueous citric acid solution . the ether solution is dried over magnesium sulfate , filtered , and concentrated to a white solid . the solid is chromatographed on 230 - 400 mesh silica gel , eluting with dichloromethane followed by 3 % methanol in dichloromethane . one obtains 10 . 99 g of [ s -( r , r )]- phenylmethyl - 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ; [ α ] d 25 - 11 . 6 ° ( c 1 . 21 , methanol ). anal . calcd for c 25 h 38 n 2 o 5 s : c , 62 . 73 ; h , 8 . 00 ; n , 5 . 85 , s , 6 . 70 . found : c , 63 . 01 ; h , 7 . 79 ; n , 5 . 84 ; s , 6 . 91 . to 10 ml of trifluoroacetic acid at 0 ° c . is added 1 . 80 g ( 0 . 004 mol ) of [ s -( r , r )]- phenylmethyl2 -[[[ 1 -[[[ 2 -( 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidine carboxylate . the reaction mixture is allowed to slowly warm to room temperature . the trifluoroacetic acid is removed on the rotary evaporator at 50 ° c . ether is thrice added to the residue and stripped off each time . the residual oil is chromatographed on 230 - 400 mesh silica gel , eluting with dichloromethane followed by 2 % methanol in dichloromethane . one obtains 0 . 92 g of [ 2s -( r , r )- phenylmethyl2 -[[[ 1 -[[( carboxymethyl ) thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ; [ α ] d 25 - 18 . 0 ° ( c 0 . 92 , methanol ). anal . calcd for c 21 h 30 n 2 o 5 s . 1 / 10ch 2 cl 2 : c , 58 . 80 ; h , 7 . 06 ; n , 6 . 50 ; s , 7 . 44 . found : c , 58 . 83 ; h , 7 . 07 ; n , 6 . 40 ; s , 7 . 71 . [ s -( r , r )]- phenylmethyl 2 -[[[ 1 -[[( 2 - amino - 2 - oxoethyl ) thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate [ 4 . 59 g ( 0 . 010 mol ) of [ 2s - r , r )]- phenylmethyl 2 -[[[ 1 -[[( carboxymethyl ) thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate is dissolved in 100 ml dichloromethane and the solution is cooled to - 5 ° c . 0 . 99 g of methylchloroformate ( 0 . 010 mol ) is added and the solution stirred for ten minutes . then 1 . 10 g ( 0 . 01 mol ) triethylamine is added and the solution cooled to - 15 ° c . ammonia gas is bubbled into the solution for one hour . the solution is then kept at room temperature for three days . the reaction mixture is filtered , the filtrate washed with saturated aqueous sodium hydrogen carbonate solution and 10 % aqueous citric acid solution . the organic layer is dried over magnesium sulfate , filtered , and concentrated to a clear oil . the oil is chromatographed on 230 - 400 mesh silica gel , using dichloromethane followed by 2 % methanol in dichloromethane as eluant . one obtains 0 . 92 g [ s -( r , r )]- phenylmethyl 2 -[[[ 1 -[[( 2 - amino - 2 - oxoethyl ) thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ; [ α ] d 25 - 30 . 3 ° ( c 1 . 12 , methanol ). anal . calcd for c 21 h 3 , n 3 o 4 s . 1 / 2h 2 o : c , 58 . 58 ; h , 7 . 49 ; n , 9 . 76 ; s , 7 . 45 . found : c , 58 . 72 ; h , 7 . 60 ; n , 9 . 67 ; s , 7 . 73 . 4 . 70 g ( 0 . 019 mol ) of ( s )- 1 , 1 - dimethylethyl [( 2 - amino - 4 - methylpentyl ) thio ] acetate , 5 . 0 g ( 0 . 019 mol ) ( 5 )- 1 - phenyl methyl - 4 - oxo - 1 , 2 - pyrrolidinedicarboxylate , 2 . 57 g ( 0 . 019 mol ) 1 - hydroxybenzotriazole , and 3 . 93 g ( 0 . 019 mol ) n , n - dicyclohexylcarbodiimide are reacted according to the procedure for example 3 to give 3 . 49 g of [ s -( r , r )]- phenylmethyl 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 ]- oxoethyl ] thio ] methylbutyl ] amino ] carbonyl ]- 4 - oxo - 1 - pyrrolidine carboxylate as a white solid , mp 89 °- 91 °. [ α ] d 25 + 33 . 2 ° ( c 1 . 06 , methanol ). anal . calcd for c 25 h 36 n 2 o 6 s : c , 60 . 95 ; h , 7 . 37 ; n , 5 . 69 ; s , 6 . 51 . found : c , 60 . 99 ; h , 7 . 28 ; n , 5 . 66 ; s , 6 . 79 . 4 . 84 g ( 0 . 01 mol ) [ s -( r , r )]- phenylmethyl 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 4 - oxo - 1 - pyrrolidinecarboxylate and 40 ml trifluoroacetic acid are reacted according to the procedure for example 4 to give 0 . 82 g of [ s -( r , r )]- phenylmethyl 2 -[[[ 1 -[[( carboxymethyl ) thio ] methyl ]- 3 - methylbutyl ] amino ] carboxymethyl ) thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 4 - oxo - 1 - pyrrolidinecarboxylate as a foam . [ α ] d 25 - 32 . 5 ° ( c 1 . 02 , methanol ). anal . calcd for c 21 h 28 n 2 o 6 s : c , 67 . 13 ; h , 6 . 12 ; n , 3 . 40 ; s , 7 . 79 . found : c , 66 . 83 ; h , 5 . 95 ; n , 3 . 33 ; s , 8 . 07 . 3 . 00 g ( 0 . 012 mol ) of ( s )- 1 , 1 - dimethylethyl [( 2 - amino - 4 - methylpentyl ) thio ] acetate , 172 g ( 0 . 012 mol ) 5 - methyl - 2 - thiophene carboxylic acid , 1 . 64 g ( 0 . 012 mol ) 1 - hydroxybenzotriazole , and 2 . 50 g ( 0 . 012 mol ) n , n - dicyclohexylcarbodiimide are reacted according to the procedure for example 3 to give 0 . 64 g of ( s )- 1 , 1 - dimethylethyl [[ 4 - methyl - 2 -[[[ 5 - methyl - 2 - thienyl ] carbonyl ] amino ] pentyl ] thio ] acetate as a crystalline solid , mp 81 °- 83 °; [ α ] d 25 + 56 . 5 ° ( c 0 . 63 , methanol ). anal . calcd for c 18 h 29 no 3 s 2 : c , 58 . 19 ; h , 7 . 87 ; n , 3 . 77 ; s , 17 . 26 . found : c , 58 . 31 ; h , 7 . 81 ; n , 3 . 76 ; s , 17 . 31 . 1 . 83 g ( 0 . 005 mol ) ( s )- 1 , 1 - dimethylethyl [[ 4 - methyl - 2 -[[[ 5 - methyl - 2 - thienyl ] carbonyl ] amino ] pentyl ] thio ] acetate and 10 ml trifluoroacetic acid are reacted according to the procedure for example 4 to give 0 . 75 g of ( s )-[[ 4 - methyl - 2 -[[( 5 - methyl - 2 - thienyl ) carbonyl ] amino ] pentyl ] thio ]- acetic acid as a viscous oil . [ α ] d 25 + 57 . 3 ° ( c 0 . 52 , methanol ). anal . calcd for c 14 h 21 no 3 s 2 : c , 53 . 31 ; h , 6 . 71 ; n , 4 . 44 ; s , 20 . 33 . found : c , 53 . 55 ; h , 6 . 81 ; n , 4 . 28 ; s , 20 . 03 . 2 . 21 g ( 0 . 009 mol ) of ( s )- 1 , 1 - dimethylethyl [( 2 - amino - 4 - methylpentyl ) thio ] acetate , 2 . 34 g ( 0 . 008 mol ) n - carbobenzoxy - l - pyroglutamic acid , 1 . 22 g ( 0 . 008 mol ) 1 - hydroxybenzotriazole , and 1 . 85 g ( 0 . 009 mol ) n , n - dicyclohexylcarbodiimide are reacted according to the procedure for example 3 to give 2 . 14 g of [ s -( r , r )]- phenylmethyl 5 - oxo -[ 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] thio ] methyl ]- 3 - methyl ] butyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate as a white solid . [ α ] d 25 + 13 . 0 ° ( c 1 . 06 , methanol ) anal . calcd for c 25 h 36 n 2 o 6 s : c , 60 . 95 ; h , 7 . 37 ; n , 5 . 69 ; s , 6 . 51 . found : c , 61 . 07 ; h , 7 . 62 ; n , 5 . 58 ; s , 6 . 57 . 5 . 0 g ( 0 . 020 mol ) of ( s )- 1 , 1 - dimethyl [( 2 - amino - 4 - methylpentyl ) thio ] acetate , 2 . 86 g ( 0 . 022 mol ) l - pyroglutamic acid , 3 . 00 g ( 0 . 022 mol ) 1 - hydroxybenzotriazole , and 4 . 56 g ( 0 . 022 mol ) n , n - dicyclohexylcarbodiimide are reacted according to the procedure for example 3 to give 1 . 24 g of [ s -( r , r )]- 1 , 1 - dimethylethyl [[ 4 - methyl - 2 -[[( 5 - oxo - 2 - pyrrolidinyl ) carbonyl ] amino ] pentyl ] thio ] acetate as a light yellow oil . anal . calcd for c 17 h 30 n 2 o 4 s : c , 56 . 96 ; h , 8 . 43 ; n , 7 . 81 ; s , 8 . 94 . found : c , 57 . 02 ; h , 8 . 44 ; n , 7 . 68 ; s , 8 . 90 . 1 . 81 g ( 0 . 0037 mol ) of [ s ,( r , r )]- phenyl methyl - 5 - oxo -[ 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] thio ] methyl ]- 3 - methyl ] butyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate and 10 ml trifluoroacetic acid are reacted according to the procedure for example 4 to give 0 . 19 g of [ s -( r , r )]- phenylmethyl 5 - oxo - 2 -[[[- 1 -[[( carboxymethyl ) thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate as a white solid [ α ] d 25 - 0 . 26 ° ( c 0 . 54 , methanol ). anal . calcd for c 21 h 28 n 2 o 6 s : c , 57 . 78 ; h , 6 . 46 ; n , 6 . 42 ; s , 7 . 34 . found : c , 57 . 57 ; h , 6 . 40 ; n , 6 . 31 ; s , 7 . 38 . 3 . 00 g ( 0 . 012 mol ) of ( s )- 1 , 1 - dimethylethyl [( 2 - amino - 4 - methylpentyl ) thio ] acetate , 1 . 51 g ( 0 . 012 mol ) 2 - picolinic acid , 1 . 64 g ( 0 . 012 mol ) 1 - hydroxybenzotriazole , and 2 . 50 g ( 0 . 012 mol ) n , n - dicyclohexylcarbodiimide are reacted according to the procedure for example 3 to give 0 . 37 g of ( s )- 1 , 1 - dimethylethyl -[[ 4 - methyl - 2 -[( 2 - pyriidinylcarbonyl ) amino ] pentyl ] thio ] acetate as a clear oil . [ α ] d 25 + 57 . 9 ° ( c 0 . 57 , methanol ). anal . calcd for c 18 h 28 n 2 o 3 s : c , 61 . 33 , h , 8 . 01 ; n , 7 . 95 ; s , 9 . 10 . found : c , 61 . 65 ; h , 7 . 90 ; n , 7 . 86 ; s , 9 . 32 . 1 . 68 g ( 0 . 0048 mol ) ( s )- 1 , 1 - dimethylethyl -[[ 4 - methyl - 2 -[( 2 - pyridinylcarbonyl ) amino ] pentyl ] thio ] acetate and 10 ml trifluoroacetic acid are reated two days at room temperature . the trifluoroacetic acid is removed on the rotary evaporator , the residue dissolved in ether , and extracted into 10 % aqueous sodium carbonate solution , which is washed with ether . the aqueous solution is made acidic with solid citric acid and is then extracted with methylene chloride . the organic layer is dried over magnesium sulfate , filtered , and concentrated to an oil . the oil is dissolved in ether and hydrogen chloride gas in ether is added . 1 . 27 g of ( s )-[[ 4 - methyl - 2 -[( 2 - pyridinylcarbonyl ) amino ] pentyl ] thio ] acetate monohydrochloride is obtained . [ α ] d 25 + 48 . 3 ° ( c 0 . 60 , methanol ). anal . calcd for c 14 h 20 n 2 o 3 s . hcl . 1 / 5h 2 o : c , 49 . 97 ; h , 6 . 41 ; n , 8 . 32 ; s , 9 . 52 . found : c , 50 . 05 ; h , 6 . 55 ; n , 7 . 94 ; s , 9 . 30 . 2 . 54 g ( 0 . 0053 mol ) of [ s -( r , r )]- phenylmethyl 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] thio ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- pyrrolidinecarboxylate is mixed with 60 ml chloroform and 1 . 15 g ( 0 . 0067 mol ) m - chloroperoxybenzoic acid at room temperature . the solution is refluxed for one hour and 1 . 15 g ( 0 . 0067 mol ) more m - chloroperoxybenzoic acid is added and the solution is refluxed overnight . then 1 . 15 g ( 0 . 0067 mol ) more m - chloroperoxybenzoic acid is added and the solution is refluxed three hours . the cooled chloroform solution is washed with 10 % aqueous sodium carbonate , dried over magnesium sulfate , filtered and stripped to a white solid . the solid is chromatographed on 230 - 400 mesh silica gel using dichloromethane , then 2 % methanol in dichloroomethane as eluant . one obtains 1 . 97 g of [ s -( r , r )]- phenylmethyl 2 -[[[- 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] sulfonyl ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate as a white solid . [ α ] d 25 - 38 . 3 ° ( c 1 . 09 , methanol ). anal . calcd for c 25 h 38 n 2 o 7 s : c , 58 . 80 , h , 7 . 50 ; n , 5 . 47 ; s , 6 . 28 . found : c , 58 . 89 ; h , 7 . 24 ; n , 5 . 44 ; s , 6 . 55 . 1 . 97 g ( 0 . 0039 mol ) [ s ,( r , r )]- phenylmethyl 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] sulfonyl ] methyl ]- 3 - methylbutyl ]- amino ] carbonyl ]- 1 - pyrrolidinecarboxylate is dissolved in 75 ml dichloromethane and 10 ml trifluoroacetic acid is added and the solution stirred overnight at room temperature . the solution is concentrated on the rotary evaporator and the residue chromatographed on 230 - 400 mesh silica gel using dichloromethane followed by 2 % methanol in dichloromethane as eluent . one obtains 0 . 93 g of [ s ,( r , r )]- 2 -[[[ 1 -[[( carboxymethyl ) sulfonyl ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate as a white solid . anal . calcd for c 21 h 30 n 2 o 7 s : c , 55 . 49 ; h , 6 . 65 ; n , 6 . 16 ; s , 7 . 05 . found : c , 55 . 65 ; h , 6 . 58 ; n , 5 . 89 ; s , 7 . 31 . 5 . 0 g ( 0 . 020 mol ) ( s )- 1 , 1 - dimethylethyl [( 2 - amino - 4 - methylpentyl ) thio ] acetate , 5 . 52 g ( 0 . 022 mol ) 1 -( 4 - methoxybenzoyl )- l - proline , 3 . 00 g ( 0 . 022 mol ) 1 - hydroxybenzotriazole , and 4 . 56 g ( 0 . 022 mol ) n , n - dicyclohexycarbodiimide are reacted according to the procedure for example 3 to give 3 . 48 g of [ s -( r , r )]- 1 , 1 - dimethylethyl [[ 2 -[[[ 1 - 4 - methoxybenzoyl )- 2 - pyrrolidinyl ] carbonyl ] amino ]- 4 - methylpentyl ] thio ] acetate as a white solid , mp 117 °- 121 ° [ α ] d 25 - 30 . 0 ° ( c 1 . 14 , methanol ). anal . calcd for c 25 h 38 n 2 o 5 s : c , 62 . 73 ; h , 8 . 00 ; n , 5 . 85 ; s , 6 . 70 . found : c , 62 . 97 ; h , 7 . 93 ; n , 5 . 66 ; s , 6 . 51 . 4 . 43 g ( 0 . 0093 mol ) [ s -( r , r )]- 1 , 1 , dimethyl ethyl -[[ 2 -[[[ 1 -( 4 - methoxybenzoyl )- 2 - pyrrolidinyl ] carbonyl ] amino ]- 4 - methylpentyl ] thio ] acetate and 18 ml trifluoroacetic acid are reacted according to the procedure for example 4 to give 3 . 19 g of [ s -( r , r )]-[[ 2 -[[[ 1 -( 4 - methoxybenzoyl )- 2 - pyrrolidinyl ] carbonyl ] amine ]- 4 - methoxypentyl ] thio ] acetate as a white foam [ α ] d 25 - 38 . 1 ° ( c 0 . 54 , methanol ). anal . calcd for c 21 h 30 n 2 o 5 s : c , 59 . 69 ; h , 7 . 16 ; n , 6 . 63 ; s , 7 . 59 . found : c , 59 . 42 ; h , 6 . 93 ; n , 6 . 96 ; s , 7 . 83 . a solution of 24 . 3 g of ( s )- 2 -( 2 - methylpropyl ) aziridine [ bull . chem . soc . ( japan ) 35 , 1004 ( 1962 ).] in 500 ml of ether is treated with 34 . 2 ml of triethylamine and cooled in ice . while stirring rapidly 40 . 4 ml ( a 10 % excess ) of benzyl chloroformate is added dropwise over a 30 minute period . after stirring for one hour at 0 °, the triethylamine , hydrochloride is filtered off and the ether removed under reduced pressure . the residue is distilled under reduced pressure . after a forerun of benzyl chloride , the product distills at 105 °- 122 °/ 0 . 6 mm . there is obtained 51 . 66 g ( 90 . 5 % yield ) of ( s )- 2 -( 2 - methylpropyl )- 1 - aziridinecarboxylic acid , phenylmethyl ester . a refluxing solution of 15 . 1 g ( a 10 % excess ) of glycine t - butyl ester in 200 ml of absolute ethanol is treated dropwise over one hour with a solution of 24 . 2 g of ( s )- 2 -( 2 - methylpropyl )- 1 - aziridinecarboxylic acid , phenylmethyl ester in 50 ml of absolute ethanol . the refluxing is continued over two nights . the solvent is removed under reduced pressure and the residue chromatographed on 1 . 5 kg of silica gel , eluting with chloroform / ethylacetate ( 3 : 1 ). combining the fractions containing the faster eluting compound gives 14 . 3 g of an oil which crystallizes on standing . a small example , recrystallized from hexane has mp 107 °- 108 °, [ α ] d 23 - 16 . 3 ° ( c 1 . 03 , methanol ). spectral and elemental analysis shows this to be [ s -( r , r )]- n , n - bis [ 4 - methyl - 2 -[[( phenylmethoxy ) carbonyl ] amino ] pentyl ] glycine , 1 , 1 - dimethylethyl ester . combining the fractions containing the slower eluting compounds gives 17 . 6 g of an oil which crystallizes on standing , mp 50 °- 52 °, [ α ] d 23 - 10 . 0 ° ( c 1 . 0 , methanol ). spectral and elemental analysis shows this to be ( s )- n -[ 4 - methyl - 2 -[[( phenylmethoxy ) carbonyl ] amino ] pentyl ] glycine , 1 , 1 - dimethylethyl ester . a solution of 17 . 43 g of ( s )- n -[ 4 - methyl - 2 -[[( phenylmethoxy ) carbonyl ] amino ] pentyl ] glycine , 1 , 1 - dimethylethyl ester in 150 ml of methanol is reduced at 25 °, 50 psi using 1 g of 20 % palladium on carbon as the catalyst . the filtered solution is treated with 7 . 84 g of phosphorous acid in 10 ml of ether and the solvent removed under reduced pressure . the residue is partitioned between ether and 10 % sodium hydroxide . the aqueous phase is washed five times with ether and the combined ether washes are washed with saturated sodium chloride solution and dried over magnesium sulfate . removal of the solvent under reduced pressure at 25 ° gives 10 . 28 g of crude ( s )- n -( 2 - amino - 4 - methylpentyl )- glycine , 1 , 1 - dimethylethyl ester . the crude product is sufficiently pure for use in subsequent reactions . a solution of 1 . 34 g of ( s )- n -( 2 - amino - 4 - methylpentyl ) glycine , 1 , 1 - dimethylethyl ester , 1 . 45 g of z - proline , and 786 mg of hydroxybenzotriazole hydrate in 40 ml of tetrahydrofuran is cooled in ice and treated dropwise with a solution of 1 . 21 g of n , n &# 39 ;- dicyclohexylcarbodiimide in 10 ml of tetrahydrofuran . after one hour at 0 °, the solution is allowed to stir at room temperature overnight . the solution is then filtered and the filtrate concentrated under reduced pressure . the residue is taken up in ethyl acetate , washed two times with saturated sodium bicarbonate , then with saturated sodium chloride . after drying over magnesium sulfate , the solvent is removed under reduced pressure . the residue is chromatographed on 145 g of silica gel , eluting with chloroform / methanol , ( 98 : 2 ). combining the appropriate fraction and removing the solvent under reduced pressure gives 1 . 77 g of [ s -( r , r )]- 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] amino ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylic acid , phenylmethyl ester . to 50 ml of methanol , saturated with hydrogen chloride gas is added 1 . 77 g of [ s -( r , r )]- 2 -[[[ 1 -[[[- 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] amino ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylic acid , phenylmethyl ester in 10 ml of methanol . after standing at room temperature for four hours , the solution is kept at 0 ° overnight . the solvent is then removed under reduced pressure and the residue taken up in ethyl acetate . the ethyl acetate solution is washed two times with saturated sodium bicarbonate solution , once with saturated sodium chloride solution , and then dried over magnesium sulfate . removal of the solvent under reduced pressure gives 1 . 14 g of [ s -( r , r )]- 2 -[[[ 1 -[[( 2 - methoxy - 2 - oxoethyl ) amino ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylic acid , phenylmethyl ester . a solution of 2 . 4 g of [ s -( r , r )]- 2 -[[[ 1 -[[( 2 - methoxy - 2 - oxoethyl ) amino ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylic acid , phenylmethyl ester in 100 ml of methanol is cooled in ice and treated with ammonia gas for 15 minutes . the flask is then stoppered and allowed to stir at room temperature overnight . the solvent is then removed under reduced pressure and the residue chromatographed on 190 g of silica gel eluting with chloroform / methanol , ( 9 : 1 ). the appropriate fractions are combined giving 1 . 62 g of an oil . this is taken up in chloroform and treated dropwise with a solution of hydrogen chloride gas in ether . the solution is decanted from the resulting gum , and the gum is triturated with ether . collecting the resulting solid and washing with ether gives 1 . 1 g of [ s -( r , r )]- 2 -[[[ 1 -[[( 2 - amino - 2 - oxoethyl )- amino ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylic acid , phenylmethyl ester , monohydrochloride , as an amorphous solid , mp 75 °- 95 ° eff ., [ α ] d 23 - 55 . 2 ° ( c 1 . 16 , methanol ). a solution of 1 . 54 g of ( s )- n -( 2 - amino - 4 - methylpentyl ) glycine , 1 , 1 - dimethylethyl ester , 890 mg of l - pyroglutamic acid , and 904 mg of hydroxybenzotriazole , hydrate in 30 ml of n , n - dimethylformamide is cooled in ice and treated dropwise with a solution of 1 . 4 g of n , n &# 39 ;- dicyclohexylcarbodiimide in 5 ml of n , n - dimethylformamide . after stirring at 0 ° for 0 . 5 hours , the mixture is kept at room temperature overnight . the mixture is filtered and the solvent distilled off under high vacuum . the residue is taken up in ethyl acetate and the ethyl acetate washed two times with water . the water is adjusted to ph 6 and lyophilized . the residue is chromatographed on 95 g of silica gel eluting with chloroform / methanol , ( 94 : 6 ). combining the appropriate fractions gives 1 . 2 g of [ s -( r , r )]- n -[ 4 - methyl - 2 -[[( 5 - oxo - 2 - pyrrolidinyl ] carbonyl ) amino ] pentyl ] glycine , 1 , 1 - dimethylethyl ester . the product is homogeneous by thin layer chromatography . a solution of 1 . 2 g of [ s -( r , r )]- n -[ 4 - methyl - 2 -[[( 5 - oxo - 2 - pyrrolidinyl ) carbonyl ] amino ] pentyl ] glycine , 1 , 1 - dimethylethyl ester in 15 ml of trifluoroacetic acid is kept at room temperature for two hours . the solvent is removed under reduced pressure and the residue dissolved in dichloromethane and the solvent again removed under reduced pressure . the residue is then taken up in dichloromethane and treated dropwise with a solution of hydrogen chloride gas in ether . the solvent is removed under reduced pressure , and the residue triturated with ether . collecting the solid and washing with ether gives 730 mg of [ s -( r , r )]- n -[ 4 - methyl - 2 -[[( 5 - oxo - 2 - pyrrolidinyl ) carbonyl ] amino ] pentyl ] glycine , monohydrochloride as an amorphous solid , mp 94 °- 125 ° eff ., [ α ] d 23 - 4 . 3 ° ( c 1 . 1 , methanol ). a solution of 8 . 15 g of [ s -( r , r )]- n , n - bis [ 4 - methyl - 2 -[[( phenylmethoxy ) carbonyl ] amino ] pentyl ] glycine , 1 , 1 - dimethyl ester in 100 ml of methanol is reduced at 24 °, 50 psi using 0 . 5 g of 20 % palladium on carbon as the catalyst . the catalyst is filtered off the solvent removed under reduced pressure . the residue is taken up in 125 ml of methanol and heated at reflux for five hours . removing the solvent under reduced pressure gives 4 . 13 g of an oil homogeneous by thin layer . this material is used in the following reaction . the dihydrochloride is prepared by taking the free base up in ether and adding dropwise a solution of hydrogen chloride gas in ether . the precipitated product is collected and washed with ether giving [ s -( r , r )]- 4 -( 2 - amino - 4 - methylpentyl )- 6 -( 2 - methylpropyl )- 2 - piperazone , dihydrochloride as an amorphous solid , mp 163 °- 173 °. the structure is confirmed by spectral and elemental analysis . the compound is homogeneous by thin layer chromatography . a solution of 2 . 0 g of [ s -( r , r )]- 4 -( 2 - amino - 4 - methylpentyl )- 6 -( 2 - methylpropyl )- 2 - piperazone , 1 . 95 g of z - proline , and 1 . 05 g of hydroxybenzotriazole hydrate in 40 ml of tetrahydrofuran is cooled in ice and treated dropwise with a solution of 1 . 63 g of n , n &# 39 ;- dicyclohexylcarbodiimide in 5 ml of tetrahydrofuran . after 0 . 5 hour at 0 °, the mixture is kept at room temperature overnight . the mixture is filtered and the solvent removed under reduced pressure . the residue is taken up in ethyl acetate and washed successively with water , saturated sodium bicarbonate , and then saturated sodium chloride . drying over magnesium sulfate and removal of the solvent under reduced pressure gives a gum . this is chromatographed on 190 g of silica gel , eluting with chloroform / methanol , ( 95 : 5 ). the appropriate fractions are combined and the residue taken up in ether and treated with hydrogen chloride gas in ether . the solid is collected and washed with ether giving 1 . 69 g of [ 2s -[ 2r , 4 [ r ( r )]]]- 2 -[[[ 3 - methyl - 1 -[[ 3 -( 2 - methylpropyl )- 5 - oxo - 1 - piperazinyl ] methyl ] butyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylic acid , phenylmethyl ester , monohydrochloride as an amorphous solid , mp 95 °- 120 °, [ α ] d 23 - 25 . 5 ° ( c 1 . 05 , methanol ). the compound is homogeneous by thin layer chromatography . a solution of 2 . 13 g of [ s -( r , r )]- 4 -( 2 - amino - 4 - methylpentyl )- 6 -( 2 - methylpropyl )- 2 - piperazone , 1 . 08 g of l - pyroglutamic acid , and 1 . 13 g of hydroxybenzotriazole hydrate in 25 ml of n , n - dimethylformamide is cooled in ice and treated dropwise with 1 . 74 g of n , n &# 39 ;- dicyclohexylcarbodiimide in 5 ml of n , n - dimethylformamide . after one hour at 0 °, the mixture is left at room temperature overnight . the mixture is filtered and the solvent is distilled off under high vacuum . the residue is taken up in ethyl acetate and washed twice with water . the water washes are adjusted to ph 7 . 2 and lyophilized . the residue is chromatographed on 175 g of silica gel , eluting with chloroform / methanol , ( 9 : 1 ). the appropriate fractions are combined . the residue is taken up in chloroform and treated with hydrogen chloride gas in ether . the solid is collected and triturated with additional ether . there is obtained 0 . 9 g of [ 2s -[ 2r , 4 [ r ( r )]]]- n -[ 3 - methyl - 1 -[[ 3 -( 2 - methylpropyl )- 5 - oxo - 1 - piperazinyl ] methyl ] butyl ]- 5 - oxo - 2 - pyrrolidinecarboxamide , monohydrochloride as an amorphous solid , mp 77 °- 110 °, [ α ] d 23 - 21 . 3 ° ( c 1 . 03 , methanol ). the product is homogeneous by thin layer chromatography . a solution of chloroacetyl chloride , 25 . 64 g ( 0 . 227 mol ), in 57 ml of acetone is added dropwise with stirring to a solution of l - leucinol , 26 . 63 g ( 0 . 227 mol ), and sodium acetate , 37 . 24 g ( 0 . 454 mol ), in a mixture of 340 ml of acetone and 170 ml of water at 0 °- 5 ° c . the mixture is stirred and allowed to reach room temperature over two hours , the solvent is evaporated in vacuo and the residue is suspended in 250 ml of chloroform and washed with water , 2 × 300 ml . the chloroform layer is separated , dried over sodium sulfate , evaporated in vacuo and the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( s )- 2 - chloro - n -[ 1 -( hydroxymethyl )- 3 - methylbutyl ] acetamide , 28 g ; [ α ] d 25 - 32 . 6 ° ( c 0 . 52 , methanol ). anal . calcd for c 8 h 16 clno 2 : c , 49 . 61 ; h , 8 . 33 ; n , 7 . 23 . found : c , 49 . 77 ; h , 8 . 07 ; n , 7 . 03 . ( s )- 2 - chloro - n -[ 1 -( hydroxymethyl )- 3 - methylbutyl ] acetamide , 26 . 34 g ( 0 . 136 mol ), is dissolved in 450 ml of tetrahydrofuran , the solution is cooled to 0 °- 5 ° c . and 7 . 8 g ( 0 . 195 mol ) of 60 % sodium hydride in mineral oil dispersion is slowly added . the mixture is allowed to reach room temperature and is stirred for 14 hours . water , 10 ml , is added , the solvents evaporated in vacuo and the residue suspended in 250 ml of chloroform and washed with 100 ml of water and then a saturated aqueous solution of sodium chloride , 2 × 200 ml . the chloroform layer is separated , dried over sodium sulfate , and evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethane methanol ( 95 : 5 ) to give ( s )- 5 -( 2 - methylpropyl )- 3 - morpholinone , 5 . 1 g , mp 69 °- 70 °; [ α ] d 25 - 13 . 7 ° ( c 1 . 11 , methanol ). anal . calcd for c 8 h 15 no 2 : c , 61 . 12 ; h , 9 . 62 ; n , 8 . 91 . found : c , 61 . 37 ; h , 10 . 06 ; n , 8 . 77 . ( s )- 5 -( 2 - methylpropyl )- 3 - morpholinone , 3 g ( 0 . 019 mol ), is suspended in a solution of 50 ml of concentrated hydrochloric acid and 50 ml of water , refluxed for four hours , cooled to room temperature , and extracted with 200 ml of dichloromethane . the aqueous layer is separated , evaporated in vacuo , the residue dissolved in 200 ml of water and the ph adjusted with a 10 % aqueous solution of sodium hydroxide to ph 10 - 10 . 5 . the solution is cooled to 5 ° c . and 3 . 73 g ( 0 . 022 mol ) of benzylchloroformate is added dropwise while the ph is maintained at ph 10 with a 10 % aqueous solution of sodium hydroxide . the mixture is stirred one hour , extracted with 100 ml of diethylether , the aqueous layer is separated and the ph is adjusted to ph 3 - 4 by the addition of a 10 % aqueous solution of hydrochloric acid . the mixture is extracted with dichloromethane , 3 × 200 ml . the dichloromethane layer is separated , washed with a saturated aqueous solution of sodium chloride , 3 × 200 ml , separated , dried over sodium sulfate , evaporated and the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( s )-[[ 4 - methyl2 [[( phenylmethoxy ) carbonyl ] amino ] pentyl ] oxy ] acetic acid , 5 g ; [ α ] d 25 - 30 . 5 ( c 0 . 55 , methanol ). anal . calcd for c 10 h 23 no 5 : c , 62 . 12 ; h , 7 . 49 ; n , 4 . 53 . found : c , 62 . 04 ; h , 7 . 28 ; n , 4 . 32 . methylchloroformate , 0 . 87 g ( 0 . 009 mol ), is added dropwise with stirring to a solution of 2 . 52 g ( 0 . 008 mol ) of ( s )-[[ 4 - methyl - 2 [[( phenylmethoxy ) carbonyl ] amino ] pentyl ] oxy ] acetic acid and 0 . 93 g ( 0 . 009 mol ) of triethylamine in 100 ml of dichloromethane at - 5 °- 10 ° c . the mixture is stirred for 30 minutes at - 5 ° c ., allowed to reach 0 ° c . and saturated with ammonia for five minutes . the mixture is allowed to reach room temperature and stirred for one hour , the solvent is evaporated in vacuo , the residue dissolved in 200 ml of dichloromethane , washed with a saturated aqueous solution of sodium chloride , 2 × 200 ml , the dichloromethane layer separated , dried over sodium sulfate and evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( s )- phenylmethyl -[ 1 -[( 2 - amino - 2 - oxoethoxy ) methyl ]- 3 - methytbutyl ] carbamate , 1 . 8 g , mp 78 °- 79 °; [ α ] d 25 - 22 . 1 ° ( c 1 . 15 , methanol ). anal . calcd for c 16 h 24 n 2 o 4 : c , 62 . 32 ; h , 7 . 85 ; n , 9 . 09 . found : c , 62 . 66 ; h , 7 . 70 ; n , 8 . 74 . a stirred suspension of 1 . 58 g ( 0 . 0051 mol ) of ( s )- phenylmethyl -[ 1 -[( 2 amino - 2 - oxoethoxy ) methyl ]- 3 - methylbutyl ] carbamate and 0 . 3 g of 20 % palladium on carbon in a 100 ml of methanol is exposed to hydrogen gas for 15 minutes , the suspension is purged with nitrogen gas , filtered , and the solvent evaporated in vacuo at 30 ° c . the residue is dissolved in 100 ml of dichloromethane , the solution is cooled to 0 ° c . and 1 . 3 g ( 0 . 0051 mol ) of carbobenzyloxyproline , 0 . 78 g ( 0 . 0051 mol ) of 1 - hyroxybenzotriazole and 1 . 1 g ( 0 . 0051 mol ) of dicyclohexylcarbodiimide are added . the mixture is allowed to reach room temperature and stirred for 14 hours , filtered , the solvent evaporated in vacuo and the residue dissolved in 200 ml of dichloromethane and washed successively with a 5 % aqueous solution of sodium carbonate , 2 × 200 ml , 10 % aqueous solution of citric acid , 2 × 200 ml and a saturated aqueous solution of sodium chloride , 2 × 200 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo and the residue purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give [ s -( r , r )]- phenylmethyl 2 [[[ 1 -[( 2 - amino - 2 - oxoethoxy ) methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate , 1 . 1 g ; mp 146 °- 148 °; [ α ] d 25 - 55 . 3 ° ( c 1 . 31 , methanol ). anal . calcd for c 21 h 31 n 3 o 5 : c , 62 . 20 ; h , 7 . 71 ; n , 10 . 36 . found : c , 62 . 39 ; h , 7 . 43 ; n , 10 . 21 . ( s )-[[ 4 - methyl - 2 [[( phenylmethoxy ) carbonyl ] amino ] pentyl ] oxy ] acetic acid , 1 . 75 g ( 0 . 0057 mol ) is dissolved in 50 ml of dichloromethane and the solution is placed in a pressure vessel , cooled under nitrogen gas to 5 ° c ., 0 . 5 ml of concentrated sulfuric acid is added , the mixture is recooled to 5 ° c . and 10 ml of isobutylene is added . after 65 . 5 hours , the mixture is poured with stirring over a mixture of 1 . 35 g ( 0 . 0098 ml ) of potassium carbonate , 50 ml of water , 50 g of ice and 50 ml of dichloromethane at such a rate that the temperature does not exceed 15 ° c . the dichloromethane layer is separated , washed with a saturated aqueous solution of sodium chloride , 2 × 200 ml , separated , dried over sodium sulfate and evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 98 : 2 ) to give the intermediate t - butyl ester . a stirred suspension of 0 . 92 g ( 0 . 0025 mol ) of the intermediate t - butyl ester and 0 . 2 g of 20 % palladium on carbon in a 100 ml of methanol is exposed to hydrogen gas for 15 minutes , the suspension is purged with nitrogen gas , filtered and the solvent evaporated in vacuum at 30 ° c . the residue is dissolved in 100 ml of dichloromethane , the solution is cooled to 0 ° c . and 0 . 63 g ( 0 . 0025 mol ) of carbobenzyloxyproline , 0 . 4 g ( 0 . 0025 mol ) of 1 - hydroxybenzotriazole and 0 . 52 g of dicylohexylcarbodiimide are added . the mixture is allowed to reach room temperature and stirred for 14 hours , filtered , the solvent evaporated in vacuo and the residue dissolved in 200 ml of dichloromethane and washed successively with a 5 % aqueous solution of sodium carbonate , 2 × 200 ml , 10 % aqueous solution of citric acid , 2 × 200 ml and a saturated aqueous solution of sodium chloride , 2 × 200 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo and the residue purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 98 : 2 ) to give [ s -( r , r )] phenylmethyl 2 -[[[ 1 -[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethoxy ] methyl ]- 3 - methylbutyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate , 0 . 9 g ; [ α ] d 25 - 62 . 8 ° ( c 0 . 56 , methanol ). anal . calcd for c 25 h 38 n 2 o 6 : c , 64 . 91 ; h , 8 . 28 ; n , 6 . 06 . found : c , 64 . 93 ; h , 8 . 16 ; n , 6 . 12 . [ s -( r , r )]- phenylmethyl 2 -[[ 1 -[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethoxy ] methyl ]- 3 - methylbuty ] amino ] carbonyl ]- 1 - pyrrolidine - carboxylate , 0 . 6 g ( 0 . 0013 mol ), is dissolved in 20 ml of trifluoroacetic acid at 0 ° c . the mixture is allowed to stand 15 minutes at 0 ° c . and then allowed to reach room temperature over 30 minutes and the solvent evaporated in vacuo at 25 ° c . the residue is dissolved in 100 ml of dichloromethane and washed with a saturated aqueous solution of sodium chloride , 2 × 100 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo and the residue purified by chromatography using silica gel and eluting with dichloromethanemethanol ( 95 : 5 ) to give [ s , r , r )]- phenylmethyl 2 -[[[ 1 -[( carboxy ) methoxy ]- 3 - methylbutyl ] amino ] carbonyl ] pyrrolidinecarbonylate , 0 . 4 g , mp 118 °- 120 °; [ α ] d 25 - 69 . 6 ° ( c 0 . 52 , methanol ). anal . calcd for c 21 h 30 n 2 o 6 : c , 62 . 05 ; h , 7 . 44 ; n , 6 . 89 . found : c , 62 . 17 ; h , 7 . 27 ; n , 6 . 75 . (±)- 5 -( phenylmethyl )- 3 - morpholinone , ( u . s . pat . no . 3 , 265 , 688 ) 5 g 0 . 026 mol ), is suspended in a solution of 50 ml of concentrated hydrochloric acid and 50 ml of water and refluxed for six hours , cooled to room temperature and extracted with 200 ml of dichloromethane . the aqueous layer is separated , evaporated in vacuo , the residue dissolved in 200 ml of water , and the ph adjusted with a 10 % aqueous solution of sodium hydroxide to ph 10 - 10 . 5 . the solution is cooled to 5 ° c . and 5 . 1 g ( 0 . 03 mol ) of benzylchloroformate is added dropwise while the ph is maintained at ph 10 with a 10 % aqueous solution of sodium hydroxide . the mixture is stirred one hour , extracted with 100 ml of diethylether , the aqueous layer is separated and the ph is adjusted to ph 3 - 4 by the addition of a 10 % aqueous solution of hydrochloric acid . the mixture is extracted with dichloromethane , 3 × 200 ml . the dichloromethane layer is separated , washed with a saturated aqueous solution of sodium chloride , 3 × 200 ml , separated , dried over sodium sulfate , evaporated and the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give (±)-[ 3 - phenyl [- 2 -[[( phenylmethoxy ] carbonyl ] amino ] propoxy ] acetic acid , 4 g ; mp 96 °- 100 °. anal . calcd for c 19 h 21 no 5 : c , 66 . 46 ; h , 6 . 17 ; n , 4 . 08 . found : c , 66 . 03 ; h , 6 . 19 ; n , 4 . 05 . methylchloroformate , 0 . 89 g ( 0 . 0094 mol ) is added dropwise with stirring to a solution of 2 . 75 g ( 0 . 008 mol ) of (±)-[ 3 - phenyl - 2 -[[( phenylmethoxy ) carbonyl ] amino ] propoxy ] acetic acid and 0 . 96 g ( 0 . 0095 mol ) of triethylamine in 100 ml of dichloromethane at - 5 °- 10 ° c . the mixture is stirred for 30 minutes at - 5 ° c ., allowed to reach 0 ° c . and saturated with ammonia for 5 minutes . the mixture is allowed to reach room temperature and stirred for one hour , the solvent is evaporated in vacuo , the residue dissolved in 200 ml of dichloromethane , washed with a saturated aqueous solution of sodium chloride , 2 × 200 ml , the dichloromethane layer separated , dried over sodium sulfate , and evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give (±)- phenylmethyl -[ 1 -[( 2 - amino - 2 - oxoethoxy ) methyl ]- 2 - phenylethyl ] carbamate , 2 . 5 g ; mp 135 °- 137 °. anal . calcd for c 19 h 22 n 2 o 4 : c , 66 . 65 ; h , 6 . 48 ; n , 8 . 18 . found : c , 66 . 33 ; h , 6 . 60 ; n , 7 . 95 . ( 2s )- phenylmethyl 2 [[[ 1 -[( 2 - amino - 2 - oxoethoxy ) methyl ]- 2 - phenylethyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ( center on chain in 2 position is a mixture of isomers ) a stirred suspension of 1 . 52 g ( 0 . 0044 mol ) of (±)- phenylmethyl [ 1 -[( 2 - amino - 2 - oxoethoxy ) methyl ]- 2 - phenylethyl ]- carbamate and 0 . 35 g of 20 % palladium on carbon in a 100 ml of methanol is exposed to hydrogen gas for 15 minutes , the suspension is purged with nitrogen gas , filtered , and the solvent evaporated in vacuo at 30 ° c . the residue is dissolved in 100 ml of dichloromethane , the solution is cooled to 0 ° c . and 1 . 196 g ( 0 . 0048 mol ) of carbobenzyloxyproline , 0 . 734 g ( 0 . 0048 mol ) of 1 - hydroxybenzotriazole and 0 . 99 g ( 0 . 0048 mol ) of dicyclohexylcarbodiimide are added . the mixture is allowed to reach room temperature and stirred for 14 hours , filtered , the solvent evaporated in vacuo , and the residue dissolved in 200 ml of dichloromethane and washed successively with a 5 % aqueous solution of sodium carbonate , 2 × 200 ml , 10 % aqueous solution of citric acid , 2 × 200 ml and a saturated aqueous solution of sodium chloride , 2 × 200 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo and the residue purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( 2s )- phenylmethyl 2 -[[[ 1 -[( 2 - amino - 2 - oxoethoxy ) methyl ]- 2 - phenylethyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ( center on chain in 2 position is a mixture of isomers ), 0 . 8 g ; mp 137 °- 142 °; [ α ] d 25 - 45 . 1 ° ( c 1 . 09 , methanol ). anal . calcd for c 24 h 29 n 3 o 5 : c , 65 . 58 ; l h , 6 . 65 ; n , 9 . 56 . found : c , 65 . 70 ; h , 6 . 45 ; n , 9 . 70 . (±)-( 2 - amino - 3 - phenylpropoxy acetic acid , monohydrochloride , 2 . 11 g ( 0 . 00838 mol ) is suspended in 40 ml of hot p - dioxane and the solution is placed in a pressure vessel , 2 . 5 ml of concentrated sulfuric acid is added , the mixture is cooled to 5 ° c . and 20 ml of isobutylene is added . after 40 hours the mixture is poured with stirring over a mixture of 3 . 52 g ( 0 . 0534 mol ) of 85 % aqueous potassium hydroxide solution , 50 ml of water , 50 g of ice and 50 ml of dichloromethane at such a rate that the temperature does not exceed 15 ° c . the dichloromethane layer is separated , washed with a saturated aqueous solution of sodium chloride , 2 × 200 ml , separated , dried over sodium sulfate and evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethane - methane ( 98 : 2 ) to give the intermediate t - butyl ester . the intermediate t - butyl ester , 1 . 6 g ( 0 . 006 mol ), is dissolved in 100 ml of dichloromethane , the solution is cooled to 0 ° c . and 1 . 5 g ( 0 . 006 mol ) of carbobenzyloxyproline , 0 . 92 g ( 0 . 006 mol ) of 1 - hydroxybenzotriazole and 1 . 24 g ( 0 . 006 mol ) of dicyclohexylcarbodiimide are added . the mixture is allowed to reach room temperature and stirred for 14 hours , filtered , the solvent evaporated in vacuo , and the residue dissolved in 200 ml of dichloromethane and washed successively with a 5 % aqueous solution of sodium carbonate , 2 × 200 ml , 10 % aqueous solution of citric acid , 2 × 200 ml and a saturated aqueous solution of sodium chloride , 2 × 200 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo , and the residue purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 99 : 1 ) to give ( 2s )- phenylmethyl 2 -[[[ 1 -[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethoxy ] methyl ]- 2 - phenylethyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ( side chain in 2 position is (±) mixture ), 1 . 5 g ; [ α ] d 25 - 59 . 4 ° ( c 0 . 63 , methanol ). anal . calcd for c 28 h 36 n 2 o 6 : c , 67 . 72 ; h , 7 . 31 ; n , 5 . 64 . found : c , 67 . 60 ; h , 7 . 31 ; n , 5 . 61 . ( 2s )- phenylmethyl 2 -[[[ 1 -[( carboxymethoxy ) methyl ]- 2 - phenylethyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ( center on chain in 2 position is a mixture of isomers ) ( 2s )- phenylmethyl 2 -[[[ 1 -[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethoxy ] methyl ]- 2 - phenylethyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ( side chain in 2 position is (±) mixture ), 0 . 5 g ( 0 . 0010 mol ), is dissolved in 30 ml of trifluoroacetic acid at 0 ° c . the mixture is allowed to stand 30 minutes at 0 ° c . and then allowed to reach room temperature over one hour and the solvent evaporated in vacuo at 25 ° c . the residue is dissolved in 100 ml of dichloromethane and washed with a saturated aqueous solution of sodium chloride , 2 × 100 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo , and the residue purified by chromatography using silica gel and eluting with dichloromethane methanol ( 95 : 5 ) to give ( 2s )- phenylmethyl 2 -[[[ 1 -[( carboxymethoxy ) methyl ]- 2 - phenylethyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate ( center on chain in 2 position is a mixture of isomers ), 0 . 39 g ; [ α ] d 25 - 52 . 2 ° ( c 0 . 23 , methanol ). anal . calcd for c 24 h 28 n 2 o 6 1 / 4ch 3 oh : c , 64 . 94 ; h , 6 . 52 ; n , 6 . 25 . found : c , 64 . 67 ; h , 6 . 12 ; n , 6 . 33 . a solution of (±)- 2 - bromo - 4 - methyl - pentanoyl chloride , 21 g ( 0 . 099 mol ), in 25 ml of acetone is added dropwise with stirring to a solution of 10 g ( 0 . 099 mol ) of l - prolinol and 16 . 2 g ( 0 . 197 mol ) of sodium acetate in a mixture of 150 ml of acetone and 75 ml of water at 0 °- 5 ° c . the mixture is stirred and allowed to reach room temperature over two hours , the solvent is evaporated in vacuo and the residue is suspended in 300 ml of chloroform and washed with water , 2 × 300 ml . the chloroform layer is separated , dried over sodium sulfate , evaporated in vacuo , and the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( 2s )- 1 -( 2 - bromo - 4 - methyl - 1 - oxopentyl ) 2 - pyrrolidinemethanol ( 2 position on side chain is r , s mixture ), 21 g ; mp 79 °- 82 °; [ α ] d 25 - 54 . 0 ° ( c 0 . 6 , methanol ). anal . calcd for c 11 h 20 brno 2 : c , 47 . 49 ; h , 7 . 25 ; n , 5 . 04 . found : c , 47 . 44 ; h , 7 . 15 ; n , 4 . 86 . ( 2s )- 1 -( 2 - bromo - 4 - methyl - 1 - oxopentyl )- 2 - pyrrolidinemethanol ( 2 position on side chain is r , s mixture ), 19 . 48 g ( 0 . 07 mol ), is dissolved in 500 ml of tetrahydrofuran , the solution is cooled to 0 °- 5 ° c . and 4 g ( 0 . 10 mol ) of 60 % sodium hydride in mineral oil dispersion is slowly added . the mixture is allowed to reach room temperature and is stirred for 14 hours and is then refluxed 2 hours . water , 10 ml , is added , the solvents evaporated in vacuo and the residue suspended in 250 ml of chloroform and washed with 100 ml of water and the a saturated aqueous solution of sodium chloride , 2 × 200 ml . the chloroform layer is separated , dried over sodium sulfate , and evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 97 : 3 ) to give ( 8as )- tetrahydro - 3 -( methylpropyl )- 1h - pyrrolo [ 2 , 1 - c ][ 1 , 4 ] oxazin - 4 ( 3h ))- one , 8 . 3 g ; mp 61 °- 65 °; [ α ] d 25 - 73 . 3 ° ( c 0 . 57 , methanol ). anal . calcd for c 11 h 19 no 2 : c , 66 . 97 ; h , 9 . 71 ; n , 7 . 10 . found : c , 67 . 22 ; h , 9 . 45 ; n , 6 . 92 . ( 8a s )- tetrahydro - 3 -( 2 - methylpropyl - 1h - pyrrolo [ 2 , 1 - c ][ 1 , 4 ] oxazine - 4 ( 3h )- one , 5 . 1 g ( 0 . 026 mol ), is suspended in a solution of 50 ml of concentrated hydrochloric acid and 50 ml of water and refluxed for four hours , cooled to room temperature and extracted with 200 ml of dichloromethane . the aqueous layer is separated , evaporated in vacuo , the residue dissolved in 200 ml of water , and the ph adjusted with a 10 % aqueous solution of sodium hydroxide to ph 10 - 10 . 5 . the solution is cooled to 5 ° c . and 4 . 44 g ( 0 . 026 mol ) of benzylchloroformate is added dropwise while the ph is maintained at ph 10 with a 10 % aqueous solution of sodium hydroxide . the mixture is stirred one hour , extracted with 100 ml of diethylether , the aqueous layer is separated and the ph is adjusted to ph 3 - 4 by the addition of a 10 % aqueous solution of hydrochloric acid . the mixture is extracted with dichloromethane , 3 × 200 ml . the dichloromethane layer is separated , washed with a saturated aqueous solution of sodium chloride , 3 × 200 ml , separated , dried over sodium sulfate , evaporated , and the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( 2s )- phenylmethyl 2 -[( 1 - carboxy - 3 - methylbutoxy ) methyl ]- 1 - pyrrolidinecarboxylate ( center on side chain is r , s mixture ), 4 . 3 g ; [ α ] d 25 - 78 . 7 ° ( c 0 . 33 , methanol ). anal . calcd for c 19 h 27 no 5 : c , 65 . 31 ; h , 7 . 79 ; n , 4 . 01 . found : c , 65 . 48 ; h , 7 . 72 ; n , 3 . 84 . ( 2s )- phenylmethyl - 2 -[( 1 - carboxy - 3 - methylbutoxy ) methyl ]- 1 - pyrrolidinecarboxylate ( center on side chain is r , s mixture ), 2 g ( 0 . 0057 mol ), is dissolved in 100 ml of dichloromethane , cooled to 0 ° c . and 1 . 1 g ( 0 . 0084 mol ) of t - butylglycinate , 0 . 88 g ( 0 . 0057 mol ) of 1 - hydroxybenzotriazole and 1 . 32 g ( 0 . 0064 mol ) of dicyclohexylcarbodiimide are added . the mixture is allowed to reach room temperature and stirred 14 hours , filtered , the solvent evaporated in vacuo and the residue dissolved in 200 ml of dichloromethane and washed successively with a 5 % aqueous solution of sodium chloride , 2 × 200 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo and the residue purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 98 : 2 ) to give ( s )- phenylmethyl 2 -[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] amino ] carbonyl ]- 3 - methoxy - butoxy ] methyl ]- 1 - pyrrolidinecarboxylate ( 2 - position of pentane chain is r s ), 1 . 75 g ; [ α ] d 25 - 70 . 2 ° ( c 0 . 39 , methanol ). anal . calcd for c 25 h 38 n 2 o 6 : c , 64 . 91 ; h , 8 . 28 ; n , 6 . 06 . found : c , 64 . 87 ; h , 8 . 46 ; n , 5 . 87 . ( s )- phenylmethyl 2 -[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] amino ] carbonyl ]- 3 - methylbutoxy ] methyl ] 1 - pyrrolidinecarboxylate ( 2 - position of pentane chain is rs ), 1 . 2 g ( 0 . 00259 mol ), is dissolved in 30 ml of trifluoroacetic acid at 0 ° c . the mixture is allowed to stand 30 minutes at 0 ° c ., and then allowed to reach room temperature over one hour and the solvent evaporated in vacuo at 25 ° c . the residue is dissolved in 100 ml of dichloromethane and washed with a saturated aqueous solution of sodium chloride , 2 × 100 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo and the residue purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( s )- phenylmethyl 2 -[[ 1 -[[( carboxymethyl ) amino ] carbonyl ]- 3 - methylbutoxymethyl ]- 1 - pyrrolidinecarboxylate ( 2 - position of pentane chain is rs ), 0 . 75 g ; [ α ] d 25 - 79 ° ( c 0 . 34 , methanol ). anal . calcd for c 21 h 30 n 2 o 6 : c , 62 . 05 , h , 7 . 44 ; n , 6 . 89 . found : c , 62 . 38 ; h , 7 . 36 ; n , 6 . 69 . triethylamine , 1 . 15 g ( 0 . 0114 mol ), is added to 1 . 59 g ( 0 . 0114 mol of ethyl glycinate hydrochloride in 200 ml of dichloromethane at 0 °. to the previous suspension at 0 ° c . is added 4 g ( 0 . 0114 mol ) of ( 2s )- phenylmethyl 2 -[( 1 - carboxy - 3 - methylbutoxy ) methyl ]- 1 - pyrrolidinecarboxylate ( center on side chain is r , s mixture ), 1 . 74 g ( 0 . 0114 mol ) of 1 - hydroxybenzotriazole and 2 . 35 g ( 0 . 0114 mol ) of dicyclohexylcarbodiimide . the mixture is allowed to reach room temperature and stirred 14 hours , filtered , the solvent evaporated in vacuo and the residue dissolved in 200 ml of dichloromethane and washed successively with a 5 % aqueous solution of sodium carbonate , 2 × 200 ml , 10 % aqueous solution of citric acid , 2 × 200 ml , and a saturated aqueous solution of sodium chloride , 2 × 200 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo , and the residue purified by chromatography using silica gel and eluting with dichloromethanemethanol ( 98 : 2 ) to give ( 2s )- phenylmethyl 2 -[[ 1 -[[( 2 - ethoxy - 2 - oxoethyl ) amino ] carbonyl ]- 3 - methylbutoxy ] methyl ]- 1 - pyrrolidinecarboxylate ( center on side chain is r , s mixture ), 4 g ; [ α ] d 25 - 72 . 7 ° ( c 0 . 33 , methanol ). anal . calcd for c 23 h 34 n 2 o 6 : c , 63 . 57 ; h , 7 . 89 ; n , 6 . 45 . found : c , 63 . 59 ; h , 7 . 84 ; n , 6 . 29 . ( 2s )- phenylmethyl - 2 -[[ 1 -[[( 2 - ethoxy - 2 - oxoethyl ) amino ] carbonyl ]- 3 - methylbutoxy ] methyl ]- 1 - pyrrolidinecarboxylate ( center on side chain is r , s mixture ), 2 g ( 0 . 0046 mol ), is dissolved in 200 ml of methanol and the solution saturated with ammonia at room temperature . the solution is allowed to stand at room temperature for 14 hours and the solvent is evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethanemethanol ( 90 : 10 ) to give ( 2s )- phenylmethyl 2 -[[ 1 -[[( 2 - amino - 2 - oxoethyl ) amino ] carbonyl ]- 3 - methyl ] butoxy ] methyl - 1 - pyrrolidinecarboxylate ( center on side chain is r , s mixture ), 1 . 6 g ; [ α ] d 25 - 76 . 9 ° ( c 0 . 46 , methanol ). anal . calcd for c 21 h 31 n 3 o 5 : c , 62 . 20 ; h , 7 . 71 ; n , 10 . 36 . found : c , 62 . 48 ; h , 7 . 35 ; n , 10 . 37 . a solution of chloroacetyl chloride , 27 . 7 g ( 0 . 247 mol ), in 66 . 5 ml of acetone is added dropwise with stirring to a solution of 25 g ( 0 . 247 mol ) of l - prolinol and 40 . 4 g ( 0 . 493 mol ) of sodium acetate in a mixture of 400 ml of acetone and 200 ml of water at 0 °- 5 ° c . the mixture is stirred and allowed to reach room temperature over two hours , the solvent is evaporated in vacuo and the residue is suspended in 300 ml chloroform and washed with water , 2 × 300 ml . the chloroform layer is separated , dried over sodium sulfate , evaporated in vacuo and the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 98 : 2 ) to give ( s )- 1 -( chloroacetyl )- 2 - pyrrolidinemethanol , 34 . 1 g ; [ α ] d 25 - 62 . 2 ° ( c 1 . 00 , methanol ). anal . calc for c 7 h 12 clno 2 : c , 47 . 33 ; h , 6 . 81 ; n , 7 . 89 . found : c , 47 . 33 ; h , 6 . 60 ; n , 7 . 61 . ( s )- 1 -( chloroacetyl )- 2 - pyrrolidinemethanol , 12 g ( 0 . 068 mol ), is dissolved in 500 ml of tetrahydrofuran , the solution is cooled to 0 °- 5 ° c ., and 3 . 96 g ( 0 . 099 mol ) of 60 % sodium hydride in mineral oil dispersion is slowly added . the mixture is allowed to reach room temperature and is stirred for 14 hours . water , 20 ml , is added , the solvents evaporated in vacuo , and the residue suspended in 300 ml of chloroform and washed with 100 ml of water and then a saturated aqueous solution of sodium chloride , 2 × 200 ml . the chloroform layer is separated , dried over sodium sulfate , and evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give tetrahydro - 1h - pyrrolo [ 2 , 1 - c ][ 1 , 4 ] oxazin - 4 -( 3h )- one , 4 . 4 g ; mp 63 . 5 °- 66 °. anal . calcd for c 7 h 11 no 2 : c , 59 . 55 ; h , 7 . 85 ; n , 9 . 92 . found : c , 59 . 41 ; h , 7 . 84 ; n , 9 . 83 . tetrahydro - 1h - pyrrolo [ 2 , 1 - c ][ 1 , 4 ] oxazin - 4 -( 3h )- one , 5 g ( 0 . 0354 mol ), is suspended in a solution of 20 ml of concentrated hydrochloric acid and 20 ml of water and refluxed for four hours , cooled to room temperature and extracted with 200 ml of dichloromethane . the aqueous layer is separated , evaporated in vacuo , the residue dissolved in 200 ml of water , and the ph adjusted with a 10 % aqueous solution of sodium hydroxide to ph 10 - 10 . 5 . the solution is cooled to 5 ° c . and 7 . 25 g ( 0 . 0425 mol ) of benzylchloroformate is added dropwise while the ph is maintained at ph 10 with a 10 % aqueous solution of sodium hydroxide . the mixture is stirred one hour , extracted with 100 ml of diethylether , the aqueous layer is separated , and the ph is adjusted to ph 3 - 4 by the addition of a 10 % aqueous solution of hydrochloric acid . the mixture is extracted with dichloromethane 3 × 200 ml . the dichloromethane layer is separated , washed with a saturated aqueous solution of sodium chloride , 3 × 200 ml , separated , dried over sodium sulfate , evaporated and the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( s )- phenylmethyl 2 -[( carboxymethoxy ) methyl ]- 1 - pyrrolidinecarboxylate , 8 g ; [ α ] d 25 - 52 . 7 ° ( c 1 . 1 , methanol ). anal . calcd for c 15 h 19 no 5 : c , 61 . 42 ; h , 6 . 53 ; n , 4 . 78 . found : c , 61 . 21 ; h , 6 . 36 ; n , 4 . 60 . triethylamine , 2 . 5 g ( 0 . 0247 mol ), is added to 3 . 46 g ( 0 . 0248 mol ) of ethyl glycinate hydrochloride in 200 ml of dichloromethane at 0 ° c . to the previous suspension at 0 ° c . is added 7 . 28 g ( 0 . 0248 mol of ( s ) phenylmethyl - 2 -[( carboxymethoxy ) methyl ]- 1 - pyrrolidinecarboxylate , 3 . 8 g ( 0 . 0247 mol ) of 1 - hydroxbenzotriazole and 5 . 1 g ( 0 . 0247 mol ) of diicyclohexylcarbodiimide . the mixture is allowed to reach room temperature and stirred 14 hours , filtered , the solvent evaporated in vacuo and the residue dissolved in 200 ml of dichloromethane and washed successively with a 5 % aqueous solution of sodium carbonate , 2 × 200 ml , 10 % aqueous solution of citric acid , 2 × 200 ml and a saturated aqueous solution of sodium chloride , 2 × 200 ml . the dichloromethane layer is separated , dried over sodium sulfate , evaporated in vacuo , and the residue purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 98 : 2 ) to give ( s )- phenylmethyl 2 -[[ [[[( ethoxycarbonyl ) methyl ] amino ] carbonyl ] methoxy ] methyl ]- 1 - pyrrolidinecarboxylate , 8 . 54 g ; [ α ] d 25 - 37 . 3 ° ( c 0 . 82 , methanol ). anal . calcd for c 19 h 26 n 2 o 6 : c , 60 . 30 ; h , 6 . 93 ; n , 7 . 40 . found : c , 60 . 46 ; h , 6 . 76 ; n , 7 . 33 . ( s )- phenylmethyl 2 -[[[[[( ethoxycarbonyl ) methyl ] amino ] carbonyl ] methoxy ] methyl ]- 1 - pyrrolidinecarboxylate , 4 g ( 0 . 01057 mol ), is dissolved in 100 ml of ethanol and the solution saturated with ammonia at room temperature . the solution is allowed to stand at room temperature for five days , the solvent evaporated in vacuo and the residue dissolved in 100 ml of methanol and the solution saturated with ammonia at room temperature . the solution is allowed to stand at room temperature for 14 hours and the solvent evaporated in vacuo . the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 90 : 10 ) to give ( s )- phenylmethyl 2 -[[[[( 2 - amino - 2 - oxoethyl ) amino ] carbonyl ] methoxy ] methyl ]- 1 - pyrrolidinecarboxylate , 3 g ; mp 109 . 5 °- 111 °; [ α ] d 25 - 41 . 0 ° ( c 0 . 57 , methanol ). anal . calcd for c 17 h 23 n 3 o 5 : c , 58 . 44 ; h , 6 . 64 ; n , 12 . 03 . found : c , 58 . 40 ; h , 6 . 55 ; n , 11 . 77 . to a solution of 3 . 87 g ( 0 . 0102 mol ) of ( s )- phenylmethyl 2 -[[[[( 2 - amino - 2 - oxoethyl ) amino ] carbonyl ] methoxy ] methyl ]- 1 - pyrrolidinecarboxylate in 100 ml of methanol is added 0 . 816 g ( 0 . 0102 mol ) of a 50 % aqueous solution of sodium hydroxide . the mixture is allowed to stand at room temperature for four hours and the solvent evaporated in vacuo . the residue is dissolved in 200 ml of water , extracted with 200 ml of dichloromethane , the aqueous layer separated and the ph is adjusted to ph 3 - 4 by the addition of a 10 % aqueous solution of hydrochloric acid . the mixture is extracted with dichloromethane , 3 × 200 ml . the dichloromethane layer is separated , washed with a saturated aqueous solution of sodium chloride , 3 × 200 ml , separated , dried over sodium sulfate , evaporated and the residue is purified by chromatography using silica gel and eluting with dichloromethane - methanol ( 95 : 5 ) to give ( s )- phenylmethyl - 2 -[[[[( carboxymethyl ) amino ] carboxy ] methoxy ] methyl ]- 1 - pyrrolidinecarboxylate , 1 . 75 g ; [ α ] d 25 - 41 . 7 ° ( c 0 . 58 , methanol ). anal . calcd for c 17 h 22 n 2 o 6 : c , 58 . 27 ; h , 6 . 33 ; n , 8 . 00 . found : c , 58 . 36 ; h , 6 . 30 ; n , 7 . 86 . a solution of 3 . 00 g of ( s )- n -[ n -[[ 1 -[( 4 - methylphenyl ) sulfonyl ]- 2 - pyrrolidinyl ] methyl ]- l - leucyl ] glycine 1 , 1 - dimethylethyl ester in 30 ml of trifluoroacetic acid is stirred at room temperature for 3 . 25 hours . the solvent is then removed under reduced pressure . the residue is dissolved in dichloromethane and the solvent removed under reduced pressure . this procedure is repeated several times . the residue is then dissolved in dichloromethane and anhydrous hydrogen chloride gas is passed through the solution . the solvent is removed under reduced pressure . the residue is dissolved in 25 ml of dichloromethane and added dropwise to 250 ml of ethyl ether . the solid is collected , washed with ethyl ether and dried in vacuo at 40 ° c . giving 2 . 18 g of a white solid , mp 148 ° ( dec ), [ α ] d 23 - 61 . 0 ° ( c 1 , methanol ). to a solution of 3 . 00 g of carbobenzoxy - l - leucylglycine t - butyl ester in 30 ml of absolute ethanol is added 0 . 1 g of 20 % palladium on charcoal . hydrogen gas is passed through the mixture for 1 . 5 hours . the mixture is then filtered through celite . to the filtrate is added 5 g of freshly activated 3 å molecular sieves and 2 . 01 g of 2 - pyrrolidinecarboxaldehyde , 1 -[( 4 - methylphenyl ) sulfonyl ]. the mixture is stirred at room temperature for 1 . 5 hours . to the mixture is added a small amount of bromcresol green and 0 . 50 g of sodium cyanaborohydride . the color of the mixture is adjusted to yellow - green with a solution of hydrogen chloride gas in absolute ethanol . the mixture is stirred at room temperature for 72 hours then filtered . solid citric acid is added to the filtrate until no further gas evolution is observed . the solvent is removed under reduced pressure . the residue is taken up in ethyl acetate , washed twice with water , then a saturated sodium bicarbonate solution until basic , and lastly a saturated brine solution . after drying over magnesium sulfate , the solvent is removed under reduced pressure giving 3 . 10 g of an oil which is used without further purification . to a mixture of 8 . 64 g of 1 -[( 4 - methylphenyl ) sulfonyl ] 2 - pyrrolidinemethanol and 14 . 2 ml of triethylamine in 100 ml of dry methyl sulfoxide is added slowly a solution of 16 . 16 g of sulfur trioxide pyridine complex in 100 ml of dry methyl sulfoxide . the solution is stirred at room temperature for one hour , then poured onto 1 l of ice water . the mixture is extracted with ethyl acetate . the combined organic extracts are washed with 1n citric acid ( twice ), water ( twice ), a saturated sodium bicarbonate solution then a saturated brine solution . after drying over magnesium sulfate , the solvent is removed under reduced pressure and the residue crystallized from chloroform / hexane . the solid is dried in vacuo at 40 ° giving 5 . 75 g of a solid , mp 136 °- 136 . 5 ° dec , [ α ] d 23 - 121 . 0 ° ( c 2 , methanol ). under nitrogen , 3 . 76 g of lithium borohydride is added to a cold solution of 12 . 23 g of n -[( 4 - methylphenyl ) sulfonyl ] proline methyl ester in 125 ml of dry tetrahydrofuran . the solution is stirred cold for one hour then at room temperature overnight . the solution is recooled and 69 ml of water is added carefully followed by 25 ml of concentrated hydrochloric acid / h 2 o ( 1 : 1 ). the mixture is warmed slightly on a steam bath to separate the layers . the layers are separated and the aqueous layer is extracted with ethyl acetate . the combined organic extracts are washed with water , a saturated sodium bicarbonate solution , then a saturated brine solution . after drying over magnesium sulfate , the solvent is removed under reduced pressure and the residue crystallized from chloroform / hexane . the solid is dried in vacuo at 40 ° c . giving 8 . 69 g of a white solid , mp 82 °- 84 °, [ α ] d 23 - 83 . 4 ° ( c 2 , methanol ). to a cold solution of 20 . 0 g of proline methyl ester hydrochloride in 110 ml of purified pyridine is added 23 . 5 g of 4 - methylphenylsulfonyl chloride . the mixture is stirred overnight allowing the ice bath to melt . the mixture is recooled and diluted with 550 ml of cold ethyl acetate . the mixture is washed with 280 ml of cold water , 280 ml of cold 6n hydrochloric acid , 250 ml of water , 250 ml of a saturated sodium bicarbonate solution then 250 ml of a saturated brine solution . after drying over magnesium sulfate , the solvent is removed under reduced pressure and the residue crystallized from chloroform / hexane . the solid is dried in vacuo at 45 ° c . giving 12 . 91 g of a white solid , mp 75 °- 77 °, [ α ] d 23 - 119 . 4 ° ( c 2 , methanol ). to a cold solution of 5 . 00 g of carbobenzoxy - l - leucine , 2 . 55 g of 1 - hydroxybenzotriazole hydrate and 2 . 47 g of glycine 1 , 1 - dimethylethyl ester in 100 ml of 1 : 1 acetonitrile / tetrahydrofuran is added dropwise a solution of 3 . 89 g of n , n - dicyclohexylcarbodiimide in 40 ml of tetrahydrofuran . the solution is stirred overnight allowing the ice bath to melt . the mixture is filtered and the solvent removed under reduced pressure . the residue is dissolved in ethyl acetate and washed with water , a 0 . 1m citric acid solution , a saturated sodium bicarbonate solution and then a saturated brine solution . after drying over magnesium sulfate , the solvent is removed under reduced pressure . the residue is chromatographed on silica gel eluting with 7 : 3 chloroform / ethyl acetate giving 6 . 68 g of an oil . 1 . 55 g ( 0 . 014 mole ) of glycinamide hydrochloride is dissolved in 50 ml of dmf by warming to 50 °. the solution is cooled to 25 ° and 2 ml of triethylamine is added , followed by 1 . 89 g of hydroxybenztriazole , 3 . 5 g ( 0 . 014 mol ) of boc - d - leucine h 2 o and lastly , 2 . 9 g ( 0 . 014 mol ) of dicyclohexylcarbodiimide . the mixture is stirred two days at 25 ° and then evaporated in vacuo to an oil . the oil is dissolved in 200 ml etoac , 50 ml chcl 3 . the organic solution is washed with water , 20 % citric acid solution , water , 10 % na 2 co 3 solution . the etoac solution is dried over mgso 4 and the solvent removed in vacuo to a glass , 3 . 7 g ( 93 %). anal . calcd for c 13 h 25 n 3 o 4 . 1 / 4chcl 3 : c , 49 . 22 ; h , 7 . 94 , n , 13 . 25 . found : c , 48 . 57 ; h , 7 . 95 ; n , 12 . 52 . to a stirred solution of 17 g ( 0 . 168 mole ) of l - pyrrolidine - 2 - methanol in 100 ml of h 2 o at 10 ° is added 32 g ( 0 . 168 mol ) of p - toluenesulfonyl chloride in 100 ml of acetone over a 30 minute period . the ph of the solution is maintained at 11 by the addition of 2n naoh solution . after stirring one hour more , the solution is evaporated in vacuo to one - half volume and acidified with conc . hcl . the solution is extracted with etoac , the etoac dried over mgso 4 and evaporated to an oil . the oil crystallized from ether - cyclohexane , 35 g ( 83 %), mp 90 °- 91 °; [ α ] d 23 - 89 . 4 ° ( c 1 , methanol ). anal . calcd for c 12 h 17 no 3 s : c , 56 . 44 ; h , 6 . 71 ; n , 5 . 49 . found : c , 56 . 51 ; h , 6 . 51 ; n , 5 . 41 . to a stirred solution of 5 g ( 0 . 0394 mol ) of oxalyl chloride in 50 ml of ch 2 cl 2 at - 60 ° is added dropwise 7 g ( 0 . 0833 mol ) of dmso . the solution is stirred 30 minutes at - 60 ° and then 10 g ( 0 . 039 mol ) of n - tosylprolinol is added over five minutes at 60 ° and 15 ml of triethylamine is added . the solution is warmed to 25 ° and stirred one hour . the solution is then washed with h 2 o , dried over mgso 4 and the solvents removed . the residual oil , 10 g , is purified using a silica gel column and chcl 3 : meoh ( 90 : 10 ) as the eluates . an oil is obtained which solidifies , 9 . 5 g ( 96 %), mp 139 °- 140 °. anal . calcd for c 12 h 15 no 3 s : c , 56 . 89 ; h , 5 . 97 ; n , 5 . 53 . found : c , 56 . 73 ; h , 6 . 11 ; n , 5 . 39 . to a solution of 3 . 5 g ( 0 . 012 mole ) of boc - d - leuylglycinamide in 20 ml of ch 2 cl 2 at 25 ° is added 20 ml of trifluoroacetic acid . the solution is left for 15 minutes at 25 °. the solvents are evaporated in vacuo . ether gives a gummy solid which is washed five times with ether and dried in vacuo . the solid is dissolved in 100 ml of methanol and triethylamine added until the solution is basic to test paper ( ph 9 ). 3 g ( 0 . 012 mol ) of tosylproline aldehyde is added , 50 ml of dried 3 å sieves and 3 g ( 0 . 048 mol ) of sodium cyanoborohydride . the ph of the mixture is brought to 5 - 6 with solid citric acid and the mixture is stirred for five days at 25 ° c . the mixture is filtered , the methanol evaporated , and the residue is taken up in etoac . the etoac solution is extracted with h 2 o , the aqueous layer is made basic with na 2 co 3 and extracted with etoac . the etoac solution is dried and evaporated to an oil , 3 g . the oil is put through a silica gel column using chcl 3 : meoh ( 90 : 10 ) as solvent . the one spot eluted fractions are pooled and evaporated to a clear oil , 2 . 5 g ( 49 %) ir bands ; 1660 , 1520 , 1340 , 1160 , 665 , 585 , 550 . nmr bands : 0 . 8 , 0 . 9 , 1 . 7 , 3 . 0 , 3 . 8 ( quartet ), 7 . 2 , 7 . 3 , 7 . 5 , 7 . 6 . anal . calcd for c 20 h 32 n 4 o 4 s . 1 / 2h 2 o : c , 55 . 40 ; h , 7 . 68 ; n , 12 . 92 . found : c , 54 . 93 ; h , 7 . 28 ; n , 12 . 80 . a solution of 4 . 98 g of [ s -( r , r )]- n -[( 1 , 1 - dimethylethoxy ) carbonyl ]- n -[ 4 - methyl - 2 -[[[ 1 -[( 4 - methylphenyl ) sulfonyl ]- 2 - pyrrolidinyl ] methyl ] amino ] pentyl ] glycine , 1 , 1 - dimethylethyl ester , in 40 ml of trifluoroacetic acid is stirred at room temperature for two hours . the solvent is then removed under reduced pressure . the residue is dissolved in dichloromethane and the solvent removed under reduced pressure . this procedure is repeated several times . the residue is then dissolved in dichloromethane and anhydrous hydrogen chloride gas is passed through the solution . the solvent is removed under reduced pressure . the residue is dissolved in 20 ml dichloromethane and added dropwise to 200 ml ethyl ether . the solid is collected , washed with ethyl ether , and dried in vacuo at 50 ° c . giving 3 . 53 g of a white solid , mp 138 ° ( dec ), [ α ] d 23 - 69 . 1 ° ( c 2 , methanol ). to a solution of 6 . 00 g of ( s )- n [( 1 , 1 - dimethylethoxy ) carbonyl ]- n -[ 4 - methyl - 2 -[[( phenylmethoxy ) carbonyl ] amino ] pentyl ] glycine , 1 , 1 - dimethylethyl ester in 60 ml of absolute ethanol is added 0 . 3 g of 20 % palladium on charcoal . hydrogen gas is passed through the mixture for 2 . 25 hours . the mixture is filtered through celite and 0 . 1 g of fresh catalyst is added . hydrogen gas is passed through for 0 . 5 hours . the mixture is filtered through celite . to the filtrate is added 6 g of freshly activated 3 å molecular sieves and 3 . 27 g of 1 -[( 4 - methylphenyl ) sulfonyl ] 2 - pyrrolidinecarboxaldehyde . the mixture is stirred at room temperature for 1 . 5 hours . to the mixture is added a small amount of bromcresol green and 0 . 81 g of sodium cyanoborohydride . the color of the mixture is adjusted to yellow - green with a solution of hydrogen chloride gas in absolute ethanol . the mixture is stirred at room temperature for 72 hours then filtered . solid citric acid is added to the filtrate until no further gas evolution is observed . the solvent is removed under reduced pressure . the residue is taken up in ethyl acetate , washed twice with water , then a saturated sodium bicarbonate solution until basic and lastly a saturated brine solution . after drying over magnesium sulfate , the solvent is removed under reduced pressure . the residue is chromatographed on 350 g of silica gel eluting with 3 : 2 chloroform / ethyl acetate giving 5 . 03 g of an oil . to a solution of 8 . 37 g of n -[ 4 - methyl - 2 -[[( phenylmethoxy ) carbonyl ] amino ] pentyl ] glycine , 1 , 1 - dimethylethyl ester in 85 ml of dichloromethane is added a solution of 5 . 51 g of di - t - butyl dicarbonate in 15 ml of dichloromethane . the solution is stirred at room temperature overnight . an additional 2 . 01 g of di - t - butyl dicarbonate is added and the solution is stirred for 3 . 5 hours . the solvent is removed under reduced pressure . the residue is chromatographed on 670 g silica gel eluting with 95 : 5 chloroform / ethyl acetate then 9 : 1 chloroform / ethyl acetate giving 9 . 95 g of an oil . a solution of 10 . 00 g of ( s )- 1 - aziridinecarboxylic acid , 2 -( 2 - methylpropyl ) phenylmethyl ester and 11 . 25 g of glycine t - butyl ester in 100 ml of absolute ethanol is refluxed for 48 hours . the solvent is removed under reduced pressure . the residue is chromatographed on 1 kg silica gel eluting with 7 : 3 chloroform / ethyl acetate giving 8 . 54 g of an oil . a solution of 4 . 72 g of [ s -( r , r )]- n -[( 1 , 1 - dimethylethoxy ) carbonyl ]- n -[ 4 - methyl - 2 -[[[ 1 -[( 4 - methylphenyl ) sulfonyl ]- 2 - pyrrolidinyl ] carbonyl ] amino ] pentyl ] glycine - 1 , 1 - dimethylethyl ester in50 ml of trifluoroacetic acid is stirred at room temperature for 2 . 5 hours . the solvent is then removed under reduced pressure . the residue is dissolved in dichloromethane and the solvent removed under reduced pressure . this procedure is repeated several times . the residue is then dissolved in dichloromethane and anhydrous hydrogen chloride gas is passed through the solution . the solvent is removed under reduce pressure giving a foam which is suspended in ethyl ether to solidify . the solid is collected , washed with ethyl ether and dried in vacuo at 45 ° c . giving 3 . 44 g of a white amorphous solid , mp 175 ° ( dec ), [ α ] d 23 - 120 . 5 ° ( c 2 , methanol ). to a cold solution of 2 . 87 g of n -[( 4 - methylphenyl ) sulfonyl ] proline , 1 . 30 g of 1 - hydroxybenzotriazole hydrate and 3 . 17 g of glycine , n -( 2 - amino - 4 - methylpentyl )- n -[( 1 , 1 - dimethylethoxy ) carbonyl ]- 1 , 1 - dimethylethyl ester ( s ) in 30 ml of n , n - dimethylformamide is added dropwise a solution of 1 . 98 g of n , n - dicyclohexylcarbodiimide in 10 ml of n , n - dimethylformamide . the solution is stirred overnight allowing the ice bath to melt . the mixture is filtered and the solvent removed under high vacuum . the residue is taken up in ethyl acetate and filtered . the filtrate is washed with water , a saturated sodium bicarbonate solution , a saturated brine solution , and then dried over magnesium sulfate . after removing the solvent under reduced pressure , the residue is chromatographed on 300 g of silica gel eluting with chloroform / ethyl acetate ( 7 : 3 ) giving 5 . 21 g of an oil , [ α ] d 23 - 80 . 3 ° ( c 2 , methanol ). to a flame dried , n 2 purged 1 l flask is added 20 g l - carbobenzoxy proline and 250 ml tetrahydrofuran distilled from sodium aluminum hydride . cool to 3 ° c . charge 14 . 32 g carbonyldiimidazole and stir 30 minutes at 3 ° c . cool the mixture to - 45 ° c . and add 250 ml 1m diisobutyl aluminum hydride in hexane , over 10 minutes . stir an additional 35 minutes upon completion of the addition . add 500 ml cold 1n hydrochloric acid with foaming and warming to - 10 ° c . warm the mixture to 25 ° c . and separate phases . the aqueous phase is twice extracted with 250 ml ethyl acetate and these extracts are combined with the organic phase of the previous separation . this combined organic phase is extracted once with 400 ml 6 % hydrochloric acid , twice with 250 ml saturated sodium bicarbonate solution , and once with 250 ml saturated sodium chloride solution . the organic phase is dried over anhydrous magnesium sulfate , filtered , and stripped in vacuo to an oil , 17 . 5 g , 93 % yield . nmr indicates the presence of an aldehydic proton at 9 . 4 ppm in deuterochloroform . the oil is sufficiently pure for use in the following steps . to a flame dried , n 2 purged flask , add 17 . 47 g ( s )- 2 - formyl - 1 - pyrrolidine carboxylic acid , phenylmethyl ester , l - leucylglycineamide and 600 ml dry , distilled tetrahydrofuran . add 120 g 5 å molecular sieves ( predried at 400 ° c . overnight ) and stir at 25 ° c . overnight . filter , strip in vacuo to an oil . charge 500 ml dry , absolute ethanol to the oil , followed by a few crystals of bromocresol green . cool to 3 ° c . and add 8 . 17 g sodium cyanoborohydride . adjust the color of the mixture to green by the dropwise addition of a cold solution of anhydrous hydrogen chloride gas in ethanol . stir two hours at 3 ° c . then warm to 25 ° c . overnight . continue stirring for two days at 25 ° c . add 119 g citric acid , with foaming and exotherm . strip the solvent from the mixture under vacuum , giving a resin . partition the resin between 500 ml water and 500 ml ethyl acetate . separate phases and dilute the aqueous phase with 400 ml water . saturate with solid sodium bicarbonate and extract once with 500 ml ethyl acetate . wash with ethyl acetate phase once with 250 ml saturated sodium chloride solution , dry over anhydrous magnesium sulfate , filter , and strip filtrate of solvent in vacuo to a white foam , 12 . 99 g . the foam is chromatographed on 300 g silica gel , eluted with 5 / 95 methanol / chloroform . those fractions containing product are stripped of solvent in vacuo to an oil , and are crystallized from methylene chloride / ethyl ether , giving a white solid , 8 . 33 g , 32 % yield , mp 98 °- 99 °, [ α ] d 23 - 62 . 6 ° ( c 1 . 07 , methanol ). r f 0 . 34 on merck sg60 tlc plates eluted with 10 / 90 methanol / chloroform . to a flame dried , n 2 purged flask was charged 600 ml dry tetrahydrofuran , 15 . 76 g ( s )- 2 - formyl - 1 - pyrrolidinecarboxylic acid , phenylmethyl ester ( prepared as previously described ), 80 g 5 å molecular sieves ( predried at 400 ° c . overnight ) and 12 . 65 g l - leucine t - butyl ester . stir at 25 ° c . overnight , filter , and strip to a hazy oil , 31 . 45 g . to the oil add 330 ml dry absolute ethanol and a few crystals of bromocresol green . cool to 5 ° c . add 4 . 24 g sodium cyanoborohydride and adjust color of the mixture to green by the dropwise addition of a cold solution of anhydrous hydrogen chloride gas in ethanol . stir one hour at 5 ° c . then warm to 25 ° c . and stir for three days . add 70 g citric acid over one hour with offgassing , strip off ethanol under vacuum , and dissolve the resulting resin in 500 ml ethyl acetate . wash once with 250 ml water , twice with 400 ml saturated sodium bicarbonate solution , and once with 50 ml saturated sodium chloride soluton . dry the organic phase over magnesium sulfate ( anhydrous ), filter , and strip filtrate under vacuum to an oil , 24 . 1 g . chromatograph on 1000 g silica gel , eluting with 50 / 50 hexane / ethyl acetate . recover 14 . 0 g of an oil , 51 % yield . [ α ] d 23 - 49 . 4 ° ( c 1 . 06 , methanol ). r f = 0 . 54 on merck sg60 tlc plates , eluted with 50 / 50 hexane / ethyl acetate . to a 100 ml flask containing 11 . 88 g of 1 - pyrrolidinecarboxylic acid , 2 -[[[ 1 -[( 1 , 1 - dimethylethoxy ) carbonyl ]- 3 - methylbutyl ] amino ] methyl ]- phenylmethyl ester , [ s -( r , r )]- add 50 ml trifluoroacetic acid and stir at 25 ° c . for two hours . dilute with 20 ml methylene chloride and strip to an oil . repeat three times . take up oil into ethyl ether and add a solution of ethyl ether saturated with anhydrous hydrogen chloride gas , giving a precipitate . decant solvent and dry the solid in vacuo at 40 ° c ., giving a hygroscopic solid , 8 . 52 g , 76 % yield , [ α ] d 23 - 13 . 5 ° ( c 1 . 23 , methanol ). to a 250 ml flask containing 1 . 40 g ( s )- n -[ n -[ 1 -[( phenylmethoxy ) carbonyl ]- 2 - pyrrolidinyl ]- l - leucyl ] glycine methyl ester add 50 ml methanol , cool to 3 ° c . and saturate with anhydrous ammonia gas over five minutes . stopper the flask and stir overnight . remove the solvent in vacuo at less than 40 ° c . giving a white foam , 1 . 4 g . chromatograph on 50 g silica gel , eluting with 10 / 90 methanol / chloroform . recover a clear resin , 1 . 39 g . triturate with ethyl ether , giving a solid . wash with petroleum ether and dry in vacuo at 40 ° c . giving a white solid , 1 . 18 g , mp 98 °- 99 °. [ α ] d 23 - 61 . 0 ° ( c 1 . 06 , methanol ). to a 500 flask containing 7 . 33 g [ s -( r , r )]- 2 -[[( 1 - carboxy - 3 - methyl butyl ) amino ] methyl ]- 1 - pyrrolidinecarboxylic acid , phenylmethyl ester hydrochloride add 150 ml dimethylformamide and cool to - 5 ° c . add 2 . 57 g 1 - hydroxybenzotriazole , 2 . 39 g glycine methyl ester hydrochloride , and 5 . 35 ml triethylamine . add a solution of 3 . 98 g dicyclohexylcarbodiimide in 50 ml dimethylformamide over five minutes . stir and allow to warm to 25 ° c . overnight . filter and strip filtrate in vacuo to a paste . take up into 100 ml ethyl acetate and filter . wash filtrate once with 75 ml water , twice with 50 ml saturated sodium bicarbonate solution and once with 25 ml sodium chloride solution . dry organic phase over anhydrous magnesium sulfate , filter and strip in vacuo to an oil . chromatograph on 200 g silica gel , eluting with 5 / 95 methanol / chloroform , recovering an oil , 1 . 41 g , 18 % yield . r f 0 . 52 on merck sg60 tlc plates , eluted with 10 / 90 methanol / chloroform . mass specrometry detects the molecular ion at 402 . 2 . additional fragmentation supports anticipated structure . to a 500 ml flask containing ( s )- 2 - formyl - 1 - pyrrolidinecarboxylic acid , phenylmethyl ester add 250 ml dry , distilled tetrahydrofuran , and 70 g 5 å molecular sieves ( predried at 400 ° c .). add 6 . 88 g ( s )-[( 2 - amino - 4 - methylpentyl ) thio ] acetic acid , 1 , 1 - dimethylethyl ester and stir at 25 ° c . overnight . filter and strip filtrate in vacuo to a yellow oil , 14 . 6 g . dissolve in 130 ml dry absolute ethanol and cool to 5 ° c . add a few crystals of bromocresol green followed by 1 . 73 g sodium cyanoborohydride . adjust color to green by the dropwise addition of a cold solution of anhydrous hydrogen chloride gas in ethanol . stir one hour at 5 ° c . then at 25 ° c . for three days . add 31 g citric acid with foaming and stir one hour . strip in vacuo to a syrup . dissolve in 250 ml ethyl acetate , and wash once with 75 ml water , twice with 200 ml saturated sodium bicarbonate solution , and once with 50 ml saturated sodium chloride solution . the organic phase was dried over anhyrous magnesium sulfate , filtered , and stripped in vacuo to a bluish oil , 13 . 11 g . chromatograph on 500 g silica gel , eluting with 10 / 90 methanol / chloroform , recovering a yellow oil , 10 . 3 g , 80 % yield . [ α ] d 23 - 21 . 4 ° ( c 0 . 98 , methanol ). r f = 0 . 63 on merck sg60 tlc plates eluted with 10 / 90 methanol / chloroform . to a 500 ml flask containing 8 . 29 g of [ s -( r , r )]- 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] thio ] methyl ]- 3 - methylbutyl ] amino ] methyl ]- 1 - pyrrolidonecarboxylic acid , phenylmethyl ester charge 100 ml trifluoroacetic acid , stir 2 . 5 hours at 25 ° c . and strip in vacuo to an oil . add 100 ml methylene chloride and strip to an oil . add 100 ml methylene chloride , saturate with anhydrous hydrogen chloride gas , and strip to an oil . repeat once . dissolve in 50 ml ethyl acetate and adjust ph to 4 with saturated sodium bicarbonate solution . wash the mixture twice with 25 ml saturated sodium chloride solution and dry the organic phase over anhydrous magnesium sulfate . filter and strip in vacuo to an oil , 7 . 75 g . chromatograph on 300 g silica gel , eluting with 10 / 90 methanol / chloroform , recovering a yellow resin , 3 . 81 g . dissolve in methylene chloride and precipitate by addition to 250 ml petroleum ether , giving a gum . cool to - 50 ° c . and decant solvent . dry residue in vacuo , 25 ° c ., giving 3 . 48 g of a white foam , 44 % yield . [ α ] d 23 - 16 . 1 ° ( c 1 . 1 , methanol ). r f = 0 . 29 on merck sg60 tlc plates eluted with 10 / 90 methanol / chloroform . to a 1 l flask containing 12 . 84 g of [ s -( r , r )] 2 -[[[ 1 -[[( carboxymethyl ) thio ] methyl ]- 3 - methylbutyl ] amino ] methyl ]- 1 - pyrrolidinecarboxylic acid , phenylmethyl ester add 200 ml methylene chloride , 6 . 78 ml triethylamine , and 5 . 34 g ditertbutyl dicarbonate . stir at 25 ° c . overnight . add 1 . 0 g di - tert - butyl dicarbonate , stir at 25 ° c . for eight hours , then refrigerate for three days . strip in vacuo to a paste , dissolve in a minimum amount of ethyl acetate and filter . chromatograph on 300 g silica gel , eluting with 10 / 90 methanol / chloroform . recover a hazy oil , 3 . 87 g , 35 % yield . r f = 0 . 39 merck sg60 tlc plates eluted with 10 / 90 methanol / chloroform . the material is sufficiently pure to use in the next step . to a 250 ml flask , add 150 ml dry , distilled tetrahydrofuran and 3 . 87 g [ s -( r , r )]- 2 [[[ 1 -[[( carboxymethyl ) thio ] methyl ]- 3 - methylbutyl ][( 1 , 1 - dimethylethoxy ) carbonyl ] amino ] methyl ]- 1 - pyrrolidine carboxylic acid , phenylmethyl ester . cool to 0 ° c . and add 0 . 84 ml n - methylmorpholine followed by 1 . 04 ml isobutylchloroformate . a solid forms . stir 15 minutes , then sparge with anhydrous ammonia gas , giving a thick , white precipate . stir two hours at 5 ° c ., followed by two hours at 25 ° c . filter , and wash the solid with 50 ml tetrahydrofuran . strip the filtrate in vacuo to an oil 4 . 26 g . chromatograph the oil on 200 g silica gel , eluting with 15 / 85 hexane / ethyl acetate . recover a foam , 2 . 68 g , 69 % yield . [ α ] d 23 + 16 . 6 ° ( c = 1 . 07 , methanol ). r f = 0 . 50 on merck sg60 tlc plates , eluted with 10 / 90 methanol / chloroform . to a 100 ml flask containing 2 . 46 g [ s -( r , r )]- 2 -[[[ 1 -[[( 2 - amino - 2 - oxoethyl ) thio ] methyl - 3 - methylbutyl ][( 1 , 1 - dimethylethoxy ) carbonyl ] amino ] methyl ] 1 - pyrrolidinecarboxylic acid , phenylmethyl ester , add 75 ml methylene chloride and saturate with anhydrous hydrogen chloride gas . stir two hours and strip in vacuo to a foam . dissolve in a minimum amount of methylene chloride and precipitate by addition to ethyl ether . filter the solid and dry in vacuo at 40 ° c ., giving a hygroscopic foam , 1 . 7 g , 79 % yield . [ α ] d 23 - 5 . 9 ° ( c 1 . 28 , methanol ). r f = 0 . 31 on merck sg60 tlc plates , eluted with 10 / 90 methanol / chloroform . to a flame dried , n 2 purged 500 ml flask add 6 . 17 g ( s )- 2 - formyl - 1 - pyrrolidonecarboxylic acid , phenylmethyl ester , 250 ml dry , distilled thf , 93 g 5 å molecular sieves ( predried at 400 ° c .) and 5 . 30 g ( s )- glycine , n -( 2 - amino - 4 - methylpentyl )-, 1 , 1 - dimethyl ethyl ester . stir at 25 ° c . overnight . filter , and strip filtrate in vacuo to a yellow oil , 9 . 83 g . add 110 ml dry , absolute ethanol , a few crystals of bromocresol green and 1 . 38 g sodium cyanoborohydride . cool to 5 ° c . and adjust color to green by the dropwise addition of a cold solution of anhydrous hydrogen chloride gas in ethanol over four hours . add 1 . 38 g sodium cyanoborohydride , and adjust color to green as previously described . stir for two days at 25 ° c . add 45 g citric acid over one hour with foaming . strip off ethanol in vacuo and dissolve residue in 250 ml ethyl acetate . wash organic phase twice with 150 ml h 2 o . neutralize aqueous phase by addition of solid sodium bicarbonate and extract twice with 150 ml ethyl acetate . dry the organic phase over anhydrous magnesium sulfate , filter , and strip in vacuo to a clear oil , 4 . 8 g . chromatograph on 200 g silica gel , eluting with methanol . recover a yellow oil , 3 . 62 g 37 % yield . r f = 0 . 46 on merck sg60 tlc plates eluted with 10 / 90 methanol / chloroform . mass spectra detected the molecular ion of the anticipated product at 448 . 2 . additional fragmentation supports the proposed structure . the material was sufficiently pure for use in the next step . to a 100 ml flask containing 3 . 44 g ( s )- 2 -[[[ 1 -[[[ 2 -( 1 , 1 - dimethylethoxy )- 2 - oxoethyl ] amino ] methyl ]- 3 - methylbutyl ] amino ] methyl ]- 1 - pyrrolidinecarboxylic acid , phenyl methyl ester add 50 ml trifluoroacetic acetic acid and stir at 25 ° c . for 1 . 5 hours . strip under vacuum to an oil . add 50 methylene chloride and strip to an oil . repeat once . add 50 ml methylene chloride , saturate with anhydrous hydrogen chloride gas and strip to an oil . repeat once . add 50 ml methylene chloride and precipitate by addition to 400 ml anhydrous ethyl ether . filter the solid and wash with ethyl ether . dry in vacuo at 37 ° c . giving a white solid , 3 . 35 g [ α ] d 23 - 7 . 2 ° ( c 1 . 05 , methanol ). mass spectra detected the molecular ion at 392 . r f = 0 . 25 on merck sg60 tlc plates , eluted with 20 / 80 methanol / chloroform . lys ( z ) ( 40 . 0 g , 0 . 14 mol ) is taken up in 120 ml cooled 6m hbr / h 2 o . nano 2 ( 10 . 6 g , 0 . 15 mol ) is added in aliquots at 0 ° over a 30 minute period . then the reaction is stirred another five minutes . during this time more hydrobromic acid is added to help dissolve all the lys ( z ). the reaction is extracted three times with ethyl acetate . the organic phases are combined and washed with h 2 o and dried with mgso 4 . the mixture is filtered and the filtrate is evaporated down to an orange oil . this is chromatographed with meoh / chcl 3 to give 23 . 2 g of product . for c 14 h 18 no 4 br . 0 . 1 mol hbr calc : c , 47 . 72 ; h , 5 . 18 ; n , 3 . 98 . found : c , 48 . 08 ; h , 5 . 01 ; n , 3 . 98 n - carbobenzyloxy - 1 - amino - 5 - bromohexanoic acid ( 10 . 1 g , 0 . 029 mol ) is dissolved in methanol and the solution cooled . gaseous hcl is bubbled into the solution for five minutes . the reaction is stirred without the bath for three hours . the solution is retreated with hcl and stirred 3 . 5 hours . the reaction is placed in the refrigerator for three days and then evaporated down to 9 . 0 g of a yellow oil calc . : c , 50 . 29 ; h , 5 . 63 ; n , 3 . 91 . found : c , 49 . 85 ; h , 5 . 17 ; n , 3 . 81 . triphenylphosphine ( 33 . 6 g , 0 . 128 mol ) is dissolved in 150 ml thf and cooled to 0 °. 25 . 2 ml ( 0 . 128 mol ) of diisopropyl azodicarboxylate ( diad ) is added slowly and the reaction then stirred at 0 ° for one - half hour . 15 . 0 g ( 0 . 064 mol ) of 1 - carbobenzyloxy prolinol and 9 . 2 ml ( 0 . 128 mol ) of acetylthiol in 75 ml of thf are added dropwise . the reaction is stirred for one hour at 0 ° and overnight at room temperature . the reaction is evaporated down and the residue chromatographed with ch 2 cl 2 / hexane 1 / 1 . for c 15 h 19 no 3 s . 1 / 6 mol diad calc . : c , 60 . 02 ; h , 6 . 48 ; n , 5 . 70 . found : c , 59 . 83 ; h , 6 . 53 ; n , 5 . 41 . this reaction is run under n 2 . 1 - carbobenzyloxy - 2 - acetylmercaptomethylpyrrolidine ( 1 . 7 g , 0 . 0058 mol ) is dissolved in 25 ml ch 3 cn . to this is added 5 . 3 g of 54 % nh 2 nh 2 . the reaction is heated to 50 °. after one - half hour the tlc shows complete reaction . it is stirred one more hour and then evaporated down . to the residue is added ether and the solution is washed with dilute hcl solution and then h 2 o . the organic phase is dried with mgso 4 , filtered , and evaporated to 1 . 4 g of a purple oil . this is chromatographed on silica gel with isopropyl ether to give 1 . 1 g of an oil . for c 13 h 17 no 2 s . 1 / 8 mol diad : calc . : c , 60 . 84 ; h , 6 . 75 ; n , 6 . 33 . found : c , 60 . 66 ; h , 6 . 92 ; n , 6 . 30 . 1 - carbobenzyloxy - 2 - pyrrolidinemethanethiol 2 . 7 g , 0 . 0106 mol ) is taken up in thf and cooled to 0 °- 5 °. to this is added 1 . 7 g ( 0 . 043 mol ) nah . methyl , n - carbobenzyloxy - 1 - amino - 5 - bromohexanoate ( 3 . 8 g , 0 . 0106 mol ) in thf is then added dropwise . the reaction is stirred overnight allowing the bath to come to room temperature . the thf is evaporated off and the residue is taken up in ch 2 cl 2 and dilute hcl solution . the organic phase is isolated and washed with na 2 co 3 solution . the ch 2 cl 2 phase is dried with mgso 4 . the mixture is filtered and the filtrate evaporated down . the residue is chromatographed with meoh / chcl 3 to give the product . calc . : c , 63 . 01 ; h , 6 . 66 ; n , 5 . 44 . found : c , 62 . 71 ; h , 6 . 58 ; n , 5 . 40 . 5 g ( 0 . 0136 m ) of boc - lysinol ( z ) is stirred for 15 minutes in 50 % tfa / ch 2 cl 2 at room temperature . the solution is evaporated down . pet ether and ether are added and then evaporated off . this step is repeated . a solution of pet ether / ether / ch 2 cl 2 is added and the mixutre cooled . this is then evaporated down to a part oil , part solid which is dissolved in ch 2 cl 2 and ether is added . a white solid is filtered which is dried under vacuum to give 2 . 9 g of product , mp 91 °- 95 °. calc . : c , 50 . 52 ; h , 6 . 09 ; n , 7 . 37 . found : c , 50 . 50 ; h , 6 . 06 ; n , 7 . 31 . 1 . 8 g ( 0 . 0074 mol ) of z - pro is dissolved in ch 2 cl 2 and cooled to 5 °- 10 °. to this is added 1 . 13 g ( 0 . 0074 mol ) 1 - hydroxybenzotriazole , a cold solution of nε - z - lysinol . tfa ( 2 . 8 g , 0 . 0074 mol ) and et 3 n ( 1 . 0 ml , 0 . 0074 mol ) in ch 2 cl 2 , and by 1 . 7 g ( 0 . 0081 mol ) of dcc . the reaction is stirred in an ice bath , which is allowed to come to room temperature and then stirred overnight . acetic acid is added to destroy any unreacted dcc . the reaction is filtered and filtrate is washed with h 2 o , hcl solution and finally na 2 co 3 solution . the organic phase is dried with mgso 4 and filtered . the filtrate is evaporated down to a residue which is taken up in ch 2 cl 2 and filtered . this filtrate is evaporated down and ether added . a solid forms which is recrystallized from ethyl acetate - pet ether to give 2 . 5 g of product in a 67 . 9 % yield . calc . : c , 65 . 17 ; h , 7 . 09 ; n , 8 . 44 . found : c , 65 . 34 ; h , 7 . 31 ; n , 8 . 25 . glynh 2 . hcl ( 2 . 65 g , 0 . 024 mol ) is dispersed in dmf and to this is added et 3 n ( 3 . 35 ml , 0 . 024 mol ) and hobt ( 3 . 7 g , 0 . 024 mol ). 9 . 0 g ( 0 . 024 mol ) of boc - d - lys ( z ) in a large volume of dmf is added and the glynh 2 goes into solution . the total volume of dmf is 400 ml . the reaction is stirred overnight and then filtered . the solvent is evaporated off and the residue dissolved in ch 2 cl 2 . this is washed with citric acid solution , na 2 co 3 solution and then nacl solution , and dried with mgso 4 . the mixture is filtered , the filtrate evaporated down and the residue is taken up in ethyl acetate and cooled . the solid is filtered and washed with pet ether . more solid is obtained from the filtrate . both crops are combined and triturated with ether . 7 . 5 g of a tan , solid is obtained in a 71 % yield : calc : c , 57 . 78 ; h , 7 . 39 ; n , 12 . 84 . found : c , 58 . 45 ; h , 7 . 27 ; n , 12 . 66 . boc - d - lys ( z )- glynh 2 ( 7 . 3 g , 0 . 017 mol ) is dissolved in ch 2 cl 2 and an equal volume of trifluoroacetic acid is added . the solution is stirred at room temperature for 15 - 20 minutes . the reaction is evaporated down and ch 2 cl 2 added . this is evaporated down and pet ether , ether and ch 2 cl 2 are added . the flask is placed in the refrigerator overnight . the solvent is decanted and a solid is obtained by triturating in ether / pet ether . the product is dried under vacuum to give 6 . 8 g of a tan solid . for c 16 h 24 n 4 o 4 . 1 . 2 mol tfa : calc : c , 46 . 70 ; h , 5 . 36 ; n , 11 . 84 . found : c , 46 . 58 ; h , 5 . 34 ; n , 11 . 63 . d - lys - glynh 2 . 1 . 2 tfa ( 6 . 65 g , 0 . 014 mol ) is dissolved in methanol and the ph is brought to 7 with et 3 n . to this is added boc - prolinal ( 2 . 8 g , 0 . 014 mol ), 3å molecular sieves ( activated ) and nacnbh 3 ( 3 . 1 g , 0 . 05 mol ). the ph is adjusted to 5 and the reaction is stirred at room temperature over the weekend . the mixture is filtered and the filtrate evaporated down . the residue is taken up in ethyl acetate and washed with citric acid solution , na 2 co 3 solution and then h 2 o . the organic phase is dried with mgso 4 , filtered and evaporated down to 3 . 9 g of an orange oil . this is chromatographed using flash chromatography with ch 2 cl 2 - meoh as eluent . 700 mg of product is obtained . for c 26 h 41 n 5 o 6 . 1 / 4ch 2 cl 2 : calc . : c , 58 . 29 ; h , 7 . 73 , n , 12 . 95 . found : c , 58 . 52 ; h , 7 . 24 ; n , 13 . 07 . 2 -[[[ 1 -[[( 2 - amino - 2 - oxoethyl ) amino ] carbonyl ]- 5 -[[( phenylmethoxy ) carbonyl ] amino ] pentyl ] amino ] methyl ]- 1 - pyrrolidinecarboxylic acid , 1 , 1 - dimethylethyl ester ( 1 . 0 g , 0 . 0019 mol ) is dissolved in ch 2 cl 2 and an equal portion of trifluoroacetic acid is added . the solution is stirred at room temperature for 15 minutes . the reaction is evaporated down and the residue dissolved in ch 2 cl 2 and reevaporated . this is repeated a number of times to remove the trifluroacetic acid . ether / pet ether is added and the mixture is cooled . a hygroscopic solid is filtered , dissolved in a solvent and evaporated to a foam . pet ether is added and a solid is filtered , which is dried under vacuum . calc . : c , 46 . 37 ; h , 5 . 45 ; n , 10 . 81 ; f , 17 . 60 . found : c , 45 . 04 ; h , 5 . 39 ; n , 11 . 06 ; f , 17 . 83 . under nitrogen , a suspension of 84 . 0 g of 1 - trimethylsilyl - propyne - 3 - triphenylphosphonium bromide ( j . chem . soc . 1981 ( 1974 ) in 1 l tetrahydrofuran is cooled to - 80 ° and treated dropwise with 88 . 3 ml of a 2 . 1m solution of n - butyl lithium in hexane . after stirring for 45 minutes at - 80 °, the mixture is treated dropwise with a solution of 39 . 9 g of n -( t - butoxycarbonyl )- l - leucinal ( synthesis 676 ( 1983 ) in 600 ml of tetrahydrofuran . after stirring at - 80 ° for 30 minutes , the mixture is allowed to warm to room temperature over two hours . the mixture is concentrated to one - half volume under reduced pressure and poured into 1 l of water . the mixture is extracted with ether , then two times with petroleum ether . the combined organic extracts are washed with saturated sodium chloride solution , dried over magnesium sulfate and the solvent removed under reduced pressure . the residue is dissolved in petroleum ether and the insoluble triphenylphosphine is filtered off . removal of the solvent under reduced pressure gives the crude product . after chromatography on silica gel , eluting with chloroform , there is obtained 34 . 2 g of [ s -( e )] 1 , 1 - dimethylethyl [ 1 - 2 - methylpropyl )- 5 -( trimethylsilyl )- 2 - penten - 4 - ynyl ] carbamate sufficiently pure to use in the following reaction . under nitrogen , a solution of 316 ml of borane ( 1n in tetrahydrofuran ) is cooled in ice and treated dropwise with a solution of 64 ml of cyclohexene in 890 ml of tetrahydrofuran . after stirring at 0 ° for thirty - five minutes , the solution is treated dropwise with a solution of 27 . 94 g of [ s -( e )] 1 , 1 - dimethylethyl [ 1 -( 2 - methylpropyl )- 5 -( trimethylsilyl )- 2 - penten - 4 - ynyl ] carbamate in 110 ml of tetrahydrofuran . after stirring for one - half hour , the solution is treated dropwise with 112 ml of methanol , 157 ml of 2n sodium hydroxide , and then over one - half hour with 102 ml of 30 % hydrogen peroxide , keeping the temperature below - 10 °. the solution is then stirred for one - half hour , and poured into 2 . 2 l of water containing 112 ml of 2n sodium hydroxide . after extracting three times with ether , the ph is adjusted to 2 . 0 and the solution extracted three times with ether . the combined ether extracts are washed with saturated sodium chloride solution and dried over magnesium sulfate . removal of the solvent under reduced pressure and chromatography on silica gel , eluting with chloroform / methanol ( 95 / 5 ) gives 10 . 7 g [ s -( e )]- 5 -[[( 1 , 1 - dimethylethoxy ) carbonyl ] amino ]- 7 - methyl - 3 - octenoic acid as an oil suitable for use in subsequent reactions . the product is characterized by converting a small amount to the dicyclohexylamine salt , mp 126 °- 128 ∞, [ α ] d 23 - 18 ° ( c 1 . 02 , methanol ). a solution of 6 . 0 g [ s -( e )]- s -[[( 1 , 1 - dimethylethoxy ) carbonyl ] amino ]- 7 - methyl - 3 - octenoic acid in 60 ml tetrahydrofuran is cooled in ice and treated with 2 . 44 ml of n - methylmorpholine followed by the dropwise addition of 2 . 9 ml of isobutylchloroformate . after 5 minutes at 0 °, 6 . 0 ml of concentrated ammonium hydroxide is added and the solution allowed to stir at 0 ° for one hour . the solvent is removed under reduced pressue and the residue taken up in ethyl acetate , washed with water , 1n citric acid , saturated sodium bicarbonate , and then with saturated sodium chloride . after drying over magnesium sulfate and removal of the solvent under reduced pressue , the residue is chromatographed on silica gel , eluting with chloroform / methanol ( 9 : 1 ). there is obtained 3 . 5 g of [ s -( e )] 1 , 1 - dimethylethyl [ 5 - amino - 1 -( 2 - methylpropyl )- 2 - pentenyl ] carbamate as an oil which solidifies on standing . the material is suitable for use in the following reaction . a small sample , recrystallized from toluene / hexane has mp 85 °- 89 °. a solution of 6 . 23 g of [ s -( e )] 1 , 1 - dimethylethyl [ 5 - amino - 1 -( 2 - methylpropyl )- 2 - pentenyl ] carbamate in 60 ml of trifluoroacetic acid is stirred at room temperature for one hour . the trifluoroacetic acid is removed under reduced pressure , the residue taken up in dichloromethane , and the solvent removed again . the residue is taken up in dichloromethane and hydrogen chloride gas bubbled into the solution for a few minutes . the solvent is then removed under reduced pressure . the residue is taken up in a small amount of dichloromethane and added dropwise to excess ether . the solid is collected and washed with ether . there is obtained 4 . 14 g of [ s -( e )]- 5 - amino - 7 - methyl - 3 - octenamide , monohydrochloride suitable for use in the following reaction , [ α ] d 23 - 20 . 0 ° ( c 1 . 04 , methanol ). to a suspension of 2 . 0 g of [ s -( e )]- 5 - amino - 7 - methyl - 3 - octenamide , monohydrochloride in 50 ml of tetrahydrofuran is added 2 . 42 g of z - proline and 1 . 31 g of hydroxybenzotriazole hydrate . the mixture is cooled in ice and treated with 1 . 35 ml of triethylamine followed by a solution of 2 . 0 g of dicyclohexylcarbodiimide in 10 ml of tetrahydrofuran . the solution is kept at 0 ° for one hour , then at room temperature overnight . the solution is then filtered and the filtrate concentrated under reduced pressure . the residue is taken - up in ethyl acetate and washed with water , 1n citric acid , saturated sodium bicarbonate , and then with saturated sodium chloride . after drying over magnesium sulfate and removal of the solvent under reduced pressure , the residue is chromatographed on silica gel , eluting with chloroform / methanol ( 95 / 5 ). after combining the appropriate fractions and trituating the residue with ethyl acetate / hexane , there is obtained 1 . 54 g of [ s -( r , r -( e )]- phenylmethyl 2 -[[[ 5 - amino - 1 -( 2 - methylpropyl )- 5 - oxo - 2 - pentenyl ] amino ] carbonyl ]- 1 - pyrrolidinecarboxylate , mp 140 °- 142 °, [ α ] d 23 - 73 . 0 ° ( c 1 . 03 , methanol ). to a suspension of 2 . 1 g of [ s -( e )]- 5 - amino - 7 - methyl - 3 - octenamide , monohydrochloride ( prepared in example 97 ) in 40 ml of n , n - dimethylformamide is added 1 . 32 of l - pyroglutamic acid , and 1 . 38 g of hydroxybenzotriazole hydrate . the mixture is cooled in ice and treated with 1 . 42 ml of triethylamine followed by a solution of 2 . 1 g of dicyclohexylcarbodiimide in 10 ml of n , n - dimethylformamide . the solution is kept at 0 ° for one hour , then at room temperature overnight . after filtering to remove dicyclohexylurea , the solvent is removed under high vacuum . the residue is taken up in chloroform and washed twice with water . on cooling the water extracts , hydroxybenzotriazole precipitates and is removed by filtration . the filtrate in lyophilized . the residue is chromatographed on silica gel , eluting with chloroform / methanol ( 85 / 15 ). combining the appropriate fractions and recrystallizing the residue from acetonitrile gives 1 . 03 g of [ s -( r , r - e )]- n -[ 5 - amino - 1 -( 2 - methylpropyl )- 5 - oxo - 2 - pentenyl ]- 5 - oxo - 2 - pyrrolidinecarboxyamide , mp 150 °- 152 °, [ α ] d 23 - 39 . 1 ° ( c 1 . 19 , methanol ).	8
a first embodiment of a conductivity measuring apparatus according to the invention will be explained in details in reference to the drawings as follows . fig1 through fig8 are explanatory views of the conductivity measuring apparatus of the first embodiment of the invention . fig1 is a constitution view of the conductivity measuring apparatus and fig2 is a perspective view of an essential portion of the conductivity measuring apparatus . further , according to the embodiment , an explanation will be given by taking an example of a case of utilizing optical lever system . as shown in fig1 and fig2 , the conductivity measuring apparatus 1 of the embodiment is an apparatus for measuring a conductivity of a sample s 1 and generally includes a sample base 2 , a two terminals tweezers 15 ( tweezer member ), a probe base 7 , oscillating means 1 , displacement measuring means 11 , probe driving means 12 , moving means 13 , first measuring means 35 , and controlling means 14 . the sample s 1 in a shape of a flat plate constituting an object to be measured is fixed on a sample support face 2 a provided at the sample base 2 by fixing means , not illustrated . further , when normally using the conductivity measuring apparatus 1 , the sample supporting face 2 a is arranged in parallel with a horizontal face and two directions orthogonal to each other in parallel with the sample support face 2 a correspond to the x direction and the y direction and a direction orthogonal to the x direction and the y direction corresponds to the z direction . the two terminals tweezers 15 is constituted by an observing probe 3 and a grasping probe 4 arranged on an upper side of the sample s 1 and arranged to be contiguous to each other in a state of being spaced apart from each other by a predetermined separating distance g on an imaginary face c 1 in parallel with the sample support face 2 a . further , a front end 3 a of the observing probe 3 is provided with a conductive first tip 5 and a front end 4 a of the grasping probe 4 is provided with a conductive second tip 6 . further , also an imaginary line c 2 connecting a front end 5 a of the first tip 5 and a front end 6 a of the second tip 6 is set to be in parallel with the imaginary face c 1 . as shown by fig2 , also the first tip 5 and the second tip 6 are arranged to be contiguous to each other in a state of being spaced apart from each other by the separating distance g , and a side of a base end 3 b of the observing probe 3 and a side of a base end 4 b and the grasping probe 4 are fixed to the probe base 7 respectively in a cantilever state . the first tip 5 and the second tip 6 are formed by a conductive material such as tungsten , and the observing probe 3 and the grasping probe 4 are formed by silicon . further , the observing probe 3 and the grasping probe 4 are electrically insulated from each other . further , the observing probe 3 and the grasping probe 4 are set such that respective resonance frequencies in z direction differ from each other . the observing probe 3 is fixed with a piezoelectric member 16 for vibrating the observing probe 3 . the piezoelectric member 16 is made to be vibrated at a predetermined frequency ( f 0 ) and a predetermined amplitude ( a 0 ) by receiving a signal from a piezoelectric member control portion 17 to transmit the vibration to the observing probe 3 . thereby , the observing probe 3 is vibrated at the predetermined frequency ( f 0 ) and the predetermined amplitude ( a 0 ) similar to the piezoelectric member 16 . that is , the piezoelectric member 16 and the piezoelectric member control portion 17 function as the oscillating means 10 . a middle portion of the grasping probe 4 and the probe base 7 are respectively provided with pairs of combteeth ( combteeth - shaped part ) 4 c and combteeth ( combteeth - shaped part ) 7 a in correspondence with each other formed in recessed and projected shapes so as not to be brought into contact with each other . further , opposed faces of the pairs of the combteeth 4 c and the combteeth 7 a are respectively provided with electrodes 4 d and electrodes 7 b . further , it is preferable to set such that a rigidity of the combteeth 7 a becomes high such that the combteeth 7 a is not moved . the electrode 4 d and the electrode 7 b are connected to a voltage apparatus 18 for combteeth . when a voltage is applied between the pair of electrodes 4 a and the electrodes 7 b by the voltage apparatus 18 for combteeth , by attracting the electrode 4 a and the electrode 7 b , a side of the front end 4 a of the grabbing probe 4 is moved to a side of the front end 3 a of the observing probe 3 , and a distance of separating the first tip 5 and the second tip 6 is adjusted . that is , the combteeth 4 c , the combteeth 7 a , the electrode 4 d , the electrode 7 b and the voltage apparatus 18 for combteeth function as the probe driving means 12 . further , the voltage apparatus 18 for combteeth corresponds to a voltage apparatus in the scope of claims . further , the piezoelectric member control portion 17 and the voltage apparatus 18 for combteeth are connected to a control portion 32 . further , the conductivity measuring apparatus 1 includes oscillating means 10 for vibrating the observing probe 3 by the predetermined frequency and the predetermined amplitude , a current apparatus 8 for generating a current flowing between the first tip 5 and the second tip 6 , and a voltage measuring apparatus 9 of measuring a voltage generated between the first tip 5 and the second tip 6 . further , the current apparatus 8 and the voltage measuring apparatus 9 function as the first measuring means 35 . as shown by fig1 , the sample base 2 is mounted on an xy scanner 21 and mounted on a vibration isolating base , not illustrated . the xy scanner 21 is constituted by , for example , a piezoelectric element and is made to move by a small amount in xy directions in parallel with the sample support base 2 a by being applied with a voltage from an xyz scanner control portion 22 including an xy scanning system and a z servo system . thereby , the sample s 1 can be moved by a small amount in xy directions . further , a holder portion 19 is fixed to hang down from the z scanner 23 , and the probe base 7 is fixed to a lower side of the holder portion 19 . the z scanner 23 is constituted by , for example , a piezoelectric element similar to the xy scanner 21 and is made to move by a small amount in z direction orthogonal to the sample support face 2 a , that is , orthogonal to a surface of the sample s 1 by being applied with a voltage from the xyz scanner control portion 22 . thereby , the observing probe 3 and the grabbing probe 4 fixed to the probe base 7 are made to be able to move by a small amount in z direction . that is , the xy scanner 21 , the z scanner 23 and the xyz scanner control portion 22 are made to function as the moving means 13 for moving the probe base 7 and the sample base 2 such that the probe base 7 is moved in directions in parallel with x direction , y direction and z direction , that is , in three - dimensional directions relative to the sample support face 2 a . further , a laser light source 25 for irradiating laser light l to a reflecting face , not illustrated , formed on a back face side of the observing probe 3 , and a optical detecting portion 27 of receiving laser light l reflected by the reflecting face by utilizing a mirror 26 are provided above the sample base 2 . the optical detecting portion 27 is , for example , a photodiode an incident face of which is divided into 2 or divided into 4 for detecting a state of vibrating the observing probe 3 from an incident position of the laser light l . further , the optical detecting portion 27 outputs a detected displacement of a state of vibrating the observing probe 3 in z direction to a preamplifier 28 as a dif signal . that is , the laser light source 25 , the mirror 26 , and the optical detecting portion 27 are made to function as the displacement measuring means 11 for measuring the displacement of the observing probe 3 . further , an optical microscope 29 for observing the sample base 2 is provided above the sample base 2 . the dif signal outputted from the optical detecting portion 27 is amplified by the preamplifier 28 , thereafter , transmitted to an alternating current - direct current converting circuit 30 to be converted into a direct current and is transmitted to a z voltage feedback circuit 31 . the z voltage feedback circuit 31 carries out a feedback control through the xyz scanner control portion 22 such that the dif signal converted into the direct current becomes always constant . thereby , when an afm observation of the sample s 1 is carried out , a distance between the surface of the sample s 1 and the front end 5 a of the first tip 5 provided at the observing probe 3 can be controlled such that a state of vibrating the observing probe 3 in z direction becomes constant , specifically , an amount of attenuating an amplitude or an amount of shifting a frequency , or an amount of shifting a phase becomes constant . further , the z voltage feedback circuit 31 is connected with the control portion 32 , and the control portion 32 is made to be able to acquire observing data of the sample base s 1 based on a signal transmitted by the z voltage feedback circuit 31 . further , the control portion 32 outputs xy scanning signals to the xyz scanner control portion 22 . thereby , a position data or a shape data of the sample s 1 is made to be able to be acquired . in this way , the preamplifier 28 , the alternating current - direct current converting circuit 30 , the z voltage feedback circuit 31 and the control portion 32 are made to function as the controlling means 14 . further , the controlling means 14 generally controls the above - described respective constituent portions . next , an explanation will be given as follows of steps of calculating a conductivity between measured points of the sample s 1 in a small region of the sample s 1 after observing the sample s 1 on the sample base 2 by the conductivity measuring apparatus 1 constituted in this way . fig3 is a flowchart showing steps of calculating the conductivity , and fig4 through fig6 are explanatory views showing respective steps of calculating the conductivity . first , an initial setting is carried out before carrying out the steps . that is , as shown by fig1 and fig2 , positions of the laser light source 25 and the optical detecting portion 27 are adjusted such that the laser light l is firmly incident on the reflecting face of the observing probe 3 , further , such that the reflecting laser light l is firmly incident on the optical detecting portion 27 . further , a signal is outputted from the piezoelectric control portion 17 to the piezoelectric electric member 16 and the piezoelectric member 16 is vibrated by the predetermined frequency ( f 0 ) and the predetermined amplitude ( a 0 ). thereby , as shown by fig4 , the observing probe 3 is vibrated by the predetermined frequency ( f 0 ) and the predetermined amplitude ( a 0 ) in z direction . after finishing the initial setting , at a data acquiring step ( step s 11 ) shown in fig3 , first , a state of a total of the surface of the sample s 1 is observed by the optical microscope 29 , and an outline of an outer shape of a surface of the sample s 1 and an outline position of a measured point are grasped . successively , afm observation of the sample s 1 is carried out . specifically , as shown by fig1 and fig4 , the surface of the sample s 1 is scanned by the xy scanner 21 in a state of controlling a height or a distance between the first tip 5 provided at the front end 3 a of the observing probe 3 and the surface of the sample s 1 while vibrating the observing probe 3 by the predetermined amplitude ( a 0 ) in z direction such that the state of vibrating the observing probe 3 in z direction becomes constant . at this occasion , the amplitude of the observing probe in z direction is going to be increased or reduced in accordance with recesses and projections of the surface of the sample s 1 , and therefore , the amplitude of laser light l ( laser light reflected by the reflecting face ) incident on the optical detecting portion 27 shown in fig1 differs . the optical detecting portion 27 outputs the dif signal in accordance with the amplitude to the preamplifier 28 . the outputted dif signal is amplified by the preamplifier 28 , converted into the direct current by the alternating current - direct current converting circuit 30 , thereafter , transmitted to the z voltage feedback circuit 31 . the z voltage feedback circuit 31 carries out the feedback control by moving the z scanner 23 by a small amount in z direction by the xyz scanner control portion 22 such that the dif signal converted into the direct current becomes always constant ( that is , amplitude in z direction of the observing probe 3 becomes constant ). thereby , the surface of the sample s 1 can be scanned in the state of controlling the height or the distance between the surface of the sample s 1 and the first tip 5 such that the state of vibrating the observing probe 3 in z direction becomes constant . further , the control portion 32 can acquire data of observing the surface of the sample s 1 based on a signal transmitted by the z voltage feedback circuit 31 for moving up and down the z scanner 23 . as a result , the position data and the shape data of the sample s 1 can be acquired and it can be grasped at which place of the sample s 1 the measured point p is arranged . next , at a positioning step ( step s 12 ), the measured point p is determined based on the acquired position data and the acquired shape data , the xy scanner 21 and the z scanner 23 are moved by the xyz scanner control portion 22 , move to position the probe base 7 such that the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 are arranged at the measured point p as shown by fig5 . an imaginary line c 2 connecting the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 is set to be in parallel with the imaginary face c 1 , that is , in parallel with the sample support face 2 a . further , the sample s 1 is constituted by the shape of the flat plate , and therefore , the imaginary line c 2 becomes in parallel with an upper face of the sample s 1 . further , by the moving means 13 , the two terminals tweezers 15 is moved in a direction in parallel with the sample support face 2 a and a direction orthogonal to the sample support face 2 a . therefore , the front end 5 a of the first tip 5 a and the front end 6 a of the second tip 6 can simultaneously be pressed to the sample s 1 . further , it has already been grasped by the afm observation at which place of the surface of the sample s 1 the measured point p is disposed , and therefore , the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 can swiftly be positioned . next , at a probe pressing step ( step s 13 ), as shown by fig6 , the two terminals tweezers 14 is moved to a side of the sample s 1 , that is , in z direction by a predetermined length d and the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 are pressed to the sample s 1 . here , forces of pressing the sample s 1 by the respective tips are determined by a spring constant in z direction of each probe and a bending amount in z direction , in this case , the predetermined length d . that is , by constituting the bending amount in z direction of each probe by the predetermined length d at respective measurements , the force of pressing the sample s 1 respectively by the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 is adjusted to be constant without depending on the measurement . thereby , a reproducibility of the force of pressing the measured point p of the sample s 1 respectively by the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 can be promoted . finally , at a measuring step ( step s 14 ), first , a constant current flowing between the first tip 5 and the second tip 6 is generated by the current apparatus 8 and a voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 . further , the voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 while changing an interval between the first tip 5 and the second tip 6 by moving the side of the front end 4 a of the grasping probe 4 to the side of the front end 3 a of the observing probe 3 by changing the voltage applied between the electrode 4 d and the electrode 7 b by the voltage apparatus 18 for combteeth . as described above , a voltage value v generated between the first tip 5 and the second tip 6 is measured by making a current of a constant current value io flow between the first tip 5 and the second tip 6 . at this occasion , as shown by fig7 , a synthesized resistance value q calculated by dividing the measured voltage value by the measured current value includes not only a resistance r between the measured points of the sample s 1 but an internal resistance r 1 provided by the first tip 5 , the observing probe 3 , the voltage measuring apparatus 9 and the like , and a contact resistance r 2 generated respectively between the first tip 5 and the second tip 6 and the surface of the sample s 1 . however , a dispersion in the press force is restrained , and therefore , the contact resistance r 2 is substantially constant , and also the internal resistance r 1 becomes constant by using the same conductivity measuring apparatus . therefore , when the voltage generated between the first tip 5 and the second tip 6 is measured as v 1 , v 2 , . . . by the voltage measuring apparatus 9 while changing a distance g of separating the first tip 5 and the second tip 6 as g 1 , g 2 , equation ( 3 ) through equation ( 4 ) shown below are established . v 1 / i o = i o = q 1 = r 1 +( r 1 + r 2 ) ( 3 ) v 2 / i o = i o = q 2 = r 2 +( r 1 + r 2 ) ( 4 ) where , r 1 , r 2 , . . . : resistance values for measured intervals g 1 , g 2 , . . . of sample s 1 further , a value calculated by an equation ( r 1 + r 2 ) can be provided by approximating a relationship of the synthesized resistance value q of the ordinate relative to the distance g of separating the first tip 5 and the second tip 6 of the abscissa and calculating a value of a segment thereby as shown by fig8 . that is , a further accurate resistance value r between the measured points of the sample s 1 of separating the internal resistance r 1 and the contact resistance r 2 from the calculated synthesized resistance value q can be calculated . further , the conductivity of the sample s 1 can be calculated from the calculated resistance value r . in this way , according to the conductivity measuring apparatus of the embodiment of the invention , the separating distance g between the two terminals tweezers 15 is adjusted by the single probe driving means 12 , and therefore , the separating distance g can accurately and continuously be adjusted . further , the separating distance g can accurately be adjusted , and therefore , the conductivity can accurately be measured by making the separating distance g between the two terminals tweezers 15 near to the predetermined small distance equal to or smaller than , for example , 100 nanometers . further , the distance between the pairs of combteeth 4 c and combteeth 7 a respectively provided at the middle portions of the probe base 7 and the grabbing probe 4 and in correspondence with each other can be adjusted by an electrostatic force operated between the electrode 4 d and the electrode 7 b by applying a voltage between the pairs of electrodes 4 d and the electrodes 7 b by the voltage apparatus 18 for combteeth . thereby , the separating distance g between the observing probe 3 and the grabbing probe 4 can further accurately and continuously be adjusted . further , the conductivity between the measured points p of the sample s 1 is measured while changing the separating distance g of the observing probe 3 and the grasping probe 4 , and therefore , an influence of the separating distance g between the observing probe 3 and the grabbing probe 4 effected on the electric property can be measured , and the conductivity between the measured points p of the sample s 1 can further accurately be measured . further , according to the first embodiment , the voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 while changing the separating distance g of the first tip 5 and the second tip 6 by generating the constant current flowing between the first tip 5 and the second tip 6 by the current apparatus 8 . however , the current flowing between the first tip 5 and the second tip 6 may be measured by the current measuring apparatus while changing the interval between the first tip 5 and the second tip 6 by generating the constant voltage applied between the first tip 5 and the second tip 6 by the constant voltage apparatus 8 . a second embodiment of the conductivity measuring apparatus according to the invention will be explained in details in reference to the drawings as follows . fig9 through fig1 are explanatory views of a conductivity measuring apparatus of a second embodiment of the invention . fig9 is a constitution view of a conductivity measuring apparatus and fig1 is a perspective view of an essential portion of the conductivity measuring apparatus . further , for convenience of explanation , in the second embodiment of the invention , constituent elements which are the same as constituent elements explained in the above - described first embodiment are attached with the same notations and an explanation thereof will be omitted . the second embodiment differs from the above described first embodiment only in an essential portion of a conductivity measuring apparatus 50 . specifically , as shown in fig9 and fig1 , in addition to the observing probe 3 and the grasping probe 4 provided at the conductivity measuring apparatus of the first embodiment , outer sides of the observing probe 3 and the grasping probe 4 are provided with a pair of outer side probes 53 , 54 arranged to be remote from the two probes 3 , 4 . respective front ends 53 a and 54 a of the pair of outer side probes 53 and 54 are provided with outer side styluses 55 and 56 . further , the front end 55 a of the outer side stylus 55 and the front end 56 a of the outer side stylus 56 are arranged on the imaginary line c 2 connecting the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 . further , the probe base 7 fixed with the base end 3 b of the observing probe 3 and the base end 4 b of the grasping probe 4 according to the first embodiment is fixed with also respective base ends 53 b and 54 b of the pair of outer side probes 53 and 54 respectively in the cantilever state according to the second embodiment . further , a 4 terminals tweezers 57 is constituted by the observing probe 3 , and the grasping probe 4 and the pair of outer side probes 53 and 54 . further , the outer side styluses 55 and 56 are formed by a conductive material of , for example , tungsten and the pair of outer side probes 53 and 54 are formed by silicon . although the current apparatus 8 of the first embodiment generates the current flowing between the first tip 5 and the second tip 6 , the current apparatus 8 of the second embodiment generates a current flowing between the outer side styluses 55 and 56 . further , the voltage measuring apparatus 9 measures the voltage generated between the first tip 5 and the second tip 6 similar to the first embodiment . further , the current apparatus 8 and the voltage measuring apparatus 9 are made to function as the second measuring means 58 . next , an explanation will be given as follows of steps of observing the sample s 1 on the sample base 2 , thereafter , calculating the conductivity between the measured points of the sample s 1 at a small region of the sample s 1 by the conductivity measuring apparatus 50 constituted in this way . the steps of the second embodiment are common up to a data acquiring step ( step s 11 ) of the first embodiment shown in fig3 and only contents of the steps of a positioning step ( step s 12 ) and thereafter differ . at the positioning step ( step s 12 ), the measured point p is determined based on acquired position data and acquired shape data , the xy scanner 21 and the z scanner 23 are moved by the xyz scanner control portion 22 , as shown by fig1 , the probe base 7 is moved to position such that the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 are arranged at the measured point p to proceed to step s 13 . the front end 5 a of the first tip 5 , and the front end 6 a of the second tip 6 , a front end 55 a of the outer side stylus 55 and a front end 56 a of the outer side stylus 56 are arranged on an imaginary line c 2 and the imaginary line c 2 is set to be in parallel with an imaginary face c 1 , that is , in parallel with the sample support face 2 a . further , the sample s 1 is constituted by a shape of a flat plate , and therefore , the imaginary line c 2 is in parallel with an upper face of the sample s 1 . further , a movement is carried out in a direction in parallel with the sample support face 2 a and a direction orthogonal to the sample support face 2 a by the moving means 13 . the 4 terminals tweezers 57 is moved in a direction in parallel with the sample support face 2 a and the direction orthogonal to the sample support face 2 a by the moving means 13 . therefore , the front end 5 a of the first tip 5 , the front end 6 a of the second tip 6 , the front end 55 a of the outer side stylus 55 and the front end 55 a of the outer side stylus 56 can simultaneously be pressed to the sample s 1 . further , it has already been grasped by afm observation at which place on the surface of the sample s 1 the measured point p is disposed , and therefore , the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 can swiftly be positioned . next , at the probe pressing step ( step s 13 ), the z scanner 23 is moved by the xyz scanner control portion 22 , as shown by fig1 , the 4 terminals tweezers 57 is moved to a side of the sample s 1 , that is , in z direction by a predetermined length d , and the front end 5 a of the first tip 5 , the front end 6 a of the second tip 6 , the front end 55 a of the outer side stylus 55 and the front end 56 a of the outer side stylus 56 are pressed to the sample s 1 . here , forces of pressing the sample s 1 by 4 of the respective styluses are determined by spring constants in z direction and bending amounts in z direction of the respective probes , in this case , the predetermined length d . therefore , by constituting the bending amounts in z direction of 4 of the respective probes by the predetermined length d at respective measurements , forces of pressing the sample s 1 respectively by the front end 5 a of the first tip 5 and the front end 6 a of the second tip 6 , the front end 55 a of the outer side stylus 55 and the front end 56 a of the outer side stylus 56 for respective measurements are adjusted to be constant without depending on the measurements . thereby , the forces for pressing the front ends of the 4 styluses respectively to the measured point p of the sample s 1 can be reproduced . finally , at the measuring step ( step s 14 ), first , a constant current flowing between the outer side styluses 55 , 56 is generated by the current apparatus 8 , and a voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 . further , a voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 while changing the separating distance g of the first tip and the second tip 6 by moving the side of the front end 4 a of the grasping probe 4 to the side of the front end 3 a of the observing probe 3 by changing the voltage applied between the electrode 4 d and the electrode 7 b by the voltage apparatus 18 for combteeth . in this way , according to the conductivity measuring apparatus of the embodiment of the invention , the voltage is measured by using 4 pieces of the styluses of the first tip 5 , the second tip 6 and the outer side styluses 55 and 56 , and therefore , as shown by fig1 , a change in the voltage relative to the distance between the measured points p of the sample s 1 can be measured by further effectively restraining an influence of the internal resistance r 1 provided to the outer side styluses 55 , 56 , the outer side probes 53 , 54 and the voltage measuring apparatus 9 and the like , and the contact resistance r 2 generated between the first tip 5 and the surface of the sample s 1 and the like . further , the conductivity of the sample s 1 can be calculated from the measured voltage . in this way , the conductivity between the measured points of the sample s 1 can be calculated by restraining a dispersion in the force of pressing the sample s 1 by the measurement and a dispersion in the pressing force among the styluses . further , according to the second embodiment , the constant current flowing between the outer side styluses 55 and 56 is generated by the current apparatus 8 , and the voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 while changing the separating distance g of the first tip 5 and the second tip 6 . however , a constant voltage applied between the outer side styluses 55 and 56 may be generated by the constant voltage apparatus 8 , and the current flowing between the first tip 5 and the second tip 6 may be measured by the current measuring apparatus while changing the interval between the first tip 5 and the second tip 6 . a third embodiment of a conductivity measuring apparatus according to the invention will be explained in details in reference to the drawings as follows . further , for convenience of explanation , in the third embodiment of the invention , constituent elements which are the same as constituent elements explained in the above - described first embodiment and second embodiment are attached with the same notations and an explanation thereof will be omitted . the third embodiment is the same as the first embodiment in the constitution of the conductivity measuring apparatus 1 and is different therefrom only in a shape of a sample a conductivity of which is measured and a portion of steps of measuring the conductivity . specifically , although according to the first embodiment , the sample s 1 in the shape of the flat plate is measured , according to the third embodiment , as shown by fig1 , for example , a small predetermined portion s 2 of the sample s 1 having a diameter equal to or smaller than several micrometers constitutes an object of measurement . next , an explanation will be given as follows of steps of calculating a conductivity of a small predetermined portion after observing the sample on the sample base . fig1 is a flowchart showing steps of calculating the conductivity , and fig1 and fig1 are explanatory views of the conductivity measuring apparatus of the third embodiment . further , the initial step described in the first embodiment is carried out before carrying out respective steps of the third embodiment . after finishing the initial setting , at a data acquiring step ( step s 21 ) shown in fig1 , a step the same as the data acquiring step ( step s 11 ) shown in fig3 of the first embodiment is carried out . however , according to the embodiment , by afm observation of the sample s 1 , a position and a shape of the predetermined portion s 2 are grasped to find out by what surface shape ( height , outer shape or the like ) the sample s 1 is constituted . next , at a positioning step ( step s 22 ), the position of the predetermined portion s 2 is determined based on acquired position data and shape data , the xy scanner 21 and the z scanner 23 are moved by the xyz scanner control portion 22 , further , the voltage applied between the electrode 4 d and the electrode 7 b is changed by the voltage apparatus 18 for combteeth . further , as shown by fig1 , positioning is carried out to squeeze the predetermined portion s 2 of the sample 1 by the first tip 5 provided at the observing probe 3 and the second tip 6 provided at the grasping probe 4 . it has already been grasped at which place on the surface of the sample s 1 the predetermined portion s 2 is disposed , and therefore , the first tip 5 and the second tip 6 can swiftly be positioned . next , at a grasping step ( step s 23 ), the voltage applied between the electrode 4 d and the electrode 7 b is changed by the voltage apparatus 18 for combteeth , as shown by fig1 , the predetermined portion s 2 of the sample s 1 is pressed to be grasped by the two terminals tweezers 15 by making the separating distance g between the first tip 5 and the second tip 6 short by the predetermined distance d . a force of pressing the predetermined portion s 2 by the two terminals tweezers 15 is determined by a spring constant and a bending amount to a side opposed to the squeezed predetermined portion s 2 . bending amounts of the respective probes become constant without depending on the measurement , and therefore , the reproducibility of the pressing force can be promoted by making forces for pressing the predetermined portion s 2 by the respective probes of the two terminals tweezers 15 respectively constant . next , at a measured portion cutting to separate step ( step s 24 ), the z scanner 23 is moved by the xyz scanner control portion 22 , as shown by fig1 , the predetermined portion s 2 of the sample s 1 grasped by the first tip 5 and the second tip 6 is lifted in z direction to cut to separate from the other portion of the sample s 1 . finally , at a measuring step ( step s 25 ), first , a constant current flowing between the first tip 5 and the second tip 6 is generated by the current apparatus 8 , and a voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 . further , by changing the voltage applied between the electrode 4 d and the electrode 7 b by the voltage apparatus 18 for combteeth , as shown by fig1 , the side of the front end 4 a of the grabbing probe 4 is moved to the side of the front end 3 a of the observing probe 3 , while changing the separating distance g of the first tip 5 and the second tip 6 , the voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 . in this way , according to the conductivity measuring apparatus of the embodiment of the invention , the separating distance g between the first tip 5 and the second tip 6 is adjusted by the single probe driving means 12 , and therefore , the separating distance g can accurately and continuously be adjusted and the conductivity can be measured by accurately picking up the small predetermined portion s 2 . further , the conductivity is measured by lifting the predetermined portion s 2 , and therefore , the conductivity between the predetermined portions s 2 is measured without being influenced by the sample s 1 and the conductivity can further accurately be measured . further , the conductivity between the predetermined portions s 2 is measured while changing the grasping force between the predetermined portions s 2 by changing the separating distance g . therefore , an influence of the pressing force between the predetermined portions s 2 of the sample s 1 effected on an electric property can be measured and the conductivity between the predetermined portions s 2 can further accurately be measured . further , according to the third embodiment , the constant current flowing between the first tip 5 and the second tip 6 is generated by the current apparatus 8 , while changing the separating distance g of the first tip 5 and the second tip 6 , the voltage generated between the first tip 5 and the second tip 6 is measured by the voltage measuring apparatus 9 . however , a constant voltage applied between the first tip 5 and the second tip 6 may be generated by the constant voltage apparatus 8 , and a current flowing between the first tip 5 and the second tip 6 may be measured while changing the interval between the first tip 5 and the second tip 6 . although , as described above , a detailed description has been given of the first embodiment , the second embodiment and the third embodiment with reference to the drawings , the specific features of the invention are not limited to these embodiments but also includes variations without departing from the gist of the invention . for example , although according to the first embodiment through the third embodiment , the first tip 5 is provided at the front end 3 a of the observing probe 3 . however , the first tip 5 may be integrated to the observing probe 3 to be conductive . the same goes also with the grabbing probe 4 and the pair of outer side probes 53 and 54 . further , according to the first embodiment through the third embodiment , front ends of the styluses of the respective probes are extended from the respective probes to a lower side and the imaginary line c 2 connecting the front ends of the styluses is not disposed on the imaginary face c 1 arranged with the respective probes along therewith . however , there may be constructed a constitution in which the imaginary line c 2 is disposed on the imaginary face c 1 . further , according to the first embodiment through the third embodiment , the probe driving means 12 is provided with the combteeth having the electrode utilizing the electrostatic force . however , the side of the front end 4 a of the grabbing probe 4 may be moved by a thermal actuator . further , according to the first embodiment through the third embodiment , the conductivity is measured by changing the separating distance g between the first tip 5 and the second tip 6 by the measuring step . however , the conductivity may be measured without changing the separating distance g . further , although according to the third embodiment , the conductivity is measured by lifting the predetermined portion s 2 , the conductivity of the predetermined portion s 2 may be measured without lifting the predetermined portion s 2 . or , instead of lifting the predetermined portion s 2 , a lifting mechanism may be provided on the side of the sample base 2 , and the measured sample s 1 may be moved down to cut to separate from the predetermined portion s 2 . further , although according to the third embodiment , the conductivity is measured while changing the grasping force between the predetermined portions s 2 , the conductivity of the predetermined portion s 2 may be measured by making the grasping force between the predetermined portions s 2 constant without changing the grasping force . further , according to the first embodiment through the third embodiment , the data acquiring step is carried out , and the surface shape of the sample s 1 is grasped by acquiring position data and shape data by carrying out afm observation of the sample s 1 . however , position data and shape data of the sample s 1 previously acquired separately may be utilized by dispensing with the data acquiring step . further , according to the first embodiment through the second embodiment , the observing probe 3 is positioned based on position data and shape data acquired by carrying out afm observation . however , the positioning may be carried out by vibrating the observing probe 3 again and by observing a state of the vibration also in the positioning . further , although in the first embodiment and the third embodiment the relative movement between the two terminal tweezers 14 and the sample s 1 is accomplished by moving the two terminals tweezers relative to the sample s 1 which is fixed , the relative movement may also be accomplished by moving the sample s 1 relative to the two terminals tweezers 14 which is fixed . also in the second embodiment , the sample s 1 may be moved by fixing the 4 terminals tweezers 57 .	6
referring now to the drawings , like reference numerals are used to identify identical components in the various views . although the invention will be illustrated in the context of a framed vehicle door , it will be appreciated that this invention may be used in conjunction with other applications requiring an adjustable vehicle door such as a frameless window application . referring now to fig1 an automotive vehicle 20 is shown having a vehicle body 21 and an automotive vehicle door assembly 22 for closing an opening 23 in vehicle body 21 . the terms , interior , exterior , rearward and forward , as used in this description , are related to door assembly as installed in vehicle body 21 . the door assembly 22 described hereinafter is a passenger side door . a driver side door would essentially be the mirror of the passenger side door . referring now to fig2 door assembly 22 is shown in an exploded view having door cassette 24 separated from lower door 26 . pivot bolts 28 , mounting bolts 30 and fine adjust bolts 90 ( shown best in fig1 ) are used to mount door cassette 24 to lower door 26 . pivot bolts 28 pivotally connect door cassette 24 to lower door 26 when door cassette 24 is housed by lower door 26 . the axis of the pivot allows door cassette 24 to move laterally with respect to the vehicle body when the door is closed . mounting bolts 30 fix lower door cassette 24 into a predetermined position with respect to the vehicle body . door cassette 24 includes a door frame having an upper door frame 34 , lower door frame 38 and lower door frame channel 39 , a window 36 and its associated hardware , a plate member 40 and a cross member 46 . a seal 48 may also be included as part of door cassette 24 . upper door frame 34 defines an opening to enclose window 36 . upper door frame 34 is preferably roll formed but may also be stamped from steel . of course , light weight material may be used in door cassette 24 such as plastic or aluminum if structural integrity is maintained . upper door frame 34 may be eliminated in a frameless window application for applications such as a convertible . lower door frame 38 and lower door frame channel 39 extend into lower door 26 when assembled . as shown , both lower door frame 38 and lower door frame channel 39 comprise two members , one of each on the forward most end and rearward most end of door cassette 24 . each member of lower door frame 38 extends from upper door frame 34 near pivot bolt 28 . lower door frame 38 and upper door frame 34 may be separate pieces but may also be formed as a single continuous piece with upper door frame 34 . when formed as a continuous piece the transition between upper door frame 34 and lower door frame 38 is roughly at pivot bolts 28 . lower door frame channel 39 preferably defines a partially open channel into which lower door frame 38 slidably engages . although the shape is not critical , lower door frame channel 39 as shown is essentially a square channel with one side removed . other shapes would be evident to those skilled in the art . lower door frame 38 is fully removable from within the lower door frame channel 39 . lower door frame channel 39 is used as means to secure door cassette 24 to lower door 26 by remaining fixed to lower door 26 once door cassette 24 is assembled and adjusted to fit to the vehicle body . when the lower door frame 38 is replaced after removal , the entire door cassette 24 is fixed in its previously adjusted position . a button assembly 60 keeps lower door frame 38 engaged with lower door frame 39 . plate member 40 is preferably an individual stamped piece that extends across door cassette 24 and is rigidly connected to the two members of lower door frame 38 . plate member 40 is shaped to provide attachment points for window and door movement hardware such as a window regulator 42 and glass guides 44 . plate member 40 may also provide some structural rigidity to door cassette by acting as a cross support . cross member 46 extends across door cassette 24 between the two members of lower door frame 38 and provides rigidity for door cassette 24 . because lower door frame 38 is used to secure door cassette 24 , cross member 46 preferably connects to lower door frame 38 near where lower door frame 38 secures to lower door 26 . cross member 46 also provides rigidity to door cassette when shipped since door cassette 24 is built off line and transported before assembly . cross member may also serve the purpose of providing a surface on which door cassette can rest when removed from the vehicle . cross member 46 is preferably flat on its bottom end and connects the lowermost ends of lower door frame 38 to provide maximum rigidity to prevent damage to door cassette 24 . cross member 46 may also be structured to provide support so that door cassette 24 may be self supporting when removed from lower door 26 . seal 48 extends around upper door frame 34 for sealing upper door frame 34 against the vehicle body . when supplied to the vehicle manufacturer door cassette 24 may contain seal 48 pre - installed on upper door frame 34 . an additional seal my be provided on lower door 26 . preferably seal 48 and the seal on lower door 26 provide a complete seal around door assembly 24 . if a long seal is provided with door cassette 24 , seal 48 may be fastened to lower door 26 after door cassette 24 is installed and adjusted . seal 48 may also be used to cover connecting hardware such as pivot bolts 28 . lower door 26 may be supplied by the vehicle manufacturer and has the necessary structure to connect to door cassette 24 . lower door 26 is shaped generally to define a cavity to receive door cassette 24 . lower door 26 has an outer door panel 50 contoured to meet the styling for the desired vehicle application . outer door panel 50 has an opening 52 for receiving a door handle and lock . lower door 26 may also have a side impact beam 54 to meet government mandates . side impact beam 54 extends across lower door 26 . side impact beam 54 is used to provide structural rigidity to lower door 26 in the event of a side impact . a latch 56 may also be included in lower door 26 . latch 26 is preferably a conventional type latch . including latch 56 on lower door 26 provides a means to keep the door assembly closed if desired during positioning of door cassette 24 . referring now to fig3 door cassette 24 is installed within lower door 26 . pivot bolts 28 , mounting bolts 30 and button assemblies 60 are used to position door cassette 24 within lower door 26 and with respect to the vehicle body . pivot bolts 28 define an axis 55 around which door cassette 24 rotates . although not shown , a finished trim panel is fastened to lower door 26 to complete assembly . the trim panel contains the buttons and levers to provide a vehicle operator interface to control the functions provided by the door assembly such as moving the window and locking the door . referring now to fig4 when door cassette 24 is first placed into lower door 26 , the position secured is governed by mounting bolt 30 and its associated hardware . mounting bolt 30 is secured to lower door through a slot 58 . the pivot movement of door cassette 24 is shown around pivot bolt 28 . the maximum distance for movement is governed by slot 58 . an opening 57 in lower door 26 allows access to mounting bolt 30 . during assembly door cassette 24 is positioned and mounting bolt 30 is tightened to set door frame channel 39 to correspond to a finished position . referring now to fig5 and 6 , a portion of lower door 26 is shown with its pivot means . as shown , the pivot means in lower door 26 may be a u - shaped channel or a hole 59 into which pivot bolts 28 rest . of course , other means for pivoting would be known to those skilled in the art such as providing a pin on either door cassette 24 or lower door 26 that cooperate to provide a pivoting motion . flanges 61 are secured to lower door frame channel 39 and to pivot bolt 28 . pivot bolt 28 , however , may also be connected directly to lower door frame channel 39 . referring now to fig7 deformable button assembly 60 is shown in greater detail . button assembly 60 provides an easy way to secure and remove door cassette 24 from door housing 26 . button assembly 60 preferably has a housing 62 formed over a hole 75 in lower door frame channel 39 . a button 64 may extend partially outside housing 62 . a spring 66 is used to bias button 64 outside housing 62 . retainers 68 and 69 are secured to button 64 to prevent button 64 from fully extending out of housing 62 and as a means to retain spring 66 within housing 62 . one button assembly may be located on each lower frame member . a flexible detent engager 74 is fixedly secured to lower door frame 38 . flexible detent engager 74 has a ridge 76 that extends outwardly from detent engager 74 . detent engager 74 deforms to fit between lower door frame channel 39 and lower door frame 38 . when ridge 76 on detent engager 74 reaches button 64 , ridge 76 expands against button 64 and holds lower door frame 38 in place . a stop 72 is mounted within lower door frame channel 39 to provide the lower limit of travel of lower door frame 38 within lower door frame channel 39 . stop 72 prevents frame 38 from being inserted further than desired , i . e ., so ridge 76 does not extend past hole 75 . stop 72 may be formed of a resilient material such as rubber or the like and is slightly in compression when ridge 76 is aligned with hole 75 and lower door frame contacts stop 72 . referring now to fig8 to remove door cassette 24 from lower door , button 64 is pushed to deform ridge 76 into channel 39 . door cassette 24 may then be lifted from lower door 26 . since stop 72 is slightly deformed when ridge 72 aligns with button 64 , a slight upward force is provided by stop 72 to assist in removing the door cassette from the lower door . this slight upward force prevents ridge 76 from becoming unintentionally re - engaged within hole 75 . as is shown , ridge 76 on flexible detent engager 74 is deformed to allow lower door frame to move within lower door frame channel 39 . referring now to fig9 a bolt 80 and nut 82 are shown in addition to deformable button assembly as an additional means for securing door cassette 24 to lower door 26 . in this configuration , to remove the door cassette 24 from lower door 26 , bolt 80 must be removed from nut 82 . nut 82 is shown on the outside of channel 39 . nut 82 , however , may be also integral to the interior of channel 39 . that is , nut 82 may be welded in place . referring now to fig1 , a lower door 26 is shown having the door cassette removed . lower door frame channel 39 remains fixed within lower door 26 to cover the opening 84 left by the removal of the door cassette a cover may be used during the operation of the vehicle . cover 86 may be of a plastic or metal material sized to fit within opening 84 . cover 86 may be snapped fit or screwed to fasten cover 86 to opening 84 . referring now to fig1 , an alternative adjustment configuration is shown for adjusting lower door frame channel 39 . a coarse adjust bolt 88 and a fine adjust bolt 90 may be used to adjust lower door frame channel 39 within lower door 26 . one set of a coarse adjust bolt 88 and fine adjust bolt 90 may be used to mount each lower door frame channel 39 . the coarse adjustment and fine adjustment may be similar to those described in the co - pending application incorporated by reference above . coarse adjust bolt 88 may be similar to that of mounting bolt 30 described above . that is , coarse adjust bolt 88 may be placed through a slot 92 which defines the amount of adjustment possible for lower door frame channel 39 . once door cassette 24 is placed within lower door 26 , coarse adjust bolt 88 is used to finely adjust the position of lower door frame channel 39 . fine adjust bolt 90 may engage a flange 94 that is secured to lower door frame channel 39 . another flange 96 may be used to mount fine adjust bolt 90 relative to lower door 26 . a nut 98 may be used to provide threaded movement between fine adjust bolt 90 and flange 94 . it is preferred that the rotation of fine adjust bolt 90 moves lower door frame channel 39 a predetermined distance with respect to the vehicle . for example , a full rotation of fine adjust bolt 90 may correspond to a movement of the upper door frame of one millimeter . in operation , lower door 26 may be manufactured and installed on the vehicle so that lower door 26 may be painted along with the rest of the vehicle . during the assembly process door cassette 24 is placed into lower door 26 . pivot bolts 28 are inserted so that door cassette pivots in lower door 26 . once placed in an adjusted position , mounting bolts 30 are tightened to hold lower door frame channel 39 into that position . as described above , a coarse adjustment and a fine adjustment may be used in place of mounting bolts 30 . once mounted and adjusted , lower door frame channel 39 remains mounted to the vehicle . by depressing the button 64 , the rest of door cassette 24 may be removed from lower door 26 . that is , lower door frame 38 may be removed from lower door frame channel 39 . a cover may be placed on the lower door 26 to fill the void left in lower door 26 from removal of door cassette 24 . while the best mode for carrying out the present invention has been described in detail , those familiar with the art to which this invention relates will recognize various alternative designs and embodiments for practicing the invention as defined by the following claims . for example in a frameless window application the upper door frame and seal may be eliminated , the seal may placed on the vehicle body .	4
for purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiments illustrated in the drawings , and specific language will be used to describe the same . it will nonetheless be understood that no limitation of the scope of the invention is intended by the illustration and description of certain embodiments of the invention . in addition , any alterations and / or modifications of the illustrated and / or described embodiment ( s ) are contemplated as being within the scope of the present invention . further , any other applications of the principles of the invention , as illustrated and / or described herein , as would normally occur to one skilled in the art to which the invention pertains , are contemplated as being within the scope of the present invention . referring now to the drawings , and in particular , fig1 , a non - limiting example of a gas turbine engine 10 in accordance with an embodiment of the present invention is schematically depicted . in one form , gas turbine engine 10 is an axial flow machine , e . g ., an air - vehicle power plant . in other embodiments , gas turbine engine 10 may be a radial flow machine or a combination axial - radial flow machine . embodiments of the present invention include various gas turbine engine configurations , for example , including turbojet engines , turbofan engines , turboprop engines , and turboshaft engines having axial , centrifugal and / or axi - centrifugal compressors and / or turbines . in one form , gas turbine engine 10 includes a compressor 12 having a compressor rotor 14 ; a diffuser 16 ; a combustion system 18 ; a turbine 20 having a turbine rotor 22 ; and a shaft 24 coupling compressor rotor 14 with turbine rotor 22 . combustion system 18 is in fluid communication with compressor 12 and turbine 20 . turbine rotor 22 is drivingly coupled to compressor rotor 14 via shaft 24 . compressor rotor 14 , turbine rotor 22 and shaft 24 form a main engine rotor 26 , which rotates about an engine centerline 28 . although only a single spool is depicted , it will be understood that embodiments of the present invention include both single - spool and multi - spool engines . the number of blades and vanes , and the number of stages thereof of compressor 12 and turbine 20 may vary with the application , e . g ., the efficiency and power output requirements of a particular installation of gas turbine engine 10 . in various embodiments , gas turbine engine 10 may include one or more fans , additional compressors and / or additional turbines . during the operation of gas turbine engine 10 , air is received at the inlet of compressor 12 and compressed . after having been compressed , the air is supplied to diffuser 16 , which reduces the velocity of the pressurized air discharged from compressor 12 . the pressurized air exiting diffuser 16 is mixed with fuel and combusted in combustion system 18 . the hot gases exiting combustion system 18 are directed into turbine 20 . turbine 20 extracts energy from the hot gases to , among other things , generate mechanical shaft power to drive compressor 12 via shaft 24 . in one form , the hot gases exiting turbine 20 are directed into a nozzle ( not shown ), which provides thrust output for gas turbine engine 10 . in other embodiments , additional compressor and / or turbine stages in one or more additional rotors upstream and / or downstream of compressor 12 and / or turbine 20 may be employed , e . g ., in single or multi - spool gas turbine engines . referring now to fig2 , a non - limiting example of a system 30 for clamping together components of main engine rotor 26 is schematically depicted in accordance with an embodiment of the present invention . in the present example , turbine rotor 22 includes a stub shaft 32 . in other embodiments , stub shaft 32 may be formed separately and affixed to turbine rotor 22 . system 30 is operative to clamp shaft 24 and stub shaft 32 . in one form , stub shaft 32 is integral with turbine rotor 22 . system 30 retains turbine rotor 22 and shaft 24 in a coupled arrangement . a splined interface 34 between stub shaft 32 and shaft 24 transmits torque between turbine rotor 22 and shaft 24 . system 30 includes a compression washer 36 and a retaining ring 38 positioned in such a way that a preload is maintained between the turbine rotor 22 and shaft 24 during engine 10 operation . the preload is maintained by compression washer 36 , which is placed into a state of compression during the assembly of turbine rotor 22 and shaft 24 . use of the term , “ compression ” in the present context indicates that compression washer 36 is compressed in the sense that a spring is compressed , and is not necessarily reflective of the stress field within compression washer 36 . in one form , compression washer 36 is a conical compression washer , otherwise known as , for example , a bellville spring , a bellville washer or a disk spring . it will be understood that the shape of compression washer 36 is not limited to being conical ; rather , any suitable shape may be employed in various embodiments . in one form , retaining ring 38 is a split retaining ring . in other embodiments , other retaining ring types may be employed , for example , spiral retaining rings . referring now to fig3 , an enlarged view of system 30 is depicted with turbine rotor 22 and shaft 24 in the assembled state . each component of rotor 26 that is clamped together with system 30 includes a face through which loads to / from compression washer 36 are transferred into the component . in the depicted example , shaft 24 includes a face 40 , and stub shaft 32 of turbine rotor 22 includes a face 42 opposite face 40 , through which loads to and from compression washer 36 are transferred into the respective shaft 24 and turbine rotor 22 . compression washer 36 mechanically loads face 40 against face 42 . in some embodiments , an intervening component , such as a spacer or another component , may be placed between compression washer 36 and either or both of face 40 and face 42 . each component of rotor 26 that is clamped together with system 30 also includes another face for reacting the compression washer 36 loads with retaining ring 38 . in one form , the other face is part of an opening in each component that receives therein retaining ring 38 . in the depicted example , shaft 24 includes a shouldered channel 44 , and stub shaft 32 includes a shouldered channel 46 . channels 44 and 46 are configured to receive retaining ring 38 . in one form , channels 44 and 46 extend circumferentially around a respective inside or outside diameter of each component . in one example , the channels are circumferentially continuous . in other embodiments , discontinuous or interrupted channels may be employed . in one form , channel 44 is a groove , e . g ., a circumferential slot , and channel 46 is also a groove . groove 44 includes a face 48 , and groove 46 includes a face 50 that faces opposite face 48 . faces 48 and 50 react the compression washer 36 loads through retaining ring 38 , which loads retaining ring 38 in shear . faces 40 and 42 , and grooves 44 and 46 , or more particularly , faces 48 and 50 of respective grooves 44 and 46 , are positioned so that compression washer 36 is in a state of compression between face 40 and face 42 when retaining ring 38 is positioned in both groove 44 and groove 46 , or more particularly , when retaining ring 38 is positioned between faces 48 and 50 . in other embodiments , other types of channels in addition to or in place of grooves may be employed , so long as those channels include opposing faces such as faces 48 and 50 to react the compression washer 36 loads through retaining ring 38 . in one form , at assembly , retaining ring 38 is displaced inward into groove 44 , and once assembled , retaining ring 38 is displaced radially outward and expanded into groove 46 , which locks shaft 24 and turbine rotor 22 together axially . faces 40 and 42 , and compression washer 36 are positioned such that when retaining ring 38 is in the expanded state , occupying both grooves 44 and 46 between faces 48 and 50 , conical compression washer 36 is in a compressed state . loads from the compressed compression washer 36 tend to drive shaft 24 and turbine rotor 22 axially apart , which is prevented by retaining ring 38 . in one form , the force exerted by compression washer 36 is selected to provide a preload on the mated components during all operating conditions of engine 10 . the force is based primarily on the spring characteristics of compression washer 36 , the axial dimensions of compression washer 36 and retaining ring 38 , and the locations of faces 40 , 42 , 48 and 50 . in other embodiments , the force exerted by compression washer 36 may be selected to maintain a preload only under some engine 10 operating conditions . referring now to fig4 , a non - limiting example of some additional features that may be included in various embodiments of system 30 is depicted . additional features may include , for example , a spring 52 disposed adjacent to retaining ring 38 . spring 52 is operative to provide a load to retaining ring 38 in order to assist retaining ring 38 in expanding from groove 44 into groove 46 . in other embodiments , spring 52 may be operative to assist retaining ring in collapsing from groove 46 into groove 44 . in one form , spring 52 is a circumferential wave washer . in other embodiments , other types of springs may be employed . additional features may also include one or more openings in one or both components of rotor 26 to facilitate the assembly and / or disassembly of rotor 26 components . in the embodiment of fig4 , stub shaft 32 of turbine rotor 22 includes a plurality of openings in the form of holes 54 . holes 54 are configured to receive a tool 56 , such as one or more tooling pins . tool 56 may be used to compress retaining ring 38 ( and spring 52 for those embodiments that employ spring 52 ) so that turbine rotor 22 may be removed from shaft 24 . in other embodiments , shaft 24 may include openings such as holes 54 to aid in expanding retaining ring 38 using a tool such as tool 56 . in various embodiments , either or both components of rotor 26 may include openings such as holes 54 to aid in compressing and / or expanding retaining ring 38 to aid in the assembly and / or disassembly of rotor 26 . the assembly and disassembly of rotor components such as turbine rotor 22 and shaft 24 may be accomplished in more than one manner . in one form , assembly may include positioning compression washer 36 between face 40 of shaft 24 and face 42 of stub shaft 32 of turbine rotor 22 ; positioning retaining ring 38 in groove 44 ; assembling stub shaft 32 of turbine rotor 22 onto shaft 24 ; applying a clamp load to force compression washer 36 into a state of compression between face 40 of shaft 24 and face 42 of stub shaft 32 of turbine rotor 22 ; and displacing retaining ring 38 so that retaining ring 38 is positioned in both grooves 44 and 46 . the displacement of retaining ring 38 may include self - displacement from a compressed state , and / or forced displacement . other assembly steps in addition to or in place of those described herein may likewise be employed . disassembly of turbine rotor 22 from shaft 24 may be performed by repositioning retaining ring 38 from being in both groove 44 and groove 46 to being in only one of groove 44 and groove 46 , and by removing sliding turbine rotor 22 off of shaft 24 . in the illustrated embodiment , retaining ring 38 is displaced from groove 46 into groove 44 in order to disassemble rotor 36 . in other embodiments , retaining ring 38 may be displaced from groove 44 into groove 46 in order to disassembly rotor 36 . in either case , a tool such as tool 56 may be inserted into an opening such as hole 54 and be used to apply force to retaining ring 38 in order to displace retaining ring 38 to disassemble rotor 36 . referring now to fig5 , a convenient method of assembling turbine rotor 22 and shaft 24 is described . in one form , assembly is accomplished by first installing retaining ring 38 in groove 44 in shaft 24 . next , retaining ring 38 is compressed , and compression washer 36 is installed atop retaining ring 38 . this displaces the retaining ring 38 into groove 44 , and allows the forward edge of stub shaft 32 to pass over retaining ring 38 . in some embodiments , stub shaft 32 is heated to expand the pilot diameters thereby eliminating any interference at the mating surfaces . likewise , in some embodiments shaft 24 is cooled . stub shaft 32 is then slid onto shaft 24 , engaging drive splines 34 . as turbine rotor 22 is further engaged , the forward edge of the stub shaft 32 displaces compression washer 36 off of retaining ring 38 . a chamfer 58 on the inner edge of stub shaft 32 allows stub shaft 32 to pass smoothly over retaining ring 38 . an axial clamping load is then applied between turbine rotor 22 and shaft 24 , rotor displacing compression washer 36 until groove 46 in stub shaft 32 shaft aligns with retaining ring 38 . with the components thus aligned , retaining ring 38 expands outward into groove 46 of stub shaft 32 . the assembly of shaft 24 and turbine rotor 22 is now complete . in embodiments that employ spring 52 , spring 52 assists retaining ring 38 in expanding into groove 46 . in some embodiments , no special tooling is required to join the mating parts . disassembly is accomplished by first applying an axial clamp load to the mated components such that the preload is removed from retaining ring 38 . tool 56 is then employed via holes 54 to reposition retaining ring 38 out of groove 46 and further into groove 44 . displacing retaining ring 38 inward with the tooling pins allows stub shaft 32 to disengage from shaft 24 . in other embodiments , other types of tools may be employed to disassemble rotor 26 . in the depiction of fig2 - 5 aspects of the present invention are illustrated and described relative to assembling a shaft to a rotor . embodiments of the present invention are equally applicable to other rotor assembly configurations , such as for clamping together rotor disks and / or spacers of a turbine rotor or compressor rotor . for example , referring now to fig6 a and 6b , a non - limiting example of a four stage compressor rotor 60 in accordance with an embodiment of the present invention is depicted . rotor 60 includes four disks 62 , three of which include an integral spacer 64 . in other embodiments , spacers 64 may be separately formed and attached to disks 62 using any convenient method , such as that described herein . in the embodiment of fig6 a and 6b , a system 70 for clamping components of compressor rotor 60 together includes a compression washer 72 and a retaining ring 74 . similar to the embodiments described in fig2 - 5 , compression washer 72 is disposed between opposite faces 76 and 78 of the mating adjacent components ; and retaining ring 74 is disposed in opposite channels 80 and 82 with opposite faces 84 and 86 . as with the embodiment of fig2 - 5 , compression washer 72 and a retaining ring 74 are positioned in such a way that a preload is maintained between each adjacent disk / spacer during engine operation . the preload is generated by compression washer 72 , which is placed into a state of compression during the assembly of rotor 60 in a manner similar to that set forth above with respect to rotor 26 . faces 76 and 78 , and channels 80 and 82 , or more particularly , faces 84 and 86 , are positioned so that compression washer 72 is in a state of compression between faces 76 and 78 when retaining ring 74 is positioned in both of channels 80 and 82 , or more particularly , when retaining ring 74 is positioned between faces 84 and 86 . the assembly and disassembly of rotor 60 may be performed similarly to that described above with respect to the embodiment of fig2 - 5 . torque may be transmitted between each disk / spacer by means ( not shown ), such as splines , pins or keys , for example . in addition to the above , embodiments of the present invention include similar systems having compression washers , retaining rings , and two groups of two opposing faces that may be used to assemble static components , such as engine case structures , without the use of threaded joints or threaded fasteners . embodiments of the present invention include a gas turbine engine , comprising : a main engine rotor having a first rotor component and a second rotor component , wherein the first rotor component includes a first face and a first channel ; and wherein the second rotor component includes a second face and a second channel ; a compression washer disposed between the first face and the second face , wherein the compression washer is operative to mechanically load the first face against the second face ; and a retaining ring , wherein the first face , the first channel , the second face and the second channel are positioned so that the compression washer is in a state of compression between the first face and the second face when the retaining ring is positioned in both the first channel and the second channel ; and wherein the retaining ring reacts the mechanical loading produced by the compression of the compression washer . in a refinement , the main engine rotor includes a turbine rotor and a compressor rotor , and wherein the first rotor component is one of the turbine rotor and the compressor rotor . in another refinement , the main engine rotor includes a shaft operative to transmit power from the turbine rotor to drive the compressor rotor , and wherein the second rotor component is the shaft . in yet another refinement , the compressor rotor includes a plurality of compressor stages , and wherein the first rotor component is a first compressor stage and wherein the second rotor component is a second compressor stage . in still another refinement , at least one of the first rotor component and the second rotor component includes an opening extending into the respective at least one of the first channel and the second channel . in yet still another refinement , the opening is structured to admit a tool therein for displacement of the retaining ring . in a further refinement , the engine includes a spring disposed in one of the first channel and the second channel , wherein the spring is positioned to place a spring load on the retaining ring . in a yet further refinement , the spring is a circumferential wave washer . embodiments include a method for assembly and disassembly of a main engine rotor of a gas turbine engine , comprising : positioning a compression washer between at least one of a first face of a first rotor component of the main engine rotor and a second face of a second rotor component of the main engine rotor ; positioning a retaining ring in one of a first groove of the first rotor component and a second groove of the second rotor component ; assembling the first rotor component to the second rotor component ; applying a clamp load to force the compression washer into a state of compression between the first face and the second face ; and displacing the retaining ring so that the retaining ring is positioned in both the first groove and the second groove . in a refinement , the method further includes releasing the clamp load , wherein the retaining ring reacts the compression of the compression washer and retains the first rotor component in assembly with the second rotor component . in another refinement , the first rotor component is clamped to the second rotor component without the use of threads . in yet another refinement , the method also includes disassembling the first rotor component from the second rotor component by repositioning the retaining ring from being in both the first groove and the second groove to being in the one of the first groove and the second groove , and removing the first rotor component from the second rotor component . in still another refinement , the repositioning of the retaining ring includes inserting a tool into an opening in one of the first groove and the second groove , and applying force to the retaining ring using the tool to displace the retaining ring . in yet still another refinement , the method includes positioning a spring in one of the first groove and the second groove , wherein the spring is positioned to place a spring load on the retaining ring . in a further refinement , the main engine rotor includes a shaft operative to transmit power from a turbine rotor to drive a compressor rotor , and wherein one of the first rotor component and the second rotor component is the shaft . in a yet further refinement , the main engine rotor includes a plurality of compressor stages , and wherein the first rotor component is one compressor stage and wherein the second rotor component is an other compressor stage . in a still further refinement , the main engine rotor includes a compressor disk and a compressor spacer , and wherein the first rotor component is the disk and wherein the second rotor component is the spacer . embodiments of the present invention include a system , comprising : a first component having a first face and a second face ; a second component having a third face and a fourth face , wherein the third face is opposite the first face , and wherein the fourth face is opposite the third face ; a compression washer disposed between the first face and the third face , wherein the compression washer is operative to mechanically load the first face against the third face ; and a retaining ring , wherein the first face , the second face , the third face and the fourth face are positioned so that the compression washer is in a state of compression between the first face and the third face when the retaining ring is positioned between the second face and the fourth face ; and wherein the retaining ring reacts the mechanical loading produced by the compression of the compression washer . embodiments of the present invention include a gas turbine engine main engine rotor , comprising : a first rotor component ; a second rotor component ; and means for clamping the first rotor component to the second rotor component . in a refinement , the means for clamping includes a compression washer and a split retaining ring that jointly clamp together the first rotor component and the second rotor component . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment ( s ), but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims , which scope is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures as permitted under the law . furthermore it should be understood that while the use of the word preferable , preferably , or preferred in the description above indicates that feature so described may be more desirable , it nonetheless may not be necessary and any embodiment lacking the same may be contemplated as within the scope of the invention , that scope being defined by the claims that follow . in reading the claims it is intended that when words such as “ a ,” “ an ,” “ at least one ” and “ at least a portion ” are used , there is no intention to limit the claim to only one item unless specifically stated to the contrary in the claim . further , when the language “ at least a portion ” and / or “ a portion ” is used the item may include a portion and / or the entire item unless specifically stated to the contrary .	5
the invention will now be described with reference to the drawings . fig1 shows a pressure sensor of the present invention . the pressure sensor comprises a cylindrical main body 1 made of titanium and having an outer diameter ( d ) of 10 mm ( at a recess 14 ) and an entire length of 70 mm , a film 7 of an amorphous magnetic alloy mounted around the outer periphery of the body 1 , a cylindrical bobbin 10 of a phenolic resin disposed radially outwardly of the film 7 and mounted around the outer periphery of the body 1 , a pressure detector coil 8 wound on the outer periphery of the bobbin 10 , a dummy coil 9 wound on the outer periphery of the bobbin 10 , a yoke 11 of 45 % ni - fe alloy disposed radially outwardly of the coils 8 and 9 , and a detector unit 13 electrically connected to the two coils 8 and 9 . the body 1 has two central holes separated from each other by a partition wall 1a , the two central holes defining a pressure chamber 3 and an dummy ( or reference ) chamber 6 , respectively . the body 1 also has a pressure introducing opening 2 defined by an open end of the pressure chamber 3 , a greater - diameter flange 1b formed on the outer periphery of the body 1 and disposed adjacent to the end of the body 1 having the pressure introducing opening 2 , the above mentioned recess ( smallest - diameter portion ) 14 formed in the outer periphery of the body 1 and extending throughout the entire length of the smaller - diameter portion of the body 1 between the end portion of the body 1 remote from the pressure introducing opening 2 and the greater - diameter flange 1b , and a fixing screw thread 12 formed on the outer periphery of the end portion of the body 1 close the pressure introducing opening 2 . a wall part which defines part of the pressure chamber 3 and exists between the pressure chamber 3 and the recess 14 is a deforming part 4 which is deformed in response to a change in the pressure within the pressure chamber 3 . another wall part , being integrated with the above - mentioned wall , which defines part of the dummy chamber 6 and exists between the dummy chamber 6 and the recess 14 is a non - deforming part 5 which is not influenced by the pressure within the pressure chamber 3 . the depth of the recess 14 , that is , the height of steps 14a and 14b , is 0 . 2 mm in this embodiment . the film 7 is received in the recess 14 and is wound around the outer periphery of the body 1 . the film 7 is a rectangular thin sheet of an amorphous magnetic alloy having a thickness of 0 . 03 mm . this amorphous magnetic alloy is of the fe - si - b - cr type . the amorphous magnetic alloy film 7 is fixedly bonded to the body 1 by an imide - system adhesive as a bonding material . for bonding the film 7 to the body 1 , a pressure of 10 atm . is applied to the film 7 at 250 ° c . for one hour . the bonding of the film 7 by application of pressure is carried out by fitting a tube 21 of a heat - shrinkable resin on the film 7 and then by heating this tube to shrink . at this time , since the depth of the recess 14 is greater ( sufficiently greater , in this case ) than the thickness of the film 7 , there is a possibility that part of the adhesive disposed between the film 7 and the body 1 is squeezed out to the outer surface of the film 7 . after this bonding operation , the tube is removed . the steps 14a and 14b serve as positioning means which prevents the film 7 from being displaced along the axis of the body 1 during bonding of the film 7 by the adhesive . the circumferential length of the film 7 may be sufficiently long to surround the outer periphery of the body 1 , either with the opposite side edge portions of the film 7 overlapping each other , or with the opposite side edges of the film 7 butted together ( see example 5 ). alternatively , the circumferential length of the film 7 may be shorter not to completely surround the outer periphery of the body 1 , with the opposite side edges of the film 7 spaced apart from each other . the bobbin 10 having two peripheral grooves is fitted on the body 1 to cover the recess 14 . the pressure detector coil 8 ( whose number of turns is 100 ) is received in one of the two peripheral grooves close to the flange 1b , and the dummy coil 9 ( whose number of turns is 100 ) is received in the other peripheral groove . both coils 8 and 9 are used as permeability detector elements , and cooperate with the amorphous magnetic alloy film 7 to form a magnetic circuit . the detector unit 13 comprises resistors which constitute , together with the coils 8 and 9 , a bridge , and a differential amplifier . the yoke 11 is a magnetic shield member of a cylindrical cup - shape , and is fixedly secured by an adhesive to the bobbin 10 and / or the flange 1b to cover the bobbin 10 . the operation of the pressure sensor of this example will now be described . the pressure of a fluid to be measured is transmitted to the pressure chamber 3 via the pressure introducing opening 2 , and applies a force in a direction to expand the deforming part 4 defining the pressure chamber 3 . as a result , the part 4 is deformed , so that the amorphous magnetic alloy film 7 adhesively bonded to the outer surface of the part 4 is deformed . this deformation changes the permeability of the amorphous magnetic alloy film 7 due to the magnetostriction effect . this permeability change is detected by the pressure detector coil 8 as a change in inductance , and the pressure change is obtained by detecting a differential output between the coil 8 and the dummy coil 9 through the detector unit 13 . the yield rate of the pressure sensor of the example , in manufacturing of the sensor , is about 70 %, and is about two times higher than that of the conventional pressure sensor . the reason for this is that at the time of coating the adhesive , the excess of the adhesive tending to cause irregularities in the adhesive layer escapes to a space 14c defined by the greater steps 14a and 14b , so that the bonding conditions on both parts 4 and 5 become closer to a uniform condition . according to the example , the pressure sensor having a higher yield rate than those of conventional sensors was obtained . a second example of the present invention will now be described with reference to fig2 and 3a - 3c . those portions of this example identical respectively to those of the first example of fig1 and the prior art of fig7 and 8a - 8c are designated by identical reference numerals , respectively , and explanation thereof will be omitted , and only those portions constituting features of this example will be described . the feature of this example is that an imide - system adhesive which is used to bond an amorphous magnetic alloy film 7 to a body 1 is also coated , as a buffer material ( easily - deformable pressure - applying medium ), onto an outer surface of the amorphous magnetic alloy film 7 ( see fig2 ). the use of the buffer - material 15 eliminates the effects of the non - uniformity of a heat - shrinkable tube 21 . this condition is shown in fig3 a to 3c which are enlarged views of that portion of fig1 indicated by a dotted line . it will be appreciated that no matter how the heat - shrinkable tube 21 is shrunk , the adhesive layer 22 inside the amorphous magnetic alloy film 7 is made uniform in thickness , so that the uniform bonding can be achieved . as a result , the pressure sensor of this example achieved a yield rate of 100 % in manufacturing of the sensor and higher corrosion resistance than those of conventional sensors . the pressure sensor of this example was dipped in hot water of 80 ° c . for about one week , but no corrosion was found on the surface of the film 7 . according to this example , there was obtained a pressure sensor having a higher yield rate . a third example of the invention will now be described with reference to fig4 . the present example is basically similar in structure to the first example of fig1 and therefore detailed description of the present example will be omitted , and only those portions constituting features of this example will be described . the feature of this example is that each of steps 14a and 14b has the shape of a two - step stair ( see fig4 ). the height of the inner step portion is 0 . 1 mm , and the height of the outer step portion is 0 . 2 mm . an amorphous magnetic alloy film 7 was adhesively bonded to a body 1 having the steps 14a and 14b of such a shape , and a heat cycle test ( cycle of - 40 ° c . and 150 ° c .) was conducted 800 times . as a result , no exfoliation part as shown in fig1 was recognized . the reason for this is that at the time of bonding the film 7 , a heat - shrinkable tube is shrunk in accordance with the configuration of the stair - like steps 14a and 14b , so that the adhesive residing at the steps 14a and 14b is more dispersed as compared with the first embodiment , thereby reducing the concentration of stress on the adhesive layer during the heat cycle test . according to this example , there was obtained a pressure sensor having higher durability than those of conventional sensors . in this example , although the number of the step portions of the stair - like steps 14a and 14b is two , it may be more than two in which case the adhesive can be dispersed more effectively , so that the stress concentration is further restrained , thereby improving the durability . a fourth example of the invention will now be described with reference to fig5 . the present example is basically similar in structure to the first example of fig1 and therefore detailed description of this example will be omitted , and only those portions constituting features of this example will be described . the feature of this example is that each of steps 14a and 14b is tapered or inclined ( see fig5 ). the width ( w ) of the tapered portion is 1 mm . an amorphous magnetic alloy film 7 was adhesively bonded to a body 1 having the steps 14a and 14b of such a tapered shape , and a heat cycle test ( cycle of - 40 ° c . and 150 ° c .) was conducted 800 times . as a result , as in the third example , no exfoliation part as shown in fig1 was recognized . the reason for this is that at the time of bonding the film 7 , a heat - shrinkable tube is shrunk in accordance with the configuration of the tapered steps 14a and 14b , so that the adhesive hardly resides at the steps 14a and 14b as compared with the first example , thereby greatly reducing the concentration of stress on the adhesive layer during the heat cycle test . according to this example , there was obtained a pressure sensor having higher durability than that of the conventional sensor . the present example will now be described with reference to fig6 and fig1 . this example is basically similar in structure to the first example of fig1 and therefore detailed description of this example will be omitted , and only those portions constituting features of this example will be described . the feature of this example is that the circumferential length of an amorphous magnetic alloy film 7 is equal to the circumferential length of a cylindrical body 1 ( fig1 ), so that the film 7 has such a shape as shown in fig6 . therefore , when the film 7 is adhesively bonded on the surface of the body 1 including a deforming part 4 and a non - deforming part 5 , a gap as designated at 23 in fig1 will not be formed , and the cylindrical body 1 is completely surrounded by the film 7 over the entire circumference of the body 1 . the pressure sensor of this example was subjected to a heat cycle test ( cycle of - 40 ° c . and 150 ° c .) 500 times . as a result , as in the third example , no exfoliation part as designated at 24 in fig1 was recognized . with this structure , there is achieved an advantage that the durability can be improved without complicating the shape of the steps 14a and 14b as in the third and fourth example . according to the example , there was obtained the pressure sensor having higher durability than those of conventional sensors .	8
referring now to the drawings , in which like numerals indicate corresponding parts throughout the several views , fig1 is a perspective view of an embodiment of the present invention . as depicted in fig1 the drain tool 10 comprises a head portion 14 that includes a shaped aperture 16 . the shaped aperture 16 is configured to engage shower and / or sink drains that are commercially available . the shaped aperture 16 includes tab portions 18 designed to engage tab - type lock nuts on sink and / or shower drains . the number of tab slots 18 and the positioning of the tab slots 18 can vary . for example , in one embodiment , the tab slots 18 are configured to engage the tabs of 4 tab , 6 tab , and 8 tab locking nuts on conventional strainer drains . additionally , as depicted in fig1 the shaped aperture 16 includes hex nut portions 20 designed to engage hex - type lock nuts on shower and / or sink drains . the shaped aperture 16 is also substantially symmetric and is of sufficient diameter to fit over standard strainer drains so that the shaped aperture 16 may engage the lock nuts of conventional sink and / or shower drains . as shown in fig1 in one implementation , the head portion 14 is substantially round . however , other shapes for the head portion are possible , including rectangular , square , triangular , etc . such shapes are considered within the scope of the present invention . also as depicted in fig1 the drain tool 10 includes means for rotating the head portion 14 when the head portion 14 is engaged with the shower or sink drain . one implementation of the rotating means is an attached handle 12 . other rotating means such as a detachable handle ( not shown ) are equally applicable to the present invention and are considered within the scope of the present invention . as further indicated in fig1 the head portion 14 includes an edge piece 22 configured to engage internal lock nut slots of conventional drop - in shower drains . the edge piece 22 may be at the end of the head portion 14 opposite of the rotating means . in other embodiments , the edge piece 22 may be located at different places on the head portion 14 ( not shown ). fig2 is a top view of one implementation of the present invention . as depicted in fig2 the rotating means may be a fixed elongated handle 12 , permanently attached to the head portion 14 such that the head portion 14 and handle 12 are substantially flat . in this embodiment , the handle 12 may be used to rotate the head portion 14 when the head portion 14 is engaged with the shower or sink drain . this is shown in fig6 . for the commonly available strainer drains , the head portion 14 is placed over the strainer drain , such that the shaped aperture 16 engages the strainer drain lock nuts , and the handle 12 is used to rotate the strainer drain to either install or remove the strainer drain . additionally , as depicted in fig2 the edge piece 22 may be attached to the head portion 14 at a location on the head portion 14 opposite of the handle 12 . in this implementation , the edge piece 22 engages the lock nut slots of drop - in shower drains , and the edge piece 22 may be rotated via the handle 12 to install or remove the drop - in shower drain . fig4 shows an alternative embodiment of the present invention , wherein the rotating means is a fixed handle 12 offset at an angle 26 from the head portion 14 . in the embodiment depicted in fig4 the handle 12 is permanently affixed to the head portion 14 with a throat portion 24 interposed between the head portion 14 and handle 12 . fig5 is a side view of the embodiment of the present invention depicted in fig4 . fig5 shows the offset handle 12 , wherein the throat portion 24 forms an angle 26 with the head portion 14 , such that the handle 12 is offset from the head portion 14 . this enables the drain tool 10 to be used more efficiently and more easily . the angle 26 may vary in different embodiments , such as from 0 degrees elevation from the head portion 14 to 70 degrees elevation from the head portion 14 . fig6 shows one implementation of the present invention engaged with a strainer drain containing tab style locking nuts . as depicted in fig6 the head portion 14 fits over the strainer drain , such that the shaped aperture 16 engages the locking nuts on the strainer drain . as further depicted in fig6 the tab slots 18 engage the tab style locking nuts on the drain such that the head portion 14 , when rotated by the handle 12 , may remove or install the drain fig7 depicts an embodiment of the present invention engaged with a drop - in shower drain . as depicted in fig7 the edge piece 22 may be inserted into the internal lock nut slots of a drop - in shower drain . when the edge piece 22 is engaged with the lock nut slots , the head portion 14 may be rotated by the handle 12 such that the drop - in shower drain may be removed or installed . in an alternative embodiment , the edge piece 22 may be located on a side of the head part 14 , such that when the edge piece 22 is engaged with the lock nut slots , the handle 12 forms an approximately 90 degree angle with the drop in shower drain ( not shown ). it should be emphasized that the above described embodiments of the present invention , particularly , any preferred embodiments , are merely possible examples of implementations , set forth for a clear understanding of the principles of the invention . many variations and modifications may be made to the above described embodiment ( s ) of the invention without departing substantially from the spirit and principles of the invention . all such modifications and variations are intended to be included herein within the scope of this disclosure and the present invention and protected by the following claims .	1
the diagrammatic view of fig1 shows a machine for bending and tempering of glass plates according to the invention , in which the glass plates are moved along a regular curved profile with an upturned concavity to define a bending zone 11 and a tempering zone 14 . in the bending and tempering machine , two chassis elements , a lower element 1 and an upper element 2 , are curved in the direction of their length and carried by a frame 3 . lower element 1 is equipped with lower roller elements for support of the glass , such as straight rollers 4 placed parallel to one another and extending along the width of said element . the rollers 4 are rotatable about their longitudinal axes by , for example , a chain 5 engaging sprockets 6 placed at an end of the rollers , held taut by take up and return sprockets 7 and driven by a drive shaft 8 . the array of rollers 4 define a shaping bed for the glass plates with a curved profile , positioned downstream from a conveyor 9 for the glass plates going through a furnace 10 for heating of the glass . preferably , conveyor 9 is tangential to the shaping bed so as to offer a continuous path for the glass plates that is regular , so that the glass plates may move without jerking , cracking or jumping . upper element 2 does not have any rollers in the bending zone 11 , except optionally rollers such as 12 that are separated in relation to lower rollers 4 by a large spacing , so that glass plates advancing on lower rollers 4 , as they become bent on the shaping bed , do not normally touch them . if such upper rollers 12 exist , their position is adjustable in such a way that they are at least at a distance on the order of 0 . 3 or 0 . 4 mm from the upper surface of the glass . thus , when glass plates 3 mm thick are introduced into the machine , optional upper rollers 12 are adjusted so that they are 3 . 3 or 3 . 4 mm , even 3 . 6 mm or more , from a curve connecting the tops of the lower rollers 4 . these upper rollers 12 can be placed approximately directly above lower rollers 4 . within the boundary of the bending zone 11 , just before the tempering zone 14 of the machine , upper chassis element 2 is equipped with a means for aiding the advancement of the glass plates and a barrier to the penetration of the tempering air into the bending zone . advantageously , the functions of these two means are performed by one and the same element consisting of an upper boundary roller 13 placed so as to be in contact with the upper surface of the glass plates , this upper boundary roller 13 being mounted on chassis element 2 opposite lower roller 4 at the end of the bending zone with a spacing no greater than the thickness of the glass plate and being driven at the same speed as lower rollers 4 . advantageously , to avoid too great a pinching pressure on the glass , this upper boundary roller 13 is adjustably and elastically positioned , for example as described in said french patent document no . 2 549 465 . to facilitate the advance of the glass plates within the bending zone 11 , if this zone is long and the glass plates are poorly driven , two or three upper boundary rollers 13 can be used . in the tempering zone 14 , which immediately follows bending zone 11 , in addition to the lower support elements consisting of rollers 4 , upper rollers 15 of the same type as boundary rollers 13 are positioned to be in contact with the glass and press on it with a predetermined pressure , as are blowing nozzles 16 for blowing a cooling gas , in general air , over the glass to temper it . these nozzles 16 are placed so as to blow the cooling gas both on the lower face and the upper face of the glass . they have pipes or slots which , both on the top and on the bottom , come close to the faces of the glass plates . however , for clarity of the drawings , these pipes and slots are not shown , only the main ducts that lead to the pipes or slots are shown . the removal of the glass plates at the downstream boundary of the tempering zone 14 can be achieved as described in said french patent document no . 2 549 465 , i . e ., by a swinging unit not shown in the figures , for delivering the glass plates to an approximately horizontal conveyor , not shown . if a complex curvature is desired for the glass plates , the last pair of rollers of bending zone 11 , serving to block the passage of the tempering air toward the bending zone and to aid in the advance of the glass plates , consist of rollers 17 and 18 which are not cylindrical , but shaped with complementary shapes as shown in fig2 . thus , for example , lower roller 17 can be longitudinally concave , while upper roller 18 can be longitudinally convex or vice - versa . in a variant that makes it possible to obtain glass plates of complex shape , i . e ., having a curvature in the longitudinal direction and a curvature in the crosswise direction , such as an approximately spherical cap , lower rollers 4 and upper rollers 12 , 13 and 15 of the overall installation consist of longitudinally curved rollers . they can be curved rods 19 as shown in fig3 each covered with a rotating tubular sleeve 20 that is axially flexible but rigid in rotation , resting on its curved rod 19 by graphite sliding rings , the sleeve 20 covered with a protection 21 of braided or woven glass or silica threads . they can also be curved rollers of another type , for example , rollers curved by counterbending or by stress exerted on their ends . at the end of the bending zone 11 , two curved rollers such as curved rods 19 frame the glass plates , aid them in advancing and prevent the passage of the tempering air toward the bending zone . curved shaping elements such as rods 19 , covered with sleeves 20 and protections 21 are described in detail in french patent documents 1 476 785 , 92 064 , 2 129 919 , 2 144 523 and 2 189 330 . advantageously , to facilitate access to the inside of the machine , lower chassis 1 and upper chassis 2 can be separated from one another , for example by jacks ( not shown ) or , in a variant , they are able to pivot in relation to one another around a laterally - placed hinge ( oyster opening ). the bending of glass plates in the machine described above , without exerting pressure on the upper face of the glass plates , is described below . the glass plates are heated to their bending and tempering temperature while going through heating furnace 10 . they are then at a temperature greater than 610 ° c ., preferably on the order of 630 to 650 ° c . they enter the bending / tempering machine smoothly and without jerking , the curved path that they have to travel in said machine having as a tangent the path in furnace 10 . their speed is high , at least equal to 10 cm / second , on the order of 10 to 24 cm / second and preferably 15 to 18 cm / second . the pitch of rollers 4 in the bending machine is on the order of 30 to 70 mm and , for example , on the order of 50 to 60 mm for glass approximately 3 mm thick at 650 ° c . because of the high speed of advance of the glass plates , their weight and their temperature , they naturally take the shape of the shaping bed consisting of rollers 4 , without sagging between said rollers . upper rollers 12 which can be present in the machine and which delimit a passage for the glass at least 0 . 3 mm greater than the thickness of the glass , and preferably on the order of 0 . 4 to 0 . 6 mm greater , normally do not intervene in the bending . not driven in rotation by a drive means , they remain immobile , which is a sign of their inoperativeness in normal operation . however , in case the temperature of the glass is not completely satisfactory , and / or in case the speed of advance is too high , they constitute a safety means which prevent the glass from resting on two spaced rollers 4 of the shaping bed without touching intermediate rollers 4 . under these conditions the glass plate would be bent by a degree less than the curvature of the array of rollers 4 in the bending zone 11 . only then would a mid - portion of the top surface of the glass plate contact the rollers 12 . this can constitute means aiding in the adjustment of the optimal operating conditions of the machine , knowing that such optimal conditions are obtained when the upper rollers 12 have no action . the bending of glass plates 3 mm thick and at 650 ° c ., traveling at a speed on the order of 15 to 18 cm / second on a bed of lower rollers 4 with a pitch of approximately 50 to 60 mm can be obtained over a distance which is not greater than that occupied by 7 rollers and which , therefore , can be as short as 250 to 300 mm . at the end of bending zone 11 , the path to be traveled conforms to the curvature of the plates which is liable to cause a sliding of the glass plates . moreover , the jets of blowing air of tempering zone 14 encounter a resistance to their penetration due to the front edge of the glass plates . furthermore , these jets of cold air run the risk of cooling the bending zone and therefore of disturbing the bending . for all these reasons , means are provided for aiding the glass to continue to advance smoothly and for forming a barrier to the tempering air . the glass plates , therefore , pass between two rollers : a lower roller 4 and the upper boundary roller 13 pressing elastically on the surface of the glass . the glass then continues its advance along the same curved path in tempering zone 14 , held this time by lower rollers 4 and upper rollers 15 and it is simultaneously subjected to the action of the blowing jets . then it is removed from the machine . if a complex bending is desired , a pair of rollers in the shape of the concave / convex type of fig2 positioned at the end of the bending zone 11 obtains the expected result . as a variant , the glass plates travel on a shaping bed consisting of curved rollers , particularly curved rods covered with rotating sleeves such as is shown in fig3 . the speeds and temperatures are on the same order as those already indicated . in the case of a double curvature of the glass , it is preferred to obtain the curvature whose radius is smaller by use of the shaping bed with a profile curved in the longitudinal direction of the glass plates , while the larger radius curvature is obtained by the curvature of the curved rollers , etc ., i . e . transverse to the direction of advance . if the glass does not need to be tempered , the pair of lower 4 and upper 13 rollers is no longer necessary and can be eliminated if the slope of the bed of rollers 4 at the end of bending zone 11 is not too high and the glass plates can continue to advance smoothly without sliding . actually , the difficulty created by the cool air of the tempering station no longer exists , and the difficulty of the front edge of the glass entering the air jets of the tempering blowing is also eliminated . in addition to the exceptional optical quality of the glazings obtained in such a bending machine , there is also noted the ease of bending of glazings carrying coatings of enamel on their upper face , which at this stage of production are not yet totally hardened . the absence of upper rollers , or their very separated position when they exist only as safety means , eliminates the danger of deterioration of the enamel during production . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the claims , the invention may be practiced otherwise than as specifically described herein .	2
it will be readily understood that the components of the present invention , as generally described and illustrated in the drawings herein , could be arranged and designed in a wide variety of different configurations . thus , the following more detailed description of the embodiments of the system and method of the present invention , as represented in the drawings , is not intended to limit the scope of the invention , as claimed , but is merely representative of various embodiments of the invention . the illustrated embodiments of the invention will be best understood by reference to the drawings , wherein like parts are designated by like numerals throughout . referring to fig1 - 6 , while referring generally to fig1 - 19 , a system 10 in accordance with the invention may be manufactured as a modular system , susceptible to user maintenance and repair , onsite . moreover , a system 10 in accordance with the invention provides not only aroma diffusion or diffusion of an operating liquid atomized to be introduced into an atmosphere of an enclosed space , but also purification of the air used to drive the system 10 , and to atomize the liquid . as used herein , the liquid will typically be an oil , such as an essential oil used for aromatherapy , antibacterial treatment of a space , or the like . such liquids may include oils , alcohols , other solvents , antimicrobials , and the like . such liquids may also be combinations of various components , in order to obtain multiple benefits from a single liquid combination . in the illustrated embodiment , the system 10 may be driven by an electrical module 11 that contains the powered components of the system 10 . the entire system 10 may be enclosed in a housing 12 that includes a base 14 and door 16 that close together in a clamshell - like arrangement . for example , a germicidal module 13 may fit in the base 14 , upstream from the electrical module 11 . meanwhile , downstream , through a collar 15 , formed as a relief 15 or collar 15 in the base 14 and door 16 , may be an exit port for treated air . in the illustrated embodiment , a retainer 17 or clip 17 may be formed on the door 16 , or on the base 14 to hold spare parts , replacement components , and the like . for example , a holder for filter media may be used . however , more difficult items to locate may be such items as tubes , which may wear , age , or the like . thus , a retainer 17 or clip 17 in the case 12 , or multiple retainers 17 , may be used to provide readily - accessible components , that may need replacement over time . a lock 18 may be useful for multiple reasons . for example , tampering with controls may be expensive , damaging to the system 10 , damaging to the environment being treated by the system 10 , or may be problematic , given the value of liquids that may be dispensed in the system 10 . thus , providing a lock 18 will assure that the base 14 and door 16 are locked together and inaccessible by unauthorized persons . in one embodiment a key on a retractable line system 191 is hidden from view in the well 70 of the base 14 . thus , a key is retracted into the well 70 , not visible to a casual observer , yet accessible to an authorized , knowledgeable person servicing the system 10 . thus the lock 18 provides some protection against tampering , while the key retractor 191 provides a spring - loaded , retractable line holding a key ring with a key available . such retractable line systems are often worn by maintenance personnel as a retractable key ring on a belt - connected assembly as known in the art . filtration may be done upon intake , but also through a filter module 19 positioned between the germicidal module 13 , and the electrical module 11 downstream therefrom . in the illustrated embodiment , the passage of air is from an inlet 20 through a filter 22 . air passes then into the germicidal module 13 , followed by the filter module 19 , and the electrical module 11 . the electrical module 11 is thereby cooled by the principal flow of air flowing through the system 10 . in the illustrated embodiment , the germicidal module 13 may include a baffle 23 . the outer surface , or convex surface of the baffle 23 may serve as an air baffle to redirect air into the chamber 24 . the chamber 24 or ultraviolet chamber 24 operates by a light source 26 emitting an ultraviolet light irradiation . typically , the light source 26 will emit a strong ultraviolet wavelength of light that is reflected from the concave side of the baffle 23 as a reflector 23 . that is , the baffle 23 may operate as a baffle 23 for air incoming from the inlet 20 , but also on the opposite face thereof , operate as a reflector 23 . thus , a highly reflective material , such as a metal , may be disposed on the back or downstream face of the baffle 23 . typically , the indirect light from the source , may thus be recycled , or recaptured , by the reflector 23 . in one embodiment , a catalytic screen 28 , such as a metal , or metallic - coated , screen may operate to ionize oxygen . ionized oxygen may result in free oxygen ions , but will often result in creation of ozone , a combination of three atoms of oxygen , that is fundamentally unstable , and highly reactive . thus , any microbe , such as a bacterium , virus , or the like , may be killed directly by ultraviolet radiation , may be damaged or killed by oxidation by an oxygen ion near the catalytic screen 28 , or may be influenced by both . one kill mechanism is typically pure radiation from the light source 26 , whether direct or reflective . another is chemical damage to a cellular organism by oxygen ions . oxygenation , or oxidation is effectively the same effect as burning . the temperature may not be as high , but the chemical result is that of oxidation or consuming . accordingly , the reaction of chemicals within a microbe can destroy the cell . referring to fig1 - 2 , while referring generally to fig1 - 19 , a system 10 in accordance with the invention may include one or more filters in a filter module 19 . for example , in the illustrated embodiment , two sides of the filter module 19 are combined on a slide 29 or center portion 29 . the slide 29 operates as a frame 29 holding a filter 30 upstream , captured behind a grill 31 , and a second filter 32 downstream , captured by a grill 33 . in the illustrated embodiment , the filter 30 may have a mesh size smaller than the incoming filter 22 , but larger than that of the third level filter 32 downstream . in the illustrated embodiment , various combinations of filters 22 , 30 , 32 may be used . in certain embodiments , the grills 31 , 33 may operate as frames , engaging the slide 29 . the grills 31 , 33 may be glued as a unitary system to the slide 29 , all three being formed of similar or compatible plastics . they may be solvent or adhesive bonded to one another . in other embodiments , brackets on the slide 29 may receive the grills 31 , 33 sliding thereinto , to form a unitary filtration module 19 . in certain embodiments , fibers treated with capture materials that will hold items that stay on impact may be suitable . in some embodiments , a mat , bat , fiber , fabric , or the like may be used for the second filter 32 in the filter module 19 . for example , a folded paper filter , a folded screen , a folded glass fiber mesh , non woven fabric , or the like may be used . in any suitable embodiment , the power used to drive air or draw air through the filtration module 19 should be matched with the drag , caused by porosity or the size and number of apertures in the filters 30 , 32 . one must be aware that the system 10 will adjust to match the power requirements for airflow with the airflow and the filtration capacity . in certain embodiments , the filtration may be sub - micron in at least one of the filters 30 , 32 . in other embodiments , the filtration may be done to sub micron sizes by a tortuous path , that does not have an affirmatively smaller aperture , but rather simply attaches and holds such particles . a control system 34 may be contained within the electrical module 11 . for example , in the illustrated embodiment , various control buttons 35 may provide operational controls such as set up . for example , in the illustrated embodiment , a set of control buttons 35 may provide set up of the system , with information displayed on a display 37 in which the control buttons 35 are integrated . meanwhile , placed thereabove , is a set of knobs 36 or controller knobs 36 that control the operation of the fan , the output volumetric flow of liquid from the diffuser , the delay time between operation in a less than a 100 percent duty cycle , and the total run time in each individual cycle of the overall duty cycle . meanwhile , the buttons 35 associated with the display 37 may control for example , a computer program selection . it may scroll through various programmatic operational schemes . a selection button for setting or confirming a particular setting , opening up settings for operation , closing settings as acceptable or confirmed , and the like may also be included . meanwhile , incremental buttons may be included for incrementing week , hour , minute , seconds , or the like on a clock for program timing . meanwhile , a decrement button may be included for decrementing weeks , hours , minutes , or seconds of time . meanwhile , there may be available a button for erasing or backing over a previous selection , and the like . typically , a reset key to return to a default position , or to return to a known location in the process of programming may be available as well . in certain embodiments , various on and off switches as well as programming and operating indicators may be included . the control system 34 may be installed effectively behind or against the back of a recessed portion 38 of the electrical module 11 . in the illustrated embodiment , the various control knobs 36 a , 36 b , 36 c , 36 d , are used to control , respectively , the fan speed , the pump pressure and effective output , the rest time or wait time , sometimes referred to as dead time or delay time , in which the system is not operating , and the run time duration of operation after a rest time , respectively . thus , the overall passage of air , the amount of atomized or diffused liquid , the down time , and the run duration , may all be controlled directly by the controller knobs 36 . it should be noted herein that all reference numerals refer to specific items . trailing letters following reference numerals refer to specific instances of the item identified by the reference numeral . thus , the control knobs 36 a , 36 b , 36 c , 36 d correspond to specific instances of control knobs 36 generally . it is proper to refer the number alone to mean any or all , and to the number with the reference letter to identify a specific instance . a pump housing 39 or pump housing portion 39 of the electrical module 11 may house one or more pumps 40 . these pumps may be as described in the patents incorporated hereinabove by reference . in certain embodiments , the system 10 may operate with a single pump 40 . in other embodiments , two pumps 40 may be operated in parallel to feed compressed air to the diffuser 46 of diffused liquid . considering the overall structure of the electrical module 11 , a front panel 41 may actually include a pump housing portion 39 defining the space in which the pumps 40 will reside , as well as a control portion 38 or recessed portion 38 that will hold the control system 34 , with its control buttons 35 and knobs 36 likewise , the display 37 is positioned in the recess portion 38 . in the illustrated embodiment , a fan housing 66 or fan housing portion 66 may fill out the remainder of the front panel 41 . more will be discussed about the various constituent components in addition to the panel 41 of the electrical module 11 . the handle 42 is secured by brackets 43 to the electrical module 11 . for example , the electrical module 11 contains two or more motors . the controllers also contain electrical components . electrical components constitute weight . thus , additional strength , modularity , and support are engineered into the electrical module 11 . the handle 42 secured by brackets 43 to the module 11 , may lift the entire system 10 . it may lift the electrical module 11 out , once securements are removed that hold the electrical module 11 inside the base 14 of the housing 12 . the pumps 40 provide compressed air , purified through the germicidal module 13 and filter module 19 , typically as that principal flow of air passes through the electrical module 11 , cooling the electrical components therein . thus , the fan 64 in the fan housing 66 or fan housing region 66 , draws and drives the principal airflow . nevertheless , a portion of the airflow is drawn off from the principal airflow to the one or more pumps 40 to pressurize a flow of air in a line 44 feeding the diffusion module 45 . the diffusion module 45 , may be thought of as the arrangement of components , or the housed region including all the components . thus , in the illustrated embodiment , the pressure line 44 feeds directly into a diffuser 46 or atomizer 46 . this atomizer 46 has been discussed in detail in the patents incorporated herein by reference . the atomizer 46 feeds a flow of atomized liquid droplets out through a nozzle 48 . at the opposite end from the nozzle 48 , the diffuser 46 connects by way of an adapter 50 to a reservoir 52 . the reservoir 52 is supported by a seat 54 formed into , or attached to the housing 12 . in the illustrated embodiment , the seat 54 is secured to the base portion 14 of the housing 12 . it may be supported by , or may be in contact with , the bottom or floor of the door 16 of the housing 12 in certain embodiments . the diffuser module 45 receives the principal flow of air passed from the electrical module 11 into the diffusion module 45 . thus , the principal flow of air , after warming itself by cooling the electrical module 11 , is passed through the space of the diffuser module 45 . the flow of air past the nozzle 48 acts as an eductor drawing with itself , by a transfer of momentum thereto , the flow of compressed air . entrained therein are the ultra - small - diameter liquid droplets from the nozzle 48 as generated in the diffuser 46 . various separation schemes , discussed in the patents incorporated herein by reference , as well as elsewhere in this disclosure , identify the operation of the diffuser 46 and the nozzle 48 . obtaining a comparatively very small droplet size of liquid droplets is hereby defined as obtaining a size thereof entrained into the flow of air out of the nozzle 48 , and into the shroud 56 such that droplets persist for from about one to about 30 minutes in ambient air without settling out . thus , the entire flow , including the portion drawn off by the pumps 40 into the line 44 , is recombined by eduction to enter the shroud 56 . that director 56 provides an exit 60 or outlet 60 from the system 10 . in the illustrated embodiment , the shroud 56 may be rotated with respect to the collar 15 in the housing 12 to provide directionality . moreover , a grill 58 or louvers 58 may be formed at the outlet 60 to provide vanes to direct flow exiting the system 10 through the outlet 60 of the shroud 56 . practically , the germicidal capability of the system 10 is served in at least two ways by the shroud 56 or director 56 . the volumetric flow rate provided by a fan 64 is selected to provide an exit velocity through the outlet 60 that will project into the enclosed spaced serviced by the system 10 . by maintaining a suitable volumetric flow rate ( cubic feet per minute , cubic meters per second , or the like ), the system 10 may project an entrainment jet from the exit 60 , directed by the orientation of the housing 56 or shroud 56 , and the louvers 58 . typically , twenty outlet diameters of distance may still include or demonstrate velocity of the jet or plume being projected from the outlet 60 . for example , near the outlet 60 , the jet or plume of air , laden with liquid droplets travels at a substantially faster velocity than surrounding air , which is substantially still . according to the rules of newtonian momentum transfer , and the equations thereof , well understood fluid mechanics , the jet will exchange momentum with the surrounding air , slowing the outer perimeter of the jet , and speeding up the engaged portion of the surrounding air . with additional distance away from the outlet 60 , the jet will expand in size , decrease in maximum velocity , and spread out its velocity distribution in space . the plume will occupy more area , have less speed , and involve more volume and mass of air . thus , the diffuser 46 diffuses into the principal flow by an eduction scheme with the nozzle 48 inside the housing 12 . the educted flow of scented air passes out of the shroud 56 , through the outlet 60 , and continues to entrain ambient air in a jet extending many diameters away from the outlet 60 . this may be actual diameter , and may be characterized in equations using effective diameter . effective diameter in fluid mechanics is referred to as a hydraulic diameter . a hydraulic diameter is four times the area available for passage of a fluid divided by the wetted perimeter , or the overall perimeter to which the passing fluid is exposed . the diffuser module 45 may include , or operate cooperatively with windows 62 or sight glasses 62 . for example , the sight windows 62 or sight glasses 62 may include flexible , closed windows fitted into the corners of the housing 12 to prevent the free flow of air in or out through the windows 62 . meanwhile , the windows 62 provide a sight glass 62 for observation of the liquid level in the reservoir 52 . the sight glasses 62 or windows 62 may be spaced at approximately one quarter , one half , three quarters , and full height , with respect to the shoulder of the reservoir 52 . more or fewer of these sight windows 62 may be formed in the housing 12 as desired . a fan 64 in the fan housing 66 may be of a suitable form , whether a squirrel - cage , centrifugal , screw , or rotary impeller type . it has been found that a rotary screw impeller , such as a pancake fan 64 serves adequately with minimum electrical power draw . a hinge pin 49 may connect the base 12 to the cover 14 . in the illustrated embodiment , an ejector pin 49 serves this function well by providing a head that would normally function as the ejection portion itself , and the push rod acting as the hinge pin 49 . by proper sizing and a suitable core pull , the ejector pin 49 serves as a hinge pin 49 . referring to fig3 - 4 , while continuing to refer generally to fig1 - 19 , the housing 12 of the system 10 may include a back portion or base 14 . a front portion or cover 16 operates as a door 16 opening the housing 12 to expose the modules 11 , 13 , 19 , 45 therewithin . in the illustrated embodiment , the components have been removed to show the structure of the housing 12 . one may note that the apertures 20 or inlets 20 to which first stage filters 22 are fitted , occupy corners of the housing 12 . likewise , the lock 18 requires a shape that causes an incursion into the interior of the housing 12 . nevertheless , the shape of the germicidal module 13 accommodates the relief required to receive the lock 18 . a series of slots 67 includes slots 67 a , 67 b , 67 c , and may include others . the slots 67 receive the individual components . for example , the slot 67 a receives the germicidal module 13 , fitting around an outer rim of the housing thereof . the slots 67 are formed by rails 68 or guides 68 . in the illustrated embodiment , the edges of the respective components 11 , 13 , 19 , 45 may be formed to be received by the slots 67 , as constrained by the rails 68 or guides 68 . thus , the rails 68 or guides 68 in combination with their respective modules 11 , 13 , 19 , 45 form somewhat of a seal urging all of the principal airflow to pass therethrough . a detent 69 corresponding to certain slots 67 may provide capture of a module 13 , 19 . thus , in certain embodiments , the modules 11 , 13 , 19 may be hand insertable , retained , and removable , all without tools . an undercut in each of the detents 69 a , 69 b may be matched by a swell or expansion in the dimensions of an outer rim of a module 11 , 13 , 19 , thus providing for ready insertion , snap to lock , and snap to unlock and remove . a well 70 may encroach on the inner volume of the base 14 . in the illustrated embodiment , the well 70 provides an external well 70 that can receive a power supply , plugs , other power connection devices , and the like . thus , the system 10 may be totally integrated to connect to a power source by a suitable means , including a transformer or other power supply , without affecting the outer envelope , that is the outer volume or the outer volumetric maxima , of the system 10 . mounted against a wall , for example , the base 14 can contain in the well 70 a power supply or plugs to a wall or line power source . the well 70 may be provided with an aperture 71 for passing cables , as necessary , through from outside the housing 12 inside to the controller system 34 , pumps 40 , and fans 64 in the electrical module 11 of the system 10 . various bosses 72 may be formed , of any suitable length , as needed , such as for receiving fasteners . relieved regions 73 may represent surfaces flush with the outer surface of the housing 12 , but recesses that pass almost through those outer surfaces . the relieved regions 73 may provide a comparatively thinner wall in the housing 12 in order to readily receive a fastener penetrating therethrough . for example , a user can punch the point of a screw through the relieve region 73 , due to the very thin wall . on the other hand , spurious sources or leaks of air may not spring up through unused holes or other apertures in the walls of the housing 12 . thus , a variety of relieve regions 73 may be provided through which a user or installer can puncture , typically the hand , a screw or other sharp pointed fastener . hinge lugs 74 may be formed in each of the base 14 and door 16 portions of the housing 12 . in one innovative design of a housing 12 in accordance with the invention , the hinge lugs 74 are sized to match a diameter of an ejection pin 49 from an injection molding machine . meanwhile , the drive shaft for driving an ejector pin 49 may have a diameter selected to be the diameter of a hole formed by a core pull through the hinge lugs 74 . thus , total alignment of the hinge lugs 74 , may be formed by a core pull element that is removed before the mold is opened . thus , assembly may be done by sliding a new ejector pin 49 down , as a hinge pin 49 , through each of the hinge lugs 74 , to make a piano - hinge type of attachment of the door 16 to the housing 12 . slots 75 may be formed to receive the brackets 43 of the handle 42 . thus , the electrical module 11 may be released by removing fasteners , and may be picked up and taken out of the base 14 , directly , without removal of or from the handle 42 . for example , in the illustrated embodiment , the brackets 43 are integrally and homogeneously formed with the framing structure of the electrical module 11 . they capture the handle 42 during assembly . thus , the handle 42 is integrated with the electrical module 11 , which may then be integrated with the overall housing 12 , and other modules 13 , 19 , 45 . in the illustrated embodiment , the rails 68 c may capture and seal a portion of the electrical module 11 securely to the base 14 of the housing 12 . the rails 68 c operate as guides about the slots 67 c formed by the rail sets 68 c . each receives a matching edge of a portion of the electrical module 11 . various apertures and fasteners ( e . g . screws ) may secure the electrical module 11 into the case 12 or housing 12 . typically , the weights of the germicidal module 13 and filter module 19 typically weighing ounces , are such that the detents 69 exert sufficient force to maintain them in place . in contrast , the electrical module 11 may weigh several pounds owing to the motors , magnets , wire , and the like contained therein . accordingly , it is normally safer to have the electrical module 11 firmly maintained within the slots 67 by fasteners through the walls of the housing 12 , rather than simply by detents 69 . referring to fig5 - 6 , while continuing to refer generally to fig1 - 19 , a system 10 encased in a housing 12 may be carried by a handle 42 for temporary duty . for example , a chambermaid , homeowner , or traveler may carry the system 10 by handle 42 from room to room for use . feet secured to the bottom of the housing 12 may support the system 10 on a surface , such as a desk , cabinet , counter , or the like in order to treat a room . a homeowner , a chambermaid , or the like may carry the system 10 by the handle 42 into a room , activate it by powering it up from wall current , operating it according to the control system 34 , for a temporary time period . the effect may be one of providing a scenting of the enclosed area , fumigation , extermination of microbes or bugs , or any combination . in other embodiments , apertures in the base 14 may receive fasteners to secure the system 10 to a wall . meanwhile , from the exterior , the sight glass windows 62 may be used to determine the condition of the reservoir 52 , and its content level . the lock 18 may be accessed for opening and closing the housing 12 . typically , the shroud 56 rotates in the collar 15 , which may include a keeper securing to the housing 12 a rim or flange of the shroud 56 . this maintains position , yet provides for rotary motion with respect to the housing 12 . thus , the louvers 58 at the outlet 60 may be aimed in any suitable direction . referring to fig7 , while continuing to refer generally to fig1 - 19 , the germicidal module 13 may include a box 76 or housing 76 that operates as a frame 76 to contain the remaining components thereof . in the illustrated embodiment , for example , a baffle 23 defines a light chamber 24 served by a reflector 23 on the concave side of the baffle 23 formed on the convex side of the barrier 23 . typically , as illustrated , a ballast 78 may operate in conjunction with a light source 26 in the light chamber 24 . typically , the light band is in the ultraviolet region in order to provide the best , direct germicidal effect . the catalytic screen 28 and the reflector 23 may include catalytic metals to provide for catalysis of oxygen atoms from ambient air as charged , ionic particles . light irradiation in the ultraviolet bandwidth of the light source 26 may provide direct killing of microbes , such as bacteria and viruses . the catalysis of oxygen into oxygen ions at the metallic screen 28 provides oxygen ions , ozone , or both to react chemically with the cells of microbes and viruses , thereby destroying them . the keeper 80 is secured , and may be shaped to support or register the catalytic screen 28 thereon , holding the catalytic stream 28 against edges of the baffle 23 or reflector 23 . the entire assembly may be secured by the keeper 80 within the rim or edge of the housing 76 of the germicidal module 13 . securement may be by glue , fasteners , clips , screws , or the like . the registers 77 space the baffle 23 or reflector 23 properly to clamp or otherwise hold the catalytic screen 28 between a rail 79 or edge 79 of the baffle element 23 and the keeper 80 . the registers 77 thus fit against the edge 79 or rail 79 providing a reaction force for the clamping by the keeper 80 . the keeper 80 is provided with an aperture sized to expose the majority of the catalytic screen 28 to the passage of air through the aperture and out of the germicidal module 13 . in certain embodiments , the germicidal module 13 may have a rim sized to snap into a detent 69 , at the end of traverse or sliding along a slot 67 . thus , for example , a slot 67 a may receive a rim of a housing 76 , which may then be snapped into a detent 69 a once in the proper position . thus , the germicidal module 13 may be removed for service , replacement , repair , or the like . no tools are required . in addition to viruses , bacteria , and the like , the germicidal module 13 is also responsive to kill plant matter , such as mold spores , and the like . in general , the photo catalytic oxidation process will oxidize anything that is reactive , which includes substantially all living single - cell matter and the like . the chemical reaction with oxygen effectively destroys by oxidation , which is the same chemical effect observed in rust , burning , or the like . referring to fig8 , the filter module 19 may include a slide 29 fitted to a slot 67 and capable of securement by a detent 69 . thus , a grill 31 may secure a first filter medium 30 against the grill of the slide 29 . the slide 29 may be thought of as the backbone , or base 29 of the filter module 19 . on the opposite side of the slide 29 , a second , usually different , filter medium 32 may be secured by another grill 33 . the grills 31 , 33 may be glued to the slide 29 . in other embodiments , the grills 31 , 33 may be secured by sliding , snapping , clipping , or other fastening mechanisms to the slide 29 . in the illustrated embodiment , the slide 29 includes a rim that is offset , such that the grill thereof is closer to the grill 31 of the first filter medium 30 , and an additional space is provided to receive the other , second , filter medium 32 . thus , the grills 31 , 33 may actually be the same size , even identical , and yet a filter medium 30 , 32 need not be the same size . thus , an offset of the grill in the slide 29 may provide additional space for filter medium 32 . in this way , folded media may operate as the second filter medium 32 . referring to fig9 , the electrical module 11 is illustrated in isolation from the overall system 10 . in the illustrated embodiment , as discussed hereinabove , the handle 42 is inherent or organic to the electrical module 11 . brackets 43 may be secured to , and even molded homogenously with the appropriate portions of the frame 81 . the frame 81 represents the structural elements of the electrical module 11 . for example , in the illustrated embodiment , the frame 81 or cage 81 may include sides 82 or side panels 82 . these may be mirror images of one another . a top panel 83 may secure to the side panels 82 , thus forming a more - or - less rectangular structure . in the illustrated embodiment , the brackets 43 are molded homogenously with , from the same material at the same time , the side panels 82 . a bottom panel 84 may secure to each of the side panels 82 , at the bottom ends thereof . a support 85 or sled 85 may support one or more pumps 40 . the support 85 or sled 85 may ride on slides 86 or rails 86 formed in each of the side panels 82 . in this way , the entire pump assembly constituted by the pumps 40 on their sled 85 may be withdrawn , serviced , and replaced in the frame 81 , by an individual user . as a practical matter , the edges 87 of the side panels 82 may fit into the slots 67 c between the rails 68 c in the base 14 of the housing 12 . rather than circular apertures , such as blind holes for receiving screws , slots 88 may be formed in each of the panels 82 , 83 , 84 to receive fasteners . by using self - tapping screws , for example , adequate strength may be obtained , and each of the panels 82 , 83 , 84 may be manufactured by a simple two - piece mold , with no core pulls required . in selected embodiments , a slide 29 may be configured to have a reduced height on one side . thus , the slide 29 may slide into a fixture , or slot 88 in the base 14 of the housing 12 . moreover , in certain embodiments , the slide 29 itself is not planar symmetrical along the axis of flow , or distribution of the components , of fig8 . for example , as illustrated , the grill portion of the slide 29 is toward the left side , but an extension exists on the right side . accordingly , a larger cavity is created between the slide 29 , and the grill 33 than is formed between the slide 29 and the grill 31 . for example , in folded medium 32 , such as paper , folded fiberglass , or glass mats , additional axis space may be required . accordingly , the cavity formed between the slide 29 and the grill 33 may be larger than that of the cavity between the slide 29 and the grill 31 . thus , the filter medium 32 may be thicker by any preselected amount than the filter medium 30 . in the illustrated embodiment , for example , the grill of the slide 29 actually extends into the outer framing toward the grill 31 . in contrast , the grill 33 is spaced away therefrom and may house a larger thickness of filter medium 32 . referring to fig9 - 11 , while continuing to refer generally to fig1 - 19 , the electrical module 11 may be secured together by fasteners , such as screws , rivets , or the like . typically , screws embedded through apertures in the various panels 82 , 83 , 84 , may be received into slots 88 in adjacent panels 82 , 83 , 84 , for securing the frame 81 together . typically , the components , such as a control system 34 , display 37 , pumps 40 , and fans 64 may be secured to their respective panels 82 , 83 , 84 by suitable fasteners in blind holes , slots , or the like . however , threading a screw type fastener into a side of a flat or comparatively flat object is not a problem . such cavities may be molded with suitable draft in a two - piece injection mold or other molding system . thus , the end - or edge - oriented fasteners , which must penetrate the slots 88 , would otherwise require core pulls . this effort may be avoided in the illustrated , manufactured product . referring to fig1 - 11 , while continuing to refer generally to fig1 - 19 , the electrical module 11 is illustrated in exploded view showing details of each of the components therein . for example , the fan 64 operates secured to one side panel . the knobs 36 of the controller 34 , and the display 37 , all on the front side thereof , fit through apertures in the front panel 41 . the various bosses 72 may be formed , to the extent needed , at any suitable length . they may have blind holes formed therein for receiving self - tapping screws or other fasteners , such as rivets . thus , the securement of the various panels 82 , 83 , 84 may be complete , to one another and the securement of the components 34 , 40 , 64 thereto may also be effected . typically , the fan 64 will be protected by an open material in the corresponding side panel 82 . a large and open grill system may be formed where appropriate to encourage cooling air flow through the electrical module 11 and over all of the components therein . meanwhile , the rails 86 may be formed in the side panels 82 to receive the sled 85 supporting the pumps 40 . referring to fig1 , while continuing to refer generally to fig1 - 19 , the diffuser module 45 includes several components , including a choice of reservoirs 52 . again , trailing reference letters refer to specific instances of the item identified by the reference number . thus , it is proper to speak of any or all of the reservoirs 52 , or of each individual reservoir 52 a , 52 b , 52 c , 52 d as appropriate . in the illustrated embodiment , the diffuser module 45 may include or be incorporated within a region of the housing 12 that houses all the components illustrated in fig1 . in one embodiment , a diffuser 46 may be provided with an adapter 50 . the adapter 50 may include a fixture 93 or fitting 93 adapted to fit with , within , or without ( outside ) the diffuser 46 . a line 44 or tube 44 is shown for carrying liquid from the reservoir 52 up through the line and into the diffuser 46 . similarly , the fitting 93 fits or is adapted to connect , such as by threads , bayonet fitting , slot , compression fitting , or the like with the diffuser 46 . likewise , the adapter 50 also includes a fitting 94 configured to fit with a specific type of fitting 95 of a reservoir 52 . in the illustrated embodiment , various sizes of reservoirs 52 a , 52 b , 52 c , 52 d are illustrated . the system 10 , and the diffuser module 45 , in particular , will accommodate any of the reservoirs 52 illustrated and more . other shapes and sizes may also be used . this is contrast to typical systems . conventionally , canisters or cartridges contain liquids to be atomized . the diffuser 46 , or whatever mechanism was used as an atomizer 46 is typically built into the cap or top portion of the cartridge - type reservoir 52 . as a result , customer selection of reservoir type , size , content , and operating system 10 using such reservoir for delivery for atomized liquids , has been limited , constricted , and rendered much more expensive . sufficient expense is involved that most atomization systems for industrial applications are not even sold . they are typically owned and maintained by a supplier of the canister or cartridge style reservoir 52 . in the illustrated embodiment , a supply of adapters 50 can fit any common reservoir type 52 . for example , one ounce , two ounce , eight ounce , sixteen ounce , and thirty two ounce bottles of essential oils are available . similarly , other bottle styles and sizes , made of various materials , whether glass or polymer , are also available . the adapters 50 in accordance with the invention adapt between the diffuser 46 , and any suitable reservoir 52 requested by a customer . therefore , the adapter 50 provides for a universal diffuser module 45 , adaptable virtually to any source of liquids . moreover , a user may simply select a particular type of reservoir 52 , use an adapter 50 suitable for that reservoir 52 , and then refill or re - purchase a generic reservoir 52 for use in the system 10 . the atomizer 46 may be fitted with a micro - cyclone 90 . the micro - cyclone 90 or cyclone 90 contains a spiral channel 91 . the channel 91 begins below a central plane 96 , which is actually defined by a plate 96 formed thereby . in one embodiment , the micro - cyclone 90 is cast in a two - piece mold , as a comparatively thin walled casting . vacuum forming may even operate to make such devices in certain embodiments . as a vacuum formed or injection - molded part , the micro - cyclone 90 may be formed in two halves , each having a base plate 96 or plane 96 on which half the spiraling channel 91 or spiral - shaped channel 91 is formed . by remaining connected , at one small area or region , the two halves of the micro - cyclone 90 may be folded together , and snapped closed . for example , an aperture in one half , and a button or extension in the other half provide a detent to tie down the two halves together . thus , held on one side by a continuation of the flange 96 or plate 96 , the micro - cyclone 90 folds in half to double up . it snaps together to form the central plate 96 , with a channel 91 spiraling from fully below the plate 96 to fully above it . the entire cross - sectional area of the channel 91 may remain constant throughout the entire spiraling circular route , from below the plate 96 to above the plate 96 . in the illustrated embodiment , it has been found appropriate and best functioning to keep the size of the channel 91 at constant area , and cross - section . some atomized liquid particles , passing out through the channel 91 from the atomizer 46 , pass into the channel 91 , and out the nozzle 48 . any larger particles , or the comparatively larger particles in the stream of air , tend to smash and coalesce against the inside of the outer wall of the channel 91 . they drip back into the atomizer 46 , or diffuser 46 , to be re - atomized . thus , only the comparatively smallest range of droplets is passed out to the nozzle 48 . this provides higher efficiency , more effectiveness , and eliminates collection of oil droplets on surfaces outside the system 10 . in certain embodiment , the micro - cyclone 90 may include a dam 92 that begins at the innermost radius of the upper opening of the channel 91 . it then passes in spiraling , circular , arcuate shape around to the upper outside wall of the channel 91 . eventually its lower edge rides up along that wall to the pre - selected height of the dam 92 . the dam 92 typically ends at a gap just before the wall of the channel 91 at which it begins , at its innermost diameter . the gap provides for the retrieval or return of any oil that collects within the dam 92 . the dam 92 performs three significant functions . from its position in the micro - cyclone 90 , the dam 92 collects liquid , makes a constructive gap , and changes direction of the flow . the dam 92 serves to fit close ( from 10 to 50 mils , usually about 20 ) to a corresponding dam within the nozzle 48 . thus , the air must pass through a slot between the dam 92 , and a corresponding dam extending down within the nozzle 48 . thus , an additional sharp change in direction tends to collect out overly large particles that are not small enough to remain entrained substantially with the air at any velocity within the system 10 . the dam 92 also serves as a noise barrier . in fact , the micro - cyclone 90 , itself , by extending around an angle or included angle of about 330 degrees ( typically from about 250 to about 380 , and most preferably less than 360 degrees of included angle , with a target at about 330 degrees ) provides a barrier to the passage of internal noise . thus , the diffuser 46 operates extremely quietly compared to conventional diffusers . in the illustrated embodiment , views of the micro - cyclone 90 , moving in a clockwise direction , beginning in the upper right corner , show a top plan view , a right side elevation view , a bottom plan view , and a left side elevation view . in the center , the micro - cyclone 90 is shown in its two halves , separated . in reality , the two halves are never separated by that distance , since they are hinged together at one edge , and snapped together at an opposite edge of the plane 96 or plate 96 . in the illustrated embodiment , the bottle 52 or other type of reservoir 52 may be fitted to a seat 54 for support . the seat 54 may be formed in or may be secured to the housing 12 , such as by securement to the base 14 . padding , by way of expandable , elastomeric , polymeric foam pads may be provided to stabilize a reservoir 52 with respect to the housing 12 , the seat 54 , or both . thus , by adding or subtracting pads , or simply compressing pads , various sizes of reservoirs 52 may be fitted into the diffuser module 45 . the aperture , with the attachment penetrating therethrough , is visible in the small circle in the upper right hand corner of the top plan view . in the bottom plan view , the stud fit into the aperture is on the opposite side of the plane 96 or flange 96 thereof . meanwhile , the noise suppression capability of the micro - cyclone 90 comes partly as a matter of the circuitous route , through the channel 91 and beyond . the plate 96 or flange 96 blocks the propagation of sound waves directly out of the barrel or central cavity of the diffuser 46 . similarly , by maintaining constant effective lengths , cross - section , and diameter , whistling is reduced in the channel 91 . by diameter is meant the effective diameter . the cross - sectional area , long and short dimensions , shape , which tends to be a rounded rectangular shape and so forth , are maintained substantially constantly throughout the entire circular spiral rise of the channel 91 in the micro - cyclone 90 . referring to fig1 - 18 , the design of the apparatus 10 is viewed from a front elevation , rear elevation , right end elevation , left end elevation , top plan , and bottom plan view . in the illustrated embodiment , various apertures 98 , 99 may be provided . for example , certain apertures 98 may be formed to provide a location for extending fasteners through the wall of the housing 12 in order to secure selected components of the various modules 11 , 13 , 19 , 45 within the housing 12 . other apertures 99 are formed to receive feet that will support the housing 12 and the system 10 on a surface . referring to fig1 , a process 100 in accordance with the invention may begin outside the system 10 by drawing 102 a quantity or flow volume of ambient air from a treated , enclosed , habitable space . typically , upon drawing 102 a quantity of air through the inlet 20 , filtering 104 is completed at a highest ( e . g . largest , grossest ) size consideration by filters 22 or filter media 22 positioned in the inlet 20 . typically , foam filter media backed by keepers , may be deformed into the corner shape of the housing 12 in order to fit snuggly within the inlets 20 . following this outermost , largest - particle - size filtering 104 , exposure 106 to a germicidal module 13 may occur . exposure 106 may include exposure to ultraviolet light , ozone , oxygen ions , or the like . in the illustrated embodiment , exposure 106 may include all three . that is , ultraviolet light provides a direct kill of microbes , while catalytic screens 28 may provide ionization of oxygen for the formation of oxygen radicals and ozone to react with and kill microbes . catalysis 108 may occur on the reflector 23 or baffle 23 of the germicidal module 13 , but will typically occur in about the catalytic screen 28 as a result of the ultraviolet light or ultraviolet irradiation . filtering 110 by a filter medium 30 is second in the overall flow of the principal flow through the system 10 . it may be followed by filtering 112 through an additional , typically more restrictive , filter medium 32 . bypassing 114 may include drawing the majority of the principal flow coming through the inlets 20 and filter module 19 into the electrical module 11 . meanwhile , a flow of air passing into pumps 40 is drawn from the principal flow , and pressurized to flow into a line 44 driving a diffuser 46 . thus , bypassing 114 is substantially supporting the cooling 116 of the components within the electrical module 11 . for example , the actual majority of airflow typically bypasses the diffuser 46 . it first passes into the electrical module 11 , cooling 116 the principal electrical components , such as the fan 64 , pump 40 or pumps 40 , and the control system 34 with its associated electronics . it then flows around the outside of the diffuser 46 . the fan 64 provides for the drawing 102 of the principal flow of air . meanwhile , the fan also draws the principal flow of air over the components in the electrical module 11 . accordingly , the cooling 116 is driven by the fan 64 . likewise , by passing through the fan 64 , the bypass flow is compressed 118 to a certain much lesser extent by the fan 64 . a pressure rise across the fan 64 is a result of the work put into the airflow by the fan 64 . thus , the fan 64 slightly compresses the flow of the bypass air . induction 120 by the pumps 40 draws air from the principal flow , typically upstream from the fan 64 , into the diffuser 46 . in certain embodiments , the flow may be drawn from an area downstream of the fan , thus providing additional pressure rise or a net higher gauge pressure as an output of the pumps 40 . compression 118 by the pumps 40 , or a single pump in certain embodiments , is completed before passing an output from the pumps 40 into the line 44 . typical operational capacities of the pumps may be about 1 . 7 psi ( 12 kpa ) gauge or pressure increase in the flow . approximately 0 . 12 cfm ( 3 . 5 liters per minute ) flow through the two pumps , and out the controlling orifice of the diffuser 46 . a single pump will produce approximately the same pressure rise , but will reduce the volumetric flow rate to about 0 . 09 cfm ( 2 . 5 liters per minute ). the compression 118 results in a flow of air that induces 120 or causes atomization . typically , the pumps 40 may compress air by about 1 to about 3 pounds per square inch ( 7 kpa to 21 kpa ). however , it has been found that a set point of about 1 . 7 pounds per square inch ( 12 kpa ) rise ( gauge pressure above atmospheric ) is appropriate through the pumps 40 to the nozzle 48 of the diffuser 46 . typically , atomization 124 will occur by eduction , wherein the flow of compressed air over or near an opening drawing from the reservoir 52 , will impart momentum to the fluid ( liquid ). this strips away liquid , thus drawing more liquid out of the tube , and atomizing 124 that liquid into a range of small particles . as a practical matter , in one embodiment , a feed line may receive a flow of comparatively higher speed air passing over the top thereof , thus stripping liquid from the feed line , and imparting a momentum transfer , with a corresponding draw in pressure . thus , the liquid droplets are entrained within the air stream , thrown toward a nozzle cone , and ejected out a small aperture in the point of that cone against an opposite wall . atomization 124 as described is completed by an eductor . the eductor may operate in a classical concentrical , collinear , or parallel path arrangement . alternatively , eduction may be done by one flow transverse to another , as described . the air flow thereby transferring momentum to the liquid available at a surface , is stripping droplets away from the surface . movement of liquid calls for replacement liquid in the tube . the eductor may eject out a nozzle sized and shaped to match the plume of the eduction air flow . separation 126 may occur by various events . in one presently contemplated embodiment , the micro - cyclone 90 described hereinabove fits just above a nozzle , and receives liquid droplets entrained in the compressed airflow . the micro - cyclone 90 typically requires a spiraling flow , flowing tangentially with respect to a radius and circumference of the diffuser 46 . meanwhile , the eductor operates to eject along a radius of the diffuser module 46 or the outer housing 46 of the diffuser module 45 . thus , the change in direction results in any large particles being thrown against an opposite wall by the eductor . only the comparatively smaller particles remain with the air , pass up through the spiral path of the micro - cyclone 90 . moreover , the direct impact of droplets against an opposing wall results in an absolute and total change of direction . change of direction should be at least 90 degrees , and will typically be closer to 180 degrees . the momentum and energy transfer from the wall to the droplets may result in additional atomization of particles . the comparatively larger particles from this separation stage pass down through a passage into the reservoir 52 for recycling . those that are sufficiently small to remain entrained pass into the micro - cyclone 90 . as described hereinabove , the micro - cyclone 90 then takes the droplets remaining in the airflow , and subjects them to centrifugal forces , thus throwing the comparatively larger particles of this distribution ( size range ) remaining in the entrained flow against the walls of the micro - cyclone channel 91 . subsequently droplets striking a solid surface coalesce and flow back down the sloping channel 91 , into the reservoir 52 below . ultimately , only the comparatively smallest range of particles initially entrained in the airflow can eventually pass into and through the micro - cyclone 90 , and past the gap between the dam 92 and a corresponding dam 92 in the nozzle 48 . following atomization 124 as described , separation 126 in the diffuser 46 itself and later in the micro - cyclone 90 fixture inside the diffuser 46 , as well as passing over the dam 92 through a narrow slot between the dam 92 and the micro - cyclone 90 and the dam 92 in the nozzle 48 , the eduction 128 by the principal flow occurs . eduction 128 occurs as the principal flow , flowing through the portion of the housing 12 that houses the diffuser module 45 , passes by the nozzle 48 , entraining the output of the nozzle 48 . the nozzle 48 may be any suitable shape , and may be straight , flat , tapered , non tapered , or the like . typically , the eduction by the principal flow past the nozzle 48 further mixes and entrains the droplets and their carrier airstream from the pumps 40 into the shroud 56 toward the outlet 60 of the system 10 . following eduction 128 , diffusion 130 occurs by momentum transfer between the flow of air proceeding from the nozzle 48 , with its entrained droplets of the liquid from the reservoir 52 , and the principal airflow . eventually , the shroud 56 provides ducting 132 of the flow and the shroud 56 in combination with the louvers 58 provide directing 134 of that flow into the enclosed , habitable space . again , a top cap on the shroud 56 may operate to impart a final change of direction , and may be tapered to facilitate a smoother turn by the airflow . ultimately , proper selection of a liquid for reservoir 52 to be used in the system 10 may result in antisepsis , disinfectant , extermination , fumigation , or germicidal activity by the fog or micro droplets themselves in the enclosed space . for example , various antibiotics , antiseptics , antimicrobial devices , and simply certain essential oils cause germicidal and fumigation activity in the enclosed space treated by the system 10 . in certain embodiments , the shroud 56 may be replaced with a conventional 90 - degree elbow of polymeric , e . g ., polyvinyl fluoride ( pvc ) pipe . the shroud 56 has been sized , such that the collar 15 will receive a pipe elbow that has been provided with an o - ring - type of cut in order that it may be captured by the collar 15 . thus , the system 10 may feed treated air directly through an elbow 56 , rather than a shroud 56 , into a heating , ventilating , and air conditioning ( hvac ) system . in certain embodiments , dual , silent pumps , as described in u . s . pat . no . 8 , 047 , 813 , incorporated hereinabove by reference , may be used in single or multiple arrangements . a support 85 for mounting the pumps may be mounted on the rails 86 of the frame 81 . a single pump 40 will provide an output of about 0 . 09 cfm ( 2 . 5 liters per minute ) at about 1 . 7 psi ( 12 kpa ). in certain embodiment , a purchaser may purchase a system 10 absent two pumps 40 , and use a single pump , with about two thirds the volume , and the same pressure for operation of the diffuser 46 . later , to improve capacity , an additional pump may be added to the system 10 . similarly , with the filtration module 19 , improved filters may be included , and the fan 64 may be upgraded for a higher pressure differential . thus , smaller mesh sizes may be used in the filtration 30 , 32 with an upgrade in the power of the fan 64 . in some embodiments , the germicidal module 13 may be replaced with another or a different type of filter module 19 . thus , the expense of operation , as well as the expense of the module 13 may be eliminated if such a feature is deemed unnecessary . thus , additional filtering , or no filtering , other than the original filter module 19 may be installed . the fan system 64 is modular and may be changed out to alter power or volume flow rate capacity . the filter modules 19 may be swapped out , added , or changed . the germicidal module 13 may be eliminated , replaced with the filter module 19 , or the like . similarly , at the opposite end of the system 10 , the liquid reservoir 52 may be sized to fit virtually any practical demand . the adapters 50 may be selected to adapt to different sizes , manufacturers , or other sources of reservoirs 52 , or the content liquid therein . likewise , users may select their own reservoir 52 and fill according to their own bulk purchases of liquids . thus , the system 10 is entirely modular at the behest of the user . in certain embodiments , the germicidal module 13 may be disabled in order to simply use the system 10 for its post - eduction germicidal and aroma effects of the diffuser 46 . in other embodiments , the filter module 19 may still be absent or used as the first , last , only , combined filter . thus , the initial filter 22 may suffice for a system 10 that is installed principally as a germicidal fogging machine to disperse or otherwise atomize a germicidal agent from the reservoir 52 . in certain embodiments , the micro - cyclone 90 may include a registration notch designed to register the micro - cyclone 90 in a plane of the flange 96 . thus , the flange 96 has a notch that registers , typically with the incoming pressurized line 44 . accordingly , this registration places the inlet or opening of the channel 91 above , but facing in the same direction as the injection or ejection nozzle feeding from the line 44 . the result is that the spray atomized from the initial eductor and nozzle must first proceed toward the opposite wall , internal wall , of the atomizer 46 , change direction after smashing into the wall in the comparatively largest particles , and proceed along the wall in a circumferential direction in order to come back around at least 180 degrees . a design point is about 230 degrees to arrive at the opening to the channel 91 . the atomized liquid droplets in the entrained pressurized air must travel forward to a wall , change direction by at least a 90 degree angle , proceed about 180 degrees around the circumference of the interior of the atomizer 46 , rising to enter into the entrance of the channel 91 . thus , a first stage separation occurs outside the nozzle 48 as comparatively large droplets coalesce against a film of oil or other liquid from the reservoir 52 , collecting on the wall opposite the eductor inside the diffuser 46 . a second stage separation occurs as the micro - cyclone 90 throws off the next smallest , comparatively larger particles still entrained in the compressed airflow during their transit through the micro - cyclone 90 . the third stage of separation is the change in direction , and constriction of flow in passing over the dam 92 and through a slot between the dams 92 of the micro - cyclone 90 and the final eduction nozzle 48 , in order to enter that nozzle 48 . significantly , each of the first , second , and third separation processes operates in a significant length of less than an 0 . 4 inch ( 1 centimeter ). moreover , the shortest significant length for each is typically on the order of about one eighth inch , in the narrower dimension of the micro - cyclone 90 channel 91 , and in the gap of about 0 . 060 inches ( 1 . 5 mm ) between the dams 92 in the micro - cyclone 90 and the nozzle 48 . thus , each significant length , or maximum significant length of the various separation processes is successively smaller than its predecessor . from about ⅜ inch to about ⅛ inch by about 5 / 16 inch width and height dimensions on the channel 91 , to a 0 . 06 inches ( 1 . 5 mm ) gap on the final separator . moreover , each of the first , second , and third separation processes involves a change of direction . first , about 230 degrees , then a change of direction of about 330 degrees , and then two changes of direction , each of about 90 degrees , actually constituting a full change of 90 degrees to horizontal , followed by 90 degrees to vertical . in a system 10 in accordance with the invention , the liquid in the reservoir 52 is not contaminated because the air drawn into the air pump has been purified , including all air through the fan 64 , around the reservoir 52 , and sent out into the room . microbes , such as bacteria and viruses are eliminated before air reaches the compressor or fan . thus , the system 10 may purify , filter , compress , diffuse , fan force , fumigate , in substantially any combination of such features . conventional systems recirculate liquids in ways that can contaminate their reservoirs . here , only the comparatively smallest particles are discharged , those that remain airborne for from about one to about 30 minutes . many will persist for an hour , and the minimum persistence time may be increased to five , ten , or twenty minutes . only these smallest atomized particles leave the bottle , while the heavier particles recirculate . this is an even greater advantage if the liquid itself is not a germicide , wherein microbes could propagate . users may make an arbitrary selection of liquids , absent conventional contracts for proprietary liquids and cartridges , with captive customers and monopolistic profit margins . any user or supplier may use the system 10 , buy or sell any diffusable liquid , purchase or rent the diffusing system , buy or sell their own oils or other liquids , without being locked into a contract for any constituent of operation . virtually any generic , refillable bottle may be used with any generic liquid suitable for atomizing . the air purifying industry may use the system 10 to add fragrance to pre - cleaned air , and may supply its own filter media . the fragrance industry can use the system 10 to fill a room with a selected aromatic material without contamination over long term use . the essential oil industry can use the system to provide health benefits ( e . g ., like eucalyptus oil , citrus , etc . ), a pleasant atmosphere , or aromatherapy for wellbeing . agricultural enterprises can use it for animal husbandry , such as milking parlors , barns , poultry coops for chickens , turkeys , game hens , and the like , horse stables , and the like . individual patients may use it for respiratory care , such as asthma or allergy control , purifying air , adding therapeutic amounts of decongestants like eucalyptus or other liquids , distributing masking or germicidal aromas , or the like . in general the system may be controlled , programmed , or both , as described to deliver a therapeutic amount of a suitable liquid for any of the foregoing uses , at a rate selected for effectiveness , economy , safety , or other technical criterion . a user may select the liquid , the air flow rate ( bulk or bypass volumetric flow rate ), the diffusion rate ( mass flow rate ) of liquid atomized during operation , the wait time between diffusion operation , the operation time with each diffusion on - off cycle , as well as schedule and calendaring . the present invention may be embodied in other specific forms without departing from its purposes , functions , structures , or operational characteristics . the described embodiments are to be considered in all respects only as illustrative , and not restrictive . the scope of the invention is , therefore , indicated by the appended claims , rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	0
fig1 illustrates a typical bone fracture of a human tibia into two bone fragments . fig2 illustrates a commercially available hip replacement joint . during a typical hip replacement surgery the technician may use a hammer to push a femoral anchor into the femur bone with great force . it is not uncommon with older patients to have hairline fractures or major fractures occur during the anchoring process in an artificial hip replacement . fig3 illustrates how prior art metal bands 71 and fasteners 72 could be used in multiple locations to hold fractured bone intact so that an artificial hip implant can be stabilized and bone can heal . fig4 illustrates a method of compressing the two bone fragments together with tensioning strips 1 . fig5 and 6 show a tension strip 1 with differentially modified surfaces along the axis . the tension strip 1 comprises a proximal portion 6 that has ribs or texturing for attaching to a tension strip head 10 that further comprises an upper portion 11 and a bottom portion 12 . the tension strip head 10 is attached to a tension strip distal portion 8 . tension strip 1 has a medial portion 7 disposed between the proximal portion 6 and distal portion 8 . the medial portion 7 is disclosed with various surface modifications to improve friction between the tension strip 1 and bone ( see additional fig9 - 12 ). the thickness of the tension strip 1 may also vary as well as the type of texture . fig7 illustrates a preferred embodiment of a tension strip head 10 , often referred to as a ratchet in common commercial uses such as an electrician organizing many loose wires into a clean bundle of wires . the top portion 11 of the head 10 is fixed to the tension strip body distal portion 8 . the bottom portion 12 of the head 10 is flexibly attached to the tension strip body distal portion 8 . either or both the top and bottom portions 11 , 12 of the tension strip head 10 may be textured ( such as with ridges ) to increase friction and ensure locking with the proximal portion 6 of the tension strip 1 . the proximal portion 6 of the tension strip 1 is folded over and passes between the top and bottom portions 11 , 12 of the tension strip head 10 . as the proximal portion 6 of the tension strip 1 continues to pass through the head 10 ribs on the tension strip surface temporarily displace the bottom portion 12 of the tension strip head 10 . once the tension strip rib completely clears the ridge on the bottom portion 12 of the tension strip head 10 the bottom portion 12 of the tension strip head 10 returns to its natural unflexed position . in this unflexed position the rib and ridge of the bottom portion 12 of the tension strip head 10 are in frictional contact . once the proximal portion 6 of the tension strip has passed through the tension strip head 10 a closed loop is formed and the loop cannot be loosened , it can only be tightened . fig8 shows a close up cross section of a tension strip head 10 with the tension strip proximal portion 6 engaged . fig9 and 10 show a cross section of a medial portion 7 of a tension strip 1 . in particular , in fig9 the bottom surface 13 has a generally flat profile , the surface could be smooth , have ribs , or otherwise have a textured surface that is complementary to the bottom portion 12 of the tensions strip head 10 . fig1 illustrates another preferred embodiment wherein the cross section of the tension strip 1 is curved in an arcuate profile . an arcuate profile could increase surface area contact between a tension strip medial portion 7 and bone fragment when compared to a similarly sized tension strip 1 with a flat surface , thus increasing the friction between the tension strip 1 and bone fragment . the more friction between the tensions strip 1 and the bone fragment the less likely that the tension strip 1 can slip in a longitudinal or radial direction . fig1 and 12 show the profile of a medial portion 7 of a tension strip 1 . fig1 shows a relatively smooth profile to reduce friction with tissue . fig1 shows textured teeth 14 on the bottom surface 13 of the tension strip 1 . the textured teeth 14 need not cover the entire length of the tension strip 1 , the textured teeth 14 can be preferably tailored to cover a certain bone fragment diameter from 2 millimeter to 10 millimeter for small diameter bones to 10 millimeter to 100 millimeter diameter for larger bones , so called engagement portion since it engages the tension strip head 10 . the bottom surface 13 of the tension strip 1 could have a textured surface for interfacing with the bone fragments and a different surface texture ( such as ribs ) for engaging the tensions strip head 10 . the proximal portion 6 of the tensions strip 1 can be quite long relative the diameter of the target bone to enable the technician to easily handle the tensions strip 1 and engage the tension strip head 10 into the tensioning device 50 . thus , the tension strip 1 can have differentially textured bottom surfaces to improve engagement with bone and the tension strip head 10 . fig9 and 10 also illustrate a curved top side 15 of the tension strip 1 . this curved shape can reduce interference with tissue surrounding the bone . although tension strips 1 could be made of surgical grade metals , in a preferred embodiment the tension strip 1 can be manufactured of a bioresorbable material . bioresorption rate can be increased by adjusting the surface area to volume ratio of the tension strip profile . thus , bones that require a longer time to heal could have a thicker cross section or a rectangular cross section . smaller bones or bones that do not require a long time to heal , i . e . less than six weeks can utilize tension strips 1 with a small cross section or a cross section that promotes quick bioresorption . in a preferred embodiment , a bioresorbable polymer is doped with a radiopaque material to allow patient monitoring via x - ray or fluoroscopic methods . typical bioresorbable polymers include polylactic and polyglycolic acids , polyetheylene and polydioxanone . other bioresorbable polymers are well known for different applications such as bioresorbable sutures . radiopaque dopents are known in the industry , for example compounds containing iodine , barium sulfate and bismuth oxides . other common biocompatible materials are peek polymer . additionally , the material used for the tension strip 1 must be capable of being manufactured in a sterile environment or capable of post manufacture sterilization , commonly ethylene oxide , autoclave or irradiation . tension strips must be capable of maintaining a range of pressure from 30 - 200 psi ( 207 - 1379 kpa ) because the preferred pressure setting long bones is 100 - 150 psi ( 690 - 1 , 034 kpa ). additionally , the tension strip 1 of a preferred embodiment is low profile and the guide member 22 has a similar low profile that reduces injury to tissue adjacent the bone fragment . the guide member conduit 23 is adapted to receive low profile tension strip 1 and reduce the overall profile of the guide member 22 . fig1 and 14 show an embodiment of a tensioning strip guide member 22 . the guide member 22 is an elongate member , which is generally hook shaped with a conduit 23 for receiving a tensioning strip 1 . a tension strip 1 is inserted into the conduit 23 with the head 10 of the tension strip 1 adjacent the distal opening 25 of the guide member 22 . when a tension strip 1 is placed in this manner , the tension strip head 10 has a profile that is just large enough to match the profile of the guide member 22 . additionally , the tension strip proximal portion 6 may have a lower profile than the tension strip head 10 and the tension strip proximal portion 6 can fit in the narrow conduit 23 of the tension strip guide member 22 . the distal end 26 of the guide member 22 is inserted through tissue and around a bone fragment . in this embodiment , the low profile tension strip head 10 allows tension strip guide member 22 to pass through tissue without snagging the tissue . this embodiment will reduce trauma to the tissue surrounding the bone . the tension strip guide member 22 is then removed while the technician holds the tension strip head 10 in place . once the guide member 22 is completely removed the tension strip 1 is in position and the technician can attach the tension strip head 10 to a tensioning device 50 ( fig1 - 19 ). the methods of attaching the tension strip 1 to the tension device 50 and actuating the tension device is more fully described below . in an alternative embodiment the conduit 23 of the tension strip guide member 22 is large enough to allow passage of a tension strip head 10 from a proximal opening 24 through a distal opening 25 . fig1 shows a distal portion 26 that has an angled cut so that it may lead and penetrate tissue with or without a tension strip 1 inserted into the conduit 23 . contrast fig1 , the distal opening 125 is blunt and the use of a tension strip 1 would aid in the penetration of tissue . preferred method of placement of a tension strip ( fig1 ): 1 . technician places tension strip proximal portion 6 into guide member distal opening 125 and pushes tension strip 1 into guide member conduit 123 , the tension strip 1 may optionally protrude out of guide member medial opening 126 or remain in the conduit 123 , the tension strip head 10 is in contact with distal opening 125 and occluding the guide member conduit 123 . 2 . the distal opening 125 of the loaded guide member 122 is then placed through the tissue around the bone . 3 . technician then grabs the tension strip head 10 , holds tension strip head 10 in place and removes the guide member 122 . 4 . the tension strip 1 is then ready to attach to the tension device 50 . in this embodiment the guide member 122 would have an extremely low profile , just thick enough to accommodate the thin proximal portion 6 of the tension strip 1 . also , the low profile head 10 would actually act as an obturator to block the distal opening 125 from snagging tissue . the tension strip guide member 122 can be made of very strong metal such as aluminum or surgical steel so that the guide member 122 is strong enough to push though tissue and maintain the open conduit shape . alternatively , a method utilizes a larger profile guide member 122 and concomitantly larger conduit that could accommodate the tension strip 1 and tension strip head 10 . in such a case the guide member 122 would be placed ( with or without a tensions strip loaded ) first , then multiple tension strips 1 could be fed through medial opening 126 to distal opening 125 as the guide member 122 is moved along the bone . this method would allow rapid placement of multiple tension strips 1 . in an alternative embodiment a tension strip 1 could be pushed through proximal opening 124 to avoid large tissue mass in unusual situations and then positioned to exit medial opening 126 or distal opening 125 . the guide member 22 , 122 disclosed in fig1 - 15 have conduits 23 , 123 respectively , the conduit profile is intended to be complementary to the profile of the tension strip , such that the typical profile is flat thin rectangular shape . alternatively , the conduit profile could accommodate tension strip 1 profiles as shown in fig9 - 10 . by matching the conduit profile and the tension strip profile the overall profile can be minimized and reduce injury to tissue around the bone . fig1 - 17 illustrate prior art and a preferred embodiment fig1 - 19 , of a tensioning device 50 . tensioning devices are know in various industries with various combinations of properties for various field applications . the tensioning device 50 of the present invention comprises a handle 52 that a user holds to control positioning of tensioning device 50 . the tensioning device 50 further comprises a lever 53 that when squeezed towards the handle 52 operates a ratcheting mechanism . the tensioning device 50 further comprises an elongate barrel 60 with a tensioning dial 59 at a proximal end and a blade 56 at a distal end . the distal end of the elongate barrel 60 has an entry channel 57 for receiving a tension strip proximal portion 6 . once a tension strip 1 is in place around a bone the head 10 is abutted against distal surface 61 of barrel 60 and a user feeds the proximal potion 6 of the tension strip 1 through the head 10 and into entry channel 57 . the user can feed as much excess proximal portion 6 through the entry channel 57 until the proximal portion 6 exits through the top of the elongate barrel 60 via an exit channel 58 . before the user needs to operate the ratcheting mechanism . the ratcheting mechanism has an upper grasper 55 and a lower grasper 56 that are actuated by lever 53 by pivoting about axis 62 . fig1 shows the upper grasper 55 and lower grasper 56 in the relaxed position ( prior to applying pressure to the lever ) and fig1 shows the upper grasper 55 and lower grasper 56 in the actuated position ( subsequent to applying pressure to the lever ). the disclosed ratcheting mechanism shows that the proximal portion 6 has a textured surface on the top and bottom , alternative designs would only require one side of the proximal portion 6 to have texture and the graspers 55 , 56 are optional such that only one grasper is required to engage and pull a tension strip 1 through exit channel 58 . the ratcheting mechanism allows the operator to maintain very accurate control , while there is virtually no tension applied to the tension strip 1 the ratcheting mechanism can pull ten to thirty millimeters length . as tension in the tension strip 1 builds the user can operate the lever 53 to move advance the tension strip 1 by less than one half millimeter per lever action . the elongate barrel 60 further comprises a tension dial 59 at the proximal end and an on / off cutting switch 63 . the tension dial 59 rotates to set the pressure at which tensioning stops . the on / off cutting switch 63 is shown in fig1 is in the “ on ” position such that when pressure in the tension strip 1 reaches a predetermined pressure on the tension dial 59 a blade 54 cuts the proximal portion 6 adjacent the head 10 . by placing the blade adjacent the head 10 less than one millimeter of excess material is retained on the tension strip 1 . if the on / off switch 53 is moved to the forward position ( not shown ) the blade 54 will not automatically cut the tension strip 1 , thus the user can make adjustments to placement of tension strips 1 and gradually add pressure optimally to the fractured bone . in this inventive application it is critical that the tension strip 1 be cut as close to the tension strip head 10 as possible to reduce the total amount of material left in the patient as possible . however , there is occasion when the cutting of excess material should be done immediately and occasion to delay cutting the excess material . for example , in applications that require only one tension strip 1 it is time saving to set the tensioning device 50 to automatically cut the excess material . in other applications , for example , in fixing long bones , the tensioning may be done with several tension strips 1 and the user may want to place bone fragments under a slight tension to aid in alignment then come back to the tension strips 1 and increase the tension to a clinically beneficial pressure . by analogy , a mechanic tensions a wheel to an axle by tensioning the bolts in a criss cross fashion . similarly , a user can adjust the tension on several tension strips 1 then comeback to each tension strip 1 and cut the excess material . so , in a preferred embodiment the functionality to turn on and turn off the automatic cutting function is desirable . another desirable feature of the preferred embodiment is the ability of the user to preselect what force to use to tension the bone fragment . it is well known in the industry that children &# 39 ; s bone fractures depending on the bone age and cause of the fracture may require higher or lower compression to promote healing . also , normal adult bone compression may be preselected to quickly set the bone . additional care may be required or a lower compression force used in geriatric patients . another feature that has not been addressed in the prior art is the user ergonomics . in a preferred embodiment , fig1 , the elongate barrel 60 of the tensioning device 50 is long and narrow to improve user visualization of the target bone . also , the tension strip 1 is fed through the tension device 50 such that the proximal portion 6 of the tension strip exits the tension strip head 10 channel through the entry channel 57 and out the top of the tensioning device 50 via the exit channel 58 . this allows the user to get close to the bone and not have the tension strip 1 poke down and into the patient body or tissue . also , due to the close positioning of the tension strip head 10 to the site of removing excess tension strip 1 the overall placement of the tension strip 1 will achieve a low profile . the low profile and reduced excess material will reduce the possibility of tissue damage or a user accidentally snagging excess tension strip . it will be understood that various modifications can be made to the various embodiments of the present invention herein disclosed without departing from the spirit and scope thereof . for example , various devices are contemplated as well as various types of construction materials . also , various modifications may be made in the configuration of the parts and their interaction . therefore , the above description should not be construed as limiting the invention , but merely as an exemplification of preferred embodiments thereof . those of skill in the art will envision other modifications within the scope and spirit of the present invention as defined by the claims appended hereto .	0
as stated above , the present invention relates to semiconductor structures with an embedded semiconductor region and methods of manufacturing the same , which are now described in detail with accompanying figures . it is noted that like and corresponding elements are referred to by like reference numerals . referring to fig2 , a first exemplary semiconductor structure according to the present invention comprises a semiconductor substrate 2 that contains a substrate semiconductor region 10 and shallow trench isolation 20 . a gate of an insulated gate field effect transistor ( igfet ) comprises a gate dielectric 30 located on the substrate semiconductor region 10 , a gate semiconductor 32 , a gate cap insulator 34 , an l - shaped first gate spacer 40 , and a second spacer 42 . exposed portions of an original semiconductor surface 11 include the area between the gate and the shallow trench isolation 20 . the semiconductor materials in the substrate semiconductor region 10 comprises a semiconductor material such as silicon , germanium , silicon - germanium alloy , silicon - carbon alloy , and silicon - germanium - carbon alloy , gallium arsenide , indium arsenide , indium phosphide , iii - v compound semiconductor materials , ii - vi compound semiconductor materials , organic semiconductor materials , and other compound semiconductor materials . the semiconductor substrate 2 may be a bulk substrate , a semiconductor - on - insulator ( soi ) substrate , or a hybrid substrate . the orientation of the semiconductor substrate 2 is determined by the crystallographic orientation of the substrate semiconductor region 10 underneath the gate structure along a surface normal of the semiconductor substrate 2 . an soi substrate or a hybrid substrate may have multiple regions of semiconductor material with different crystallographic orientations in the same semiconductor substrate . in this case , the orientation of the semiconductor substrate 2 is defined locally by the orientation of the substrate semiconductor region 10 underneath a semiconductor device in reference . the l - shaped first spacer 40 and the second spacer 42 may be replaced with other types of spacers , or even eliminated in the practice of the present invention . further , any semiconductor structure with at least one patterned exposed semiconductor surface may be employed to form embedded semiconductor regions in the practice of the present invention . the igfets in the first and subsequent exemplary structures , do not limit the application of the present invention to semiconductor structures containing an igfet in any way , but serves as a demonstration of the practicability of the present invention . referring to fig3 , the at least one exposed original semiconductor surface 11 ( shown in fig2 ), which is the source and drain regions of the igfet in the first exemplary semiconductor structure , is subjected to a crystallographic anisotropic etch . the substrate semiconductor material in the substrate semiconductor region 10 is etched at different etch rates along different crystallographic orientations with a high degree of anisotropy . the crystallographic anisotropic etch forms at least one cavity surrounded by outer walls made of crystallographic facets . the crystallographic anisotropic etch may employ a wet etch process or a reactive ion etch process . both types of crystallographic anisotropic etch processes need to have anisotropic etch rates along different crystallographic orientations of the substrate . a high etch rate crystallographic facet , which has a high etch rate for a given crystallographic anisotropic etch , moves rapidly in the direction normal to the facet . conversely , a low etch rate crystallographic facet , which has a low etch rate for a given crystallographic anisotropic etch , moves slowly in the direction normal to the facet . it is noted that “ high ” or “ low ” etch rates are relative to each other i . e ., measured against etch rates along different orientations of the same material in a given etch process . the ratio of the etch rates between the high etch rate crystallographic facet and the etch rate crystallographic facet is about 3 or greater , and preferably about 10 or greater , and more preferably about 30 or greater . oftentimes , the area of a low etch rate crystallographic facet may increase as a high etch rate crystallographic facet slides along the surface of the low etch rate crystallographic facet . a prolonged crystallographic anisotropic etch tends to form predominantly low etch rate crystallographic facets in a resulting structure , while a prematurely terminated crystallographic anisotropic etch tends to form both high etch rate crystallographic facets and low etch rate crystallographic facets . fig3 shows both high etch rate crystallographic facets 50 and low etch rate crystallographic facets 51 formed in the semiconductor substrate 2 by the crystallographic anisotropic etch of the substrate semiconductor region 10 . the substrate semiconductor material is not etched from the sidewalls of the shallow trench isolation 20 since a low etch rate crystallographic facet 51 is formed from the interface between the original exposed semiconductor surface 11 and the shallow trench isolation 20 and extends downward at an angle less than 90 degrees relative to the original exposed semiconductor surface 11 . for example , the semiconductor substrate 2 may be a silicon substrate . in this case , the following exemplary crystallographic anisotropic etch processes may be used to form low etch rate crystallographic facets having { 110 } orientations on a silicon substrate . a first example of such a process is a wet etch process utilizing a pure tmah ( tetramethyl - ammonium hydroxide ; ( ch 3 ) 4 noh ) solution , which produces { 110 } facets due to a low etch rate perpendicular to { 110 } facets . a second example is a wet etch process which comprises a pretreatment with sci clean consisting of a mixture of h 2 o , nh 4 oh , and h 2 o 2 , followed by an etch in a dilute hydrofluoric acid ( dhf ), then followed by another etch in an ammonium hydroxide solution ( nh 4 oh ). this process also has a low etch rate perpendicular to { 110 } facets compared to other facets . a third example is a reactive ion etch used for deep trench formation in the dram processes , which tends to produce { 110 } facets on the surface of the semiconductor material . alternatively , the following exemplary crystallographic anisotropic etch process may be used to form low etch rate crystallographic facets having { 100 } orientations on a silicon substrate . the exemplary crystallographic anisotropic etch process comprises a pretreatment in a dilute hydrofluoric acid ( dhf ), followed by drying in an environment containing isopropyl alcohol ( ipa ) vapor , then followed by an etch in an ammonium hydroxide ( nh 4 oh ) solution . in general , for an arbitrary substrate semiconductor material , a wet etch process or a reactive ion etch processes may be employed as a crystallographic anisotropic etch as long as the etchant has an anisotropic etch rate along different crystallographic planes . in the case of an anisotropic wet etch process , the semiconductor substrate may be pretreated with a chemical that modifies the ratio of etch rates along different crystallographic planes of the semiconductor substrate prior to subjecting the exposed semiconductor surface to the etchant . preferably , the crystallographic facets are major crystallographic surfaces with low miller indices such as { 100 }, { 110 }, { 111 }, { 211 }, { 221 }, { 311 }, { 321 }, { 331 }, and { 332 }. in general , if none of the indices have numbers exceeds 6 in magnitude , the corresponding crystallographic surface may be considered a major crystallographic surface with low miller indices . the angle between a surface normal of some of the crystallographic facets and a surface normal of common semiconductor substrate orientations are tabulated in table 1 . the angle between the surface normal of the crystallographic facets and the substrate orientation is less than 90 degrees . typically , a pair of low etch rate crystallographic facets 51 are formed in the semiconductor substrate 2 as well as a high etch rate crystallographic facet 50 in each cavity . if the crystallographic anisotropic etch is terminated before the high etch rate crystallographic facet is reduced to a ridge , the exemplary structure in fig3 is formed . preferably , the high etch rate crystallographic facets 50 are parallel to the original semiconductor surface 11 . alternatively , the high etch rate crystallographic facet 50 may not be parallel to the original semiconductor surface 11 . while the angle between facets may vary depending on the substrate orientation and the crystallographic etch process , a ridge is formed where two facets are adjoined to each other . thus , the crystallographic anisotropic etch produces at least one cavity surrounded by crystallographic facets adjoined by two ridges on the substrate semiconductor region 10 . referring to fig4 , an embedded semiconductor material is deposited on the facets ( 50 , 51 ) of the substrate semiconductor region 10 preferably by selective epitaxy . preferably , the embedded semiconductor material has a different composition than the substrate semiconductor material in the substrate semiconductor region 10 . preferably , the embedded semiconductor material has the same crystal structure as the substrate semiconductor material and has a lattice mismatch in the range from 0 % to about 10 %, and preferably from 0 % to about 3 %. preferably , the selective epitaxy process provides a higher growth rate to surfaces that are parallel to the original semiconductor surface 11 than to surfaces that are parallel to the low etch rate crystallographic facets 51 . in other words , the selective epitaxy causes the embedded semiconductor material to grow at a higher growth rate from surfaces that are parallel to the original semiconductor surface 11 in the direction perpendicular to the original semiconductor surface 11 than the growth rate of the embedded semiconductor material from the low etch rate crystallographic facet 51 in the direction perpendicular to the low etch rate crystallographic facets 51 . this causes the growth surface of the embedded semiconductor material to be parallel to the high etch rate crystallographic facet 50 . the embedded semiconductor material thus forms trapezoidal embedded semiconductor regions 60 a , i . e ., embedded semiconductor regions with a trapezoidal cross - sectional area . the epitaxial constraint , i . e ., the forced alignment of the atoms of the embedded semiconductor material with the underlying crystal structure of the substrate semiconductor region 10 , causes the embedded semiconductor material to be strained . the strained embedded semiconductor region 60 a exerts stress on neighboring semiconductor structures , including the channel of the igfet between the two trapezoidal embedded semiconductor regions 60 a . due to the constraint on the crystal structure and lattice mismatch , the variety of the material that may be used for the embedded trapezoidal semiconductor region 60 a is determined by the crystal structure and the lattice constant of the substrate semiconductor region 10 . for example , if the substrate semiconductor region 10 comprises silicon , the embedded semiconductor material may be silicon - germanium alloy , silicon - carbon alloy , or silicon - carbon - germanium alloy . if the semiconductor substrate region 10 comprises gallium arsenide , the embedded semiconductor material may comprise indium - gallium arsenide . other combinations that are capable of producing epitaxial alignment are known in the art . since the substrate semiconductor region 10 is epitaxially aligned to the trapezoidal embedded semiconductor region 60 a , each of the facets ( 50 , 51 in fig3 ) on the substrate semiconductor region 10 adjoins a facet of the embedded semiconductor region 60 a that is located directly across the boundary between the trapezoidal embedded semiconductor region 60 a and the substrate semiconductor region 10 . therefore , at each boundary between the trapezoidal embedded semiconductor region 60 a and the substrate semiconductor region 10 , two facets of the same surface orientations , one belonging to the trapezoidal embedded semiconductor region 60 a and the other belonging to the semiconductor substrate region 10 , are adjoined to each other with an epitaxial alignment across the boundary . at a ridge where two facets belonging to the substrate semiconductor region 10 are adjoined , two other facets belonging to the trapezoidal embedded semiconductor region 60 a are also adjoined . referring to fig5 , a variant of the first exemplary semiconductor structure is shown , wherein the selective epitaxy process is prolonged after the embedded semiconductor region 60 a reaches a top surface of the sti 20 . two more facets are added to the cross - sectional area of the embedded semiconductor region 60 a . the trapezoidal embedded semiconductor region 60 a in fig4 grows into a hexagonal embedded semiconductor region 60 a ′, i . e ., an embedded semiconductor region that has a hexagonal cross - sectional area . further , it is herein explicitly contemplated that the selective epitaxy process may be terminated before the growth of the embedded semiconductor region reaches the original semiconductor surface 11 , resulting in a trapezoidal embedded semiconductor region ( not shown ) that does not contact the sti 20 . referring to fig6 , a second exemplary structure according to a second embodiment of the present invention is shown . the semiconductor structure in fig6 is formed by extending the crystallographic anisotropic etch after the first exemplary semiconductor structure shown in fig3 is formed . the low etch rate crystallographic facet 51 in fig3 extends further downward until the high etch rate crystallographic facet 50 is reduced to a ridge that joins the two low etch rate crystallographic facets 51 . a v - shaped groove with a ridge in the middle is formed by the two low etch rate crystallographic facets 51 in an exposed semiconductor area . thus , the crystallographic anisotropic etch produces at least one cavity surrounded by crystallographic facets adjoined by a ridge on the substrate semiconductor region 10 . referring to fig7 , an embedded semiconductor material is deposited on the low etch rate crystallographic facets 51 of the substrate semiconductor region 10 preferably by selective epitaxy as in the first embodiment . the requirements for the composition , crystal structure , and lattice constants are the same as in the first embodiment . preferably , the selective epitaxy process provides a higher growth rate to surfaces that are parallel to the original semiconductor surface 11 than to surfaces that are parallel to the low etch rate crystallographic facets 51 . in other words , the selective epitaxy causes the embedded semiconductor material to grow at a higher growth rate from surfaces parallel to the original semiconductor surface 11 in the direction perpendicular to the original semiconductor surface 11 than the growth rate of the embedded semiconductor material from the low etch rate crystallographic facet 51 in the direction perpendicular to the low etch rate crystallographic facets 51 . this causes the growth surface of the embedded semiconductor material to be parallel to the original semiconductor surface 11 . the embedded semiconductor material thus forms triangular embedded semiconductor regions 60 b , i . e ., embedded semiconductor regions with a triangular cross - sectional area . through the same mechanism as in the first embodiment , the strained embedded semiconductor region 60 b exerts stress on neighboring semiconductor structures . also , the variety of the material that may be used for the embedded triangular semiconductor region 60 b is determined by the crystal structure and the lattice constant of the substrate semiconductor region 10 . as in the first embodiment , each of the facets 51 ( in fig6 ) of the substrate semiconductor region 10 adjoins a facet of the triangular embedded semiconductor region 60 b that is located directly across the boundary between the trapezoidal embedded semiconductor region 60 b and the substrate semiconductor region 10 . at a ridge where two facets belonging to the substrate semiconductor region 10 are adjoined , two other facets belonging to the triangular embedded semiconductor region 60 b are also adjoined . referring to fig8 , a variant of the second exemplary semiconductor structure is shown , wherein the selective epitaxy process is prolonged after the embedded semiconductor region 60 b reaches a top surface of the sti 20 . two more facets are added to the cross - sectional area of the embedded semiconductor region 60 b . the triangular embedded semiconductor region 60 b in fig7 grows into a pentagonal embedded semiconductor region 60 b ′, i . e ., an embedded semiconductor region that has a pentagonal cross - sectional area . further , it is herein explicitly contemplated that the selective epitaxy process may be terminated before the growth of the embedded semiconductor region reaches the original semiconductor surface 11 , resulting in a triangular embedded semiconductor region ( not shown ) that does not contact the sti 20 . referring to fig9 , a third exemplary structure according to a third embodiment of the present invention is shown . the semiconductor structure in fig8 is formed by subjecting the first exemplary semiconductor structure shown in fig3 to a subsequent isotropic etch . during the isotropic etch , the substrate semiconductor material is removed at substantially the same rate along the various crystallographic orientations of the substrate semiconductor region 10 . preferably , the high etch rate crystallographic facets 50 are parallel to the original semiconductor surface 11 . alternatively , the high etch rate crystallographic facet 50 may not be parallel to the original semiconductor surface 11 . the portions of the substrate semiconductor region 10 underneath the spacers ( 40 , 42 ) are undercut during the isotropic etch . further , the line at which a low etch rate crystallographic facet 51 adjoins the shallow trench isolation ( sti ) 20 is recessed downward along a sidewall of the sti 20 . the cavity in the structure in fig3 is thus enlarged to enable incorporation of more embedded semiconductor material into the semiconductor structure . thus , the combination of the crystallographic anisotropic etch and the isotropic etch produces at least one cavity surrounded by crystallographic facets adjoined by two ridges on the substrate semiconductor region 10 . referring to fig1 , an embedded semiconductor material is deposited on the crystallographic facets ( 50 , 51 ) of the substrate semiconductor region 10 preferably by selective epitaxy as in the first embodiment . the requirements for the composition , crystal structure , and lattice constants are the same as in the first embodiment . preferably , the selective epitaxy process provides a higher growth rate to surfaces that are parallel to original semiconductor surface 11 than to surfaces that are parallel to the low etch rate crystallographic facets 51 . this causes the growth surface of the embedded semiconductor material to be parallel to the original semiconductor surface 11 . the growth of the embedded semiconductor material may be pegged , however , at a pegging line p along a sidewall of the shallow trench isolation 20 . a facet develops from the pegging line p upward and at an angle from the sidewall on which the pegging liner p is formed . the embedded semiconductor material thus forms pentagonal embedded semiconductor regions 60 c , i . e ., embedded semiconductor regions with a pentagonal cross - sectional area . through the same mechanism as in the first embodiment , the strained embedded semiconductor region 60 c exerts stress on neighboring semiconductor structures . also , the variety of the material that may be used for the embedded pentagonal semiconductor region 60 c is determined by the crystal structure and the lattice constant of the substrate semiconductor region 10 . as in the first embodiment , each of the facets 51 ( in fig9 ) of the substrate semiconductor region 10 adjoins a facet of the pentagonal embedded semiconductor region 60 c that is located directly across the boundary between the pentagonal embedded semiconductor region 60 c and the substrate semiconductor region 10 . at a ridge where two facets belonging to the substrate semiconductor region 10 are adjoined , two other facets belonging to the triangular pentagonal embedded semiconductor region 60 c are also adjoined . referring to fig1 , a variant of the third exemplary semiconductor structure is shown , wherein the selective epitaxy process is prolonged after the embedded semiconductor region 60 c reaches a top surface of the sti 20 . two more facets are added to the cross - sectional area of the embedded semiconductor region 60 c . the pentagonal embedded semiconductor region 60 c in fig7 grows into a heptagonal embedded semiconductor region 60 c ′, i . e ., an embedded semiconductor region that has a heptagonal cross - sectional area . further , it is herein explicitly contemplated that the selective epitaxy process may be terminated before the growth of the embedded semiconductor region reaches the original semiconductor surface 11 , resulting in a trapezoidal or pentagonal embedded semiconductor region ( not shown ). referring to fig1 , a fourth exemplary structure according to a fourth embodiment of the present invention is shown . a first exposed semiconductor surface 11 a adjoining shallow trench isolation 20 and second and third exposed semiconductor surfaces ( 11 b and 11 c , respectively ), each of which adjoin a pair of gate structures , are shown . the distance between the adjoining gate structures is greater for the second exposed semiconductor surface 11 b than for the third exposed semiconductor surface 11 c . referring to fig1 , the substrate semiconductor region 10 is recessed by a reactive ion etch ( rie ). the reactive ion etch is anisotropic and forms substantially vertical sidewalls on the recessed portions of the substrate semiconductor region 10 . the depth of the reactive ion etch may be in the range from about 3 nm to about 100 nm , and preferably in the range from about 5 nm to about 20 nm . referring to fig1 , a crystallographic anisotropic etch performed on the exposed semiconductor surfaces ( 11 a , 11 b , 11 c ) forms both high etch rate crystallographic facets 50 and low etch rate crystallographic facets 51 . the substrate semiconductor material is etched fast in the direction perpendicular to the high etch rate crystallographic facets 50 , while the low etch rate crystallographic facets 51 tend to grow in size laterally until the they meet another low etch rate crystallographic facet 51 . a first , second , and third cavities ( c 1 , c 2 , c 3 , respectively ) that are surrounded by crystallographic facets are formed underneath each of the three original exposed semiconductor surfaces ( 11 a , 11 b , 11 c in fig1 ) by the crystallographic anisotropic etch . depending on the duration of the crystallographic anisotropic etch , a high etch rate crystallographic facet 50 may or may not be present in a cavity . for example , the crystallographic anisotropic etch may proceed such that the first cavity c 1 comprises three low etch rate crystallographic facets 51 and does not contain a high etch rate crystallographic facet 50 . the second cavity c 2 , formed underneath the second exposed semiconductor surface 11 b , comprises one high etch rate crystallographic facet 50 and four low etch rate crystallographic facets 51 . the third cavity c 3 , formed underneath the third exposed semiconductor surface 11 c , comprises three low etch rate crystallographic facets 51 and does not contain a high etch rate crystallographic facet 50 . it is understood that a high etch rate crystallographic facet 50 may be present in the first and third cavities ( c 1 , c 3 ) if the crystallographic anisotropic etch is shortened . some of the crystallographic facets in the fourth embodiment are “ retro - facets ” that face downward , i . e ., crystallographic facets in which a surface normal toward the cavity ( c 1 , c 2 , or c 3 ) has a downward component . the retro - facets are formed because the crystallographic anisotropic etch is pegged at the edge of the gate spacers ( 40 , 42 ). at a microscopic level , as individual atoms of the substrate semiconductor region 10 are removed by the crystallographic anisotropic etch , microscopic facets are formed around the edge of the gate spacers ( 40 , 42 ). while a microscopic facet with a high etch rate is etched during the crystallographic anisotropic etch , a microscopic facet with a low etch rate is locked in its place and grows only laterally as the etch front of an adjacent high etch rate crystallographic facet moves into the substrate semiconductor region 10 . referring to fig1 , an embedded semiconductor material is deposited on the crystallographic facets ( 50 , 51 ) of the substrate semiconductor region 10 preferably by selective epitaxy as in the first embodiment . the requirements for the composition , crystal structure , and lattice constants are the same as in the first embodiment . preferably , the selective epitaxy process provides a higher growth rate to surfaces that are parallel to the original semiconductor surface 11 than to surfaces that are parallel to the low etch rate crystallographic facets 51 . this causes the growth surface of the embedded semiconductor material to be parallel to the original semiconductor surface 11 . the embedded semiconductor material thus forms a first pentagonal embedded semiconductor region 60 d in the first cavity c 1 , a hexagonal embedded semiconductor region 60 e in the second cavity c 2 , and a second pentagonal embedded semiconductor region 60 f in the third cavity c 3 . the pentagonal embedded semiconductor regions ( 60 d , 60 f ) have a pentagonal cross - sectional area and the hexagonal embedded semiconductor region 60 e has a hexagonal cross - sectional area . through the same mechanism as in the first embodiment , the strained embedded semiconductor regions ( 60 d , 60 e , 60 f ) exerts stress on neighboring semiconductor structures . also , the variety of the material that may be used for the embedded triangular semiconductor regions ( 60 d , 60 e , 60 f ) is determined by the crystal structure and the lattice constant of the substrate semiconductor region 10 . the strained embedded semiconductor regions may be enclosed by substrate semiconductor regions 10 up to the level of the original semiconductor surface ( 11 b , 11 c ) as in the case of the hexagonal embedded semiconductor region 60 e and the second pentagonal embedded semiconductor region 60 f . alternatively , the strained embedded semiconductor regions may contact the shallow trench isolation 20 at an edge of a crystallographic facet , in which the edge is also a ridge adjoining two crystallographic facets , as is the case with the first pentagonal embedded semiconductor region 60 d . the edge forms a pegging line p , which is recessed from the top surface of the sti 20 by a depth on the order of the depth of the recess rie . as in the first embodiment , each of the facets 51 ( in fig1 ) of the substrate semiconductor region 10 adjoins a facet of one of the embedded semiconductor regions ( 60 d , 60 e , or 60 f ) that is located directly across the boundary between the embedded semiconductor regions ( 60 d , 60 e , or 60 f ) and the substrate semiconductor region 10 . at a ridge where two facets belonging to the substrate semiconductor region 10 are adjoined , two other facets belonging to the same embedded semiconductor regions ( 60 d , 60 e , or 60 f ) are also adjoined . referring to fig1 , a variant of the fourth exemplary semiconductor structure is shown , wherein the selective epitaxy process is prolonged after the embedded semiconductor regions ( 60 d , 60 e , 60 f ) reaches a top surface of the sti 20 . more facets are added to the cross - sectional area of the embedded semiconductor regions ( 60 d , 60 e , 60 f ). the additional facets above the level of the original semiconductor surfaces ( 11 a , 11 b , 11 c ) may , or may not , be parallel to the low etch rate crystallographic facets 51 . top surfaces of the embedded semiconductor regions ( 60 d , 60 e , 60 f ) are located above the level of the original semiconductor surfaces ( 11 a , 11 b , 11 c ). further , it is herein explicitly contemplated that the selective epitaxy process may be terminated before the growth of the embedded semiconductor region reaches the original semiconductor surfaces ( 11 a , 11 b , 11 c ), resulting in a embedded semiconductor region ( not shown ) with top surfaces located at a level lower than the original semiconductor surfaces ( 11 a , 11 b , 11 c ). referring to fig1 , a fifth exemplary structure according to a fifth embodiment of the present invention is shown . the semiconductor structure in fig1 is formed by subjecting the fourth exemplary semiconductor structure shown in fig1 to a subsequent isotropic etch . during the isotropic etch , the substrate semiconductor material is removed at substantially the same rate along the various crystallographic orientations of the substrate semiconductor region 10 . preferably , the high etch rate crystallographic facets 50 are parallel to the original semiconductor surface 11 . alternatively , the high etch rate crystallographic facet 50 may not be parallel to the original semiconductor surface 11 . the portions of the substrate semiconductor region 10 underneath the spacers ( 40 , 42 ) are undercut during the isotropic etch . further , the line at which a low etch rate crystallographic facet 51 adjoins the shallow trench isolation ( sti ) 20 is recessed downward along a sidewall of the sti 20 . the cavity in the structure in fig3 is thus enlarged to enable incorporation of more embedded semiconductor material into the semiconductor structure . the combination of the crystallographic anisotropic etch and the isotropic etch produces enlarges the cavities ( c 1 , c 2 , c 3 ) of fig1 to subsequently accommodate an increased volume of embedded semiconductor material in the semiconductor substrate 2 according to the fifth embodiment . referring to fig1 , an embedded semiconductor material is deposited on the crystallographic facets ( 50 , 51 ) of the substrate semiconductor region 10 preferably by selective epitaxy as in the first embodiment . the requirements for the composition , crystal structure , and lattice constants are the same as in the first embodiment . preferably , the selective epitaxy process provides a higher growth rate to surfaces that are parallel to original semiconductor surfaces ( 11 a , 11 b , 11 c ) than to surfaces that are parallel to the low etch rate crystallographic facets 51 . this causes the growth surface of the embedded semiconductor material to be parallel to the original semiconductor surface 11 . the growth of the embedded semiconductor material may be pegged , however , at a pegging line p along a sidewall of the shallow trench isolation 20 . a facet develops from the pegging line p upward and at an angle from the sidewall on which the pegging liner p is formed . the embedded semiconductor material thus forms a first pentagonal embedded semiconductor region 60 g in the first enlarged cavity c 1 , a hexagonal embedded semiconductor region 60 h in the second enlarged cavity c 2 , and a second pentagonal embedded semiconductor region 60 i in the third enlarged cavity c 3 . the pentagonal embedded semiconductor regions ( 60 g , 60 i ) have a pentagonal cross - sectional area and the hexagonal embedded semiconductor region 60 h has a hexagonal cross - sectional area . through the same mechanism as in the first embodiment , the strained embedded semiconductor regions ( 60 g , 60 h , 60 i ) exert stress on neighboring semiconductor structures . also , the variety of the material that may be used for the embedded pentagonal semiconductor regions ( 60 g , 60 h , 60 i ) is determined by the crystal structure and the lattice constant of the substrate semiconductor region 10 . as in the first embodiment , each of the facets 51 ( in fig1 ) of the substrate semiconductor region 10 adjoins a facet of one of the polygonal embedded semiconductor regions ( 60 g , 60 h , or 60 i ) that is located directly across the boundary between the polygonal embedded semiconductor region ( 60 g , 60 h , or 60 i ) and the substrate semiconductor region 10 . at a ridge where two facets belonging to the substrate semiconductor region 10 are adjoined , two other facets belonging to the same polygonal embedded semiconductor region ( 60 g , 60 h , or 60 i ) are also adjoined . referring to fig1 , a variant of the fifth exemplary semiconductor structure is shown , wherein the selective epitaxy process is prolonged after the embedded semiconductor regions ( 60 g , 60 h , 60 i ) reaches a top surface of the sti 20 . more facets are added to the cross - sectional area of the embedded semiconductor regions ( 60 g , 60 h , 60 i ). further , it is herein explicitly contemplated that the selective epitaxy process may be terminated before the growth of the embedded semiconductor region reaches the original semiconductor surfaces ( 11 a , 11 b , 11 c ), resulting in a embedded semiconductor region ( not shown ) with top surfaces located at a level lower than the original semiconductor surfaces ( 11 a , 11 b , 11 c ). while the invention has been described in terms of specific embodiments , it is evident in view of the foregoing description that numerous alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , the invention is intended to encompass all such alternatives , modifications and variations which fall within the scope and spirit of the invention and the following claims .	7
ldl receptor deficient mice , transgenic mice developed essentially as described in ishibashi et al ., “ massive xanthomatosis and atherosclerosis in cholesterol fed low density lipoprotein receptor - negative mice ”, j . clin . invest ., 93 : 1885 - 1893 ( 1994 ), incorporated herein by reference , were used in these examples . the ldl deficient mice are currently used as a model for the development of atherosclerosis ( see von der thüsen et al ., circulation ( 2001 ) supra ). male ldl receptor deficient mice were put on a cholesterol rich diet ( type w diet containing 0 . 25 % cholesterol , 15 % cocoa butter ). after 14 days , collars were placed around the left and the right carotid artery ( as described in von der thüsen circulation 2001 , supra ). the mice were then treated with il - 9 with daily intraperitoneal injection with 1 μg baculovirus recombinant il - 9 ( druez , et al ., j . immunol ., 145 : 2494 - 2499 ( 1990 ) incorporated herein by reference ) per mouse per day from day 21 to day 56 . control animals received daily injections with vehicle alone ( pbs containing 1 % autologous mouse serum ). body weight , cholesterol levels and lipoprotein profile were monitored throughout the experiment . at the end of the experiment ( day 56 after the last dose of il - 9 ), animals were anesthetized and exsanguinated by femoral artery transection . in situ perfusion fixation through the left cardiac ventricle was performed by pbs instillation for 15 minutes , followed by constant - pressure infusion ( at 80 mm hg ) of 10 % neutral buffered formalin for 30 minutes . subsequently , both carotid bifurcations and common carotid arteries were removed . no differences were observed between the body weight of il - 9 - treated and vehicle - treated mice . in addition , il - 9 treatment did not affect the cholesterol levels as compared to the control mice . throughout the experiments the mice , regardless of treatment , maintained a level of approximately 3000 mg cholesterol / dl . il - 9 treatment did not alter the lipoprotein profile of the treated mice as compared to the control mice ( 80 % of the total cholesterol is recovered in both groups in the vldl fraction ). the collar - induced atherosclerosis in treated and untreated mice was assayed by determining plaque size ( surface area at the point where the size / area of the plaque is maximal ) media size ( between the intima ( plaque ) and the smooth muscle layer ), intima / media ratio and intima / lumen ratio ( fig1 a - d ) essentially as described in von der thüsen ( circulation 2001 supra ). briefly , hematoxylin and eosin - stained sections were assessed in cross - section at 3 levels : 0 . 5 mm proximal , in the mid - section and 0 . 5 mm distal to the collar . the intimal surface area was calculated by subtracting the patent lumen area from the area circumscribed by the internal elastic lamina . the medial surface area was defined as the area between the internal elastic lamina and the external elastic lamina . the intima / media ratio and the intima / lumen ratio were determined by dividing the intimal area by the medial area and the total area confined by the internal elastic lamina , respectively . the results are set forth in fig1 a through 1d and indicate that il - 9 significantly reduced plaque size without effect on the size of the media . these results clearly demonstrate that daily treatment of mice with il - 9 significantly reduces the initiation of atherosclerosis . example 1 was repeated in female ldl receptor deficient mice and the effects of il - 9 on atherosclerotic plaque formation was evaluated . on day 1 , two groups of mice ( group a ( il - 9 treated , n = 9 ) and group b ( control , n = 8 )) were put on a western type diet containing 0 . 25 % cholesterol and 15 % cocoa butter . at day 15 collars were placed around the left and right carotid artery ( as described by von der thüsen et al ., circulation ( 2001 ) supra ). from day 16 through day 42 the group a mice were injected daily ( intra - peritoneal ) with 1 μg baculovirus produced il - 9 dissolved in 100 μl of pbs ( containing 1 % normal autologous mouse serum ). the group b control mice received a daily intra - peritoneal injection of 100 μl of pbs ( containing 1 % normal autologous mouse serum ). at day 42 , both groups of mice were anaesthetized and exsanguinated by femoral artery transection , and in situ perfusion fixation through the left cardiac ventricle was performed by pbs instillation for 15 minutes , followed by constant - pressure infusion ( at 80 mm hg ) of 10 % neutral buffered formalin for 30 minutes . subsequently , both carotid bifurcations and common carotid arteries were removed . formalin fixation was omitted for arteries that were to be stained for von willebrand factor “ vwf ”; these were immediately snap - frozen in liquid nitrogen after having been embedded in oct compound ( tissue - tek ; sakura finetek ), whereas the remaining arteries were left in 10 % formalin overnight before freezing . the specimens were stored at − 20 ° c . until further use . transverse 5 - mm cryosections were prepared in a proximal direction from the carotid bifurcation and mounted in order on a parallel series of slides . [ 0035 ] fig2 depicts the effects of baculovirus - produced il - 9 on the development of atherosclerotic plaques . the mice of group a , which were treated with il - 9 , showed a clear diminishment in the extent of atherosclerosis . the significant reduction in the extent of atherosclerosis was 58 . 6 % in comparison to the control group ( p & lt ; 0 . 05 ). the effect of il - 9 on tnf - a production by blood monocytes in response to lps was determined in a whole blood assay . mice ( group a : il - 9 treated , n = 9 )) received a daily intra - peritoneal injection of recombinant il - 9 dissolved in 100 μl of pbs ( containing 1 % normal autologous mouse serum ) for five days . control mice ( group b , n = 8 ) received a daily i . p . injection of 100 μl of pbs ( containing 1 % normal autologous mouse serum ) for five days . at day 5 blood was collected from the tail vein of all mice . whole blood was obtained by tail vein transection and diluted 25 fold in dulbecco &# 39 ; s modified eagle &# 39 ; s medium supplemented with l - glutamine , penicillin and streptomycin , which contained varying concentration so lipopolysaccharide ( re 595 , list biological laboratories , campbell , calif .). following incubation overnight at 37 ° c ., 50 μl of the supernatent was analyzed for tnf - α content by elisa . the results are depicted in fig3 . the tnf - α production in the whole blood assay after lps stimulation was not significantly different in the il - 9 treated animals as compared to the control treated animals . the effect of endogenous interleukin 9 on atherosclerosis was also assayed by vaccinating mice with il - 9 ovalbumin conjugates ( il - 9 - ova ) prior to placing the mice on a diet containing 0 . 25 % cholesterol and 15 % cocoa butter . on day 1 , 10 female ldl receptor mice ( group a ) were vaccinated in both footpads using 1 μg of il - 9 - ovalbumin conjugate in the presence of complete freund &# 39 ; s adjuvant as described by richard et al ., (“ anti - il - 9 vaccination prevents worm expulsion and blood eosinophilia in trichuris muris - infected mice ”, pnas 97 767 - 772 ( 2000 ) incorporated herein by reference ). control mice were 10 female ldl receptor mice vaccinated with ovalbumin in the presence of complete freund &# 39 ; s adjuvant ( group b ). on days 15 , 29 and 43 , the group a mice were vaccinated with 1 μg of il - 9 - ovalbumin conjugate in the presence of incomplete freund &# 39 ; s adjuvant . on days 15 , 29 and 43 , the control group b mice were vaccinated with ovalbumin in the presence of incomplete freund &# 39 ; s adjuvant . on day 57 the two groups of mice were put on a western type diet ( 0 . 25 % cholesterol , 15 % cocoa butter ) and assayed for the production of il - 9 specific antibodies . anti - il - 9 titers of the vaccinated mice were tested in a ts1 assay . the titers are the reciprocal dilutions of the sera that produce 50 % inhibition of il - 9 ( 50 pg / ml ). the only group a mice that were included in the experiment were those that had a significant level of anti - il - 9 antibodies ( 6 / 10 mice ). the control mice vaccinated with ova did not produce il - 9 antibodies . two weeks later ( day 71 ) collars were placed around the left and right carotid artery ( as described by von der thüsen et al . 2001 supra ) of the control mice and the mice with the significant levels of anti - il - 9 antibody . on day 113 , both groups of mice were anaesthetized , and in situ perfusion fixation through the left cardiac ventricle was performed by pbs instillation for 15 minutes , followed by constant - pressure infusion ( at 80 mm hg ) of 10 % neutral buffered formalin for 30 minutes . subsequently , both carotid bifurcations and common carotid arteries were removed . formalin fixation was omitted for arteries that were to be stained for vwf ; these were immediately snap - frozen in liquid nitrogen after having been embedded in oct compound ( tissue - tek ; sakura finetek ), whereas the remaining arteries were left in 10 % formalin overnight before freezing . the specimens were stored at − 20 ° c . until further use . transverse 5 - mm cryosections were prepared in a proximal direction from the carotid bifurcation and mounted in order on a parallel series of slides . [ 0045 ] fig4 demonstrates that the group a mice , which were vaccinated with il - 9 - ova conjugates and had significant levels of il - 9 specific antibodies , had a clear increase in the extent of atherosclerosis . the level of atherosclerosis was more than double ( 2 . 05 fold ) the level in control mice which were vaccinated ovalbumin ( p & lt ; 0 . 05 ). the results set forth herein demonstrate that administration of il - 9 to a subject inhibits formation and progression of atherosclerotic plaques . the increase in atherosclerosis as a result of il - 9 - ova immunization demonstrates that endogenous il - 9 plays a role in inhibiting atherosclerosis and that il - 9 does not prevent the subsequent production of tnf by blood monocytes in response to lps in vitro . the terms and expressions which have been employed are used as terms of description and not of limitation , and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or any portions thereof , it being recognized that various modifications are possible within the scope of the invention .	0
one example of the most popular take - down type archery bow is shown in fig1 in a disassembled state , in which a take - down bow includes a handle riser h and upper and lower limbs l to be joined to both distal ends of the handle riser h . more specifically , the handle riser h is provided at both distal ends with sockets s receptive of plugs p attached to the proximal ends of the limbs l . for use , the plugs p of the upper and lower limbs l are inserted and fixed in the sockets s of the handle riser h and a string ( not shown ) is set with tension between string notches n of the limbs l . one example of the conventional joint structure between a handle riser h and a limb r is shown in fig2 . in this case , a threaded hole 3 is formed through the back side wall 2a of the socket s of the handle riser h and a set screw 4 is screwed into the threaded hole 3 . this set screw 4 provides the first support for the plug p of the limb l . at a position closer to the mouth of the socket s , and idle hole 5 is formed through the face side wall 2b of the socket s of the handle riser h and a threaded fixer bolt 6 is inserted into the idle hole 5 in screw engagement with a fixer nut 8 embedded in the body of the plug p of the limb l . this fixer bolt 6 provides the second support for the plug p of the limb l . by fastening the set screw 4 and the fixer bolt 6 , the plug p is fixedly held in the socket s at two points and the limb l is joined firmly to the handle riser h . further , by properly varying the extent of fastening of the set screw , the angular position of the limb l with respect to the handle riser h can be adjusted as shown with chain lines over an angle θ . the above - described conventional joint structure , however , is accompanied with an inevitable drawback that , as the angular adjustment of the limb l is carried out by a very thin set screw 4 in point contact with the back side of the plug p , stress concentration tends to occur at the point of contact whilst causing breakage of the plug p of the limb l . in other words , the joint structure of this type seriously lowers durability of limbs . another example of the conventional joint structure between a handle riser h and a limb l is shown in fig3 which was proposed in order to remove the drawback of the first example . the construction of this joint structure is basically same as that of the first example except for use of a flat strap 9 interposed between the point of the set screw 4 and the back side of the plug p . stress concentration may be more or less alleviated due to the enlarged surface contact . in this case , however , the point of action &# 34 ; a &# 34 ; by the set screw 4 shifts towards the mouth of the socket s depending on the size of the strap 9 . as a consequence , the span 1 2 between the first and second supports in this example becomes smaller than the corresponding span 1 1 for the first two supports shown in fig2 and causes increased application of force to the section defining the mouth of the socket . in order to well withstand such increased force under any conditions of use , the section is required to have a thick construction which connects to increased weight of the archery handle riser . it is thinkable to make the socket deeper in order to maintain the initial span . this also requires a thicker construction of the walls of the socket , or use of some fortifiers for the walls of the socket . either again connects to undesirable increase in weight of the archery handle riser . use of screw members for position adjustment of limbs causes a further problem relating to designing of take - down bows . design of the handle riser plays an important role in commercial value of a take - down type archery bow . designing of a bow is usually based on mechanical calculation of compression and tension thereof in the shooting direction whilst taking the knocking point as a center of force . the strength of the handle riser on a line connection the knocking point with one of the two supports for the limbs is used as a basis for the strength distribution over the entire body . presence of the above - described screw members in the socket walls of the handle riser causes change in position of the supports , which disenables easy and correct designing of the handle riser . as described above , the take - down archery bow in accordance with the present invention has a sort of two position support type joint structure , one near the mouth of the socket and the other near the bottom of the socket . one embodiment of such a joint structure is shown in fig4 to 6 , in which the structure includes , like the conventional examples , a socket s of the handle riser h and a plug p of one of the limbs l , at least the plug p being made of a highly elastic material such as fiber reinforced plastics . as best seen in fig6 a locker wall 13 projects from the bottom of the socket s whilst spanning the face side and back side walls 12a , 12b of the socket s . a center guide groove 14 is formed in the face side wall 12a running in the longitudinal direction of the socket s . a leaf spring 15 having a center projection 15a is fixed at one end to the face side wall 12a in the guide groove 14 . in the assembled state , the plug p of the limb l is received and held firmly in the socket s of the handle riser h . the plug p is provided at the bottom end with a locker cutout 17 engageable with the locker wall 13 in the socket s . near the string side end of the plug p , a first circular supporter piece 18 is fixed to the face side wall pa of the plug p by means of a set screw 16 . this supporter piece 18 has a bottom brim 18a whose diameter is roughly equal to the width of the plug p and a thread 19 is formed in the periphery of the circular piece for screw engagement with an adjuster nut 21 . the first supporter piece 18 further has a center projection 20 engageable with the center guide groove 14 formed in the face side wall 12a of the socket s . the set screw 16 is received in the center axial hole of the first supporter piece 18 and screwed into the plug p . the position of the first supporter piece 18 is chosen so that the adjuster nut 21 should partly project upwards form the mouth of the socket s for easy manual turning . apparently , the first supporter piece 18 with the adjuster nut 21 forms the first support for the limb l in abutment on the face side wall 12a of the socket s . by manually turning the adjuster nut 21 on the first supporter piece 18 , the angular position of the limb l with respect to the handle riser h can be freely adjusted over the angle θ as shown with chain lines in fig4 by changing the gap &# 34 ; t &# 34 ; in fig5 . near the bottom end of the plug p , a second circular supporter piece 22 is fixed to the face side wall pa of the plug p by means of a set screw , and provided with an annular chamfer 22a for abutment on the center projection 15a of the leaf spring 15 on the face side wall 12a of the socket s . the second supporter piece 22 apparently forms the second support for the limb l and its abutment on the leaf spring effectively prevents undesirable swing of the limb l relative to the handle riser h . for a more stable holding by the second supporter piece 22 , a strap 23 is preferably interposed between the back side wall 12b of the socket s and the back side of the plug p . when the above - described joint structure of the present invention is employed , no transverse holes are present in either side wall of the socket s of the handle riser , and absence of such holes assures a stronger construction of the socket . in addition , support by surface contact well prevents stress concentration on any related elements . further , adjustment in the angular position of the limb l with respect to the handle riser h can be carried out merely by axially turning the first supporter piece 18 , i . e . the first support , located near the mouth of the socket s without any change in position of the second supporter piece 22 , i . e . the second support . this fixes the basis for strength destribution and greatly simplifies mechanical designing of the take - down bows . another embodiment of the joint structure in accordance with the present invention is shown in fig7 and 8 . the joint structure includes a pair of flat , metal spacers 31 bonded to the face side wall 12a of the socket s on both sides of the center guide groove 14 . one example of such a spacer 31 is shown in fig8 in which the spacer 31 is accompanied with a bonding tape 32 for easy attachment to the socket wall 12a . in the assembled state of the archery bow , the spacer 31 is clamped between the plug p and the face side wall 12a of the socket s . by using different spacers of different thicknesses , the gap &# 34 ; t &# 34 ; shown in fig5 can be freely changed as desired for tiller height adjustment . preferably , spacers of a thickness in a range from 0 . 1 to 0 . 3 mm are prepared for free replacement by archers . more specifically , as shown in fig9 the plug p of the limb abuts on the spacers 31 provided on the face side wall 12a of the socket s at a position close to the mouth of the handle riser . this constitutes a first support for the limb l . the plug p is also supported at its end by the back side wall 12b of the socket s . this constitutes a second support for the limb l . although the joint structure shown in fig9 is provided with the second circular supporter piece 22 in combination with the leaf spring 15 as that shown in fig4 for stabler second support , the joint structure basically operates as expected even without these elements .	5
the steering system 1 that is shown in fig1 comprises a steering wheel 2 , which is connected in a torque - proof manner with a steering arbor or shaft 3 , by which the steering angle δl that has been preset by the driver can be transferred on to the steered front wheels 6 , in which a wheel steering angle δv is adjusted . the steering shaft 3 is coupled cinematically with a steering linkage 5 over a steering gear 4 , which comprises a steering rack , which is adjusted during a steering movement , whereupon the wheel steering angle δv is adjusted in the front wheels 6 . for supporting the hand moment that is brought up over the steering wheel 2 by the driver an electric servo engine 7 is provided , which computerizes an additional support moment over the steering gear 4 into the steering system 1 . the servo engine 7 is construed as electromotor . the servo engine 7 is assigned to a control device 8 , which communicates with a can - bus 9 . over the can - bus 9 the data and signals are exchanged with other regulation or control devices in the vehicle . as it can be taken from fig2 the electric servo engine 7 is assigned to a sensor technology 10 , over which the rotation angle δ mot of the rotor shaft 12 of the servo engine 7 is determined . the sensor technology 10 comprises a torque - proof magnet 11 , which is connected with the rotor shaft 12 and which sits on the front side of the rotor shaft and whose magnetic field is detected by a magnetic field sensor 13 — for example a reverberation sensor that is arranged housing - firmly . furthermore the sensor technology 10 comprises a sensor evaluation unit 14 , in which the value about the rotor rotation angle mot is determined from the sensor signals and forwarded to the control device 8 . the control device 8 is equipped with a current drain control 15 , which controls the consumption of current in the control device 8 and which is supplied externally with a supply voltage u . furthermore the control device 8 comprises diverse components , in which the incoming signals are processed and the actually adjusted steering angle δl is calculated as output signal . as input signal , as it is exemplary registered , the angular velocity ω 1 of each wheel , but in particular the angular velocity of the steered wheels flows in , whereby this information is supplied over the can - bus 9 . the engine moment m mot , which is created by the electric servo engine 7 , the steering moment m l , the vehicle lateral acceleration a and / or the yaw rate ψ and if necessary further vehicle state variables can be computerized into the control device 9 as further vehicle state variables , whereby these state variables are also conveniently supplied over the can - bus 9 . the determined steering angle δ l is distributed as output signal over the can - bus . the control device 8 comprises a first calculating unit 16 as electronic components , which comprises an amplification link and an offset - correcting unit , an a / d - converter 17 , a general calculation unit 18 , an offset - correcting unit 19 as well as a monitoring unit 20 . the rotor rotation angle δ mot , which is determined by the sensor technology 10 , is initially supplied to the first calculation unit 16 , in which an amplification and an offset - correction is carried out . subsequently the determined value is delivered to the a / d - converter 17 , in which the analog signal is converted into a digital signal . this digital signal is then forwarded into the calculation unit 18 , where a reasonability process of the determined value is carried out on software level , which takes in particular place by a comparison with reference signals . the previously mentioned vehicle sate variables are considered for the determination of the steering angle δ l in the calculation unit 18 . for improving the quality of the calculated values the steering angle α l is supplied to the offset - correcting unit 19 , in which an offset - angle δ off is determined and supplied in a reverse loop of the calculation unit 16 . the monitoring unit 20 contains a security logic , in order to check and ensure the functionality of the modules of the control device 8 . therefore test structures are realized in the monitoring unit 20 , over which the test signals are created , which are supplied to the single modules of the control device 8 as digital signals , in order to check their functionality . furthermore the monitoring unit 20 can also gather signals from the modules and submit them to a reasonability process . the offset - correcting unit 19 is built according to the type of a regulator , in which the calculated value of the steering angle δ l is led back over the offset - correcting unit 19 and a correcting value δ off is supplied to the integrator 16 as offset - angle correction value . over the offset - correcting unit 19 the steering angle signal is purified from interfering variables . fig3 shows a detailed illustration of the asic that is realized in the control device 8 . in a first sensor 13 a , which is a component of the sensor technology 10 , sine and cosine signals are generated from the detected sensor signals over evaluation set - ups , which are each supplied to the first calculation units 16 in the control device 8 . the first calculation units 16 are also available in pairs like the second subsequent calculating units 18 and are each assigned to one of the sensor signals from the first sensor 13 a . in the first calculation units 16 a first signal processing takes place , subsequently the pre - processed signals are supplied to the subsequent second calculation units 18 . the processing of the sensor signals takes place parallel in the sine and cosine course . after a further signal processing in the second calculating units 18 the output signals are provided to further processing modules in the vehicle over interfaces 25 and 26 , whereby the interface 25 is a spi - interface ( serial peripheral interface ) and the second interface ̂ 26 is an uart - interface ( universal asynchronous receiver / transmitter ). the monitoring unit 20 takes over monitoring and test functions for the individual modules of the control device 8 as it is described in fig2 . furthermore a current drain system 21 is provided in the control unit 8 , which comprises a current monitoring unit 22 , a current drain unit 23 and a sensor current drain unit 24 . as it is shown in the lower half of the drawing of fig3 the signals of a second sensor 13 b are processed by a calculation block 27 , which provides a calculation unit like the first calculation unit 16 , which is integrated in the calculation block that is assigned to the first sensor 13 a . the signal processing of the unit that is assigned to the second sensor 13 b has no steering angle evaluation , only the detection of the rotor position in on - state takes place . in off - state this unit is completely deactivated . the current drain control 15 provides an energy efficiency thereby that the control device 8 is switched into a sleep - mode , if the vehicle is standing and the engine is turned off . fig4 shows the calculation units 16 and 18 in detail one more time . the first calculation unit 16 , which is supplied with the sensor signals , comprises an amplification link 28 , in which the difference of the two signals that come form the sensor is amplified and furthermore purified by an offset - value doff , which is determined by the offset - correction unit 19 . this offset δ off is also supplied to the second calculation unit 18 over a module 34 . the amplified signal of the difference of the two sensor signals is subsequently supplied in the second calculation unit 18 to a comparing link 29 , in which a comparison between the supplied value and the already previously mentioned offset is carried out . the thereof crated signal is supplied to a signal storage 30 , in which the a signal storage takes place over at least two consecutive time bins , as well as a rotation direction detection unit 31 , in which the rotation direction of the rotor of the electric servo engine is determined from the at least two consecutive signals . in a subsequent integrator 32 an on - integration of the signals takes place , which can be stored in a further storage 33 . over the interfaces 25 and 26 the won output signals can be picked off from the control device 8 . fig5 and 6 show the embodiments for a redundant sensor detection as well as signal processing . in order to sense the circulation of the shaft — either of the steering shaft of the steering system or the rotor shaft of the electric drive engine — a magnet 11 is connect in a torque - proof manner with the shaft , whose magnetic field is detected by two magnetic field sensors 13 a and 13 b . according to fig5 each of the two magnetic field sensors 13 and 13 b is assigned to a signal processing unit 35 or 36 , so that on the level of the signal processing units redundancy is present . the processed signals are subsequently supplied to the further processing modules . even the signal transfer from the signal processing units 35 and 36 to the control device 8 takes place separately and independently from each other , so that redundancy is also present in so far . according to fig6 the same sensor technology is provided with torque - proof arranged magnets 11 and two magnet field sensors 13 a and 13 b as in fig5 . but the difference to fig5 is that the two magnetic field sensors 13 a and 13 b are only assigned to one signal processing unit 35 , which is equipped with a switch 37 , over which the signal processing unit 35 has to be connected selectively with one of the two sensors 13 a or 13 b . in this simplified embodiment an additional signal processing unit can be waived , but the signals of the two sensors 13 a and 13 b cannot be processed simultaneously . the data transfer between the signals processing unit 35 and the modules of the control device 8 takes place bi - directional . in the signal processing units according to fig5 and 6 a data conversion from analog to digital takes place , furthermore also test functions can be realized in the signal processing units . the magnetic field sensors 13 a and 13 b are conveniently a component of the control device 8 in the embodiments according to fig5 and 6 .	1
referring now to the figures of the drawing in detail and first , particularly , to fig1 a and 1b thereof , there is shown a front view and a rear view of an embodiment of an upper body protector as can be used , for example , by riders . according to the invention , the upper body protector for protecting persons from compression trauma is composed of rigid protection elements 1 and shoulder supports 2 which together each form a cage part 3 protecting the left side of the upper body protector and a cage part 4 protecting the right side of the upper body . the cage parts 3 and 4 are formed by at least one tubular body 5 made of fiber - reinforced plastic . even though the fiber - reinforced plastics are very rigid , they have a certain elasticity by means of which impaction forces can be taken up into the structure and distributed . through the continuous structure of the protection elements 1 and shoulder supports 2 and through the use of fiber - reinforced plastic and the particular design of the upper body protector , a particularly high degree of protection from compression is achieved . the left and right cage parts 3 , 4 are releasably connected to one another at the connection points on the front by way of closure elements 6 . these closure elements 6 can be formed by straps , clasps or the like . at the connection point of the cage parts 3 , 4 on the back of the upper body protector , closure elements can likewise be arranged for releasable connection , or also one or more hinges 7 . such a hinge 7 can , for example , be formed by a strap formed in a figure eight . the cage parts 3 , 4 formed from the tubular body 5 can be embedded in a plastic shell 8 , and a cushioning layer 9 of foam material or the like is arranged on the side directed toward the body in the use position . this can be better seen from the detail according to fig2 a . moreover , the tubular body 5 has an oval cross section giving a high degree of stability and wearing comfort . such an upper body protector can protect a rider from a horse falling on top of him and withstands a weight of over a metric ton . this is achieved by the cage - like structure of the protector , which affords an especially stable structure . an important aspect is that a load does not cause lateral shifting of the cage parts 3 , 4 relative to one another . this must be ensured by suitable closure elements 6 or hinges 7 . fig2 b shows a variant in which a cushioning layer 9 is arranged on the side directed toward the upper body in the use position and has a layer of fabric 20 arranged underneath it . it is also possible for the protector to be produced in one piece , see fig6 , in which case , however , a tight fit to the body is not obtainable because it has to be possible to pull the protector on and off by providing suitably large openings for the arms and head . by contrast , a two - piece or multi - piece embodiment of the upper body protector can offer a greater accuracy of fit . the tubular body 5 can comprise a core 10 which can be formed , for example , by a foam material or the like , around which , during production , the resin - impregnated fiber fabric , for example glass fiber fabric or carbon fiber fabric , is wound , and thereafter subjected to hardening by heat and pressure . it is likewise possible to form the core 10 from a plastically deformable material , for example aluminum , and thus construct the upper body protector and then , by winding the core 10 with the resin - impregnated fabric and hardening the structure , give said structure a suitable strength . in the upper body protector according to fig1 , each cage part 3 , 4 is composed of a half tire 11 which , in the use position , extends in the lower rib region from the back to the front of the upper body and whose front end 12 is connected to the shoulder support 14 via a connecting bridge 13 arranged alongside the sternum , which shoulder support part 14 is connected to the other end 16 of the half tire 11 via a connecting bridge 15 extending on the back alongside the spinal column . the areas are indicated by broken lines on the right cage part 4 . of course , a wide variety of modifications of such a construction are possible . fig1 b also shows plastic parts 19 which can be attached to the tubular body 5 and provide protection , for example for the spinal column . fig3 is a schematic cross section through the cage parts 3 , 4 in the area of a connection point on the front , where the two tubular bodies 5 forming the cage parts 3 and 4 are surrounded by a strap 17 which is secured via a corresponding clasp 18 or the like . the strap 17 can be fixed , for example , by way of a hook - and - loop ( e . g ., velcro ®) closure 22 . in this way , both a hinge 7 and a releasable closure element 6 can be constructed , and a secure connection of the tubular bodies 5 of the left and right cage parts 3 , 4 can be achieved . by means of suitable formations , for example teeth , at the connection point , displacements perpendicular to the surface of the upper body can be avoided , so as to reliably avoid compression of the upper body . this represents just one embodiment of a closure element 6 or hinge 7 , and other constructions are also possible . finally , fig4 shows a perspective view of a further variant of an upper body protector , seen toward the back , and additional plastic parts 19 for protecting the spinal column are attached to the tubular bodies 5 forming the right and left cage parts 3 , 4 . the plastic parts 19 can be made by injection molding of thermoplastics . in this way , the shoulder regions or other areas of the upper body can also be protected . fig5 shows a perspective view of a further embodiment of an upper body protector in which many tubular bodies 5 are used to form the cage - like structure of the protector . the tubular bodies 5 are advantageously incorporated or embedded in a plastic shell 8 which has a cushioning layer 9 , for example of foam material , on the side directed toward the upper body in the use position . a layer of fabric ( not shown ) can be arranged on the side of the plastic shell 8 directed away from the upper body in the use position . fig6 shows a perspective diagrammatic view of an upper body protector composed of one piece , which is made up of one or more tubular bodies 5 . finally , fig7 shows a sectional drawing of a tubular body 5 whose surface comprises structures intended to provide increased strength , for example ribs 21 . by means of such structures for providing increased strength , the stability can be improved at least in the area of certain connection points . elements 23 for increased strength can be incorporated underneath the structures , for instance the ribs 21 . it will be understood by those of skill in the art that the construction of the upper body protector can be modified in a wide variety of ways . likewise , its application is not limited to the aforementioned riders or motorcyclists or construction workers , and instead the upper body protector can be used in all sectors where persons are exposed to increased risk of compression of the upper body .	0
an embodiment of the invention will be described with reference to the drawings . referring to fig1 , the structure of a sputtering apparatus according to an embodiment will be described . fig1 is a schematic diagram for describing the structure of a sputtering apparatus according to an embodiment . in fig1 , a sputtering apparatus 1 has a vacuum chamber in which a target 2 and a substrate 3 are placed facing each other . predetermined electrical power with a predetermined voltage waveform is supplied from a power source v to the target 2 . application of a predetermined voltage to the target 2 generates plasma on the surface of the target 2 , from which sputtered particles are emitted . the sputtered particles emitted from the target 2 are adhered onto the substrate 3 , thereby forming a thin film . the substrate 3 on which the thin film is formed is a substrate for a semiconductor device , such as a liquid crystal device . the thin film is , for example , a thin film for an electrode on the substrate of the liquid crystal device . the substrate 3 is maintained at a predetermined potential with respect to a ground potential . the sputtering apparatus 1 includes a cover 4 serving as a frame formed to surround the periphery of the target 2 and a cover 5 serving as a frame formed to surround the substrate 3 . the cover 5 constitutes a shield frame . the covers 4 and 5 are made of a conductive material , such as a stainless steel . the covers 4 and 5 have openings 6 and 7 , respectively . when a sputtering treatment is performed , sputtered particles emitted from the target 2 pass through the openings 6 and 7 . in particular , the opening 7 is an opening for allowing the sputtered particles to be adhered to a predetermined region on the substrate 3 . in this case , the opening 7 toward the substrate 3 has a substantially circular shape along the planar shape of the substrate 3 . the opening 6 toward the target 2 has an aperture area larger than that of the opening 7 and has a rectangular shape in this case . the covers 4 and 5 are arranged with an o - ring 8 disposed therebetween , which is made of an insulating material such as a rubber material or the like so that the covers 4 and 5 are not electrically connected with each other when a sputtering treatment is performed . the o - ring 8 has a ring shape , and the center of the ring is a hollow center portionserving as a hole . the o - ring 8 is placed between the covers 4 and 5 . the openings 6 and 7 communicate with each other via the hollow center portionof the o - ring 8 . the sputtered particles emitted from the target 2 go through this communicating part and reach the substrate 3 . a cover 9 made of a conductive material is disposed on a face 5 a of the cover 5 facing the cover 4 via an insulating material 10 . the insulating material 10 is , for example , teflon ®. when a sputtering treatment is performed , the covers 4 and 5 are arranged with the o - ring 8 , the cover 9 , and the insulating material 10 disposed therebetween . the cover 4 is not grounded and is electrically floating with respect to the target 2 . the substrate 3 is at a predetermined potential with respect to the target 2 . the cover 9 is also electrically floating . the covers 4 , 5 , and 9 are made of a conductive material , such as a stainless used steel ( sus ) or the like . the cover 9 has a function as an anti - adhesion plate . the anti - adhesion plate has a finely irregular surface so that , even when the sputtered particles are adhered thereto , the adhered sputtered particles do not come off . the surface of the stainless cover 9 is coated with copper ( cu ) or the like by thermal spraying to form an irregular surface . this adds an anti - adhesion function to the cover 9 so as to serve as the anti - adhesion plate . next , the structure of the sputtering apparatus 1 will be described in more detail . fig2 is a partial sectional view of the covers 4 and 5 . fig3 is an exploded perspective view of main components of the sputtering apparatus 1 . the ring - shaped cover 9 , which is a plate member , is disposed via the insulating material 10 on the planar face 5 a of the cover 5 facing the cover 4 . even when the o - ring 8 becomes worn out , the insulating material 10 prevents generation of an abnormal discharge , i . e ., micro - arching , between the cover 5 and the target 2 . the insulating material 10 is also disposed on an inner periphery 5 b of the opening 7 of the cover 5 . the cover 9 has an extension 9 b bending from a ring - shaped planar portion 9 a firmly attached to the face 5 a toward the inner periphery 5 b of the opening 7 and extending along the inner periphery 5 b . the insulating material 10 is also disposed on an outer periphery 5 c of the cover 5 . the cover 9 has an extension 9 c bending from the ring - shaped planar portion 9 a firmly attached to the face 5 a toward the outer periphery 5 c and extending along the outer periphery 5 c . the cover 9 is fixed by a fixture such as a screw to the cover 5 . by loosening the screw , the cover 9 can be replaced . next , the case in which the o - ring 8 becomes worn out will be described . in a known sputtering apparatus , the o - ring 8 becomes worn out and an abnormal discharge is generated when the covers 4 and 5 come into contact with each other or do not come into contact with each other , but become very close to each other , and , as a result , an electrical current channel is formed , through which an electrical current flows from the target 2 to the grounded cover 5 via the cover 4 . in contrast , according to the embodiment , even when the o - ring 8 becomes worn out , the cover 9 and the cover 5 are insulated from each other by the insulating material 10 . thus , no electrical current channel is formed , through which an electrical current flows from the target 2 to the grounded cover 5 . according to the sputtering apparatus 1 , an abnormal discharge can be prevented , and a high - quality thin film can be formed . in particular , the cover 9 has the extension 9 b extending to the inner periphery 5 b of the opening 7 of the cover 5 and the extension 9 c extending to the outer periphery 5 c of the cover 5 . the extensions 9 b and 9 c are insulated from the cover 5 by the insulating material 10 . that is , besides the face 5 a of the cover 5 facing the cover 4 , the cover 9 has the additional extensions 9 b and 9 c so that no abnormal discharge is generated between the target 2 and the inner periphery 5 b serving as an end face of the opening 7 of the cover 5 and between the target 2 and the outer periphery 5 c of the cover 5 . since the inner periphery 5 b of the opening 7 of the cover 5 is also insulated , even when the o - ring 8 becomes worn out , the insulating material 10 can prevent generation of an abnormal discharge between the end face of the opening 7 of the cover 5 and the target 2 . in addition , since the outer periphery 5 c of the cover 5 is also insulated , even when the o - ring 8 becomes worn out , the insulating material 10 can prevent generation of an abnormal discharge between the outer periphery 5 c of the cover 5 and the target 2 . according to the sputtering apparatus 1 of the embodiment , an abnormal discharge can be reliably prevented , thereby forming a high - quality thin film . according to the embodiment , the cover 9 is placed over the cover 5 surrounding the substrate 3 on which a thin film is formed . alternatively , as a modification , the cover 9 may be placed over the cover 4 surrounding the target 2 . fig4 is a schematic diagram for describing the structure of a sputtering apparatus in which the cover 9 is placed over the cover 4 surrounding the target 2 . fig5 is a partial sectional view of the covers 4 and 5 in which the cover 9 is placed over the cover 4 surrounding the target 2 . in fig4 and 5 , the cover 9 is placed , via an insulating material , over a face 4 a of the cover 4 facing the cover 5 . thus , no electrical current channel through which an electrical current flows from the target 2 to the grounded cover 5 is formed . as in fig1 and 2 , the cover 9 has the extension 9 b extending to an inner periphery 4 b of the opening 6 of the cover 4 and the extension 9 c extending to an outer periphery 4 c of the cover 4 . the extensions 9 b and 9 c are insulated from the cover 4 by the insulating material 10 . in addition , the cover 9 has the extension 9 b extending from the ring - shaped planar portion 9 a firmly attached to the face 4 a toward the inner periphery 4 b of the opening 6 and extending along the inner periphery 4 b . specifically , the ring - shaped cover 9 , which is a plate member , is disposed via the insulating material 10 on the planar face 4 a of the cover 4 facing the cover 5 . even when the o - ring 8 becomes worn out , the insulating material 10 prevents generation of an abnormal discharge between the cover 5 and the target 2 . the insulating material 10 is also disposed on the inner periphery 4 b of the opening 6 of the cover 4 . the cover 9 has the extension 9 b bending from the ring - shaped planar portion 9 a firmly attached to the face 4 a toward the inner periphery 4 b of the opening 6 and extending along the inner periphery 4 b . in addition , the insulating material 10 is also disposed on the outer periphery 4 c of the cover 4 . the cover 9 has the extension 9 c bending from the ring - shaped planar portion 9 a firmly attached to the face 4 a toward the outer periphery 4 c and extending along the outer periphery 4 c . since the inner periphery 4 b of the opening 6 of the cover 4 is additionally insulated , even when the o - ring 8 becomes worn out , the insulating material 10 can prevent generation of an abnormal discharge between the end face of the opening 6 of the cover 4 and the cover 5 . since the outer periphery 4 c of the cover 4 is additionally insulated , even when the o - ring 8 becomes worn out , the insulating material 10 can prevent generation of an abnormal discharge between the outer periphery 4 c of the cover 4 and the cover 5 . as has been described above , according to the sputtering apparatus of the embodiment , generation of an abnormal discharge can be reliably prevented . thus , no unpleasant change in electric field or dusting is caused in the sputtering apparatus . as a result , the quality of a thin film formed on the substrate using the sputtering apparatus is improved . the invention is not limited to the above - described embodiment , and various modifications and changes can be made without departing from the scope of the invention . the entire disclosure of japanese patent application no . 2006 - 030609 , filed feb . 8 , 2006 , is expressly incorporated by reference herein .	7
fig1 a schematically depicts an electric lamp 102 comprising a primary semiconductor light source 104 having a primary optical axis 105 , and being in thermal communication with a reflective primary reflector 106 . the primary reflector is configured for reflecting light generated by the primary semiconductor light source 104 during operation . for that purpose , the primary reflector 106 may be manufactured from a ceramic material , additionally , the primary reflector 106 is arranged for transferring away heat generated by said primary semiconductor light source 104 during operation . in a further embodiment , the primary reflector 106 comprises a covered surface area which is covered by the primary semiconductor light source 104 and a . further surface area , and wherein the further surface area is larger than the covered surface area , preferably two times larger and more preferably three times larger . in this specific example , the electric lamp 102 furthermore comprises a secondary semiconductor light source 108 having a secondary optical axis 109 . herein , the primary and secondary semiconductor light sources 104 and 108 are situated on mutually opposite sides of the primary reflector 106 . in this particular example , a primary printed circuit board 110 is situated between the primary semiconductor light source 104 and the primary reflector 106 as to provide thermal communication there between . likewise , a secondary printed circuit board 112 is installed between the secondary semiconductor light source 108 and the primary reflector 106 for the purpose of thermal communication between . optionally , transparent optical chambers 114 and 116 are mounted to the primary reflector 106 for accommodating the primary and secondary semiconductor light sources 104 and 108 , respectively . preferably , the transparent optical chambers 114 and 116 are manufactured from a transparent ceramic material such as aluminum oxide . the primary reflector 106 may be mechanically connected to a socket 118 , which socket 118 is arranged for providing electrical energy to the primary and secondary semiconductor light sources 104 and 108 via the primary and secondary printed circuit boards 110 and 112 , respectively . fig2 a schematically depicts an electric lamp 202 comprising a primary semiconductor light source 204 having a primary optical axis 205 , and being in thermal communication with a primary reflector 206 . said primary reflector 206 is arranged for transferring away heat generated by the primary semiconductor light source 204 during operation . the electric lamp furthermore comprises a secondary semiconductor light source 208 having a secondary optical axis 209 , and being in thermal communication with a secondary reflector 210 . the secondary reflector 210 is configured for transferring away heat generated by the secondary semiconductor light source 208 during operation . in this particular embodiment , the primary and secondary reflectors 206 and 210 are mounted in a mutually substantially parallel configuration . herein , the primary semiconductor light source 204 is situated on a side of the primary reflector 206 facing away from the secondary reflector 210 , whereas the secondary semiconductor light source 208 is situated on a side of the secondary reflector 210 facing away from the primary reflector 206 . the primary and secondary semiconductor light sources 204 and 208 are in electrical connection with a printed circuit board 212 , which printed circuit board may be provided with electrical power via a socket 214 . alternatively , a battery may be employed for the purpose of providing electrical power to the printed circuit board 212 . optionally , transparent optical chambers 216 and 218 are mounted to the primary reflector 206 and the secondary reflector 210 , respectively , for accommodating the primary and secondary semiconductor light sources 204 and 208 . in this particular embodiment an area of the primary reflector 206 underneath the optical chamber 216 is reflective . the remaining area of the primary reflector 206 is transparent . likewise , an area of the secondary reflector 210 underneath the optical chamber 218 is reflective whereas the remaining area of the primary reflector 210 is transparent . fig3 schematically depicts an electric lamp 302 comprising a primary semiconductor light source 304 having a primary optical axis 305 and thermally connected to a reflective primary reflector 306 . the primary reflector 306 is capable both of reflecting light generated by the primary semiconductor light source 304 during operation and of transferring away heat generated by the semiconductor light source 304 during operational conditions . the primary reflector 306 is mechanically connected to a socket 310 via a cage 308 . herein , said cage 3080 is generally an open structure , for instance a structure comprising a plurality of bars 312 . a primary transparent optical chamber 314 may be mounted to the primary reflector 306 . preferably the primary transparent optical chamber 314 is manufactured from a transparent ceramic material as to increase heat transfer . fig4 schematically depicts an electric lamp 402 comprising a primary semiconductor light source 404 in thermal communication with a translucent primary reflector 406 . said primary reflector 406 is arranged for transferring away heat generated by the primary semiconductor light source 404 during operation . the electric lamp furthermore comprises a secondary semiconductor light source 408 in thermal communication with a translucent secondary reflector 410 . the secondary reflector 410 is configured for transferring away heat generated by the secondary semiconductor light source 408 during operation . in this particular embodiment , the primary and secondary reflectors 406 and 410 are mounted in a mutually substantially parallel configuration . furthermore , in this particular example , the distance d 1 between the primary reflector 406 and the secondary reflector 410 amounts to 7 mm . preferably the primary and secondary reflectors 406 and 410 are manufactured from ceramic material , e . g . magnesium silicate . owing to the significant electrical resistance of the latter material the primary and secondary reflectors 406 and 410 are enabled to perform as ceramic printed circuit boards , i . e . encompassing printed circuit boards , without installing further electrical insulation for that purpose . herein , the primary and secondary semiconductor light sources 404 and 408 are situated on mutually opposite sides relative to the structure composed of the primary and secondary reflectors 406 and 410 . the primary and secondary reflectors 406 and 410 are in electrical connection with a socket 412 . transparent optical chambers 416 and 418 are optionally mounted to the primary reflector 406 and the secondary reflector 410 , respectively , for accommodating the primary and secondary semiconductor light sources 404 and 408 . preferably , the transparent optical chambers 416 and 418 are manufactured from a transparent ceramic material . fig5 schematically depicts an electric lamp 502 comprising a primary semiconductor light source 504 accommodated in a primary transparent optical chamber 506 . the primary semiconductor light source 504 has a primary optical axis 508 . the primary semiconductor light source 504 is thermally connected to a reflective primary reflector 510 . the primary reflector 510 is capable both of reflecting light generated by the primary semiconductor light source 504 during operation and of transferring away heat generated by the primary semiconductor light source 504 during operational conditions . the electric lamp 502 furthermore comprises a secondary semiconductor light source 512 being accommodated in a secondary transparent optical chamber 514 , having a secondary optical axis 516 and being thermal communication with a reflective secondary reflector 518 . the secondary reflector 518 is configured for reflecting light generated by the secondary semiconductor light source 512 during operation , as well as for transferring away heat generated by the secondary semiconductor light source 512 during operational conditions . the primary and secondary reflectors 510 and 518 are substantially curved . for increasing the ability to reflect light along a direction having a substantial component parallel to the primary and secondary optical axes 508 and 516 , the primary and secondary reflectors 510 and 518 are concave with respect to the primary and secondary semiconductor light sources 504 and 512 , respectively . the primary and secondary reflectors 510 and 518 are mechanically connected to a socket 520 . fig6 schematically displays an electric lamp 602 comprising a primary semiconductor light source 604 having a primary optical axis 606 . the primary semiconductor light source 604 is thermally connected to a primary reflector 608 . the primary reflector 608 is capable of transferring away heat generated by the primary semiconductor light source 604 during operational conditions . the electric lamp 602 furthermore comprises a secondary semiconductor light source 610 which has a secondary optical axis 612 , and which is in thermal communication with a secondary reflector 614 . the secondary reflector 614 is configured for transferring away heat generated by the secondary semiconductor light source 610 during operational conditions . for focusing light emitted in backward directions towards directions alike the primary and secondary optical axes 606 and 612 , the primary and secondary reflectors 608 and 614 are provided with local indentations surrounding the primary and secondary semiconductor light sources 604 and 612 , respectively . for the purpose of reflection , the primary and secondary reflectors 608 and 614 are reflective within said local indentations . aside from said local indentations , the primary and secondary reflectors 608 and 614 are transparent . the primary and secondary reflectors 608 and 614 are mechanically connected to a socket 616 . fig7 a schematically depicts an electric lamp 702 by way of a bottom view . the electric lamp comprises a primary semiconductor light source 704 and a secondary semiconductor light source 706 , which are mounted in thermal communication to a primary reflector 708 and a secondary reflector 710 , respectively . referring to fig7 b , the primary semiconductor light source 704 is provided with a primary optical axis 705 whereas the secondary semiconductor light source 706 has a secondary optical axis 707 . the primary and secondary reflectors 708 and 710 are configured for both reflecting light generated during operation by the primary and secondary semiconductor light sources 704 and 706 , and for transferring away heat from said primary and secondary semiconductor light sources 704 and 706 , respectively . referring to fig7 a , the electric lamp 702 furthermore comprises a third semiconductor light source 712 and a fourth semiconductor light source 714 . the third and fourth semiconductor light sources 712 and 714 are in thermal communication with third and fourth reflectors 716 and 718 , respectively . the primary and secondary reflectors 708 and 710 are configured for both reflecting light generated during operation by the primary and secondary semiconductor light sources 704 and 706 , and for transferring away heat from said primary and secondary semiconductor light sources 704 and 706 , respectively . as apparent from fig7 b , the primary and secondary reflectors 708 and 710 are substantially curved as to focus the light generated during operation by the primary and secondary semiconductor light sources 704 and 706 in particular directions . preferably , the curvature of the primary and secondary reflectors is adjustable , e . g . by manufacturing the primary and secondary reflectors from a material allowing for significant plastic deformation , as to enable the focusing of light in any direction desired . all reflectors may be mechanically mounted to a socket 720 . while the invention has been illustrated and described in detail in the drawings and in the foregoing description , the illustrations and the description are to be considered illustrative or exemplary and not restrictive . the invention is not limited to the disclosed embodiments . it is noted that the system according to the invention and all its components can be made by applying processes and materials known per se . in the set of claims and the description the word “ comprising ” does not exclude other elements and the indefinite article “ a ” or “ an ” does not exclude a plurality . any reference signs in the claims should not be construed as limiting the scope . it is further noted that all possible combinations of features as defined in the set of claims are part of the invention .	5
fig1 shows a robot arrangement comprising a robot with only two links for illustration purposes and a control means 3 according to one embodiment of the present invention in a side view ( fig1 a ) and a top view ( fig1 b ). the robot comprises a robot base 1 . 1 , which can be rotated around a first vertical rotational axis q h . a hinge moment sensor of said axis determines the torque m 1 acting on it . a robotic arm 1 . 2 is pivotably supported or coupled around a second horizontal rotational axis q 2 at the basic frame . a hinge moment sensor of said axis determines the torque m 2 acting on it . a tool 1 . 3 is mounted on a flange tool of the robotic arm . a sensor for measuring the force moment determines a force f 1 , f 2 on six axes between the flange tool and the tool . in a squeeze - related situation illustrated in fig1 a , the robot has squeezed an obstacle on the floor with its tool as illustrated by a compressed spring 2 . in contrast , in a squeeze - related situation illustrated in fig1 b , the robot has squeezed an obstacle against a vertical wall with its tool , as illustrated by a compressed spring 2 ′. in the example , the obstacle , related the squeezing and / or actively , for example as a result of it leaning against the tool , is exerting a force onto the robot - guided tool , which is determined as f 1 or f 2 between the flange tool and the tool and induces corresponding torques m 1 and m 2 . in the example , as a consequence of the force exerted by the obstacle , the torque induced in the axes q 1 and q 2 exceeds the corresponding torque as a consequence of the weight ( which equals zero in axis q 1 , since this axis is not subject to gravitational force ). in the following explanation , the torques m 1 , m 2 determined by the hinge moment sensors of the axes q 1 , q 2 are used as axial loads t 1 , t 2 as an example ; in a different embodiment , it is also possible to use the forces f 1 , f 2 instead . fig2 is initially used to explain the sequence of a procedure for controlling the robot according to a more complex embodiment of the present invention , in which the two aspects of a specified duration and a dependency of an axial load explained above are combined with each other . as explained afterwards , both aspects can also be realized independently from each other . in a step s 5 , the drive mechanisms of the axes q 1 , q 2 are disconnected from an energy supply related to the monitoring or specifications , and a command for the closure of the holding brakes of the axes q 1 , q 2 of the robot is issued , preferably if the robot is shut down ( shown in fig2 with the command “ b → close !”) or the holding brakes are closed related to the monitoring or specifications ( shown in fig2 with the status b = close ). then , by initializing or incrementing a counter in steps s 10 , s 15 , a step s 20 is initially used for both axes to check whether a deviation of the respective axial load t i from an axis - dependent load specification t g , i exceeds a limit value t 1 , i with regard to the amount . in so doing , the limit value t 1 , i is adjustable , the load specification t g , i is a gravitational force - related axial load , which coincides with the moment induced by the robot &# 39 ; s own weight in the respective axis and can be determined based on the model . it becomes evident that the load specification t g , 2 is pose - dependent , that it is at a maximum in particular in the horizontal pose illustrated in fig1 and at a minimum in a vertically stretched upward or downward suspended pose , while the load specification t g , 1 disappears . in the event that the deviation does not exceed the limit value ( s 20 : “ n ”), the corresponding holding brake remains unaffected , in particular a command is issued for its closure or it remains closed . in contrast , in the event that the deviation exceeds the limit value ( s 20 :“ y ”), a step s 25 is used to check whether this concerns an actually gravitational force - loaded axis , by verifying whether the gravitational force - related load specification t g , i exceeds a tolerance - related limit value t 2 , i in terms of the amount . in the event that this concerns an actually gravitational force - loaded axis or the gravitational force - related load specification exceeds the limit value t 2 , i ( s 25 : “ y ”), a step s 30 is used to check further whether the corresponding axial load is acting in a pose - dependent , gravitational force - related load direction . for this purpose , the axial load t i is transformed with the correct signs into a lifting torque t l , i that reacts to the effect of the gravitational force : as long as the robotic arm is located in the two right quadrants of fig1 a , in particular in the illustrated vertically stretched out position toward the right between said two right quadrants , an axial moment t i acting in a counterclockwise direction in fig1 is determined as positive lifting torque t l , i of & gt ; 0 , while an axial moment t i acting in clockwise direction is determined as negative lifting torque t l , i of & lt ; 0 . however , as long as the robotic arm is located in the two left quadrants of fig1 a , in particular in a vertically stretched position to the left that mirrors the illustrated position between said two left quadrants , an axial moment t i acting in a counterclockwise direction is determined as negative lifting torque t l , i of & lt ; 0 , while an axial moment t i acting in a clockwise direction is determined as positive lifting torque t l , i of & gt ; 0 . in step s 30 , it is verified analogously whether said lifting torque t l , i exceeds a limit value t 3 , i or not . if the lifting torque t l , i exceeds the limit value t 3 , i ( s 30 : “ y ”), i . e ., if the axial load is acting as an adequate lifting torque reacting to the effect of the gravitational force , then the procedure continues with step s 35 ; otherwise ( s 30 : “ n ”), the corresponding holding brake remains unaffected , in particular a command is issued for its closure or it remains closed . if this does not concern an actually gravitational force - loaded axis , or if the gravitational force - related specification does not exceed the limit value t 2 , i in terms of the amount ( s 25 : “ n ”), then this check is skipped according to step s 30 and the procedure continues directly with step s 35 . in this fashion , the sign of the lifting torque is used to determine whether the respective axial load is acting in the gravitational force - related load direction to lift the robotic arm ( s 30 : “ y ”) or not ( 30 : “ n ”). if with an actually gravitational force - loaded axis ( s 25 : “ y ”), the axial load is acting in the specific , pose - dependent load direction to lift the robotic arm ( s 30 : “ y ”), or if this does not concern an actually gravitational force - loaded axis ( s 25 : “ n ”), the procedure continues with step s 35 ; otherwise , the corresponding holding brake remains unaffected , in particular , a command is issued for its closure or it remains closed . in step s 35 , the corresponding holding brake is opened or a command is issued for the holding brakes to remain open , jointly illustrated in fig2 with b i → open . in addition , a time counter t is initialized ( t = 0 ). it is incremented ( step s 40 , step s 45 : “ n ”) until a specified , axis - dependent first period of time t h , i has elapsed ( s 45 : “ y ”). now steps s 50 to s 60 and steps s 20 to s 30 are used to check in a corresponding fashion , whether the deviation is still exceeding the limit value ( s 50 : “ y ”), whether this concerns an actually gravitational force - loaded axis ( s 55 : “ y ”) and whether the axial load is then acting in the specific , pose - dependent load direction to lift the robotic arm ( s 60 : “ y ”). only if these conditions are met ( s 50 : “ y ” and s 55 : “ y ” and s 60 : “ y ”), does the procedure continue with step s 65 ; otherwise ( s 50 : “ n ” or s 55 : “ n ” or s 60 : “ n ”) with step s 80 . in this step , s 80 , the corresponding holding brake is closed ( b i → close ). in step s 65 , the specified period of time t h , i is extended once to t ′ h , i and the time counter t is incremented further ( step s 70 , step s 55 : “” n ″), until said extended period of time t h , i has also elapsed ( s 75 : “ y ”). next , the corresponding holding brake is likewise closed in step s 80 ( b i → close ). it becomes apparent that the holding brakes are in each case opened again for a specified axis - dependent duration t h , i or remain open prior to the closure ( s 35 ) with this procedure , if the deviation of the axial load from an axis - dependent , pose - dependent , gravitational force - related load specification exceeds a limit value ( s 20 : “ y ”) and in the case of a gravitational force - loaded axis ( s 25 : “ y ”) is additionally acting in a pose - dependent , gravitational force - related load direction ( s 30 : “ y ”). said first specified duration t h , i is extended ( s 65 ), if after it has ended ( s 45 : “ y ”) the deviation still exceeds a limit value ( s 50 : “ y ”) and in the case of a gravitational force - loaded axis ( s 55 : “ y ”) is additionally acting in a pose - dependent , gravitational force - related load direction ( s 60 : “ y ”). as a result , the holding brake is in each case opened again for a specified duration , depending on an axial load or remains open prior to the closure related to the monitoring . as explained at the beginning , this represents a complex variant , in which a plurality of aspects of the present invention are combined multiple times , in particular the selection of the squeezing axes or the extension of the specified duration depending on the axial load ( s 20 , s 30 , s 50 , s 60 ) with the renewed opening or the continued opening for a specified duration ( s 40 , s 45 , s 70 , s 75 ). fig2 provides a compact illustration of different simpler variants : for example , all steps except s 5 - s 15 , s 35 - s 45 and s 80 are omitted in one variant . then , the holding brakes for all axes are simply opened again for a specified duration or remain open in spite of the monitoring - related closure command . in an upgrade of this variant , the steps s 20 and / or s 25 , s 30 are added . then , only holding brakes of squeezing axes are or remain open ( s 20 : “ y ”) or holding brakes are or remain only open ( s 30 : “ y ”) in the event that a squeezing force prevents the slumping of the robot , meaning that the respective axial load is acting in a specific , pose - dependent direction in such a way that a gravitational force - related slumping is prevented . in a further upgrade of said variant , the steps s 50 and / or s 55 , s 60 as well as s 65 to s 75 are added . then , the specified duration is extended depending on the axial load . in another variant , the steps s 40 , s 45 , s 65 to s 75 are omitted , whereby the procedure instead returns to step s 50 , if the condition in step s 60 is answered with yes . then , the holding brakes are opened again or still remain open in spite of the issued monitoring - related closure command , for as long as the respective axis is squeezing the obstacle ( s 20 , s 50 : “ y ”) or the holding brakes are or remain open for as long as a squeezing force prevents the slumping of the robot ( s 30 , s 60 : “ y ”). in an upgrade of said variant , the steps s 40 , s 45 or s 70 , s 75 are added to implement a temporal hysteresis . in all of the variants mentioned above , instead of the combination of the steps s 20 and s 25 , s 30 and / or the steps s 50 and s 55 , s 60 , it is in each case possible to only take into consideration or check the transgression of the limit value ( s 20 , s 50 ), or for gravitational force - loaded axes ( s 25 , s 55 : “ y ”) only the load direction ( s 30 , s 60 ).	6
in fig1 - 4 , there is depicted various views of an exemplary embodiment of a head and neck restraint device , generally designated 100 , that is used to control forces exerted upon an occupant seated in a moving vehicle especially during deceleration of the vehicle . more especially the head and neck restraint device 100 is designed to control forces exerted upon the seated occupant during rapid deceleration of the vehicle such as during an impact . the present head and neck restraint device 100 is useable with cars , aircraft and boats ( collectively , vehicles ), but especially with all types of high performance vehicles such as race cars . the head and neck restraint device 100 may also be used in conjunction with seated and non - seated static or moving rides such as may be used in amusement parks or other places . as apparent , the head and neck restraint device 100 may be used in various other types of devices . an example of use of the head and neck restraint device 100 in a high performance car is depicted in fig5 and 6 . in fig5 and 6 , a race car 400 is illustrated in partial cutaway showing an occupant o ( e . g . the driver ) seated in a seat 450 of the race car 400 . the seat 450 is equipped with a seat harness 300 configured to retain and restrain movement of the occupant in the seat . the head and neck restraint device 100 is associated with and utilizes the seat harness 300 for use and operability . this combination may be defined as a head and neck restraint system 500 and form at least a part of the present invention . as discerned in fig5 and 6 , a helmet tether 230 that is detachably attached to opposite sides of a helmet 200 of the occupant o is retained by and about the head and neck restraint device 100 . particularly , and as better discerned in fig7 and 8 , the head and neck restraint device 100 is intertwined with left and right ( as viewed by the occupant o ) shoulder straps 150 and 160 . it should be appreciated that the term left and right are to be taken relative to the forward view of the occupant o . the head and neck restraint device 100 is preferably made out of a composite or similar material , but may be made of one or more other types of materials as desired . the device 100 is defined generally by a body 101 . the body 101 has a back 134 , a left sidewall 102 extending out from the back 134 , and a right sidewall 104 extending out from the back 134 and spaced approximately a shoulder &# 39 ; s width apart from the left sidewall 102 . the left sidewall 102 defines a contoured front surface 103 and a contoured bottom surface 106 . the right sidewall 104 defines a contoured front surface 105 and a contoured bottom surface 108 . the body 101 is thereby configured to partially surround the neck and head areas of the occupant o . particularly , when the device 100 is used , the back 134 of the body 101 is situated behind the occupant &# 39 ; s head and is thus oriented essentially co - axial with the occupant &# 39 ; s spine , the left sidewall 102 extends essentially transverse to and along the length of the left side of the back 134 and is thus oriented essentially along and / or adjacent the left side of the occupant &# 39 ; s neck , and right sidewall 102 extends essentially transverse to and along the length of the right side of the back 134 and is thus oriented essentially along and / or adjacent the left side of the occupant &# 39 ; s neck . the left and right sidewalls 102 , 104 may be outwardly contoured as desired . the bottom surfaces 106 and 108 are friction and shoulder belt contacting surfaces and as such , each bottom surface 106 , 108 is slightly rounded or curved to provide a pivot point for a cantilever or rocking action of the device 100 per the principles of the present invention . bottom surface curvature configuration determines the pivot point of the device 100 as well as the extent of forward and reverse pivoting thereof . the bottom surfaces 106 and 108 preferably , but not necessarily , have a width that is approximately the same as the width of seat harness shoulder straps . the body 101 has a left side extension 120 that is situated on the lower part of the front surface 103 of the left sidewall 102 , and a right side extension 122 that is situated on the lower part of the front surface 105 of the right sidewall 104 . the right and left extensions 122 , 120 may or may not be moveable ( adjustable ) up and down relative to the sidewalls 102 , 104 ( as represented by the double - headed arrows adjacent the extensions ) as desired . the extensions 120 , 122 are shown as adjustable . as such , the left side extension 120 is adjustably connected to the lower portion of the front surface 103 . the left side extension 120 is adjustably connected to the front surface 103 through interaction of bolt and slot assemblies 124 , 125 . in this embodiment , the bolt portion is part of the left sidewall 102 while the slots are part of the left side extension 120 . the left side extension 120 includes a contoured bottom surface 128 that defines a belt contacting surface being preferably , but not necessarily , approximately the same width as the left shoulder strap 150 . up / down adjustability of the left side extension 120 provides up / down adjustability in the distance between the bottom surface 128 of the left side extension 120 and the bottom surface 106 of the left sidewall 102 . this affects forward pivoting of the device 100 . moreover , the right side 122 is adjustably connected to the lower portion of the front surface 105 . the right side extension 122 is adjustably connected to the front surface 105 through interaction of bolt and slot assemblies 126 , 127 . in this embodiment , the bolt portion is part of the right sidewall 104 while the slots are part of the right side extension 122 . the right side extension 122 includes a contoured bottom surface 130 that defines a belt contacting surface being preferably , but not necessarily , approximately the same width as the right shoulder strap 160 . up / down adjustability of the right side extension 122 provides up / down adjustability in the distance between the bottom surface 130 of the right side extension 122 and the bottom surface 108 the right sidewall 104 . this affects forward pivoting of the device 100 . the height of the surface 128 relative to the surface 106 , and the height of the surface 130 relative to the surface 108 ( ratio thereof ) limits the amount of load , grip or holding of the device 100 on the shoulder straps 150 , 160 before the device 100 pivots ( cantilevers ) forward and moves with the occupant during deceleration . the device 100 moves while maintaining its pivot or cantilever angle . typically and preferably , but not necessarily , the two extensions 120 and 122 are adjusted for the same height . surfaces 128 and 130 may be deemed cantilever surfaces in that the height or ratio of the height of these surfaces relative to their associated surfaces 106 and 108 determines when the device 100 will stop , pivot and interact with the shoulder straps 150 , 160 . the device 100 further includes a belt interaction portion 110 that extends outwardly from the left and right sides of the back or center portion 134 of the body 101 . the left and right side extensions of the belt interaction portion 110 each have a contact surface 112 on a respective upper area thereof . this contact surface 112 is a friction and binding area and is adapted to receive and contact a shoulder strap 150 , 160 over the left and right extensions respectively . the left sidewall 102 of the body 101 has a cutout area 113 . the cutout area 113 defines a strap space for receiving and guiding the left strap 150 therethrough and over the left side extension , thereby directing the strap 150 thus between the contact surface 112 of the left side extension and the bottom surface 106 of the left sidewall 102 . likewise , the right sidewall 104 of the body 101 has a cutout area 115 . the cutout area 115 defines a strap space for receiving and guiding the right strap 160 therethrough and over the right side extension , thereby directing the strap 160 thus between the contact surface 112 of the right side extension and the bottom surface 108 of the right sidewall 104 . fig3 and 9 depict rear views of the head and neck restraint device 100 and additional attention is directed thereto . particularly , fig3 depicts the head and neck restraint device 100 by itself while fig9 depicts the head and neck restraint device 100 as situated during use and as a rear view of fig7 and 8 . these views show the gap or areas 113 and 115 between the left and right extensions of the belt interaction portion 110 through which the respective straps 150 , 160 extend . since the ends of the extensions are open , this allows easy lateral insertion and removal of the respective shoulder straps onto the device 100 . while not shown , the extensions may have belt retention portions extending from their contact surface 112 to aid in releasably retaining the shoulder straps thereon . fig3 additionally depicts a helmet tether 230 extending through retention portions or brackets 136 and 138 on the back side of the body 101 . this tether is releasably connected at a left end to a left connector 212 of the helmet 200 ( see e . g . fig4 and 7 ) and releasably connected at a right end to a right connector 210 of the helmet 200 ( see e . g . fig8 ). the tethers are angled upwardly from the device to the helmet . this aids in providing the necessary cantilever action with respect to the device . in this manner , the helmet 200 is connected to the device 100 . the length of the tether 230 determines the maximum outward ( forward ) length of travel for the helmet 200 relative to the device 100 . the longer the tether the greater the length of travel for the occupant &# 39 ; s helmet relative to the device and visa versa . the length of travel determines actuation of the cantilever motion . the retention portions 136 , 138 of the body 101 allow the tether 230 to move freely therethrough , thereby allowing side - to - side head motion by the occupant o ( as represented by the double - headed arrow ) regardless of the maximum length of travel for the tether . thus , as the restraint helmet 200 moves from side to side , the tether may move with it . other configurations for retention portions are contemplated . fig4 provides a close - up perspective view of the present head and neck restraint device 100 in relation to shoulder straps 150 and 160 , and an occupant &# 39 ; s restraint helmet 200 particularly illustrating the various moments , forces , motions , dynamics and / or the like of the present invention as represented by the arrows and any associated lines . shoulder strap 150 is positioned over the belt interaction portion 110 ( side or lateral placement onto surface 112 ) and under the extension 102 and plate 120 . likewise , the shoulder strap 160 is positioned over the belt interaction portion 110 ( side or lateral placement onto the surface 112 ) and under the extension 104 and plate 122 . the device 100 may move forward and back along the shoulder straps as represented by the double - headed arrows below the extensions 102 and 104 . the device 100 also tilts , pivots or provides a cantilever action as represented by the dashed lines and angled double - headed arrows . the relationship of the tether 230 to the device is also illustrated by dashed line - tether 230 . in fig7 there is depicted the left side of the head and neck restraint system 500 using the head and neck restraint device 100 . the helmet tether 230 is shown connected to the connector 212 of the restraint helmet 200 . the shoulder strap 150 is shown extending over the shoulders of the occupant o , under the surface 128 of the adjustment plate 120 , under the friction surface 106 of the left sidewall 106 , and over the surface 112 of the belt interaction portion 110 . in fig8 there is depicted the right side of the head and neck restraint system 500 using the head and neck restraint device 100 . the helmet tether 230 is shown connected to the connector 210 of the restraint helmet 200 . the shoulder strap 320 is shown extending over the shoulders of the occupant o , under the surface 130 of the adjustment plate 122 , under the surface 108 of the right sidewall 104 , and over the surface 112 of the belt interaction portion 110 . it can thus be deduced that when the body moves forward during impact or deceleration , the head , through helmet 200 and tether 230 pulls the upper portion of the device 100 . the device 100 will move along the shoulder straps 310 , 320 by the pulling of the upper portion as the head and body move forward . depending on the friction of the surfaces 106 , 108 , 112 , 128 and 130 the device 100 will move along the straps 310 , 320 until a frictional point is reached and the device 100 pivots or provides a cantilever action . fig1 - 14 depict various views of another exemplary embodiment of a head and neck restraint device , generally designated 300 . the head and neck restraint device 300 is formed as a one piece body 301 . preferably , but not necessarily , the body 301 is formed of a composite material or as a composite structure . this makes the device lightweight and durable . the body 301 has a back 302 defining a collar portion 304 , a right leg 306 and a left leg 308 . the right leg 306 is contoured to define a right belt surface 360 ( see e . g . fig1 ). the left leg 308 is contoured to define a left belt surface 350 ( see e . g . fig1 ). when the device 300 is used , the collar portion 304 is situated behind the occupant &# 39 ; s head and is thus oriented essentially co - axial with the occupant &# 39 ; s spine , the left leg 308 is oriented essentially along and / or adjacent the left side of the occupant &# 39 ; s neck or over the left shoulder , and the right leg 306 is oriented essentially along and / or adjacent the right side of the occupant &# 39 ; s neck or over the right shoulder . the left and right legs 308 , 306 may be outwardly contoured as desired . the bottom surfaces 350 and 360 of the legs 308 , 306 are friction and shoulder belt contacting surfaces and as such , each bottom surface 350 , 360 is contoured to provide a pivot point for a cantilever or rocking action of the device 300 per the principles of the present invention . bottom surface curvature configuration determines the pivot point of the device 300 as well as the extent of forward and reverse pivoting thereof . the bottom surfaces 350 , 360 preferably , but not necessarily , have a width that is approximately the same as the width of seat harness shoulder straps . in one form , the widths are larger than the strap . in another form , the widths are smaller than the strap . with attention directed to fig1 , the bottom surface 350 of the left leg 308 has a double ridge configuration defining a trough therebetween . particularly , the bottom surface 350 has a stop ridge 330 that extends essentially transverse to a forward / reverse direction of the body 301 and a pivot ridge 332 that extends essentially transverse to the forward / reverse direction of the body 301 . the stop ridge 330 and the pivot ridge 332 defines a transverse trough 334 situated between the ridges . the height of the ridges relative to one another defines the amount of forward pivot of the device 300 . particularly , the height of stop surface 330 relative to the pivot surface 332 limits the amount of load / grip the device 300 exhibits ( holding ) before the device tilts or pivots and then moves . the bottom surface 360 of the right leg 306 likewise has a double ridge configuration defining a trough therebetween . particularly , the bottom surface 360 has a stop ridge 320 that extends essentially transverse to a forward / reverse direction of the body 301 and a pivot ridge 322 that extends essentially transverse to the forward / reverse direction of the body 301 . the stop ridge 320 and the pivot ridge 322 defines a transverse trough 324 . particularly , the height of stop surface 320 relative to the pivot surface 322 limits the amount of load / grip the device 300 exhibits ( holding ) before the device tilts or pivots and then moves . the device 300 further includes a belt interaction portion 310 that extends down from the bottom of the back 302 and outwardly from the left and right sides thereof . the belt interaction portion 310 has a left wing 311 and a right wing 313 each having a contact surface 112 on a respective upper area thereof . these contact surfaces 112 are a friction and binding areas and are adapted to receive and contact a shoulder strap over the left and right wings . referring to fig1 , the device 300 may have one or more brackets for holding and / or guiding a helmet tether . the body 301 has a right bracket 305 on the right rear of the collar 304 and a left bracket 307 on the left rear of the collar 304 . the brackets are sized to receive a helmet tether and allow the tether to slide therethrough . fig1 and 16 depict another exemplary embodiment of a head and neck restraint device , generally designated 700 . the head and neck device 700 is formed as a one piece body 701 . preferably , but not necessarily , the body 701 is formed of a composite material or as a composite structure . this makes the device lightweight and durable . the body 701 has a collar 702 , a right leg 706 and a left leg 704 . the right leg 706 is contoured on its underside to define a right belt pivot . the left leg 704 is contoured on its underside to define a left belt pivot . when the device 700 is used , the collar 702 is situated behind the occupant &# 39 ; s head and is thus oriented essentially co - axial with the occupant &# 39 ; s spine , the left leg 704 is oriented over the left shoulder adjacent the left side of the occupant &# 39 ; s neck , and the right leg 706 is oriented over the right should adjacent the left side of the occupant &# 39 ; s neck . the device 700 further includes a belt interaction portion 730 that extends down from the bottom of the collar 702 and outwardly from the left and right sides thereof . the belt interaction portion 730 has a left wing 732 and a right wing 734 each having a respective contact surface 733 , 735 on a respective upper area thereof . these contact surfaces 733 , 735 are a friction and binding areas and are adapted to receive and contact a shoulder strap over the left and right wings . the left wing 732 and the left leg 704 together define a belt reception area 785 . the right wing 734 and the right leg 706 together define a belt reception area 780 . the device 700 may have one or more brackets for holding and / or guiding a helmet tether . the device 700 is shown with a two brackets , particularly a right bracket 790 on the right rear of the collar 702 , and a left bracket 765 on the left rear of the collar 702 . the brackets are sized to receive a helmet tether and allow the tether to slide therethrough . the device 700 has longer belt surfaces so consequently have longer legs . as such , the left leg 704 has a left extension or foot 710 with an adjustable toe piece 712 . likewise , the right leg 706 has a left extension or foot 720 with an adjustable toe piece 722 . the left toe piece 712 includes a stop surface on the bottom thereof . the right toe piece 722 likewise includes a stop surface on the bottom thereof . the stop surfaces of the toes pieces limit the amount of forward pivoting of the device 700 . it should be appreciated that the device 700 has features and thus functions in like manner to the other embodiments presented herein . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only preferred embodiments have been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .	1
reference herein to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment can be included in at least one embodiment of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment , nor are separate or alternative embodiments mutually exclusive of other embodiments . in the prior art , there are various examples of virtual objects , such as multimedia players ( e . g ., the windows media player from microsoft , the quicktime player from apple , and the divx playa from the divx consortium ) and other windowed user - interfaces and virtual on - screen devices that have a graphical representation on the screen of a computer or other imdd . these virtual objects employ various techniques ( e . g ., 3d shading , metallic colors , buttons , dials , shadowing , and virtual leds ) to make them appear more interesting and realistic ( e . g ., more like actual , tangible , physical objects ). on some of these virtual objects , buttons can be pressed , and the shadowing is adjusted to reflect the depression of the button . on others , a technique known as “ skinning ” is sometimes used to provide a user with some control of the colors and shapes of certain players ( e . g ., winamp ). progressive shading , highlighting , and related techniques are used to display contours and surface textures and depths . however , the prior art lacks user interfaces where the displayed virtual object ( e . g ., quicktime player ) is affected by the content that it plays or the environment outside the object in a real and dynamic way . for example , the “ metallic - looking ” border of a multimedia player of the present art does not optically reflect video content that it plays . however , if the player were a real physical object with a real physical metallic border , the light from the video window would be reflected off that border , in a dynamic fashion , the way it does , for example , off an actual physical border of a tv or computer screen . thus , the multimedia player of the prior art lacks a degree of realism . in one embodiment , the invention is a windowing technique for a visual display device . thus , one embodiment of the present invention is a graphical border for a multimedia ( e . g ., video ) display where the border is rendered in a way such that visual content within the border affects the display of the border . in one example of this invention , the border is rendered as a metallic / reflective frame around a video display window . a viewer location is assumed ( e . g ., centered in front of the display window at a nominal viewing distance to a screen upon which the window is presented to the viewer ). in this example , visual objects within the display window are processed ( e . g ., ray traced with respect to the assumed viewer location ) to dynamically affect the rendering of the window border . in one variation of the above embodiment , the viewer &# 39 ; s actual location is used in the processing of the reflections to improve the realism of the reflections off the surface of the border . in another variant of the above embodiment , the invention is a mechanism that takes aspects ( e . g ., the spatial luminance over time ) of displayed multimedia objects and uses those aspects to affect characteristics of virtual players that are used to display those objects . objects , as defined herein , are intended to carry , at a minimum the breadth of objects implied by , for example , the mpeg - 4 visual standard ( e . g ., audio , video , sprites , applications , vrml , 3d mesh vops , and background / foreground planes ). more information on the mpeg - 4 visual standard can be found in international standards organization standard iso / iec 14496 - 2 : 2004 . as an example of the problem , and the solution provided by the present invention , consider a multimedia player of the present art ( e . g ., the quicktime player per fig1 ) for displaying video on a computer screen . the rendered graphical representation of the player includes a brushed - aluminum border surrounding the video window . this border is statically highlighted in such a way as to provide a degree or physical realism to the border / player . however , the implementation falls short of the realism that could be realized in a number of ways . if the brushed aluminum border were , in fact , physical , it would reflect light back to the viewer , and those reflections would change dynamically as the ambient light conditions changed in the room of the viewer and / or on the screen surface surrounding the rendered player ( and also , in the most realistic implementations , as the viewers perspective with respect to the player changed ). the reflections would also change in response to changes to the video content displayed within the dynamic video window within the quicktime player . as illustrated by fig1 , the multimedia player 100 is displayed on imdd screen 120 and exhibits static border 102 , and visual display area 104 . note that region 106 of border 102 of the player that is proximate to the brighter region 107 of the visual display area of the player is substantially the same brightness and texture as the region 108 of the border that is proximate the darker region 109 of the visual display . note also that screen icons 122 are also not affected ( even virtually ) by light emanating from the visual display . thus , one example of the present invention is a more realistic virtual player that makes use of ray tracing and related graphical techniques to dynamically change the elements ( e . g ., borders , virtually raised buttons , contoured surfaces ) of the player in response to the content that the player is displaying to create a more realistic rendering of the player . thus in the present invention , in response to the visual display , the borders of the multimedia player might look , for example , like those illustrated in fig2 , where the left region 206 of the border is slightly lighter than the right region 208 of the border , as a function of the greater brightness of the visual display 207 , on the left of the visual display . fig2 illustrates just a snapshot of a video sequence . in the present invention , as the light ( and color ) varied across the screen in an actual video sequence , the rendering of the border would be adjusted correspondingly to reflect the dynamics of the changes in the luminosity and chromaticity of the sequence of images over time . another example of the present invention is a more realistic virtual player that makes use of ray tracing and related graphical techniques to dynamically change the elements ( e . g ., borders , virtually raised buttons , contoured surfaces ) of the player in response to ambient light conditions sensed by the physical imdd upon which the virtual player is displayed . another example of the present invention is illustrated by the before and after views of a quicktime player depicted in fig3 . in the before view 302 , a quicktime player according to the prior art is depicted . it includes static border 304 and visual display area 306 that includes video sequence element including foliage 308 and clouds 310 . in the after view 322 , the rendering of the player has been enhanced according to the present invention wherein the foliage and clouds now extend beyond the visual image to appear to become part of ( i . e ., interact with ) the player ( e . g ., the foliage starts to grow 322 on the border of the player ) or even 324 extend outside of the player ( e . g ., the clouds tumble out of the screen , over the border of the player and might even invade the rest of the computer screen ). in certain embodiments of the present invention , the perspective of the viewer can additionally be either sensed ( e . g ., by a camera that is adapted to track the viewer , or by physical sensors attached to the display or viewer seating area ) or assumed dynamically , and the elements of the player are changed in response to this sensed or assumed perspective . note that the invention is not limited to application to a player with a border that surrounds a multimedia object display window . the latter is just one example of a virtual object on a imdd display . other examples relevant to the present invention include any type of on - screen display ( osd ) provided by a graphical user interface ( gui ) in a set - top box ( e . g ., a dct6412 dual - tuner digital video recorder from motorola corporation of chicago , ill . ), station identification bug provided by a broadcaster in the lower right hand region of a tv screen , a menu provided at the top of a computer screen , a button or icon located on a tv screen or computer screen , a flip bar for an electronic program guide on a tv screen , an entire epg ( opaque or semi - transparent ), or any graphical or multimedia object that is intended to emulate a physical object on a display . note that , although an objective of the present invention is enhanced realism , another goal is market appeal . in some cases these objectives are orthogonal . thus , it is not necessary under the present invention that the rendering be highly accurate or even “ realistic .” rather , any approximation to dynamic affect of the multimedia object on its player ( even if crude ) would be within the scope of the present invention as long as it achieves the objectives of favorably differentiating the display from existing devices . for example , one low complexity implementation of the present invention with respect to a multimedia player would involve ( a ) regularly sampling a set of representative pixels from a video display , ( b ) calculating the average luminance of the set by performing a 2d averaging of the luminance components of the pixels in the set , and ( c ) using the average luminance at each sample time to adjust the relative brightness / lightness ( e . g ., approximating reflection of the visual content ) of the border of the multimedia player . a higher complexity implementation ( see fig4 ) could divide the video display into four regions , average within each region , and use the luminance average for each region to adjust the brightness of the proximate border section ( optionally using a distance or distance squared attenuation of the effect ). fig4 illustrates imdd display 400 having physical border 402 , screen 404 , virtual multimedia player having virtual border 406 and video display window inside border 406 . the display has been logically divided into four regions for illustration purposes . in the actual device , the video window would continue to display the video sequence . illustratively , fig4 shows that quadrant 408 of the video display window was calculated by the present invention to have a higher luminance than the other three regions . correspondingly , the section 410 of the border of the virtual player device is lightened to reflect the brighter video proximate to that section of the border . higher complexity implementations would be understood to those skilled in the art including those involving finer resolution of intensity averaging calculations all the way up to where luminance and chrominance effects on the graphical object ( e . g ., border ) are calculated as a function of each pixel . also , calculation of proper angles and reflections via ray tracing for proper perspective , and other related techniques can be used as would be understood to one skilled in the art . 1 . an epg flip bar that is overlaid on a video sequence ( via a graphics engine in a set - top box ) where the rendering of the flip bar is dynamically affected by the content of the video sequence . consider a flip bar in the shape of a metallic horizontal cylinder with epg rendered onto the surface . the metallic surface would “ reflect ” the video to the viewer , with appropriate transformations made to the reflection corresponding to the curvature of the cylinder . 2 . a picture - in - picture ( pip ) border or picture - in - graphic ( pig ) where the border ( in the pip case ), or the graphic ( in the pig case ) rendering is dynamically affected by the displayed video sequence . 3 . a graphical object on a tv screen whose rendering is dynamically affected by a specific multimedia object of interest ( e . g ., one specific video object layer ) within a multi - object multimedia object ( e . g ., an mpeg - 4 composite video sequence ). for example , as discussed , in some of the previously discussed embodiments of the present invention , a border on a window displaying an explosion scene in a video might lighten during the explosion sequence . however , in the present embodiment , for example , the border of a player is might not be affected by the explosion but instead only change in response to the position of one particular object of interest ( e . g ., a superhero ) in the explosion sequence . in another example of this embodiment , in a soccer game , the soccer ball could be artificially considered to have a high “ brightness ” ( e . g ., importance ). thus , the border of a virtual player around this video could accentuate the location of the soccer ball through time without being affected by the rest of the scene . this is an example where the effect of the visual sequence on the border does not necessarily improve the realism of the display but rather the functionality and / or “ cool ” factor of the display . fig5 depicts exemplary apparatus ( e . g ., part of the hardware / software in a set - top box ) 500 according to the present invention . it includes video decoder ( e . g ., mpeg - 2 or mpeg - 4 visual decoder ) 502 , on - screen display engine ( e . g ., graphics engine , processor , associated hardware ) 504 , and compositor 506 . in operation , video decoder 502 receives and decodes a video stream that potentially includes some descriptive information about the structure of the stream ( e . g ., object layer information or 3d object description information in the case of an mpeg - 4 stream ) in addition to the coded texture for the elements of the video sequence . osd engine 504 processes requests from a user and also receives information about the video stream from the video decoder , in some cases including rendered objects in a frame buffer format , and optionally content description information ( e . g ., mpeg - 7 content description ) that is correlated with the video and may be part of the same video transport stream as the video or part of a separate stream provided to the osd engine , for example , over the internet . the osd engine can use information from the video stream or content information to modify the user interface before sending it to compositor for compositing into a visual frame for display ( e . g ., by a monitor ). in cases as described in the following section , where the user interface affects or interacts with the rendering of the video objects , information or controls can be sent from the osd engine to the video decoder ( affecting which objects get decoded or the spatial location , visibility , transparency , luminance and chrominance of video objects . alternatively , the osd can request that certain video objects instead be sent to the osd engine from the decoder and not to the compositor . the osd engine then modifies these objects before sending them , along with other graphical objects ( e . g . created by the osd engine and which represent aspects typically of the osd ) to the compositing engine for compositing . the flip side of the above embodiments of the present invention , where the multimedia objects have a dynamic effect on the rendering of the user interface , is where the user interface dynamically affects the rendering of the multimedia object ( s ). the following example should help illustrate the concept . in the prior art , it is common to have a graphical object ( e . g ., part of the user interface ) appear to cast a shadow over , for example , a region of a computer screen under ( from a chosen light source and viewer perspective that is typically not coincident ) the graphical object . however , the present invention goes beyond this concept to have the graphical object ( part of the user interface ) appear to be part of ( affect or interact with ) the actual multimedia object ( e . g ., video ). as an example , again consider an epg “ flip bar ” that pops up across the bottom of a video screen . in the present art , such a flip bar might at best have a 3d - shadow - box effect associated with it . the shadow - box is designed to make the flip bar appear to float slightly above the video screen . however , this is a limited effect that assumes the location of a virtual light source and limits the “ shadow ” to a homogenous color / texture partial border around the flip bar that does not interact in any way with the underlying video . in the present invention , however , a flip bar would actually interact with or affect the presentation of the video by shadowing , for example , differently across different video objects in the video scene , dynamically , based on their color and luminance . this can be accomplished in a number of different ways , as would be understood to one skilled in the art , and some implementations are provided some additional support in the context of object based video , such as that supported by the mpeg - 4 visual standard . fig6 , 7 , and 8 help illustrate the above example . fig6 includes a display 600 ( e . g ., tv or imdd monitor / lcd ) with border 602 , and screen region 604 . each also illustrates a video playing on the screen region where the video includes white foreground building 606 and cross - hatched background building 608 , where the cross - hatched building is smaller to illustrate ( by perspective of the video that is playing ) that it is farther away in the video scene . fig6 further includes flip bar 610 , shadow effect 612 and video scene objects 606 and 608 ( e . g ., white and cross - hatched buildings that are part of the video being played ). note that fig7 and 8 include a similar display , border , screen region , and buildings , as shown in fig6 . note that in fig6 , 7 , and 8 , an attempt is made to illustrate the effect of shadowing different objects in the content differently based on their distance from the virtual object that overlays the display of the content . though the illustrations may have limited accuracy in representing this , the idea is that in an actual implementation , proper artistic properties of perspective , shadowing , the dispersion of light and other effects would be considered to render the scene with the appropriate effect . fig6 illustrates a flip bar and shadow effect 612 of the prior art . even though the flip bar &# 39 ; s shadow is cast over objects in the video scene with different luminances ( and potentially color / reflectivity ), the shadow effect is homogenous in color / intensity / texture and has no interaction with the actual content of the video scene over which it is cast . contrast this with the flip bar 710 and shadow 712 of an example of the present invention as illustrated by fig7 . imdd 700 of fig7 has similar elements to imdd 600 of fig6 . however , in the present invention , the shadow effect is different as a function of objects within the video scene . in other words , the graphical object ( e . g ., flip bar ) affects the display of the multimedia content . notice that shadow effect 714 over the white building is different that shadow effect 716 over the cross - hatched building . one approximate way to implement this effect in the present invention is by using a degree of transparency on the shadow effect . transparency is well known in the art as are interfaces which use semi - transparent graphical overlays so that the underlying subject matter is still partially visible , however , the concept of affecting or interacting with the video is new as will become more clear from the next example . to appreciate the scope of the present invention , it is not so important to recognize that the shadow effect of the present invention is better or more realistic than the prior art , but it is important to recognize that in the present invention , the user interface interacts or affects the video being displayed in ways that are novel and interesting . to appreciate the meaning of “ affects or interacts with ” the multimedia content , consider the two buildings in the video , where , as described earlier the white building is closer than the cross - hatched building ( at least they were arranged that way in the video when they were shot ). if the flip bar were actually in the video , for example , if during the filming of the video , a physical flip bar were placed in front of the buildings , it would cast a shadow on the buildings but the shadow would vary in not just texture , but also in shape . this is illustrated by the fig8 which illustrates how the shadow is projected along a line from an assumed location for a point of illumination which casts the shadow to the white and cross - hatched buildings . note that the shadow cast on the cross - hatched building has a shadow line that is lower than that cast on the white building . this is because the shadow “ should ” be lower on the object that is further , because the projection of the shadow is extended . again , it is not so much that the shadow is true to life , but rather that characteristics of the multimedia content were used in calculating the projection of the shadow box of the graphical object ( flip bar in this example ). in other words , the graphical object interacts with the video content to affect the display of the video objects within the scene . for visualization and appreciation of the dynamics , think of a video sequence where a plane is flying low over some mountains and the viewpoint is from the plane or just above the plane such that the shadow of the plane can be seen on the mountains below . note that the shadow of the plane jumps back and forth , up and down as the depth of the mountains below changes . the plane and the mountains are all part of the video sequence . consider , however , the present invention . think now of the flip bar replacing the plane or overshadowing the plane from the video . in one embodiment of the present invention , when a flip bar is popped up on the display , it will cast its shadow on the mountains in the same way the plane did , the shadow bouncing up and down as if the flip bar were itself flying over the mountains . as another example , consider a video scene that includes a mirror . true to the present invention , when the flip bar pops up , the mirror in the scene would reflect the flip bar back to the viewer providing an interesting feeling of the flip bar being somehow a part of the actual video , or in another sense , the video itself becomes more real and the flip bar appears to be more like a real physical object as opposed to just a graphical overlay . again , as mentioned before , some of these things are more difficult than others to implement in the present state of the art of video . however , consider mpeg - 4 visual video streams that can include multiple object planes where , for compositing purposes , at a minimum , the ordering ( which implies a relative depth ) of the video object layers is provided . in one embodiment of the present invention a compositing engine ( e . g ., in an imdd supporting mpeg - 4 visual ) is interfaced with a user - interface graphics engine in the imdd and the ui makes use of information in the mpeg - 4 scenes description to calculate flip bar and shadow effects . these shadow effects are sent back to the compositing engine where they are composited and therefore affect or “ interact ” with the scene . in another related embodiment , when encountering 3 d mesh objects in the mpeg - 4 scene , for example , the compositing engine sends specifics about the objects to the graphics engine , the graphics engine calculates how the graphical element ( s ) of the ui should interact with the scene and it feeds information back to the compositing engine to affect the display of the 3d objects . as another example , consider a situation where the designer of the flip bar wants to make it “ luminous .” in other words , the flip bar or any other element of the graphical user interface ( even the channel bug ) could itself be a source of light , perhaps a bright source of light . in this case , an example of the present invention is where this graphical object does not cast a shadow on the scene , but rather illuminates the video scene . again , various degrees of complexity can be applied in the implementation of this example of the present invention . in one implementation , the light of the graphical object is projected in r ̂ 2 manner to pixels of the video scene . the luminance of those pixels closest to the graphical object is increased . possibly , the luminance of those pixels further from the object can be decreased . if the graphical object includes chrominance , the chrominance can also be used to change the chrominance of pixels in the video scene , again using a proximity function where closer pixels are affected to a greater extent than further pixels . in a variation of this embodiment , black regions of a video scene are assumed to be for example , background areas and thus further away , and thus less affected ( due to distance ) by the luminosity of the graphical object . a threshold on luminance can be selected such that those pixels below a certain luminance threshold ( the threshold potentially also a function of distance or a dynamic function of some other scene characteristic ( e . g ., average scene luminance )) are not changed , while other pixel are adjusted in luminance and chrominance . to clarify the concept , imagine a graveyard scene and a ui with a graphical element glowed a bright red . in the present invention , as the scene panned slowly from left to right , for example , tombstones would be illuminated with an eerie red glow from the graphical element , creating the illusion that somehow , graphical element were in the graveyard as well . as another example of this type of interaction , consider a video sequence that consists of , for example , a flow from left to right . for ease of visualization , consider a video sequence showing similar to the stampede scene from the movie the lion king where numerous animals of various sorts are streaming across the screen from left to right . now imagine a user pops up a graphical object ( e . g ., some type of virtual control widget for navigating his imdd ). in the prior art , this object would typically opaquely overlay the video scene or at best overlay in a semitransparent manner . in an embodiment of the present invention , however , the graphical object interacts with the elements of the video sequence . so , for example , in this embodiment of the present invention , when a user pops up a graphical widget ( for example volume control slider ), the present invention would cause the video to be rendered in such a way that it would appear that the animals had been directed to avoid running into the virtual widget . this would look similar to the way the animals streamed around the one branch to which simba clung in that fateful scene in the lion king movie during the stampede . implementations of the above would include interacting with the actual objects of an mpeg - 4 multi - object scene or , in the case of a more convention video sequence , using stretching , morphing , and non - linear distortion techniques on the scene to have it flow around the graphical object dynamically as would be understood to one skilled in the art . in a variant on the above embodiment , an alternative effect can be applied . here the surface of the video screen is considered to be made of stretch saran wrap , for example , and again using standard projection techniques , the video surface is made to appear to sink in the middle where it is “ supporting ” the virtual widget . in another variant , when the widget ( e . g ., flip bar ) is flipped up , it creates ripples on the surface of the video sequence as if the surface of the screen was the surface of a pool and the widget was placed down ( or even splashed down ) onto the video scene . this invention is a twist on gui icons in use in various computer systems and in some tv systems . guis have historically used color and texture to improve the usability of the ui . consider the file manager or “ explorer ” in microsoft windows . in one view , files can be represented as little rectangular icons , and folders as little manilla folders . in icon view the representation of the file implies the application which created the file . in thumbnail view , the representation of a file represents the content of the file ( e . g ., via a preview of an image within the file , for example ). however , in the present invention , the concept of weight or girth is used to add to the functionality of the user interface by quickly allowing the importance of a file ( as represented graphically in terms of the size , weight , girth of the icon for the file ). this invention , in a sense follows the american motto of “ bigger is better ,” or at least bigger is more important . with all the emphasis there is on dieting these days , it is unlikely that the difference between the size or “ plumpness ” of file representations or icons in a user interface would go unnoticed . hence , one embodiment of the present invention is the representation of files with varying degrees of plumpness , the degree of plumpness mapped to a user - selected parameter of importance . for example , if the user would like to see larger files as plumper , he selects a view that maps file sizes to plumpness and then all his files change to a representation where the biggest is the plumpest and the smallest is relatively skinny ( see , for example fig9 ). note that this can be used as an alternative to a sorting function or in addition to it . for example , you could still sort the files by date as per the prior art , but per the present invention , in the plump = large mode , the user could quickly determine both the newest and largest files at a glance . fig9 depicts three icons , each representing a system resource . in this case , each system resource is a multimedia object , in particular , a program recording in a personal video recorder , and the parameters of importance are the recorded length of each program . note that the figure illustrates for each icon the combination of three distinct characteristics to depict plumpness . these characteristics are icon size , line thickness , and bending of the vertical fill lines of the icons to indicate a stretched pants effect . note that in other embodiments , the system resources could be storage elements ( e . g ., minisd memory cards ) associated with , for example , a portable device , and the parameter of importance or interest could be the total size or space remaining on each of those storage elements . interestingly , though mapping file size to plumpness is sort of intuitive , the invention is not limited to just mapping file size . rather , any parameter of a file that is of interest can be mapped to plumpness . “ size matters ” in a sense here since plump means “ of relative importance ” in terms of the mapped parameter . as another example , in the present invention , the user may decide that older files are “ important ” to him . he can thus map age ( reverse chronological ) to plumpness . then all old files will map to plumpness and be easily identified . a particularly interesting mapping is “ relevance ” to plumpness . this is a variant on the theme . in this embodiment , a user selects a “ key ” file , then selects a “ map relevance to plumpness ” view . the software then executes a word frequency analysis of all files ( e . g ., in a directory ), then compares then with the key file , calculates a relative match , and then adjusts the plumpness of all iconic representations of the files in the directory to reflect the match . in various implementations , plumpness of an icon is represented by modifying a simulated context or environment for the icon in a way that conveys plumpness , including , for example , depicting icons as resting on a deformable surface , such as a cushion , and depicting plumper icons as depressing the surface to a greater degree than less plump icons , or depicting icons as hanging from a stretchable support , such as a bungee cord , spring , flexible metal or plastic support structure or related support , and depicting the plumper icons as elongating or bending the elements of the support structure to a greater degree than the less plump icons . and in other embodiments , plumpness of an icon can be left to the artists eye and can include making personifying the depiction of the icon and making the icon look more plump by , for example , generally making the icon look more curvaceous , rounding the edges of the icon , stretching the icon in the horizontal direction , bending vertical lines of the icon outward from the center of the icon , and / or adding indications of plumpness to the icon such as chubby cheeks , double chin , a pot belly , or a general slump . another variant on this invention is using the concept of age , independently , or in conjunction with “ plumpness ” or “ largeness ” as described previously . in this embodiment , certain typical visual characteristics of age are used to modify the appearance of standard icons . for example , whiskers , slight asymmetry , a general graying of the icon or around the “ temples ,” the effects of gravity on the overall shape , and other aspects that would be understood to graphical and cartoon artists can be applied to imply “ age ” of a file . the content streams as described herein may be in digital or analog form . as can be seen by the various examples provided , the invention includes systems where elements of a user interface affect the content that is presented , systems where content that is presented affects elements of a user interface associated with that content presentation , and systems where the user interface elements interact with the content and vice - versa . also within the scope of the present invention are systems where elements of the user interface are dynamically correlated with elements of the content and vice versa . as an example , consider an electronic program guide ( epg ) on a settop that is playing back a multiple multimedia object presentation of the wizard of oz . a user - selectable virtual object ( e . g ., semi - transparent button ) associated with the epg could be dynamically correlated over time with an object within the content feed such as the tin man , or dorothy &# 39 ; s shoes . this button would allow the user to effectively select a function that is relevant to the tin man or dorothy &# 39 ; s shoes , such as purchasing the song “ if i only had a brain ,” or ordering a catalog featuring shoes from kansas . as a related example of altering the content as a function of the user interface , consider the same movie playing back where the user selects the option to highlight dorothy &# 39 ; s shoes or track the tinman over time , as part of , for example , a user convenience feature . while this invention has been described with reference to illustrative embodiments , this description should not be construed in a limiting sense . various modifications of the described embodiments , as well as other embodiments of the invention , which are apparent to persons skilled in the art to which the invention pertains are deemed to lie within the principle and scope of the invention as expressed in the following claims .	7
referring to fig1 , a high - level schematic diagram of a receiver 100 in accordance with one or more embodiments will be briefly discussed and described . as shown , receiver 100 can include front end 102 and back end 104 , wherein front end 102 can generally receive and process radio frequency analog signals , and output analog intermediate frequency signals . back end 104 can generally digitally process signals produced in the analog front end , and output digital baseband signals . front end 102 can receive radio frequency signals from antenna 106 , or another radio frequency signal source , such as a coaxial cable system , or the like . antenna 106 can be coupled to switch 108 , which can be used to select a frequency band , when , for example , receiver 100 can receive radio frequency signals from multiple frequency bands . switch 108 can also be used as a transmit - receive ( t - r ) switch for a time - division multiplexing ( tdm ) system , such as the global system for mobile communications ( gsm ) system ( which is documented in a specification published by the european telecommunications standards institute ( etsi )). switch 108 can be implemented in one embodiment with a solid - state electronic switch . while one terminal of switch 108 can be coupled to antenna 106 , another terminal can be coupled to an input of bandpass filter 110 . bandpass filter 110 can be used to filter , or attenuate , radio frequency signals that are outside of the desired band of signals ( e . g ., the desired group of channels or carrier frequencies ) that can be processed by receiver 100 . an output of bandpass filter 110 can be coupled to an input of low noise amplifier ( lna ) 112 , which can be used to boost the radio frequency signal for further processing . an output of lna 112 can be input into a pair of mixers 114 and 116 , wherein the mixers are used to process and output the i and q , in - phase and quadrature - phase signal components , respectively . mixers 114 and 116 can be implemented with an active mixer topology ( e . g ., a gilbert cell ) or a passive mixer topology ( e . g ., a switching mixer ). mixers 114 and 116 together can be referred to as a first mixer , wherein such a first mixer is a complex mixer , wherein the i and q inputs can together be referred to in the singular ( e . g ., a first mixer having a signal input ). local oscillator signals input into mixers 114 and 116 can be produced by oscillator 118 , in conjunction with phase locked loop ( pll ) 120 and quadrature generator 122 . phase locked loop 120 can be used to set the frequency for , and provide a phase reference for , oscillator 118 . quadrature generator 122 can be used to produce in phase and quadrature phase local oscillator ( lo ) signals that can be used by mixers 114 and 116 to multiply the radio frequency signal from lna 112 . the multiplication performed by mixers 114 and 116 shifts , or converts , or heterodynes , the frequency of the output of lna 112 to a lower frequency , or intermediate frequency , which can be a “ low ,” or “ very low ,” intermediate frequency , e . g ., 100 khz - 300 khz , or a “ zero ” intermediate frequency , depending upon a selected frequency for pll 120 , and / or the desired operating mode of receiver 100 . note that the outputs of quadrature generator 122 ( e . g ., the in phase and quadrature phase local oscillator components ) can be collectively referred to as a first local oscillator output , which can be coupled to the first local oscillator input of the first mixer . outputs of mixers 114 and 116 can be input into analog filters 124 and 126 , respectively . analog filters 124 and 126 can be implemented with a passive component filter ( e . g ., a filter that uses resistive ( r ) and capacitive ( c ) components to realize a first order filter ), or with a biquad filter ( e . g ., a filter that uses active components to realize a higher order filter ). the purpose of analog filters 124 and 126 is to attenuate interfering signals and noise , such as an adjacent channel or alternate channel signals outside the bandwidth of the filter and to prevent anti - aliasing in analog to digital converters 132 , 134 . in one embodiment a bandwidth on the order of 1 mhz is used for the analog filter . outputs of analog filters 124 and 126 can be input into amplifiers 128 and 130 , respectively . amplifier 128 can boost the signal for analog to digital conversion and provide variable gain to increase the dynamic range of the receiver . in the embodiment shown in fig1 , outputs of amplifiers 128 and 130 can be considered outputs of receiver front end 102 and inputs to receiver back end 104 . as shown in back end 104 , processing of the i and q signal paths continues as the outputs of amplifiers 128 and 130 are input into inputs of analog - to - digital ( a / d ) converters 132 and 134 , respectively . in one embodiment , a / d converters 132 and 134 can be implemented with known sigma - delta type converters ( i . e ., σ - adc ). output from each of the a / d converters 132 and 134 is a stream of digital data , or symbols , corresponding to the analog waveform output by amplifiers 128 and 130 . the digital output of a / d converters 132 and 134 can be input into digital filters 136 and 138 , respectively , in order to further process the i and q quadrature signals . digital filters 136 and 138 can be used to realize additional selectivity to reduce the effects of close - in , interfering adjacent channel signals . as is known , the primary selectivity for the receiver is provided by digital filters 136 , 138 . in one embodiment , these filters have a bandwidth on the order of 200 khz . outputs of digital filters 136 and 138 can be selectively input into digital mixer 140 , which can be used in conjunction with digital local oscillator 142 to digitally shift the frequency of a very low intermediate frequency ( vlif ) signal to produce a digital baseband signal , and to remove an image signal , using known digital mixer techniques . note that digital mixer 140 can be referred to as a second mixer for performing a second mixer function using a signal from a second local oscillator . the difficulty in rejecting the image signal depends upon an amplitude and phase imbalance between the i and q signals , where a lower imbalance produces a greater image rejection . for example , a second generation ( i . e ., 2g ) gsm receiver with an if frequency of 130 khz requires an image rejection of 45 db to meet the adjacent channel ( or alternate channel ) selectivity specification . this specification translates into very stringent amplitude and phase imbalance requirements for the i and q signals , i . e ., stringent imbalance requirements for the first mixer and digital mixers . maintaining a low amplitude and phase imbalance is difficult in a vlif receiver , especially over the specified temperature range . to maintain a low amplitude and phase imbalance , receivers can use calibration techniques and circuitry , which can require additional time , power , integrated circuit die area , software , and complexity . outputs of digital mixer 140 can be coupled to inputs of digital filters 144 and 146 , respectively , to perform further filtering of the i and q quadrature signals . digital filter 144 can include output 148 for outputting digital data from the i signal path of receiver 100 . similarly , digital filter 146 can include output 150 for outputting digital data from the q signal path . in order to improve the performance of receiver 100 , controller 152 can selectively and automatically configure receiver 100 to operate in two or more modes to receive a selected rf channel . in one embodiment , these multiple modes can include modes using different intermediate frequencies to receive information on the same selected rf channel or the same selected signal , wherein one of the intermediate frequencies can include a zero intermediate frequency . for example , receiver 100 can be configured to operate in a very low intermediate frequency ( vlif ) mode , and in a zero intermediate frequency ( zif ) mode . to change the configuration of receiver 100 , controller 152 can send signals to front end 102 and to back end 104 to change the operation of each in response to a performance metric in the receiver . for example , to operate in the zif mode , controller 152 can configure front end 102 so that a front end local oscillator ( e . g ., local oscillator 118 in cooperation with phase locked loop 120 ) is set to operate at the carrier frequency of a desired radio frequency signal received at antenna 106 , and set back end 104 to bypass , or bypass the function of , digital mixer 140 . with regard to operating in the vlif mode , controller 152 can configure the front end local oscillator ( e . g ., lo 118 and pll 120 ) to operate at a frequency that produces an analog signal having a very low intermediate frequency at the output of mixers 114 and 116 , and configure back end 104 to enable the operation of digital mixer 140 with an lo signal of an appropriate frequency from digital local oscillator 142 . in one embodiment of a zif mode operation , bypassing digital mixer 140 can be implemented by closing bypass switches 154 and 156 to provide a signal path around digital mixer 140 ( i . e ., to provide a switched second mixer bypass signal path ). in another embodiment , bypassing digital mixer 140 can be implemented by bypassing the function of digital mixer 140 by setting digital local oscillator 142 to a zero frequency to multiply the signals input to digital mixer 140 by a constant ( e . g ., the lo outputs all zeros ). digital lo 142 can be set to a zero frequency output by sending a signal from controller 152 to zero frequency function 166 , which function can contain circuits , or software code , or both ( depending upon whether digital lo 142 is implemented with logic circuits , or software , or both ) to set lo 142 to a frequency of zero . when digital lo 142 is set to zero frequency , the i and q signals can be passed through the digital mixer without modification . in yet another embodiment , bypassing the function of digital mixer 140 can be implemented with software code that bypasses , or jumps around , the code or instructions written to perform the function of digital mixer 140 . bypassing , or not bypassing , digital mixer 140 can also be referred to as disabling or enabling digital mixer 140 , respectively . memory 158 can be coupled to controller 152 for storing various data variables , data regarding historical receiver operation , data constants , data tables , code or microcode for implementing functions and / or algorithms , and the like . for example , memory 158 can be used to store threshold values for one or more metrics of receiver 100 that can be used in selecting a mode of operation of receiver 100 . memory 158 can be used to store microcode for executing an algorithm , or method that can be used to select and configure a mode of operation of receiver 100 . metric monitor 160 can be coupled to controller 152 for determining and providing data corresponding to one or more metrics that can be used by controller 152 to select a mode of operation of receiver 100 . metric monitor 160 can input data from various parts of receiver 100 , as illustrated in fig1 by dashed lines showing signal inputs at 162 and 164 . as shown at inputs 162 , analog i and q signals from the outputs of amplifiers 128 and 130 can be input into metric monitor 160 . at inputs 164 , digital i and q signals can be input into metric monitor 160 . with reference to fig3 , there is depicted a more detailed diagram of metric monitor 160 in accordance with one or more embodiments . as shown , metric monitor 160 can receive one or more signals , or sets of signals ( e . g ., an i and q signal set at inputs 302 and 304 , and possibly and additional i and q signal set at inputs 312 and 314 ). results of various measurements and calculations within metric monitor 160 can be reported to controller 152 through output 306 . in various embodiments , metric monitor 160 can monitor one metric , or more than one metric , wherein the metrics can be based upon analog inputs , digital inputs , or both . thus , in the example embodiment shown in fig1 , metric monitor 160 has inputs ( e . g ., inputs 302 and 304 in fig3 ) that receive analog signals from an analog portion of receiver 100 to monitor a first metric , and additional inputs ( e . g ., inputs 312 and 314 ) for receiving digital inputs from a digital portion of the receiver to monitor a second metric . thus , receiver metrics can be measured and / or calculated values that correspond to a characteristic of receiver operation or performance . in another embodiment , a receiver metric can be based upon a history of a metric , or upon statistical or other processing of a history of a metric . as shown in fig3 , metric monitor 160 can include received signal strength indication ( rssi ) detector 308 and adjacent channel detector 310 . rssi detector 308 , in one embodiment , can use digital signals ( e . g ., inputs 164 in fig1 ) input at 302 and 304 to monitor an rssi metric , which is a measurement of the power present in a received signal , i . e ., the on channel or desired signal or selected signal . in an embodiment of adjacent channel detector 310 , analog signals ( e . g ., inputs 162 in fig1 ) input at 302 and 304 ( or alternatively at 312 and 314 ) can be used to determine the presence of an adjacent channel transmission . alternatively , the outputs from adc 132 , 134 can be used as the inputs 302 , 304 to the adjacent channel detector . determining the presence of an adjacent channel transmission can include determining the presence of a transmission ( or energy ) on an immediately adjacent channel ( i . e ., a contiguous channel ), or determining the presence of a transmission on an alternate channel ( a noncontiguous , nearby channel ). in yet another embodiment , adjacent channel detector 310 can be used to detect a transmission or energy on any other channel ( i . e ., off - channel energy ) in the band that can reduce the performance of receiver 100 . the channel selected for monitoring in adjacent channel detector 310 can vary depending upon the intermediate frequency selected in the vlif mode . for example , when an intermediate frequency of 130 khz is selected , an rf transmission on a channel 400 khz away can impact receiver performance . in an embodiment that monitors an adjacent channel metric , receiver 100 performance can be increased by operating in a zif mode when an adjacent channel transmission is present . adjacent channel detector 310 can use a wideband detector to detect adjacent channel transmissions during an idle time slot . in some embodiments , adjacent channel detector 310 can use discrete fourier transform techniques to quantify transmitted or detected energy in various portions of the radio frequency band , wherein energy is quantified in “ bins .” when this technique is used , adjacent channel detector 310 can check for interfering out - of - channel energy by examining bin data corresponding to frequencies that can interfere with the selected signal frequency in receiver 100 . in another embodiment that monitors an rssi metric as an input to control the receiver mode , receiver performance can be increased by configuring receiver 100 to operate in the zif mode when the rssi value is above a threshold , or otherwise satisfies a threshold . the threshold , in one embodiment , can be set at − 90 dbm . in some receivers , the zif mode can have an advantage over the vlif mode because it avoids the difficulties in meeting the stringent image rejection requirement in the gsm specification . in operation , an rssi level can be calculated in metric monitor 160 and reported to controller 152 at the beginning of a received slot using a gsm receiver sequence ( grs ) command that provides information about setting the frequency of the lo . in an embodiment of receiver 100 that uses frequency hopping , data provided by metric monitor 160 can be stored as historical data in memory 158 , where such data can be used to calculate or produce a metric based upon statistical analysis or data history . such metrics based upon historical data can be used to predict an adjacent channel transmission metric based on prior metrics indicating which channel had an adjacent channel present and knowledge of the hopping sequence . thus , an adjacent channel metric can be predicted for the next time that channel is selected again . referring now to fig2 , there is depicted a high - level flowchart of one or more processes that can be implemented in receiver 100 in accordance with one or more embodiments . as shown , the process begins at 202 , and thereafter continues at 204 wherein the process determines values for monitored metrics . such monitored metrics can be measured and / or calculated values that correspond to a characteristic of receiver operation or performance . in one embodiment , rssi can be a monitored metric , wherein the rssi can be produced in rssi detector 308 ( see fig3 ) in metric monitor 160 ( see fig1 ). the rssi metric can be represented as a power level measured in dbm , which is passed to controller 152 . in another embodiment , the presence of an adjacent channel transmission can be a monitored metric , wherein the presence or absence of the adjacent channel transmission can be represented as a boolean value . the presence or absence of an adjacent channel can be determined by adjacent channel detector 310 in metric monitor 160 using a wideband detector during an idle time slot . in embodiments that monitor more than one metric , both rssi and the presence of an adjacent channel transmission can be monitored metrics . in embodiments that use frequency hopping in receiver 100 , metrics can be based upon a history of previously measured metrics . next , the process determines whether the rssi is greater than , or otherwise satisfies , an rssi threshold ( e . g ., − 90 dbm ), as illustrated at 206 . if rssi is not greater than the rssi threshold , the process configures the receiver to operate in the vlif mode , as depicted at 210 , thereby avoiding problems associated with zif operating modes at low signal level . receiver 100 can be configured to operate in the vlif mode by setting the lo of front end 102 ( e . g ., the first lo , which includes oscillator 118 and pll 120 ) to operate at a frequency that is slightly lower than the carrier frequency by a difference equal to the intermediate frequency . in one embodiment the intermediate frequency can be 130 khz . additionally , digital local oscillator 142 ( e . g ., the second lo ) can be set to operate at the intermediate frequency ( e . g ., 130 khz in this example ) so that the function of digital mixer 140 is enabled , or not bypassed ( i . e ., bypass switches 154 and 156 are set open ). in an embodiment that monitors only one metric ( e . g ., rssi ) and if the rssi is greater than the rssi threshold at 206 , the process can skip step 208 and configure the receiver to operate in the zif mode , as illustrated at 212 . receiver 100 can be configured to operate in the zif mode by setting the lo of front end 102 ( e . g ., the first lo ) equal to the carrier frequency , and by setting digital local oscillator 142 ( e . g ., the second lo ) to a zero frequency ( e . g ., a constant zero output ). digital lo 142 can be set to a zero frequency output by sending a signal from controller 152 to zero frequency function 166 , which function can contain circuits or software code ( depending upon whether digital lo 142 is implemented with logic circuits , or software , or both ) to set lo 142 to a frequency of zero . by setting digital lo 142 to a zero frequency , the function of digital mixer 140 is disabled , or bypassed , because the i and q signals are passed through digital mixer 140 without modification . alternatively , digital mixer 140 can be bypassed by closing bypass switches 154 and 156 to provide an i and q signal path around the function of digital mixer 140 . in another embodiment that monitors two metrics , following the comparison at 206 the process can determine whether an adjacent channel transmission is present ( e . g ., determine whether a blocker signal level exceeds a blocker threshold ), as depicted with dashed lines at 208 . if the process determines that an adjacent channel transmission is not present , the process can configure the receiver to operate in the vlif mode , as indicated by the “ no ” branch from 208 to 210 . the process of configuring receiver 100 to operate in the vlif mode is described above with reference to step 210 . alternatively , if the process determines that an adjacent channel transmission is present at 208 , the process can configure the receiver to operate in the zif mode , as shown by the “ yes ” branch from 208 to 212 . the process of configuring receiver 100 to operate in the zif mode is described above with reference to step 212 . in one embodiment , a mode of operation of receiver 100 can be determined according to the conditions and required performance values contained in table 1 . in table 1 , column 1 indicates the frequency proximity of a blocker signal ( e . g ., a frequency proximity to the desired channel that can be examined by adjacent channel detector 310 ), column 2 indicates the blocker signal power level ; column 3 indicates the desired signal level of the output of receiver 100 at the conditions set forth in columns 1 and 2 . column 4 can indicate the receiver mode that can be used to achieve the desired signal level performance shown in column 3 . as shown in fig2 , after the operating mode of receiver 100 is configured , the process can iteratively return to 204 wherein the values for monitored metrics can be once again determined . in one embodiment , the values for monitored metrics are determined at the beginning of a receive time slot in order to properly configure the receiver for receiving data in the next time slot . thus , the process shown in fig2 can be iteratively repeated during operation of the receiver in order to automatically improve receiver operation by selecting one of a plurality of modes of operation to receive a selected rf signal . although the invention is described herein with reference to specific embodiments , various modifications and changes can be made without departing from the scope of the present invention as set forth in the claims below . for example , while the techniques and apparatus for automatically selecting a receiver operation mode may vary widely , one or more embodiments can be used in a wireless telecommunications system , or a cable system for distributing rf signals , or the like . accordingly , the specification and figures are to be regarded in an illustrative rather than a restrictive sense , and all such modifications are intended to be included within the scope of the present invention . any benefits , advantages , or solutions to problems that are described herein with regard to specific embodiments are not intended to be construed as a critical , required , or an essential feature or element of any or all the claims . unless stated otherwise , terms such as “ first ” and “ second ” are used to arbitrarily distinguish between the elements such terms describe . thus , these terms are not necessarily intended to indicate temporal or other prioritization of such elements .	7
the systems disclosed herein use a single gate to guide a paper article through a sheet conveying system into one of at least three different pathways . as used herein , the phrase “ sheet conveying device ” encompasses any apparatus , such as a digital copier , a bookmaking machine , a facsimile machine , and a multi - function machine , which performs an outputting function for any purpose . the sheet conveying device includes printing and nonprinting devices . examples of marking technologies include xerographic , inkjet , and offset marking . as used herein , the phrase “ sheet ” encompasses , for example , one or more of a usually flimsy physical sheet of paper , heavy media paper , coated papers , transparencies , parchment , film , fabric , plastic , or other suitable physical print media substrate on which information can be reproduced . as used herein , the phrase “ path ” or “ pathway ” encompasses any apparatus for separating and / or conveying one or more sheets into a substrate conveyance path inside a printing device . as used herein the phrase “ baffle ” refers to a device configured to guide a substrate , such as a sheet , along a path . the baffle used herein includes moving baffles and non moving baffles . the moving baffles may be independently pivotable or connected to and pivotable with the gate . additionally , it is contemplated that the baffle could be a non moving part that guides the sheet into the intended path , or pathway formed by members . the baffle could be made of plates , flexible or non flexible extensions , stand alone protrusions or knobs , wires , plastic moldings and any other devices that are configured to guide a substrate . fig1 provides a three - way gate system 10 for diverting or guiding a sheet 2 into one of three pathways 12 ( 12 a , 12 b , 12 c ) in a sheet conveying device 1 . a sheet 2 is fed from rolls 3 towards the gate plate 14 along the path direction d . the gate plate 14 is rotatable about a single gate plate axis 16 . the gate plate 14 is an elongated planar plate with a first surface 13 and a second surface 15 . the gate plate 14 rotates to align one of its surfaces ( 13 , 15 ) with one of the three pathways 12 . the sheet 2 is moved by the rolls 3 onto and across the gate plate 14 in the direction of d . the sheet is guided by the gate plate 14 into the aligned pathway in the path direction of x , y or z . fig1 shows the various orientations of gate plate 14 to direct the sheet 2 into one of the three pathways ( 12 a , 12 b , 12 c ). the gate plate 14 has a rotation angle range e which allows the gate plate 14 to align with any of the three pathways . the gate plate 14 is rotated about the axis 16 to orient the gate plate 14 into position a . position a of the gate plate 14 directs or guides the sheet 2 along the first surface 13 of the gate plate 14 and into the first pathway 12 a in the direction of x . similarly , gate plate 14 is rotated about the axis 16 to orient the gate plate 14 into position b . position b of the gate plate 14 directs or guides the sheet 2 along the first surface 13 of the gate plate 14 and into the second pathway 12 b in the direction of y . further , when gate plate 14 is rotated about the axis 16 to orient the gate plate 14 into position c , position c of the gate plate 14 directs or guides the sheet 2 along the second surface 15 of the gate plate 14 and into the third pathway 12 c in the direction of z . the actuation of the gate plate 14 about the axis 16 may be achieved by a motor , such as a stepper motor . fig2 provides a three - way gate system 20 for diverting or guiding a sheet 2 into one of three pathways 22 ( 22 a , 22 b , 22 c ) in a sheet conveying device 1 . the three - way gate system 20 is similar to the three - way gate system 10 including a gate plate 14 . the three - way gate system 20 includes a gate plate 24 and a hinged baffle 28 . the hinged baffle 28 is positioned at the first surface 23 side of the gate plate 24 . various baffle designs are available to provide the spacing as required herein . fig2 shows the hinged baffle 28 has an l - shaped bar , rod or plate including an elongated portion 28 a and a shorter portion 28 b extending perpendicularly from the elongated portion 28 a . the hinged baffle 28 includes a first surface 30 and a second surface 32 . fig2 shows a protrusion 29 extends from the second surface 32 of the elongated portion 28 a in the opposing direction from the shorter portion 28 b . the hinged baffle 28 prevents a severely curled sheet intended to enter into the middle pathway 22 b from diverting into the pathway 22 a . additionally , the hinged baffle 28 prevents paper jamming that may occur if the paper is caught between the two pathways ( 22 a , 22 b ). the hinged baffle 28 is rotatable about a baffle axis 34 . the hinged baffle 28 has a rotation angle range f which allows the hinged baffle 28 to move from the first pathway 22 a to the second pathway 22 b . the hinged baffle 28 is limited in rotation due to the stop 36 located at the far end of the hinged baffle 28 at the opposite end of the protrusion 29 . the stop 36 limits the rotation of the protrusion 29 end of the hinged baffle 28 towards the gate plate 24 . the hinged baffle 28 is directed to rotate the angle f by contact with the gate plate 24 , as the gate plate 24 guides the hinged baffle 28 to the first pathway 22 a or the second pathway 22 b , and the stop 36 limits the movement towards the gate plate 24 . the limited range of movement of the hinged baffle 28 prevents the hinged baffle 28 from interfering with the gate plate 24 , or jamming the gate plate 24 . the contact of the hinged baffle 28 with the gate plate 24 is maintained by a torsion spring or by the hinged baffle &# 39 ; s weight with gravity acting downward in the configuration as shown in fig2 . the torsion spring may be installed around the center of the baffle axis 34 . fig2 shows the sheet 2 is fed from rolls 3 towards the gate plate 24 along the path direction d . the gate plate 24 is rotatable about a single gate plate axis 26 . the gate plate 24 is an elongated planar plate with a first surface 23 and a second surface 25 . the gate plate 24 rotates to align one of its surfaces ( 23 , 25 ) with one of the three pathways 22 . the sheet 2 is moved by the rolls 3 onto and across the gate plate 24 in the direction of d . the sheet is guided by the gate plate 24 into the aligned pathway in the path direction of x , y or z . fig2 shows the various orientations of gate plate 24 to direct the sheet 2 into one of the three pathways ( 22 a , 22 b , 22 c ). the gate plate 24 has a rotation angle range e which allows the gate plate 24 to align with any of the three pathways . the gate plate 24 is rotated about the axis 26 to orient the gate plate 24 in alignment with first pathway 22 a . the hinged baffle 28 contacts the first surface 23 of the gate plate 24 . the sheet 2 slides between the first surface 23 and the hinged baffle 28 and the sheet is guided into the first pathway 22 a in the direction of x . similarly , gate plate 24 is rotated about the axis 26 to orient the gate plate 24 in alignment with second pathway 22 b . the hinged baffle 28 contacts the first surface 23 of the gate plate 24 . the sheet 2 slides between the first surface 23 and the hinged baffle 28 and the sheet is guided into the second pathway 22 b in the direction of y . further , when gate plate 24 is rotated about the axis 26 to orient the gate plate 24 in alignment with third pathway 22 c , the gate plate 24 directs or guides the sheet 2 along the second surface 25 of the gate plate 24 and into the third pathway 22 c in the direction of z . the actuation of the gate plate 24 about the axis 26 may be achieved by a motor , such as a stepper motor . fig3 provides a four - way gate system 40 that is similar to the three - way gate system 20 of fig2 including a gate plate and hinged baffle . the four - way gate system 40 is used for directing or guiding a sheet article to one of the four pathways 45 ( 45 a , 45 b , 45 c , 45 d ). the four - way gate system 40 includes a gate plate 42 sandwiched between two hinged baffles 44 , 46 . the gate plate 42 has a rotation angle range g which allows the gate plate to move in alignment with the four pathways 45 . the hinged baffles 44 , 46 include first hinged baffle 44 and second hinged baffle 46 . the hinged baffles 44 , 46 are similar to the hinged baffle 28 of fig2 . the hinged baffles 44 , 46 are rotatable about baffle axes 48 , 50 , respectively . various baffle designs are available to provide the spacing as required herein . fig3 shows each hinged baffle 44 , 46 as having an l - shaped bar , rod or plate including an elongated portion 44 a , 46 a and a shorter portion 44 b , 46 b extending perpendicularly from the elongated portion 44 a and 46 a . the hinged baffles 44 , 46 include a first surface and a second surface with a protrusion 52 , 54 respectively , extending from each surface of the elongated portion in the opposing direction from the shorter portion . the first hinged baffle 44 is limited in rotation due to the stop 56 located at the far end of the first hinged baffle 44 at the opposite end of the protrusion 52 . the first hinged baffle 44 has a rotation angle range h which allows for movement and alignment between the first pathway 45 a and the second pathway 45 b . the first hinged baffle 44 is positioned at the first surface 41 side of the gate plate 42 . the first hinged baffle 44 prevents a severely curled sheet intended to enter into the second pathway 45 b from diverting into the first pathway 45 a . additionally , the hinged top baffle 44 prevents paper jamming that may occur if the paper is caught between the two pathways ( 45 a , 45 b ). the stop 56 limits the rotation of the protrusion 52 end of the first hinged baffle 44 towards the gate plate 42 . the first hinged baffle 44 is directed to move between the first pathway 45 a and the second pathway 45 b by contact with the gate plate 42 . the limited range of movement of the first hinged baffle 44 prevents the hinged top baffle 44 from interfering with the gate plate 42 , or jamming the system . the contact of the first hinged baffle 44 with the gate plate 42 is maintained by a torsion spring or by the first hinged baffle &# 39 ; s weight with gravity acting downward in the configuration as shown in fig3 . the torsion spring may be installed around the center of the baffle axis 48 . the second hinged baffle 46 is positioned at the second surface 43 side of the gate plate 42 . the second hinged baffle 46 prevents a severely curled sheet intended to enter into the third pathway 45 c from diverting into the fourth pathway 45 d . additionally , the second hinged baffle 46 prevents paper jamming that may occur if the paper is caught between the two pathways ( 45 c , 45 d ). the stop 57 limits the rotation of the protrusion 54 end of the second hinged baffle 46 towards the gate plate 42 . the second hinged baffle 46 is directed to move between the third pathway 45 c and the fourth pathway 45 d by contact with the gate plate 42 . the contact of the second hinged baffle 46 with the gate plate 42 is maintained by the gate plate 42 pushing on the second hinged baffle 46 and a torsion spring assembly setting the second hinged baffle 46 to be positioned at the resting state of alignment with the third pathway 45 c . force is required to move the second hinged baffle 46 against the force of the spring to the location of the fourth pathway 45 d . the torsion spring may be installed around the center of the baffle axis 50 . the second hinged baffle 46 has rotation angle range i which allows for alignment between the third pathway 45 c and the fourth pathway 45 d . fig3 shows the sheet 2 is fed from rolls 3 towards the gate plate 42 along the path direction d . the gate plate 42 is rotatable about a single gate plate axis 47 . the gate plate 42 is an elongated planar plate with a first surface 41 and a second surface 43 . the gate plate 42 rotates to align one of its surfaces ( 41 , 43 ) with one of the four pathways 45 . the sheet 2 is moved by the rolls 3 onto and across the gate plate 42 in the direction of d . the sheet is guided by the gate plate 42 into the aligned pathway . fig3 shows the various orientations of gate plate 42 to direct the sheet 2 into one of the four pathways ( 45 a , 45 b , 45 c , and 45 d ). the gate plate 42 has a rotation angle range g which allows the gate plate 42 to align with any of the four pathways . for example , the gate plate 42 is rotated about the axis 47 to orient the gate plate 45 in alignment with first pathway 45 a . the first hinged baffle 44 contacts the first surface 41 of the gate plate 42 . the sheet 2 slides between the first surface 41 and the first hinged baffle 44 and the sheet is guided into the first pathway 45 a . similarly , gate plate 42 is rotated about the axis 47 to orient the gate plate 42 in alignment with second pathway 45 b . the first hinged baffle 44 contacts the first surface 41 of the gate plate 42 . the sheet 2 slides between the first surface 41 and the first hinged baffle 44 and the sheet is guided into the second pathway 22 b . further , when gate plate 42 is rotated about the axis 47 to orient the gate plate 42 in alignment with the third pathway 45 c , the second hinged baffle 46 contacts the second surface 43 of the gate plate 42 . the gate plate 42 and second hinged baffle 46 directs or guides the sheet 2 along the second surface 43 of the gate plate 42 and into the third pathway 45 c . furthermore , when gate plate 42 is rotated about the axis 47 to orient the gate plate 42 in alignment with the fourth pathway 45 d , the second hinged baffle 46 contacts the second surface 43 of the gate plate 42 . the gate plate 42 and second hinged baffle 46 directs or guides the sheet 2 along the second surface 43 of the gate plate 42 and into the fourth pathway 45 d . the actuation of the gate plate 42 about the axis 47 may be achieved by a motor , such as a stepper motor . having described the aspects herein , it should now be appreciated that variations may be made thereto without departing from the contemplated scope . accordingly , the aspects described herein are deemed illustrative rather than limiting , the true scope is set forth in the claims appended hereto .	1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.