text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
fig1 shows a perspective of an embodiment of the extended table tennis playing surface apparatus . fig2 shows a longitudinal view of the apparatus shown in fig1 . horizontal section 101 is comparable to a standard table tennis playing surface . curved sections 102 are provided across from each other on opposite sides of the horizontal section 101 . fig1 and 2 show an embodiment of the curved section 102 for extending the table tennis playing surface 101 . curved section 102 has a predetermined length , in this case a length chosen to be less than the length of the horizontal section 101 . the first edge 108 and the second edge 109 of the curved section are both perpendicular to said central axis . the third edge 106 and the fourth edge 107 are equal to said predetermined length , and both parallel to said central axis . the interior surface of said concave curved section is designed to rebound a table tennis ball . a second surface on the exterior of said concave curved section is present . the third edge is configured to attach to a side edge of said standard table tennis playing surface and said first surface is configured to extend the horizontal playing surface . the third edge 106 illustrates the line of contact between horizontal section 101 and curved sections 102 . the surface at the third edge 106 is smooth and forms a continuous uniform transition from the playing surface of horizontal section 101 to curved sections 102 . flat / planar sidewalls 103 have a joining edge 107 provided at the fourth edge 107 to respectively provide extensions of the playing surface of each curved section 102 . the transitions at 107 are again smooth and continuous to provide a uniform playing surface extending from the playing surface of horizontal potion 101 through curved sections 102 to sidewalls 103 . it is important to note that curved section 102 with an attached side wall extension 103 can be made of a single material and then provided to the horizontal section 101 , as is the case in fig1 and 2 . as such , a physical “ edge ” would not exist since curved section 102 and sidewall 103 would be formed from the same material , and instead fourth edge 107 would merely be an illustrative line signaling the end of the curved section and the beginning of the flat sidewall section 103 . likewise , horizontal section 101 and curved section 102 can also be made of a single material and therefore third edge 106 is not a physical “ edge ” but merely be an illustrative line signaling the end of the horizontal section 101 and start of the curved section 102 . one skilled in the art can appreciate that alternative embodiments may require abrupt and discontinuous transitions at line of contact 106 and 107 , and that the texture of the playing surface and rebounding properties of each of horizontal section 101 , curved sections 102 and sidewalls 103 may be altered , changed and different from each other to enhance a player &# 39 ; s experience . a net 104 is provided , as is customary with games associated with the playing surface of horizontal section 101 . net 104 is provided to be midway and perpendicular to the length of horizontal section 101 . the net 104 can be attached to the curved sections 102 at points 105 . the net 104 can be directly attached mechanically , attached via an adhesive or an opening through curved sections 102 can be provided at 105 so that part of net 104 can be drawn through and secured on the opposite / exterior sides of curved sections 102 . players at opposite ends of horizontal section 101 , facing each other in parallel with curved sections 102 and sidewalls 103 can use the entire extended playing surface of the curved sections 102 and sidewalls 103 to enhance game play . combinations of shots from horizontal section 101 bouncing to curved sections 102 or sidewalls 103 over the net 104 to the opposite side of horizontal section 101 , or a bounce directly from side walls 103 to horizontal section 101 and limitless combinations thereof allow for faster ball movement , longer rallies , more intense reactions and faster reflex responses . paradoxically this enhanced game of table tennis may become easier and more fun for some younger or unskilled players . playing off the extend playing surface created by the additions of curved section 102 and sidewalls 102 may increase the average volley time as well as make it easier to keep the ball movement on the playing surface as opposed to the regular game of table tennis . one can also appreciate that instead of a right angle being formed at the third edge 106 , the curved section 102 ensures there is always an angled vertical bounce from the playing surface of curved section 102 , whereas a fully right angle formed by 2 flat playing surfaces at 106 would produce no bounce at all or a bounce that would not provide enough vertical velocity to allow game play to continue . in a preferred embodiment , curved sections 102 and sidewalls 103 are the same length as each other , form symmetrical surfaces on each side of horizontal section 101 and do not extend the entire length of horizontal section 101 . however , in alternative embodiments the length of curved sections 102 can be different from each other , and different from the lengths of sidewalls 103 . in addition , the lengths of the curved sections 102 and sidewalls 103 may be much shorter than , the same , or longer than the length of the horizontal section 101 . in the preferred embodiment , the lengths of the curved sections and sidewalls are selected to be less than the entire length of the horizontal section 101 in order to create a corner bouncing space of game play wherein shots , angled at a corner of the horizontal section 101 , can send a ball outside of the playing surface area . in particular , the angled shots cause a ball to bounce beyond the width of the horizontal section 101 and laterally behind the sidewalls 103 . as a result , these angled shots can only be returned by carefully angling a return volley at the respective far corner of horizontal section 101 , but preferably at the playing surfaces of opposite sidewall 103 or opposite curved section 102 . alternatively , a volley can be returned by sending a ball over sidewall 103 and down into the horizontal playing surface on horizontal section 101 . the exterior second playing surface of sidewall 103 and exterior second playing surface of curved section 102 partially block all of the above return shots and as a result the difficulty , excitement and fun of the game is increased when the length of said curved sections and sidewalls is selected to be less than the entire length of horizontal section 101 . description of the geometric structure of the curved sections 102 of the extended playing surface apparatus will now be described . the natural shape of the curved sections 102 is that of an elliptical arc . an ellipse being governed by the cartesian equation : where x and y stand for the x - axis and y - axis respectively of the cartesian coordinate system . although there are numerous other mathematical coordinate systems and methods for describing and forming ellipses , the above cartesian method will be used for exemplary purposes . other methods may be used to accomplish the same ellipse structure without detracting from the disclosed invention herein . in the present invention , let “ a ” be one of two radii of an ellipse and “ b ” be the other radii . as shown in fig3 , an ellipse is constructed from radius “ a ” and radius “ b ”, wherein radius “ b ” corresponds to the y - axis and radius “ a ” corresponds to the x - axis , the arrow of 360 ° indicates the counter clockwise direction in which degrees are customarily calculated in coordinate geometry . in coordinate geometry , the degrees are typically calculated starting at the positive x - axis at 0 ° and rotating left until the x - axis is reached , which encompasses a full 360 ° rotation . in the present invention , the size and curvature of a desired curved section of the table extending apparatus can be achieved by appropriately selecting radius “ a ” and radius “ b ”. further , after radii “ a ” and “ b ” are selected and an ellipse created as defined by the cartesian equation , a section of that ellipse is selected . from the origin of the ellipse , one can select the section desired by defining a degree range encompassing the desired section . for example , using coordinate geometry wherein the degrees are calculated counter clockwise fashion starting at 0 ° for the positive x - axis , 90 ° for the positive y - axis , 180 ° for the negative x - axis , and 270 ° for the negative y - axis , we can define the desired section of the ellipse . for example , fig4 is an ellipse with radius “ a ”& lt ; radius “ b ” and a shaded region to indicate 270 ° to 0 °. in this example , the shaded region is the desired shape of the curved section of the table tennis apparatus , which specifically is a 90 ° range . it is readily apparent that by appropriately selecting radius “ a ”, radius “ b ” and a degree range , any desired elliptical arc can be constructed for the curved section of the table tennis apparatus . expanding on this ellipse , if we take the ellipse created by choosing radii “ a ” and “ b ” and then use said ellipse as a base for a cylinder with length “ l ” we now have an elliptical cylinder , as shown in fig5 . if we take the desired degree range of a curve of the ellipse as before , we now have a curved playing surface of a desired length which in this case would be the length “ l ” of the elliptical cylinder . fig5 is a perspective view of a hollow elliptical cylinder with a central axis 502 for the exemplary showing of how the curved sections 102 of the table tennis apparatus are structured . as can be seen in fig1 and 2 as well as other figures , the curved sections 102 are 3 - dimensional objects and it naturally follows that the curved sections 102 can be described as sections of an elliptical cylinder . in fig5 , the exemplary elliptical cylinder has been selected so that radius “ a ” is equal to radius “ b ”; however the disclosed apparatus can also encompass radius “ a ”& lt ; or & gt ; radius “ b ”. the hollow cylinder of fig5 shown with perspective has a surface thickness t , length l , horizontal radius “ a ” and vertical radius “ b ”. accordingly , the horizontal diameter is 2a = a and the vertical diameter is 2b = b . the material of cylinder 501 is chosen to have the desired rebounding and transparency properties on the inside of the cylinder 501 . a cross sectional view of cylinder 501 is presented in fig6 . after radii “ a ” and “ b ” are selected , angles θ 1 and θ 2 are then chosen and in a preferred embodiment radii “ a ” and “ b ” are equal and angles θ 1 and θ 2 are symmetrical . from the center of the cylinder , angles θ 1 and θ 2 may comprise any angle from 0 ° to 360 °. fig6 is a longitudinal view of the exemplary cylinder of fig5 with angles θ 1 and θ 2 both equal to each other and less than 90 °. the shaded regions created by angles θ 1 and θ 2 respectively are the shapes of the elliptical cylinder , which create the curved sections 102 of a table tennis apparatus . in a preferred embodiment , there are two curved sections 102 , one for each side of the horizontal section of a table tennis surface and accordingly each shaded region created by angles θ 1 and θ 2 is a curved section to be placed on opposing sides of the horizontal table tennis surface . alternatively , fig7 is longitudinal view of the exemplary cylinder of fig5 with angles θ 1 and θ 2 each equal to 90 °, where radius “ a ”= radius “ b ” and accordingly each shaded region created by angles θ 1 and θ 2 are each a curved section to be placed on opposing sides of a horizontal table tennis surface . fig8 is longitudinal view of the exemplary cylinder of fig5 with angles θ 1 and θ 2 each greater than 90 ° and radius “ a ”= radius “ b ”, and accordingly , the shaded regions created by angles θ 1 and θ 2 are each a curved section to be placed on opposing sides of a horizontal table tennis surface . fig1 and 2 show leg support structure 201 , 301 and 302 . leg support structure 201 could comprise any vertical support structure to elevate a horizontal surface 101 for table tennis . leg support structure 301 may comprise one or more vertical supports to elevate the curved section 102 to the same height as that of horizontal surface 101 with the concept that the table tennis surface and curved section form a smooth continuous playing surface . leg support structures 302 can be provided angled outwards away from the horizontal surface 101 to provide a combination of horizontal and vertical support to curved sections 102 and sidewalls 103 . the leg structure 302 in particular could be useful for preventing the curved section 102 and sidewalls 103 from tipping away from the horizontal surface 101 , especially if the height of the sidewall 103 becomes large and top heavy . various combinations of support structures are known in the art of table tennis , which can be used and provided in the extended playing surface apparatus disclosed herein to accomplish sufficient support for the combination of a horizontal surface 101 , curved surface 102 and sidewall surface 103 . fig9 a and 9 b are perspective views of a preferred embodiment of an extended playing surface apparatus configuration . in fig9 a and 9 b the playing surface of horizontal section 101 is extended by a total of 4 apparatuses each having a curved section 102 , a sidewall 103 , vertical supports 301 and angled supports 302 . the four apparatuses are arranged symmetrically on each side of the horizontal section 101 and on each side of the net 104 . put in other words the four apparatuses would be mirror images of each other on each side of the horizontal section 101 and net 104 . in this preferred embodiment , the texture and rebounding properties of the playing surfaces of horizontal section 101 , curved sections 102 and sidewalls 103 are substantially uniform . the preferred dimensions of the horizontal section 101 are a width of 5 feet , length of 9 feet and a height of two feet and six inches from the ground ( i . e . the standard for table tennis ). the curved sections 102 would form together to have a combined length of 6 feet on each side of the horizontal section 101 , the geometric description being an elliptical arc of 90 ° wherein radius “ a ” and “ b ” are six inches . the sidewall 103 is a combined six feet in length on each side of the horizontal section 101 and a width , or as drawn in fig9 a and 9 b , a vertical height of 2 feet . accordingly , the combined height of the curved section 102 and sidewall section 103 from the horizontal section 101 is 2 feet and 6 inches . in this embodiment , the horizontal section 101 could be a standard table tennis table , and each extended playing surface apparatus would be attached at their respective symmetric locations . fig2 is a close up longitudinal view of one of the combined table tennis extension apparatus comprising a curved section 102 , vertical supports 301 , combined horizontal and vertical supports or angled supports 302 and side wall 103 placed up against the side of horizontal section 101 . although the combination of horizontal surface 101 , curved section 102 and sidewall 103 have been discussed to create an extended table tennis playing surface , the extended table tennis apparatus alternatively could merely comprise a curved section 102 created and then provided to a normal table tennis playing surface . depending on the radii “ a ” and “ b ” selected , an entirely curved section 102 without a flat sidewall section 103 could accomplish the goal of extending the table tennis playing surface . radius “ a ” and “ b ” are not limited in size ; however , in a preferred embodiment radius “ a ” and “ b ” are selected to be appropriate in size to the dimensions of a standard table tennis surface . in particular , radius “ a ” and “ b ” are selected to both equal 6 inches in a preferred embodiment . however , alternative embodiments can include radius “ a ”& gt ;& gt ; radius “ b ” or radius “ a ”& lt ;& lt ; radius “ b ”. for example , radius “ a ” may be chosen to equal 6 inches , yet radius “ b ” could be chosen to equal 36 inches . then a desired degree range can be selected and a desired shape of the curved section 102 can be formed . one of ordinary skill in the art would recognize there are limitless combinations of radii and degree ranges to select in order to provide a curved section for the present invention . it should be noted that mathematical description for obtaining the curved sections is for exemplary purposes for understanding the invention and planning the desired curve of the curved section . in practice the desired curve would be established and then efforts would be made to create the desired curved section with or without constructing an entire ellipsoid cylinder . there are numerous methods known of molding and shaping objects into curved surfaces . the present invention would preferably use materials for the curve that comprise rebounding properties similar to a table tennis playing surface i . e . masonite , wood , plywood , plexiglas , glass , a one - way transparent material and even metal . any material that possess the rebounding qualities desired and that can be shaped into the desired curved section may be used . the present invention is not limited to any one particular material . in a preferred embodiment , the curved section would be selected to be a transparent material having rebounding properties similar to a table tennis table . plexiglas is an excellent candidate material for these effects and by selecting the desired thickness and type of plexiglas , the desired transparency and desired rebounding properties can be achieved . like the curved sections 102 , the sidewall extensions 103 can be of any material having desired transparency properties and rebounding properties . the concept of transparent curved and transparent side wall sections is to allow for the inclusion of individuals other than the two or more players facing each other on opposite ends of the playing surface to witness the ball movements and game - play without having to be along the parallel axis of the curved and side wall sections . in an embodiment , the horizontal section , curved section , and side wall extension can all be made from one single piece of material and then molded to take the desired shape , mainly the curved section can be appropriately shaped as described above . in so doing , the need for external supports , that is , a support structure to hold up the curved section and sidewall section would not be needed . standard table tennis table structures would simply hold up the table off the ground and the internal material would maintain it &# 39 ; s shape naturally ; for example , a single molded piece of plexiglas would not need external supports to maintain the apparatus shape . alternative embodiments of the extended table tennis apparatus may comprise a length of the curved sections 102 longer , the same or shorter than the horizontal section , and further comprise various radii combinations and various degree ranges selected . fig1 - 14 show exemplary images of a horizontal section 101 in combination with a curved section 102 and sidewall section 103 , wherein the length of the curved section and sidewall sections have been selected to equal the length of the horizontal section . the curved section in fig1 - 14 has been formed by selecting radius “ a ”= radius “ b ” and the chosen angles to both equal 90 °. fig1 - 17 show exemplary images of a horizontal section 101 in combination with a curved section 102 and sidewall section 103 , wherein the length of the curved section and sidewall sections have been selected to equal the length of the horizontal section . the curved section in fig1 - 17 has been formed by selected radius “ a ”= radius “ b ” and the chosen angles to both be greater than 90 °. fig1 - 20 show exemplary images of a horizontal section 101 in combination with a curved section 102 and sidewall section 103 , wherein the length of the curved section and sidewall sections have been selected to equal the length of the horizontal section . the curved section in fig1 - 20 has been formed by selected radius “ a ”= radius “ b ” and the chosen angles to both be less than 90 °. fig2 is a composite of the longitudinal view and top view of the configurations of fig1 - 20 . in embodiments where the curved section 102 is not made from a single piece of material in connection with the horizontal section 101 , the curved section 102 can be held to the horizontal section 101 through numerous means , such as an adhesive . alternatively , a molded structure could be present on both the horizontal section 101 and the curved section 102 configured to interlock . alternatively , a vice type device designed to run underneath the horizontal section 101 and apply pressure to opposing curved sections 102 thereby holding the curved sections 102 in place could be used . alternatively , the support structure itself with vertical supports 301 and angled supports 302 holding up the curved section could be used to hold the curved section 102 in place against the horizontal section 101 . if wheels are provided on the ends of vertical supports 301 and / or angled supports 302 , the wheels could be locked in place . alternatively , fig2 shows an exemplary extending playing surface apparatus comprising a curved section 102 , a sidewall extension 103 and a male component 111 . in this embodiment , as shown in fig2 , a female component 110 can be attached to the lower side of horizontal section 101 , which can receive and secure the male component 111 of the combined apparatus of curved section 102 and sidewall 103 . in the above embodiments , to further enhance table tennis gameplay , light emitting objects can be adhered to or implanted in the table tennis playing apparatus of the present disclosure , especially when the material chosen is transparent in nature . glow in the dark tape can be adhered as the lines on the table tennis playing surface , curved section , and side wall extensions to mark the boundary of the playing region regardless if the material chosen is transparent or opaque . in addition , the boundaries can be marked by paint or some other form of contrast / color . in the case where the apparatus is made from a transparent material , leds or other light emitting objects can be implanted into or adhered to the material . although the primary object of the present invention is to provide an apparatus for extending the playing surface for the game of table tennis ; applications of the enclosed invention may expand to other racket based games , such as but not limited to , racketball , tennis , etc . various other designs and adaptations can be accomplished without limitations by the disclosure herein . although examples and exemplary embodiments of the invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the disclosure and the accompanying claims . for example , elements and / or features of different examples and illustrative embodiments may be combined with each other and / or substituted for each other within the scope of this disclosure and appended claims . | 8 |
fig1 is a schematic representation of a known display panel . the panel , denoted by the reference numeral 1 , contains a matrix of display elements 3 . conductors x1 , x2 , x3 , x4 . . . xm , collectively referred to herein as x conductors , are respectively connected to all of the elements 3 in the first , second , third , fourth . . . mth rows of the matrix . conductors y1 , y2 , y3 , y4 . . . yn , collectively referred to herein as y conductors , are respectively connected to all of the elements 3 in the first , second , third , fourth . . . nth columns of the matrix . the elements 3 may for instance be electroluminescent phosphor elements , such as elements which are responsive to unidirectional operating voltages , for instance those made from zinc sulphide doped with manganese and copper . electroluminescent phosphor panels made in such a way are described in copending united kingdom patent application nos . 54853 / 72 and 8707 / 73 . the elements 3 may also be , for instance , electrochemicl - luminescent elements , ( so called ) light - emitting diodes , i . e ., semiconductor p - n junctions which emit light when forward biased , miniature plasma discharge elements , liquid crystal elements , electrochromic elements or electrophoretic elements . if they are liquid crystal elements , electrochromic elements or electrophoretic elements they are used to modulate light generated from a separate source ( not shown ). when appropriate voltages are applied between selected x conductors and y conductors the elements 3 at the intersections of those conductors are operated , i . e ., are caused to emit light or modulate light as appropriate , to give a display . alphanumeric characters can conveniently be displayed by operating selected groups of the elements 3 together . one known way of applying the operating voltages is to apply an electrical potential pulse of one polarity to the conductor x1 whilst applying an electrical potential pulse of the opposite polarity to selected y conductors , then to apply an electrical potential pulse of the first polarity to the conductor x2 whilst applying an electrical potential pulse of the opposite polarity to further selected y conductors , and so on . the two kinds of pulses , i . e ., of opposite polarities , have magnitudes such that they are not capable of causing significant operation of the elements 3 alone but are so capable when combined together . the elements 3 may each incorporate a non - linear electrical resistor , or latch , for this purpose . if the voltages are applied in the way described then in order to apply electrical potential pulses to the selected y conductors two particular addressing functions have to be carried out . the first of these functions is to select the appropriate y conductors to which an electrical potential pulse must be applied contemporaneously with the pulse applied to each separate x conductor . the second function is to generate an electrical potential pulse and to gate it to the appropriate y conductors selected as a result of the first function . in general two distinct units are required to carry out the two functions . typically , in known systems , the unit for carrying out the first function is an arrangement of integrated circuit logic elements and the unit for carrying out the second function is a source of electrical energy and an arrangement of electronic switches for periodically connecting the source to the appropriate y conductors , the electronic switches being controlled by the output signals from the logic elements . normally integrated circuit logic elements handle only low voltage ( about 4 to 5 volts ) signals . in comparison , electronic switches which are used to address electroluminescent phosphor panels have to handle voltages up to about 100 volts . as a result , these electronic switches have to be made from discrete electronic components , and their assembly is considrably time consuming and hence relatively expensive when a large number are involved . in accordance with an embodiment of the present invention the electronic switches used in the prior art are replaced by optoelectronic switches . each optoelectronic switch includes a photosensitive element , such as a photoconductor , for periodically connecting the source of electrical potential to a separate y conductor , and a photoelectric element for generating in response to a control signal from the logic elements an optical signal capable of periodically converting the photosensitive element into the state in which it connects the source of electrical energy and the appropriate y conductor . fig2 is a schematic representation of a display system embodying the present invention . the system incorporates the known display panel 1 described with reference to fig1 and a series of optoelectronic addressing switches . a patch ( strip ) 5 of photoconductor material such as cadmium sulphide or selenide is located adjacent to one end of the panel so as to make contact with all of the y conductors of the panel 1 . the patch 5 and the panel 1 may ( if appropriate ) both be formed on a single substrate indicated by reference numeral 21 . the patch 5 may be considered as having a row of discrete channels 10 each attached individually to a corresponding y conductor . alternatively the patch 5 may be scribed or etched to produce the channels 10 in a physically isolated form . a conductor 6 is attached to all of the channels 10 . when optical radiation of sufficient intensity is incident on any one of the channels 10 a conductive bridge is formed between the conductor 6 and the appropriate y conductor through that channel 10 . the intensity of the optical radiation depends on the particular panel 1 and the switching speed required but the intensity is typically 1 , 000 ft lamberts for a rapidly switched electroluminescent phosphor panel . the conductor 6 is connected to a voltage source 8 . an optical signal generator module 9 has a row of optical signal generatng elements 7 which can each be operated selectively , i . e ., when required , to produce an individual pulse of fixed intensity optical radiation . for the purpose of illustration , three such pulses are denoted in fig2 by wavy lines and the symbol hν . each individual pulse of optical radiation is incident on an appropriate individual channel 10 of the patch 5 of photoconductor material . a conventional optical guide plate ( not shown ) incorporating a series of fibre - optic radiation guides can be used to direct the pulses of radiation from the selected elements 7 to the appropriate channels 10 . the module 9 is not in general coplanar with the patch 5 ( or substrate 21 ). conveniently , the module 9 is arranged so that the pulses of radiation are incident on the patch 5 in a direction perpendicular to the plane of the patch 5 . the module 9 is conveniently operated using electrical signals supplied from conventional logic 17 via a shift register 15 . the outputs of the various stages of the shift register 15 are applied individually to the elements 7 of the module 9 by conductors 11 . in operation , the logic 17 supplies a series of electrical pulses which appear to be randomly spaced to the shift register 15 . the apparent randomness of the spacing represents the selection of elements 3 in any given row in the panel 1 to which elements 3 an operating voltage pulse is to be applied via the appropriate y conductors . therefore the series of pulses from the logic 17 constitutes a series of ` 0 ` ( no pulse ) and ` 1 ` ( pulse ) digits applied to the shift register 15 . when all the pulses in the series have been applied to the shift register 15 selected stages of the shift register are in the ` 1 ` state and unselected stages are in the ` 0 ` state . an output command pulse is then applied to the shift register 15 from the logic 17 . this causes the selected stages of the shift register 15 to emit a voltage pulse ( typically 4 to 5 volts ). this voltage pulse is transferred via the appropriate conductors 11 to the appropriate elements 7 and causes those elements 7 to emit a pulse of optical radiation . each pulse of optical radiation is incident on the appropriate one of the channels 10 causing conductive bridge to form through that channel 10 and between the conductor 6 and the appropriate y conductor . the conductive bridge lasts for the period during which optical radiation is emitted from the appropriate one of the elements 7 , which period is the duration of the output pulses from the shift register 15 , plus the period required for the photoconductor material of the patch 5 to relax back into its high resistance state . each conductive bridge allows the voltage developed by the voltage source 8 to be applied separately to the selected y conductors . the voltage developed by the voltage source 8 and applied to the selected y conductors may be steady , pulsed or alternating according to the kind of display panel 1 used . when the panel 1 is continuously operated a significant voltage can be built up across unselected elements 3 , particularly when the panel 1 consists of an array of liquid crystal elements , which have a relatively high resistance . this occurs when a fraction of the full operating voltage is repeatedly applied across those unselected elements 3 . to avoid this problem the elements 3 may all be discharged at some suitable time , for example after all the elements 3 in a given row or all the elements 3 in the panel 1 have been addressed , by applying an optical radiation pulse to all of the channels 10 to make them conducting for a short period . alternatively , the problem may be avoided if conductivity through the channels 10 is suitably non - ohmic , eg if the channels 10 have a much higher resistance for a voltage of one polarity than for a voltage of the opposite polarity or have a much higher resistance for a high voltage than for a low voltage . one way of achieving a non - ohmic characteristic is described below . the module 9 may be a row of elements of any known kind which are responsive to voltages of about 4 to 5 volts ( the output from the logic 17 and the shift register 15 ). it may for instance be a row of liquid crystal optical modulating elements , together with a source ( not shown ) of fixed intensity optical radiation continuously irradiating them ; or a row of ( so called ) light - emitting diodes preferably formed from a iii - v compound or alloy system , such as gallium arsenide , gallium arsenide phosphide or indium gallium phosphide ; or a thin film electroluminescent phosphor panel such as a panel made from ii - vi material doped appropriately with a conducting material such as copper and an activating agent such as manganese , together with voltage amplifying means to make the module 9 in that case responsive to the pulses from the shift reister 15 . if the module 9 is required to emit high intensity radiation , light - emitting diodes fabricated in a known way in the form of semiconductor lasers may be used . the module 9 does not necessarily have to be addressed using the shift register 15 . it can be addressed using any known means which is suitable . the photoconductor material of the patch 5 is preferably cadmium sulphide or cadmium selenide , although it can be any material which has a high ratio of light conductivity to dark conductivity and which is suitable for use with the particular module 9 used . fig3 is a cross - sectional diagram illustrating one form of physical construction of part of the system described with reference to fig2 . the panel 1 ( not shown in fig3 ) is fabricated on one part of a glass block constituting the substrate 21 . each y conductor leading from the panel 1 is in the form of a strip 23 ( one shown ) of conducting material , such as tin oxide , running across the surface of the block 1 . the patch 5 of photoconductor material is deposited in a known way , such as by r . f . sputtering , across the surface of the block 1 and over the ends of each of the strips 23 . the conductor 6 is deposited in a known way in the form of a strip of opaque material such as gold running across the surface of the block 1 parallel to the patch 5 . a separate layer 25 ( one shown ) of transparent conducting material is deposited in a known way over the patch 5 at each place where the patch 5 overlies one of the strips 23 . each of the layers 2 extends over a discrete part of the conductor 6 . a layer 27 of silica , which is optically transparent , is deposited in a known way over the conductor 6 , the patch 5 and each layer 25 for the purpose of encapsulation . a fibreoptic guide plate ( not shown ) may be attached or located across the surface of the finished structure on top of the patch 5 , so that the fibre - optic guides optically connect individual elements 7 ( fig2 ) and channels 10 . the module 9 ( not shown in fig3 ) is arranged so that pulse of optical radiation from its elements 7 are incident on each channel 10 of the patch 5 in a direction perpendicular to the plane of the patch 5 . the conductor 6 is opaque so that the layers 25 , which can act as optical radiation guides , are optically isolated from one another . in another embodiment of the invention the part of each strip 23 in contact with the patch 5 is coated with a metal , such as gold , to provide a schottky barrier . if selected strips 23 are biased negatively to produce operation of appropriate elements 3 the conductivity through the various channels 10 of the patch 5 is then significantly non - ohmic , i . e . has a rectifying characteristic . in another embodiment of the invention the strips 23 and the layers 25 may be mutually arranged to form the digits of an interdigital comb structure . in another embodiment of the invention the x conductors of the panel 1 described with reference to fig1 can be optoelectronically addressed in the same way as that used for addressing the y conductors . | 6 |
the following paragraphs describe some preferred embodiments of the present invention . in this example , a dry etching method according to the present invention is applied to a gate electrode forming process wherein a w polycide film masked by a tion anti - reflection film pattern is etched by using s 2 f 2 / h 2 mixed gas . this process is described by referring to fig1 a - 1d . referring first to fig1 a , a silicon substrate 1 was coated on the surface thereof with a gate oxide film 2 , which was formed in a thickness of about 8 nm by thermal oxidation . then , the gate oxide film 2 was coated on the surface thereof with a w polycide film 5 for forming a gate electrode . the w polycide film 5 was composed of a polysilicon layer s doped with n - type impurities ( about 100 nm thick ) and a wsi x layer 4 ( about 100 nm thick ), which were fabricated in this order on the gate oxide film 2 . further , the w polycide film 5 was coated on the surface thereof with a tion anti - reflection film 6 , which was formed in a thickness of 40 nm by reactive sputtering . finally , the tion anti - reflection film 6 was provided on the surface thereof with a resist mask 7 , which was formed of a chemical amplification photoresist material in a thickness of 0 . 35 um by patterning . the resist mask 7 was patterned by krf excimer laser lithography and alkaline development into a highly anisotropic shape because the tion anti - reflection film 6 served to reduce the adverse effect on the resist mask 7 by reflected light from the underlying wsi x layer 4 . the sample wafer thus formed was set on a wafer supporting electrode provided on a magnetron type reactive ion etcher ( rie ). in this state , the tion anti - reflection film 6 was etched , for instance , under the following conditions : ______________________________________c - c . sub . 4 f . sub . 8 flow rate : 50 sccmo . sub . 2 flow rate : 5 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) rf power density : 3 . 1 w / cm . sup . 2 ( 2 mhz ) ______________________________________ in the above - mentioned etching conditions , c - c 4 f 8 ( octafluorocyclobutane ) will form from each molecule thereof a plurality of cf x + ions which will assist an etching reaction . besides , c - c 4 f 8 will supply carbon for itself due to the carbon skeleton thereof without being supplied with depositional gas as additive gas and serve to sufficiently increase the c / f ratio ( i . e . the ratio of carbon ( c ) atoms to that of fluorine ( f ) atoms ) of the etching system , thus improving both selectivity and anisotropy . the tion anti - reflection film 6 was selectively removed in the form of tio x f y , etc . referring next to fig1 b , when the sample wafer was set on a plasma ashing apparatus to remove the resist mask 7 by ordinary o 2 plasma ashing , a tion anti - reflection film pattern 6a was formed on the wafer . this means that the tion anti - reflection film 6 , which no longer acted as an anti - reflection film , was patterned to form an etching mask . then , the wafer was set on a wafer supporting electrode provided on an rf biased magnetically enhanced microwave plasma etcher to etch the w polycide film 5 . the wafer supporting electrode houses a cooling pipe for circulating a refrigerant , i . e . ethanol in the example 1 , fed from a cooling system , for instance , a chiller to cool the wafer to predetermined temperature . in this state , the w polycide film 5 was etched , for instance , under the following conditions : ______________________________________s . sub . 2 f . sub . 2 flow rate : 20 sccmh . sub . 2 flow rate : 5 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) microwave power : 850 w ( 2 . 45 ghz ) rf bias power : 5 w ( 400 khz ) wafer temperature : - 50 ° c . ______________________________________ in the above - mentioned etching conditions , s 2 f 2 is one of sulfur fluorides proposed by the present inventors as effective chlorofluorocarbon ( cfc )- free etching gas for a silicon based material layer in the proceedings on the 4th microprocess conference ( 1991 ), p . 32 . s 2 f 2 formed f *, which acted as a main etchant for the silicon based material layer and promoted etching with the assistance of such ions as sf x + and s + . h 2 contained in etching gas formed h * in a plasma , which captured excessive f * for removal from the etching system in the form of hf , thus serving to increase the s / f ratio ( i . e . the ratio of the number of sulfur ( s ) atoms to that of fluorine ( f ) atoms ) of the etching system . on the w polycide film 5 , the lower polysilicon layer 3 was more vulnerable to attacks by f * than the upper wsi x layer 4 and was prevented from under - cutting by increasing the s / f ratio and thereby reducing the amount of f * in the above - mentioned manner . another advantage of capturing excessive f * was to improve selectivity for the underlying gate oxide film 2 . in the above - mentioned etching conditions , the low wafer temperature inhibited the reactivity of f * and the low rf bias power reduced the energy of incident ions , thus further improving selectivity for the gate oxide film 2 . another important feature of s 2 f 2 is that it has a higher s / f ratio than the most well - known sulfur fluoride sf 6 and will form free sulfur in a plasma . the sulfur thus formed in a plasma will adsorb on the surface of a target substrate ( wafer ) when it is kept at temperatures below room temperature . at this time , sulfur nitride based compounds were formed on the surface of the tion anti - reflection film pattern 6a . the estimated process of forming the sulfur nitride based compounds is that f * present in a plasma extracts ti atoms in the form of tio x f y to form dangling nitrogen bonds , which combine with sulfur also present in a plasma . typical of the sulfur nitride based compounds is a polythiazyl ( sn ) x , which is shown schematically in fig1 c . the sulfur nitride based compounds served to greatly reduce an etchrate on the surface of the tion anti - reflection film pattern 6a . this is the reason why the tion anti - reflection film pattern 6a acted adequately as an etching mask . meanwhile sulfur which is present in a plasma is deposited on the sidewalls to protect the sidewalls of the tion anti - reflection film pattern 6a , which were struck by no ion in principle . as a result , a gate electrode 5a was formed into a highly anisotropic shape . incidentally , individual material layer patterns formed after etching are identified by a subscript &# 34 ; a &# 34 ; added to the numerals for corresponding material layers . referring finally to fig1 d , when the sample wafer was set on a plasma ashing apparatus to subject it to ordinary o 2 plasma ashing , the sulfur nitride based compounds deposited on the surface of the tion anti - reflection film pattern 6a were removed in the forms of no x , n 2 , so x , etc . while the sulfur deposited on the sidewalls thereof sublimed or was removed in the form of so x . as a result , no particle pollution occurred . incidentally , most sulfur nitride based compounds will decompose at temperatures above 130 ° c . while sulfur will sublime at temperatures above 90 ° c . therefore , the wafer may be heated , for instance , to about 150 ° c . instead of subjecting it to o 2 plasma ashing . according to the present invention , a nitrogen based compound film is substituted for a resist mask in forming a gate electrode , thereby avoiding various problems with the prior art , such as promotion of particle pollution due to carbonaceous polymers and deterioration of selectivity for an underlying gate oxide film . further , sulfur formed in the gaseous phase is used to protect pattern sidewalls , thus eliminating the need for high - energy incident ions and improving selectivity for the gate oxide film . the tion anti - reflection film pattern 6a , about one fifth as thick as the gate electrode 5a , may be left unremoved as part of an inter - layer insulation film after being used as an etching mask without an accompanying excessive increase in the magnitude of the wafer surface steps . in this example , a tion anti - reflection film acts as a nitrogen based compound film . it is to be understood , however , that any other anti - reflection film , for instance , an si 3 n 4 film formed through plasma cvd , may also be used as an etching mask to form a gate electrode . in this example , a dry etching methods according to the present invention is also applied to a gate electrode forming process wherein a w polycide film masked by a tion anti - reflection film pattern is etched by using a s 2 f 2 / h 2 s gas mixture . a sample wafer was prepared in the same manner as in example 1 and provided on the surface thereof with the tion anti - reflection film pattern 6a . the sample wafer thus formed was set on a wafer supporting electrode provided on an rf biased magnetically enhanced microwave plasma etcher to etch the w polycide film 5 , for instance , under the following conditions : ______________________________________s . sub . 2 f . sub . 2 flow rate : 20 sccmh . sub . 2 s flow rate : 5 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) microwave power : 850 w ( 2 . 45 ghz ) rf bias power : 5 w ( 400 khz ) wafer temperature : - 30 ° c . ______________________________________ in the above - mentioned etching conditions , h 2 s added to the etching gas will supply both h * and s for itself , thus serving to increase the s / f ratio of the etching system more than the h 2 , which was used in example 1 . in fact , even when the wafer was kept at 20 ° c . higher than in the first embodiment , sulfur nitride based compounds , typically ( sn ) x , and sulfur based sidewall protection films were formed , so that a gate electrode was formed into a highly anisotropic shape with high selectivity for the tion anti - reflection film pattern 6a . in this example , a dry etching methods according to the present invention is applied to a gate electrode forming process wherein a w polycide film masked by a tion anti - reflection film is etched in two steps . namely a wsi x is first etched by using a s 2 f 2 / n 2 gas mixture and a polysilicon layer is then etched by using a s 2 br 2 / n 2 gas mixture . this process is described by referring to fig2 a - 2d with the same reference symbols as fig1 a - 1d . referring first to fig2 a , a sample wafer was prepared in the same manner as in example 1 and provided on the surface thereof with the tion anti - reflection film pattern 6a . the sample wafer thus formed was set on a wafer supporting electrode provided on an rf biased magnetically enhanced microwave plasma etcher to first etch the wsi x layer 4 , for instance , under the following conditions : ______________________________________s . sub . 2 f . sub . 2 flow rate : 10 sccmn . sub . 2 flow rate : 10 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) microwave power : 850 w ( 2 . 45 ghz ) rf bias power : 5 w ( 400 khz ) wafer temperature : - 20 ° c . ______________________________________ then , sulfur nitride based compounds deposited on the surface of the tion anti - reflection film pattern 6a in the same manner as in example 1 . in the above - mentioned etching conditions , since n 2 was added to the etching gas , sulfur nitride based compounds were also formed in a plasma for deposition on the sidewalls of the tion anti - reflection film pattern 6a , which were struck by no incident ion in principle , on the surface of the sample wafer kept at - 20 ° c . these sulfur nitride based compounds protected the sidewalls of the tion anti - reflection film pattern 6a . as a result , the wsi x pattern 4a was formed into a highly anisotropic shape as shown in fig2 b . next , the polysilicon layer 3 was etched , for instance , under the following condition : ______________________________________s . sub . 2 br . sub . 2 flow rate : 10 sccmn . sub . 2 flow rate : 10 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) microwave power : 850 w ( 2 . 45 ghz ) rf bias power : 15 w ( 400 khz ) wafer temperature : - 20 ° c . ______________________________________ in the above - mentioned etching conditions , s 2 br 2 was substituted for s 2 f 2 in order to remove f * from the etching system and form br * for use as a main etchant , thereby improving selectivity for the underlying gate oxide film 2 . at this time , sulfur nitride based compounds also deposited on both the surface and sidewalls of the polysilicon layer 3 . as a result , the gate electrode 5a was formed into a highly anisotropic shape as shown in fig2 c . referring finally to fig2 d , when the sample wafer was set on a plasma ashing apparatus to subject it to ordinary o 2 plasma ashing , the sulfur nitride based compounds deposited on the surface of the sample wafer were removed in the form of no x , n 2 , so x , etc . as a result , no particle pollution occurred . in this example , a dry etching methods according to the present invention is also applied to a gate electrode forming process wherein a w polycide film masked by a tion anti - reflection film pattern is etched by using a s 2 f 2 / n 2 / h 2 gas mixture . a sample wafer was prepared as shown in fig2 a and set on a wafer supporting electrode provided on an rf biased magnetically enhanced microwave plasma etcher to etch the w polycide film 5 , for instance , under the following conditions : ______________________________________s . sub . 2 f . sub . 2 flow rate : 20 sccmn . sub . 2 flow rate : 10 sccmh . sub . 2 flow rate : 10 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) microwave power : 850 w ( 2 . 45 ghz ) rf bias power : 5 w ( 400 khz ) wafer temperature : 0 ° c . ______________________________________ in the above - mentioned etching conditions , h 2 added to the etching gas served to increase the apparent s / f ratio of the etching system . as a result , the gate electrode 5a was formed into a highly anisotropic shape as shown in fig2 c without the need to etch the w polycide film 5 in two steps as in example 3 . in this example , a dry etching method according to the present invention is applied to a barrier metal based al metallization process wherein an al - 1 % si layer masked by a tion anti - reflection film is etched by using s 2 cl 2 and a barrier metal is then etched by using a nf 3 / o 2 gas mixture . this process is described by referring to fig3 a - 3d . referring first to fig3 a , a silicon substrate 11 was provided on the surface thereof with a barrier metal 14 ( 100 nm thick ), an al - 1 % si layer 15 ( 400 nm thick ), and a tion anti - reflection film 16 ( 40 nm thick ), which were formed in this order by sputtering . the barrier metal 14 was composed of a ti layer 12 ( 30 nm thick ) and a tion layer 13 ( 70 nm thick ), which were fabricated in this order on the silicon substrate 11 . further , the tion anti - reflection film 16 was provided on the surface thereof with a resist mask 17 , which was formed of a chemical amplification photoresist material by patterning . the sample wafer thus formed was set on a wafer supporting electrode provided on a hexode type reactive ion etcher . in this state , the tion anti - reflection film 16 was etched via the resist mask 17 , for instance , under the following conditions : ______________________________________c - c . sub . 4 f . sub . 8 flow rate : 70 sccmo . sub . 2 flow rate : 10 sccmgas pressure : 6 . 7 pa ( 50 mtorr ) rf power density : 4 . 2 w / cm . sup . 2 ( 2 mhz ) ______________________________________ referring next to fig3 b , when the sample wafer was set on a plasma ashing apparatus to remove the resist mask 7 by ordinary o 2 plasma ashing , a tion anti - reflection film pattern 16a was formed on the wafer . then , the sample wafer was set on a wafer supporting electrode provided on an rf biased magnetically enhanced microwave plasma etcher . in this state , the al - 1 % si layer 15 was etched , for instance , under the following conditions : ______________________________________s . sub . 2 cl . sub . 2 flow rate : 20 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) microwave power : 850 w ( 2 . 45 ghz ) rf bias power : 50 w ( 2 mhz ) wafer temperature : - 30 ° c . ______________________________________ in the above - mentioned etching conditions , s 2 cl 2 is one of the sulfur halides proposed by the present inventors as an etching gas for a silicon based material layer and an aluminum based material layer . s 2 cl 2 will form cl *, which will act as a main etchant for the aluminum based material layer and promote etching with the assistance of such ions as scl x + , s + , and cl + . like the above - mentioned s 2 f 2 , s 2 cl 2 , when dissociated by electric discharges , formed in a plasma free sulfur , which , in turn , formed sulfur nitride based compounds on the surface of the tion anti - reflection film pattern lea . a polythiazyl ( sn ) x typical of the sulfur nitride based compounds is shown schematically in fig3 c . sulfur is deposited on the sidewalls to protect the sidewalls of the tion anti - reflection film pattern 16a in the same manner as in example 1 . when the al - 1 % si layer 15 was almost etched , the underlying tion layer 13 was exposed to a plasma , whereupon the sulfur nitride based compounds , typically ( sn ) x , were formed on the surface of the tion layer 13 in the above - mentioned manner , thus greatly reducing an etchrate on that surface . as a result , an al based metallization pattern 15a was formed into a highly anisotropic shape with a selectivity of about 30 for the tion layer 13 . again , the sample wafer was set on a wafer supporting electrode provided on an rf biased magnetically enhanced microwave plasma etcher . in this state , the tion anti - reflection film pattern 16a and the barrier metal 14 were etched , for instance , under the following conditions : ______________________________________nf . sub . 3 flow rate : 50 sccmo . sub . 2 flow rate : 5 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) microwave power : 850 w ( 2 . 45 ghz ) rf bias power : 100 w ( 2 mhz ) wafer temperature : - 30 ° c . ______________________________________ referring finally to fig3 d , the tion anti - reflection film pattern 16a volatilized for removal in the form of tio x f y , etc . further , the sulfur nitride compounds , typically ( sn ) x , deposited on the surface of the tion anti - reflection film pattern 16a and the tion layer 13 were also removed in the form of no x , n 2 , so x , etc . while the sulfur deposited on the sidewalls of the tion anti - reflection film pattern 16a sublimed or was removed in the form of so x . as a result , no particle pollution occurred . the wafer thus processed was left in the atmosphere experimentally for 72 hours but developed no after - corrosion in striking contrast to the conventional dry etching methods using a resist mask whereby the same sample wafer developed after - corrosion immediately after being left in the atmosphere . according to the prior art , a great quantity of chlorine will occlude in a resist mask and a sidewall protection film formed of the decomposition product thereof . by contrast , according to the present invention , neither an etching mask nor a sidewall protection film will entrap any residual chlorine . another advantage of the present invention is the ability to remove the tion anti - reflection film pattern 16a in etching the barrier metal 14 , thereby decreasing the number of interfaces between dissimilar material layers where chlorine is most likely to remain particularly when the al based wire pattern 15a is composed of multiple layers . in this example , a dry etching method according to the present invention is applied to a barrier metal based al metallization process wherein an al - 1 % si layer masked by a tion anti - reflection film is etched by using a s 2 cl 2 / n 2 gas mixture . this process is described by referring to fig3 b and fig4 . referring first to fig3 b , a sample wafer was prepared in the same manner as in example 5 and provided on the surface thereof with the tion anti - reflection film pattern 16a . the sample wafer thus formed was set on a wafer supporting electrode provided on an rf biased magnetically enhanced microwave plasma etcher to etch the al - 1 % si layer 15 , for instance , under the following conditions : ______________________________________s . sub . 2 f . sub . 2 flow rate : 20 sccmn . sub . 2 flow rate : 10 sccmgas pressure : 1 . 3 pa ( 10 mtorr ) microwave power : 850 w ( 2 . 45 ghz ) rf bias power : 10 w ( 400 khz ) wafer temperature : 20 ° c . ______________________________________ then , the al - 1 % si layer 15 was etched in the almost same manner as in example 5 , except that n + and other ions assisted the etching reaction . further , since sulfur nitride based compounds were formed in the gaseous phase besides the solid phase , the al - 1 % si layer 15 was etched with a higher selectivity of about 40 for the tion anti - reflection film pattern 16a and the underlying tion layer 13 . moreover , sulfur nitride based compounds also deposited on the sidewalls of the tion anti - reflection film pattern 16a , thus protecting them more effectively . as a result , the al based metallization pattern 15a was formed into a highly anisotropic shape despite a smaller rf bias power and higher wafer temperature . while the present invention has been described in six preferred embodiments thereof , it is to be understood that the present invention is not limited to those embodiments and that various changes and modifications may be made in the present invention without departing from the spirit and scope thereof . for instance , in preferred embodiments of the present invention , a target material layer is a w polycide film or an al - 1 % si layer but may be replaced by a polycide film having a lower amorphous silicon layer , a polycide film containing other refractory metal than w , any other al based material layer like an al - 1 % si - 0 . 5 % cu layer , a single - crystal silicon layer , an amorphous silicon layer , a polysilicon layer , a refractory metal layer , etc . however , when a nitrogen based compound film is an anti - reflection film , the lower target material layer thereof should naturally have a relatively high reflection index . meanwhile , in preferred embodiments of the present invention , s 2 f 2 forms free sulfur in a plasma when dissociated by electric discharges . but such sulfur based compounds may vary depending on the type of a target material layer . as one instance , when the target material layer is a silicon based compound layer , s 2 f 2 may be replaced by sulfur fluorides such as sf 2 , sf 4 , s 2 f 10 , sulfur chlorides such as s 3 cl 2 , s 2 cl 2 , and scl 2 , sulfur bromides such as s 3 br 2 , s 2 br 2 , and sbr 2 , thionyl fluoride ( sof 2 ), thionyl chloride ( socl 2 ), thionyl bromide ( sobr 2 ), and other sulfur based compounds . as another instance , when the target material layer is an aluminum based compound layer , the above - mentioned group of compounds excluding those containing fluorine atoms are available . further , in preferred embodiments of the present invention , h 2 or h 2 s serves to increase the s / x ratio of the etching system . basically , however , the effects of these halogen radical consuming compounds can also be achieved by silane based compounds like sih 4 . still further , n 2 contained as an additive gas in the etching gas may be replaced by n 2 h 2 , nf 3 , ncl 3 , nbr 3 , nitrogen oxide , etc . it is to be noted , however , that nh 3 is not preferable as such an additive gas because it may react with sulfur to form ammonium sulfide in a solid state . etching gas may also contain he , ar , and other rare gases for producing sputtering , cooling , and dilution effects . | 7 |
a come - along includes an improved rope - winding mechanism and rope - securing mechanism . the rope - winding mechanism enables the rope to be wound and unwound smoothly during operation of the come - along . the rope - securing mechanism also improves the winding of the rope of the come - along and prevents the rope from pulling off the come - along . fig6 is a side partial cut - away view of a come - along according to principles of the invention . fig7 is a front view of the come - along according to principles of the invention . the come - along 90 includes a main body 105 , a handle 106 ( as shown in fig6 ), a rope 103 , a first hook 107 and a second hook 152 . the axial tube 101 and ratchet 108 are on the main body 105 . the axial tube 101 and ratchet 108 are securely connected together . turning the handle 106 turns the ratchet 108 , thereby winding the rope 103 onto axial tube 101 . when using the come - along 90 , the rope 103 is pulled out and the first hook 107 is hooked onto a heavy item or to a vehicle . the handle 106 is then turned to tighten the rope 103 winding on the axial tube 101 . according to principles of the invention , the axial tube includes concave helical slots 104 . fig8 - 17 illustrate a rope winding mechanism and rope - securing mechanism of the present invention . fig8 is a cross - section view at 8 - 8 of windings of rope on the axial tube including a rope winding mechanism according to principles of the invention . fig9 is a front view of a rope securing latch 102 of the present invention . fig1 is a side view of the rope securing latch 102 of the present invention including a pressing portion 113 that , in operation , presses on the rope 103 . fig1 is a top view of the axial tube 101 of the present invention . fig1 is a side view of the axial tube of the present invention . fig1 is an illustration of the stopper plate 112 in a pressed - down state and fig1 is an illustration of the stopper plate 112 in a bent state according to principles of the invention . fig1 is a side cross - section view of the rope securing latch in operation according to principles of the invention . fig1 is a top view of the axial tube 101 including an a - shaped curvature . fig1 is a side view of the axial tube including a rope securing mechanism of the present invention . in the rope winding mechanism in fig8 , the surface of the axial tube 101 includes concave , helical slots 104 starting from a positioning hole 109 ( shown in fig1 ) along the winding direction of rope 103 . a gap between the slots 104 is typically approximately the diameter of the rope 103 or slightly larger . the slots 104 can be made by such methods as injection molding , machining , or casting . the present invention is not limited to these manufacturing methods . in the securing mechanism of the invention as shown in fig1 - 17 , the positioning hole 109 is located on the curvature 200 of the y - shaped cross section 202 ( as identified , e . g ., in fig1 ) that is on the surface of axial tube 101 . the positioning hole 109 located on curvature 200 orients the rope 103 exiting from the positioning hole 109 in an almost - tangent angle to the axial tube 101 . fig1 shows a first outwardly facing circumferential surface portion 180 a second radial surface portion 182 and a third radial surface portion 184 . as illustrated , the second radial surface portion 182 and third radial surface portion 184 each diverges substantially smoothly from a radial orientation to a circumferential orientation . also shown are further radial surface portions 186 and 188 . radial surface portion 182 , 184 , 186 and 188 include respective surface regions disposed in substantially parallel spaced relation to one another . in the rope securing mechanism of the invention as shown in fig1 , the installation hole 110 is on the aforementioned axial tube 101 . the installation hole 110 is connected to positioning hole 109 . the diameter of installation hole 110 is greater than the diameter of the positioning hole 109 . a seal head 111 is on one end of the rope 103 . the diameter of the seal head 111 is smaller than that of the installation hole 110 and larger than the diameter of the positioning hole 109 . thus the seal head 111 on rope 103 can be inserted into axial tube 101 through installation hole 110 , and slid into the positioning hole 109 . the diameter of the positioning hole 109 is smaller than that of the seal head 111 , and thus the rope 103 stays attached to the axial tube 101 . in the rope securing mechanism in the invention as shown in fig1 and 17 , a stopper plate 112 is located between the installation hole 110 and the positioning hole 109 . the stopper plate 112 is part of the axial tube 101 . before the seal head 111 end of the rope 103 is inserted into the installation hole 110 and slid into positioning hole 109 , the stopper plate 112 is bent to let the rope slide through . the stopper plate 112 is pressed down when the installation is complete to prevent rope 103 from sliding from positioning hole 109 back to installation hole 110 . the positioning of the stopper plate 112 is shown in detail in fig1 and 14 . in fig1 , the stopper plate 112 is shown in the pressed down state against the rope 103 . in fig1 , the stopper plate 112 is shown in the bent ( open ) state enabling the rope 103 to slide past the stopper plate 112 . in the rope positioning mechanism shown in fig8 - 12 and 15 , the press portion 113 on the rope securing latch 102 has a lateral cross - section having an “ n ” shape to match the cross - section profile of the rope to improve the attaching force between the rope 103 and the rope securing latch 102 . in the rope positioning mechanism according to principles of the invention as shown in fig1 , 15 , and 17 , the rope securing latch 102 is securely attached to the rectangular slots 115 on the axial tube 101 through the elasticity of triangular latches 114 . typically , the rope securing latch 102 is made of a metallic material . it is to be understood that the above - identified embodiments are simply illustrative of the principles of the invention . various and other modifications and changes may be made by those skilled in the art which will embody the principles of the invention and fall within the spirit and scope thereof . | 1 |
as shown in fig1 - 5 , a golf club head is generally designated 20 . the golf club head 20 of fig1 - 5 is a fairway wood , however , the golf club head 20 of the present invention may alternatively be a driver . the golf club head 20 preferably has two main components : a main body 22 and a sole portion 26 . the main body 22 is preferably composed of a metal material such as titanium , titanium alloy , stainless steel , or the like , and is most preferably composed of a cast stainless steel material . the body 22 is preferably cast from molten metal in a method such as the well - known lost - wax casting method . the metal for casting is preferably is composed of 17 - 4 steel alloy . alternatively the body 22 is composed of a titanium or a titanium alloy such as 6 - 4 titanium alloy , alpha - beta titanium alloy or beta titanium alloy for forging , and 6 - 4 titanium for casting . additional methods for manufacturing the body 22 include forming the body 22 from a flat sheet of metal , super - plastic forming the body 22 from a flat sheet of metal , machining the body 22 from a solid block of metal , electrochemical milling the body from a forged pre - form , and like manufacturing methods . the golf club head 20 preferably has a volume from 100 cubic centimeters to 600 cubic centimeters , more preferably from 130 cubic centimeters to 475 cubic centimeters . when designed as a fairway wood , the golf club head 20 preferably has a volume ranging from 130 cubic centimeters to 300 cubic centimeters , and more preferably from 150 cubic centimeters to 275 cubic centimeters . the volume of the golf club head 20 will also vary between fairway woods ( preferably ranging from 3 - woods to eleven woods ). when designed as a driver , the golf club head 20 preferably has a volume ranging from 300 cubic centimeters to 500 cubic centimeters , and more preferably from 350 cubic centimeters to 475 cubic centimeters . the golf club head 20 preferably has a mass ranging from 90 grams to 250 grams , more preferably from 150 grams to 230 grams , and most preferably from 190 grams to 225 grams . the mass of the golf club head 20 will also vary between fairway woods ( preferably ranging from 3 - woods to eleven woods ) and a driver . in a preferred embodiment , the main body 22 has a crown portion 24 , a ribbon portion 28 , a face portion 30 with a bottom extension 33 , and an opening 31 . the golf club head 20 preferably has a hollow interior . the golf club head 20 has a heel end 36 , a toe end 38 an aft end 37 . a shaft , not shown , is placed within a hosel 39 at the heel end 36 . the main body preferably has a mass ranging from 100 grams to 150 grams , and is most preferably 122 grams . the main body 22 preferably has a material volume ranging from 12 . 0 cubic centimeters to 20 cubic centimeters , and is most preferably approximately 16 . 0 cubic centimeters . the face portion 30 of the main body 22 preferably has a thickness ranging from 0 . 050 inch to 0 . 125 inch , more preferably from 0 . 075 inch to 0 . 100 inch , and most preferably 0 . 080 inch to 0 . 090 inch . the ribbon portion 28 preferably has a thickness ranging from 0 . 020 inch to 0 . 050 inch , and most preferably approximately 0 . 030 inch . the crown portion 24 preferably has a thickness ranging from 0 . 020 inch to 0 . 050 inch , and most preferably approximately 0 . 030 inch . the sole portion 26 is a separate component which is attachable to the main body 22 by known attachment means . in a preferred embodiment , the sole portion 26 is attached to the main body 22 using brazing . alternatively as shown in fig5 a , the sole potion 26 is attached to the main body 22 utilizing a plurality of bolts 47 , with each of the plurality of bolts 47 threaded into a corresponding threaded aperture 49 of a plurality of threaded apertures 49 of the main body 22 . the attachment means allow for the use of dissimilar materials between the body 22 and sole portion 26 . the sole portion 26 is composed of a metal injection molded material . preferably , the metal injection material comprises stainless steel and a tungsten alloy , and preferably has a density ranging from 7 . 90 grams per cubic centimeters (“ g / cc ”) to 12 . 5 g / cc , and more preferably from 8 . 25 g / cc to 9 . 5 g / cc . the tungsten alloy preferably comprises tungsten and at least one of nickel , iron and copper . metal injection molding powders are commercially available . catamold materials from basf is one such metal injection molding powder . the sole portion 26 preferably has a mass ranging from 45 grams to 100 grams , more preferably 70 grams to 95 grams , and most preferably 82 grams . the sole portion preferably has a volume ranging from 8 . 0 cubic centimeters to 12 . 0 cubic centimeters , and most preferably 10 . 0 cubic centimeters . the sole portion preferably has a thickness that ranges from 0 . 020 inch to 0 . 080 inch , more preferably from 0 . 030 inch to 0 . 070 inch , and even more preferably from 0 . 040 inch to 0 . 060 inch . alternatively , in order to heel bias the golf club head 20 , to better accommodate a golfer &# 39 ; s swing properties , a heel region of the sole portion 26 preferably has a greater thickness than the entirety of the sole portion 26 . the heel region may correspond to one of the surfaces discussed below in reference to sharp angle elevations . further , in order to toe bias the golf club head 20 , to better accommodate a golfer &# 39 ; s swing properties , a toe region of the sole portion 26 preferably has a greater thickness than the entirety of the sole portion 26 . as shown in fig6 and 7 , the sole portion 26 comprises an exterior wall 60 , an interior flange 72 and an interior edge wall 70 , which is substantially perpendicular to the interior flange 72 . the interior flange 72 and the interior edge wall 70 preferably extend along the entire perimeter of the sole body 26 as shown in fig6 and 7 . however , those skilled in the pertinent art will recognize that the interior flange 72 and interior edge wall 70 may not extend along the entire perimeter of the sole body 26 . as shown in fig3 , the main body 22 has a perimeter flange 80 which preferably extends along the entire perimeter of the main body 22 . however , those skilled in the pertinent art will recognize that the perimeter flange 80 may not extend along the entire perimeter of the main body 22 . the interior flange 72 and interior edge wall 70 of the sole portion 26 , and the perimeter flange 80 of the main body 22 create a connection junction for brazing of the sole portion 26 to the main body 22 . in a preferred embodiment , the sole body 26 has a plurality of sharp angle elevations 99 a - c , wherein the sharp angle ranges from 70 degrees to 90 degrees . as shown in fig3 a , the sole portion 26 is partitioned into a plurality of surfaces to demonstrate the sharp angle feature of the sole body 26 , which is made possible through the use of metal injection molding . a first surface 100 is substantially perpendicular to a second surface 101 which is substantially perpendicular to a third surface 102 which is substantially perpendicular to a fourth surface 103 which is substantially perpendicular to a fifth surface 105 . metal injection molding allows for the sharp angle elevation changes between the surfaces . in general , the moment of inertia , izz , about the z axis for the golf club head 20 of the present invention will range from 1900 g - cm 2 to 3000 g - cm 2 , preferably from 1990 g - cm 2 to 2800 g - cm 2 , and most preferably from 1990 g - cm 2 to 2600 g - cm 2 . the moment of inertia , iyy , about the y axis for the golf club head 20 of the present invention will range from 900 g - cm 2 to 1700 g - cm 2 , preferably from 950 g - cm 2 to 1500 g - cm 2 , and most preferably from 965 g - cm 2 to 1300 g - cm 2 . from the foregoing it is believed that those skilled in the pertinent art will recognize the meritorious advancement of this invention and will readily understand that while the present invention has been described in association with a preferred embodiment thereof , and other embodiments illustrated in the accompanying drawings , numerous changes , modifications and substitutions of equivalents may be made therein without departing from the spirit and scope of this invention which is intended to be unlimited by the foregoing except as may appear in the following appended claims . therefore , the embodiments of the invention in which an exclusive property or privilege is claimed are defined in the following appended claims . | 0 |
an elevator system 20 is now described with reference to fig2 . the system 20 has features similar to those shown in fig1 and like reference numerals are used to denote like parts . similarly to system 1 , the elevator system 20 includes a cantilevered elevator car assembly 2 coupled to a counterweight 8 via a rope or cable 7 , which is driven by a motor 4 , to allow the car assembly 2 to travel up and down elevator shaft 3 . the cable 7 is , however , coupled to the elevator car assembly 2 at a lower region 23 of the assembly 2 , as compared to the top cross - beam 10 shown in fig1 . more particularly , the cable 7 is connected to sockets 24 which are in turn coupled to a lower structural beam 25 of the assembly 2 so as to provide a length of cable ‘ l ’ between the motor 2 and the sockets 24 . a further difference between the systems 1 and 20 is that the motor 4 is supported in spaced relation to the top end 5 of the shaft 3 . the motor 4 can , in fact , be positioned further away from the end 5 of the shaft 3 such as in the location shown in dashed outline 30 , where the motor 4 is below a roof 26 of the assembly 2 and laterally adjacent the assembly when level with a top floor 22 serviced by the system 20 . in relation to the positioning of the motor 4 relative to the car assembly 2 , a certain minimum distance needs to be maintained between the motor 4 and the end 12 of the cable connected to the car assembly 2 , to accommodate overrun of the car assembly and the like . the specific length of cable required to accommodate the overrun is calculated by taking into consideration a number of factors such as a counterweight buffer stroke , which is the displacement distance of a buffer at a base of the elevator shaft , which is used to arrest downward displacement of the counterweight . since the cable 7 is connected to the car assembly 2 at the lower region 23 , the relevant overrun can be readily accommodated within the length ‘ l ’ of cable 7 . the motor 4 may be placed at a substantially lower location as a result , as compared to the location of the motor 4 of fig1 , where the placement of the motor needs to be above the car assembly 2 itself . the arrangement of the system 20 may thereby provide a number of advantages . flexibility exists in the specific placement of the motor 4 and the motor 4 may be more readily accessed by a person standing on the roof 26 . also , the overall height requirements for the shaft 3 may be reduced which could perhaps result in some economic advantage in the form of space and construction savings , such as by allowing the top end 5 of the shaft 3 to be lowered , or in the form of allowing an additional floor to be added and serviced by the system 20 , whilst still complying with initial building height restrictions . to further illustrate the potential height advantage provided by the system 20 , a standard minimum lift shaft overrun calculation was made for comparison with the system 1 . the minimum lift shaft overrun may be taken as a distance ‘ d ’ between the top floor 22 served and the top end 5 of the shaft 3 . the calculations were conducted for a system intended to carry 13 passengers at 1 . 0 m / s with : a counterweight buffer stroke of 80 mm ; a counterweight buffer clearance of 450 mm , below the motor or its support ; and a top - of - car person clearance of 1570 mm , which is a clearance required for a maintenance person standing on top of the car assembly 2 . the minimum lift shaft overrun for the system shown in fig1 was found to be 4680 mm while that required for system 20 was only 3960 mm , which indicates a clear height advantage may be realised utilising the present invention . the invention has been described by way of non - limiting example only and many modifications and variations may be made thereto without departing from the spirit and scope of the invention described . | 1 |
referring to fig1 there is shown one embodiment of an instrumentation system of the present invention generally denoted as 10 . the system includes various curved guides having a curved guide shaft with a curved angle of between about 0 ° and about 90 °. specifically , the curved angle may be about 0 ° to about 25 °, though any other angle is envisioned depending on the application of the guide . the system may consist of , for example , a 25 ° rotated orientation curved guide 12 , a 25 ° standard orientation curved guide 14 , a 12 ° rotated orientation curved guide 16 , a 12 ° standard orientation curved guide 18 , and a 0 ° ( i . e . straight ) guide 20 . in one example , the rotated orientation guides may be used on the posterior glenoid rim , and the standard orientation guides may be used on the anterior glenoid rim , though this may be reversed if desired . furthermore , in an alternate example , the rotated orientation guides may be used within the posterior portal , and the standard orientation guides may be used within the anterior portal , or vice versa , depending upon the desires of the user and the surgical application . the 0 ° guide may be rotated 90 ° and used on the anterior or posterior glenoid rim . bullet tip obturator 22 and a trocar tip obturator 24 may also be provided and may be used for insertion through the cannulated opening in each of the guides 12 , 14 , 16 , 18 and 20 . a flexible drill 26 may further be provided . the drill tip may be capable of drilling , for example , a 3 . 5 mm pilot hole . finally a suture anchor inserter 28 may be provided which again has a flexible shaft and is capable of receiving , for example , a 5 mm suture anchor which may either be made of metal or a polymer such as polyetheretherketone ( peek ). referring to fig2 there is shown a first embodiment of the 25 ° standard orientation curved guide 14 which includes a hollow tubular shaft 29 and handle 30 which is cannulated to allow the passage of the various other instruments of the system therethrough . fig3 shows a first embodiment of a 25 ° rotated orientation curved guide 12 having a shaft 31 also attached to a handle 30 . guides 14 and 12 include a distal end 32 , 34 respectively having edges 36 , 38 defining an aperture opening to the hollow anterior of each of the curved guide shafts . distal ends 32 , 34 may include windows 42 , in any form or shape , such as illustrated as elongated slats , in the walls of the shafts which allow the various instruments extending through the hollow interior of the shafts of the curved guides 12 , 14 to be viewed . in one embodiment , a window 42 may be on at least one side of the distal end of each guide . likewise fig4 shows a first embodiment of a 12 ° standard orientation curved guide 18 . fig5 shows a first embodiment of a 12 ° rotated orientation curved guide 16 . again , both guides 18 and 16 include shafts 44 and 46 which are tubular in shape and are received within cannulated handles 30 . the shafts 44 and 46 are curved at 12 ° compared to the 25 ° curve of shafts 29 and 31 . by this it is meant that the central axis of the straight part of the shaft adjacent the handle and the central axis at the tip 52 , 54 of guides 18 and 16 form an angle of 12 °. referring to fig6 there is shown guide 20 having a hollow shaft 58 and cannulated handle 30 in which the cannulation through the shaft and the handle are co - axial with the shaft 58 being straight thus having a 0 ° angle between the shaft part adjacent handle 30 and a distal shaft end 62 . while the standard and rotated orientations refer to the relative position of the aperture as to the curve of the shaft , it is understood that the guide 20 could have either orientation because the curve of the shaft is 0 degrees . referring to fig7 there is shown one example of the handle 30 of guides 12 , 14 , 16 , 18 and 20 which may be ergonomically designed having a helical groove formed for easy gripping . while the helically shaped handle 30 is shown , any handle design may be utilized as long as it has a cannulation adapted to receive the instruments 22 , 24 , 26 and 28 of system 10 . referring to fig8 - 12 , there are shown the various embodiments of the tips of the guides 12 , 14 , 16 , 18 and 20 . while each tip embodiment is designated to a specific guide , it should be understood that each tip can be used with each guide . the tip 32 of the 25 ° standard guide 14 is shown in fig1 with the tip 34 of the 25 ° rotated guide 12 shown in fig8 . the 12 ° standard and rotated guides 18 and 16 are shown in fig9 and 12 respectively and have distal tips 37 and 35 respectively . the distal tip of the straight or 0 ° guide 20 is illustrated in fig1 . all the guide tips have a “ parabolic ” shape to , among other reasons , allow better engagement with the rim of the glenoid . the orientation of the “ parabolic ” with respect to the curved section on curved guides determine whether the orientation is standard or rotated , as is illustrated throughout the figures . each of the distal tips may have a laser marking 66 and , in the case of the curved guide , an arrow 68 pointing to the direction of curvature . obviously the arrow 68 is unnecessary for the straight or 0 ° guide 20 . laser mark 66 indicates the desired depth of insertion of the instruments passing within the guides , and helps the user in achieving the specified depth of , for example , drilling into the bone or setting of the suture anchor . each guide has edges 70 and 72 extending between the inner and outer walls of the hollow guide which edge surfaces are generally parabolic in shape . while the edges 70 and 72 form the parabolic shape are shown to be symmetric , they could be non - symmetric if such would better fit the anatomy . furthermore , edges 70 and 72 may include specific designs or dimensions depending on the requirements of anatomy or surgical procedure . for example , as illustrated in fig9 and 12 , the aperture edge 70 or 72 may include a flattened portion 73 . the portion 73 may assist in moving the guide through the cannula . this is particularly useful for the 12 ° guides , as shown , because the curve of the shaft may make it difficult for the parabolic shape to pass through the cannula . this may also be useful for the 25 ° guides , however , typically the 25 ° guide will be used without a cannula and will be inserted percutaneously because the curve of the shaft may not fit through a cannula . moreover , as illustrated in fig1 , an edge 70 or 72 may include a cut - out 74 . cut - out 74 may further assist the passage of the curved guide through the cannula , while also providing sharpened points which may engage the bone and provide a stable base on which the guide 16 can rest . referring to fig1 there is shown one embodiment of an obturator 24 including a trocar tip 80 . the obturator may be made of a flexible shaft 82 and a handle portion 84 with an adjustable stop surface 86 which can engage a proximal surface 88 of handle 30 as shown for example in fig7 . the shaft 82 may be made from nitinol with trocar tip 80 being made , for example , of titanium . one embodiment of tip 80 is shown enlarged in fig1 and has a bore 90 for receiving nitinol shaft 82 and a sharpened point 92 . referring to fig1 there is shown one embodiment of an obturator shaft 22 including a bullet tip 94 again with handle portion 84 having a stop surface 86 . obturator 22 again may include a nitinol shaft 96 on which bullet tip 94 is mounted . tip 94 is shown in an enlarged view in fig1 which has a typical bullet shaped point 98 and a bore 100 for receiving shaft 96 . both tips 80 and 94 may be welded to their respective shafts 82 and 96 . the outer diameters of tip 80 and 94 are sized to be slidingly received within the hollow bore of guides 12 , 14 , 16 , 18 and 20 . the tips help prevent damage to the seal on the inner bore of the cannula . also , trocar tip 80 may be used to cut through tissue in percutaneous applications , while bullet tip 94 may also push aside tissue when moving the guide within the body . referring to fig1 there is shown drill 26 which includes a shaft 102 which , in another embodiment , has a proximal solid portion 104 and a flexible portion 106 . the flexible portion 106 is made by taking hypodermic metal tubing and forming a laser cut in the metal to a sufficient depth to allow flexing about the cut . the shaft 102 may be substantially cannulated and may include a thickness between an outer surface and an inner surface , such as would be the case with hypodermic metal tubing , for example . the laser cut may extend circumferentially around the outer surface of the hypodermic tubing and may have a wave or sinusoidal shape to enhance flexibility . for example , the laser cuts may merely score the outer surface , or may penetrate deeper into the thickness of the shaft . the flexible portion is then laser welded onto the solid rod of section 104 . in a further embodiment , the laser cuts may pass completely through the tubing to form discrete portions of tubing which may be interlocked by the shape of the cuts , for example , like jig - saw puzzle pieces , such that sections 104 and 106 may be a single piece , and the laser cut may then be applied to the tubing at portion 106 to form the flexible portion . at the distal end of the flexible section 106 is a drill bit 108 which may be laser welded at point 109 to flexible portion 106 . the drill bit 108 may have a diameter for producing a pilot hole to receive a desired suture anchor such as a 3 . 5 mm suture anchor . a proximal end 110 of flexible drill 26 includes a drive element 112 which may be inserted into a standard power drill chuck . proximal end 110 also includes a stop feature for engaging surface 88 of handle 30 to limit the depth of a pilot hole drilled in bone . referring to fig1 a - 22 there is shown one embodiment of the flexible suture anchor inserter 28 of the present invention . referring to fig1 a there is shown an elevation view of inserter 28 which can be seen in cross - section in fig1 b . inserter 28 has a handle 114 which is cannulated as is the shaft portion 116 . referring to fig1 and 21 , fig1 illustrates one example of the distal end 120 of shaft 116 with fig2 showing shaft 116 rotated 90 ° with respect to the view shown in fig1 . fig2 and 22 show enlarged views a and b of the distal end 120 including a laser marking 122 and u - shaped recessed areas 124 and 126 . as shown in fig2 the tip 120 may also include an axially extending laser marking 130 . marking 130 may show the orientation of the suture anchor attached to tip 120 . for example , the vertical marking 130 may show the orientation of a suture eyelet on the suture anchor . tips 120 including recesses 124 , 126 , are adapted to receive , for example , a 3 . 5 mm stryker twinloop ™ suture anchor . of course the tip can be designed to be utilized with any desirable suture anchor . suture ( not shown ), which may be attached to the suture anchor , may then be passed up through the cannulated shaft and handle . alternatively , the suture may be positioned elsewhere relative to the suture anchor and inserter , as is known in the art . fig2 and 28a illustrate another embodiment of a flexible suture anchor inserter 128 . similar to the construction of the flexible drill 26 , above , a shaft portion 216 may include a solid portion 204 and a flexible portion 206 . the flexible portion 206 is made using a length of hypodermic metal tubing , or the like , and forming a laser cut in the metal to a sufficient depth to allow flexing about the cut . the shaft 216 may be substantially cannulated and may include a thickness between an outer surface and an inner surface , such as would be the case with hypodermic metal tubing , for example . the laser cut may extend circumferentially around the outer surface of the hypodermic tubing and may have a wave , or sinusoidal shape to enhance flexibility . the cuts may , in another arrangement , be a single cut which moves along at least a portion of the shaft in a spiral pattern , like a thread on a screw . the laser cuts may be at any depth relative to the thickness of the shaft , such as , for example , cuts which merely score the outer surface , or cuts which may penetrate deeper into the thickness of the shaft . the flexible portion is then laser welded onto the solid rod of section 204 . in a further embodiment , the laser cuts may pass completely through the tubing to form discrete portions of tubing which may be interlocked by the shape of the cuts , for example , like jig - saw puzzle pieces , such that sections 204 and 206 may be a single piece , and the laser cut may then be applied to the tubing at portion 206 to form the flexible portion . the cuts may be in a circumferential pattern , in a spiral pattern , or the like . at the distal end of the flexible section 206 is a tip 220 , which may be laser welded at point 209 to flexible portion 206 . alternatively , tip 220 may be a unitary piece , along with portions 204 and 206 , and is later machined as needed to accommodate a suture anchor . this interlocking flexible portion 206 may provide even stronger resistance to buckling when , for example , pressing the suture anchor into the pilot hole . the method of using the system 10 will now be explained . referring to fig2 and 24 there is shown a schematic of the bones in the shoulder which include a clavicle 300 , a coracoid process 302 and a proximal humerus 304 . a head 307 of the proximal humerus 304 engages a glenoid 306 . one guide chosen from guides 16 , 18 and 20 may be placed in a cannula 310 such that a tip 312 of the guide is located adjacent the glenoid 306 . guides 12 and 14 may also be used in this method , but due to the 25 ° curvature , a cannula may not be used and percutaneous entry may be used instead ( though of course the use of a cannula capable of handling the 25 ° curved angle may allow these guides to be used with a cannula ). likewise , any of guides 16 , 18 and 20 may also be used percutaneously , without a cannula . an obturator 22 having a bullet shaped tip is shown in this method . obturator 24 can be used if a trocar tip 80 is required , especially for percutaneous entry . the cannula which may be used with this method may be any cannula known in the art suitable for use with the guides of the present invention . referring to fig2 there is an enlarged view of the distal tip 312 of guide 308 with the bullet tip 94 of the obturator 22 extending beyond the edges 322 of tip 312 . as shown in fig2 after the tip 312 of guide 308 is properly located adjacent the glenoid 306 , the obturator 22 is removed with the guide 308 positioned as shown in fig2 . using the laser marked arrows 68 which may be pointed towards the curved section of the guide therefore allows the surgeon to orient the bend in a manner to place the parabolic shaped edge 322 of the distal tip portion 312 on the glenoid rim 306 at an appropriate location to perform the repair . the flexible drill 26 is then inserted through guide 308 and a pilot hole 324 is drilled in the glenoid rim 306 as shown in fig2 . the drill tip 108 is visible in windows 42 of tip 312 prior to drilling the hole 324 . the flexible drill 26 is then removed from the cannulated bore in drill guide 308 . referring to fig2 , a suture anchor 330 is then placed on the tip 120 of an inserter 28 which again is placed through the cannulation of handle 30 and through the guide 308 into pilot hole 324 in the glenoid rim 306 . again the suture anchor would be visible in window 42 of tip 312 , and laser markings 66 , 122 and 130 may be used to orient the suture anchor to a proper depth into the bone and proper radial alignment ( i . e ., rotational alignment of suture eyelets ) dependent upon a particular application . after the suture anchor is firmly in position on rim 306 the inserter 28 is removed from guide 308 . additional suture anchors may be implanted in the rim as desired . after the installation of suture anchors is complete the guide 308 and the cannula 310 are removed . although the invention herein has been described with reference to particular embodiments , it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims . | 0 |
implementations described include an apparatus and process which allow electroplating to fill sub - micron , high aspect ratio features ( e . g ., 20 ) utilizing a pre - electroplating ( non - copper ) layer 16 over the feature side wall 13 between the seed layer 14 and the electroplated copper fill material 40 . the pre - electroplating ( e . g ., cobalt ) layer 16 after processing and in the final structure remains mainly over the feature side walls 13 , i . e ., the vertical surfaces of the feature , with little or no pre - electroplating material on the bottom surfaces 22 of the features to be filled . the presence of this pre - electroplating layer over the side wall finds a more reliable bottom up electroplating deposition within the feature , to achieve a reliable void - free feature fill capability . in one implementation ( as in the prior art fig1 - 3 ), a conformal barrier layer 12 is first deposited over the dielectric layer 10 and features , where the conformal barrier layer 12 forms on all planar surfaces 11 and side wall surfaces 13 of the dielectric layer 10 and the feature 20 contained therein . a seed layer 14 ( such as copper ) is then deposited , such as by pvd , on the conformal barrier layer 12 , where the seed layer 14 forms on the conformal barrier layer 12 and over all planar surfaces 11 and side wall surfaces 13 of the dielectric layer 10 and the feature 20 contained therein . next , a non - copper / pre - electroplating layer 16 ( fig4 ) is deposited on the seed layer 14 , the exposed surfaces of the non - copper / pre - electroplating layer 16 are directionally etched ( fig5 ) to remove the non - copper pre - electro plating layer 16 from the planar upward facing surfaces 11 of the dielectric layer 10 and to remove the non - copper pre - electroplating layer 16 from the bottom surface 22 of the feature 20 , leaving the non - copper pre - electroplating layer 16 only over the side walls 13 of the feature 20 . the arrows 17 ′ represent the direction of the electric field influencing the ions in the argon gas to collide with the top ( planar ) surface of the pre - electroplating layer to remove it during the directional etch process . the arrows 17 ″ similarly show the direction of the electric field at the bottom surface 22 of the feature 20 in the dielectric layer . the vertical side wall 13 is substantially unaffected by the etch process and so the pre - electroplating layer 16 deposited over the side wall 13 remains intact after the etch process is completed . electro - plating is then performed to fill the feature 20 . fig4 - 6 show cross - sectional views of a portion of a semiconductor wafer during various stages of an electroplating feature filling process as described herein . first , a dielectric or insulating layer 10 , such as a silicon oxide , is conventionally formed over a semiconductor wafer . the dielectric layer 10 can be deposited over a silicon substrate 5 , in which transistor elements or other active component areas have been formed , over patterned metal layers , or over any other suitable layers that require electrical connection to areas on the same or adjacent layers . dielectric layer 10 is then etched to form features 20 , such as vias , over selected areas for electrical connection . features with aspect ratios up to about 10 : 1 are fillable . note that other features can also be etched from the dielectric , such as contacts , lines , damascene and dual damascene structures having a via and a trench portion . etching can be performed with conventional methods , such as photolithography techniques in which deposited photoresist is patterned and used as a mask to etch dielectric layer . as shown in fig4 , a conformal barrier layer 12 has been deposited on the dielectric layer 10 . barrier layer 12 forms a relatively uniform layer of material on the planar surface 11 of the dielectric , the side walls of feature 20 , and the bottom surface 22 of feature 20 . the barrier layer can be tantalum ( ta ), tungsten nitride ( wn ), titanium nitride ( tin ), tinxsiy , tantalum nitride ( tanx ), silicon nitride ( sin ), tungsten ( w ), cowp , nimop , nimob , ruthenium ( ru ), ruo 2 , molybdenum ( mo ), and mo x n y , where x and y are non - zero numbers . this list is not exhaustive , and other materials that could be used are ones that can be deposited with good adhesion and that when deposited as a layer approximately 2 - 10 nm thick show acceptable barrier layer performance . these films can be deposited by pvd , cvd , or ald techniques ( pvd is typically used ). the deposited film is typically 4 nm thick . barrier layer 12 prevents atoms from the subsequently deposited metal layers ( e . g ., cu ) from migrating ( out ) into the dielectric layers , since this can cause the integrity of the dielectric layer to be compromised ( damages the device ) or cause voids in the conductors because of out - diffusion of the copper . as shown in fig4 , a seed layer 14 , such as a copper layer , has also been deposited over the dielectric and feature area . deposition could be performed by using a physical vapor deposition ( pvd ) tool using ( sputter source technology ). next , in fig4 , a pre - electroplating layer 16 ( e . g ., cobalt , or a copper alloy or another material that slows the electroplating process to be less ( ideally substantially less ) than the rate of the electroplating rate of accumulation from the bottom surface 22 , e . g ., the side wall has a 10 % ( or 15 % or 20 % or 25 %) electroplating rate of the rate of material accumulation accumulating from the bottom surface 22 , ( elements and alloys of rh , pd , ni , zn , cd , cr , w , mo , ru alone or in combination are possible materials that could work as described herein for the side wall electroplating accumulation rate retarding layer ) is deposited using a cvd process , or a pvd process over the seed layer 14 already in place . the electroplating rate on the side wall ( s ) should be so low that they do not pinch off the bottom up fill accumulation ( growth , deposition ) and create voids in the metal ( copper ) material being deposited during the electroplating process . whether there is one tubular shaped side wall ( providing a tubular via feature with facing side surfaces ) or separate side walls on opposite side of a line feature , the feature still have facing ( essentially opposing ) walls . the rate of deposition of metal ( copper ) material on those opposing walls will essentially cause the rate of closure of the feature gap to be double the rate of deposition on one sidewall . for example , in a feature having a 5 to 1 aspect ratio , depth to width ( assuming 5 dimension units of depth and 1 dimension unit of width ), initially assuming no side wall deposition , a bottom up fill could take 5 deposition time increment units to fill the feature from bottom to top . if the side wall growth were 100 % of the bottom up deposition rate , the “ one ” unit wide feature would be choked off in 0 . 5 deposition time increment units while only 0 . 5 dimension units of metal thickness would have been deposited at the bottom of the feature . to allow time for the bottom up deposition in the feature to take place leaving an opening of 50 % of the top gap opening available would require that the side wall deposition rate be 5 % of the bottom up deposition rate ( assuming a constant side wall deposition rate ). however , in practice , once a continuous metal ( copper ) layer has initially been formed on a side wall face and is electrically connected to the metal copper seed layer , then the continuous metal layer on the side wall will be charged to a similar electrical charge as the metal seed layer during electroplating . once the side wall is electrically charged , like the seed layer , metal ( copper ) deposition will take place on the initially deposited material on the side wall face without a reduction or obstruction in rate . with this in mind , a successful bottom up fill requires that the initial rate of deposition of electroplating material on the sidewall be close to zero . a slow accumulation of atoms ( or molecules ) will take place on the side wall surface until a current carrying stable electrical connection is achieved with the metal seed layer , at that point deposition will occur as fast as the bottom up feature fill deposition rate and choke off the top of the feature from bottom up deposition ( growth ) if it is not already near full . in one implementation , pre - electroplating layer has a thickness between 1 angstrom and 20 angstroms , with a typical thickness of 10 angstroms . because there may be little or no conductive layer material on the side walls of the feature , the pre - electroplating layer must have good adhesion to as well as acting as a conductor with a lower conductivity or higher resistance than the underlying copper seed layer . further , the materials for pre - electroplating layer must be capable of bonding to the fill material when the fill material is electroplated in a bottom - up accumulation in the feature ( good bonding is sometimes referred to as good adhesion ). fig5 shows an argon etch process where positive ions of argon that are attracted towards the semiconductor wafer by the electric field within a plasma formed over the dielectric layer . as a result the ions move in a direction normal to the surface of the dielectric layer and etch the top planar and feature bottom surfaces to remove the pre - electroplating layer 16 from those surfaces leaving the pre - electroplating layer 16 only on the feature side wall 13 . the pre - electroplating layer 16 remaining on the side wall acts to control ( reduce ) the rate of copper deposition on the side wall during electroplating ( as compared to a side wall surface which has no pre - electroplating layer 16 — normally copper on copper electroplating takes place . the materials and thickness of the pre - electroplating layer 16 can be adjusted and investigated to empirically determine the most efficient idealized case where a minimal thickness of the layer 16 is deposited while the bottom up electroplating still satisfactorily occurs in small size device features . satisfactory performance is defined by having a current density through the feature exceeding the current density during normal operation in features having an opening size of approximately 50 nm ( the current state - of - the - art ). satisfactory performance is defined as void free or substantially void free electroplating fill material as determined by persons skilled in the art . when pvd ( or another process suitable for directionally ( geometrically ) influenced material deposition ) is used to deposit the pre - electroplating layer on the seed layer the non - conformability may be tuned to reduce or avoid deposition of the pre - electroplating on or near the bottom surface ( e . g ., 22 ) of the feature 20 , then the etching step can be eliminated . the lower portion of the sidewall ( or near the bottom surface ) can be defined as being a distance up from the bottom surface about equal to the width dimension of the feature . in the instance when the pre - electroplating deposition is performed using a pvd process , an efficiency associated with this process is the ability to immediately transition the pvd deposition process in a chamber in which plasma is generated for the pvd process to an argon etch process for directionally removing the pre - electroplating process without having to move the substrate being processed to another processing chamber . a conventional electroplating process , in which features are filled from the bottom up as shown by intermediate fill level indicator dashed lines 42 , 44 , 46 , 48 , to top out at a feature filled level 50 . the process of electroplating may cause the pre - electroplating layer to thin and disappear completely in portions of the feature side wall where it was originally present after etching . it is expected that at least some remnants of the pre - electroplating layer will be able to be detected in a structural investigation of the fill material in a feature of a dielectric layer at or near an original position of the pre - electroplating layer in the feature after the electroplating process has concluded . during electroplating the feature is typically filled with copper or other suitable material without any voids , is shown in fig6 . planarization , such as by cmp , removes the excess copper , i . e ., the portion of the feature filled level 50 of copper above the top surface of the dielectric layer 10 , and further processing continues . although co is the preferred pre - electroplating layer material , other materials such as pt , pd , and ru may be used . they have the advantage of not being attacked by conventional plating chemistries , and therefore may be deposited as a thin layer . this approach is counter intuitive and reduces the electroplating rate on the side wall while still maintaining a high ( acceptable ) current flow through the bottom surface of the feature to promote the electroplating rate at the bottom surface of the feature . while the foregoing is directed to implementations according to the present invention , other and further implementations may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow . | 7 |
the following description is presented to enable any person of ordinary skill in the art to make and use the present invention . various modifications to the preferred embodiment will be readily apparent to those of ordinary skill in the art , and the principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the embodiment shown , but is to be accorded the broadest scope consistent with the principles and features disclosed herein . the present invention is designed specifically for use by pharmacies which distribute prescriptions to patients in nursing homes , hospitals , or other large medical institutions . however , it will be realized by those of ordinary skill in the art that the present invention may be used by any pharmacy in distributing prescribed medicine . thus , the present invention is in no way limited to use in nursing homes and hospitals . referring to fig1 , the system 10 in accordance with the present invention includes a digital camera 12 for taking digital photographs of the patients , such as a kodak ™ digital camera ; a secondary computer 14 , such as an ibm compatible personal computer , for downloading the digital photographs from the digital camera 12 and converting the photographs into software objects ; a primary computer 16 , such as a midrange computer , for creating the labels ; and a printer 18 attached to the secondary computer 16 for printing the labels . for purposes of this discussion , it will be assumed that the system 10 will be used by a pharmacy to distribute medicine to patients in a nursing home . referring to fig2 , using the digital camera 12 , a pharmacist , or an agent or employee of the pharmacist , first takes a digital photograph of each nursing home patient . the digital camera 12 is then attached , via an appropriately configured port , to the secondary computer 14 which contains processing software 20 stored in a memory 21 for converting the digital photographs into software objects 22 , such as jpeg files . the photographs are then uploaded to the secondary computer 14 from the digital camera 12 and converted into software objects 22 . digital cameras are generally sold with processing software which will run under popular operating systems , such as windows 95 ™, which do this conversion . depending on the number of patients and the capacity of the digital camera 12 , this process may need to be repeated a number of times . additionally , as new patients enter the nursing home , their photographs must be taken as well . after conversion , the software objects 22 are temporarily stored on the secondary computer 14 in memory 21 . it will be realized by those of ordinary skill in the art that the secondary computer 14 may be any type of computer which is capable of performing the functions described herein . however , the secondary computer 14 will typically be an inexpensive ibm ™ compatible personal computer having a central - processing - unit ( cpu ), a bard drive for storing the processing software and the software objects , a random - access - memory ( ram ), a read only memory ( rom ), a monitor , a keyboard and a mouse , all running under windows 95 ™ or the like . the software objects are next uploaded from the secondary computer 14 to the primary computer 16 via appropriately configured ports on each computer , where they are indexed and stored in a photograph database 24 which is stored in a memory 25 . the primary computer 16 also includes stored in memory 25 a prescription database 26 which contains the prescription information of each patient , including the name of the patient , the name of the medicine and the dosage particulars , the name of the prescribing doctor , the name of the nursing home and the quantity of medicine in the prescription , and an inventory database 28 which contains information relating to the medicine which the pharmacist has in stock , including the identity of the manufacturers and the expiration date of the various medicines . the prescription database 26 and the inventory database 28 will be periodically updated as the prescription information of the patients change and as the pharmacist &# 39 ; s inventory changes . the primary computer 16 also includes a label algorithm 30 which will create the labels . while the primary computer may also be an ibm ™ compatible computer , it will generally be a more business oriented computer , such as an ibm as / 400 ™, having a more powerful cpu , more ram , more rom , and a hard drive having sufficient memory to hold the various databases described herein . it will be apparent to those of ordinary skill in the art , however , that the primary computer 16 may be any type of computer capable of performing the functions described herein . before any prescriptions are filled , the photographs should be confirmed by sending a grid sheet having the name and photograph of every patient to the nursing home , who will ensure that the names and photographs are correctly matched . in this way any errors which may have occurred during the photographing process can be corrected . when it comes time to fill a prescription for a patient , a pharmacist or a pharmacist &# 39 ; s technician or the like will run the label algorithm 30 using a terminal 32 connected to the primary computer 16 . typically , the label algorithm 30 will be launched through a master software module 33 which is used to control the overall operation of the primary computer 16 , including updating of the various databases . such master software modules are commercially available and are well known to those of ordinary skill in the art . referring to fig3 , which illustrates how the label algorithm functions , the pharmacist or pharmacist &# 39 ; s technician or the like will enter information which identifies the patient , such as the patient &# 39 ; s name or a prescription number . the label algorithm 30 will then retrieve the prescription information from the prescription database 26 , the corresponding photograph from the photograph database 24 and the medicine information from the inventory database 28 and combine the data to create a label . the label will then be printed on the printer 18 , which is preferably a laser printer for clarity , but which may be any type of printer . the printed label is then attached to the medicine container , preferably through an adhesive on the back of the label . it will be appreciated that a label algorithm in accordance with the present invention may be readily implemented by one of ordinary skill in the art . a sample label 34 in accordance with the present invention is shown in fig4 . as is clear from fig4 , the label contains a photograph of the patient , as well as the patient &# 39 ; s prescription information . additionally , the label contains the expiration date of the medicine ; a code which identifies the medicine manufacturer ; the name and address of the pharmacy which filled the prescription ; and a upc code generated by the label algorithm 30 which can be used by the pharmacy to automatically identify and track the prescription . it will be realized by those of ordinary skill in the art that the functions performed by the primary and secondary computers may in fact be performed on one computer instead of two , and thus the present invention is not limited to two separate computers . it will also be realized by those of ordinary skill in the art that the present invention is also not limited to use of a digital camera . for example , photographs may be taken using an ordinary camera . after developing , the photographs may be converted to computer software objects using a scanner or the like . nor , as discussed above , is the present invention limited to use in nursing homes , hospitals and the like . rather , it will be apparent to those of ordinary skill in the art that the present invention may be used in any type of pharmacy , including a consumer &# 39 ; s neighborhood pharmacy . for example , when a consumer goes to his neighborhood pharmacy to fill a prescription for the first time , the pharmacist can take his / her photograph and store the photograph in the pharmacist &# 39 ; s computer . each time the consumer fills a prescription , his / her photograph will be printed on the label . thus , in accordance with the foregoing the objects of the present invention are achieved . modifications to the above would be obvious to those of ordinary skill in the art , but would not bring the invention so modified beyond the scope of the appended claims . | 6 |
referring to fig1 , a cutter head assembly 10 has a cutter head body 12 rotatable about an axis extending through its end surfaces 14 , 16 . the cutter head body 12 has an outer periphery or side surface 18 extending between the end surfaces 14 and 16 . as shown , at least one slot 20 is formed in the cutter head body 12 and extends generally longitudinally between the end surfaces 14 , 16 . in the implementation of fig1 , there are 18 evenly spaced slots 20 . each slot 20 is configured to receive a knife blade 22 that is held in place within the slot 20 by a gib assembly 30 . for purposes of illustration , the uppermost slot 20 as depicted in fig1 is shown with the knife blade 22 and each of two gib assemblies 30 partially removed to reveal other components . as shown , each gib assembly 30 includes a gib 32 , at least one gib screw 34 configured to be received in a gib screw aperture 36 extending through the gib 32 . in the example of fig1 , each gib 32 has two such gib screws 34 and respective gib screw apertures 36 . referring to fig2 , which is a section of a portion of the cutter head assembly 10 , the relative positions of the knife blade 22 , the gib 32 and the gib screw 34 as installed in one of the slots 20 are shown . a projecting tip of the knife blade 22 extends beyond the outer periphery 18 of the cutter head body 12 and defines a cutting circle c . the gib screw 34 is tightened or loosened to cause the gib 32 to move within the slot and effect a clamping action on the knife blade 22 . in the illustrated implementation , the gib 32 urges the blade 22 against one side of the slot 20 as is described below in greater detail . portions of the gib 32 and the slot 20 have complementary geometry , as is best described in connection with fig2 - 4 . referring to fig4 , which shows a section of the gib 32 , the gib 32 has a shaped leading side 38 ( also called a forward side ) and an opposite trailing side 40 ( also called a rearward side ). in the illustrated implementation , the shaped leading side 38 includes a first angled segment 42 and a second angled segment 44 that is spaced away from the first angled segment 42 and one or more intermediate surface ( s ) 46 separating the first angled segment and the second angled segment . there are two such intermediate surfaces 46 in the implementation shown in fig4 . there is a bottom side 48 that connects the leading side 38 and trailing side 40 . the trailing side 40 includes a blade mounting surface 50 by which contact between the gib 32 and the knife blade 22 is made . optionally , the trailing side 40 may include a recessed surface 54 as shown that is dimensioned to remain spaced apart from the knife blade ( see fig2 ). a minimum knife indicator 52 can be defined at an interface between the blade contacting surface 50 and the recessed surface 54 . the minimum knife indicator 52 , if present , provides a visual indication to the operator of whether the knife has been worn beyond it usable extent . in addition , by providing a blade contacting surface 50 that is sized and shaped as shown , a clamping force can be achieved as desired , without undesirable point loading . a top side 56 of the gib 32 extends between the leading side 38 and the trailing side 40 . in the implementation shown in fig4 , there is forward top side region 58 and a rearward top side region 60 . referring again to fig2 , and particularly to the labeled empty slot , the illustrated section of slot 20 can be described as having a rearward side 70 ( also called the knife blade side ), a bottom side 72 and a forward side 76 ( also called the profiled side ). the bottom side 72 is joined to the rearward side 70 at a radiused corner 74 . similarly , the bottom side 72 is joined to the forward side 76 at a radiused corner 78 . the profiled side 76 has at least a first angled segment 80 and a second angled segment 82 . as illustrated , the second angled segment 82 is spaced apart from the first angled segment 80 by at least one intermediate surface 84 . in the specific implementation shown , there is one intermediate surface 84 extending approximately parallel to the rearward side 70 and another intermediate surface 84 angled forwardly or in a diverging direction . as shown in fig1 - 4 , and with specific reference to fig2 , the gib 32 and the slot 20 have respective angled segments configured for contact with each other and to effect a clamping action against the blade 22 . that is , the first angled segment 42 of the gib is configured to complement the first angled segment 80 of the slot . similarly , the second angled segment 44 of the gib 32 is configured to complement the second angled segment 82 of the slot 20 . the gib screw 34 is dimensioned to extend through the gib screw aperture 36 and into direct contact with the bottom side 72 of the slot , or , as illustrated , an optional insert 24 positioned to protect the bottom side 72 . as the gib screw 34 is threaded or unthreaded relative to the gib 32 , the gib 32 moves along the slot axis s and also moves laterally along the axis l due to the wedging action of the angled segments in contact with each other . the first angled segments can be described as defining a first convergent angle relative to the slot axis s in the direction from the bottom side of the slot outward . similarly , the second angled segments 44 , 82 can be described as defining a second radially converging angle relative to the slot axis s . in the illustrated implementation , the first angled segment 42 and the first angled segment 80 are configured to have approximately the same angular dimension , but in alternative implementations , these angles could differ . similarly , the second angled segment 44 and the second angled segment 82 have approximately the same angular dimension in the illustrated implementation , but these angles could differ . further , the first angled segments 42 , 80 may have angles that differ from the second angled segments 44 , 82 . in one implementation , the angled segments 42 , 44 , 80 and 82 are dimensioned to have angles of approximately 5 - 30 °. in another implementation , the angled segments 42 , 44 , 80 and 82 are dimensioned to have angles of approximately 15 - 25 °. in yet another specific implementation , the angled surfaces 42 , 44 , 80 and 82 are dimensioned to have angles of approximately 20 °. as shown in fig5 a and 5b , the gib screw 34 has a head 92 , a shaft 94 and an end 96 . the head 92 may have any suitable configuration . in the illustrated implementation , the head 92 is configured to have a socket head configuration , such as to receive a torx ® bit ( another type of a bit , such as an allen key , could also be used ). over time , the gib 32 may wear . in particular , the gib 32 can be shaped to focus wear to occur along its top side 56 and in a relieved region 99 by directing shavings away from the cutterhead . the wear that occurs on the gib 32 tends to reduce wear on the adjacent section of the cutter head body 12 , which is advantageous because the gib 32 can be replaced relatively easily and inexpensively . fig6 a , 6b and 6c illustrate alternative configurations for the relieved region 99 on the top side 56 of the gib 32 . in fig6 a , a section of the profile of the relieved region 99 has an angled leading segment 100 a that intersects an angled segment 104 a . in fig6 b , the relieved region 99 has a leading angled segment 100 b joined to a radiused segment 102 a , which is in turn joined to an angled segment 104 b . in some implementations , the segment 104 b is not present . in fig6 c , the relieved region 99 is defined by an angled segment 100 b which is joined to a radiused segment 102 b . as indicated , the radiused segment 102 b is slightly upturned by an angle d at the trailing side of the gib 32 . a specification implementation , the angle d is approximately 11 °, but could be in the range from about 0 ° to about 30 °. the described approaches for positioning and retaining a cutting blade can be implemented in any suitable configuration . for example , fig7 shows a large cutter head 110 having 36 slots and blades . in contrast , fig8 shows a small cutter head 120 having 18 slots and blades , similar to fig1 . of course , it would be possible to implement the same approach in a cutter head having more slots or fewer slots than the cutter heads 110 , 120 . the cutter head body 12 can be made of any suitable material , such as a high carbon steel . the gib 32 and gib screw 34 are also formed of suitable materials such as high carbon steel and / or tool steel . the knife blade 22 can be any commercially available knife blade , such as those sold by global tooling and supply of eugene , oreg . one suitable seal 37 is the parker model 2 - 010n70 seal . the insert 24 can be made of any suitable material , such as metal strapping material . in the illustrated implementations , the gib and slot are configured to have two sets of angled surfaces . in other implementations , it would be possible to achieve the same benefits using a fewer or greater number of angled surfaces . in view of the many possible embodiments to which the disclosed principles may be applied , it should be recognized that the illustrated embodiments are only preferred examples and should not be taken as limiting the scope of protection . rather , the scope of protection is defined by the following claims . we therefore claim all that comes within the scope and spirit of these claims . | 1 |
fig1 a is an architectural diagram illustrating network - extensible reconfigurable media appliance 100 according to an embodiment of the present invention . media appliance 100 comprises media unit 101 , controller 108 , communication unit 103 , and power module 116 . media unit 101 comprises audio and / or video ( a / v ) sensor 120 for sensing incoming audio and / or video . sensed video is stored in memory 110 using video format such as digital video disc ( dvd ), pal digital video cassette ( pal dvc ), pal or ntsc laserdisc , 24p hd , ¾ - inch , mpeg - 2 , mpeg - 4 ( dv - 25 , dv - 50 , imix , isma , etc . ), h . 264 , avi , dv , dvcam , dvcpro , dvcpro - 25 / 50 / 100 , vhs , d - vhs , w - vhs , digital - 8 , digital - s , d1 , d2 , d5 hd , betacam sx , digital betacam , other digital eng format , motion jpeg , any other hdtv format , ntsc , pal , hdd / raid / disk arrays , and / or other format for encoding video ( specifications for describing these formats are herein incorporated by reference ). media unit 101 optionally comprises biometric module 106 . biometric module 106 comprises finger - print scanner , retinal scanner , and / or other element for collecting a biometric sample , and stores scanned biometric data and / or result of biometric identification process in memory 110 . for example , a data structure is stored comprising a digital representation of collected biometric sample for authorization based on comparison with previously - stored biometric identifier . biometric module 106 optionally couples with a micro - array chip for genetically - based identification . media unit 106 optionally comprises reconfigurable logic and / or software 122 for performing programmable audio and / or video sensing , or for conversion to or from audio and / or video formats . controller 108 comprises microprocessor 123 ( such as one from the intel centrino processor family , the specification of which is herein incorporated by reference ), and optionally comprises co - processor 124 , digital signal processing ( dsp ) unit 125 , array processor 126 , and / or reconfigurable logic 127 . controller 108 performs audio and / or video processing on audio and / or video data residing in memory 110 . optionally in real - time manner , controller 108 performs on - the - fly audio processing and / or on - the - fly video processing on incoming encoded audio data and / or incoming encoded video data prior to storage of resulting processed audio data and / or resulting processed video data in memory 110 . controller 108 is implemented in application specific integrated circuit ( asic ) blocks , synthesizable intellectual - property cores , cell processors , reconfigurable logic blocks , field programmable gate arrays ( fpgas ), tensilica &# 39 ; s xtensa chip architecture and / or instruction set , single or multiple instruction single or multiple data ( s / mis / md ) architecture signal processing chips , sony “ cell ” chip , and / or other architecture for performing audio and / or video processing . controller 108 and / or a / v sensor 120 may perform color - space conversion , brightness , white - balance , backlight compensation , gain control , activity detection , motion detection , motion tracking , gamma correction , sharpening , multi - frame noise reduction , depth estimation , 2 - d bad - pixel correction , video compression , video stabilization , digital pan , digital tilt , digital zoom , and / or mosaicing for building panoramic images from successive frames . communication unit 103 comprises radio - frequency ( rf ) transceiver 128 for communicating via radio waves ( e . g . over cellular or other wireless network ), and / or network controller 129 for communicating via a wired and / or wireless network ( e . g . local area network ( lan ), wide area network ( wan ), wireless fidelity ( wifi ) network , etc .). communication unit 103 optionally comprises subscriber information module ( sim ) unit 130 and / or smart card unit for storage and / or retrieval of information about a user ( such as user preference , subscribed service , permission , account information , etc . ), and / or for allowing usage of media appliance 100 by one or more users . communication unit 103 optionally comprises gps module 112 for receiving gps data over satellite . optionally , gps module 112 is a micro gps transponder implemented in single chip or chipset . communication unit 103 optionally comprises acceleration detector 113 ( such as a gyroscope , a single - chip accelerometer or other element for detecting acceleration ) for determining orientation and / or acceleration of media appliance 100 . communication unit 103 optionally comprises reconfigurable logic or software 131 for performing programmable protocol translation , format conversion , network packet processing , network packet compression and / or decompression , communication encryption and / or decryption , and / or other communication processing . power module 116 provides power for media appliance 100 , and comprises ac and / or dc source , portable rechargeable battery , fuel cell ( e . g . direct methanol fuel cell , etc . ), and / or other source for providing electrical power . optionally , media appliance 100 employs mica microsensor platform for low - power wireless sensor networks , herein incorporated by reference . optionally , media appliance 100 architecture conforms to advanced telecommunication computing architecture ( advancedtca ), herein incorporated by reference . fig1 b is a diagram illustrating network - extensible reconfigurable media appliance 100 according to one embodiment of the present invention . light or video sensor 102 senses incoming image stream and stores digital representation in memory 110 . preferably , sensor 102 is a complementary metal oxide semiconductor ( cmos ) image sensor . optionally , sensor 102 is integrated with an image preprocessor . optionally , sensor 102 comprises integrated two - chip set such as pixim d1000 or d2000 video imaging system chip sets . sensor 102 optionally comprises a partition for post image processing steps . alternatively , sensor 102 is a charge - coupled device ( ccd ) or an active pixel sensor ( aps ) imager . audio sensor 104 senses incoming sound and stores digital representation of incoming sound in memory 110 using audio format such as audio interchange file format ( aiff ), mpeg layer 3 ( mp3 ), and / or other format for encoding audio information . i / o module 111 preferably has audio and video outputs . i / o module 111 preferably communicates with on - appliance display or screen unit 114 and on - appliance speaker 115 for displaying video and generating audio . optionally , display unit 114 comprises a teleprompter for displaying visual prompts ( such as text and / or pictures ). optionally , i / o module 111 communicates wirelessly , wired , over cellular network , over lan and / or over wan ( such as internet ), to send and / or receive gps data , digital rights management ( drm ) meta - data , audio and / or video plugins , and / or other instructions and / or data for processing and / or tagging of audio and / or video data . optionally , i / o module 111 has video and audio inputs for receiving audio and video signals from external audio and / or video source such as a camera , a pda , a media repository , a satellite , a security service , a drm service , a biometric service , a gps service , a pc or workstation , a cellular service or cellular device , or other device or service communicating with media appliance 100 . media appliance 100 optionally has network controller 117 for communicating with other devices and / or services over a network . fig2 shows memory 110 according to a preferred embodiment of the present invention . memory 110 comprises dynamic random - access memory ( dram ), static random - access memory ( sram ), high - speed flash memory , and / or removable memory ( e . g . removable flash memory card such as multimediacard ). memory 110 stores audio and video data 201 . optionally , memory 110 stores software instructions and data implementing billing 202 and / or business methods , such as a time - based pay - per - view and / or micro - billing feature . for example , memory 110 stores a data structure comprising a field describing a viewing ( such as a home - viewing of a video clip of video stream ) and / or a field indicating an amount to be charged for the viewing and / or a field identifying a party to be charged . optionally , memory 110 stores meta - data and / or instructions for implementing drm 203 ( e . g . disney media asset management ( mam ) format ), resource definition framework ( rdf ) implementation such as adobe &# 39 ; s xmp ( extensible metadata framework ), or other scheme for managing meta - data . for example , an xmp packet data structure comprising a header , an xml meta - data , a trailer , and a padding field is employed . optionally , memory 110 stores data and / or instructions for implementing drm according to a right expression language data model , for example employing extensible rights markup language ( xrml ). optionally , memory 110 stores meta - data and / or instructions for implementing proposed global release identifier syntax ( grid ), for example employing a data structure having an identifier scheme , an issuer code , a release number , and a checksum . optionally , memory 110 stores instructions and / or data 204 for performing digital authentication , encryption , decryption , key generation , digital signing , digital watermarking , and / or other instructions for performing security and / or privacy related computation on audio and / or video data , drm data , billing data and / or conditions , sensitive personal data , or other data residing in media appliance 100 and / or communicated to of from media appliance 100 . for example , memory 110 stores a data structure comprising a field describing an encryption ( and / or decryption ) key , and further stores instructions for encrypting a video stream using the encryption ( and / or decryption ) key . optionally , memory 110 stores instructions and / or data 205 for performing identity recognition ( such as facial recognition , emotion recognition , voice recognition , and / or other pattern or identity recognition ) on video data 201 and / or on incoming video signal . for example , memory 110 stores a data structure comprising an identifier for a database against which image recognition is to be performed , for example a database of faces for recognizing faces in a crowd . the database may be stored ( partially or completely ) internally on media appliance 100 or reside externally on a server . as another example , memory 110 stores a data structure comprising a feature extracted from a video stream and / or video clip ( using image extraction instructions stored in memory 110 ), and the extracted feature is used for a data base query or is sent to a server for further handling . optionally , memory 110 stores instructions and / or data for performing authoring 206 and / or digital video editing ( e . g . linear or non - linear editing ), compositing , and / or special effects , such as apple &# 39 ; s final cut pro software . for example , memory 110 stores a data structure comprising a bit rate associated with the encoding of a video clip and / or video stream . as another example , memory 110 stores a data structure comprising author information , genre information , title , characters , actors , genre , story , activities , viewer demographics , locations , scenes , backgrounds , props , objects , set pieces , or other information pertaining to a video clip and / or video stream . optionally , memory 110 stores instructions and / or data for tagging 207 the digital representation of a sensed scene ( video stream and / or video clip ) with meta - data . for example , memory 110 stores a data structure comprising time , media appliance location ( such as provided by gps module 112 ), media appliance orientation and / or media appliance acceleration ( such as provided by acceleration detector 113 ), multi - lingual features ( allowing for translation , subtitles , voice - over , etc . ), cues to a theater automation system ( such as instructions for house lights to go up , half - way up , or down , or instructions to open or close curtains , etc . ), instructions for allowing or disallowing content ( such as trailers or promotional clips ) to play next to other similar content , information indicating suitability of content for different audiences such as children , information indicating any promotional offers , products and / or services ( such as advertisements , product catalogs and / or coupons for products and / or services ), information allowing for organizing and / or managing meta - data available to advertisers and / or service providers , and / or other information describing , identifying and / or relating to content . drm meta - data and / or instructions optionally comprise flags for implementing rights and / or limitations of reproduction , rights and / or limitations of public performance , rights and / or limitations of display , rights and / or limitations of distribution , rights and / or limitations of importation , rights and / or limitations of transmission or access , rights and / or provisions under digital millennium copyright act ( dmca ), rights and / or limitations of caching , rights and / or limitations of browsing , rights and / or limitations of storage , rights and / or limitations of transfer such as burning to compact disk ( cd ) or dvd , rights and / or limitations of referring or linking or framing , rights and / or limitations of streaming or downloading , rights and / or limitations of advertising , or other rights and / or limitations and / or provisions . for example , memory 110 stores a data structure comprising a field identifying a video clip or video stream , and a field for indicating whether a reproduction right is granted for the identified video clip of video stream . in another example , memory 110 stores a data structure comprising a field identifying a video clip or video stream , and a field for indicating whether a public performance ( and / or display ) right is granted for the identified video clip of video stream . other digital rights can be implemented analogously . drm meta - data and / or instructions optionally support secure promotion , sale , delivery , distribution , and / or usage tracking of digital content . optionally , execution environment is partitioned into kernel versus user space and / or into standard versus trusted partitions according to microsoft &# 39 ; s next - generation secure computing base ( ngscb ). media appliance 100 optionally inserts , deletes , and / or modifies a label in an rdf ( e . g . xmp ) tag describing a media segment . media appliance 100 optionally implements content authenticity , device authentication , and / or user authentication . content authenticity comprises digital watermarking , digital fingerprinting , and / or other technique for content authentication . for example , memory 110 stores instructions for reading an identifier describing a source of a video clip and / or video stream , wherein the identifier is embedded in a digital watermark within the video clip and / or video stream . as another example , memory 110 stores a data structure comprising a field identifying one or more authorized sources for downloading video clips and / or video streams . device authentication comprises smartcards , public key certificates , and / or device for performing authentication . user authentication comprises biometrics using biometric module 106 , passwords , and / or other technique for performing user authentication . media appliance 100 optionally implements , in software ( e . g . residing in memory 110 ) and / or hardware , an abstraction layer between application and display , such as dvb ( digital video broadcast ) and / or mhp ( multimedia home platform ) abstraction layers . specifications for incorporating the dvb and mhp formats are herein incorporated by reference . fig3 a shows networked media appliance 100 communicating with other device and / or service , according to a preferred embodiment of the present invention . communication with other device and / or service proceeds via direct network connection , internet , wifi , ieee 802 . 11 , ieee 802 . 16 , ieee 802 . 15 . 4 , zigbee specification , cellular , bluetooth , universal serial bus ( usb ), apple &# 39 ; s firewire , and / or other communication channel or protocol . communication is optionally encrypted , authenticated and / or digitally signed , preferably with encryption engine 204 implemented in memory 110 , or alternatively with encryption engine 204 implemented in controller 108 . media appliance 100 optionally communicates with media repository 307 for downloading and / or uploading video and / or audio clips , video and / or audio meta - data such as author information , genre information , title , characters , actors , genre , story , activities , demographics , locations , scenes , backgrounds , props , objects , set pieces , etc . media appliance 100 optionally communicates with drm service 308 for downloading and / or uploading drm meta - data . optionally , media appliance 100 generates a message indicating an infringement and / or other violation of digital rights , according to a set of drm rules , such as copying without permission , broadcasting without permission , etc . for example , memory stores a data structure comprising a field identifying a video clip and / or video stream , and an indicator of a violation of a drm rule , such as an act of broadcasting the video clip and / or video stream without permission . media appliance 100 optionally communicates with security service 309 to upload security information such as video and / or audio record of scene , identity recognition data as computed by identity recognition instructions 203 , gps data as provided by gps module 112 , directional data as provided by acceleration detector 113 , and / or to download security information such as location to watch , identity data to store for matching against images , and / or voice audio signature to store for matching against audio clips . for example , media appliance 100 sends a data structure to security service 309 , wherein the data structure comprises a field identifying a person , and a field identifying the location of the media appliance 100 at the time the person is sensed by media appliance 100 . optionally , media appliance 100 couples to police authority for providing live and / or recorded footage and / or triggering alarm and calling police according to built - in media appliance intelligence for identifying potential dangerous and / or suspicious conditions . media appliance 100 optionally communicates with biometric service 301 to upload biometric information obtained by biometric module 106 , and / or to download biometric signature for matching against incoming biometric data . media appliance 100 optionally communicates with gps service 302 , such as gps satellites , to receive gps information . for example , if media appliance 100 moves into a restricted area , as indicated by gps service 302 and / or by information residing on media appliance 100 and / or obtained remotely , gps unit 112 activates an alert . for example , memory 110 stores a data structure comprising a field identifying a restricted geographical area , and media appliance 100 generates an alarm when location of media appliance 100 , as indicated by gps service 302 , falls within the restricted geographic area . media appliance 100 optionally communicates with news service 310 and / or other objective information service . in one embodiment , media appliance 100 receives a data structure from news service 310 , the data structure representing a digital template and comprising a field identifying a location , and one or more fields identifying elements to be covered by reporter ( such as a person to interview , a particular place to point out to viewers , other news reporters covering the same news story , etc .). media appliance 100 optionally communicates with sports broadcasting network , game - show broadcasting network , and / or other gaming or competition - related network 311 . in one embodiment , media appliance 100 receives a data structure from sports broadcasting network 310 , the data structure comprising a field identifying one or more competing parties , a field identifying a location of the competition , and a field indicating the competition schedule . media appliance 100 optionally communicates with private service 312 . in one embodiment , media appliance 100 receives a data structure from movie production source or network 310 , the data structure comprising a field identifying one or more movie or media production , a field identifying a location of the production , a field indicating the production schedule , a field indicating one or more scenes , and a field indicating one or more cast or staff members . media appliance 100 optionally communicates with renderer 313 to display video data . renderer 313 comprises a cinema or movie theater , television receiver , computer display , imax display , a digital audio broadcast ( dab ) broadcaster , a satellite broadcaster , a digital tv , a high definition tv ( hdtv ), a pda and / or cellular phone ( or other mobile device display ). media appliance 100 optionally communicates with a personal computer ( pc ) and / or workstation 303 and / or other computing device for synchronization of data residing on media appliance 100 with computer 303 ( optionally interfacing with media repository manager and / or program manager residing on computer 303 ). for example , memory 110 stores a data structure comprising a field indicating the time of last synchronization of media appliance 100 with computer 303 ( or media repository manager or program manager residing on computer 303 ). communication proceeds wirelessly and / or via a cradle ( coupled to computer 303 ) into which media appliance 100 is placed for synchronization . in one embodiment , media appliance 100 comprises a user interface offering a synchronization button ( hard button on media appliance 100 and / or soft button displayed in media appliance &# 39 ; s 100 graphical display ), activation of which causes described data synchronization . media appliance 100 optionally communicates with pda 304 , cellular service and / or device 305 , and / or other mobile service and / or device for displaying video and / or audio data . media appliance 100 optionally communicates with other networked media appliance 306 for exchanging video and / or audio clips and / or for collaborating in the production of a media project , wherein a media appliance is assigned a token ( number , string , etc . ), statically or dynamically , for identifying the media appliance . media appliance 100 optionally communicates with other networked media appliance 306 to enable video - conferencing and / or multi - way collaboration , for example , in business meetings , real estate transactions , distance learning , sports , fashion shows , surveillance , training , games , tourism , etc . for example , memory 110 stores a data structure comprising a field for describing a group of collaborating media appliances 100 , and a field identifying media appliance 100 itself among the group of collaborating media appliances . fig3 b is a diagram illustrating network - extensible reconfigurable media appliances communicating over a network with a server , according to an embodiment of the present invention . one or more client media appliances 330 communicate over a network 331 with server 332 . network 331 is a combination of one or more wired and / or wireless networks such as the internet , a lan , a wan , a satellite network , or other network for communication . in one embodiment , server 332 is a news server , having a script or digital template for producing a news program . server 332 delegates the recording or streaming of various predetermined pieces of audio and / or video footage to the various media appliance clients 330 , wherein the recorded or streamed pieces will serve to fill - in the server 332 script or digital template for producing the news program . in another embodiment , server 332 is a server for sports or other competition , having a script or digital template for producing a sports program or a program for other competitive activity . server 332 delegates the recording or streaming of various predetermined pieces of audio and / or video footage to the various media appliance clients 330 , wherein the recorded or streamed pieces serve to fill - in the server 332 script or digital template for producing the sports ( or other competition ) program . in one embodiment , i / o module 111 presents a user interface ( ui ), comprising a combination of hard ( physical ) buttons and / or soft ( graphical ) buttons for accessing and using billing functions , drm functions , authentication , identity recognition , digital editing of media , and / or other services as shown in fig3 a and described above . for example , a view ( for example comprising a button ) is presented via display 114 to allow approval of a billing associated with the viewing of video data . as another example , a view is presented via display 114 , allowing selection of one or more audio and / or video data for submission or transmission to a server 332 , such as a news server or a sports server , as described above . selection of a presented audio and / or video data designates the selected data for submission or transmission to the server . optionally , interfaces and media appliances are physically separate , wherein through an interface a user can tap into a pool or one or more media appliances to view available audio and / or video data , and / or select one or more available audio and / or video for submission or transmission to a server 332 , as described above . as another example , a view is presented at server 332 for approving the inclusion of a submitted or transmitted audio and / or video data into a script or a digital template for a news or sports program , wherein the audio and / or video data is submitted by a media appliance client 330 to server 332 , as described above . fig4 is a flow diagram illustrating a method for sensing according to one embodiment of the present invention . the method begins with pre - production 401 . pre - production comprises employing 402 a script and / or storyboard flowchart , or employing 403 a digital template 403 . a portion of this front - end may be implemented automatically or manually in software , comprising analysis , design , development , production , implementation or evaluation of script , storyboard , and / or digital template . optionally , frames and / or scenes are labeled ( via meta - data ) according to script , storyboard , or digital template in use . a script or storyboard is downloaded over a wired and / or wireless network , made available via removable storage ( e . g . memory card and / or disk ), or is alternatively created on media appliance . a digital template describes how to construct a video and / or multimedia document by sensing ( i . e . “ shooting ” or recording ) and assembling individual scenes and / or segments in particular order , and is downloaded over a wired and / or wireless network or created on media appliance . alternatively , user of media appliance 100 may decide not to consult a script , storyboard , or digital template , and proceed directly to sensing 404 . one example of a template is a template for insurance inspection of vehicle accidents , wherein the template indicates “ slots ” for video clips , taken from various angles , of the vehicles involved in the accident , as prescribed by an insurance company . optionally , media appliance 100 adaptively guides media appliance operator in making discretionary decisions to take alternate script paths and / or alter flow of script ( or storyboard or digital template ) or generally deviate from the script , for example when dealing with emergency conditions and / or events which do not occur according to script . such guidance may employ non - deterministic scripts , according to logic specified using bayesian modeling , neural networks , fuzzy logic , and / or other technique for making decisions under complex conditions and / or under incomplete information . for example , in one embodiment a cast member in a script is described by fuzzy attributes , such as “ a female actor with at least five years drama experience ” in leading role ( instead of or in addition of identifying the lead role actor by name ). then , in case the lead actor canceling her engagement , instructions employing fuzzy logic perform a search for actors matching the fuzzy attributes to dynamically recommend one or more candidates to fill the role . optionally , digital template or script is non - linear , allowing for one or more branching points . a branching point allows the script and / or template to flow in more than one path . for example , scene ( or clip or stream ) a can be followed by scene b or scene c , depending on which branch of the branching point following a is taken . for a viewer , a media presentation prepared according to such non - linear template or script allows for a multiplicity of presentations comprising different scene ( or clip or stream ) orderings . for a viewer , the decision of which of the alternate paths to follow in a branching point can be viewer selected , randomly chosen , based on external variable ( such as a combination of one or more of : weather , temperature , stock quotes , time of day or year , viewing location , amount of money left in viewer &# 39 ; s account , or any other external variables ), based on biometric sensing of viewer , based on the result of an identity or emotion recognition procedure on viewer ( such as distinguishing between happiness , sadness , excitement , apathy , interest in a particular aspect of the presentation and / or other emotions or indications of interest exhibited by viewer ), based on real - time input from viewer or from larger audience ( such as deliberate viewer decision of which script or template path to take next , provided via an input device or detected by the presentation module ), or based on other variables . such non - linear template or script allows for example for the production and presentation of a pg - rated , r - rated , or x - rated version of a given movie depending on the audience ( for example a parent may elect to view the r - rated version of the movie while electing a pg - rated presentation for the children ). as another example , a wedding template or script may allow for different presentations based on whether the bride &# 39 ; s family or the groom &# 39 ; s family is viewing . as another example , a mystery presentation may offer alternate endings , based on viewer input or external variables as described above . media appliance 100 senses 404 video and / or audio and stores a digital representation in memory 110 . optionally , multiple audio and / or video streams are sensed , either by the same media appliance or by collaborating media appliances , wherein synchronization is provided for the multiple streams , in the form of meta - data tags describing related scenes and / or streams and / or frames , and / or in the form of meta - data describing time stamps relating different scenes and / or streams . for example , memory 110 stores a data structure comprising one or more fields identifying one or more related video scenes and / or streams and / or frames , and a field indicating the nature of the relation ( for example indicating that the video scenes and / or streams and / or frames represented different viewing angles of the same sensed object ). media appliance 100 then post - produces the stored digital representation , using controller 108 and / or audio or video plugin stored in memory 110 . the post - produced digital representation is then stored 406 in memory 110 ( or in other storage medium such as optional on - appliance hard - disk or storage tape for storing data ), displayed 407 on on - appliance display unit 114 , and / or sent for off - appliance display and / or exhibition ( e . g . for imax display according to imax 15 / 70 format , or for texas instruments dlp ( digital light processing ) format ), or for digital remastering according to imax &# 39 ; s dmr ( digital remastering ) format , or for satellite distribution ( e . g . to digital audio broadcast ( dab ) distribution scheme to dab enabled devices such as pdas , cellular phones , personal audio and / or video players , or other devices for presenting audio and / or video ). optionally , communication of media appliance 100 with other devices and / or services complies with atsc dase ( advanced television systems committee digital tv application software environment ) architecture , incorporated herein by reference . fig5 is a flow diagram illustrating a method for optionally filling - in a template according to a preferred embodiment of the present invention . starting 501 with a template , sense 502 a first scene according to the template , and fill - in 503 sensed scene in template . if no additional scene is desired 505 , finish 506 , else 504 proceed to step 502 and repeat until done . template is stored in memory 110 comprising suitable format such as the advanced authoring format ( aaf ). fig6 is a flow diagram illustrating a method for optionally tagging audio and / or video representation with information contained in a meta - data structure . upon sensing 601 a scene , the digital representation of the sensed scene is tagged 602 with meta - data . meta - data comprises time , media appliance location ( such as provided by gps module 112 ), media appliance orientation and / or media appliance acceleration ( such as provided by acceleration detector 113 ), multi - lingual features ( allowing for translation , subtitles , voice - over , etc . ), cues to a theater automation system ( such as instructions for house lights to go up , half - way up , or down , or instructions to open or close curtains , etc . ), instructions for allowing or disallowing content ( such as trailers or promotional clips ) to play next to other similar content , information indicating suitability of content for different audiences such as children , information indicating any promotional offers , products and / or services ( such as advertisements , product catalogs and / or coupons for products and / or services ), information allowing for organizing and / or managing meta - data available to advertisers and / or service providers , and / or other information describing , identifying and / or relating to content . tagging may be done per scene , per frame , per audio and / or video stream ( e . g . when multiple streams are present ), or per other defined segment of audio and / or video . for example , a video scene is tagged with meta - data comprising a field identifying the language used in the video scene . as another example , a video stream is tagged with meta - data comprising a field indicating a warning against viewing by children . fig7 is a flow diagram illustrating a method for transferring data and / or instructions from off - appliance source to on - appliance memory . after determining 701 off - appliance source , such as external repository ( for templates , plugins , drm data , encryption keys , media clips , security data , biometric data , gps data , etc . ), proceed by transferring 702 data and / or instructions from determined off - appliance source to on - appliance memory 110 . in one embodiment , media appliance 100 is a member of a distributed group of media appliances 100 , for example in a distributed network of media appliances 100 and / or in a peer - to - peer configuration of media appliances 100 . a media appliance 100 dynamically joins and / or leaves a distributed group of media appliances 100 , in parallel and / or serially with other media appliances 100 . alternatively , media appliance 100 initiates a distributed group of media appliances 100 , allowing for other media appliance &# 39 ; s 100 to dynamically join and / or leave the group . in one embodiment , the group of media appliances 100 collaborates to cover an event , such as a sporting event , a public political event ( e . g . a rally ), a family event ( e . g . a wedding ), or other event . media appliances 100 tag sensed audio and / or video data as described above ( e . g . with gps information , time stamps , drm meta - data , or other information previously described ), allowing reconstruction of covered event from the audio and / or video data collected by distributed media appliances 100 . memory 110 stores instructions and / or data for initiating , joining , leaving and / or querying the status of or information about such a distributed group of media appliances 100 . foregoing described embodiments of the invention are provided as illustrations and descriptions . they are not intended to limit the invention to precise form described . in particular , it is contemplated that functional implementation of invention described herein may be implemented equivalently in hardware , software , firmware , and / or other available functional components or building blocks , and that networks may be wired , wireless , or a combination of wired and wireless . other variations and embodiments are possible in light of above teachings , and it is thus intended that the scope of invention not be limited by this detailed description , but rather by claims following . | 6 |
the circuit sections of a complete interface circuit according to the present invention , shown as a whole in the block diagram of fig3 are hereinbelow described individually for ease of description . a satisfactory circuit structure for generating the reference voltages vref -- p and vref -- n is shown in fig4 a . the reference voltages vref -- p and vref -- n are instrumental , as will become clearer through the following description , for ensuring a protection of the gate oxide of transistors subject to the high voltage , by keeping the difference of potential between the gate and the drain and source diffusions of p - channel and n - channel transistors of the different stages that make up the interface circuit of the invention , below a limit value on account of the physical characteristics of the devices and which is defined by the following equations : ______________________________________vdd high - vref . sub .-- p ≦ vmax ( 1 . 1 ) vref . sub .-- p ≦ vmax ( 1 . 2 ) vref . sub .-- n - gnd ≦ vmax ( 2 . 1 ) vdd high - vref . sub .-- n ≦ vmax ( 2 . 2 ) ______________________________________ where vmax is the maximum voltage applicable to the gate oxide and which generally corresponds to the maximum value of vdd low , for instance 3 . 3v + 10 %= 3 . 6v . the above relationships must be satisfied for the entire range of vdd high ( for example : 5v ± 10 %) and of vdd low ( for example : 3 . 3v + 10 % to 3 . 3v - 20 %). a circuit for generating the reference voltage vref -- p may be composed a chain of a variable number of p - mos transistor , such as to provide a partition of the high supply voltage , whereby vref -- p may be derived from an intermediate voltage tap . this reference voltage vref -- p is applied to the gate of cascoding p - channel transistors that are employed where it is necessary to maintain the difference of potential across the gate oxide of p - channel transistors below the limits set by the equations ( 1 . 1 ) and ( 1 . 2 ). as far as the other reference voltage vref -- n is concerned , this may be available through a direct connection to vdd low , according to the scheme shown in fig4 b , otherwise it may be derived from a tap of a voltage divider line of the high supply voltage , similarly to vref -- p , as shown in fig4 a . alternatively , according to an important embodiment of the invention , it is possible to employ dedicated generators for generating both reference voltages , substantially independent from variations of the supply voltages , as it will be illustrated below . the circuits for generating the required reference voltages can be realized in any suitable form of the innumerable known forms and they may contemplate the addition of capacitive decoupling elements or be realized with source follower stages , as in the example illustrated in fig4 c , or with voltage follower stages . by referring to fig5 the level rising stage is illustratively constituted by a cascode structure . the n - channel section is cascoded by means of an n - channel transistor , whose gate can be directly coupled to the low supply voltage ( 3v ), whereas the p - channel sections are cascoded by means of a p - channel transistor whose gate is coupled to the reference voltage vref -- p . the level rising stage is driven by the input data stream a and by the inverted signal ( of opposite phase ) an . starting from a condition where a is low , the an phase will be high , that is at 3v . the node a3 will be at 3v - v t - n while the node a4 will be low . the node a7 will be also low and the node a6 will be at 5v . the output a1 ( df1 ) will be low and precisely at a voltage given by 5v - vref -- + v t - p , while the output a2 ( df2 ) will be high , practically at 5v . when the input signal a becomes high , an becomes low , the internal nodes a3 and a4 switch , between the ground potential and the voltage given by 3v - v t - n , respectively , whereas of the other pair of nodes , a7 rises to 5v while a6 drops to ground potential . the output a1 ( df1 ) rises to 5v while the output a2 ( df2 ) drops to a potential given by 5v - vref -- p + v t - p . by referring to fig6 an essential aspect of the circuit of the invention is the presence of an overdriving stage of the p - channel pull - up device of the output buffer stage ( off - chip driver ), which comprises in essence an n - channel diode coupled in series on the driving line of the pull - up device of the output buffer and a drain follower stage having a cascode architecture . the stage may be composed by the transistors of the cascoded pull - up section of the drain follower stage formed by md6 and md5 , by the n - channel diode md2 and by the transistor md4 of the pull - down section drain follower stage . eventually , a second diode md3 may be inserted , in case the variation range of vdd high exceeds 5 . 5v . the stage , besides ensuring an adequate overdriving , increases the speed of rise and fall of the driving node voltage of the pull - up transistor of the output buffer . the output buffer can have a structure as shown in fig7 a . the p - channel transistors , md6 and md5 , belonging to the drain follower of the overdriving stage act as boosters during the rise of the voltage transient on the driving node of the pull - up transistor p10 of the output buffer , while md2 and md4 provide for a fast discharge path of the driving node . in prior art cascoded structures , the p - channel section of the output buffer stage , is driven with a signal variable within the following voltage ranges : ______________________________________low logic level high logic level______________________________________vref . sub .-- p + vtp vdd high______________________________________ since to p - channel transistors may be attributed a driving capacity proportional to the absolute value of vgs - vtp ( voltage between the gate and the source less the threshold voltage of the transistor ), it occurs that in cascoded structures of prior generation devices the overdriving of the p - channel part be proportional to : as noted , there exist a vtp term that contributes to reduce the overdriving of the p - channel section of the output buffer below the maximum level allowed by the constrains of equations 1 . 1 , 1 . 2 , 2 . 1 , 2 . 2 . this represents a factor of turn - off loss in respect to the theoretical efficiency permitted by the aforementioned equations . in these circuits the vtp term may be estimated to be about 1v , and therefore the loss of performance is rather sensitive . indeed , in a saturation state , the current in a transistor is proportional to the square of the voltage between the gate and the source . by passing from an overdrive proportional to 2v to one proportional to 3v , the current pulled by the p - channel transistor increases by a factor equal to 9 rather than to 4 . according to an aspect of the invention , an n - channel transistor , md1 , configured as a diode ( fig6 ), is connected in series between the output a2 ( df2 ) of the level rising stage ( fig5 ) and the driving ( gate ) node of the p - channel transistor p - 10 of the output buffer ( fig7 a ), in order to lower the gate voltage of the p10 transistor by a quantity vtn , approximately equal to vtp , so that the overdrive of the pull - up transistor p10 of the output buffer is , for the example shown , given by the following expression : the drain follower stage , inserted between the voltage rising stage and the output buffer stage , permits the adjustment of the negative term vtp , when necessary , or in other words , only during the switch - up phase of the output node , while maintaining , during the switch - down phase of the output node , the high logic value vdd high . this avoids current flows between the supply rail and ground in absence of transitions . to this end , is directed the unique coupling of the overdriving stage with the level lifting stage , so as to exploit the nodes thereof that more quickly reach the new state following a transition ( switching ) of the input node a . when implementing the invention in a 5v capable output section of a bi - directional i / o cell , the output buffer can be further provided with pull - down or pull - up structures , as schematically shown in fig7 b . when the output section of the bi - directional cell is disabled , the pull - down or pull - up circuits assign a high or a low logic value , respectively , to the node z that constitutes the input of the input section of the bi - directional cell . in this kind of bi - directional cells is implemented an enabling function that permits the use of the interfacing cell either as an output or as an input cell . the input portion of such bi - directional cells must be realized so as to withstand the high supply voltage , according to any of the known techniques . the description of such an input portion of the cell &# 39 ; s circuit is not included here because it is not pertinent to the subject matter of the present invention neither it is necessary for a thorough comprehension of the invention . by referring to fig5 and 7a ( or 7b ), on a fall down front of a , the node a1 is the one that more rapidly reaches ground potential , while on the rise up front of a , the compensation function of the term vtp , superfluous in the drain follower stage , is activated by means of the transistor md4 , which quickly reduces the gate voltage of the transistor p10 to a value approximately equal to vref -- p . moreover , on the fall down front of a , the output node is rapidly discharged through the transistor n7 , along a direct path . in terms of speed of propagation , the signal paths no longer comprise , as in the known circuits , the voltage lifting stage , thus increasing considerably the performances of the circuit of the invention in comparison with a prior art circuit . in the present context , an improvement of the performances means : 1 ) possibility of interfacing high supply voltage circuits with optimized low voltage circuits , without the risk of deteriorating the gate oxide layer ; 2 ) minimizing the loss of propagation speed in lifting the voltage from vdd low to vdd high ; 3 ) sufficient speed and drive capability for a large number of applications ; and 4 ) flexibility of the circuit to interface also with voltage levels different from those presently used ( 3 . 3v and 5v ), for example between 2 . 0v and 3 . 3v , or others . fig8 shows operating diagrams obtained by computer simulation of a circuit like that illustrated in fig5 for the conditions indicated and a data stream frequency of 20 mhz . according to a further aspect of the invention , it is possible to further improve the performances of the interface by also overcoming some limitations of the above described embodiments . from equations 1 . 1 and 1 . 2 we note that the minimum voltage value applicable to the gates of the p - channel transistors is given by : according to the above described embodiments , the reference voltage vref -- p is obtained as a fixed fraction of the vdd high voltage . this does not guarantee an ideal condition under all the conditions . for example , assuming vmax = 4 . 0v , and vref -- p = 2 / 6 * vdd high we would have : ______________________________________vdd high 4 . 5 5 . 0 6 . 0vref . sub .-- p 1 . 5 1 . 6 2 . 0vref . sub .-- p ideal 0 . 5 1 . 0 2 . 0______________________________________ the deviation from the theoretical minimum for vref -- p , that is , the deviation from a condition of maximum performance is rather marked . even for vref -- n we would have a similar deviation from the theoretical maximum value and that reached by the circuit of fig4 c - 8 . a considerable improvement of the performances by generating a reference voltage equal to vmax , to be used as vref -- n and a vref -- p reference voltage equal to : a circuit that will realize the above conditions is marginally more complex , but it may be considered that part of the circuit could be shared by a plurality of interfacing cells towards a high voltage , for example by integrating a reference voltage generator for each row of i / os on the chip , or for portions of each row . such reference voltage generators could be physically realized for example in &# 34 ; corner areas &# 34 ; of the chip , where there is usually space available or in a so - called core cell . fig9 shows the logic blocks that would realize such a dedicated reference generator . first of all , a bandgap cell is used to produce a fixed reference voltage , given by the voltage between the base and the emitter of a parasitic bipolar transistor , therefore independent of the supply voltage and equal to about 1 . 2v . such value is then increased up to vmax by an operational amplifier op amp connected in a noninverting configuration and having a voltage gain given by : an output voltage , independent of the supply voltage and determined only by the respective value of the resistors r2 and r1 is obtained . the so obtained vmax voltage can be used as vref -- n so as to ensure the reaching of the theoretically permissible limit . finally a diff structure may be used to produce a static difference between the vdd high voltage and vmax in order to provide the other reference voltage required vref -- p . even in this case , the reaching of the maximum theoretical value is ensured . intuitively , the circuit of the invention , according to the alternative embodiments shown in fig3 and in fig9 may conveniently have an expandable modular structure . for example , the overdriving stage ( fig6 ) can drive in parallel more output buffers , or a parallel arrangement of the three modules in cascade , namely : the level lifter stage , the overdriving stage and the output buffer , respectively , may be realized . more generally , combinations of circuit blocks realized according to the invention are possible , to satisfy speed and load specifications of the interface required for a particular application . | 7 |
with reference to fig1 to 6 , an overall configuration of a personal watercraft 10 , an overturn switch 12 , and various control routines will be described . the watercraft 10 preferably employs an ecu ( electronic control unit ) 13 . the ecu 13 , the overturn switch 12 , and the disclosed control routines have particular utility for use within the personal watercraft 10 , and thus , are described in the context of personal watercraft . the ecu 13 , the overturn switch 12 , and the control routines , however , also can be used in conjunction with other types of watercraft , such as , for example , small jet boats , and other vehicles that operate on a body of water . with reference to fig1 the illustrated watercraft 10 includes a hull 14 that is defined by a lower portion 16 and a top portion or deck 18 . these portions of the hull 14 are preferably formed from a suitable material , such as , for example , a molded fiberglass reinforced resin . a bond flange 20 preferably connects the lower portion 16 to the deck 18 . of course , any other suitable means may be used to interconnect the lower portion 16 and the deck 18 . alternatively , the lower portion 16 and the deck 18 can be integrally formed . as viewed in the direction from the bow to the stem , the deck 18 includes a bow portion 22 , a control mast 24 , and a rider &# 39 ; s area 26 . the bow portion 22 preferably includes a hatch cover ( not shown ). the hatch cover preferably is pivotally attached to the deck 18 such that it is capable of being selectively locked in a substantially closed watertight position . a storage bin ( not shown ) preferably is positioned beneath the hatch cover . the control mast 24 supports a handlebar assembly 28 . the handlebar assembly 28 controls the steering of the watercraft 10 in a conventional manner . the handlebar assembly 28 preferably carries a variety of controls for the watercraft 10 , such as , for example , a throttle control ( not shown ), a start switch ( not shown ), and a lanyard switch ( not shown ). additionally , a gauge assembly ( not shown ) preferably is mounted to the upper deck section 18 forward of the control mast 24 . the gauge assembly can include a variety of gauges , such as , for example , a fuel gauge , a speedometer , an oil pressure gauge , a tachometer , and a battery voltage gauge . in particularly preferred arrangements , a warning lamp or other suitable alerting device can be disposed proximate or within the gauge assembly . the rider area 26 lies rearward of the control mast 24 and includes a seat assembly 30 . the illustrated seat assembly 30 includes at least one seat cushion 32 that is supported by a raised pedestal 34 . the raised pedestal 34 forms a portion of the upper deck 18 and has an elongated shape that extends longitudinally substantially along the center of the watercraft 10 . the seat cushion 32 can be removably attached to a top surface of the raised pedestal 34 by one or more latching mechanisms ( not shown ) and , in the illustrated arrangement , covers the entire upper end of the pedestal 34 for rider and passenger comfort . an engine access opening 36 preferably is defined in the upper surface of the illustrated pedestal 34 . the access opening 36 opens into an engine compartment 38 formed within the hull 14 . the seat cushion 32 can be disposed on a support plate that normally covers and substantially seals the access opening 36 to reduce the likelihood that water will enter the engine compartment 38 . when the seat cushion 32 and the associated support plate are removed , the engine compartment 38 is accessible through the access opening 36 . the interior of the hull 14 includes one or more bulkheads 40 that can be used to reinforce the hull 14 internally and that also can serve to define , in part , the engine compartment 38 and a propulsion compartment 42 . the propulsion compartment 42 is arranged generally rearward from the engine compartment 38 . an engine 43 is mounted within the engine compartment 38 in any suitable manner preferably at a central transverse position of the watercraft 10 . a fuel tank 44 preferably is arranged in front of the engine 43 and is suitably secured to the hull 14 of the watercraft 10 . a fuel filler tube ( not shown ) preferably extends between the fuel tank 44 and the upper deck 18 . a forward air duct 46 extends through the upper deck portion 18 . the forward air duct 46 allows atmospheric air to enter and exit the engine compartment 38 . similarly , a rear air duct 48 extends through an upper surface of the seat pedestal 34 , preferably beneath the seat cushion 32 , thus also allowing atmospheric air to enter and exit the engine compartment 38 . air may pass through the air ducts 46 , 48 in both directions ( i . e ., into and out of the engine compartment 38 ). except for the air ducts 46 , 48 , the engine compartment 38 is substantially sealed so as to enclose the engine 43 of the watercraft 10 from the body of water in which the watercraft 10 is operated . toward a transom 50 of the watercraft 10 , the inclined sections of the lower hull section 16 extend outwardly from a recessed channel or tunnel 52 . the tunnel 52 is recessed within the lower hull section 16 in a direction that extends upward toward the upper deck section 18 . an intake duct 56 , defined by the hull tunnel 52 , begins at an inlet 58 and extends to a jet pump unit 54 which propels the watercraft 10 . the jet pump unit 54 comprises an impeller housing 60 . a steering nozzle 62 is supported at the downstream end of a discharge nozzle 64 of the impeller housing 60 by a pair of vertically extending pivot pins ( not shown ). in an exemplary embodiment , the steering nozzle 62 has an integral lever on one side that is coupled to the handlebar assembly 28 through , for example , a bowden - wire actuator , as known in the art . in this manner , the operator of the watercraft 10 can move the steering nozzle 62 to effect directional changes of the watercraft 10 . an impeller shaft 66 supports an impeller ( not shown ) within the impeller housing 60 . the aft end of the impeller shaft 66 is suitably supported and journaled within a compression chamber of the impeller housing 60 in a known manner . the impeller shaft 66 extends in a forward direction through the bulkhead 40 . a protective casing preferably surrounds a portion of the impeller shaft 66 . the forward end of the impeller shaft is connected to a crankshaft 68 of the engine 43 via a toothed coupling 70 in the illustrated arrangement . with continued reference to fig1 an engine air intake system is illustrated . a portion of the air entering the watercraft 10 through the air ducts 46 , 48 enters the engine 43 through an intake silencer 72 , which is positioned generally in front of the illustrated engine 43 . the air travels from the silencer 52 through an intake duct 74 and into an intake chamber 76 . the air enters the engine 43 from the intake chamber 76 directly through various intake pipes 78 which extend upward from the intake chamber 76 and inward toward the engine 43 . with reference to fig1 an exhaust system is illustrated . the exhaust gases leaving the engine 43 travel into an initial exhaust pipe 80 , through a water trap 82 , through a secondary exhaust pipe 84 and exit the watercraft proximate the jet pump unit 54 . the engine 43 , which drives the jet pump unit 54 , can be a four - stroke in - line straight four cylinder engine . however , it should be appreciated that several features and advantages of the present invention can be used with an engine with a different cylinder configuration ( e . g ., v - type , w - type or opposed ), a different number of cylinders ( e . g ., six ) and / or a different principle of operation ( e . g ., two - cycle , rotary , or diesel principles ). the watercraft 10 preferably includes an emergency stop system 86 that determines when the watercraft 10 is overturned and monitors the overturn switch 12 to inform the rider if the overturn switch 12 is faulty . the emergency stop system 86 in the illustrated arrangement includes the overturn switch 12 ( see fig2 ) and the ecu 13 ( see also fig1 ). the emergency stop system 86 is illustrated schematically in fig3 where the overturn switch 12 , an engine speed sensor 87 , and a lanyard engine stop switch 88 are inputs to the ecu 13 . the output signal from the ecu 13 is directed to the spark plug 96 and / or fuel injector system 94 . preferably , the ecu 13 can cease engine operation by interrupting either ignition or fuel injection ( e . g ., if an exhaust catalyst is employed , fuel injection preferably is stopped ) under appropriate conditions , which will be understood from the following discussion . fig2 illustrates an arrangement of the overturn switch 12 . it should be noted that the overturn switch could be mounted in any of a number of positions in and on the watercraft . the overturn switch 12 can include a pendulum 89 that is configured to pivot about an axis 90 . when the watercraft 10 is overturned , the pendulum 89 pivots , as indicated by the arrow d , and rests against the right or left stopper 92 a , 92 b . when the pendulum 89 contacts one of the stoppers 92 a , 92 b , the overturn switch 12 sends a signal to the ecu 13 . while one particular switch is illustrated in fig2 any suitable overturn switch can be used . with reference to fig4 a control arrangement is shown that is arranged and configured in accordance with certain features , aspects , and advantages of the present invention . the routine basically evaluates whether a false overturn signal is likely and provides an appropriate sensing technique to substantially reduce the likelihood of false overturn signals . the illustrated control routine begins and moves to a first decision block p 1 in which the engine speed is compared to a predetermined engine planing speed “ a ” ( e . g ., a can be about 6000 rpm in some applications ). preferably , the predetermined engine planing speed is an engine speed that generally corresponds to a watercraft speed that places the watercraft 10 in the planing mode . such a speed generally identifies that the watercraft is being operated at a water speed that greatly increases the likelihood of a false positive overturn signal . additionally , operation at or above that speed generally results in operation of a lanyard activated kill switch when the watercraft overturns . if the watercraft 10 is found to be in a planing mode , then the watercraft 10 is operating in a vehicle speed range in which the overturn switch 12 may be closed temporarily due to jumping or rough waters , for instance . therefore if the engine speed is determined to be greater than “ a ”, the routine returns to start and repeats . if the engine speed is less than “ a ”, the routine proceeds to a decision block p 2 where it determines if the overturn switch 12 is closed . in the decision block p 2 , if the overturn switch 12 is determined to be closed , then the routine proceeds to a decision block p 3 where the routine checks whether a preset period of time , which can be determined empirically , has passed . preferably , the time period is long enough to distinguish a false positive signal caused by jumping or the like and the time period is short enough to greatly reduce the likelihood of substantial water ingestion by the engine in the event of an actual overturn . in some applications , the time period can be about 0 . 5 second . if the predetermined period of time has passed , then the watercraft 10 most likely has overturned and the routine would move to process block p 4 . in the process block p 4 , the engine 43 is shut off and the routine then repeats . as illustrated , if , in the decision block p 2 , the overturn switch 12 is open , then the routine repeats . in the decision block p 3 , if a predetermined amount of time has not elapsed , then the routine repeats without stopping the engine 43 . in short , when the ecu 13 receives a signal from the overturn switch 12 while the watercraft is operating in a nonplaning mode , a delay loop is employed for a predetermined amount of time . if the overturn switch 12 is still sending a signal to the ecu 13 after the predetermined amount of time , the emergency shut off system 86 determines that the watercraft 10 has overturned . if the overturn switch 12 has stopped sending a signal after the predetermined amount of time , the emergency shut off system 86 determines that the watercraft has not overturned . in such a situation , the ecu 13 continues to look for a signal from the overturn switch 12 while normal engine operation continues . if the emergency shut off system 86 determines that the watercraft 10 is overturned , the ecu 13 stops the engine 43 by stopping the supply of electricity to the ignition system or by stopping the fuel supply through the fuel injectors . an advantage of this arrangement is that the emergency shut off system 86 does not determine that the watercraft 10 is overturned if the watercraft 10 is merely turning abruptly or rocking back and forth quickly . in such situations , the pendulum 88 contacts the stoppers 92 a , 92 b for period of time that is less than the predetermined time . unless the pendulum 88 rests on one of the stoppers 92 a , 92 b for the predetermined period of time ( e . g ., about 0 . 5 second ), no overturn is detected and engine operation is uninterrupted . additionally , when the vehicle is being operated at planning speeds , the lanyard switch can be used to shut down the engine during a vehicle overturn such that the output from the overturn switch can be ignored . this technique greatly reduces the likelihood of false positive signals from the watercraft during operation . in order to provide a system for better determining if the watercraft 10 is capsized using the overturn switch 12 , the system desirably is capable of checking the operability of the overturn switch 12 . with reference to fig5 and 6 , a schematic of a control circuit and a control routine are shown . the ecu 13 preferably controls various outputs ; ( e . g ., fuel injectors 94 , spark plugs 96 , and the alarm 98 ), in order to turn off the engine 43 in the case of an overturn , or to communicate with the driver that the overturn switch 12 is faulty . with reference to fig5 power is provided from a battery 100 to the ecu 13 , the fuel injectors 94 , spark plugs 96 , and the alarm 98 through a main relay 102 . a main relay circuit 104 controls shutting off the main relay operation during capsizing . in the illustrated arrangement , a signal from the ecu 13 is sent when the predetermined time needed to determine a watercraft overturn has elapsed , as discussed above . a starter relay 106 switches on as soon as the starter switch 108 is closed and keeps the main relay 102 closed ( i . e ., on ) after the starter switch 108 is opened and the starter ( not shown ) stops operating ( i . e ., the engine operates under its own power rather than under the starter &# 39 ; s power ). with reference now to fig6 an overturn switch failure control arrangement that is arranged and configured in accordance with certain features , aspects , and advantages of the present invention is illustrated . the control routine begins and moves to a first decision block p 10 in which operability of the overturn switch 12 at engine start is checked . in a presently preferred arrangement , the operability can be monitored by detecting the voltages of the overturn switch 12 . in one advantageous arrangement , the voltages of the overturn switch 12 are prearranged to be about 0 volts when the overturn switch 12 is closed ( e . g ., when the watercraft is capsized ) and about 5 volts ( or about 12 volts in some applications ) when the overturn switch is open . when the wires are disconnected from the overturn switch 12 , the voltage can default to about 2 . 5 volts ( or about 6 volts in some applications ). any suitable wiring arrangement can be used to create these or similar voltage levels under the above - described conditions . thus , these various voltage levels can be used to determine a failure of the overturn switch 12 . it should be noted that other voltage levels also can be used , however , for reasons that are apparent , the use of a zero voltage , a high level voltage , and a mid level voltage have been selected . if there is a failure of the overturn switch 12 at engine start , then the control routine moves the decision block p 20 where the alarm buzzer / warning light 98 is switched on . the alarm buzzer / warning light can be disposed proximate the control mast 24 . when the alarm 98 is switched on , a software alarm flag can be set in the ecu 13 . the flag can be used by the software to indicate an on - going error in the system . thus , in the illustrated arrangement , the alarm 98 remains on until the switch has been repaired and the alarm flag in the ecu 13 is reset ( e . g ., by a repair technician ). other suitable techniques of indicating a failure also can be used . if there is no failure at engine start ( i . e ., at decision block p 10 ), the control routine proceeds to decision block p 30 where operability is checked during engine operation . if no failure occurs while the engine 43 is running , then the control routine simply continues to repeat . if a failure does occur while the engine 43 is running , the control routine proceeds to the operation block p 40 and turns on the alarm 98 ( where again an alarm flag can be set in the ecu 13 ). the control routine then proceeds to the decision block p 50 where the engine speed is compared to a predetermined engine planing speed “ a ” ( e . g ., a can be about 6000 rpm in some applications ). preferably , the predetermined engine planing speed is an engine speed that generally corresponds to a watercraft speed that places the watercraft 10 in the planing mode . if the watercraft 10 is found to be in a planing mode then operability of the overturn switch is considered less important for the reasons discussed above . the engine 43 preferably is not shut off if the watercraft 10 is above the planing speed even if the overturn switch 12 is closed or faulty . therefore , if the engine speed is determined to be greater than “ a ”, the routine returns to start and repeats . it should be noted that a throttle position sensor can be used , in some arrangements , to act as a proxy for engine speed sensing . for instance , a throttle position of 30 degrees may be determined to be an approximate throttle position at which the watercraft can reach planing speed . in such cases , the approximate throttle position can be checked rather than engine speed , if desired . furthermore , the engine speed actually serves as a proxy for watercraft speed or watercraft operational mode ( i . e ., planing mode ). therefore , in some arrangements , a watercraft speed sensor , planing condition sensor , or any other suitable sensor arrangement for determining a planing speed or watercraft operational mode can be used . if the engine speed is less than “ a ”, ( e . g ., the watercraft is decelerated ), the routine proceeds to an operation block p 60 where the engine 43 is stopped . the control routine then proceeds to the operation block p 70 where power to the entire watercraft 10 is shut down after a predetermined time has passed . the control routine then returns to start and repeats upon the next starting of the engine . upon the next starting of the engine , if the malfunction of the overturn switch continues to be detected , the routine simply activates the buzzer and allows the watercraft to operate ( i . e ., the engine is not shut down ). in one preferred arrangement , at least one cylinder is disabled such that the watercraft speed is limited and the watercraft can return to port under a “ limp - home ” mode . it is to be noted that the control systems described above may be in the form of a hard - wired feedback control circuit in some configurations . alternatively , the control systems may be constructed of a dedicated processor and memory for storing a computer program configured to perform the steps described above in the context of the flowcharts . additionally , the control systems may be constructed of a general purpose computer having a general purpose processor and memory for storing the computer program for performing the routines . preferably , however , the control systems are incorporated into the ecu 13 , in any of the above - mentioned forms . although the present invention has been described in terms of a certain preferred embodiments , other embodiments apparent to those of ordinary skill in the art also are within the scope of this invention . thus , various changes and modifications may be made without departing from the spirit and scope of the invention . for instance , various steps within the routines may be combined , separated , or reordered . in some arrangements , both routines described above are integrated and implemented in a single application . in addition , some of the indicators sensed ( e . g ., engine speed and throttle position ) to determine certain operating conditions ( e . g ., watercraft planing speed ) can be replaced by other indicators of the same or similar operating conditions . moreover , not all of the features , aspects and advantages are necessarily required to practice the present invention . accordingly , the scope of the present invention is intended to be defined only by the claims that follow . | 5 |
in the following detailed description of the embodiments , reference is made to the accompanying drawings , which form a part hereof , and in which is shown by way of illustration of specific embodiments in which the present invention may be practiced . generally , methods and systems are provided for detecting a receiver over a pci - express link ( or any other computer bus standard or protocol ). a receiver can be detected on a pci - express link by bringing the common mode voltage of a voltage mode driver for the pci - express link to a low voltage state , e . g ., by pulling the differential outputs of the voltage mode driver low . once the low voltage state is detected on both differential outputs , a pulse signal can be applied via the voltage mode driver to bring the common mode voltage to a high voltage state . the differential outputs of the voltage mode driver can be compared to one or more predefined reference voltages . the time between applying the pulse signal and the time the differential outputs reach the one or more predefined reference voltages can be used to determine whether there is a receiver on the pci - express link . fig1 illustrates a diagram of a voltage mode driver of the present invention for detecting a receiver on a computer bus . a voltage mode driver of the present invention 40 comprises multiplexers 10 and 12 , nand gates 16 and 20 , nor gates 14 , 18 , and 22 , inverter 24 , control input signals , and driver cells 26 and 28 . the driver cell 26 comprises a pmos transistor , two resistors , and an nmos transistor serially connected to generate a positive output t xp for the transmission lines of the pci - express link . the driver cell 28 comprises a pmos transistor , two resistors , and an nmos transistor serially connected to generate a negative output t xn for the transmission lines of the pci - express link . the positive output t xp and the negative output t xn can also be referred to as the transmission voltages for the transmission lines of the pci - express link . the controls signals rcvdetecten , rcvdetectclr , and disdry are inputted to the voltage mode driver 40 via the multiplexers 10 and 12 , nand gates 16 and 20 , nor gates 14 , 18 , and 22 , inverter 24 to control the output of the voltage mode driver 40 . a positive input voltage in_t xp and the rcvdetecten signal are inputted to the multiplexer 10 , which is controlled by the output of the nor gate 14 . the not output of the multiplexer 10 is inputted to the nand gate 16 and the nor gate 18 . a negative input voltage in_t xn and the rcvdetecten signal are inputted to the multiplexer 12 , which is controlled by the output of the nor gate 14 . the not output of the multiplexer 12 is inputted to the nand gate 20 and the nor gate 22 . the rcvdetecten signal and the rcvdetectclr signal is inputted to the nor gate 14 . the disdry signal is inputted to the inverter 24 and the nor gates 18 and 22 . the inverter 24 output is inputted to the nand gates 16 and 20 . the nand gate 16 drives the gate of the pmos transistor of the driver cell 26 . the nor gate 18 drives the gate of the nmos transistor of the driver cell 26 . the nand gate 20 drives the gate of the pmos transistor of the driver cell 28 . the nor gate 22 drives the gate of the nmos transistor of the driver cell 28 . when the rcvdetecten signal is low and the rcvdetectclr signal is high , the transmission voltages t xp and t xn are both driven low . when the rcvdetecten signal is high and the rcvdetectclr signal is high , then the transmission voltages t xp and t xn are both driven high . when the disdry signal is high , then the voltage mode driver 40 is tri - stated , and effectively disabled . in normal operation ( e . g ., when the rcvdetectclr , rcvdetecten , and disdry signals are low ), the multiplexer 10 is enabled so that the input signal in_t xp for the differential transmission line is directed to the output t xp of the voltage mode driver 40 . the multiplexer 12 is also enabled so that the input signal in_t xn for the differential transmission line is directed to the output t xn of the voltage mode driver 40 . fig2 illustrates a diagram for a receiver detection system of the present invention . the receiver detection system of the present invention comprises the voltage mode driver 40 , a signal generation and control unit 42 , a low detect logic 44 , a high detect logic 46 , a disable drive logic 48 , and a reference voltage generator 50 . the low detect logic 44 , the high detect logic 46 , and the disable drive logic 48 monitor the transmission voltages t xp and t xn . the signal generation and control unit 42 transmits the control signals rcvdetecten , rcvdetectclr , and disdry to the voltage mode driver 40 based upon the results of the monitored transmission voltages t xp and t xn . a host controller ( not shown ) can assert the control signal rcvdeten to the signal generation and control unit 42 to start the receiver detection system . upon receiving the rcvdeten signal , the signal generation and control unit 42 drives the rcvdetectclr signal high and the rcvdetecten signal low , which is inputted to the voltage mode driver 40 . the voltage mode driver 40 then brings down the transmission voltages t xp and t xn low . the low detect logic 44 comprises a summing circuit and comparators that compare the transmission voltages t xp and t xn to a reference voltage a ( e . g ., 100 mv ). the reference voltage a is generated by the reference voltage generator 50 and can be adjusted as desired . when the low detect logic 44 detects that the transmission voltages t xp and t xn are both below the reference voltage a , the low detect logic 44 signals this occurrence to the signal generation and control unit 42 via a lowdetect signal . the signal generation and control unit 42 then drives the transmission voltages t xp and t xn to high by outputting a high signal for the control signal rcvdetecten . the high detect logic 46 comprises a summing circuit and comparators that compare the transmission voltages t xp and t xn with a reference voltage b ( e . g ., 600 mv ). the reference voltage b is generated by the reference voltage generator 50 and can be adjusted as desired . as the transmission voltages t xp and t xn are driven high , the high detect logic 46 detects when the signals t xp and t xn both exceed the reference voltage b . this occurrence is reported to the signal generation and control unit 42 to estimate the amount of time ( which can be measured in clock cycles or in nanoseconds ) it takes to raise the transmission voltages t xp and t xn from the reference voltage a to the reference voltage b . the disable drive logic 48 comprises a summing circuit and comparators that compare the transmission voltages t xp and t xn with a reference voltage c ( e . g ., 700 mv ). the reference voltage c is generated by the reference voltage generator 50 and can be adjusted as desired . due to specific protocols and standards for the computer bus , the computer bus may have a stated maximum common mode voltage . the disable drive logic 48 detects whether or not the transmission voltages t xp and t xn exceed the reference voltage c , which can be set to this stated maximum common mode voltage or below the maximum common mode voltage to allow for some margin of error . if so , then the voltage mode driver 40 is disabled . operationally , the receiver detection system can begin by asserting a high signal for the control signal rcvdeten . upon receiving the control signal rcvdeten , the signal generation and control unit 42 asserts the rcvdetectclr signal to the voltage mode driver 40 . the voltage mode driver 40 then pulls the transmission voltages t xp and t xn low . the low detect logic 44 determines whether the transmission voltages t xp and t xn is below the predefined reference voltage a . if the transmission voltages t xp and t xn are below the reference voltage a , the low detect logic 44 asserts a lowdetect signal to the signal generation and control unit 42 . the signal generation and control unit 42 then asserts the rcvdetecten signal to the voltage mode driver 40 . the rcvdetecten signal is inputted to the voltage mode driver 40 to drive the transmission voltages t xp and t xn high . the high detect logic 46 monitors whether the transmission voltages t xp and t xn have reached or exceeded the predefined reference voltage b , which is programmable . if the transmission voltages t xp and t xn are above the reference voltage b , then a highdetect signal is asserted to the signal generation and control unit 42 . the signal generation and control unit 42 checks the delay between the rcvdetecten and highdetect signal assertions . if the delay is less than or equal to a programmable value , t1 , then the receiver is not present . else , the receiver is present . the disable driver logic 48 determines whether the transmission voltages t xp and t xn have reached the predefined reference voltage c , which is programmable . if the transmission voltages t xp and t xn both exceed the reference voltage c , then a signal disabledry is asserted to the signal generation and control unit 42 . the signal generation and control unit 42 in turn disables the voltage mode driver 40 by enabling the disdry signal . this is to make sure the transmission voltages t xp and t xn are always less than the protocol dictated maximum common mode voltage . if the signal generation and control unit 42 determines that there is a receiver on the transmission line , then the signal rcvstatus is reported to the controller . fig3 illustrates a diagram for an equivalent circuit for a computer bus when a receiver is present . a voltage mode driver 60 of the present invention and a receiver 62 communicate over a differential transmission line 64 , e . g ., a pci - express link . ac coupling between the voltage mode driver 60 and the receiver 62 is characterized through the coupling capacitors 66 . the transmission line 64 can be inputted to the voltage mode driver 60 from a transmitter that communicates over the differential transmission line 64 . the voltage mode driver 60 can adjust the voltage signals t xp and t xn on the differential transmission line 64 for output to the receiver 62 . if the receiver 62 is present and connected to the differential transmission line 64 , then the resistors 68 can terminate the differential transmission line 64 by being serially connected across the differential transmission line 64 . if the present invention recognizes that when the receiver 64 is present and connected to the transmission line 64 , large ac coupling capacitors 66 will act as a load to the voltage mode driver 60 . if the voltage mode driver 60 applies a high signal on the differential transmission line 64 , the transmission voltages t xp and t xn at the differential transmission line 64 will slowly rise due to the receiver 62 being connected to the differential transmission line 64 . fig4 illustrates a diagram for an equivalent circuit for a computer bus when a receiver is not present . a voltage mode driver 70 of the present invention and a possible receiver 72 communicate over a differential transmission line 74 , e . g ., a pci - express link . ac coupling between the voltage mode driver 70 and the receiver 72 is characterized through coupling capacitors 76 . the differential transmission line 74 can be inputted to the voltage mode driver 70 from a transmitter that communicates over the differential transmission line 74 . the voltage mode driver 70 can adjust the transmission voltages t xp and t xn on the differential transmission line 74 for output to the receiver 72 . if the receiver 72 is not present and / or not connected to the differential transmission line 74 , then the differential transmission line 74 does not have a terminating resistor at the receiver 72 . when the receiver 72 is not present and / or not connected to the transmission line 74 , large ac coupling capacitors 76 will act as a load to the voltage mode driver 70 . if the voltage mode driver 70 applies a high signal on the differential transmission line 74 , the transmission voltages t xp and t xn at the differential transmission line 74 will quickly rise on the differential transmission line 64 when the receiver is not present and / or not connected to the transmission line 74 . fig5 illustrates a waveform of various signals of a receiver detection system of the present invention when a receiver is not present on a computer bus . when the receiver is not present , the transmission voltages t xp and t xn quickly exceed a predefined voltage , e . g ., 700 mv , within a short time frame . the receiver detection system can determine the amount of time t1 for the transmission voltages t xp and t xn to reach the predefined voltage . if the time t1 is within a predefined amount of time , then the receiver detection system can signal that a receiver is not present . fig6 illustrates a waveform of various signals of a receiver detection system of the present invention when a receiver is not present on a computer bus . when the receiver is present , the transmission voltages t xp and t xn slowly rise to the predefined voltage , e . g ., 700 mv , taking a relatively long amount of time to reach the predefined voltage . the receiver detection system can determine the amount of time t1 for the transmission voltages t xp and t xn to reach the predefined voltage or come close to the predefined voltage . if the time t1 exceeds a predefined time frame for detecting the receiver , then the receiver detection system can signal that a receiver is present . while the present invention has been described with reference to certain preferred embodiments or methods , it is to be understood that the present invention is not limited to such specific embodiments or methods . rather , it is the inventor &# 39 ; s contention that the invention be understood and construed in its broadest meaning as reflected by the following claims . thus , these claims are to be understood as incorporating not only the preferred methods described herein but all those other and further alterations and modifications as would be apparent to those of ordinary skilled in the art . | 8 |
in general , a gui according to the present invention is constructed from one or more “ components ”. each component has a graphical representation and a code section that determines the behavior of the component and how the component is displayed . in general , each component has a default representation that automatically sizes the graphical representation for the amount of space assigned to that component on the current display . when the display changes orientation , the amount of space for the various components also changes , and the graphical representations are adjusted accordingly . a collection of components can be grouped together in a container . the space allocated for the container is divided among the components in the container . there is a default space allocation that is applied unless a different allocation is specified for the container . the entire display is the highest level of container . the manner in which the present invention provides its advantages can be more easily understood in terms of two types of containers . in the first type of container , referred to as a vgroup in the following discussion , the default space allocation consists of dividing the vertical space in the container equally among the objects in the container . it should be noted that when the display screen changes from portrait mode to landscape mode , the available space in the container changes , the vertical space being reduced and the horizontal space being increased . hence , each component in the container is assigned a new space when the change in orientation takes place and the components &# 39 ; representations are likewise resized . the second type of container will be referred to as an hgroup . the default space allocation in an hgroup consists of dividing the horizontal space in the container equally among the objects in the container . again , when the display screen changes from portrait mode to landscape mode , the available space in the container changes , the vertical space being reduced and the horizontal space being increased . vpanels and hpanels are special types of vgroups and hgroups , respectively , in which the individual components and the panels are automatically provided with borders that delineate the elements in question . refer now to fig1 a and 1b , which illustrate displays on a data processing system which includes a vgroup having three buttons in portrait and landscape mode , respectively . when the orientation changes from portrait to landscape , the space available for each button changes such that the vertical height of each button is reduced and the width is increased . the fonts are changed accordingly to fit the available space . in one aspect of the present invention , the user defines the layout of the display in a declarative language such as xml . only those items that are not contained in the default specification of a component need be included in the file if the containers of the present invention are utilized . for example , the xml , code for the three - button display shown in fig1 a and 1b consists of it should be noted that only the text needs to be specified , as the display space is automatically divided into three vertical sections which are allocated to the various buttons . the code associated with the buttons automatically takes care of sizing the text and buttons for the current display screen and orientation . in the above - described example , the three buttons have the same size , which is the default allocation . however , the user may wish to provide more space for one of the buttons . in one aspect of the present invention , the user can specify the relative layout weights of the components within a container . the default weight is 1 . to change the default layout weight , a corresponding entry is made in the layout file . for example , if the user wishes to assign more space to button 1 , the xml file would be refer now to fig2 , which illustrates a three button vpanel in which the first button has twice the weight of the remaining two buttons . in this case , button 1 has a height that is twice that of the other two buttons . it should be noted that the width of the button remains the same as that of the other buttons . since the width limits the font size used for the labels , button 1 has the same font size in as the remaining buttons . the present invention also implements a horizontal panel , hpanel , that provides an analogous function to the vpanel described above . in an hpanel , the horizontal space is divided equally . hpanel is the equivalent of the vpanel shown in fig1 a and 1b . the layout file for the hpanel is as follows refer now to fig4 , which illustrates the three - button panel with button 1 allocated twice the space of the other buttons . again , if more space is to be allocated to one button , the layout weight parameter can again be used . however , since this is an hpanel , the increased layout weight increases the horizontal space allocated to button 1 in the panel rather than the vertical space . the layout file for the hpanel with the increased weight is as follows : it should be noted that vpanels and hpanels , as well as the corresponding vgroup and hgroup , are themselves components that obey the same rules as other components . hence , the various panels and groups can be nested within one another to provide more complex layouts without the need to specify the exact sizes of the components . refer now to fig5 a and 5b , which illustrate a nested display in portrait and landscape modes , respectively . these displays include a number of nested panels . the layout description for the displays in question is as follows : as noted above , a vpanel and an hpanel have a distinctive border around their child components . when nested , hpanel and vpanel components are used for grouping the border shading which can sometimes lead to a cluttered display . the hgroup and vgroup components behave in the same manner as hpanel and vpanel but they do not have a border . in addition , in one aspect of the invention , hgroup and vgroup have a transparent background while hpanel and vpanel do not . this difference is illustrated in fig6 a and 6b , which illustrate a nested display that includes a trace component 21 that displays a graphic . fig6 a shows the display when only vpanel and hpanel containers are used . the layout code for fig6 a is as follows : the corresponding display when hgroups and vgroups are used is shown in fig6 b . the layout code for fig6 b is as follows : in the above described examples , the components have sizes that are automatically computed . however , there are situations in which a designer may prefer to assign specific sizes to one or more of the components . in one aspect of the present invention , components can also have explicit sizes assigned in a manner that is separate from the weight mechanism that assigns relative sizes . components according to the present invention also have layout_width and layout_height attributes that can be assigned by the designer in the layout code . refer now to fig7 , which illustrates a display in which the size of the button 1 component has been explicitly set using the following layout code : in this aspect of the invention , the layout width and height can be specified in display pixels , px , scale independent pixels , sp , or density independent pixels , dp . the sp unit selects a font size based on the display screen density as well as the user &# 39 ; s font size preference . when this information is not available to an implementation , an sp value is interpreted as a dp value . in general , sp is used when a size is desired relative to user font selection preferences . the dp unit selects a font size based on a density independent pixel . these units are relative to a 160 dpi screen . a dp is one pixel on a 160 dpi screen but two pixels on a 320 dpi screen . for text , sp is preferred because it accommodates the users &# 39 ; font size preference . in general , the px unit should be avoided as it does not scale well between devices . the introduction of a fixed size component can lead to extra space being available in a container . in one aspect of the present invention , the layout engine that is part of a runtime system library allocates space utilizing the layout description . the space in a container is divided according to the layout_weights of the components in that container . when a component uses less than that component &# 39 ; s share of the space , the additional space is divided among the remaining components in proportion to their respective layout_weights . a component in which a fixed width and height have been defined can also have a non - zero layout_weight . in this case , the final space allocated to the component is the sum of the specified fixed width or height and its share of any remaining space . if the designer does not wish the fixed width or height component to be stretched in this manner , a layout_weight of zero can be assigned to that component , and hence , that component will not receive any additional space . in one aspect of the present invention , components can be reduced in size beyond their intrinsic size that results from assigning fixed widths or heights . such reductions take place if the available space is less than the sum of the intrinsic sizes of the objects specified through the layout_width and layout_height parameters . in this case , space is taken away from each component based on its layout_weight . automatically sizing components that include textual material poses additional challenges . refer now to fig8 a and 8b , which illustrate a gui that is to run on a device such as a smart phone in either portrait or landscape orientation . in particular , the gui includes a number of boxes that include text . the particular gui in fig8 a is running with the device in landscape mode . when the device is rotated to portrait mode as shown in fig8 b , the sizes of the boxes are altered to make more efficient use of the display space . unfortunately , the text within the box cannot be re - sized with the same degree of flexibility without causing problems . the aspect ratio of the text for a given font is normally fixed . consider a box that has text that just fits into the box when the screen is in the landscape mode . when the screen is rotated to portrait , the width of the box must be reduced . if the font size is not changed , as shown in fig8 b , the original text will no longer fit in the box . hence , the text size is changed to accommodate the change in orientation . the amount by which the text font size must change to accommodate the change in orientation will be different for different objects in the gui . one method for changing the font size involves adjusting the font size to just fit in the object when the object size changes with a change in orientation . unfortunately , this strategy can result in different components that started with the same text size having different text sizes in the new orientation as can be seen in fig9 a and 9b , which illustrate a display in which the individual components have their fonts adjusted based on the size of the component . fig9 a shows the display with the device in landscape mode , and fig9 b shows the display with the device in portrait mode . as can be seen from these figures , this approach can lead to a display that lacks the aesthetic qualities of the original display . in one aspect of the present invention , this problem is overcome by defining a group of elements that all need to share the same font size when the orientation or resolution changes to preserve the aesthetic quality of the display . a font group is defined for these elements , and this font is used rather than the font that would have been used by the layout engine in the absence of the font group . refer now to fig1 a and 10b , which illustrate a display in which the same font size is used for a number of different components even though one or more of the components could have used a different font size . for example , the objects shown at 71 in fig1 a and 10b need to use the same font size in each orientation . the size of the objects changes when the orientation changes ; however , the font size remains constant across the objects . in this aspect of the present invention , a two step process is used for setting the font size for all components of a container that are part of the same group . in the first step , the font size that is required to fit the text into each component is determined . the font size is set such that no object has text that is cut - off in the new orientation . different components may have different determined font sizes at this step . in the second step , the minimum of the determined font sizes is then chosen for all of the components in the font group . this ensures that the components have a consistent appearance while ensuring that the text is not cut - off in any of the components . once a font is determined for each object in a font group , the font is communicated to each object for use by that object . the font group to which a component is to belong can be specified in the layout description for that component . in the case of the gui shown in fig1 a and 10b , the xml , description could be as follows : in some cases , it may be more efficient to define the font group for a “ parent ” component that includes a number of “ children ”. in this case , the font group assignment applies to all of the children of the parent , e . g ., to simplify the layout code , an “ implicit font group ” is assigned to each container . the implicit font group only applies to the first level of children of the container . it ensures that the first level of children will all have the same font group . an explicit font group assignment is inherited by all of the children of the container . the implicit font group assignment can be avoided by providing a predetermined explicit font group assignment such as “ none ” or by assigning a property that is incompatible with an implicit font group such as a layout_weight = 0 . in another aspect of the invention , buttons , text boxes , and other primarily textual components have a number of additional properties that configure various aspects of the displayed text . the textsize property allows specification of a relative or absolute text size while maxchars specifies the maximum length of a text field . the textsize property can specify text size in the same units as described for layout size specification . in addition , a % relative size is defined . for text , sp is preferred because it accommodates the user &# 39 ; s font size preference . the % unit is a relative automatic font size . when textsize is not specified for a component the layout engine will choose a font size automatically . if the font size is specified with % units the resulting font size will be a percentage of the automatic font size . for example , setting textsize = 50 % will result in the font size being 50 percent of the automatic font size . text size and font group can both be used in the same container . this allows the same automatic font group to be used for all of the elements , except that some of the elements have a reduced font size . in some cases , the contents of some of the text fields are not known at the time the layout is specified . for example , a text box may be populated by the output of a remote device and the size of the text string will not be known until the text string actually arrives . in one aspect of the present invention , a field property is provided that allows the designer to inform the layout engine of the maximum size of the expected input . this is referred to as the maxchars property . when the maxchars property is specified , the textual components choose a text size based on the specified length . the layout engine will then reserve space for that number of characters . if less than that number arrives , the font size is still defined as if the defined maximum number had arrived . this ensures that the appearance of the text does not change from input to input , since the text may change in length during the operation of the gui . in anther aspect of the invention , a width or height can be specified to match that of the parent container . a width or height specified as match_parent informs the layout engine that the component should be sized to match its parent container . that is , it will expand to fill available space . children of hpanel , vpanel , hgroup , and vgroup default to match_parent if an explicit width or height is not specified . in yet another aspect of the invention , a property that informs the layout engine to size the component just big enough to accommodate its contents is provided . a width or height can be specified as wrap content . this is typically used to wrap a set of fixed sized components . for example , a vpanel with the layout height =“ wrap content ” around a fixed size text component would result in a panel just big enough to surround the text . if the children in a container have either fixed or intrinsic sizes and the designer does not wish to calculate the minimum size container that will contain the children , the designer can use a special version of the vpanel and hpanel containers referred to as vwrap and hwrap , respectively . these containers automatically set the height or width of the container to a value that is just big enough to fit all of the children in the container . the positioning of a component in a container can be explicitly controlled using two position specification parameters . a container can specify a layout for all of the children in the container by specifying a value for a parameter , “ gravity ”. for example , if gravity =“ left ”, all of the components in a container will be aligned on the left boundary of the container . in some cases , the designer may wish to explicitly specify the position of one of the components in a container without altering the positioning of the remaining contacts . the parameter , “ layout_gravity ” allows a component to define its position within the parent container . the values of gravity and layout_gravity do not affect the size of the components . for a vertical orientation container such as a vpanel , lay_out gravity can take on the values “ left ”, “ center ”, or “ right ”, which result in the object being aligned with the left boundary of the container , the center of the container , or the right boundary of the container , respectively . for a horizontal orientation container such as an hpanel , lay_out gravity can take on the values “ top ”, “ center ”, or “ bottom ”, which result in the object being aligned with the top boundary of the container , the center of the container , or the bottom boundary of the container , respectively . in addition , layout_gravity can have the values “ center_vertical ” and “ center_horizontal that signal that the object is to be vertical center of its container or the horizontal center of its container , respectively . the above - described embodiments utilize containers referred to as vgroup and hgroup . however , embodiments of the present invention that utilize different types of containers in which the component sizes are automatically set can be constructed . for example , a swipepanel is defined in one embodiment of the present invention . the children of this panel are “ pages ” in a multi - page view in which the user moves between pages using a gesture such as a swipe gesture or “ pushing ” a button . a swipepanel is equivalent to a display that is much larger than that provided on the device . the allocated space on the device is a “ window ” on the larger display . the positioning of the window is determined by the swipe gesture and the current position . in essence , the swipe moves the relative position of the window and the underlying display so that a different portion of the underlying display appears in the window after the gesture . the children of the swipepanel may be arranged in a manner that depends on whether the device is in portrait or landscape mode . in one aspect of the invention , each child occupies a space on the display such that one child is visible at any time and fills the allocated space . the user changes children by performing the swipe gesture which replaces the currently visible child with one to the left or right of the current child , depending on the direction of the swipe . the drawings in the present application show various display arrangement of components on a display of a data processing system or computer . the data processing system or computer is not explicitly shown as a separate “ box ”, since such components are well known in the art . however , it is to be understood that such displays also indicate the present of the underlying data processing system or computer and are a representation of the data processing system or computer as well as the display . the above - described embodiments of the present invention have been provided to illustrate various aspects of the invention . however , it is to be understood that different aspects of the present invention that are shown in different specific embodiments can be combined to provide other embodiments of the present invention . in addition , various modifications to the present invention will become apparent from the foregoing description and accompanying drawings . accordingly , the present invention is to be limited solely by the scope of the following claims . | 6 |
the catalyst of the present invention is advantageously a salt of a group ia metal ( alkali metal ): a group iia or iib , preferably group iib , metal : and a neutralizing number of counter anions supported on a non - alumina porous carrier material . preferred group ia metals include sodium , potassium , rubidium , lithium and cesium , with potassium and cesium being more preferred and potassium being most preferred . the preferred group iib metals include zinc , cadmium and mercury with zinc being more preferred . while any counter anion , such as bromide , chloride and fluoride , is suitable in the catalyst of this invention , the halides are preferred with chloride being most preferred . other suitable anions are nitrates , sulfate , phosphate , acetates , oxylate and cyanides . the molar ratio of group ia metal to group iia or iib metal in the salt is preferably at least about 0 . 5 : 1 and no greater than about 1 . 5 : 1 . it is more preferred that the molar ratio is at least about 0 . 9 : 1 and no greater than about 1 . 1 : 1 and most preferred that approximately equimolar portions of the two metals are used . the amount of counter anion used is that which is sufficient to neutralize the cations of the salt . any non - alumina support which will withstand the hydrochlorination conditions described herein can be used in the process of the present invention . examples of appropriate supports include the well - known carbon supports such as activated carbon , carbon black , chars and coke . other suitable supports that may be used to support the catalyst include pumice , silica gel , asbestos , diatomaceous earth , fullers earth , titania , zirconia , magnesia , magnesium silicate , silicon carbide , silicalite , and silica . a preferred support is silica . a silica having a surface area between 100 m 2 / g and 300 m 2 / g and a pore volume in the range of 0 . 75 cc / to 1 . 4 cc / g is particularly active in the process of this invention . the salt is suitably supported on the carrier material by any standard impregnation technique such as that disclosed in experimental methods in catalytic research , vol . ii , edited by r . b . anderson and p . t . dawson , academic press , new york , 1978 . a solution of both the group ia and group iia or iib metal cations and the associated anions may be employed to impregnate the support material or the metal salts may be impregnated from separate solutions . the resulting catalyst comprising the catalytically active salt and the support preferably comprises from about 1 to about 50 weight percent of the group iia or iib metal salt , e . g ., zncl 2 , and from about 0 . 5 to about 30 weight percent of the group ia metal salt , e . g ., kcl , based on the percentage by weight of the total salts to the support . it is preferred to use at least about 20 and no greater than about 30 weight percent of the group iia or iib metal salt and at least about 10 and no greater than about 20 weight percent of the group ia metal salt and more preferred to use about 20 weight percent of the group iia or iib metal salt and about 10 weight percent of the group iia metal salt . preferred weight percents of the two salts are selected so as to result in approximately equimolar proportions of the group ia and group iia or iib salt being used . the process of the present invention comprises contacting a alcohol and hydrogen chloride in the presence of the aforementioned catalyst under reaction conditions sufficient to produce the corresponding chlorinated hydrocarbon . examples of alcohols useful in the practice of this invention include compounds corresponding to the formula wherein r is alkyl , aryl , arylalkyl and alkylaryl . it is preferred that r is alkyl and more preferred that r is lower alkyl having from about 1 to about 5 carbon atoms . it is most preferred that r is alkyl having from 1 to about 3 carbon atoms . examples of preferred alcohol compounds thus include methanol , ethanol and propanol with methanol being more preferred . molar ratios of alcohol to hydrogen chloride useful in the practice of this invention are generally at least about 1 : 10 and no greater than about 10 : 1 . when hydrogen chloride is used in excess , it is preferred that the amount of excess hydrogen chloride is no more than about 30 molar percent . it is preferred that the alcohol be used in excess . when the alcohol is used in excess , it is preferred that the molar ratio of alcohol to hydrogen chloride is about no greater than about 2 : 1 and more preferred that it is no greater than about 1 . 5 : 1 and most preferred that is is about 1 . 1 : 1 . the temperature range useful in the practice of this invention is any at which the hydrochlorination reaction will proceed . preferably , the reaction is conducted at a temperature of at least about 25 ° c . and no greater than about 475 ° c . with at least about 175 ° c . to no greater than about 300 ° c . being more preferred . the most preferred temperature ranges from at least about 250 ° c . to no greater than about 275 ° c . pressures typically employed in the process of the present invention are at least about 14 psig and no greater than about 500 psig . preferred pressures are at least about 35 psig and no greater than about 150 psig . gas hourly space velocities are suitably at least about 100 and no greater than about 10 , 000 hours - 1 , preferably at least about 300 and no greater than about 3000 h - 1 . the process may be operated in a batch mode or continuously although continuous operation is preferred . in a preferred embodiment , vaporized methanol and hydrogen chloride are added in approximately equimolar proportions to a fixed bed reactor containing a kzncl 3 catalyst supported on silica . the resultant products are separated by distillation . the process of this invention is effective in reducing the amount of by - products formed . in a preferred embodiment wherein methanol and hydrogen chloride react to form methyl chloride , the production of by - products such as dimethyl ether is decreased . the process of the present invention also results in a long - lived catalyst . the catalyst of the present invention is stable and the absence of alumina eliminates the problem of bohemite formation . the following examples are provided to illustrate the invention and should not be interpreted as limiting it in any way . unless stated otherwise , all parts and percentages are by weight . a silica sample is sieved between three screens and the fractions retained by 4 mesh , 5 mesh and 8 mesh , respectively , are collected . the 8 mesh fraction is used in the preparation of 200 g samples of about 500 cubic centimeters each . a 200 g sample is placed in a 2 liter dish and dried 48 hours at 150 ° c . the sample is transferred to 1 liter fluted flask , placed on a rotovap and cooled to 70 ° c . under vacuum . the silica is then impregnated with a solution of 60 g of zncl 2 and 32 . 81 g of kcl in a total volume of 278 cubic centimeters of water . the impregnated catalyst is returned to the 2 liter dish and air dried for 24 hours and then dried for an additional 25 hours at 150 ° c . a three - liter portion of catalyst , prepared as described above , is placed into an inconel reactor that is 20 feet long and 1 . 25 inches in diameter . the reactor is then purged with nitrogen for 48 hours at 220 ° c . the catalyst is then conditioned with hcl mixed with nitrogen prior to reaction with methanol . the proportions of methanol to hydrogen chloride and the reaction temperature are varied as shown in table i below . the reactor effluent is analyzed by gas chromatography to determine the conversion obtained and the amount of dimethyl ether produced relative to the amount of methyl chloride produced . the results obtained are shown in table i below . table i______________________________________ con - methanol hcl temp version . sup . ○ 1 dme / mc . sup . ○ 2run ( lb / hr ) ( lb / hr ) (° c .) (%) ( ppm ) ______________________________________1 8 . 00 10 . 00 220 96 . 6 117262 8 . 00 10 . 00 235 96 . 4 115453 3 . 92 5 . 57 220 99 . 0 69814 3 . 92 4 . 91 220 98 . 2 89575 7 . 46 10 . 57 220 98 . 4 77136 5 . 83 7 . 78 220 98 . 4 81617 8 . 00 10 . 00 220 93 . 1 137808 4 . 14 4 . 95 220 94 . 3 134419 8 . 00 10 . 00 220 93 . 4 1406510 4 . 24 4 . 84 220 91 . 3 1620911 9 . 81 10 . 34 220 93 . 6 13900______________________________________ . sup . ○ 1 conversion of methanol to methyl chloride . sup . ○ 2 parts of dimethyl ether produced per million parts of methyl chloride the data above illustrate that the use of the catalytic process of this invention results in a high rate of conversion of methanol . runs 1 and 2 demonstrate that an increase in the reaction temperature from 220 ° c . to 235 ° c . has little effect on conversion or dimethyl ether production . runs 3 and 4 demonstrate the effect of varying the ratio of methanol to hydrogen chloride . run 3 represents a 25 percent molar excess of hydrogen chloride while run 4 shows a 10 percent molar excess . at the 10 percent excess level , the conversion decreases and the dimethyl ether production increases although in either case the conversion is high and the dimethyl ether production is low . runs 8 , 10 and 11 show the effect of decreasing the molar proportion of hcl until methanol is used in excess . the ratios of methanol to hcl change from 1 : 1 . 05 in run 8 to 1 : 1 in run 10 and to 1 . 13 : 1 and follow the trend shown in runs 3 and 4 . these trends indicate that high conversion and acceptably low dimethyl ether production may be obtained when methanol is used in excess . runs 1 , 7 and 9 are all identical and demonstrate that after a breaking in period , the catalyst is stable within the time frame of the experiment . | 2 |
the following is a description of embodiments in this invention with reference to each figure mentioned . in fig1 reference 21 is a magnetic disk , 22 is a head slider and 23 is a gimbal supporting it . reference 24 is the enitre data recording and reproduction area where the data is recorded and reproduced , and 25 is the landing zone of the head . reference 26 is the interval between heads and 27 shows the seek distance . fig2 shows a reversed view of the head slider 22 . a head gap 28 is provided at the back end of the abs ( ski ) section 29 , and the interval between the gaps is more than about 1 / n of the width of the entire data recording and reproduction area 24 on the magnetic disk 21 and yet it is made smaller than the width the entire data reccording and reproduction area 24 . the head on the outer circumferential side takes charge of the recording and reproduction of the outer half of the data in the entire data recording and reproduction area 24 , while the inner circumferential side head takes charge of the entire data recording and reproduction area 24 . for this reason , the heads can access the track of the entire data recording and reproduction area 24 merely by seeking about half of the entire data recording and reproduction area 24 . this makes it clear that the seek distance can be shortened as compared with the conventional device which provides one head gap for one head slider . when a plural number of heads were provided for one magnetic disk , each head was supported by a separate gimbal in the conventional device , thus causing a problem by increasing the weight of the head carriage as a whole . in this embodiment , one head slider 22 include the weight of the head slider 22 itself enlarged by the width of head slider 22 . this is smaller compared with the weight of a gimbal , and the weight is little increased in this embodiment as compared with a case where two sets of head sliders and gimbals are used . from these facts , it is feasible in this embodiment to increase the number of heads per magnetic disk and to shorten the seek distance without increasing the weight of the head actuator . although the head landing zone is provided for css , when n pieces ( n : an integer of two or more ) of heads are used per one disk in a conventional device , it needs n pieces of landing zones having a larger width than the width of head slider . the css in this embodiment is carried out in the abs section 29 only as shown in fig3 when the head slider 22 is positioned in the css position . consequently , the width of landing zone 25 in this embodiment can be a vicinity of the width of the abs section 29 of head slider 22 . if so , the width can be reduced to one - third to one - fourth of the landing zone in a conventional device . by this , the recording surface of a disk can be used effectively without increasing the rate in the landing zone occupying the effective area on the disk surface as in a conventional device , even if the number of heads is increased per a disk . this is suitable for the enlargement of a capacity of magnetic disk storage device . as to structure of head slider 22 , it can be lightened by hollowing out a part of members of a head slider 22 to make them a skeleton as shown in fig4 . the larger the width of head slider is in this method , the more its effect becomes . the data recording and reproduction are performed by using arbitrarily a plural number of heads integrated in one slider 22 concurrently or separately . in a conventional device in which a plurality of head sliders are supported by a plural number of gimbals , since the gimbal itself has movability , it was difficult to keep constant the interval between these head gaps . in this embodiment , since the head gap 28 is formed fixedly in one head slider 22 , the interval of each head gap 28 can be kept constant . for instance , when the thermal expansion factor is made equal between the two by using ceramic for the substrates of the head slider 22 and magnetic disk 21 , the amount of off - track due to the thermal expansion of magnetic disk 21 becomes equal to the change due to the thermal expansion in the interval of the respective head gap 28 , this settling the problem on the off - track due to the thermal expansion . by this , it becomes possible to record and reproduce data with the inner head while reading the positioning signal with the outer head , for instance . furthermore , as another embodiment , it is feasible to have a magnetic disk storage device by integrating n pieces of heads in one head slider 22 and by providing n pieces of landing zone 25 with the width of one landing zones taken as that of the abs section 29 or , the width may be equal to a feature section other than the abs section , and not always confined to the abs section . that is , a structure can be taken to provide the head and abs section separately . next , each embodiment of this invention which employs a means to stabilize the floating posture of the head slider will be explained following . as shown in fig6 the head slider 22 is supported by the gimbal 23 , and the pivot 31 provided in the gimbal 23 comes into contact with the suspension 32 at one point . the head slider 22 makes a rotary movement freely in a movable range of the gimbal 23 with this point taken as a fulcrum . in this embodiment , the pivot 31 is positioned on the outer circumferential side of the magnetic disk 21 from the center line which is equally distant from two heads 23 . also , the width as well as the structure are equal in two abs sections 29 . in the figure , however , the rotary directon of the magnetic disk 21 is in the direction running from the reverse side to the obverse side at right angles to the paper surface , and the left end in the figure shows the outer circumferential side of the magnetic disk 21 and the right end the inner circumferential side . according to the relative speed between disk 21 and head slider 22 caused by the rotation of the magnetic disk 21 , a floating force is generated in the abs section 29 of the head slider 22 . there is a relation as shown in fig7 between the floating force generated in the abs section 29 and the speed . as the speed raises , the floating force becomes larger . the relative speed between the abs sections 29 and 29 &# 39 ; of the head slider 22 and the rotating disk 21 is proportionate to the distance from the center of rotation of the magnetic disk 21 to the abs sections 29 and 29 &# 39 ;. when the interval between two abs sections 29 and 29 &# 39 ; becomes relatively larger as compared with the radius of the magnetic disk 21 , the difference in speed between two abs sections 29 and 29 &# 39 ; becomes larger . consequently , a difference occurs in the floating force generated in each of two abs sections 29 and 29 &# 39 ;, too . the floating force generated in the outer side abs section 29 becomes larger than that generated in the inner side abs section 29 &# 39 ;. since the head slider 22 can be rotated with the pivot 31 taken as a center , when the pivot 31 is positioned in the center between the right and left abs sections 29 and 29 &# 39 ;, the head slider 22 makes a rotary movement on account of the difference in the floating force between the two according to the reason given above , and the posture of the head slider 22 becomes unstable . now , in this embodiment , the pivot 31 is positioned outside of the center position of right and left abs sections 29 and 29 &# 39 ;, so that the floating force generated in the right and left abs sections is balanced and the angular moment centering around the pivot 31 becomes 0 . by taking this method , it becomes possible to make equal the amount of float between two abs sections 29 and 29 &# 39 ; and thus the floating posture of head slider 22 is stabilized . fig8 shows another embodiment in which the posture of the head slider 22 is stabilized . in this embodiment , although the pivot 31 of the head slider 22 is positioned to be equal in distance from the two right and left heads 33 , the width of the abs sections of the head slider 22 is narrow on the outer circumferential side and wide on the inner circumferential side . except the difference in this width , however , the structure of these two abs sections 29 and 29 &# 39 ; are basically the same as each other . the relative speed between two abs sections 29 and 29 &# 39 ; of the head slider 22 and the magnetic disk 21 is fast on the outer circumferential side and slow on the inner circumferential side likewise in the case shown in fig6 . when the area is equal between two abs sections 29 and 29 &# 39 ;, the floating force to be applied to these two abs sections 29 and 29 &# 39 ; becomes larger on the outer circumferential side and smaller on the inner circumferential side . besides , there is a relationship between the width and floating force of the abs sections in that the floating force increases as the width of the abs section increases as shown in fig7 . to avoid this , an adjustment is made in this embodiment , so that the width of the abs section 29 on the outer circumferential side is made smaller than the abs section 29 &# 39 ; on the inner circumferential side . by this , the floating force becomes equal between two abs sections 29 and 29 &# 39 ;, thus enabling the floating posture of the head slider 22 to be stabilized . fig9 and 10 show another embodiment to further stabilize the head slider 22 . in this embodiment , the pivot 31 of head slider 22 is equal in distance from two heads 33 and the width is also equal between two abs sections 29 and 29 &# 39 ; of the head slider 22 . however , a negative pressure generating section 34 is provided in the abs section 29 on the outer circumferential side as shown clearly in fig1 . the relative speed between the abs sections 29 and 29 &# 39 ; of the head slider 22 is fast on the outer circumferential side and slow on the inner circumferential side as stated above . in case the area of the abs sections 29 and 29 &# 39 ; is equal between the outer circumferential side and inner circumferential side , the floating force applied to two abs sections becomes larger on the outer circumferential side and smaller on the inner circumferential side . now , in this embodiment , the floating force is reduced by providing a negative pressure generating section 34 in the abs section 29 on the outer circumferential side and the floating force applied to two abs sections 29 and 29 &# 39 ; becomes equal to work out a structure not to cause angular moment around the pivot 31 , even if the pivot 31 of the head slider 22 is equal in distance from two heads 33 . by this , the amount of float becomes equal between two abs sections 29 and 29 &# 39 ; and the floating posture of the head slider 22 can be stabilized . incidentally , to stabilize the floating posture of head slider 22 , it is possible to use all or a part of the measures shown in fig6 and 9 or in combination . as a modification of the embodiment in fig6 it is also possible to improve the magnetic characteristic of the head by making the amount of float of the abs section 29 &# 39 ; on the inner circumferential side much smaller as compared with that of the abs section 29 on the outer circumferential side by providing the position of the pivot 31 of the head slider 22 on the inner circumferential side , not on the outer circumferential side , from the center line of head slider 22 . in addition , as a modification of the embodiment shown in fig8 it is also possible to improve the magnetic characteristic of a head by reducing sharply the amount of float of the head on the inner circumferential side by making further smaller the floating force of the abs section 29 &# 39 ; on the inner circumferential side as compared with that of the abs section 29 on the outer circumferential side by making larger the width of the abs sections 29 and 29 &# 39 ; of the head slider 22 and narrow on its inner circumferential side . as a modification of the embodiment shown in fig9 and 10 , it is further possible to improve the magnetic characteristic of a head by reducing sharply the amount of float on the inner circumferential side by making the floating force of the abs section 29 &# 39 ; on the inner circumferential side as compared with that of the abs section 29 on the outer circumferential side by providing a negative pressure generating section in the abs section 29 &# 39 ; on the inner circumferential side of the head slider 22 . as to the other embodiments , it is also possible to work out a structure to improve the magnetic characteristic of a head by reducing sharply the amount of float of the abs section on the inner circumferential side as compared with that of the abs section on the outer circumferential side by combining all or some of the following means : ( 1 ) to provide the pivot position of head slider on the inner circumferential side , not on the outer circumferential side , from the center line of the head slider . ( 2 ) to make larger the width of the abs section of head slider on the outer circumferential side of a disk , and smaller on the inner circumferential side . ( 3 ) to provide a negative pressure generating section in the abs section on the inner circumferential side of the head slider . even in a case where the number of heads is three or more and also three abs are provided , it is possible to balance the floating force applied to a plural number of abs sections of one head slider to stabilize the floating posture of the head slider by resorting to either one or any arbitrary combination of items ( 1 ), ( 2 ) and ( 3 ) shown below : ( 1 ) to position the pivot of the head slider of the gimbal which supports the head slider on the inside or outside from the center line of the head slider . ( 2 ) to make different the width of a plural number of abs sections of one head slider . ( 3 ) to provide a negative pressure generating section in a part of each abs section of the head slider , and to make different the size of this negative pressure generating section in each abs section or to provide the negative pressure generating section in a particular abs section only of a plural number of abs sections . next , another embodiment in which the recording density of the track on the outer circumferential side is raised to prevent the use efficiency from being lowered by making smaller the width of the head on the outer circumferential side than that on the inner circumferential side will be explained using fig1 . the embodiment in fig1 shows a case of two heads , where the head slider has approximately a half of the width of the data recording and reproduction area of the magnetic disk . in the same figure , reference 40 shows the head slider , 41 shows the track on the outer circumferential side , 42 shows the track on the inner circumferential side , and 43 and 44 show the width of the track 41 and track 42 , respectively . in the conventional structure in which the width is made equal between the track on the outer circumferential side that on the inner circumferential side , suppose that the s / n of the track on the inner circumferential side is lower by 3 db than on the outer circumferential side . the limit of recording density at this time is determined according to the s / n of the track on the inner circumferential side . when the recording density of the track is equal between the outer circumferential side and inner circumferential side , there is a room to raise the recording density on the outer circumferential side . when the width 43 of track 41 on the outer circumferential side is set to a half of the width 44 of the track 42 on the inner circumferential side as shown in fig1 , the s / n become equal between tracks 41 and 42 . since the width of track 41 is a half of that track 42 , the track density can be doubled in the half section on the outer circumferential side in the disk recording and reproduction area . consequently , it is possible to make the number of tracks 1 . 5 times that of a case where the density is made equal between the inner circumferential and outer circumference . when such a structure is used for the servo surface of a magnetic disk storage device which employs a servo surface servo method , the speed data under the speed control is obtained from track 42 which is larger in width on the inner circumferential side , and the positioning data from track 41 which is smaller in width on the outer circumferential side . the head can be moved at twice the speed of a case were the speed data is obtained from track 41 on the outer circumferential side under the speed control . as compared with a case where all tracks have an equal width , it can have twice the positioning accuracy . such a servo structure is suitable to a case where two or more heads are mounted on one slider and a change in the relative position between heads due to thermal expansion , etc ., does not pose any problem in this respect in this invention . this embodiment has features in that the point of component parts can be increased by raising the track density in the disk outer circumference which had a room in the conventional recording density , that the structure can be changed greatly , and that the capacity of the entire magnetic disk is made larger without using high performance component parts . next , other embodiments in this invention will be explained below . the following are descriptions of embodiments in which precise positioning is made feasible by reducing the rate of servo pattern occupying the entire data area and by securing the track detecting capacity referring to figures . in fig1 , reference 51 is a magnetic disk and servo sector 52 is formed in a part of the disk by dividing it in the circumferential direction . while , 53a and 53b are a pair of magnetic heads mounted on one head slider 54 . the interval between head gaps , that is , the interval between magnetic heads 53a and 53b , is formed approximately a half of the entire data recording and reproduction area . the magnetic head 53a on the outer circumferential side takes charge of the outer half of the recording and reproduction of the entire data recording area , and the magnetic head 53b on the inner circumferential side takes charge of the recording and reproduction of the inner half of the entire data recording area . consequently , each head 53a and 53b can access the tracks in the entire data recording area merely by seeking approximately a half of the entire recording area . on the other hand , in the conventional device having a structure to provide one head for one head slider , the head has to make a seek operation just the same distance as the width of the entire data recording area . it is known from these facts that the seek distance of magnetic heads 53a and 53b can be reduced to a half of the conventional ones in this embodiment . when a plural number of heads are provided for one magnetic disk , there was a problem in conventional devices that the weight of the head carriage increased as a whole , since each head was supported by a separate gimbal . in this embodiment , a structure is realized in which one head slider 54 composed of two heads 53a and 53b is supported by one gimbal . since the increase in the weight of the head slider 54 itself caused by the enlargement of the width of head slider 54 is far smaller as compared with the weight of one gimbal , the weight is little increased as compared with a case where two sets of head sliders and gimbals are used . from these , it becomes possible in this embodiment to increase the number of heads per one disk and to shorten the seek distance without increasing the weight of the head actuator . further , the embodiment in this fig1 is so designed that a precise track position can be detected and the track positioning servo signal can therefore be obtained , since the magnetic head 53a on the outer circumferential side takes charge of area z 1 of the outer half of the entire data area and the servo pattern in the servo sector 52a in this are z 1 forms a two - phase di - bit pattern with four tracks taken as one cycle . on the other hand , the magnetic head 53b on the inner circumferential side takes charge of area z 2 of the inner half of the entire data area . the servo pattern in servo sector 52b in this area z 2 forms a coarse pattern with 16 tracks taken as one cycle , this making it possible to detect the track position when magnetic heads 53a and 53b are moved at high speed . at this time , the servo data is read from magnetic heads 53a and 53b , through which the whole of the head slider 54 is controlled in its positioning according to the servo data of the both heads 53a and 53b . since the magnetic heads 53a and 53b are composed on a same head slider 54 , the relationship between the fine servo patterns a , b , c and d on the outer circumferential side and coarse servo patterns p , q and r on the inner circumferential side is the same as shown in the example of a conventional magnetic disk storage device ( shown in fig2 ). since the magnetic disk storage device shown in fig2 is of a structure composed of one head 13 for one head slider , it is necessary to form all servo patterns of p , q a , b , c , d and r thoroughly from the outer circumference to the inner circumference , this making larger the rate of servo patterns occupying the entire data area . in the embodiment of this invention , the fine servo patterns a , b , c and d are formed beforehand in the magnetic head 53a area on the outer circumferential side and coarse servo patterns p , q and r in the magnetic head 53b area on the inner circumferential side separatly , through which these two servo patterns can be read concurrently through each head of 53a and 53b ; the rate of servo patterns occupying the entire data area can be reduced , and yet a precise head detecting capacity can be secured as in the conventional ones . fig1 is a configuration block diagram of the positioning system of this magnetic disk storage device . the fine positioning signal is detected by the fine positioning signal detector circuit 61 according to the fine servo patterns read through magnetic head 53a and the coarse positioning signal is detected by the coarse positioning signal detector circuit 62 according to the coarse servo patterns read through magnetic head 53b , and these signals are fetched by the microcomputer 63 . the microcomputer 63 , under the track follow - up control , reproduces the fine positioning signal from the fine positioning signal , sends it to the positioning control circuit 64 , and controls carriage 66 through the positioning mechanism 65 . while , under the speed control , the microcomputer 63 operates the position and moving speed of head slider 54 according to the coarse positioning signal and precise positioning signal and , sends the control signal to the positioning control circuit 64 so that head slider 54 can be moved smoothly up to the target tracking position to control the carriage 66 through the positioning mechanism 65 . fig1 shows the other embodiment of this invention . this embodiment is to divide the surface of magnetic disk in the circumferential direction to form servo patterns corresponding to each area taken charge by each magnetic head . in fig1 , reference 71 is the magnetic disk which is divided in the circumferential direction , and on which servo sectors 72a and 72b are formed in a different position ( a different angular interval ) in areas taken charge by each magnetic head 73a and 73b . in the same figure , reference 74 is the head slider and magnetic head 73a and 73b are provided on its both ends . incidentally , the interval of head gaps , that is , the interval between magnetic heads 73a and 73b , is set to approximately a half of the entire data area as in the embodiment shown in fig1 . in this embodiment , too , the seek distance between magnetic heads 73a and 73b can be reduced to a half as compared with the conventional ones as in the embodiment shown in fig1 . in the embodiment shown in fig1 , the magnetic head 73a on the outer circumferential side takes charge of area z 1 of the outer half of the entire data area , while the magnetic head 73b on the inner circumferential side takes charge of area z 2 of the inner half of the entire data area . servo sectors 72a and 72b are formed in different position ( angular interval ) in their respective areas z 1 and z 2 . the servo data is read by magnetic heads 73a and 73b , and the whole of the head slider 74 is controlled in positioning according to the servo data of these two heads 73a and 73b . since magnetic heads 73a and 73b are composed on a same head slider 74 , the positioning can be made accurately , even if the servo data is read alternately by each servo sector 72a and 72b for the positioning . in a conventional device in fig2 , since the magnetic disk storage device is composed of one head 13 for one head slider , a servo sector with two times of area is required from the outer circumference to the inner circumference thoroughly to obtain the servo data at the same sampling as that shown in fig1 , this making larger the rate of servo patterns occupying the entire data area . in the case of this embodiment , it is clear that the servo pattern occupying area can be reduced sharply as compared with the conventional ones . fig1 shows the head positioning system configuration block diagram of this embodiment . the position signal is detected in the position signal detection circuits 81 and 82 from the servo pattern read alternately by magnetic heads 73a and 73b and the signal is fetched by microcomputer 83 . this computer 83 reproduces the position signal and sends it to the positioning control circuit 84 to control the carriage 86 through the positioning mechanism 85 . although the above description is made in the case where two magnetic heads are provided in this embodiment , the number of magnetic heads can be increased appropriately in this invention . next , other embodiments this invention will be explained as follows : fig1 shows the magnetic head pertaining to this invention . as shown , eight magnetic heads are provided for one head slider 91 , the head gap interval 108 of two heads adjacent to these eight heads are more than approximately one - eighth of the width of the entire recording and reproducing area on the magnetic disk and yet smaller than the width of the entire recording and reproducing area , and each of these eight head gaps 100 to 107 is positioned independently in the abs sections 92 to 99 of the aobve - mentioned head slider 91 . that is , these eight abs sections provided on the head slider do not get in contact with the above - mentioned magnetic disk other than the abs sections in css . the , head slider 91 is set to the actuator through gimbal 109 . note here that the head slider 91 used must be as close as possible to the magnetic disk in its thermal expansion coefficient . fig1 shows the relation between the magnetic heads ( slider + eight heads ) and the servo data formed on the magnetic disk 110 . there are four magnetic disks 110 provided in this embodiment , so they have eight accessing surfaces . the magnetic head 100 positioned in the innermost circumference of eight heads provided on the above - mentioned one head slider for each of these eight disk surfaces is used exclusively for servo without recording or reproducing data . the width of its core is two times of heads 101 to 107 for data . the area 111 on the disk to which the servo head 100 is accessed uses the area further on the inner part than the innermost circumference of the data area which is determined by the maximum linear recording density of data , where the continuous servo data is written throughout the area beforehand . then , the above - mentioned servo data is read with the above - mentioned servo only head , through which the head positioning is made to the track within the servo data area decided . heads 101 to 107 for data recording and reproduction are formed on a same head slider 91 together with the servo only head 100 . as the servo head is positioned in the above - mentioned track , they are positioned in their corresponding position within the data recording and reproduction area . on the other hand , the signal frequency of the servo data is lower as compared with the data recording frequency . it uses the minimum recording frequency in general and 1f frequency in the mfm modulation method when employed . since the width of core of the servo head is two times of the data head as mentioned above , the s / n of the servo signal is enough , even if it is positioned further inner part of the data recording and reproducing area in general . consequently , when all of the servo data area are formed on the inner side from the innermost circuumference to be determined by the maximum linear recording density , the formatting efficiency is not lowered at all due to the formation of this servo data . even when all servo data areas are formed within the area where the data can be recorded , the format area at this time is the same as the case of the so - called servo surface servo method in which the servo only surface is provided on one disk . servo patterns are formed beforehand in the servo data area as shown in fig1 and the signal of the sync area 113 is the synchronous signal to fetch the position data 114 . the position signal which is read and generated by the servo head having two times of core width of the data head becomes two - phase position signals x25 and y26 at 4 - track cycle shown in fig1 ( a ). the servo only head is positioned for each track using the following position signals ( where n indicates an integer ): ______________________________________4n track position signal x (= a - b ) 4n + 1 track position signal y (= c - d ) 4n + 2 track position signal - x (= b - a ) 4n + 3 track position signal - y (= d - c ) ______________________________________ these position signals are selected by selecting the analog switch using the signal shown in fig1 ( b ) which is obtained by binary coding of each position signal . the position signal is obtained as shown in fig1 ( c ) in the output of this analog switch as the result . the speed of a head can be obtained by differentiating the output of the analog switch . the positioning control is performed by means of a speed control to move the head at a head speed to the vicinity of a target track and a positioning control to make the head follow up the target track accurately . aimed at moving the head effectively at a high speed in this speed control , a target speed profile is prepared beforehand according to the distance from the current track and a speed feedback control is applied to the head actuator to make the head follow up this target speed . when the head enters a prescribed distance for the target track , the speed control is changed over to the position control . in the speed control at this time , the speed is controlled to become almost zero ( 0 ). when changed over to the position control , the above - mentioned position signals are to be used according to the target track . in the position control , the stiffness is taken higher in the servo loop and a phase - lag compensation is applied to the low frequency zone to make the head follow up the target track enough with no steady error and also a phase - lead compensation is applied to the vicinity of the servo zone in serial to take a large enough phase margin to realize a stablized servo system . although the number of magnetic heads is assumed to be eight in the above - mentioned embodiment for instance , the seek time is generally proportionate to the total weight of movable parts , seek distance , and thrust constant as shown in the following equation . ## equ1 ## ( t : seek time , m : total mass of movable parts , x : seek distance and kf : thrust constant ) the smaller the former two are , the shorter the seek time becomes . so , the larger the number of heads provided for one slider is , the shorter the seek distance / seek time becomes . and yet , the more the number of heads is , the narrower the area to which one head accesses becomes . this causing the area used for the servo data area to be lessened and the formatting efficiency to be improved . when a part of the head is hollowed out to make it into a skeleton structure to lessen the total weight of movable parts , the seek time can be shortened further . as for the thermal off - track which causes a trouble in the servo surface servo method , since the servo head and the other data heads are provided through a slider only accordingly to this invention , the trouble can be removed completely and no off - track occurs due to a mechanical deviation , only if the thermal expansion coefficient of the slider is taken the same as that of the magnetic disk . in addition , since a continuous servo data can be obtained in this embodiment , the high frequency zone of the off - track can be obtained , the servo frequency zone can be taken higher , and a high stiffness can be obtained . this resists to disturbance and makes the settling time short . furthermore , since the servo data is formed even in the inner circumference than the area to record and reproduce data in general in this embodiment , it prevents the lowering in the formatting efficiency due to the servo data . when a number of heads are provided for one slider , all of the servo data areas can be formed inside from the innermost circunference to be determined by the maximum linear recording density . by this , the formatting efficiency is not lowered at all by the formation of servo data . in addition , this embodiment provides only slider as compared with conventional ones which provide several heads ( head + slider ). when some members other than the abs section are made into a skeleton structure , the seek distance can be shortened by 1 / n without increasing the weight sharply , and the seek time can be reduced effectively to a large degree . | 6 |
with reference to fig1 there is generally shown at 20 a schematic of a grinding machine incorporating a pair of grinding wheels 22 , 24 carried by grinding wheel spindles 26 , 28 which are , in turn , rotatively carried by workheads 32 , 34 respectively . workheads 32 , 34 and spindles 22 , 24 are shown disposed in a vertical spindle configuration ( i . e . with their respective spindle axis of rotation in vertical co - linear alignment ) but could also be disposed in a horizontal configuration ( i . e . with their respective spindle axis of rotation in horizontal co - linear alignment ). a first motor 40 serves to provide a rotative drive to spindle 26 and grinding wheel 22 through a drive belt 42 and pulley 44 arrangement ; while a second motor 50 serves to provide a rotative drive to spindle 28 and grinding wheel 24 through a drive belt 52 and pulley 54 arrangement . suitable and conventional power is provided for motors 40 , 50 through suitable and conventional controls 60 carried by and / or within machine frame and base 62 . spindles 26 , 28 and workheads 32 , 34 are carried by machine frame and base 62 for movement towards and away from each other through controls 60 and otherwise in a conventional manner , and so as to provide for a spacing “ s ” between a work face 70 of grinding wheel or disk 22 and a work face 72 of grinding wheel or disk 24 . an article carrier 90 is conventionally disposed for rotation about an axis 92 to move articles 94 to be ground through space “ s ” and between work face 70 of grinding wheel 22 and work face 72 of grinding wheel 24 all in substantially conventional manner . the spacing “ s ” of faces 70 , 72 is set to permit entry thereinto of article carrier 90 with articles 94 carried thereby and to facilitate grinding faces 100 , 102 of articles 94 by movement of faces 70 , 72 of grinding wheels 22 , 24 towards and into contact with faces 100 , 102 of articles 94 ; all in substantially conventional manner and under control of controls 60 . after each article 94 has had its faces 100 , 102 ground the article exits space “ s ” from between grinding faces 70 , 72 , is removed from article carrier 90 and is replaced by another article 94 with unground faces 100 , 102 also in conventional manner . the respective grinding faces 70 , 72 of grinding wheels 22 , 24 and the use of those faces and grinding wheels to grind articles comprise the instant invention . grinding wheels 22 and 24 are identical in construction and use and accordingly only grinding wheel 22 will be described in detail and with respect to fig2 and 3 . a grinding wheel base 120 ( fig2 and 3 ) is provided for grinding wheels 22 , 24 . each base 120 is circular and disk - like and includes a peripheral rim 122 extending up from a face 124 of base 120 . a plurality of openings 130 ( fig2 and 3 ) extend through base 120 to facilitate securing grinding wheel base 120 to grinding wheel spindle ( 22 , 24 ) with a rear face 132 of base 120 disposed adjacent or proximate a corresponding surface or face ( not shown ) of the spindle . additional openings 140 ( fig2 ) also extend through base 120 to facilitate securing base 120 to its spindle . an annular surface 140 ( fig2 ) of rim 122 extends between concentric walls thereof and is configured and disposed to receive a plurality of abrasive pieces 150 which are secured in place by a suitable adhesive such as an epoxy or the like . while fig2 only shows a few abrasive pieces 150 adhesively secured to surface 140 of rim 122 it should be understood that such abrasive pieces 150 are adhered to surface 140 in an array about the entire rim 122 as shown in fig4 ; and that while fig4 shows such abrasive pieces 150 slightly spaced one from the other that such abrasive pieces 150 may , in fact , be disposed so as to touch as shown in fig2 or so as to be slightly spaced as shown in fig4 . each abrasive piece 150 ( fig2 - 6 ) is of circular disk - like or wafer configuration and is preferably fabricated from vitrified material with cbn cubic boron nitride or diamond to provide super abrasive abrasive pieces . abrasive pieces 150 also be fabricated from formulations utilizing resin bond or metal bond and incorporating cbn or diamond . other combinations of the aforementioned materials may also be utilized for abrasive pieces 150 . the diameter “ d ” ( fig5 and 6 ) of each abrasive piece 150 preferably corresponds to the thickness “ t ” ( fig3 ) or width of rim 122 . an abrasive piece one inch ( 1 ″) in diameter has been found to function well but abrasive pieces in a range between one - half inch “ ½ ″ to one and one - half inches ( 1½ ″) will also serve the purpose . each abrasive piece is preferably fabricated to a thickness “ t ” ( fig6 ) of one - eighth of an inch ( ⅛ ″) but abrasive piece thickness between one - sixteenth of an inch ({ fraction ( 1 / 16 )}″) and one - half an inch ( ½ ″) would also function for the intended purpose . in fig7 and 8 an alternative embodiment of grinding disk 220 is shown . disk 220 is formed with an annular ring base 222 that includes an annular rim 224 about which abrasive pieces 230 are affixed preferably by a suitable adhesive such as that utilized for securing abrasive pieces 150 of fig2 - 6 to rim 122 ( fig2 - 4 ) of disk 120 . abrasive pieces or wafers 230 are preferably fabricated from the same materials as disks 150 and in similar size ranges of diameter and thickness ; with the thickness of rim 224 substantially corresponding to the diameter of the abrasive pieces 230 that are to be affixed thereto . abrasive pieces 230 are applied to rim 224 of disk 220 about the entire rim as shown for pieces 150 and rim 122 of disk 120 and may be so applied in a spaced relationship as shown in fig7 or closely adjacent each other as shown for pieces 150 in fig2 and 4 . or further apart as will be hereinafter explained in greater detail . articles 94 to be ground may be items and parts such as brake rotors , power steering pump rings and rotors , valve plates or the like . such articles 94 are fed between grinding wheels 22 , 24 and the grinding wheels are rotated and advanced towards each other by specified amounts to grind off the correct amount of material from articles 94 . the grinding process creates granular material both from the abrasive used for grinding and the article being ground . preferably that granular material or “ swarf ” is carried away by fluids utilized for that purpose and which also serve to cool the articles being ground and the grinding wheels . to effectively cool and to effectively carry away the swarf the fluid must circulate over and about the abrasive surfaces and over and about the articles to be ground . thus , if the entire surface of the grinding wheel rims were covered with abrasive then it would greatly restrict the flow of coolant and articles would not be properly ground . in fact , heat generated during the grinding process could effectively destroy and render useless the articles being ground . alternatively , too great a spacing between areas of abrasive of the rims of the respective grinding wheels or disks might result in inefficient grinding or improper grinding of the articles . [ 0044 ] fig1 and 13 both show a pair of abrasive pieces 150 disposed one proximate the other on a portion of the surface 122 of rim 120 of grinding wheel 22 . surface 122 has been divided into sectors 122 a , 122 b by dotted lines 123 and as such the entire surface 122 of rim 120 could be similarly divided into similar sectors . each sector 122 a , 122 b , 122 n has a given area “ a ” for its portion of surface 122 of rim 120 ; and each abrasive piece or wafer 150 covers a predetermined portion “ w ” of each sector area “ a ”. the remaining sector surface area “ r ” ( shown cross - hatched in fig1 ) that is not covered by an abrasive piece or wafer 150 provides a space over and through which fluids can flow to cool the grinding disk , and articles to be ground and to carry away “ swarf ”. in fig1 abrasive pieces 150 are spaced one adjacent the other and the covered area “ w ” equals a maximum percent of area a ; while in fig1 abrasive pieces 150 are spaced one from the other and covered area “ w ” is a lesser percent of area a then that for the configuration of fig1 . a percentage of covered are “ w ” ranging between 60 to 80 percent of sector area a is preferable to maximize grinding efficiency utilizing grinding disks according to the instant invention ; while a percentage of covered area “ w ” ranging between 10 % and 90 % of the sector area could provide acceptable grinding . [ 0046 ] fig1 shows yet another embodiment of configuration of abrasive pieces 400 and arrangement of pieces 400 on a surface 410 of a rim 420 of a grinding disk 430 . abrasive pieces 400 are shown with an octagonal , non - circular , configuration . pieces 400 are otherwise fabricated from the same material as pieces 150 and to similar dimensions . other peripheral configurations may be utilized . in addition , pieces 400 are applied to surface 410 of rim 420 in the same manner that abrasive pieces 150 are applied to surface 122 of rim 120 . rim 420 is however wider than rim 120 and abrasive pieces 400 are applied to surface 410 in spaced relationship so as to provide for at least acceptable grinding as hereinabove described and preferably so as to maximize grinding efficiency as hereinabove described . from the above description it will thus be seen that there has been provided new and novel grinding wheels and grinding processes . it is understood that although i have shown the preferred embodiments of my invention that various modifications may be made in details thereof without departing from the spirit as comprehended by the following claims . | 1 |
the invention discloses a method and system for testing networking systems . in the following description , numerous specific details are set forth to provide a more thorough description of embodiments of the invention . it will be apparent , however , to one skilled in the art , that the invention may be practiced without these specific details . in other instances , well known features have not been described in detail so as not to obscure the invention . [ 0021 ] fig1 a is a bock diagram representing a network testing system implementing an embodiment of the invention . other systems embodying the invention are exemplified in several figures described below . embodiments of the invention are implemented to test networking systems 110 . a networking system is any machine capable of handling network data traffic . examples of networking systems are hubs , repeaters , switches , routers and any machine connected to a network and capable of receiving and / or transmitting data through the network . a networking system such as a network switch performs one or more data processing on network data packets . a network switch , for example , inspects each packet for its destination and transmits each packet through the appropriate physical port 115 associated with the network route to its destination identified by its address . in other configurations , such as in network routers and firewalls , the networking system conducts more complicated processing of the data packets . for example , firewalls process data packets and apply sets of rules , which comprise filtering , blocking , redirecting of network traffic or any other rule that may be configured in the networking system . a networking system usually comprises multiple physical ports 115 for connecting with other networking systems . in an embodiment of the invention , a testing apparatus 140 is typically designed to test the capabilities of networking devices . to this end , a testing apparatus may have multiple input and output ports 130 . the testing apparatus is typically connected to the networking system through one or more physical links 120 . systems implementing the invention typically comprise at least one testing apparatus 140 containing one or more testing devices 144 , a communication bus 142 in addition to other electronic components that allow the testing apparatus to exchange data within and with outside devices . systems implementing the invention also comprise at least one processing apparatus 160 containing one or more processors 162 , a communication bus 164 and one or more communication devices 166 . in embodiments of the invention , each of the testing apparatus 140 and the processing apparatus 160 comprises at least one data communication bus ( e . g . 142 and 164 ). a data bus is typically a set of parallel connections configured to allow for the transmission of data and control instructions between electronic boards in an electronic apparatus . a widely utilized data bus architectures is the peripheral component interconnect ( pci ). the peripheral component interconnect specification is an industry standard data bus architecture . the pci architecture is designed to be synchronized with the clock speed of the microprocessor . a peripheral component interconnect data bus is part of the architecture of most modern computers , example of such computers are those based on intel &# 39 ; s pentium processor and the powerpc . the peripheral component interconnect data bus transmits 32 bits at a time through a 124 - pin connection , and 64 bits through a 188 - pin connection in an expanded implementation . a peripheral component interconnect data bus uses all active paths to transmit both address and data signals , sending the address on one clock cycle and the data on the next clock cycle . burst data can be transmitted starting with an address on the first cycle and a sequence of data transmissions can be sent on a certain number of successive cycles . in the system exemplified in fig1 a , the communication bus 142 is an industry standard architecture ( isa ) data bus , or a variation thereof . other existing standards for data bus architectures comprise the extended industry standard architecture ( eisa ) and the micro channel architecture ( mca ). however , the data communication bus 142 and / or any other data communications bus described herein may be of any data bus types . furthermore , embodiments of the invention may flexibly utilize future data bus architectures . in a current form , an embodiment of the invention implements the peripheral component interconnect architecture which is no longer implemented as a local bus and is designed to be independent of microprocessor design . in the system exemplified in fig1 a , the communication bus 142 is an industry standard architecture ( isa ) data bus . in addition , the network testing device 144 , in embodiments of the invention , is equipped individually with a pci bus and a serial link interface ( see fig1 b and the description below ). the latter pci bus allow each testing device to communicate through a serial link 150 with a processing apparatus . the processing apparatus contains one or more communication interfaces that allow the processing apparatus to communicate through one or more serial links with the testing devices . in embodiments of the invention the communication interface 166 is coupled with the testing device through a serial link 150 . the combination of the communication interfaces 166 , the serial link 150 and the local bus of the testing device constitute a bridge . embodiments of the invention utilize a bi - directional bridge allowing for transparent communications at the two ends of the serial link 150 . the bi - directional bridge allows the processing apparatus 160 to serve each of the testing devices as though they were directly coupled with bus 164 . in embodiments of the invention , the processing apparatus 160 is configured to run an operating system and computer programs that operate the testing apparatus 140 . the processing apparatus allows users to input configuration parameters that may be interpreted and then communicated to the testing apparatus . a user may select a type of testing and the individual testing devices for conducting tests on one or more networking systems . embodiments of the invention provide users with a software test suite that contains computer programs for simulating a network traffic distribution from one or more network data sources . other computer program modules allow for prioritizing traffic ( e . g ., configuring the timing of the network communication of simulated nodes ), policing traffic ( e . g ., buffering data packets and controlling the latency of the data packets &# 39 ; transit through the testing device ), and injecting errors to test error detection and handling . the computer programs enable the testing system to simulate network traffic and adapt tests based on several aspects of processing performed by the simulated / emulate network nodes . for example , the testing device may be utilized to generate data packets as though generated by a switch , a firewall , or any other machine capable of communicating through a network . in the latter example , the testing system is enabled to adapt the processing of data packets depending on the protocol chosen , and one or more simulated tasks performed by the testing system . embodiments of the invention utilize a communication interface 146 in the testing apparatus to communication with a user interface 180 . the communication interface is typically an electronic board coupled with the data bus and provides the capability of communicating data to a user interface . the communication interface may be network interface card for communicating through a network or any other communication interface such serial / parallel links . in embodiments of the invention , the user interface 180 may be a typical workstation computer equipped with a central processing unit ( cpu ), random access memory ( ram ) and all of the electronic components , well known in the art of computers , necessary to make the user interface process data and communicate with other computers and with human users . embodiments of the invention contain , computer programs for running tests on networking systems , a set of programs for analyzing traffic , filtering traffic and capturing traffic for analysis and decoding . the test suite of programs provides a way for configuring test parameters , running tests and capturing and monitoring network traffic . embodiments of the invention collect measurements about network traffic going into and coming out of a networking system in controlled situations and then analyze the data . the analysis may involve conducting one or more statistical analyses on the measurements , comparing data to previously run tests and / or comparing analysis results to a pre - defined benchmark . [ 0031 ] fig1 b is a block diagram representing a testing device as implemented in embodiments of the invention . the network testing device 144 is an electronic board containing electronic components ( e . g . silicon chips ) designed to process network packets . a testing device 144 typically comprises an electronic circuit board that comprises electronic components such as field - programmable gate array c / hips , resistors , capacitors or any other electronic component necessary for building an electronic test device . a testing device may provide several capabilities for handling network traffic . handling network traffic comprises generating network data packets , receiving network data packets , analyzing network data packets and monitoring network traffic . the capabilities for testing , monitoring and analyzing data are not limited to any specific set of functions , and they also are not limited by the type of electronic components implemented in the testing device . a testing device 144 is equipped with electronic components , such as field - programmable gate array chips that provide the capability of programming new functions to be performed by the device . thus , a testing device may comprise such functional components as a network traffic generator that is a network node emulator capable of acting as a networking system . a networking device in embodiments of the invention may also be configured to act as a network traffic monitor and / or as a network traffic analyzer . in embodiments of the invention , the testing device contains a chip 145 , a bus 147 and serial port 149 . embodiments of the invention utilize an existing product that is sold under the name “ pci split bridge ”™. the product implements a technology provided by chip referred to as the “ moselle ” chip . the moselle chip is engineered to optimize the motherboard design in computers by facilitating the connection of a circuit board that is remote from a motherboard in a way that allows the circuit board to behave as though it is located on the motherboard . the moselle chip is typically implemented in computers to allow the connection of accessory circuit boards to a docked computer in a way that allows the accessories to act as if they are a part of the docked computer . to achieve this functionality , the pci split bridge product provides a host bus adapter , which is an electronic board for coupling with the processing apparatus , and a daughter board destined for coupling with a testing apparatus . the host adapter and the daughter boards are configured to be linked to each other through a serial cable 150 . [ 0033 ] fig2 is block diagram illustrating an architecture for coupling a testing apparatus and a processing apparatus by coupling their respective buses through a serial link , in embodiments of the invention . in the latter configuration , the processing apparatus communicates with the testing apparatus through a serial link ( e . g . through a split bridge ). the configuration of the example of fig2 contains a communication interface 148 that allows bus 142 and bus 164 to appear as though they form a single entity . [ 0035 ] fig3 is a block diagram illustrating an architecture for coupling a testing apparatus , a processing apparatus and a user interface through a networking apparatus in embodiments of the invention . in the configuration of fig3 the testing apparatus is linked to the user interface and processing apparatus through a networking apparatus 190 . the latter configuration allows the user interface and / or the processing apparatus to be located remotely and utilize standard networking protocols and applications to access the testing apparatus and processing apparatus . [ 0036 ] fig4 is a block diagram illustrating an architecture for coupling a testing and processing apparatus with user interface , in accordance with embodiments of the invention . in the latter configuration a processing device 149 is directly coupled with the bus 142 in the testing system . the processing device contains a processor 162 , and computer programs for processing network data . [ 0037 ] fig5 is a block diagram illustrating an architecture for coupling a testing apparatus and a processing apparatus with user interface , in accordance with embodiments of the invention . in the latter configuration the testing apparatus and the processing apparatus are coupled through a bi - directional bridge ( e . g . split bridge technology ). the bi - directional bridge allow the testing apparatus and the processing apparatus to transparently communicate through the bridge behaving as though they shared the single data bus . the user interface system may be linked to the processing in any configuration possible ( e . g . through a network connection ). [ 0038 ] fig6 is a flowchart illustrating the steps involved in the methodology of testing a networking system using embodiments of the invention . testing a networking system &# 39 ; s performance requires addressing several aspects of the functionality of handling network traffic . a networking system may be designed to provide one or more functions for handling network traffic . a networking system may be designed to distribute traffic across all network nodes , as in the case of hubs or route packets on a port - by - port basis and / or perform packet routing ( or blocking ), depending on user - defined rules as in the case of load - balancing systems , routers and firewalls . embodiments of the invention allow a user to design a test strategy , run it through the system , monitor the test and analyze the outcome . this is achieved in systems implementing the invention by utilizing one or more configurable testing devices 144 , connected to a processing apparatus through a bi - directional bridge , represented in fig1 by its components 146 , 150 and 166 . the processing apparatus , in accordance with embodiments of the invention , provides computer programs to interface with users allowing the users to enter configuration data through a user interface at step 610 . obtaining user configuration data may involve automatically running software scripts that follow the a user &# 39 ; s actions or a programmed instruction to run the scripts . the system then generates hardware specific configuration information specifically designed to drive the testing devices at step 620 . since the testing devices are transparently accessible to the processing apparatus , the identification information for each testing device may be obtained as though the testing device is located on the local data bus of the processing apparatus . the identification information may comprise all or part of the hardware information , comprising the bus address , interrupt numbers and all other information that allows the processing apparatus to properly address and control the testing device . the system communicates the configuration information to the testing device hardware through the communication bridge linking the two separate data buses that are part of the processing apparatus and the testing apparatus , respectively , at step 630 . at step 640 , systems embodying the invention utilize the configuration information to run a networking test by selecting the testing functions that are involved in a testing session . for example , a user may choose to test how the bandwidth of the networking apparatus scales up under conditions representing a heavy load . the user may also elect to study one more networking protocols in particular detail . examples of network communications protocols are the hypertext transfer protocol ( http ) and the secure hypertext transfer protocol , that underlie most of the world wide web ( www ) traffic and the file transfer protocol ( ftp ) that allows for point - to - point transfer of electronic files . other examples comprise the simple mail transfer protocol ( smtp ), that underlies the posting of electronic mail , and the post office protocol 3 ( pop3 ), utilized in fetching electronic mail . the testing device is configured in accordance with the user &# 39 ; s configuration information to generate simulated network traffic designed to test one or more aspects of the networking functions supported by the networking system . systems embodying the invention may also behave as one or more networking systems . in this case the testing apparatus simulates one or more network nodes exchanging network data and involves the networking system undergoing testing to determine its ability to handle the networked communications . furthermore , the system may introduce errors in data packets to simulate real world experiences with errors occurring in faulty networking systems or simply under a heavy load of traffic . thus , simulation of network traffic may comprise inserting errors into network traffic . the network traffic generated for testing is applied to the networking system as an input test parameter . at step 650 , a system embodying the invention captures network test data , and monitors network traffic , by inspecting a time stamp inserted into the data packets . at step 660 , the system communicates the captured information , representing test results , in accordance with the user &# 39 ; s configuration information , through the bi - directional bridge to the processing apparatus . thus , a method and a system for testing networking systems utilizing a split system having a processing apparatus and a testing apparatus linked through a bi - directional bridge has been disclosed . the method and system allow the processing apparatus to transparently access and control testing devices on a remote apparatus as through the testing devices are located on a local system data bus . | 7 |
the present invention will now be discussed in some detail with reference to the accompanying drawings . however , first of all , some of the expedients not readily ascertainable from the drawings will be discussed . the manufacture of the die is based on the drawing which depicts the blank to be produced , that is the outer contour thereof along which it is to be severed from the rest of the material passing through the rotary creasing and cutting machine , and the folding lines along which the blank is subsequently folded to form a wrapping box or a similar container . of course , the blank will be substantially planar after leaving the machine , while the die when mounted in the rotary machine is curved to conform to the curvature of the rotating roller on which it is mounted for rotation therewith . therefore , it is necessary to take into consideration the fact that the die will be assembled in its planar position but that it will be subsequently bent , when preparing the image of the blank which is to be transferred onto a major surface of a sheet which constitutes the support portion of the die so that , when cutting and / or creasing blades are connected to the sheet and also bent therewith , the dimensions of the blank as actually severed and / or embossed during the rotation of the roller correspond to the desired dimensions . in other words , when preparing the image of the blank to be produced , the dimensions of the image which will extend in the direction of rotation of the roller when the die is mounted thereon , must be multiplied by a reducing factor when preparing the image of the blank . of course , it is also possible to obtain such an image automatically when an automatic drafting mechanism is used which is connected to a computer which recalculates the respective dimensions and controls the drafting mechanism accordingly . another possibility is to prepare the image of the blank using conventional optical methods resulting in appropriately reducing the distortion of the image of the blank in the desired direction . the image may be then photographed and one or more slides may be prepared . fig1 illustrates an image of an example of a blank to be produced in a rotary creasing and cutting machine utilizing a die according to the present invention . it may be seen that this image includes a plurality of cutting blade positioning lines 1 , and of creasing blade positioning lines 2 . in addition thereto , a plurality of cutting blade auxiliary lines 3 and of creasing blade auxiliary lines 4 extends adjacent to the lines 1 and 2 and parallel thereto . the purpose of the lines 1 to 4 will be discussed later on . a plate 5 , which may be of a metallic material , has a major surface 9 which may be provided with a lightsensitive layer . if such is the case , one or more of the slides which depict the modified images of the blanks to be produced may be distributed on the major surface 9 , and the latter may be exposed to light penetrating the slides so that a latent image is formed in the lightsensitive layer . subsequently thereto , the metallic sheet 5 is further treated in accordance with methods well known , for instance , in the printing industry for producing copied offset plates . coming now to fig2 which depicts the sheet 5 after the latent images have been developed on the major surface 9 thereof or produced in any other conventional manner , the major surface 9 in this embodiment being provided with four adjacent images arranged in their correct positions with respect to the plate 5 . the cutting blade positioning lines 1 define on the major surface 9 of the sheet 5 a blank image 6 which substantially -- except for the reducing factor -- corresponds to the configuration of the blank . fig3 and 4 illustrate two views of a sheet 5 which is provided on its major surface 9 with different images 6 . a plurality of rectangular tongues 7 and substantially semi - circular tongues 8 is bent out of the general plane of the sheet 5 and to the side thereof on which it is provided with the images 6 . the tongues 7 and 8 are bent by means of a conventional punching machine , and in the illustrated positions they extend substantially normal to the surface 9 of the sheet 5 . the tongues 7 and 8 are distributed along the cutting blade positioning lines 1 and similarly also along the creasing blade positioning lines 2 which have not been illustrated in fig3 for the sake of clarity . in the currently preferred embodiment of the invention , the distance of the tongues 7 and 8 from the cutting blade positioning lines 1 and from the creasing blade positioning lines 2 substantially corresponds to the distance of the cutting blade auxiliary lines 3 and creasing line auxiliary lines from the lines 1 and 2 , respectively . thus , the auxiliary lines 3 and 4 serve as visual guides during the punching - out of the tongues 7 and 8 . after the tongues 7 and 8 are punched out or similarly produced , elongated cutting blades 11 and / or creasing blades 11 &# 39 ; are positioned on the sheet 5 so that their respective longitudinal axes extend parallel to the positioning lines 1 and 2 , respectively and that the tongues 7 and 8 are located laterally of the respective blades 11 and 11 &# 39 ;. one of the cutting blades 11 is illustrated in fig5 and 6 as formed with a central cutting portion 12 and two laterally projecting portions 13 having upper surfaces 14 . fig7 and 8 , on the other hand , illustrate one of the creasing blades 11 &# 39 ; which is provided with a central creasing portion 12 &# 39 ; and two portions 13 &# 39 ; which project laterally of the creasing portion 12 &# 39 ; and have upper surfaces 14 &# 39 ;. thus , the blades 11 and 11 &# 39 ; are similar in construction except for the fact that the cutting portion 12 has a sharp edge , while the edge of the creasing portion 12 &# 39 ; is rounded . fig5 to 8 further illustrate two possibilities of providing the tongues 7 . thus , in the embodiment of fig5 and 6 the tongues 7 are provided on the other side of the auxiliary line 3 or 4 than the blade 11 or 11 &# 39 ;, while the tongues 7 of the embodiment of fig7 and 8 are located to the same side . as seen in fig5 to 8 , once the blades 11 and 11 &# 39 ; are positioned on the sheet 5 between the tongues 7 , the latter are bent in a conventional manner around the lateral portions 13 or 13 &# 39 ; until they contact and press against the surfaces 14 and 14 &# 39 ; respectively . in this manner , the respective blades 11 and 11 &# 39 ; are securely connected to the sheet 5 , their portions 12 , 12 &# 39 ; extending substantially normal to the major surface 9 thereof . in order to facilitate the assembly of the die , and to improve the attachment of the blades 11 and 11 &# 39 ; to the sheet 5 , a bilaterally adhesive foil 15 may be interposed between the blades 11 and 11 &# 39 ; and the surface 9 of the sheet 5 in the region bounded by the auxiliary lines 3 and 4 , respectively , which foil 15 adheres to the blades 11 and 11 &# 39 ; and to the surface 9 and thus preliminarily connects the blades 11 and 11 &# 39 ;, being reinforced by the bending of the tongues 7 around the lateral portions 13 , 13 &# 39 ; of the blades 11 and 11 &# 39 ;, respectively . fig9 illustrates a region of the sheet 5 which includes a corner region of the image 6 provided on the surface 9 of the sheet 5 . it will be appreciated that special measures must be taken for connecting the blades 11 , 11 &# 39 ; to the sheet 5 in the region of the corner of the image 6 of the blank or in any other region where the blades 11 , 11 &# 39 ; meet , particularly if the corner is rounded . thus , for example , the reference numeral 10 designates an additional tongue which has been produced without resorting to the auxiliary lines 3 and 4 . it may also be seen in this figure that the lateral portions 13 may be cut off in order to be able to assemble the die . it is also possible to provide various other recesses , which have not been illustrated , and which may receive the respective tongues 7 . this figure also illustrates that the tongues 7 may either be located opposite one another across the respective blade 11 , or may alternate therealong , or any combination of the opposite and alternating locations . after the die has been assembled in the above - discussed manner in a plane , it can be bent around , and attached to , the roller of the creasing and cutting machine . this is rendered possible by the facts that the sheet 5 is relatively thin and the blades relatively low , so that the moment of resistance of the die in the direction of bending is also relatively low . of course , it is possible that , as a result of deviations of the actual dimensions of the sheet 5 and the blades 11 from the ideal ones , the die when attached to the roller will not be completely rotationally symmetrical . in this event , any deviations from the ideal rotationally symmetrical mounting of the die on the roller may be easily compensated for by interposing suitable adhesive foils between the inner major surface of the sheet 5 and the outer circumferential surface of the roller . an advantage of the die according to the invention is that it is easy to locate the region in which the shape of the die deviates from its ideal shape , the tongues 7 serving as reference points . the worn - out or damaged blades 11 and 11 &# 39 ;, unless the damage is of such a character that it can be compensated for by interposing additional foils between the sheet 5 and the roller on which it is mounted , can be easily replaced by simply bending the tongues 7 or 8 out of contact with the surfaces 14 and 14 &# 39 ;, respectively , and into their normal positions with respect to the sheet 5 , upon which the damaged blades 11 or 11 &# 39 ; may be removed and new blades 11 or 11 &# 39 ; put into their places , after which the tongues 7 or 8 are again bent into contact with the surfaces 14 or 14 &# 39 ; of the replacement blades 11 or 11 &# 39 ;. when the method according to the present invention is utilized , it is possible to arrange the creasing and cutting blades 11 and 11 &# 39 ; on a shared sheet 5 in the same region thereof , or in two separate regions thereof , one for the cutting blades 11 and the other for the creasing blades 11 &# 39 ;, or to attach the creasing blades 11 &# 39 ; to a different sheet 5 than the cutting blades 11 . in the latter two instances , the creasing and cutting operations are performed in succession , while in the first instance both operations are performed simultaneously . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of dies differing from the types described above . so , for instance , a similar method could be used for attaching blades to a sheet of a die which is to be used in planar condition . while the invention has been illustrated and described as embodied in a method of manufacturing a cutting and / or creasing die , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can by applying current knowledge readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 8 |
for convenience and uniformity we have represented and named all compounds described in the disclosure as substituted 2 - iminoperhydroazacarbocyclics , as represented by formula i . it is known , however , that compounds of this type as acid addition salts may also be represented by the tautomeric form illustrated by the following formula ii : ## str3 ## this tautomerism has been discussed by r . kwok and p . pranc , j . org . chem . 32 , 740 ( 1967 ). structures of this formula could be named differently . in solution , under the conditions of the therapeutic utility , the proportion of each tautomeric form , or the delocalization of the charge between the two nitrogen atoms , will be dependent upon numerous factors including the nature of the substituents , the ph of the medium , and the like . this equilibrium state is conveniently depicted by the following formula iii : ## str4 ## it is understood that this disclosure relates to compounds represented or named in either tautomeric form . preferred compounds of this invention are compounds of the following type : ## str5 ## wherein y &# 39 ; is thienyl , cyclohexyl or phenyl , z is hydrogen or hydroxy ; m &# 39 ; is 3 to 5 ; and n &# 39 ; is 4 to 7 . as examples of the cycloalkyl radicals which the symbol y may represent in each of the above formulas i , ii or iii there may be mentioned , for example , cyclopentyl , cyclohexyl and cycloheptyl . as examples of the lower alkyl radicals that r and r 1 may represent , as well as the lower alkyl radicals which may appear as substituents on the substituted phenyl radicals that the symbol y may represent there may be mentioned , for example , methyl , ethyl , propyl and butyl . likewise , as examples of the lower alkoxy radicals which may appear as substituents on the substituted phenyl radicals that the symbol y may represent there may be mentioned , for example , methoxy , ethoxy , propoxy and butoxy . as examples of compounds of this invention there may be mentioned , for example , as examples of preferred compounds of this invention there may be mentioned , for example , pharmaceutically acceptable acid addition salts of the base compounds of this invention are those of any suitable inorganic or organic acids . suitable inorganic acids are , for example , hydrochloric , hydrobromic , sulfuric or phosphoric acids and the like . suitable organic acids are , for example , carboxylic acids such as acetic , propionic , glycolic , lactic , pyruvic , malonic , succinic , fumaric , malic , tartaric , citric , ascorbic , maleic , hydroxymaleic , benzoic , hydroxybenzoic , phenylacetic , cinnamic , salicyclic , 2 - phenoxybenzoic and the like , or sulfonic acids such as methane sulfonic , 2 - hydroxyethane sulfonic acid and the like . it has been found that the novel compounds of this invention , including acid addition salts and individual optical and geometric isomers where applicable , possess hypoglycemic utility . in addition to their hypoglycemic utility these compounds also possess diuretic , anticoagulant and hypotensive activity . these compounds can be used in the form of pharmaceutical preparations which contain the novel compounds suitable for oral or parenteral administration . the quantity of compound in the unit dosage can vary over a wide range to provide from about 1 . 0 mg / kg to about 100 mg / kg of body weight of the patient per dose to achieve the desired effect . the desired hypoglycemic effect can be obtained , for example , in a 70 kg subject by consumption of 25 to 500 mg of the active ingredient taken 1 to 4 times daily . the utility of the compounds of this invention is illustrated by the following . the compound of example 3 demonstrated in vitro an 89 % inhibition of adenosine diphosphate induced platelet aggregation in human platelet rich plasma when 100 μg of the compound was added to each milliliter of plasma . when 25 mg / kg of body weight of the compound of example 1 was orally administered to rats the percent of urine excretion measured in milliliters was increased by 118 % in 5 hours over that of a control group . when the compound of example 19 was orally administered to rats at 100 mg / kg of body weight a 34 % reduction in plasma glucose from control resulted . in a carrageenin abscess test when 500 mg / kg of body weight of the compound of example 22 was orally administered to rats there was a decrease in abscess weight by 60 %. the compounds of this invention are prepared by reacting an excess of a lactim ether of the formula ## str6 ## with a primary amine of the following formula ## str7 ## in a manner like that reported by r . e . benson and t . l . cairns , j . am . chem . soc . 70 , 2115 - 8 ( 1948 ). the various symbols , that is , n , r 1 , y , z and m have the meanings defined hereinbefore , and lower alkyl may be methyl , ethyl , or the like . this reaction may be carried out either in the presence or absence of a solvent . when a solvent is used it is preferred that a lower alcohol , such as , methanol , ethanol or the like be used ; however , other solvents such as benzene , toluene and the like may be used . a basic or acidic catalyst such as a tertiary amine or hydrogen chloride may be added to the reaction mixture . in general it is preferred that the hydrochloride salt of the amine be used in the reaction . the temperature of the reaction can vary from - 40 ° c . to 180 ° c ., and the preferred temperature is about 15 to about 25 ° c . the reaction time varies from about 1 hour to about 60 days being dependent upon the temperature of the reaction , the reactant primary amine , and more particularly , on the degree of stearic hindrance of the amine since highly stearically hindered amines react very slowly . the lactim ethers which find use in this reaction may be prepared from commercially available corresponding lactams by methods known in the art . for example , by reaction of an appropriate lactam with dimethyl sulfate in a solvent such as benzene , toluene , xylene or the like at the reflux temperature of the solvent for 2 to 24 hours the corresponding o - methyl lactim ether is obtained . the amines which find use in this invention may be prepared by several known methods . the substituted cycloalkylamine may be obtained from the corresponding nitro derivative or the oxime [ c . kaiser et al ., j . med . pharm . chem . 5 , 1243 ( 1962 )] by reduction . or , the cyclohexylcycloalkylamine compounds may be obtained by hydrogenation of the corresponding phenylcycloalkylamine derivative . also by the leuckart reaction the appropriately substituted cycloalkanone is heated with ammonium formate to a temperature of 180 ° to 200 ° c . for 2 to 12 hours to give the desired substituted cycloalkylamine . the substituted cycloalkanone derivatives may be obtained by a grignard reaction of a suitable aryl - or cycloalkylmagnesium halide with an appropriate cycloalkanone to give the corresponding substituted cycloalkalene which is subsequently treated with hydrogen peroxide by methods generally known in the art . the compounds of this invention may also be prepared using a complex of an appropriate lactam with phosphorus oxychloride , phosgene , borontrifluoride etherate , dimethyl sulfate , hydrogen halide or a combination of two or more such reagents . the complex formed is reacted with an appropriate primary amine described hereinabove in an aromatic hydrocarbon solvent such as benzene , toluene or xylene or an alkyl polyhalide solvent such as carbon tetrachloride , chloroform , methylene chloride , dichloroethane , tetrachloroethylene or the like . the reaction temperature is limited by the boiling point of the solvent , however , in some cases it is advantageous to carry out the reaction at room temperature or with cooling at 0 ° to - 40 ° c . depending on the reactants . representative compounds of the invention and their preparation as well as pharmaceutical compositions and their preparation are illustrated in the following specific examples . a mixture of 4 . 0 g of cis - 2 - phenylcyclopentylamine hydrochloride , m . p . 205 °- 206 ° c . and 5 . 0 ml of o - methylcaprolactim was allowed to stand at room temperature for 6 days with occasional stirring . a few drops of ethanol were added to maintain a stirrable slurry , after which the mixture was cooled . the resulting solid was washed with ether and recrystallized from acetone / methanol to give the desired product , m . p . 181 . 5 °- 183 . 5 ° c . ( dec .). following the procedure of example 1 , only substituting for cis - 2 - phenylcyclopentylamine hydrochloride the appropriate molar equivalent amount of trans - 2 - phenylcyclopentylamine hydrochloride , m . p . 147 °- 149 ° c ., the desired product was obtained , m . p . 192 °- 195 ° c . ( a ) using rhodium - on - charcoal catalyst in a paar shaker , 12 . 6 g of cis - 2 - phenylcyclopentylamine hydrochloride , m . p . 204 °- 206 ° c . in 100 ml of water was hydrogenated . in 20 hours when the theoretical amount of hydrogen had been taken up the catalyst was removed by filtration , the filtrate made basic with sodium hydroxide solution , and the resulting precipitate was extracted into ether . after evaporation of the ether the residue was distilled , b . p . 100 °- 102 ° c . ( 6 . 0 mm ). the hydrochloride salt was prepared and recrystallized from isopropanolether to give 4 . 4 g of cis - 2 -( cyclohexyl ) cyclopentylamine hydrochloride , m . p . 174 °- 176 ° c . ( b ) by the procedure of example 1 only employing a reaction time of 29 days and substituting for cis - 2 - phenylcyclopentylamine hydrochloride an appropriate amount of cis - 2 - cyclohexylcyclopentylamine hydrochloride , the desired product was obtained , m . p . 179 °- 180 ° c . by the procedure described in example 3 ( a ) only substituting for cis - 2 - phenylcyclopentylamine hydrochloride an appropriate amount of trans - 2 - phenylcyclopentylamine hydrochloride , m . p . 142 °- 143 ° c ., the hydrochloride salt of trans - 2 - cyclohexylcyclopentylamine was obtained , m . p . 199 °- 200 ° c . following the procedure of example 1 only substituting for cis - 2 - phenylcyclopentylamine hydrochloride an appropriate amount of trans - 2 - cyclohexylcyclopentylamine hydrochloride and employing a reaction time of 38 days , the desired product was obtained , m . p . 208 °- 210 ° c . from 575 g of p - chlorophenyl bromide and 78 g of magnesium turnings in 2 . 6 liters of anhydrous ether was prepared p - chlorophenyl magnesium bromide to which was added dropwise a solution of 252 g of cyclopentanone in 1 liter of ether . the mixture was stirred overnight and was decomposed by careful addition of dilute hydrochloric acid . the organic phase was separated , washed and dried , and the solvent was evaporated . the resulting solid was recrystallized from ethanol to give 316 g of 1 -( p - chlorophenyl ) cyclopentene , m . p . 71 °- 73 ° c ., which was dissolved in 2 . 9 liters of acetic acid containing 6 ml of concentrated sulfuric acid . to this solution 133 g of 50 % hydrogen peroxide was added dropwise during which time the reaction temperature was maintained at 30 ° to 35 ° c . the reaction mixture was stirred overnight after which water was added and the product was extracted into ether . the extract was washed , dried and the solvent evaporated leaving crude 2 -( p - chlorophenyl ) cyclopentanone which was distilled , b . p . 135 °- 154 ° c . ( 0 . 1 mm ) yielding 140 g . the oxime , m . p . 154 °- 155 ° c . was reduced using raney nickel in alcoholic ammonia to give 2 -( p - chlorophenyl ) cyclopentylamine which was subsequently converted to the hydrochloride salt , m . p . 226 °- 228 ° c . following the procedure of example 1 , only substituting for cis - 2 - phenylcyclopentylamine hydrochloride , an appropriate amount of 2 -( p - chlorophenyl ) cyclopentylamine hydrochloride , the desired product was obtained , m . p . 253 °- 255 ° c . following the procedure of example 1 , only substituting for o - methylcaprolactim an appropriate amount of o - methylenantholactim , o - methylcaprylolactim , o - methylvalerolactim or o - methyl - 5 - tert - butylcaprolactim , the following compounds are obtained : following the procedure of example 1 , only substituting for cis - 2 - phenylcyclopentylamine hydrochloride an appropriate amount of trans - 2 - phenylcyclohexylamine hydrochloride , m . p . 251 °- 257 ° c ., and employing a reaction time of 38 days , the desired product was obtained , m . p . 236 °- 239 ° c . by the procedure of example 1 , only substituting for cis - 2 - phenylcyclopentylamine hydrochloride an appropriate amount of the hydrochloride salt of an amine listed in table i , the respective products listed in table i are obtained . the amines employed in examples 8 through 12 are described by w . f . trager et al ., in j . org . chem . 27 , 3006 - 10 ( 1962 ), and those used in examples 13 and 14 are described by m . mousseron and m . mousseron - canet , c . r . acad . sci . 239 , 502 ( 1954 ). the amines employed in examples 15 and 16 are obtained by the reduction of 2 -( m - anisyl ) cyclohexanone oxime and 2 -( p - anisyl ) cyclohexanone oxime [ w . c . and r . b . wildman , j . org . chem . 17 , 581 ( 1952 )] and those used in examples 17 and 18 are obtained by the reduction of the oxime of 2 - cyclopentylcyclopentanone ( h . cristol et al ., bull . soc . chim . france 1958 , 556 ). ______________________________________ex . no . amine final product______________________________________ 8 2 - o - tolyl ) cyclohexylamine hexahydro - 2 -[ 2 -({ 0 - tolyl }- cyclohexyl ) imino ] azepine hydrochloride 9 2 -( p - tolyl ) cyclohexylamine hexahydro - 2 -[ 2 -({ p - tolyl }- cyclohexyl ) imino ] azepine hydrochloride10 2 -( o - chlorophenyl ) cyclo - 2 -[ 2 -({ o - chlorophenyl }- hexylamine cyclohexyl ) imino ] hexa - hydroazepine hydrochloride11 2 -( m - chlorophenyl ) cyclo - 2 -[ 2 -({ m - chlorophenyl }- hexylamine cyclohexyl ) imino ] hexa - hydroazepine hydrochloride12 2 -( p - chlorophenyl ) cyclo - 2 -[ 2 -({ p - chlorophenyl }- hexylamine cyclohexyl ) imino ] hexa - hydroazepine hydrochloride13 cis - 2 - cyclopentylcyclo - 2 -[ 2 -({ cis - 2 - cyclopentyl }- hexylamine cyclohexyl ) imino ] hexa - hydroazepine hydrochloride14 trans - 2 - cyclopentylcyclo - 2 -[ 2 -({ trans - 2 - cyclopentyl }- hexylamine cyclohexyl ) imino ] hexa - hydroazepine hydrochloride15 2 -( m - anisyl ) cyclohexyl - 2 -[ 2 -({ m - anisyl } cyclohexyl )- amine imino ] hexahydroazepine hydrochloride16 2 -( p - anisyl ) cyclohexyl - 2 -[ 2 -({ p - anisyl } cyclohexyl )- amine imino ] hexahydroazepine hydrochloride17 cis - 2 -( cyclopentyl ) cyclo - 2 -[ 1 -({ cis - 2 - cyclopentyl }- pentylamine cyclopentyl ) imino ] hexa - hydroazepine hydrochloride18 trans - 2 -( cyclopentyl )- 2 -[ 2 -({ trans - 2 - cyclopentyl }- cyclopentylamine cyclopentyl ) imino ] hexa - hydroazepine hydrochloride______________________________________ by the procedure described in u . s . pat . no . 2 , 520 , 516 ( 1950 ) 2 -( 2 - thienyl ) cyclopentylamine hydrochloride , m . p . 168 °- 172 ° c ., was prepared and substituted for cis - 2 - phenylcyclopentylamine hydrochloride in example 1 to give the desired product , m . p . 144 °- 151 ° c . following the procedure of example 1 only substituting for cis - 2 - phenylcyclopentylamine hydrochloride an appropriate amount of cis - or trans - 2 - phenylcycloheptylamine hydrochloride , m . p . 229 °- 230 ° c . and 199 °- 201 ° c . respectively , and using reaction times of 20 and 21 days respectively , the desired products were obtained , cis - m . p . 234 °- 235 ° c ., trans - m . p . 207 °- 211 ° c . following the procedure of example 1 , only substituting for cis - 2 - phenylcyclopentylamine hydrochloride and o - methylcaprolactim , appropriate amounts of cis - 2 -( cyclohexyl ) cyclopentylamine hydrochloride and o - methylvalerolactim respectively the desired product was obtained . m . p . 195 . 5 °- 197 ° c . to 21 . 7 g of 2 - azacyclotridecanone in 200 ml of dry benzene was added dropwise 15 . 3 g of phosphorus oxychloride . the mixture was stirred at room temperature for 4 hours after which 19 . 8 g of cis - 2 - phenylcyclopentylamine hydrochloride was added . the reaction mixture was stirred at room temperature for 2 hours and refluxed for 24 hours . the resulting homogeneous solution was washed with 2n naoh , 2n hcl and saturated nacl solution , dried over sodium sulfate and the solvent evaporated . the resulting oily product crystallized from acetone and was recrystallized from methanol - acetone to give the desired product , m . p . 156 °- 159 ° c . by the procedure of example 22 , only substituting for 2 - azacyclotridecanone an appropriate amount of n - methyl - 2 - pyrrolidone or 3 - chlorocaprolactam the following products are obtained : to a refluxing solution of 100 g of valerolactam in 350 ml of dry benzene was added dropwise 125 g of dimethylsulfate . after refluxing overnight the mixture was treated with saturated potassium carbonate solution , dried and the solvent was evaporated . the product was distilled at 20 mm , b . p . 55 °- 57 ° c . following the procedure of example 24 only substituting for valerolactam an appropriate amount of enantholactam , caprylolactam , 5 - tert - butylcaprolactam or caprolactam the following compounds were prepared : a solution of 73 . 5 g ( 0 . 75 mole ) of 1 , 2 - cyclopentanedione in 400 ml of ether was added to 1 . 5 moles of phenyl lithium in 1 . 2 liter of ether , and the mixture was stirred under n 2 for one half hour . after careful addition of water , the ethereal layer was separated , dried over magnesium sulfate and the solvent evaporated . the residue was distilled under reduced pressure and gave 77 . 2 g of 2 - hydroxy - 2 - phenylcyclopentanone , b . p . 122 °- 126 ° c . ( 1 . 5 mm ), n d 25 1 . 5551 . the oxime was prepared by known procedures , m . p . 110 °- 112 ° c ., and was reduced by hydrogenation over raney nickel in 20 % alcoholic ammonia . removal of catalyst , evaporation of solvent and addition of hcl gave 2 - hydroxy - 2 - phenylcyclopentylamine hydrochloride , m . p . 198 °- 199 ° c . following the procedure described in example 1 , only substituting for cis - 2 - phenylcyclopentylamine hydrochloride an appropriate amount of 2 - hydroxy - 2 - phenylcyclopentylamine hydrochloride and employing a reaction time of 47 days the desired product was obtained , m . p . 261 °- 262 ° c . a slurry of 3 . 0 g ( 0 . 0152 mole ) of powdered 2 - phenylcyclopentylamine hydrochloride and 3 ml of 5 , o - dimethylbutyrolactim is allowed to stand at room temperature for 6 days with occasional stirring during which time sufficient ethanol is added to maintain the slurry . the slurry is then cooled to - 20 ° c ., and after about four hours a precipitate forms . the precipitate is collected and recrystallized several times from acetone - methanol to give 5 - methyl - 2 -[( 2 - phenylcyclopentyl ) imino ] pyrrolidine hydrochloride , m . p . 175 °- 178 ° c . a slurry of 3 . 0 g ( 0 . 0152 mole ) of powdered 2 - phenylcyclopentylamine hydrochloride and 3 ml of o - methylbutyrolactim is allowed to stand at room temperature with occasional stirring for 6 days after which the material is covered with absolute ether . the solution is allowed to stand at room temperature for an additional 6 days . a precipitate forms which is collected and recrystallized from acetone - methanol and dried to give 2 -[( 2 - phenylcyclopentyl ) imino ] pyrrolidine hydrochloride , m . p . 155 °- 158 ° c . when in the procedure of example 27 , 3 . 0 g ( 0 . 0147 mole ) of 1 - cyclohexylcyclopentylamine hydrochloride is substituted for 1 - phenylcyclopentylamine , and the slurry is allowed to stand at room temperature for 8 days , 5 - methyl - 2 -[( cis - 2 - cyclohexylcyclopent - 1 - yl ) imino ] pyrrolidine hydrochloride is obtained , m . p . 234 °- 236 ° c . ( dec ). a slurry of 3 . 0 g ( 0 . 0147 mole ) of powdered 1 - cyclohexylcyclopentylamine hydrochloride and 3 ml of o - methylbutyrolactim is allowed to stand at room temperature for 8 days during which time sufficient ethanol is added to maintain a slurry . a precipitate forms which is collected , washed with ether , dried and recrystallized from acetone - methanol to give 2 -[( cis - 2 - cyclohexylcyclopent - 1 - yl ) imino ] pyrrolidine hydrochloride , m . p . 227 °- 228 ° c . to 26 . 3 g ( 0 . 15 mole ) of n - benzylbutyrolactone in 200 ml of dry benzene is added dropwise 19 . 2 g ( 0 . 125 mole ) of phosphorus oxychloride . the mixture is stirred at room temperature for four hours after which 24 . 7 g ( 0 . 125 mole ) of 1 - phenylcyclopentylamine hydrochloride is added , and stirring is continued at room temperature for two hours . the reaction mixture is refluxed for 24 hours and then allowed to stand at room temperature for five days . a solid forms which is separated and the filtrate is washed with 2n hcl . the wash and solid residue are made basic with 2n sodium hydroxide solution , extracted into ether and dried over sodium sulfate to give 40 . 3 g of an oil . to the oil in acetone is added one equivalent of methanolic hcl . a precipitate forms which is recrystallized from methylene chloride - ether to give 1 - benzyl - 2 -[( cis - 2 - phenylcyclopentyl ) imino ] pyrrolidine hydrochloride , m . p . 158 °- 166 ° c . ______________________________________ per tablet______________________________________ ( a ) 2 -[( 2 - cyclohexylcyclopentyl ) imino ]- hexahydroazepine hydrochloride 100 mg ( b ) wheat starch 15 mg ( c ) lactose 33 . 5 mg ( d ) magnesium stearate 1 . 5 mg______________________________________ a granulation obtained upon mixing lactose with the starch and granulated starch paste is dried , screened and mixed with the active ingredient and magnesium stearate . the mixture was compressed in tablets weighing 150 mg each . in a similar manner other compositions may be prepared by substituting the other compounds of this invention for 2 -[( 2 - cyclohexylcyclopentyl ) imino ] hexahydroazepine used in this example . | 2 |
for the purposes of promoting an understanding of the principles of the present disclosure , reference will now be made to the embodiments illustrated in the drawings , and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of this disclosure is thereby intended . while the concepts of the present disclosure are illustrated and described in detail in the figures and the description herein , results in the figures and their description are to be considered as exemplary and not restrictive in character . it is understood that only the illustrative embodiments are shown and described and that all changes and modifications that come within the spirit of the disclosure are desired to be protected . unless defined otherwise , the scientific and technology nomenclatures have the same meaning as commonly understood by a person in the ordinary skill in the art pertaining to this disclosure . as disclosed herein , in at least one embodiment , a gag - based polymeric system can be prepared by following two strategies : ( i ) chemical covalent bonding and ( ii ) physically entrapped and / or entangled ( non - covalent ) strategies as shown in fig1 . in at least one embodiment , gag polysaccharides can be modified in predictable synthetic routes to control the properties of the resulting materials , including modifications leading to hydrophobicity and biological activities . in part , the present disclosure provides for a composition comprising at least one monomeric unit of ha functionalized by at least one functional group moiety . chemical modifications of ha can be targeted to three functional groups : the glucuronic acid carboxylic acid , the primary and secondary hydroxyl groups , and the n - acetyl group ( following deamidation ). in some embodiments , compositions of ha in the present disclosure are provided that may be represent by formula i , ii , iii and iv ( fig2 ). carboxylates in a ha backbond can be modified by carbodiimide - mediated reactions , esterification , and amidation . hydroxyls in a ha backbond can be modified by etherification , divinylsulfone crosslinking , esterification , and bisepoxide crosslinking . additionally , converting diols to aldehydes can be achieved through periodate oxidation of ha . finally , deacetylation of the n - acetyl group of ha recovers an amino group which can then react with an acid using the same amidation . the functional groups r 1 , r 2 , r 3 , r 4 , and r 5 may include any one of or a combination of haloacetates , dihydrazides , amines , thiols , carboxylic acids , aldehydes , ketones , active hydrogen sites on aromatic ring , dienes , azide isothiocyanates , isocyanates , acyl azides , n - hydroxysuccinimide ( nhs ) esters , sulfo - nhs , sulfonyl chloride , epoxides , carbonates , aryl halides , imidoesters , carbodiimides ( e . g . n , n ′- dicyclohexylcarbodiimide ( dcc ) and 1 - ethyl - 3 -( 3 - dimethylaminopropyl ) carbodiimide ( edc )), alkylphosphate compounds , anhydrides , fluorophenyl esters , hydroxymethyl phosphines , guanidino groups , iodoacetyl derivatives , maleimides , aziridines , acryloyl derivatives , arylating agents , disulfide derivatives , vinylsulfone , phenylthioester , cisplatins , diazoacetates , carbonyl diimidazoles , oxiranes , n , n ′- disuccinimidyl carbonates , n - hydroxylsuccinimidyl chloroformates , alkyl halogens , hydrazines , alkynes , and phosphorus - bound chlorine . the functionalized polysaccharides may include the combination of ha and cs . ha may be used in an amount ranging from 0 . 1 % to 99 % by weight . ha has an average molecular weight in the range of 10 - 3 , 000 kilo daltons , preferably 1000 - 3000 kilo daltons . sulfated gags may be used in an amount ranging from 0 . 1 % to 99 % by weight . cross - linkers can be both synthetic polymers and natural polymers . the natural polymers may include any one of or a combination of fibrin , collagen , matrigel , elastin , elastin - like peptides , albumin , natural poly ( amino acids ) ( e . g . cyanophycin , poly ( lysine ), and poly ( γ - glutamic acid )), polysaccharides ( e . g . chitosan , dextran , chondroitin sulfate , agarose , alginate , methylcellulose , and heparin ), α - cyclodextrin ( cd ), β - cd , γ - cd , and blends thereof . synthetic polymers may include any one of or a combination of poly ( aliphatic ester ) ( e . g . poly ( lactide ) ( pla )), poly ( ε - caprolactone ) ( pcl ), poly ( glycolic acid ) ( pga ), poly ( lactic - co - glycolic acid ) ( plga ), poly ( trimethylene carbonate ) ( ptmc ), polydioxanone ( pds ), poly ( ortho ester ), polyanhydrides , poly ( anhydride - co - imide ), poly ( anhydride - esters ), polyurethanes ( e . g . degrapols ), poly ( amides ), poly ( esteramides ), poly ( orthoesters ), poly ( dioxanones ), poly ( acetals ), poly ( ketals ), poly ( carbonates ), poly ( orthocarbonates ), poly ( hydroxylbutyrates ), poly ( hydroxyl - valerats ), poly ( alkylene oxalates ), poly ( alkylene succunates ), poly ( malic acid ), poly ( amino acids ), poly ( vinylpyrolidone ), poly ( hydroxycellulose ), poly ( glycerol sebacate ), poly ( ethylene imine ), poly ( acrylic acid )( paa ), poly ( n , n ′- diethylaminoethyl methacrylate ) ( pdeaema ), polyethylene glycol ( peg ), poly ( propylene oxide ) ( ppo ), peo - b - ppo block copolymers ( e . g . pluronics or poloxamers , and tetronic ), poly ( vinyl alcohol ) ( pva ), poly ( n - isopropylacrylamide ) ( pnipam ), poly ( n , n - diethylacrylamide ) ( pdeaam ), poly ( oxazolines ) ( e . g . poly ( 2 - methyloxazoline and poly ( 2 - ethyl - 2 - oxazoline )), oligo ( poly ( ethylene glycol ) fumarates ), poly ( propylene fumarate ), poly ( alkyl cyanoacrylates ), poly ( acrylic amide ), synthetic poly ( amino acids ) ( e . g . poly ( l - glutamic acid ) ( l - pga ) and poly ( aspartic acid )), poly ( phosphazenes ), poly ( phosphoesters ), and blends thereof . a cross - linker may include a homo - or hetero - functional modifier of the following formula : a - cross - linker - z in some embodiment , one of a and z is a moiety selected from the group consisting of hydroxyls , thiols , aminos , alkyls , alkenyls , alkoxysulfonate , arylsulfonate , heteroarylsulfonate , azides , maleimido , propargyl , haloacetate , dihydrazide , amines , carboxylic acids , aldehydes , ketones , active hydrogen sites on aromatic ring , dienes , azide isothiocyanates , isocyanates , acyl azides , ether nhs esters , sulfo - nhs , pentafluorophenyl ( pfp ), azlactones , sulfonyl chloride , epoxides , carbonates , aryl halides , imidoesters , biotin , carbodiimides ( e . g . dcc and edc ), alkylphosphate compounds , anhydrides , fluorophenyl esters , hydroxymethyl phosphine , guanidino groups , iodoacetyl derivatives , maleimides , aziridines , acryloyl derivatives , arylating agents , disulfide derivatives , vinylsulfone , phenylthioester , cisplatin , diazoacetate , carbonyl diimidazole , oxiranes , n , n ′- disuccinimidyl carbonate , n - hydroxylsuccinimidyl chloroformate , alkyl halogens , hydrazine , maleimide , alkyne , and phosphorus - bound chlorine . structures of a cross - linker may be any one of or a combination of linear , dendrimers - like , star - shaped , hyper - branched , combed , brushed , cross - linked architectures , fibers , microspheres , and nanoparticles . examples are shown in fig4 . the number of arms in star - shaped polymers may be two or more . fibers may comprise any one of or a combination of polymer fibers , carbon fibers , and ceramic fibers . microspheres and nanoparticles may comprise any one of or a combination of polymer micro / nanospheres , iron oxide , silica , gold , and mesoporous silica nanoparticles . a cross - linker with homo - or hetero - functional groups can be prepared by addition or chain growth polymerizations , coordination polymerizations , and condensation or step growth polymerizations . addition or chain growth polymerizations include free radical polymerization , controlled - living radical polymerization ( e . g . atom transfer radical polymerization ( atrp ), reversible addition fragmentation transfer ( raft ) polymerization , and nitroxide - mediated radical polymerization ( nmp )), cationic polymerizations , anionic polymerizations and the like . the conjugation of functionalized ha and cross linkers can be achieved by any one of or the combination of the following reactions : carbodiimide - mediated reactions , esterification , amidation , aldehyde and ketone reactions , active hydrogen reactions , photo - chemical reaction , azide - alkyne cycloaddition ( e . g . copper - catalyzed azide - alkyne cycloaddition ( cuaac ), copper - free azide - alkyne huisgen cycloaddition or strain - promoted azide - alkyne cycloaddition ( spacc )), thiol - based click reaction ( thiol - yne , thiol - ene , thiol - isocyanate , thiol - michael addition ), diels - alder reactions , tetrazole cycloaddition , nitrile oxide cycloaddition , oxime / hydrazone formation , enzymatic crosslinking , and coordination chemistry , and ligand exchange reactions . examples are shown in fig3 . the conjugated linkages may include any one of or a combination of isothiourea , isourea , amide , sulfonamide , secondary amine , sulfonamide , shift - base , secondary amino - methyl , carbamate , aryl amine , amidine , amide , phosphoramidate , guanidine , substituted imidocarbonate , thioether , aryl thioether , disulfide , sulfonate , thiosulfonyl , ester , ether , carbamate , hydrazone , diazo , triazoles , iodinated compound , carbohydrates , amino acid esters bond , cycloalkene , oxime triazole , and triazoline . physical interactions may include any one of or a combination of hydrophobic interactions , hydrophilic interactions , hydrogen bonding , electrostatic interactions , and van der waal interactions . examples are shown in fig5 . the gag - based system can be used as a cellular matrix for 3d cell culture and tissue engineering as well as a delivery vehicle for therapeutic agents including but not limited to cells , growth factors , and small molecules . cells to be encapsulated within the engineered composite may comprise any one of or the combination of , but not limited to , mesenchymal stem cells , osteoblast , chondrocytes , adipocyte , fibroblast , hepatocytes , enterocytes , urothelial cells , blood cells , skin cells , endothelial cells , nerve cells , sex cells , and cancer cells . example 1 : ha / cs / poly ( ethylene glycol ) diacrylate composite hydrogel as hmscs niches we developed a novel biomimetic hydrogel system as a tunable stem cell niche through the combination of thiolated ha ( ha - sh ) and thiolated cs ( cs — sh ) cross - linked with poly ( ethylene glycol ) diacrylate ( pegda ) as shown in fig6 . the combination of ha and cs offers a cell - friendly microenvironment found in native tissues , whereas the selection of peg is based on its established biocompatibility and chemical versatility . the efficient control of various hydrogel properties is demonstrated by simply varying the molecular weight of peg . a thiol - ene click reaction was selected due to its high efficiency in aqueous media , reliability , lack of by - products , unsubstantial degradation of the polysaccharide backbone , and without the use of any metal catalysts [ 22 ] . to our knowledge , this is the first report that tricopolymers of ha , cs , and peg in the forms of natural / synthetic composite hydrogels were fabricated through thiol - ene click chemistry . we showed the efficient control of various hydrogel properties ( e . g ., swelling , modulus , and gelation time ) by simply varying the peg molecular weight ( mw ). we also demonstrated that the composite hydrogels could support 3d encapsulation of human mscs ( hmscs ) with high viability as well as tunable cell - hydrogel interactions by varying the properties of hydrogels . the ability of fine - tuning hydrogel properties paves the way for further optimization of cellular responses to promote in situ tissue regeneration . hyaluronic acid sodium salt ( ha ) with molecular weight ( mw ) of 2 - 3 million daltons and chondroitin sulfate sodium salt ( cs ) with average mw 10 - 30k daltons were purchased from carbosynth limited ( berkshire , uk ). 1 - ethyl - 3 -( 3 - dimethylaminopropyl ) carbodiimide ( edc ), and polyethylene glycol diacrylate ( pegda ) with mw of 700 , 3400 , and 8000 were purchased from alfa aesar ( ward hill , mass .). pegda700 was passed through a short column containing basic alumina to remove the inhibitor before use . pegda3400 and pegda8000 were precipitated in diethyl ether twice to remove the inhibitor before use . peg divinylsulfone , ( mw 3500 daltons ) and 4 arm peg vinylsulfone ( mw 20000 daltons ), were purchased from jenkem technology usa inc . n - hyroxysuccinimide ( nhs ), cystamine dihydrochloride , 5 , 5 ′- dithiobis ( 2 - nitrobenzoic acid ) ( ellman &# 39 ; s reagent ), dl - dithiotreitol ( dtt ), and 2 -( n - morpholino ) ethanesulfonic acid ( mes ) were purchased from sigma - aldrich ( st . louis , mo .). 10 × phosphate buffer saline ( pbs ) was purchased from fisher bioreagents ( pittsburgh , pa .). penicillin - streptomycin ( pen strep ), ethidium homodimer - 1 ( ethd - 1 ), and calcein am were purchased from life technologies ( carlsbad , calif .). carboxyl groups in ha and cs were functionalized to thiol groups by a simple two - step reaction scheme which is depicted in fig7 . in a typical procedure , ha ( 1 g , 2 . 5 mmol ) was dissolved in 100 ml mes buffer ( 0 . 1 m mes , ph 6 . 0 ) in a 45 ° c . oil bath and allowed to dissolve overnight . edc ( 2 . 4 g , 12 . 5 mmol ) and nhs ( 3 . 9 g , 34 mmol ) were added and allowed to react for 2 h . then cystamine dihydrochloride ( 5 . 65 g , 25 mmol ) was added to the mixture and allowed to react overnight while stirring . the reaction mixture was exhaustively dialyzed ( mwco of 12 - 14 , 000 ) against distilled 0 . 1m nacl for 60 h , 25 % ethanol for 12 h and distilled ( di ) water for 12 h . after dialysis , the product , ha - conjugated cystamine ( ha - s — s — nh 2 ), was lyophilized and kept at in − 20 ° c . ha - conjugated cystamine ( 0 . 25 g ) was dissolved in pbs with a concentration of 5 mg / ml then dtt ( 0 . 75 g , 4 . 8 mmol ) was added to the flask and ph was adjusted to 7 . 4 with 1 m naoh . nacl was added to produce a 5 % w / v solution after 20 h and the modified ha was precipitated in 10 - fold ethanol three times . the precipitation was dissolved in h 2 o at a concentration of approximately 5 mg / ml and the purified product was freeze - dried and kept at − 80 ° c . freezer . in a typical procedure , cs ( 1 g , 2 mmol ) was dissolved in 40 ml mes buffer ( 0 . 1m mes , ph 6 . 0 ). edc ( 3 . 086 g , 16 . 2 mmol ) and nhs ( 2 . 280 g , 19 . 8 mmol ) were added to the flask and allowed to react for 2 h . following the 2 h activation step , the ph was raised to 7 . 2 using 1 m naoh . cystamine dihydrochloride ( 4 . 460 g , 20 mmol ) was subsequently added to the solution and allowed to react for overnight . the cs - conjugated cystamine ( cs — s — s — nh 2 ) was exhaustively dialyzed ( mwco of 12 - 14 , 000 ) against distilled 0 . 1m nacl for 60 h , 25 % ethanol for 12 h and di water for 12 h and then was lyophilized . the cs — s — s — nh 2 was reduced using dtt as the same procedure of reduction of ha . the structure of functionalized - ha or cs were confirmed 1 h nmr spectroscopy ( d 2 o , bruker arx 400 mhz ) and the degree of thiolation was also confirmed with an ellman &# 39 ; s assay using l - cysteine as the standard . the structures of ha and cs - conjugated cystamines were confirmed by proton nuclear magnetic resonance ( 1 h nmr ) spectroscopy , with the degree of modification ( ds ) estimated from integration of methylene protons relative to the n - acetyl methyl protons in fig8 . by varying the molar ratios of ha / edc / nhs , variable ds values ( 4 . 1 - 43 . 1 %) were obtained ( table 1 , which shows the effects of edc concentration on degree of substitution ( ds ) of — nh 2 .). for example , molar ratios of 1 : 5 : 13 . 5 and 1 : 10 : 13 . 5 yielded ha - conjugated cystamines with ds of 27 % and 43 . 1 %, respectively . therefore , cs / edc / nhs molar ratio of 1 : 10 : 13 . 5 was selected for cs modification . subsequently , reduction of ha and cs - conjugated cystamines by dithiotreitol ( dtt ) resulted in free thiol groups . the two - pot reaction allows for efficient control of dtt reduction reactions and minimizes the oxidation of thiols resulting in the disulfide formation and the insolubility of ha or cs . ds of both amine and thiol groups were controlled by simply adapting the ph of reaction mixture or the amount of dtt . the results of ds determined by the ellman &# 39 ; s assay and 1 h nmr were consistent and listed in table 2 , which shows the effects of dtt concentration and ph on ds of — sh . 1 h nmr spectra ( fig9 ) showed the decrease of proton signals from the cystamines disulfide pendants . peak at d is attributed to proton signals of methylenes (— ch 2 ch 2 nh 2 ). peaks at a , b , a ′ and b ′ correspond to resonances of the two side chain methylenes (— ch 2 ch 2 sh ). by altering the ph of reaction mixture , the thiol group ds of cs — sh could be controlled from 17 . 7 % to 36 . 0 % ( table 2 ). the ph at 7 . 2 was selected to offer reactive thiolate and avoid the possible degradation of thiolated ha . by altering the amount of dtt , the thiol group ds of ha - sh with 5 . 2 % and 15 . 3 % respectively were obtained ( table 2 ). for the remaining studies , ha - sh with a thiol group ds of 5 . 3 % was employed because lower substituted ha hydrogels have been shown to display higher cellular bioactivity [ 23 ]. cs — sh with a thiol group ds of 23 . 5 % was employed . moreover , the residual — nh 2 groups allow for additional functionalization of the hydrogels if desired . crosslinking of ha - sh and cs — sh mixtures was achieved using pegda as shown in fig6 . to study the effects of chain length of cross - linker , the mw of pegda was altered to distribute either 700 da , 3400 da , or 8000 da within hydrogel while the molar ratio of thiol groups to acrylate groups was kept at 1 . 07 and all other conditions were fixed ( table 3 , which shows the composition of hcp hydrogels ). hydrogels were formed by simple mixing of ha - sh , cs — sh , and pegda in pbs at 37 ° c . specifically , 1 % ha - sh ( 199 μl ) and 5 % cs — sh ( 217 μl ) were mixed in the microcentrifuge tube . either 5 % pegda 700 ( 26 . 8 μl ), 20 % pegda 3400 ( 33 . 8 μl ), or 33 % pegda 8000 ( 46 μl ), was added to the microcentrifuge tube to create ha / cs / pegda 700 ( hcp700 ), ha / cs / pegda 3400 ( hcp3400 ), and ha / cs / pegda8000 ( hcp8000 ) respectively . hydrogel samples were imaged using an fei nova nanosem field emission scanning electron microscope ( fei company , hillsboro oreg .) using et ( everhart - thornley ) dectector or the high - resolution thorough - the lens ( tld ) detector operating at 5 kv accelerating voltage , spot 3 , ˜ 5 . 0 mm working distance and 30 mm aperture . the composite hydrogels exhibited interconnected porous structures with micron - sized pores as shown in sem micrographs ( fig1 ). generally , hcp700 hydrogels possessed larger pores than hcp3400 and hcp8000 hydrogels presumably due to lower cross - linking density of hydrogels . the time to form a gel ( denoted as gelation time ) is defined as the time when the gel , in an inverted state , shows no fluidity for 1 min [ 24 ] ( fig1 ). the experiment was performed in triplicate . the gelation times decreased with increasing molecular weight of pegda ( p & lt ; 0 . 05 , n = 3 ) ( fig1 a ). hcp700 , hcp3400 and hcp8000 hydrogels exhibited a gelation time of ˜ 30 min , ˜ 18 min , and ˜ 16 min respectively . for swelling tests , hydrogel samples (˜ 0 . 35 ml ) were prepared as described above . the hydrogels were freeze - dried and weighed ( w d ). subsequently , 1 ml of pbs was applied on top of the hydrogels and then the samples were incubated at 37 ° c . for 24 h to reach the swelling equilibrium . the excess pbs was then aspirated away and the remaining saturated hydrogels were weighed ( w s ). the experiments were performed in triplicate and the degree of swelling of the hydrogels was expressed as (( w s − w d )/ w d )× 100 %. all data are presented as mean ± standard deviation . the swelling ratio is another important parameter for hydrogels , which is associated with hydrogel mechanical properties including strength and flexibility . all the composite hydrogels were highly swollen in water resulting from the hydrophilicity of peg , ha and cs molecules , and the maintenance of cross - linked ha / cs / peg networks . as shown in fig1 b , the swelling ratio decreased significantly with the increase of mw of pegda from 700 da to 3400 da ( p & lt ; 0 . 05 , n = 3 ). although not significant , a similar trend was also found while increasing mw of pegda from 3400 da to 8000 da . tricomponent hydrogels ( 350 μl ) with different peg molecular weights ( 700 , 3400 , and 8000 ) were prepared in a syringe with the end cut off . fitc - dextran ( mw = 70k , 20 μg ) was added to each hydrogel precursor solution . the syringe was then placed in a 37 ° c . incubator . the hydrogels were equilibrated for 2 h at 37 ° c . after the two hours the hydrogel was then dispensed into cell culture inserts ( 12 mm diameter with 3 μm pore size ( corning incorporated , usa ) in a 12 well plate . the hydrogels were then submerged with pbs and the well plate was placed into a 37 ° c . water bath . at specified time intervals , 1 ml of the solution from individual wells was withdrawn and replaced with pre - heated water . the amounts of released fitc - dextran were determined by fluorescence measurements ( excitation at 485 nm , emission at 528 nm ). fig1 c shows the percent cumulative release profiles of fitc - dextran from different composite hydrogels as a function of time at 37 ° c . after 58 hours , the fitc - dextran encapsulated in hcp 700 , hcp3400 , and hcp8000 hydrogels resulted in about 84 . 3 %, 77 . 6 %, and 72 . 2 % cumulative release of total fitc - dextran , respectively . the release of fitc - dextran from hcp hydrogels was mainly controlled by the diffusion . the release rate correlated well with the hydrogel pore size as a functional of pegda molecular weight . increase of pegda chain length generates greater crosslinking density resulting in smaller pore size and slower release of fitc - dextran . this observation was consistent with our swelling ratio results . rheological experiments were carried out with a new discovery series hybrid rheometer ( dhr )- 3 ( ta ) using parallel plate ( 20 mm diameter , 0 °) in the oscillatory mode . oscillatory time , frequency , and strain sweeps were performed at 37 ° c ., and the storage ( g ′) and loss ( g ″) moduli were recorded . 450 μl of gel precursor solution was mixed by vortexing at room temperature for 15 s before loading on to the rheometer . hydrogels were cast between the lower peltier plate ( preheated at 37 ° c .) and upper parallel plate . the 20 mm parallel plate geometry was set to a gap of 1000 μm . each hydrogel sample was used for only one test . strain sweeps and frequency sweeps were performed in duplicate and the data represents the average of the two tests . 1 % strain and a frequency of 1 hz were used for the time sweeps , with the same 20 mm parallel plate for 4800 s . time sweep tests were performed in triplicate and the data represents the average of the three tests with corresponding standard deviation . the composite hydrogels showed tunable rheological and mechanical properties by varying the pegda chain length . a strain sweep from 0 . 1 % to 10 % strain was conducted at a frequency of 1 . 0 hz ( chosen arbitrarily ) on a formed gel . fig1 a showed constant storage modulus g ′ values as strain is varied up to 10 % strain , indicating that strains in the range 0 . 1 % to 10 % was in the linear - viscoelastic regime ( lve )[ 25 ]. consequently , a strain of 1 % was selected for the subsequent frequency sweep tests . at low frequencies from 0 . 1 to 10 rad / s , g ′ does not change ( fig1 b ) indicating the solid - like nature of the gel . as a result , a frequency of 1 hz was selected for future tests based on a favorable torque signal at that frequency . a time sweep was performed under the condition that the strain was small enough to be in the lve and the frequency was a value under which the instrument provides a clear and favorable torque signal . therefore , 1 % strain , 1 hz , and 37 ° c . were determined to be the appropriate conditions for the hydrogel time sweep tests . ha / cs / pegda formed a gel and reached stability in ˜ 45 min ( fig1 c ). however , the hydrogels formed rapidly and the crossover of g ′ and g ″ was not observed ( g ″ was too low to measure for the extent of the tests ). as noted in fig1 c , the gels have a solid - like viscoelastic behavior . extensive rheology testing showed that by increasing the mw of the pegda , a significant increase in the hydrogel storage modulus ( p & lt ; 0 . 05 , fig1 d ) was observed , which is in good agreement with the conclusion derived from the sem data . accordingly , hcp700 hydrogels were the weakest with a g ′ value of 410 ± 30 pa , whereas hcp8000 hydrogels were the strongest with a g ′ value of 1810 ± 106 pa . storage modulus of hcp3400 hydrogels was 1300 ± 190 pa , approximately triple that of hcp700 hydrogels . hmscs were obtained from lonza . cells were cultured in growth medium containing dmem ( life technologies , catalog # 11885084 ) supplemented with 10 % fetal bovine serum ( fbs , atlanta biologicals ), 1 % glutamine ( life technologies , catalog # 25030081 ), and 1 % penicillin / streptomycin ( life technologies , catalog # 15140122 ) at 37 ° c . with 5 % co 2 . for the cell encapsulation in the hydrogels , cell pellets were obtained by centrifugation , followed by a brief resuspension with hydrogel solution through pipetting up and down gently to ensure a homogeneous distribution . then cell suspension with the density of 20 , 000 cells / 25 μl was transferred to an inverted pre - cut 1 ml syringe and incubated at 37 ° c . for 45 min . ( fig1 ). subsequently , hydrogels were injected to 24 well tissue culture plate and incubated in growth medium . the medium was changed every other day thereafter . the viability of the cells encapsulated in hydrogels after 1 and 5 days &# 39 ; culture was investigated by the live / dead viability assay ( life technologies , catalog # l3224 ) according to the manufacturer &# 39 ; s instructions . media were removed from all the samples , washed twice with sterile pbs and stained with calcein - am and ethidium homodimer - 1 solution . samples in staining solution were incubated at room temperature for 30 min . imaging was performed with a confocal microscope ( nikon air ). mesenchymal stem cells ( mscs ) offer a promising cell source for musculoskeletal regenerative engineering due to their ease availability , high expansion capacity , and multipotency . thus , hmscs were encapsulated in the composite hydrogels and characterized for cell viability and cellular responses . confocal images using a live / dead assay demonstrated that all composite hydrogels supported progressive cellular growth with high viability (& gt ; 95 %) during cell culture ( fig1 and fig1 ). cells encapsulated within hydrogels displayed an overall spherical morphology , which is in line with previous literature reports for 3d hydrogel cell culture [ 26 ]. actin immunostaining was performed with the actin cytoskeleton and focal adhesion staining kit ( millipore ). briefly , cell / hydrogels were fixed in 4 % paraformaldehyde and blocked with 1 % bsa in pbs . then samples were stained with tritc - conjugated for phalloidin f - actin and with dapi for nuclei . imaging was performed with a confocal microscope ( nikon a1r ). interestingly , hmscs responded to differences in the mechanical properties of hydrogels as evidenced from the changes in actin cytoskeleton . in specific , hmscs encapsulated in hcp700 hydrogels showed less defined actin fibers as compared to those in hcp3400 and hcp8000 hydrogels ( fig1 ). furthermore , cortical actin protrusions into the surrounding hydrogel matrix were only observed with hmscs encapsulated in hcp3400 and hcp8000 hydrogels . hmsc cells were incubated with a cell permeable focal adhesion kinase ( fak ) phosphorylation biosensor and were washed gently with pbs ( 3 × 1 ml ). after fak biosensors were successfully delivered into hmscs , they were encapsulated in hcp hydrogels . the dynamic monitoring of focal adhesion kinase ( fak ) activity was conducted to examine cell - hydrogel interactions using fluorescence lifetime imaging microscopy ( flim )[ 27 ]. the dynamic monitoring of fak activity using flim confirmed a similar finding where stiffened hydrogels exhibited increased fak phosphorylation of hmscs ( fig1 ). it is important to note that cells in different tissues are tuned to the specific mechanical environments in which they reside [ 28 ]. the prepared hcp hydrogels were freeze - dried , sterilized for 20 min under uv light , and pre - incubated in the growth medium containing dmem ( life technologies , catalog # 11885084 ) which was supplemented with 10 % fetal bovine serum ( fbs , atlanta biologicals ), 1 % glutamine ( life technologies , catalog # 25030081 ), and 1 % penicillin / streptomycin ( life technologies , catalog # 15140122 ). hmscs were seeded on the surface of the lyophilized hydrogel scaffolds with a density of 20 , 000 cells / per scaffold and were pre - incubated at 37 ° c . with 5 % co 2 for 1 h . subsequently , the lyophilized hydrogel scaffolds seeded with hmscs were cultured in 500 μl growth medium at 37 ° c . with 5 % co 2 for 1 day . cell seeded hydrogel scaffolds were dehydrated sequentially with 50 , 70 , 80 , 90 , 95 , and 100 % ethanol for 10 minutes each and then were freezer dried . the samples were then cut to expose the cross - sectional area as well as the surface , and then sputter coated with platinum for 60 seconds . the hydrogels were examined on a scanning electron microscope ( nova nanosem ) at 3 . 0 kv . the lyophilized hcp hydrogel scaffolds were shown to have porous structures ( fig1 a , c ) and to be able to support cell growth on the surface of scaffolds ( fig1 a , b ). pore structure was roughly 40 to 50 μm in diameter . example 2 . ha / cs / poly ( ethylene glycol ) divinyl sulfone ( pegvs ) composite hydrogel as primary chondrocytes niches in all experiments , the molar ratio — sh /- ene concentration was held constant . specifically , 1 % ha - sh ( 192 μl ), 5 % cs — sh ( 199 . 2 μl ), and poly ( ethylene glycol ) divinyl sulfone ( pegvs ) 3400 ( 52 . 8 μl ) were mixed at 37 ° c . in the microcentrifuge tube to create ha / cs / pegvs 3400 ( hcpv3400 ). rheological experiments were carried out with a new discovery series hybrid rheometer ( dhr )- 3 ( ta ) using parallel plate ( 20 mm diameter , 0 °) in the oscillatory mode . oscillatory time , frequency , and strain sweeps were performed at 37 ° c ., and the storage ( g ′) and loss ( g ″) moduli were recorded . 450 μl of gel precursor solution was mixed by vortexing at room temperature for 15 s before loading on to the rheometer . hydrogels were cast between the lower peltier plate ( preheated at 37 ° c .) and upper parallel plate . the 20 mm parallel plate geometry was set to a gap of 1000 μm . each hydrogel sample was used for only one test . time sweep tests were performed under 1 % strain , 1 hz , and 37 ° c . conditions ( n = 4 ). the data represents the average of the three tests with corresponding standard deviation . due to more reactive vinyl sulfone moiety , pegvs demonstrates significantly shorter gelation time and higher storage modulus compared to pegda ( fig2 ). chondrocyte cultures were prepared from pig articular cartilage [ 29 ]. shavings of cartilage were removed from the outside of the articular cartilage , such that contamination with bone cells or other connective tissue cells could be avoided . the pig cartilage was finely chopped and the chondrocytes were released from their extracellular matrix by sequential digestion at 37 ° c . with collagenase . cells obtained from the collagenase digests were pooled and passed through a sterile 60 fan aperture nylon screen ( nitex ) to remove any undigested cartilage fragments . primary chondrocytes were cultured in growth medium containing dmem ( life technologies , catalog # 11885084 ) supplemented with 20 % fetal bovine serum ( fbs , atlanta biologicals ), and 1 % penicillin / streptomycin ( life technologies , catalog # 15140122 ) at 37 ° c . with 5 % co 2 . for the cell encapsulation in the hydrogels , cell pellets were obtained by centrifugation , followed by a brief resuspension with hydrogel solution through pipetting up and down gently to ensure a homogeneous distribution . then cell suspension with the density of 20 , 000 cells / 25 μl was transferred to an inverted pre - cut 1 ml syringe and incubated at 37 ° c . for 45 min . ( fig1 ). subsequently , hydrogels were injected to a 24 well tissue culture plate and incubated in growth medium . the medium was changed every other day thereafter . actin immunostaining was performed with the actin cytoskeleton and focal adhesion staining kit ( millipore ). briefly , cell / hydrogels were fixed in 4 % paraformaldehyde and blocked with 1 % bsa in pbs . then samples were stained with tritc - conjugated phalloidin for f - actin , with aggrecan antibody ( h - 300 ) ( santa cruz biotech ) for aggrecan , and with dapi for nuclei . imaging was performed with a confocal microscope ( nikon air ). confocal images using a live / dead assay demonstrated that all composite hydrogels supported cellular growth with high viability after a 21 - day culture ( fig2 a ). primary chondrocytes are easy to de - differentiate after passages . here we show that our hydrogel can maintain chondrocytesm morphology after 21 days indicated by the staining of aggrecan ( fig2 b ). example 3 : ha / cs / 4 - arm poly ( ethylene glycol ) divinyl sulfone ( 4pegvs ) composite hydrogel as hmsc niches in all experiments , the molar ratio — sh /- ene concentration was held constant . specifically , 1 % ha - sh ( 140 μl ), 5 % cs — sh ( 150 μl ), and 25 % 4 - arm peg ) divinyl sulfone ( 4pegvs ) 20k ( 113 μl ) were mixed in the 1 . 5 ml centrifuge tube to create ha / cs / 4pegvs 3400 ( hcpv3400 ). rheological experiments were carried out with a new discovery series hybrid rheometer ( dhr )- 3 ( ta ) using parallel plate ( 20 mm diameter , 0 °) in the oscillatory mode . oscillatory time , frequency , and strain sweeps were performed at 37 ° c ., and the storage ( g ′) and loss ( g ″) moduli were recorded . 450 μl of gel precursor solution was mixed by vortexing at room temperature for 15 s before loading on to the rheometer . hydrogels were cast between the lower peltier plate ( preheated at 37 ° c .) and upper parallel plate . the 20 mm parallel plate geometry was set to a gap of 1000 μm . each hydrogel sample was used for only one test . time sweep tests were performed under 1 % strain , 1 hz , and 37 ° c . conditions ( n = 4 ). the data represents the average of the three tests with corresponding standard deviation . compared with 2 - arm pegvs , 4 - arm pegvs demonstrates significantly shorter gelation time and higher storage modulus compared to pegda ( fig2 ). hmscs were cultured in growth medium at 37 ° c . with 5 % co 2 . for the cell encapsulation in the hydrogels , cell pellets were obtained by centrifugation , followed by a brief resuspension with hydrogel solution through pipetting up and down gently to ensure a homogeneous distribution . then the cell suspension with a density of 20 , 000 cells / 25 μl was transferred to an inverted pre - cut 1 ml syringe and incubated at 37 ° c . for 30 min . ( fig1 ). subsequently , hydrogels were injected to a 24 well tissue culture plate and incubated in growth medium . the medium was changed every other day thereafter . confocal images using a live / dead assay demonstrated that all composite hydrogels supported cellular growth with high viability (& gt ; 95 %) after 21 days ( fig2 a ). cells encapsulated within hydrogels displayed an overall spherical morphology ( fig2 b ), which is in line with previous literature reports for 3d hydrogel cell culture [ 26 ]. treatment of osteochondral defects encompassing injury or degeneration to both the articular cartilage as well as the underlying subchondral bone presents a significant medical challenge . current treatment options including autografts and allografts suffer from limited availability and risk of immunogenicity , respectively . the long term goal of this work is to develop an integrated scaffold system for treatment of osteochondral defects via in situ regeneration of bone , cartilage and the bone - cartilage interface ( fig2 ). hydrogels provide an attractive biomaterial platform for regeneration of cartilage . in the present disclosure , we have developed a novel composite hydrogel that includes thiolated ha and cs cross - linked with peg to mimic cartilage . the bone mimetic is based on plga / nano - hydroxyapatite composite scaffolds [ 30 ]. here , integration between hydrogels and plga 3d scaffolds was achieved using a novel multifunctional ha . ha was chemically functionalized with both — sh and — nh 2 groups to form two functional arms : one arm to covalently bond to a cross - linker to form hydrogels and the second arm bonding to the plga 3d scaffold surface . this multifunctional ha provides a biologically active and mechanically functional bridge with scaffolds . poly ( lactide - co - glycolide ) ( plga ) 85 : 15 was purchased from lakeshore biomaterials . plga microspheres were obtained using the emulsion - solvent evaporation method . plga 3d scaffolds were fabricated by heat sintering at an optimized condition [ 31 ]. the ha - sh , cs — sh and pegda solution ( pbs ) was placed onto plga 3d scaffold surface for 45 min at 37 ° c . plga 3d scaffold - hydrogel integration was lyophilized and then sputter coated with platinum for 60 seconds . the integration were examined on a scanning electron microscope ( nova nanosem ) at 3 . 0 kv . sem images of plga 3d scaffolds - hydrogel integration was shown in fig2 . differences among groups were assessed by one - way anova with bonferroni post hoc correction to identify statistical differences among three treatments . a p - value of 0 . 05 was set as the criteria for statistical significance . graphs are annotated where values are represented as * 0 . 05 . additional disclosure is found in appendix - a , filed herewith , entirety of which is incorporated herein by reference into the present disclosure . those skilled in the art will recognize that numerous modifications can be made to the specific implementations described above . the implementations should not be limited to the particular limitations described . other implementations may be possible . in addition , all references cited herein are indicative of the level of skill in the art and are hereby incorporated by reference in their entirety . deng m , james r , laurencin c t , kumbar s g . nanostructured polymeric scaffolds for orthopaedic regenerative engineering . nanobioscience , ieee transactions on . 2012 ; 11 : 3 - 14 . kumbar s , laurencin c , deng m . natural and synthetic biomedical polymers : newnes ; 2014 . murphy w l , mcdevitt t c , engler a j . materials as stem cell regulators . nat mater . 2014 ; 13 : 547 - 57 . varghese s , hwang n s , canver a c , theprungsirikul p , lin d w , elisseeff j . chondroitin sulfate based niches for chondrogenic differentiation of mesenchymal stem cells . matrix biology . 2008 ; 27 : 12 - 21 . julian t , yujie m , bruekers s m c , shaohua m , huck w t s . 25th anniversary article : designer hydrogels for cell cultures : a materials selection guide . advanced materials . 2014 ; 26 : 125 - 48 . lee k y , mooney d j . hydrogels for tissue engineering . chem rev . 2001 ; 101 : 1869 - 79 . kirker k r , luo y , nielson j h , shelby j , prestwich g d . glycosaminoglycan hydrogel films as bio - interactive dressings for wound healing . biomaterials . 2002 ; 23 : 3661 - 71 . hu x , li d , zhou f , gao c . biological hydrogel synthesized from hyaluronic acid , gelatin and chondroitin sulfate by click chemistry . acta biomaterialia . 2011 ; 7 : 1618 - 26 . thiele j , ma y , bruekers s m c , ma s , huck w t s . 25th anniversary article : designer hydrogels for cell cultures : a materials selection guide . advanced materials . 2014 ; 26 : 125 - 48 . necas j , bartosikova l , brauner p , kolar j . hyaluronic acid ( hyaluronan ): a review . veterinarni medicina . 2008 ; 53 : 397 - 411 . burdick j a , prestwich g d . hyaluronic acid hydrogels for biomedical applications . advanced materials . 2011 ; 23 : h41 - h56 . aravamudhan a , ramos d m , nada a a , kumbar s g . chapter 4 — natural polymers : polysaccharides and their derivatives for biomedical applications a2 — deng , sangamesh g . kumbarcato t . laurencinmeng . natural and synthetic biomedical polymers . oxford : elsevier ; 2014 . p . 67 - 89 . bhatia d , bejarano t , novo m . current interventions in the management of knee osteoarthritis . journal of pharmacy & amp ; bioallied sciences . 2013 ; 5 : 30 - 8 . lü s , li b , ni b , sun z , liu m , wang q . thermoresponsive injectable hydrogel for three - dimensional cell culture : chondroitin sulfate bioconjugated with poly ( n - isopropylacrylamide ) synthesized by raft polymerization . soft matter . 2011 ; 7 : 10763 - 72 . muzzarelli r a a , greco f , busilacchi a , sollazzo v , gigante a . chitosan , hyaluronan and chondroitin sulfate in tissue engineering for cartilage regeneration : a review . carbohydrate polymers . 2012 ; 89 : 723 - 39 . li y , rodrigues j , tomas h . injectable and biodegradable hydrogels : gelation , biodegradation and biomedical applications . chemical society reviews . 2012 ; 41 : 2193 - 221 . dong - an w , shyni v , blanka s , iossif s , sara f , justin g , et al . multifunctional chondroitin sulphate for cartilage tissue - biomaterial integration . nature material . 2007 ; 6 : 385 - 92 . zou x , foong w , cao t , bay b , ouyang h , yip g . chondroitin sulfate in palatal wound healing . journal of dental research . 2004 ; 83 : 880 - 5 . iovu m , dumais g s , p . anti - inflammatory activity of chondroitin sulfate . osteoarthritis & amp ; cartilage . 2008 ; 16 suppl 3 : s14 - s8 . luo y , kirker k r , prestwich g d . cross - linked hyaluronic acid hydrogel films : new biomaterials for drug delivery . journal of controlled release : official journal of the controlled release society . 2000 ; 69 : 169 - 84 . jeon o , song s j , lee k - j , park m h , lee s - h , hahn s k , et al . mechanical properties and degradation behaviors of hyaluronic acid hydrogels cross - linked at various cross - linking densities . carbohydrate polymers . 2007 ; 70 : 251 - 7 . mergy j , fournier a , hachet e , auzély - velty r . modification of polysaccharides via thiol - ene chemistry : a versatile route to functional biomaterials . journal of polymer science part a : polymer chemistry . 2012 ; 50 : 4019 - 28 . eng d , caplan m , preul m , panitch a . hyaluronan scaffolds : a balance between backbone functionalization and bioactivity . acta biomaterialia . 2010 ; 6 : 2407 - 14 . cal s , liu y , shu x z , prestwich g d . injectable glycosaminoglycan hydrogels for controlled release of human basic fibroblast growth factor . biomaterials . 2005 ; 26 : 6054 - 67 . zuidema j m , rivet c j , gilbert r j , morrison f a . a protocol for rheological characterization of hydrogels for tissue engineering strategies . journal of biomedical materials research part b : applied biomaterials . 2014 ; 102 : 1063 - 73 . huebsch n , arany p r , mao a s , shvartsman d , ali o a , bencherif s a , et al . harnessing traction - mediated manipulation of the cell / matrix interface to control stem - cell fate . nat mater . 2010 ; 9 : 518 - 26 . damayanti n p , parker l l , irudayaraj j m k . fluorescence lifetime imaging of biosensor peptide phosphorylation in single live cells . angewandte chemie ( international ed in english ). 2013 ; 52 : 3931 - 4 . engler a j , sen s , sweeney h l , discher d e . matrix elasticity directs stem cell lineage specification . cell . 2006 ; 126 : 677 - 89 . synthesis of cartilage matrix by mammalian chondrocytes in vitro . i . isolation , culture characteristics , and morphology . the journal of cell biology . 1982 ; 93 : 743 - 50 . lv q , deng m , ulery b d , nair l s , laurencin c t . nano - ceramic composite scaffolds for bioreactor - based bone engineering . clinical orthopaedics and related research . 2013 ; 471 : 2422 - 33 . lv q , yu x , deng m , nair l , laurencin c . evaluation of plaga / n - h a composite scaffold bioactivity in vitro . bioceram dev appl . 2014 ; 4 : 2 . | 0 |
referring to fig1 there is shown a logic diagram of the open and short circuit test apparatus of the present invention , generally referred to as 10 . the apparatus 10 includes a clock circuit 12 for generating a clock signal &# 34 ; c &# 34 ; having a frequency of 12 kilohertz . the clock circuit 12 comprises , for example , a type cd4001ae &# 34 ; cos / mos quad - two - input nor gate &# 34 ; digital integrated circuit as described in the &# 34 ; rca cos / mos integrated circuits &# 34 ; databook no . ssd - 203c . as shown in fig2 a , a first 13 and a second 15 two - input nor gates are interconnected with a first 17 and a second 19 variable resistor as well as a diode 21 , a resistor 23 and a capacitor 25 to form an astable multivibrator with duty cycle control as described in &# 34 ; ican - 6267 &# 34 ; on pages 531 - 534 of the above referenced &# 34 ; databook &# 34 ;. the output of the multivibrator is coupled to a first inverter comprising a third two - input nor gate 27 . the output of the first inverter is coupled to a second inverter comprising a fourth two - input nor gate 29 . the output of the second inverter is the clock signal &# 34 ; c &# 34 ; shown in fig2 b . the clock signal &# 34 ; c &# 34 ; is output on pin 10 of the integrated circuit and is coupled to a first divide by ten network 14 , an input of a first two - input nand gate 16 and an input of a second two - input nand gate 18 through a branching conductor 20 . the first divide by ten network 14 comprises a type cd4017ae &# 34 ; cos / mos decade counter / divider &# 34 ; as described in the previously referenced rca databook . the clock signal &# 34 ; c &# 34 ; is input on pin 14 of the integrated circuit ( see fig1 . 1 , page 94 of the referenced rca databook for the logic diagram and pin numbers ) and a carry out signal c out , which completes one cycle every 10 clock input cycles ( see fig3 ), is coupled from pin 12 of the first divide by ten network 14 to a second divide by ten network 22 through a conductor 24 . the second divide by ten network 22 also comprises a type cd4017ae decade counter / divider . the carry out signal c out is input on pin 14 and serves as a clock signal for the second divide by ten network 22 . although the second divide by 10 network 22 provides 10 decoded decimal outputs , ( see fig1 . 1 , page 94 of referenced rca databook ), only the &# 34 ; 0 &# 34 ;, &# 34 ; 1 &# 34 ;, &# 34 ; 2 &# 34 ;, &# 34 ; 4 &# 34 ;, &# 34 ; 6 &# 34 ; and &# 34 ; 8 &# 34 ; pulses ( see fig3 ) are utilized . these pulses will henceforth be referred to as gate pulses . the &# 34 ; 1 &# 34 ; gate pulse signal is coupled to the other input of the first two input nand gate 16 and an input of a three input nor gate 26 through a branching conductor 28 . the &# 34 ; 6 &# 34 ; gate pulse signal is coupled to the other input of the second two input nand gate 18 through a conductor 30 . the output , gated clock signal s 1 , of the first nand gate 16 is coupled to an input of a third two input nand gate 32 and an input of a fourth two input nand gate 34 through a branching conductor 36 . the other input of the third nand gate 32 is connected to a constant + 12 volt signal which is the equivalent of a logical &# 34 ; 1 .&# 34 ; the output , gated clock signal s 2 , of the second nand gate 18 is conneced to the other input of the fourth nand gate 34 through a conductor 38 . the first , second , third and fourth nand gates , 16 , 18 , 32 and 34 respectively , can be contained in a single integrated circuit , for example , a type cd4011ae &# 34 ; quad two input cos / mos nand gates &# 34 ; as described in the previously referenced rca databook . the output , gated clock signal s 3 , of the fourth nand gate 34 is coupled to a g1 terminal pin 40 in a mount assembly connector 42 through a conductor 44 . the gated clock signal s 1 from the third nand gate 32 is coupled to one input of a first two input and gate 46 , one input of a two input or gate 48 , one input of a first two input exclusive or gate 50 and one input of a second two input exclusive or gate 52 through a branching conductor 54 . the &# 34 ; o &# 34 ; gate pulse signal from the second divide by ten network 22 is coupled to an input of the three input nor gate 26 through a conductor 56 . the &# 34 ; 2 &# 34 ; gate pulse signal is coupled to an input of the three input nor gate 26 through a conductor 58 . the three input nor gate can be , for example , one of the gates contained in a type cd4000ae &# 34 ; cos / mos nor gate &# 34 ; digital integrated circuit as described in the previously referenced rca databook . the output , s 4 , of the three input nor gate 26 is coupled to a level changer network 60 through a conductor 62 . as shown in fig4 the level changer network comprises a first resistor 64 , one terminal of which is connected to the conductor 62 and the other terminal connected to the base of a first transistor 66 . the emitter of the first transistor 66 is connected to ground through a second resistor 68 and to the base of a second transistor 70 . the collector of the first transistor 66 is connected to the base of a third transistor 72 , through a conductor 73 . the collector of the second transistor 70 is connected to ground through a third resistor 74 and to the collector of the third transistor 72 through a branching conductor 75 . the emitter of the second transistor 70 is connected to a + 4 volt power supply ( not shown ) through a conductor 77 . the emitter of the third transistor 72 is connected to a + 12 volt power supply ( not shown ) through a conductor 79 . the first transistor 66 is , for example , a type 2n3565 . the second and third transistors 70 and 72 are each , for example , a type 2n 5193 . as shown in fig1 the output s 4 &# 39 ; of the level changer 60 is coupled to a level detector 76 through a conductor 78 . the level detector 76 comprises , for example , a type cd4050ae non - inverting &# 34 ; cos / mos hex buffer / converter &# 34 ;, as described in the rca databook as previously referenced . the output s 4 &# 39 ; of the level changer 60 functions as the supply voltage v cc for the hex buffer and is connected to pin 1 thereof ( see page 252 of the referenced rca databook for the logic diagram and pin numbers ). a k r terminal pin 80 of the mount assembly connector 42 is electrically connected to a first input s 5 ( pin 3 ) of the level detector 76 , one input of a second two input and gate 82 , and one input of a third two input and gate 84 through a branching conductor 86 . a first output s 6 ( pin 2 ) of the level detector 76 , which is related to the first input s 5 through a buffer , is coupled to the other input of the first two input and gate 46 and the other input of the two input or gate 48 through a branching conductor 88 . the output s 7 of the first and gate 46 is coupled to the other input of the first exclusive or gate 50 through a conductor 90 . the output s 8 of the first exclusive or gate 50 is coupled to the set input of a first set - reset flip - flop 92 through a conductor 94 . the first set - reset flip - flop 92 comprises , for example , a first 95 and a second 97 nor gate of the type cd4001ae &# 34 ; quad two - input nor gate &# 34 ; as described in the previously referenced rca databook . the first 95 and second 97 nor gates are interconnected as shown in fig5 with the output of the first nor gate 95 coupled to a first input of the second 97 nor gate . the output of the second 97 nor gate is coupled to a second input of the first 95 nor gate . a first input of the first 95 nor gate comprises a reset input ; a second input of the second 97 nor gate comprises the set input ; and the output of the first 95 nor gate comprises an output of this set - reset flip - flop configuration . the output s 9 of the first flip - flop 92 is coupled to a first indicator circuit 96 through a conductor 98 . the first indicator circuit 96 comprises , for example , a transistor switch which switches power to a light emitting diode . as shown in fig6 the first indicator circuit 96 comprises a first resistor 100 , one terminal of which is connected to an input terminal 102 and the other terminal connected to the base of a transistor 104 . the transistor is , for example , a type 2n 3565 . the collector of the transistor 104 is connected to a + 12 volt power supply ( not shown ) through a second resistor 106 . the emitter of the transistor 104 is connected to one terminal of a light emitting diode 108 through a third resistor 110 . the other terminal of the light emitting diode is connected to ground . the output s 10 of the or gate 48 is coupled to the other input of the second exclusive or gate 52 through a conductor 112 . the output s 11 of the second exclusive or gate 52 is coupled to the set input of a second flip - flop 114 through a conductor 116 . the second flip - flop 114 comprises the same type of components as included in the flip - flop 92 , interconnected as shown in fig5 . the output s 12 of the second flip - flop 114 is coupled to a second indicator circuit 118 through a conductor 120 . the second indicator circuit 118 is the same type as the first indicator circuit 96 ( see fig6 ). the &# 34 ; 4 &# 34 ; gate pulse signal from the second divide by ten network 22 is coupled to a k g terminal pin 122 of the mount assembly connector 42 , the other input of the second and gate 82 and one input of a fourth two input and gate 124 through a branching conductor 126 . the &# 34 ; 8 &# 34 ; gate pulse signal from the second divide by 10 network 22 is coupled to a k b terminal pin 128 of the mount assemby connector 42 , the other input of the third and gate 84 and the other input of the fourth and gate 124 through a branching conductor 130 . the output s 13 of the second and gate 82 is coupled to the set input of a third flip - flop 132 through a conductor 134 . the output s 15 of the third and gate 84 is connected to the set input of a fourth flip - flop 136 through a conductor 138 . the output s 18 of the fourth and gate 124 is connected to the set input of the fifth flip - flop 140 through a conductor 142 . the first , second , third and fourth and gates , 46 , 82 , 84 and 124 respectively , can all be contained in a single integrated circuit , for example , a type cd4081b &# 34 ; cos / mos and gates &# 34 ; as described in the rca databook previously referenced . the third , fourth and fifth flip - flops 132 , 136 and 140 each comprise the same type circuit as that described for the first flip - flop 92 ( see fig5 ). the output s 14 of the third flip - flop 132 is connected to a third indicator circuit 144 through a conductor 146 . the output s 16 of the fourth flip - flop 136 is coupled to a fourth indicator circuit 148 through a conductor 150 . the output s 19 of the fifth flip - flop 140 is coupled to a fifth indicator circuit 152 through a conductor 154 . the third , fourth and fifth indicator circuits 144 , 148 and 152 respectively , each comprise the same type of circuit as that described for the first indicator circuit 96 ( see fig6 ). the operation of the open and short circuit test apparatus 10 is as follows . it should be noted that although the following describes the use of the apparatus for testing open and short circuits in a color television tube mount assembly , before the assembly has been inserted into the tube , the apparatus may be used for testing after insertion and evacuation of the tube . it may also be used to test any vacuum tube electrode assemblies having at least two electrodes which are capacitively coupled , before or after the electrode assemblies have been sealed in a vacuum tube assembly . a color television tube mount assembly ( not shown ) including three cathodes k r , k b and k g ; a g1 grid ; and a g2 grid , is inserted into the mount assembly connector 42 . insertion causes the g1 grid to be electrically connected to the g1 terminal pin 40 , the cathodes k r , k b and k g to be electrically connected to the k r , k b and k g terminal pins , 80 , 128 and 122 respectively , and the g2 grid to be electrically connected to a g2 terminal pin 156 . the flip - flop which drive the indicator circuits are reset by momentarily depressing a reset switch 158 which causes a + 4 volt reset signal to be applied to the reset input of each flip - flop through a branching conductor 160 . application of the reset signal causes all indicators to be turned off since , as shown in fig5 a + 4 volt signal applied to the reset input r causes a logical 0 ( 0 volts ) to appear at the output terminal &# 34 ; 0 .&# 34 ; the 0 volt signal will appear at the input terminal 102 of the indicator circuit and will cause the transistor 104 to be nonconductive thereby preventing power from being applied to the light emitting diode 108 ( see fig6 ). the clock signal c shown in fig2 b and 3 is generated causing the first divide by ten network 14 to generate the carryout signal c out and the second divide by 10 network to generate the &# 34 ; 0 &# 34 ;, &# 34 ; 1 &# 34 ;, &# 34 ; 2 &# 34 ;, &# 34 ; 4 &# 34 ;, &# 34 ; 6 &# 34 ; and &# 34 ; 8 &# 34 ; gate pulse signals as shown in the timing diagram depicted in fig3 . in the embodiment described herein , g1 - k r , k b , k g and g2 open circuits are measured during the &# 34 ; 1 &# 34 ; gate pulse interval ; k g - k r short circuits during the &# 34 ; 4 &# 34 ; gate pulse interval ; g1 - k r , k b , k g and g2 short circuits during the &# 34 ; 6 &# 34 ; gate pulse interval ; and k b - k r and k g short circuits during the &# 34 ; 8 &# 34 ; gate pulse interval . the clock signal c and the &# 34 ; gate pulse are nanded by the first nand gate 16 which generates the gated clock signal s 1 as shown in the timing diagram depicted in fig7 . the clock signal c and the &# 34 ; 6 &# 34 ; gate pulse are nanded by the second nand gate 18 which generates the gated clock signal s 2 as shown in fig7 . the s 1 and s 2 signals are nanded by the fourth nand gate 34 which generates the gated clock signal s 3 . as shown in fig7 the s 3 signal comprises a sequence of 10 clock pulses occurring during each of the &# 34 ; 1 &# 34 ; and &# 34 ; 6 &# 34 ; gate pulse periods . this signal is applied to the g1 grid of the mount assembly under test through the g1 terminal pin 40 . the &# 34 ; 0 &# 34 ;, &# 34 ; 1 &# 34 ; and &# 34 ; 2 &# 34 ; gate pulse signals are applied to the three input nor gate 26 which generates the s 4 signal as shown in the timing diagram of fig8 . the s 4 signal is applied to the level changer circuit 60 . referring to fig4 when s 4 is in a 0 logical state ( 0 volt ), the first transistor 66 turns off causing the second transistor 70 to turn on which in turn causes + 4 volts to be applied to the output conductor 78 . when s 4 is in a logical &# 34 ; 1 &# 34 ; state (+ 12 volts ), the first transistor 66 turns on causing the second transistor 70 to turn off which in turn causes the third transistor 72 to turn on , applying + 12 volts to the output conductor 78 . consequently , the s 4 &# 39 ; signal , as shown in fig8 appears at the output of the level changer 60 . the s 4 &# 39 ; signal has an amplitude of + 4 volts during the &# 34 ; 0 &# 34 ;, &# 34 ; 1 &# 34 ; and &# 34 ; 2 &# 34 ; gate pulse periods and + 12 volts during the &# 34 ; 3 &# 34 ; through &# 34 ; 9 &# 34 ; gate pulse periods inclusive . the s 4 &# 39 ; signal is applied to the v cc terminal ( pin 1 ) of the cd4050ae &# 34 ; cos / mos hex buffer / converter integrated circuit &# 34 ; ( see page 252 of the previously referenced rca databook ). when the amplitude of the s 4 &# 39 ; signal is + 4 volts , the minimum input voltage v nh which will cause the output logic level to change state is + 2 . 8 volts ( 70 % of + 4 volts , see pages 253 - 254 of the referenced rca databook ). when the amplitude of the s 4 &# 39 ; signal is + 12 volts , the maximum input voltage v nl which will not cause the output logic level to change state is + 3 . 6 volts ( 30 % of + 12 volts , see pages 253 - 254 ). fig9 depicts the timing sequence for a mount assembly having no open or short circuits . due to the interelectrode capacitances present in the normal mount assembly , the s 3 signal applied to the g1 electrode will cause an output signal s 5 to appear at the g2 grid k r , k g and k b terminals . as shown in fig9 s 5 comprises ten clock pulses occurring during each of the &# 34 ; 1 &# 34 ; and &# 34 ; 6 &# 34 ; gate pulse time periods as does s 3 . however , the amplitude of the s 5 clock pulses is approximately + 3 volts . since v nh is + 2 . 8 volts during the &# 34 ; 0 &# 34 ;, &# 34 ; 1 &# 34 ; and &# 34 ; 2 &# 34 ; gate pulse periods , all of the + 3 volt clock pulses occurring during the &# 34 ; 1 &# 34 ; gate pulse time period will cause the output logic level of the cd4050ae to change state . also , v nl is + 3 . 6 volts during the &# 34 ; 3 &# 34 ; through &# 34 ; 9 &# 34 ; gate pulse periods inclusive . as a result , the + 3 volt clock pulses occurring during the &# 34 ; 6 &# 34 ; gate pulse interval will not cause the output logic of the cd4050ae to change state . consequently , the output s 6 from the level detector 76 comprises ten clock pulses occurring during the &# 34 ; 1 &# 34 ; gate pulse period only , as shown in the timing diagram of fig9 . the s 1 signal ( see fig7 ) is nanded with a &# 34 ; 1 &# 34 ; logic level (+ 12 volts ) by the third nand gate 32 . the output s 1 from the third nand gate 32 is consequently the logical inverse of the s 1 signal and comprises ten clock pulses occurring during the &# 34 ; 1 &# 34 ; gate pulse period as shown in fig9 . s 1 is anded with s 6 by the first and gate 46 . as a result , the output s 7 comprises ten clock pulses occurring during the &# 34 ; 1 &# 34 ; gate pulse period as shown in fig9 . s 7 is input to the first exclusive or circuit 50 along with s 1 . the truth table for the exclusive or gate ( see page 157 of the previously referenced rca databook ) is such that the output s 8 thereof is a logical &# 34 ; 0 &# 34 ; when the inputs are either both &# 34 ; 0 &# 39 ; s &# 34 ; or both &# 34 ; 1 &# 39 ; s &# 34 ;. consequently , for the inputs s 1 and s 7 shown in fig9 the output s 8 will be a logical &# 34 ; 0 &# 34 ; which does not cause the output s 9 of the first flip - flop 92 to change state . as a result , the logical &# 34 ; 0 &# 34 ; ( 0 volts ) appearing at the output prevents the transistor 104 in the first indicator circuit 96 from turning on and supplying power to the light emitting diode 108 ( see fig6 ). the s 1 signal is also or &# 39 ; d with the s 6 signal by the or gate 48 which results in an output signal s 10 comprising 10 clock pulses occurring the &# 34 ; 1 &# 34 ; gate pulse period as shown in fig9 . the signal s 10 is input to the second exclusive or gate 52 along with s 1 . the output s 11 from the second exclusive or gate 52 will be a logical &# 34 ; 0 &# 34 ; which , as stated previously , will not cause the associated indicator circuit 118 to activate the light emitting diode contained therein . consequently , neither the first indicator circuit 96 , which as shown in fig1 corresponds to an open circuit indicator in the g1 - k r circuit , nor the second indicator circuit 118 , which corresponds to a short circuit indicator in the g1 - k r circuit , will be activated . note that the section of the logic diagram enclosed by the dotted line 161 is repeated three additional times . these three sections were omitted from fig1 for reasons of clarity . the first additional section is connected to the k b terminal pin 128 and indicates opens in the g1 - k b circuit as well as g1 - k b shorts . the second additional section is connected to the k g terminal pin 122 and indicates opens in the g1 - k g circuit as well as g1 - k g shorts . the third additional section is connected to the g2 terminal pin 156 and indicates opens in the g1 - g2 circuit as well as g1 - g2 shorts . the operation of these three additional sections is the same as that described for the section enclosed by the dotted line 161 . fig1 depicts the timing sequence for a mount assembly having an open in the g1 - k r circuit . as usual , the s 3 signal is applied to the g1 terminal 40 . as previously stated , g1 - k r open circuit measurements take place during the &# 34 ; 1 &# 34 ; gate pulse intervals . since an open circuit exists , there will be no s 5 signal appearing at the k r terminal 80 during the &# 34 ; 1 &# 34 ; gate pulse interval . consequently , the output s 6 from the level detector 76 will be a continuous logical &# 34 ; 0 &# 34 ; during this interval and when anded with s 1 will produce an output s 7 from the first and gate 46 which also has a continuous logical &# 34 ; 0 &# 34 ; level . s 7 , being continuously &# 34 ; 0 &# 34 ;, will cause the output s 8 from the first exclusive or gate 50 to change state in consonance with the s 1 signal . the first clock pulse in the s 8 signal will cause the output s 9 of the first flip - flop 92 to change state from a logical &# 34 ; 0 &# 34 ; ( 0 volt ) to a logical &# 34 ; 1 &# 34 ; (+ 4 volt ). the + 4 volt level corresponding to a logical &# 34 ; 1 &# 34 ; is applied to the base of the transistor 104 in the first indicator circuit 96 causing power to be applied to light the light emitting diode 108 signifying to the operator that an open exists in the g1 - k r circuit . fig1 depicts the timing sequence for a mount assembly having a short in the g1 - k r circuit . the s 3 signal is applied to the g1 electrode by way of the g1 terminal pin 40 . as previously stated , g1 - k r short circuit measurements take place during the &# 34 ; 6 &# 34 ; gate pulse interval . since a short circuit exists , the s 5 signal will include clock pulses during the &# 34 ; 6 &# 34 ; gate pulse interval having an amplitude substantially equal to the amplitude of the s 3 pulses , this amplitude being + 12 volts in the preferred embodiment . as described before , the s 4 &# 39 ; signal applied to the level detector 76 changes from + 4 volts to + 12 volts following the &# 34 ; 2 &# 34 ; gate pulse interval . consequently , although v nl is + 3 . 6 volts during the &# 34 ; 6 &# 34 ; gate pulse interval , the + 12 volt pulses of the s 5 signal will cause the output logic level to change state . as a result , the output s 6 from the level detector 76 will comprise clock pulses occurring during the &# 34 ; 6 &# 34 ; gate pulse interval which , when or &# 39 ; d with the s 1 signal , will produce an output s 10 from the or gate 48 which comprises clock pulses occurring during the &# 34 ; 6 &# 34 ; gate pulse interval . since the s 1 signal is a continuous logical &# 34 ; 0 &# 34 ; during the &# 34 ; 6 &# 34 ; gate pulse interval and the s 10 signal comprises clock pulses during this interval , s 1 gated with s 10 by the second exclusive or gate 52 will produce an output signal s 11 comprising clock pulses which occur during the &# 34 ; 6 &# 34 ; gate pulse interval . the first clock pulse in the s 11 signal will cause the output s 12 of the second flip - flop 114 to change from a logical &# 34 ; 0 &# 34 ; state ( 0 volt ) to a logical &# 34 ; 1 &# 34 ; state (+ 4 volts ). the + 4 volts corresponding to a logical &# 34 ; 1 &# 34 ; is applied to the base of the transistor 104 in the second indicator circuit 118 causing the light emitting diode 108 to light thereby signifiying a short circuit exists in the g1 - k r circuit . as previously stated , the k g - k r short circuit measurement occurs during the &# 34 ; 4 &# 34 ; gate pulse interval . referring to fig1 and 13 , the &# 34 ; 4 &# 34 ; gate pulse is applied to the k g terminal 122 . the &# 34 ; 4 &# 34 ; gate pulse is also anded with the signal appearing at the k r terminal pin 80 by the second and gate 82 . in a mount having no short circuit between the red and green cathodes k r and k g ( see fig1 ), there will be no signal appearing at the k r terminal , a situation equivalent to a logical &# 34 ; 0 &# 34 ;. consequently , the output s 13 from the second and gate 82 will be a logical &# 34 ; 0 &# 34 ; ( 0 volt ) which will not cause the output s 14 of the third flip - flop 132 to change state , thereby preventing the transistor 104 in the third indicator circuit 144 from turning on and supplying power to the light emitting diode 108 as previously described . if a short circuit existed between the red and green cathodes k r and k g , the signal s 5 &# 39 ; appearing at the k r terminal would be the &# 34 ; 4 &# 34 ; gate pulse ( see fig1 ) which , when anded by the second and gate 82 , would cause the output signal s 13 to rise to a logical &# 34 ; 1 &# 34 ; (+ 12 volts ) which in turn would cause the output s 14 of the third flip - flop 132 to change state . that is , s 14 would rise to a logical &# 34 ; 1 &# 34 ; (+ 4 volts ). the + 4 volt logical &# 34 ; 1 &# 34 ; signal is applied to the base of the transistor 104 in the third indicator circuit 144 causing the transistor to turn on and power the light emitting diode signifying a k r - k g short circuit . the k b - k r and k b - k g short circuit measurements occur during the &# 34 ; 8 &# 34 ; gate pulse interval as previously stated . referring to fig1 and 13 , the &# 34 ; 8 &# 34 ; gate pulse is applied to the k b terminal pin 128 . the &# 34 ; 8 &# 34 ; gate pulse is also anded with the signals appearing at the k r and k g terminals by the third 84 and fourth 124 and gates respectively . in a mount assembly having no k b - k r or k b - k g short circuits , there will be no signal appearing at either the k r or k g terminals . consequently , the outputs s 15 and s 18 from the third and fourth and gates 84 and 124 respectively , will be logical &# 34 ; 0 &# 39 ; s &# 34 ; ( 0 volts ) which will not cause the outputs s 16 and s 19 of the fourth and fifth flip - flops 136 and 140 respectively to change state . consequently , the light emitting diodes in fourth and fifth indicator circuits 148 and 154 respectively will not light . if a short circuit existed , for example , between the blue and green cathodes k b and k g , the signal appearing at the k g terminal 122 would be the &# 34 ; 8 &# 34 ; gate pulse ( see fig1 ) which , when anded by the fourth and gate 124 , would cause the output signal s 18 to rise to a logical &# 34 ; 1 &# 34 ; (+ 4 volts ) which in turn would cause the output s 19 of the fifth flip - flop 152 to change state , i . e ., s 19 would rise to a logical &# 34 ; 1 &# 34 ; (+ 4 volts ). the + 4 volt logical &# 34 ; 1 &# 34 ; signal is applied to the base of the transistor 104 in the fifth indicator circuit 152 causing the light emitting diode to light which signifies a k b - k g short circuit . thus it can be seen that the apparatus of the present invention applies , during an open circuit test interval defined by the &# 34 ; 1 &# 34 ; gate pulse interval , a sequence of ten input pulses of the terminal of the g1 electrode of the color television tube mount assembly . each input pulse has an amplitude of approximately + 12 volts and a duration of approximately 15 microseconds ( see fig2 b ). also during the open circuit test interval , the apparatus detects the amplitude of the pulses appearing at the terminals of the k r , k b , k g and g2 electrodes . any pulse having an amplitude of less than approximately + 2 . 8 volts will cause the appropriate level detector to send a signal to the corresponding open circuit indicator . it should be noted that a missing pulse is construed as a pulse having an amplitude of 0 volts which would cause the appropriate open circuit indicator to turn on . in addition , the apparatus of the present invention applies pulses to and detects responses at the electrodes during short circuit test intervals as follows . a single pulse , having an amplitude of approximately + 12 volts , is applied to the terminal of the k g electrode during a first short circuit test interval defined by the &# 34 ; 4 &# 34 ; gate pulse interval . during the &# 34 ; 4 &# 34 ; gate pulse interval , the appropriate level detector detects the amplitude , if any , of the pulse appearing at the terminal of the k r electrode . if this pulse has an amplitude which exceeds approximately + 3 . 6 volts , the level detector will send a signal causing the appropriate short circuit indicator to turn on . next , a sequence of ten pulses , each having an amplitude of approximately 12 volts , is applied to the terminal of the g1 electrode during a second short circuit interval defined by the &# 34 ; 6 &# 34 ; gate pulse interval . during this second short circuit test interval , the apparatus detects the amplitudes , if any , of the pulses appearing at the terminals of the k r , k b , k g and g2 electrodes . any pulse having an amplitude which exceeds approximately + 3 . 6 volts will cause the appropriate level detector to send a signal to the corresponding short circuit indicator . finally , a single pulse , having an amplitude of approximatey + 12 volts , is applied to the terminal of the k b electrode during a third short circuit test interval defined by the &# 34 ; 8 &# 34 ; gate pulse interval . during this interval , the appropriate level detectors detect the amplitudes , if any , of the pulses appearing at the terminals of the k r and k g electrodes and a signal is sent to the corresponding circuit indicator if an amplitude exceeding approximately + 3 . 6 volts is detected . using the apparatus and method of the present invention , it is possible to test for interelectrode short and open circuits without actually contacting the electrodes themselves . this is particularly advantageous where the electrodes themselves are sealed within an evacuated glass envelope thereby negating any possibility of direct electrical contact . | 6 |
the invention therefore relates to a civil engineering machine of the “ loader ” type . such a machine comprises a chassis and working equipment . the working equipment comprises : at least one arm that can move relative to the chassis , an arm cylinder , of which one end is connected to the arm and the other to the chassis , and capable of rotating the arm relative to the chassis , a working implement articulated relative to the arm , a main kinematic linkage forming , with a portion of the working implement and a portion of the arm , a main deformable mechanism , an implement cylinder capable of being controlled to cause the deformation of the main deformable mechanism in order to ensure the inclination of the working implement relative to the arm , a hydraulic control circuit allowing the implement cylinder to be supplied by means of a directional flow valve . a secondary kinematic linkage forming , with a portion of the arm situated in the zone of articulation of the arm on the chassis , a deformable telltale mechanism whose deformation is a direct function of the inclination of the working implement relative to the chassis , an angular sensor capable of measuring an angle representative of the deformation of the telltale mechanism , a command and control device connected to said angular sensor and capable of controlling the supply of the implement cylinder and / or of the arm cylinder . in other words , the machine that is the subject of the invention comprises a telltale mechanism that corresponds to a “ copy ” of the main working mechanism and which faithfully and mechanically imitates the movements of it , so that an angular sensor measures an inclination - image . this inclination - image is representative of the inclination of the working implement . since the telltale mechanism is shifted closer to the chassis , it is less exposed to the elements causing deterioration or disruption of the inclination measurement . the inclination of the bucket is therefore controlled in a closed loop which provides advantages in terms of precision . according to an advantageous embodiment of the invention , the main kinematic linkage ( 20 , 21 ) is formed by an assembly of link rods defining a main deformable quadrilateral , and the secondary kinematic linkage is formed by an assembly of small link rods ( 40 , 41 , 42 , 43 ) defining a deformable telltale quadrilateral ( 35 ), whose deformation is a direct function of the inclination ( 100 ) of the working implement ( 15 ) relative to the chassis ( 5 ). advantageously , the dimensions of the telltale mechanism may correspond to a homothetic reduction of the dimensions of the main deformable mechanism . therefore , the telltale mechanism produces a faithful image of the main deformable mechanism . advantageously , the telltale mechanism may be deformable under the mechanical action of a movement transmission member . in other words , this member mechanically sends information of the angle of inclination of the working implement relative to the chassis . this connecting bar causes the telltale mechanism to rotate . such a member therefore makes it possible to faithfully transmit the movement of the deformable quadrilateral to the telltale mechanism and , consequently , to transmit the angle of inclination to be measured . according to a practical embodiment of the invention , the movement transmission member may comprise a rigid bar articulated at one end on one of the link rods forming the main mechanism and at the other end in the zone of attachment of the arm to the chassis . a hydraulic compensation device making it possible to generate an additional control pressure in order to move the implement cylinder according to the signal transmitted by the angular sensor , a circuit selector capable of transmitting to the directional flow valve the higher of the control pressure delivered by the manipulator and the additional control pressure , so that the inclination of the working implement is kept generally constant irrespective of the controls applied by the driver on the manipulator . therefore , the unexpected dumping of the goods is prevented , whether it is on the cabin side for materials contained a in a bucket or on the side external to the machine for goods installed on a pallet , which is likely to slip forward along forks that are overinclined . the hydraulic device is therefore capable of automatically keeping the working implement in a substantially horizontal inclination , so as to keep the goods in the working implement . the manner of embodying the invention and the advantages that result therefrom will clearly emerge from the description of the embodiment that follows supported by the appended figures in which : fig1 is a general side view of a machine of the loader / backhoe type , fig2 is a side view of the working equipment of the loader of fig1 shown in two different positions of the arm , fig3 is a kinematic diagram of the working equipment of a machine according to the invention , fig4 represents a diagram similar to that of fig3 , to which is added the hydraulic circuit of a machine according to the invention . as already explained , the invention relates to a civil engineering machine having a “ loader ” function , and for example a “ backhoe - loader ” as illustrated in fig1 . in its front portion , this machine 1 comprises working equipment 2 allowing it to perform the function of a loader . this working equipment 2 consists mainly of two arms 3 situated on either side of the machine . at its rear end 4 , these arms 3 are articulated on the chassis 5 . these arms 3 have a slightly curved shape so that their front ends 6 are substantially level with the ground in the lowest position of the arms 3 . these arms 3 may be moved under the action of arm cylinders 7 also situated on either side of the chassis 5 . these cylinders 7 are articulated at one end 8 on the chassis , and at their opposite ends 9 on the main arms 3 , substantially at the mid - level 10 of the latter . the actuators for moving the movable members are in this instance linear hydraulic cylinders , but they could equally be rotary , pneumatic cylinders or else electric motors , all equally capable of rotating the arms of the machine . in addition , the linear cylinders employed may be connected to the parts to be moved at their ends , or at any point of their structure . similarly , nevertheless without departing from the context of the invention , the machine may also comprise only one arm instead of two . at their front ends 6 , the main arms 3 receive a working implement that is advantageously interchangeable if it is mounted on an implement - carrier . in this instance , the working implement represented in the figures is a bucket 15 . nevertheless , it could be another working implement , such as a fork for transporting pallets . in the rest of the description , the working implement 15 and its carrier will be assimilated because the interchangeability of the implement does not form a determinate feature of the present invention . this bucket 15 is articulated relative to the arms 3 , so that it can be inclined at different angles . in this manner , the opening 16 of the bucket may be inclined either toward the front when materials 17 are to be loaded into it , or toward the rear when the bucket 15 is full and it is moved . in the embodiment illustrated corresponding therefore to one side of the working equipment 2 , two link rods 20 , 21 form , with the terminal portion ( on the working implement side ) of one or the other arm 3 and a portion of the bucket 15 , a main deformable quadrilateral which defines four apexes 60 , 61 , 62 , 63 . more precisely , the working equipment 2 comprises a first rear link rod 20 which is articulated on the arm 3 at the apex 64 of the quadrilateral situated at one end of the link rod 20 . the equipment also comprises a front link rod 21 which is articulated at each end on the one hand on the bucket 15 , and on the other hand on the implement cylinder 27 and the link rod 20 , at the apex 60 and the apex 61 of the deformable working quadrilateral . the two link rods , front 21 and rear 20 , are therefore articulated with one another at their top ends 25 . the articulations are in this instance achieved by means of pivot links known to those skilled in the art . therefore , when the inclination of the bucket 15 varies relative to the arm 3 , the deformable quadrilateral including the link rods 20 , 21 deforms . this deformation of the deformable quadrilateral is caused by the action of an implement cylinder 27 . this implement cylinder 27 has a rod 28 that is articulated on the bucket 15 , substantially between the articulation point situated at the apex 62 of the front link rod 21 and the articulation point 13 of the bucket relative to the arm 3 . the end situated on the side of the chamber 29 of the implement cylinder 27 is , for its part , connected to the common articulation point 25 of the two link rods , front 21 and rear 20 . therefore , when a force is applied by the implement cylinder 27 , the latter causes the common articulation point 25 of the link rods to move closer to or further from the bucket 15 , and therefore deforms the deformable quadrilateral and consequently , varies the inclination of the bucket 15 relative to the arm 3 . the main mechanism is therefore in this instance a main deformable quadrilateral , just as the telltale mechanism 35 is a telltale quadrilateral . similarly , the main kinematic linkage consists of an assembly of link rods , just like the secondary kinematic linkage . in addition , to allow a measurement of the inclination 100 of the working implement , the machine 1 comprises a connecting bar 30 that extends essentially along the arm 3 and parallel to it , substantially from the zone where the rear link rod 20 is articulated to the articulation point 4 of said arm 3 relative to the chassis 5 . the front end 31 of this connecting bar 30 is articulated on the rear connecting rod 20 , at an articulation point 32 . the other end 33 of the connecting bar 30 is itself articulated substantially at the articulation point 4 of the arm 3 relative to the chassis 5 . more precisely , this end 33 of the connecting bar is articulated jointly with a telltale quadrilateral 35 as schematically illustrated in fig3 . the connecting bar 30 therefore defines a closed contour articulated at four points by means of pivot links whose axes are perpendicular to the plane containing the arm 3 and the connecting bar 30 . since the arm may be curved ( fig1 and 2 ), this contour is not necessarily a quadrilateral like those appearing in fig3 and 4 . this telltale quadrilateral 35 is formed by an assembly of small link rods 40 , 41 , 42 , 43 , a portion of the working implement 15 and a portion of the arm 3 situated in the zone of articulation of the arm 4 on the chassis 5 . like the working quadrilateral , pivot links articulate these small link rods with one another so as to render the telltale quadrilateral 35 deformable . the articulations are in this instance also made by means of pivot links known to those skilled in the art . like the working quadrilateral , the telltale quadrilateral 35 may comprise one or more curved small link rods 40 , 41 , 42 , 43 , as appears in fig4 and 5 . in addition , the dimensions of the small link rods 40 , 41 , 42 , 43 are chosen so that the telltale quadrilateral 35 forms a homothetic reduction , hence a faithful image , of the working quadrilateral . the apexes of origin of the deformable working quadrilateral each have an apex - image in the telltale quadrilateral 35 . in addition , because of the homothetic construction , the lengths of the small link rods 40 and 41 correspond respectively to the lengths of the link rods 20 and 21 , each multiplied by a reduction factor k , that is to say lying between 0 and 1 . the lengths of the small link rods 42 and 43 correspond respectively to the multiples , by this same factor k , of the lengths 22 and 23 of the portions separating respectively the apexes 61 and 62 on the one hand , and 62 and 63 on the other hand . for convenience of representation , the figures are not to scale . therefore , the telltale quadrilateral 35 is represented respectively bigger than in the majority of real cases . on the other hand , a homothetic transformation retains the angles . therefore , the angles at the apex - images of the telltale quadrilateral 35 are equal to the angles at the apexes of origin of the deformable working quadrilateral . in practice , this is true if the functional clearances necessary to the mobility of the parts forming the machine are excluded . furthermore , the telltale quadrilateral 35 is capable of deforming under the mechanical action of a movement transmission member . this member consists of a rigid bar 30 articulated at one end on one of the link rods 20 forming the working quadrilateral and at the other end in the zone 4 of attachment of the arm 3 to the chassis 5 . therefore , when the quadrilateral deforms , this bar 30 may mechanically transmit the information of the angle of inclination 100 of the working implement relative to the chassis 5 . this bar 30 causes the deformation of the telltale quadrilateral 35 by means of a small link rod 40 of the telltale quadrilateral that is articulated on the connection 401 . the bar 30 therefore makes it possible to reliably transmit the movement of the working quadrilateral to the telltale quadrilateral 35 . since the dimensions of the telltale quadrilateral 35 are chosen so as to correspond to a homothetic reduction of the dimensions of the deformable working quadrilateral , the deformation of the telltale quadrilateral 35 and , consequently , the angle of inclination 101 to be measured between one of the small link rods , for example the link rod 42 , and the chassis 5 are therefore a direct function of the inclination 100 of the working implement 15 relative to the chassis 5 . clearly , the rigid bar 30 playing the role of a movement transmission member may be replaced by any other equivalent system , such as for example by one or more flexible and inextensible cables suitably disposed , nevertheless without departing from the subject of the invention . under the action of the rigid bar 30 , the telltale quadrilateral 35 is therefore capable of deforming when the working quadrilateral deforms . that is why this second quadrilateral 35 is called the “ telltale ” quadrilateral . in addition , an angular sensor 44 is installed on the telltale quadrilateral 35 in order to measure the inclination 101 of the small link rod 42 , when the latter moves , jointly with the deformable working quadrilateral , under the action of the rigid bar 30 . in practice , the angular sensor 44 may be a goniometer or any other measurement instrument making it possible to determine , directly or indirectly , the angle of inclination 101 of one of the small link rods 40 , 41 , 42 , 43 of the telltale quadrilateral 35 . because of the construction explained above , the angular sensor 44 therefore makes it possible to determine the inclination 100 of the working implement relative to the chassis 5 . it is understood that such a device has the advantage of being adaptable to various working implements 15 likely to be mounted on the arm 3 , whether it be a bucket of different geometry or a fork or any other implement . in addition , such a device can operate in a reliable and durable manner because the angular sensor 44 is not situated at a distance from the chassis , but , on the contrary , is close to the latter . it is therefore little exposed to elements causing deterioration or disruptions of measurement such as vibrations , impacts , rain , dust or mud ; just like any electric wires for transmitting the measurements that it makes . this device therefore provides a reliable and easily exploitable measurement of the inclination of the bucket 15 relative to the chassis . in addition , through its construction and arrangement , the device is robust and may therefore provide measurements in a reliable manner without risk of failure . furthermore , the changing of the working implement poses no problem of adaptation to various working implements because the telltale quadrilateral will always sustain a deformation that is directly representative of the inclination of the working implement . the angular sensor 44 is incorporated into the hydraulic control circuit of the cylinders 7 , 27 so as to form a closed loop with the actuators that the cylinders 7 , 27 form . therefore , the machine 1 also comprises a hydraulic manipulator 58 which the driver of the machine 1 operates . the hydraulic manipulator 58 delivers a control pressure to a hydraulic directional flow valve 46 connected to each of the chambers 29 , 281 of the implement cylinder 27 so as to control the arm cylinder 7 and / or the implement cylinder 27 and , consequently , to modify the respective inclinations of the arms 3 and / or the implement 15 to complete the work to be done . according to a practical embodiment of the invention , as illustrated in fig4 , the machine 1 also comprises an electrohydraulic compensation device 45 making it possible to generate an additional control pressure capable of moving the implement cylinder 27 . this electrohydraulic compensation device 45 in this instance comprises two solenoid valves 452 , connected upstream to the main source of pressure that is the pump 53 and an electronic computer 451 . each solenoid valve 452 controls one of the two circuits for supplying the chambers 29 , 281 of the implement cylinder 27 , that is to say the dumping circuit or crowding circuit to incline the bucket 15 respectively toward the front or toward the rear . the electronic computer 451 drives these two solenoid valves 452 through electric signals that are a function of the signals sent by the angular sensor 44 to the electronic computer 451 , signals that are representative of the inclination 101 of a small link rod 40 , 41 , 42 or 43 of the telltale quadrilateral , as explained above . therefore , when the arms 3 incline under the action of their cylinders 7 , the telltale quadrilateral 35 deforms causing a change in the measurement of the angle of inclination 101 of the bucket 15 , hence a change of instruction at the solenoid valves 452 , then a change of supply of the hydraulic directional flow valve 46 and finally of the implement cylinder 27 . consequently , the implement cylinder 27 is inclined so as to compensate for the inclination of the arms 3 thereby keeping the inclination 100 of the bucket 15 constant . to manage the conflict of priorities arising from the juxtaposition of a manual control and an automatic compensation control , pressure sensors 601 , 571 are installed on the dump and lift ducts in order to measure the pressures thereof originating from the manual controls . as a function of these measurements , the electronic system disables the automatic correction function , in order to give priority to the user , who may therefore modify the position of the bucket 15 as he wishes . when the user does not act on the manipulator 58 , the control pressures fall below a threshold , so that the pressure sensors 601 , 571 deliver a null signal . at this precise moment , an angle position instruction is stored in an electronic memory , if necessary incorporated into the electronic computer 451 so as to preserve the inclination of the bucket 15 during subsequent raising and lowering movements of the arm 3 . the correction is made only during the raising or lowering of the arms 3 . in addition , the control members of the dump and lift circuits , namely the manipulator 58 and the solenoid valves 452 , are connected to a circuit selector 54 whose downstream output is connected to the power directional flow valve 46 in order to transmit to it the higher of the control pressure delivered by the manipulator 58 and the additional control pressure delivered by one of the solenoid valves 452 . therefore , priority is given to the most “ important ” instruction , so that the user is capable of controlling the bucket 15 while being sure of obtaining compensation in the case of excessive inclination 100 . consequently , the inclination 100 of the bucket 15 is kept generally constant when no control is applied by the driver to the manipulator 58 , while the inclination of the arm 3 varies . more precisely , the control manipulator 58 has a pressure supply 59 from the main pump 53 , and two outlet channels 57 , 60 each corresponding to a direction of inclination of the working implement , in this instance of the bucket 15 . the first outlet 60 corresponds to the command to raise the bucket 15 , while the second outlet 57 corresponds to the command to dump the bucket 15 . therefore , the circuit selector 54 transmits to the directional flow valve 46 the pressure that is the greatest between the pressure for controlling the manipulator 58 and the pressure delivered by the electrohydraulic device 45 . it is this pressure that then acts on the directional flow valve 46 that causes the movement of the implement cylinder 27 . in practice , when the pressure delivered by the manipulator 58 is greater than that originating from the electrohydraulic device 45 , it is the pressure value originating from the manipulator 58 that acts on the directional flow valve 46 . conversely , when the inclination 100 of the working implement induces a movement of the rigid bar 35 such that the pressure delivered by the electrohydraulic device 45 is greater than that originating from the manipulator 58 , this correction pressure originating from the electrohydraulic device 45 acts on the directional flow valve 46 . in other words , and according to a variant of the invention , the system automatically compensates for the inclination 100 of the bucket 15 in order to prevent the latter from dumping rearward , if it remains in the initial inclination , corresponding to that of the bottom portion , that is to say close to the ground . as a variant , the dimensions of the small link rods of the telltale quadrilateral may not produce a homothetic reduction of the working quadrilateral . in this case , a correction by the computer may be envisaged if the curve of variation of the angle of the small link rod as a function of the inclination of the working implement is known . the result of the foregoing is that the machine according to the invention has the essential advantage of allowing a reliable measurement of the inclination of the working implement . this measurement allows this inclination to be controlled in a closed loop . this control may take place automatically to allow an automatic correction of the inclination of the working implement when it is raised . consequently , the present invention makes it possible to increase the safety of the driver , because the risk of materials falling toward the rear is eliminated . | 4 |
by using mouse genomic dna ( 1 μg ) as template , p1 + p2 as primers ( 100 ng each ), pfu high fidelity polymerase ( 2 . 5 u ), 250 μmol / l dntps , 2 . 5 mmol / l mgcl2 and 25 mmol / l tris hcl ( ph8 . 3 ), a pcr reaction ( 94 ° c . 30 s , 55 ° c . 30 s , 72 ° c . 4 min , 30 cycles , perkin elmer 9700 pcr amplifier ) was performed . a qiagen gel extraction kit ( from qiagen ) and electrophoresis in 1 % agarose was used . the pcr product was purified , and then obtained dna fragments of about 4 . 4 kb . the pcr amplification reaction ( under the same conditions as the above , except the extension time at 72 ° c . was 45 s ) was performed by using human genomic dna ( 1 μg ) as template and p3 + p4 as primers ( 100 ng each ) to obtain the amplified dna fragments of 0 . 37 kb . then the isolation and purification were performed by using the same electrophoresis as above . the pcr amplification ( under the same condition as above ) is performed by using mouse genomic dna as template and p5 + p6 as primers ( 100 ng each ). then dna fragments of 0 . 65 kb were purified and obtained , and then the isolation and purification were performed by using the same electrophoresis as above . the above three kinds of dna product fragments ( 100 ng each ) were mixed as pcr template , the pcr amplification reaction was performed ( under the same condition as above , excepting the extension time at 72 ° c . was 5 minutes ) by using p1 + p6 as primers ( 100 ng each ) obtaining dna fragments of 5 . 4 kb , and then the isolation and purification were performed by using the same electrophoresis as above . pcr amplification reaction ( under the same condition as above , except the extension time at 72 ° c . is 2 min ) was performed with mouse genomic dna ( 1 μg ) as template and p7 + p8 ( 100 ng each ) as primers obtaining dna fragments of 2 kb , and then the isolation and purification were performed by using the same agarose electrophoresis as above . the ploxpneo vector ( fig1 a ) with eco ri + kpn i ( biolabs , hereinafter using the same ) was digested and purified with a qiagen gel extraction kit after the electrophoresis in 1 % agarose . the upstream long arm dna fragment with eco ri + kpn i was digested and purified the 2 . 06 kb dna fragment after the same electrophoresis as above ( middle fragment ). the fragment was ligated with the vector , and the ligation product was transformed into dh5α e . coli , and a positive clone was picked out . after sequencing analysis , the positive plasmid with kpn i + bam hi was digested and purified as cloning vector . the upstream long arm dna fragment with kpn i + bgl ii was digested , the 3 . 4 kb dna fragment was purified and inserted to the above vector , then was transformed into dh5α e . coli ; and a positive clone was picked out . the positive plasmid with xho i + not i was digested and purified after electrophoresis as cloning vector . the downstream short arm dna fragment with sal i + not i was digested , ligated the fragment with the vector after purification using electrophoresis , and obtained the targeting vector pm - hngf ( fig1 b ). fig1 c shows the process of construction . after confirmation by sequencing , the constructed vector will be used in gene targeting . this example changed three amino acids of mouse ngf - β mature peptide . by using mouse genomic dna ( 1 μg ) as template , p3 ′+ p4 ′ as primers ( 100 ng each ), pfu high fidelity polymerase ( 2 . 5 u ), 250 μmol / l dntps , 2 . 5 mmol / l mgcl2 and 25 mmol / l tris hcl ( ph8 . 3 ), the pcr reaction ( 94 ° c . 30 s , 55 ° c . 30 s , 72 ° c . 45 s , 30 cycles , perkin elmer 9700 pcr amplifier ) was performed . the pcr product was purified by using a qiagen gel extraction kit ( from qiagen ) after electrophoresis in 1 % agarose and dna fragment of about 0 . 37 kb was obtained . by using this dna fragment as template , lys32 , lys34 and glu35 in ngf mature peptide were changed to ala by using stratagen point mutation kit ( for details , see the instruction of stratagen point mutation kit ). by using mouse genomic dna ( 1 μg ) as template , p1 + p2 ′ as primers ( 100 ng each ), pfu high fidelity polymerase ( 2 . 5 u ), 250 μmol / l dntps , 2 . 5 mmol / l mgcl2 and 25 mmol / l tris - hcl ( ph8 . 3 ), a pcr reaction ( 94 ° c . 30 s , 55 ° c . 30 s , 72 ° c . 4 min , 30 cycles , perkin elmer 9700 pcr amplifier ) was performed . the pcr product was purified by using a qiagen gel extraction kit ( from qiagen ) after electrophoresis in 1 % agarose , and then dna fragments of 4 . 4 kb was obtained . under the same conditions as above , a pcr reaction was performed by using mouse genomic dna ( 1 μg ) as template and p5 ′+ p6 as primers ( 100 ng each ) as primers , 0 . 65 kb dna fragments were obtained , and the isolation and purification were performed by using the same agarose electrophoresis as above . the two above - mentioned dna fragments and the mutant ngf fragment ( 100 ng each pcr product ) were mixed as pcr template and a pcr reaction ( under the same condition as above except the extension time at 72 ° c . is 5 minutes ) was performed by using p1 + p6 as primers ( 100 ng each ), 5 . 4 kb dna fragments were obtained , and the isolation and purification were performed by using the same agarose electrophoresis as above . 4 ) construction of a downstream short arm : same as example 1 . the ploxpneo vector with eco ri + kpn i ( biolabs , hereinafter using the same ) was digested and then purified . the upstream long arm dna fragment with ecor i + kpn i was digested and the 2 . 06 kb dna fragment was purified . the fragment with the vector were ligated , the ligation product was transformed into dh5 α e . coli , and a positive clone was picked out . after sequencing , the positive plasmid with kpn i + bam hi was digested and purified as a cloning vector . the upstream long arm dna fragment with kpn i + bam hi was digested ; the 3 . 4 kb dna fragment was purified and inserted to the above vector , and then was transformed into dh5 α e . coli , and a positive clone was picked out . after sequencing , he positive plasmid with xho i + not i was digested and purified as a cloning vector using electrophoresis . the downstream short arm dna fragment with sal i + not i was digested , inserted into the vector after purification and a targeting vector pm - mngf was obtained ( fig2 a ). ( fig2 b shows the process of the construction .) after sequencing confirmation , the constructed vector will be used in the gene targeting . the mouse embryonic stem cells knock - in human ngf mature peptide gene was obtained mouse primary fibroblasts were thawed into two 100 mm dishes , trophoblast medium ( dmem , 15 % fbs , 0 . 1 mm β - mercaptoethanol , 0 . 1 mmol / l ampicillin - streptomycin , 0 . 1 mmol / l l - glutamine , 0 . 1 mm non - essential amino acids ) was added and the cells were incubated at 37 ° c . in a co 2 incubator containing co 2 of 0 . 05 %. after three days , these cells were digested with trypsin and transferred to six 150 mm tissue culture dishes . three days later , these cells were transferred to forty 150 mm tissue culture dishes and continued being cultured for 3 to 4 days until the bottom of the dishes were covered with cells . the fibroblasts was treated with mitomycin c ( final concentration : 10 μg / ml ) and the cells were incubated at 37 ° c . for 2 to 3 h . the fibroblasts treated with mitomycin c were frozen and losing mitotic activity , and then were formulated into the trophoblast . after forming the trophoblast , 129 / ter mouse embryonic stem cells on trophoblast were inoculated and the cells were cultured with trophoblast medium with the presence of 1000 u / ml lif . the cells were treated with 1 ml 0 . 25 % trypsin , then washed with 3 . 5 ml es cell culture medium and suspended in pbs . 50 μg not i linearized pm - hngf plasmid was mixed with 1 ml above - mentioned es cell mixture . the cells were transfected by using gene pulser system ( biorad ) 600v , 25 μf . one minute later at room temperature , 7 ml es cell culture medium were added and the cells were transferred to four dishes covered with trophoblast . after letting the cells grow for 24 hours , 280 μg / ml g418 and 2 μmol / l gancyclovir were added and continued being cultured for seven days ( change the medium everyday ). then the clones were picked out . 3 ) characterization of the embryonic stem cells knock - in human ngf mature peptide mouse as shown in fig3 a , the genomic dna of es cells and g418 / fiau double resistant clone were extracted , and digested with ecor i ; and then southern blotting was performed by using the probe a of 5 ′ end targeting vector . there was only one band about 10 kb in wild - type cells compared with the recombinant es cells which show another band about 5 kb ( see fig3 b ) because of the ecor i site in human ngf mature peptide gene . as shown in fig4 a , primer 1 ( 5 ′ gctcatcctcccatcccatcttccaca 3 ′ ( seq id no . 13 )) locates at the 5 ′ end of the mature peptide , and primer 2 ( 5 ′ gaacgagatcagcagcctctgttc ca 3 ′ ( seq id no . 14 )) locates at neo gene . when using primer 1 and primer 2 to amplify the genome , there is not any band in wild - type es cells . but in recombinant es cells , there is a band about 1200 bp amplified ( fig4 ). the pcr product was verified by ecor i digestion and dna sequencing , and confirmed that the ngf mature peptide gene in mouse genome has already been replaced with that of human genome . 1 ) the method to construct mutant ngf knock - in mouse embryonic stem cells is the same as example 3 . 2 ) the characterization of mouse embryonic stem cells knock - in mutant ngf : as shown in fig5 a , the genomic dna of es cells and g418 / fiau double resistant clone were extracted , and the genomic dna was digested with bamhi . and then southern blotting was performed by using probe b of the 5 ′ end downstream of the homology arm . there was only one band about 800 bp in wild - type cells when compared with the recombinant es cells , which showed a band about 2 . 7 kb ( fig5 b ). this is due to the insertion of the neo gene between the two bamh i site . primer 1 ( 5 ′ gctcatccacccacccagtcttcca ca 3 ′ ( seq id no . 15 )) which locates in the 5 ′ end of the ngf mature peptide and primer 2 ( 5 ′ gaacgagatcagcagcctctgttcca 3 ′ ( seq id no . 16 )) which locates in the neo gene was designed . when using primer 1 and primer 2 to amplify the genome , there is not any band in wild - type es cells . but in recombinant es cells , there is a band about 1200 bp amplified . the pcr product was verified by dna sequencing , and was confirmed that the ngf mature peptide gene in mouse genome has already been replaced with the mutant gene . 4 - to 6 - week - old c57bl / 6j anestrous female mice were selected , intraperitoneally injected 5 units of pregnant mare serum gonadotropin ; and after 48 hours intraperitoneally injected 5 units of human chorionic gonadotropin and then were transferred to cages of adult male mice for mating . the mice after 48 hours were checked , and set up a new cage for those having vaginal plugs . on the 4th day after mating , the donor female mice were sacrificed by cervical dislocation ; the uterus was exposed , and the two uteri at the connective area between the fallopian tubes with uterine horns were cut out by using a pair of scissors , and then the linked section of uterus were carefully cut off , and placed on a sterile 60 mm petri dish . and the fallopian tubes and uterine horns respectively at uterine head side and end side were clipped off by using a pair of scissors , which made two separate uteri unimpeded . by using a disposable syringe full of brinster &# 39 ; s bmoc - 3 ( gibco brl ) medium with 5 # needle , and , while viewing under stereo microscope , the syringe was insert into the uterine cavity , pushing the syringe plug to flush out the uterine cavity , and mouse embryos were settled quickly to the bottom of petri dish . a 35 mm dish was gotten , some culture medium was dropped , and the surface was covered with mineral oil . the embryos were collected by flushing under a stereo microscope , and transferred to medium drop , then incubated in at 37 ° c ., 5 % in a co 2 incubator for 2 hours . es cells for injection were thawed several days before use , changed for fresh es cell culture medium on the morning of injection , trypsinized after 1 to 2 hours , then kept in brinster &# 39 ; s bmoc - 3 medium as single - cell suspension . from a 35 mm petri dish , about 10 blastocysts exhibiting full form , a clear border and a visible blastocoel cavity were select , and then transferred to an injection groove which has been installed with an ovum - holding tube and injection needle . 10 to 15 small , round es cells were loaded into injection needle under a 10 × lens , and then were aspirated one side of the blastocyst by holding pipette under 40 × lens , adjusting the injection needle to a position targeting to the center of blastocyst and in a same horizontal . the injection needle &# 39 ; s joystick was rotated , by using the needle &# 39 ; s tip to quickly puncture the wall of the blastocyst and enter the blastocoel , the injection pump was pushed to expel es cells into the blastocoel in sequence , and then the needle was carefully withdrawn . according to the condition of the mouse blastocysts and the number of recipient mice , the number of blastocysts to inject was determined . blastocysts , after injection , were cultured in droplets of brinster &# 39 ; s bmoc - 3 medium . the recipient mice , kunming pseudopregnancy white mice , were females mated with vasectomized males . the recipient &# 39 ; s back was sterilized with ethanol , and then made a transverse incision of about 1 cm length on the right side just near the first lumbar . drew on both sides until the right ovary and its fat pad appear through the peritoneum . a 3 mm rip in the peritoneum was torn with tweezers . the fat pad was grasped and pulled out with the operator &# 39 ; s left hand , after which the uterus was visible . a small hemostatic forceps were attached to a little bit of the fat pad for slight fastening . a mouth - controlled pipette was put onto a transfer pipette . then , under a stereo microscope , the culture in the following sequence were carefully aspirated : medium , bubbles , medium , bubbles , the injected blastocyst , bubbles , and a small amount of medium . the operator held tweezers with his left hand to grasp the uterus wall 2 mm from the interface of uterus and fallopian tubes , while he held a 4 # needle syringe and transfer pipette with his right hand . under the anatomical lens , the needle was used to make a small hole near the tweezers ( while avoiding the vessel ), then the tip of the transfer pipette was inserted into the small hole . the embryos were gently blown into the uterus . the uterus and mesentery were pushed back into the abdominal cavity , then the incision was sutured . ( see , gene targeting technology , p 133 , xiao yang , et . al ., by science press ). the transplant surgery was successful , small mice were born after 17 days , and a few days later , were estimated whether a chimera mouse of high chimerism has been obtained from color patterns . said high - chimerism mice , when selected to mate with c57bl / 6j mice , in the offspring pure brown transgenic heterozygous mice were obtained . mating among these heterozygous mice can screen out homozygous transgenic mice . about 0 . 5 cm of a tail was cut from a 15 - day - old mouse and was put to an eppendorf tube . 400 μl tail lysis buffer ( 0 . 5 % sds , 0 . 1m nacl , 0 . 05m edta , 0 . 01m tris - hcl ph8 . 0 , 200 μg / ml proteinase k ) was added to each tube and the tubes were incubated at 50 ° c . overnight . 200 μl saturated nacl ( 6m ) was added to each tube , vortexed vigorously and stood on ice for 10 minutes . the tubes were centrifuged at 14 , 000 rpm for 10 minutes at room temperature and transferred the supernatant of each tube to a new eppendorf tube . 0 . 8 ml ethanol was added to each tube and they were mixed well . the tubes then were centrifuge at 14 , 000 rpm for 5 minutes and the supernatant was discarded . the pellets were allowed to dry and the dna in each tube was dissolved in 50 to 100 μl te . as shown in fig6 a , primer 1 ( 5 ′ acaggactcaccggagcaagcgctcat 3 ′ ( seq id no . 17 )) locates in the 5 ′ end of the mature peptide ; primer 2 ( 5 ′ gaacgagatcagcagcctctgttcca3 ′ ( seq id no . 18 )) locates in neo gene ; primer 3 ( 5 ′ gaactcccagtgtggataagtaga3 ′ ( seq id no . 19 )) locates in none coding region downstream mature peptide gene ; primer 4 ( 5 ′ aatagtagagaagcagccatcagagca3 ′ ( seq id no . 20 )) locates in 5 ′ end of downstream homology arm . by using mouse genomic dna ( 1 μg ) as template , primer 1 + primer 2 as primers ( 100 ng each ), pfu high fidelity polymerase ( 2 . 5 u ), 250 μmol / l dntps , 2 . 5 mmol / l mgcl2 and 25 mmol / l tris - hcl ( ph8 . 3 ), pcr reaction ( 94 ° c . 30 s , 55 ° c . 30 s , 72 ° c . 1 min , 30 cycle , perkin elmer 9700 pcr amplifier ) was performed . after the electrophoresis of pcr product in 1 % agarose , there is not any specific amplified band in the wild - type c57bl / 6j mouse . but in heterozygote and homozygote transgenic mouse , there was a band about 1200 bp amplified . the pcr product was verified by dna sequencing and confirmed that the ngf mature peptide gene in mouse genome has already been replaced by the human gene . a pcr reaction was performed by using primer 3 + primer 4 ( 100 ng each ) ( under the same condition as above except the extension at 72 ° c . is 2 min ). after electrophoresis of pcr product in 1 % agarose , there is a band about 190 bp in a wild - type c57bl / 6j mouse ; in heterozygote mouse , there is another band about 2000 bp besides the 190 bp bands ; as for homozygote mouse , there is only one band about 2000 bp . about 0 . 5 cm tail was cut from homozygote mouse and was put to an eppendorf tube . 400 μl tail lysis buffer ( 0 . 5 % sds , 0 . 1m nacl , 0 . 05m edta , 0 . 01m tris - hcl ph8 . 0 , 200 μg / ml proteinase k ) was added and the tubes were incubated at 50 ° c . overnight . 200 μl saturated nacl ( 6m ) was added into each tubes ; the tubes were vortexed vigorously and put on ice for 10 minutes . the tubes were centrifuge at 14 , 000 rpm for 10 minutes at room temperature and the supernatant of each tube was transferred to a new eppendorf tube . 0 . 8 ml ethanol was added to each tube and they were mixed well . the tubes were centrifuged at 14 , 000 rpm for 5 minutes , and then the supernatant was discarded . the pellets were allowed to dry , and then the dna in each tube was dissolved in 50 to 100 μl te . the primer ( 5 ′ aatccctttcaacaggactcaccggag caa 3 ′ ( seq id no . 21 )) and primer ( 5 ′ aagggggctgcag gcaagtcagcctcttc 3 ′ ( seq id no . 22 )) to upstream and downstream , respectively , of the ngf mature peptide gene were designed . by using mouse genomic dna ( 1 μg ) as template , pfu high fidelity polymerase ( 2 . 5 u ), a pcr reaction ( 94 ° c . 30 s , 55 ° c . 30 s , 72 ° c . 1 min , 30 cycle , perkin elmer 9700 pcr amplifier ) was performed . after electrophoresis in 1 % agarose and ta cloning , the pcr product was sequenced . the result shows that the mature peptide gene is human ngf - β gene . the sequence is as follows as shown in fig7 a , the mouse - tail genomic dna was extracted and digested with ecor i . a southern blotting was performed by probe a of 5 ′ end of targeting vector . there is a band of about 10 kb in a wild - type c57bl / 6j mouse . because of the ecor i site in the human ngf mature peptide gene , in the heterozygote mouse , there is another band about 5 kb besides the 10 kb band . while in homozygote mouse , there is only one 5 kb band . ( fig7 b ) 1 ) pcr identification and the results are the same as example 7 . about 0 . 5 cm of tail was cut from a homozygote mouse and was put into an eppendorf tube . 400 μl tail lysis buffer ( 0 . 5 % sds , 0 . 1m nacl , 0 . 05m edta , 0 . 01m tris - hcl ph8 . 0 , 200 μg / ml proteinase k ) was added and the tubes were incubated at 50 ° c . overnight . 200 μl saturated nacl ( 6m ) was added to each tube ; the tubes were vortexed vigorously and stood on ice for 10 minutes . the tubes then were centrifuge at 14 , 000 rpm for 10 minutes at room temperature and the supernatant of each tube was transferred to a new eppendorf tube . 0 . 8 ml ethanol was added to each tube and they were mixed well . the tubes were centrifuge at 14 , 000 rpm for 5 minutes and the supernatant was discarded . the pellets were allowed to dry , and the dna of each tube was dissolved in 50 to 100 μl te . primer ( 5 ′ aatccctttcaacaggactcaccggag caa 3 ′ ( seq id no . 24 )) and primer ( 5 ′ aagggggctgcagg caagtcagcctcttc 3 ′ ( seq id no . 25 )) to upstream and downstream , respectively , of the ngf mature peptide gene were designed . by using mouse genome dna ( 1 μg ) as template , pfu high fidelity polymerase ( 2 . 5 u ), a pcr reaction ( 94 ° c . 30 s , 55 ° c . 30 s , 72 ° c . 1 minute , 30 cycle , perkin elmer 9700 pcr amplifier ) was performed . after electrophoresis of pcr product in 1 % agarose and ta cloning , the pcr product was sequenced . the result shows that the mature peptide gene is mouse mutant ngf - β gene . the sequence is as follows : as shown in fig8 a , the mouse tail genome dna was extracted and digested with bamh i . the southern blotting was performed by probe b of 5 ′ end downstream the homology arm . there is a band about 800 bp in a wild - type c57bl / 6j mouse . after mutant ngf - β recombination , the neo gene is inserted between the two bamh i sites , so there is another band about 2 . 7 kb in the heterozygote mouse . as for the homozygote mouse , there is only one 2 . 7 kb band . ( fig8 b ) extraction of ngf from the submandibular glands of a mouse knock - in human ngf mature peptide in grade i lab , a healthy male mouse ( weight : 30 to 40 g ) was killed by cervical dislocation , and the submandibular glands were immediately collected . pure water was added by 1 : 2 to 1 : 5 ( g : ml ) and the tissue was ground with a high - speed grinder . the mixture was diluted with pure water by 2 to 3 times and centrifuged at 12 , 000 rpm for 1 hour . the supernatant was collected and dialyzed in 0 . 02m ph6 . 8 pb . the sample was loaded onto a cm - sepharose ff chromatography column fully pre - balanced with 0 . 02m ph6 . 8 pb . the column was washed with balance buffer and the eluted protein solution was collected . the protein solution was dialyzed in 0 . 25 mm ph6 . 8 pb for 24 h , during which the dialysis buffer was changed 2 or 3 times . the ph is decreased to 4 . 0 by adding 1m acetic acid buffer ( ph4 . 0 ) to the protein solution after dialysis . 0 . 4m nacl was added and stood still for 5 minutes . the solution was centrifuged at 10000 g for 30 minutes , and then the supernatant was collected . the supernatant was loaded onto a cm - sepharose ff chromatography column fully balanced with 0 . 05m ph4 . 0 acetic acid buffer ( containing 0 . 4m nacl ) beforehand . the column was washed with balance buffer to baseline . the column was washed again with 0 . 05m ph9 . 0 tris buffer until the impurity peak reaches the baseline , then gradually washed with 0 to 0 . 4m nacl and the protein peak desired was collected . after gel filtration chromatography ( superdex g75 prep grade column balanced with 0 . 05m ph9 . 0 tris ( containing 0 . 15m nacl )), the protein solution was filtered with a filter membrane ( 20 nm aperture ) to remove the virus . the filtrate was collected . sds - page was used to examine the molecular weight of the protein ( the result is shown in fig9 ). the pi is measured by using isoelectric focusing ( the result is shown in fig1 ). the methods are the same as example 9 . sds - page results are shown in fig9 . measurement of the relative activity of human ngf and further the identification of protein extracted in example 9 the bottom of culture flask was coated with mucilage mouse glue , dried and washed twice with dmem containing 10 % fcs . 3 ml dmem was added and balanced overnight . the medium was discarded just before use . the dorsal root ganglions ( drg ) from a chicken embryo ( age 8 days ) were inoculated in a flask filled with mucilage mouse glue ( 3 - 5 ganglions in each flask ). the flasks was put in an incubator ( 5 % co 2 ) and incubated for 2 hours at 37 ° c . the ngf sample was gradually dilute and the dilution was added to the flasks . the judgment criterion of the results : “−” represents no neurite outgrowth ; “+” represents a little neurite outgrowth . long neurite outgrowths , if there are many , can be represented by “++” to “+++” depending on the density and length , while “++++” represents the densest one and “#” represents over - inhibition . the amount ( per ml ) of sample with the densest and longest outgrowth is used as the activity unit . the result is shown in fig1 , which shows the differentiation of drg induced by recombinant human ngf . 1 : 27 ng / ml ngf ; 2 : 9 ng / ml ngf ; 3 : 3 ng / ml ngf ; 4 : 1 ng / ml ngf ; 5 : 0 . 33 ng / ml ngf ; 6 : negative control , drg is cultured in dmem ). identification of the biological characteristics of mutant ngf and the measurement of its activity the wt mouse ngf and mutant ngf was labeled with i 125 , then added to both the cells expressing trka and the a875 tumor cells expressing p75 . the ligand and receptor were crosslinked by n - hydroxysuccinimidyl - 4 - azidobenzoate , the cells were lysed , and the cross - linked complex was immunoprecipitated overnight at 4 ° c . after sds - page and autoradiography , results show that both wt ngf and mutant ngf can bind trka , while the mutant ngf cannot bind p75 . ( fig1 shows the autoradiography results . 1 : trka - wt ngf complex ; 2 : trka - ngf mutant complex ; 3 : p75 - wt ngf complex ; 4 . p75 - ngf mutant complex ). the bottom of a culture flask was coated with mucilage mouse glue , then dried and washed twice with dmem containing 10 % fcs . 3 ml dmem was added and balanced overnight . the medium was discard before use . the dorsal root ganglions ( drg ) from a chicken embryo ( age 8 days ) were inoculated in the flask filled with mucilage mouse glue ( 3 - 5 ganglions each flask ). the judgment criteria for the results are as follows : “−” represents no neurite outgrowth ; “+” represents a little neurite outgrowth . long neurite outgrowths , if there are many , can be represented by “++” to “+++” depending on the density and length . the symbol “++++” represents the densest one , and “#” represents over - inhibition . the results show that , at high concentration , mutant ngf has the same ability as wt ngf in inducing the growth of ganglion ( 27 ng / ml , 9 ng / ml ). at low concentration , however , this ability decreases obviously ( 3 ng / ml , 1 ng / ml , and 0 . 3 ng / ml ). the content of semi - manufactured ngf was measured by lowry . the protein solution was diluted with pyrogen - free 25 mm , ph6 . 8 pb ( containing 0 . 05 % human blood albumin and 5 % mannitol ) to the volume needed . the solution was filtered with 0 . 22 μm filter and was aliquoted sterilely . then the aliquots were frozen , dried , capped and stored at 4 ° c . the content of semi - manufactured ngf was measured by lowry . the protein solution was diluted with pyrogen - free 25 mm , ph6 . 8 pb ( containing 0 . 05 % human blood albumin ) to the volume needed . the solution was filtered with 0 . 22 μm filter and was aliquoted sterilely . then the aliquots were capped and stored at − 20 ° c . the content of semi - manufactured ngf was measured by lowry . the protein solution was diluted with pyrogen - free 20 mm , ph6 . 8 pb ( containing glycine , alanine , arginine , 3 . 33 mg / ml ( final concentration ) respectively , and 0 . 5 % nacl ) to the volume needed . the solution was filtered with 0 . 22 μm filter and was aliquoted sterilely . then the aliquots were capped and stored at − 20 ° c . based on the above discussion , many modifications may be made to the present invention . thus , there are other approaches to perform the present invention , besides the methods discussed above , within the scope of the following appended claims . | 0 |
[ 0039 ] fig1 is a block diagram showing a hardware configuration of an electronic musical instrument to which an electronic musical instrument bus system according to the present invention is applied . fig2 is a connection diagram of the electronic musical instrument bus system according to the present invention . the electronic musical instrument bus system according to the present invention is denoted as an e - bus system which includes an e - bus 11 incorporated in electronic musical instrument 1 shown in fig1 and an e - bus system which includes connections of the e - bus 11 is shown in fig2 . the e - bus 11 in the e - bus system is connected with a main controller device 10 ( host device ), panel devices 12 , 13 , keyboard devices 14 , 15 , and a midi device 16 . the main controller device 10 is provided with a main circuit board 10 a on which a main cpu ( central processing unit ), a main rom ( read only memory ), a main ram ( random access memory ) and the like are mounted . the panel devices 12 , 13 are provided with panel circuit boards 12 a , 13 a , respectively , each of which mounts a panel cpu , a panel rom and a panel ram thereon . the keyboard devices 14 , 15 are provided with keyboard circuit boards 14 a , 15 a , respectively , each of which mounts thereon a keyboard cpu , a keyboard rom , a keyboard ram and the like . the midi device 16 is provided with a midi circuit board 16 a on which a midi cpu , a midi rom , a midi ram and the like are mounted . the main controller device 10 controls the entire operation of the electronic musical instrument 1 , and performs control processing for generating a tone based on operation information of keyboard switches and panel operators inputted from the keyboard devices 14 , 15 and the panel devices 12 , 13 , and control processing for generating a tone according to a midi ( musical instrument digital interface ) message . in the main controller device 10 , a control program executed by the main cpu and preset data such as timbre data and accompaniment patterns are stored in the main rom mounted on the main circuit board 10 a . further , a working memory area , which the main cpu uses when it executes the control program and the like , and a user area for timbre data and accompaniment patterns are set in the ram mounted on the main circuit board 10 a . the panel devices 12 , 13 are each provided with a panel switch for setting timbres and effects , a continuous controller like a volume or wheel , and a panel operator such as a jog controller , so that the selection of timbres and timbre parameters can be changed . the panel cpu scans the panel operators provided in the panel devices 12 , 13 to detect input events and manipulated variables . in this case , the manipulated variables may be detected as relative values depending on the panel operator . in the panel devices 12 , 13 , a scan program and the like executed by the panel cpu are stored in the panel rom mounted on the panel circuit boards 12 a , 13 a , respectively . further , memory areas such as a working memory area used when the panel cpu executes the scan program and the like are set in the panel ram mounted on the panel circuit boards 12 a , 13 a , respectively . the keyboard devices 14 , 15 are each provided with plural keys and keyboard switches that are turned on and off in response to operations of the respective keys . the keyboard cpu scans the keyboard switches provided in the keyboard devices 14 , 15 to detect values of key events indicative of note - on / note - off , velocity and after - touch . in the keyboard devices 14 , 15 , a scan program and the like executed by the keyboard cpu are stored in the keyboard rom mounted on keyboard circuit boards 14 a , 15 a , respectively . further , a working memory area and the like used when the keyboard cpu executes the scan program and the like are set in a keyboard ram mounted on keyboard circuit board 14 a , 15 a , respectively . the midi device 16 is a midi - compatible device such as a midi input / output device provided with a midi terminal and a to - host terminal , an automatically performable sequencer and a midi keyboard . the midi device 16 may be provided with a to - host terminal for establishing a connection to a host computer . in the e - bus system , the midi device 16 can send and receive performance data and performance related data directly in the midi format . the midi cpu controls the operation of the midi device 16 . in the midi device 16 , a midi control program executed by the midi cpu and midi control data are stored in the midi rom mounted on midi circuit board 16 a . further , a working memory area and the like used when the midi cpu executes the midi control program are set in the midi ram mounted on the midi circuit board 16 a . the provision of the to - host terminal in the midi device 16 can change the electronic musical instrument to a to - host terminal equipped model . in the electronic musical instrument 1 as shown in fig1 and 2 , the main controller device 10 receives performance event data and performance related data regarding the timbres and the like through the e - bus 11 connecting between the main controller device 10 and the panel device 12 , 13 , the keyboard device 14 , 15 and the midi device 16 . then , the main controller device 10 sends sound control data to tone generator units 22 , 23 and 24 through a bus 21 as soon as an event starting time comes so that the tone generator units 22 , 23 and 24 will start generating tones . the tones generated at the tone generator units 22 , 23 and 24 are supplied to a sound system 32 , and emitted from the sound system 32 . the bus 21 can be connected with other units through i / o units 25 , 26 . in connecting the main controller device 10 , the panel devices 12 , 13 , the keyboard device 14 , 15 and the midi device 16 to the e - bus system as practiced in the embodiment , connectors provided at ends of wires constituting the e - bus 11 are engaged into bus terminals provided on the respective device boards as shown in fig2 . the other ends of the wires are connected to signal lines and power lines , respectively , constituting the e - bus 11 around a hub circuit board 17 . thus the connectors of the e - bus 11 are coupled to the respective device boards so that each device can be connected to the e - bus system . for this reason , the device can also be removed from the connector of the e - bus 11 as required , which enables free addition and removal of the device to and from the e - bus system . it should be noted that the devices connected to the e - bus system are supplied with power from the e - bus 11 . in the configuration shown in fig2 a power source , not shown , on the hub circuit board 17 supplies power . each connector of the e - bus 11 may be a 7 - pin connector in which three pins are used for signal lines and the remaining four pins for power supply . further , each connector equipped in the e - bus has the same standardized configuration or arrangement , and each bus terminal equipped in the devices has the same standardized configuration or arrangement . suppose that the e - bus system according to the embodiment is used in the electronic musical instrument 1 . in this case , if the electronic musical instrument 1 is to be an organ type electronic two - stage keyboard instrument , it will have only to attach the keyboard device 14 and the keyboard device 15 to the connectors , respectively , of the e - bus connected with the main circuit board , the panel circuit boards and the like . on the other hand , if the electronic musical instrument 1 is to be an organ type electronic three - stage keyboard instrument , it will have to attach a further additional keyboard device to a connector of the e - bus 11 . further , in the electronic musical instrument whose main circuit board , panel circuit boards , keyboard circuit boards are connected to the e - bus , only the keyboard devices may be replaced to modify the electronic musical instrument 1 , for example , from a 61 - key electronic musical instrument model to a 76 - key electronic musical instrument model . the panel devices may also be replaced to bring the electronic musical instrument 1 into correspondence with another model with many or few panel switches . thus , some of the plural circuit boards constituting the electronic musical instrument can be added , removed and changed independently of one another . for example , a keyboard device connected to a connector of the e - bus may be removed , and a panel device may be coupled to the same connector in place of the removed keyboard device . in general , various devices of different categories can be selectively coupled to the same connector . further , any device can be detached from one connector of the e - bus system , and the detached device can be attached to another connector of the same e - bus system . thus , e - bus system establishes the compatibility and universality of the devices and connections . the e - bus system used as the electronic musical instrument bus system according to the present invention will be described below in detail . the e - bus system is a two - way or bi - directional serial bus with three signal lines , namely a serial clock line ( hereinafter called the “ scl line ”), a serial data line ( hereinafter called the “ sda line ”), and an initial clear line . in this case , a data signal is sent to the sda line in synchronism with a clock signal sent to the scl line . and , a reset signal is sent to the initial clear line upon start - up or reset of the e - bus system . the e - bus system includes four power lines from which power is supplied to the devices connected to the e - bus system . the communication speed of the e - bus system may be any one of 100 kbps , 400 kbps and 3 . 4 mbps . the e - bus system can be connected with plural devices sequentially ( bus - type connection ), assigning a unique , inherent address to each device connected to the e - bus system . the inherent address , for example , is a 7 - bit address . fig5 shows a table of inherent addresses . as shown , each inherent address consists of a 4 - bit category id and a 3 - bit sub - address . the category id indicates the type of category , and the sub - address is an address indicative of an individual device out of devices of the same category type . the category id indicative of the type of category as the high - order bits of the address is preset according to the type of category of the device in the manufacturing process of the circuit board of the device . the sub - address is set through a jumper - pin or dip switch assembly not to overlap with sub - addresses of other devices of the same type when incorporated in the electronic musical instrument 1 . the categories are divided into a host type to which the main controller device 10 belongs , a keyboard type to which the keyboard devices 14 , 15 belong , a panel type to which the panel devices 12 , 13 belong , a midi type to which the midi device belongs , and a combination keyboard - panel type that combines the keyboards and panels . communications among devices on the e - bus system are carried out according to the master - to - slave communication scheme including multi - master communications . the master is a device capable of starting a data transfer onto the e - bus system . the master can also generate a clock pulse to output the same to the scl line so as to enable the transfer or end the data transfer . the slave is a transmission destination device to be addressed by the master . the term “ multi - master ” denotes that plural masters can control the e - bus system simultaneously without loss of message data . the e - bus system allows for simultaneous data transfers on the e - bus system . in other words , the e - bus system has a function for detecting a collision between data and an arbitration function to prevent data corruption . the e - bus system performs arbitration according to the category name priorities on the transmission destination side . the category name is to expand the type of category . fig5 shows a table of inherent addresses and category names . of all the priorities , the category name “ general call ” indicating that all the devices are transmission destinations is assigned the highest priority . then the category name “ host type ” is the second , “ keyboard type ” is the third , “ combination keyboard / panel type ” is the fourth , and “ panel type ” is the fifth . the lowest priority is assigned to the category name “ midi type .” these priorities are decided from importance and real - time standpoints . further , the e - bus system carries out communication using a communication protocol corresponding to the category name to which the transmission source address and the transmission destination address belong . fig5 shows a table of the category names and communication protocols . as shown in fig5 when communication between the keyboard type to which the keyboard devices 14 , 15 belong or the panel type to which the panel devices 12 , 13 belong , and the host type to which the main controller device 10 belongs is conducted , a standard protocol to be described later as a man - machine interface protocol is used for the communication . when communication between the midi type to which the midi device 16 belongs and the host type to which the main controller device 10 belongs is conducted , a midi protocol to be described later as a performance information transfer protocol is used . if the category name is “ general call ,” the host type will communicate with the keyboard type , the panel type , and the midi type using a common protocol to be described later as a control protocol . the common protocol is composed of common parts of the standard protocol and the midi protocol . in this case , only the host type can transmit data to the general call address “ 0000 000 .” the other devices in the keyboard type , the panel type and the midi type have to use their own addresses upon transmission based on the common protocol . thus the main controller device 10 of the host type can perform communication using the communication protocol corresponding to the category name . when the host type communicates with another device with another category name , any communication protocol needs to be predetermined . therefore , the host type specifies a transmission destination address prior to the communication . the transmission destination address is an address inherent in the device and whose four high - order bits represent the category id . therefore , the host type can refer to the table shown in fig5 to obtain the category name of the device as the communication partner and the communication protocol used . as shown in fig5 the host is assigned two inherent addresses corresponding to two communication protocols of the host type , so that the host type carries out communication using the address of one communication protocol corresponding to the category name of the device as the communication partner . the host type can also carry out communication under the standard protocol , where the host type uses any one of the two inherent addresses and the general call address . [ 0056 ] fig3 shows a specific constitution of the e - bus system according to the present invention . it should be noted that fig3 shows only the two signal lines , the scl line and the sda line , out of seven wires constituting the e - bus system . the signal line that is not shown is an initial clear line ( e - ic ), and the remaining four lines are power lines . as shown in fig3 a device 1 , a device 2 and a device 3 are - bus - connected to the scl line and the sda line , respectively . since the connections between the devices , and the scl line and the sda line are constructed in the same manner , description will be made below about the device 1 alone . in the device 1 , a buffer b 2 as a clock input part ( scl in ) is connected to the scl line to which the clock is transferred , and the clock pulse is taken into the device 1 through the buffer b 2 . an open drain of a field - effect transistor ( hereinafter called the “ transistor ”) tr 2 as a clock output part ( scl out ) is also connected to the scl line so that the clock pulse can be sent to the scl line by turning the transistor tr 2 on and off . further , a buffer b 1 as a data input part ( sda in ) is connected to the sda line to which a data signal is transferred . the data signal is taken into the device 1 through the buffer b 1 . an open drain of a transistor tr 1 as data output part ( sda out ) is also connected to the sda line so that the data signal can be sent to the sda line by turning the transistor tr 1 on and off . the device 2 and the device 3 are also connected to the scl line and the sda line in the same circuit configuration . in the devices 1 to 3 shown in fig3 transistors tr 1 through tr 6 are field - effect transistors , but they may be bipolar transistors whose collectors are open . the scl line and the sda line are pulled up by pullup resistors rp , respectively . in other words , the scl line and the sda line are at a high ( h ) level when they are open , and the sda line is changed to a low ( l ) level by turning on any one of the transistors tr 1 , tr 3 and tr 5 . that is , wired and connections between the data output parts of the devices 1 to 3 and the sda line are established . similarly , the scl line is at the h level in the open state , and is changed to the l level by turning on any one of the transistors tr 2 , tr 4 and tr 6 of the clock output parts in the devices . that is , wired and connections between the clock output parts of the devices 1 to 3 and the scl line are established . [ 0058 ] fig4 shows a waveform timing chart upon data transfer onto the scl line and the sda line in this e - bus system . in the e - bus system , the transfer of data can be initiated only when the bus is open ( h level ), and the master transfers a start bit upon the data transfer . in this case , the sda line is reversed to the l level when the scl line is at the h level ( in the open state ) to send the start bit as shown in fig4 . the start bit is detected by the device connected to the e - bus system , so that the device is informed of the initiation of data transfer . next , a header part prefixed to a data part is transferred . the data part consists of plural bytes ( where one byte is 8 bits ), and the header part also consists of plural bytes . in this header part , a 7 - bit transmission destination address ( slave address ) and one bit that instructs the reading and writing ( r / w ) of data constitute the first one byte . then a 7 - bit transmission source address ( master address ) and one dummy bit , “ 0 ” constitute the next one byte . following the header part , 3 or 15 consecutive bytes of data part are transferred on a byte basis as described later . the clock pulse is also sent to the scl line in synchronism with each bit of the head part and the data part . in this case , since the header part and the data part each consist of pieces of one - byte data , eight clock pulses 1 , 2 , 3 . . . 8 are sent in synchronism with each bit as shown every one byte of the header part and the data part . the header part and the data part can reverse the level of each bit while the clock pulse is at the l level . to make data of each bit effective while the clock pulse is at h level , the level of the sda needs to be stabilized for transfer . in the e - bus system , the clock pulse , the header part and the data part sent from the master reach all the devices through the scl line and the sda line . then each device compares the slave address in the header part received first with its own inherent address on a bit basis . if the 7 - bit slave address and its own address coincide with each other , the device finds that its own machine is addressed as a slave , and receives the following data . suppose that even though the level of sda line is l ( or h ), a corresponding bit of its own address is “ 1 ” ( or “ 0 ”). in this case , since its own machine is not addressed as a slave , the device judges that its own machine is not the transfer destination and rejects the following received data . thus only the addressed device can receive data . in the header part , the eighth bit of each byte is to instruct reading / writing of data . in the e - bus system , however , the bit is always kept at l ( equal to “ 0 ”), that is , the bit represents a write - only data format . since electronic musical instrument is required to respond to operations of the keyboards , the panels and the like in real time , the writing of the operation events in the keyboard type and the panel type to transmit the same so as to the host type enhances the response . the master sends the next one byte signal after it confirms that one byte - based signal in the header part and the data part sent to the sda line is received normally . after the one byte signal is sent , the master sends the scl line a ninth acknowledgment clock pulse ( ack ), which indicates whether the one byte signal is received as an effective signal . at the same time , the master opens the sda line and changes the level to h . when the one byte signal is received as an effective signal , the transmission destination device addressed at the slave address of the header part turns on the transistor of the data output part and keeps the sda line at the l level . while the ninth ack clock is holding the h level , the master takes in the level of the sda line , and when the acknowledgment pulse exhibits the l level , the master confirms that the transmission destination device has received the one byte signal normally . thus the master can send the next one byte to the sda line . at this time , the transmission destination device keeps the scl line at the l level until it is ready for reception . after a lapse of a predetermined time period , the master starts sending the sda line the next one byte serially from the first bit , and the scl line the synchronizing clock pulses . then , if the transmission destination device is ready to receive , the clock pulses of the scl line rise sequentially so that the transmission destination device can take in the next one byte in response to the clock pulses . on the other hand , if the transmission destination device is not ready , the scl line is kept at the l level . therefore , no clock pulse sent from the master appears on the scl line , and the master waits until the scl line rises . when the transmission destination device is made ready to receive , the scl line is released , so that the clock pulses rise on the scl line , thus transmitting the next one byte . if the transmission destination device fails to receive the effective one byte signal , an h - level acknowledgment signal is created and received by the master . in this case , the master reverses the sda line to the h level while keeping the scl line at the h level to send a stop bit so as to stop the data transfer . the master also sends stop bit to the e - bus 11 upon completion of the communication . the following describes arbitration . in the e - bus system , data transfer can be initiated only when the bus is open ( h level ). then , if two or more devices start data transfer as masters almost at the same time , arbitration will be performed to permit any one of the masters to communicate . the arbitration process takes advantage of the fact that wired and connections between the data output parts of the devices and the sda line are established . to be more specific , when data transfer starts , as shown in fig4 since the slave address is sent to the sda line following the start bit , the plural masters compare the address received from the sda line with a slave address addressed by its own machine on a bit basis . in this case , if the data are sent to the sda line from plural devices at the same time , since the wired and connections are established , the sda line will be kept at the l level when one of the devices sends l level . then , in some devices , while the compared bit of the slave address specified by its own machine is “ 1 ,” the bit taken in from the sda line becomes “ 0 ” ( l level ). when the addresses do not coincide with each other like this case , the device determines that the other masters have higher priorities and turns the data output part off . continuing this processing , the master assigned the highest priority is eventually permitted to communicate . as stated above , since the l level is given first priority as the level of the sda line , the slave address that has more “ 0 ” digits from the most significant bit ( msb ) is assigned higher priority . priorities in the arbitration process are decided from the category names . as stated above , the general call is assigned the highest priority . the second priority is given in a case where the device ( main controller ) of the host type is the transmission destination , the third is that the device of the keyboard type is the transmission destination , the fourth is that the device of the panel type is the transmission destination , and the fifth is that the device of the midi type is the transmission destination . it should be noted that the priority of the keyboard type is higher because real - time response is important for the keyboards . for these reasons , a category id is assigned to each category as shown in fig5 according to its category name priority . fig5 is a table showing category ids , sub - address ranges , category names and types of communication protocols which are used . referring to the category ids in the table of fig5 the category id of the general call which is transferred to all the devices is “ 0000 ,” which has the most “ 0 ” digits . then , the category id of the host type ( main controller ) is “ 0001 ,” the category id of the keyboard type is “ 0010 ,” the category id of the panel type is “ 0011 ,” the category id of the keyboard - panel combination is “ 0100 ,” and the category id of the midi type is “ 0100 .” thus the arbitration can be performed in the above - mentioned priority order . if the category ids are the same and the master cannot be decided merely by comparing the category ids , the decision will be made by comparing the sub - addresses . if no master can still be decided , then the decision will be made by comparing the transmission source addresses . since the transmission destination address never coincide with the transmission source addresses , the arbitration always finishes by comparing the transmission source addresses . if the device of the host type ( assigned the highest priority except in the case of a general call as special communication ) is the transmission destination , the keyboard type , the panel type , the combination keyboard - panel type and the midi type are prioritized as the transmission source in this order . these priorities are also decided from real - time requirements . discussing the sub - addresses , the sub - address “ 000 ” used when the category name of the device as the communication partner is the keyboard or panel type ( the keyboard type , the panel type or the combination keyboard - panel type ) and the sub - address used for the midi type are prepared for the host type . in other words , if the device whose category name is the keyboard or panel type is addressed , the device takes precedence over the midi type to communicate with the host type . it should be noted that sub - addresses “ 010 ” to “ 111 ” are reserved for different bus formats or future use . further , if the slave addresses specified as the transmission destination coincide with each other but the master cannot be decided , the decision will be made by comparing the master addresses subsequently sent . the keyboard type , the panel type , the combination keyboard - panel type and the midi type are given eight sub - address ranges “ 000 ” through “ 111 ,” respectively . for this reason , in the systems of these category names , eight devices of the same category can be connected to the e - bus system . in the e - bus system , communication between devices is conducted using a communication protocol corresponding to the category of the devices . however , the communication protocol for general call is the common protocol so that communications can be conducted among devices of all the categories . as shown in fig5 if the category names to communicate with the host type are the keyboard type , the panel type and the combination keyboard - panel type , the standard protocol is used for the communication . if the category name to communicate with the host type is the midi type , the midi protocol is used . in this case , since each device is assigned a category id corresponding to the category name , the communication protocol can be decided from the category id of the slave address specified . since the host type ( main controller ) needs to communicate with each device using a communication protocol corresponding to the category name of the device as the communication partner , a standard protocol address and a midi protocol address are prepared for the host type as shown in fig5 . for example , when the device of the host type communicates with the device of the midi type , the device of the host type uses “ 0001 001 ” as the address of its own machine , while when the device of the midi type becomes the master , “ 0001 001 ” is addressed as the slave address . thus the device of the host type and the device of the midi type can communicate with each other using the midi protocol . on the other hand , when the device of the host type communicates with any device of the keyboard type ( the panel type or the combination keyboard - panel type ), the device of the host type uses “ 0001 001 ” as the address of its own machine , while when the device of the keyboard type ( the panel type or the combination keyboard - panel type ) becomes the master , “ 0001 001 ” is addressed as the slave address . thus the device of the host type and the device of the keyboard type ( the panel type or the combination keyboard - panel type ) can communicate with each other using the standard protocol . [ 0068 ] fig6 shows a data format of a packet in the e - bus system according to the present invention . as shown in fig6 as the data formats in the e - bus system , a data format for 5 - byte standard data and a data format for 17 - byte extended data are defined . the standard data format of length 5 bytes consists of a one - byte transmission destination address ( slave address ) for addressing , a one - byte transmission source address ( master address ), and data 1 , data 2 and data 3 with one byte in each . the extended data format of length 17 bytes consists of a one - byte transmission destination address ( slave address ) for addressing , a one - byte transmission source address ( master address ), and data 1 to 15 with one byte in each . in this case , the transmission source address contains a dummy bit “ 0 ,” and the transmission destination address contains an r / w bit , respectively . the standard data format is used for the common protocol , the standard protocol and the midi protocol , while the extended data format is used for transferring the system exclusive message and the like using the midi protocol . the transmission destination address and the transmission source address constitute the header part shown in fig4 and the following 3 - or 15 - byte data constitute the data part . the data 1 in the standard and extended data is an index indicative of the kind of data to be transferred . specifically , the index represents commands in each communication protocol . thus packet lengths ( or data byte length ) are integrated into two lengths , which makes it possible to simplify each device processing during communication . in the electronic musical instrument , a 3 - byte packet is most suitable for the exchange of normal commands other than exclusive . further , the packet length of the normal commands is reduced to a short packet length of about 5 bytes ( 10 bytes or less ), which makes it possible to accelerate an isolation time of each packet on the bus , and hence a response time to input from a keyboard or panel in the electronic musical instrument . next , common protocol commands will be described . since the common protocol is a communication protocol capable of being used regardless of category of devices communicating with each other , each device can handle the common protocol during processing for the category to which the device belongs without the need to judge whether it is the common protocol . as mentioned above , in the e - bus system practiced as the electric musical instrument bus system according to the present invention , it is presumed that the device as the main controller device 10 of the host type and another device communicate with each other . fig7 shows commands for host reception and host transmission . all the commands in the common protocol are represented in the standard data format . though the following describes the commands in reverse order to that as shown , the host transmitting command column contains a category id / sub - address request command . this command is used for the device of the host type to detect the addresses of devices connected to the e - bus system so as to enable a general call . the data 1 as the index of this command is “ 00h ” ( h indicates hexadecimal notion , that is , 00h = 0000 0000 ), then the data 2 and the data 3 are also “ 00h .” when the device of the host type makes a general call to issue the category id / sub - address request command , the command issued is standard data consisting of a transmission destination address “ 0000 000 ,” a transmission source address “ 0001 000 ” ( see fig5 ), and data 1 through data 3 represented as “ 00h ” respectively . the category id / sub - address request command for which the general call has been made is received by the devices of all categories , and each device returns a category id / sub - address reply command shown in the host receiving column . the category id / sub - address reply is a command which informs the device of the host type about the address inherent in its own machine . to issue the category id / sub - address reply command , standard data is transmitted . the standard data consists of a transmission destination address “ 0001 000 ” to be addressed , a transmission source address which is set to the 7 - bit address of its own machine , data 1 “ 00h ” as the index , data 2 indicative of the category id of its own machine , and data 3 indicative of the sub - address of its own machine . thus the host can know the devices connected to the e - bus system and their addresses . the category id / sub - address request command is issued when the device of the host type makes the general call upon activation of the e - bus system . from this command , the devices connected to the e - bus system and their addresses can be known . then , from the addresses , the category names and communication protocols to be used can be known . thus the device of the host type can create a table as shown in fig5 and the following communication can be performed by setting an address in the table created . in principle , all but the device of the host type communicate with the device of host type , and two or more addresses assigned to the host type are predetermined in the e - bus system . therefore , all but the device of the host type do not have to create the table shown in fig5 because they know in advance the addresses to be set upon communication . since the general call is received by all the devices other than that of the host type , if the general call is used for each device to send the id / sub - address reply , the devices other than that of the host type need processing for ignoring the general call received . therefore , in the e - bus system according to the present invention , each device uses the host standard address as the transmission destination instead of the general call to conduct communication upon reply , which simplifies processing by the devices other than that of the host type . an e - bus start command of the host transmitting column is basically a command issued by making a general call from the main controller device 10 , and a command for enabling the e - bus system to operate upon start - up of the e - bus system . when a general call of the e - bus start command is made , standard data is transmitted . the standard data consists of a transmission destination address “ 0000 000 ,” a transmission source address “ 0001 000 ,” data 1 “ 01h ” as the index , data 2 “ 00h ,” and data 3 “ 00h .” next , standard protocol commands for host reception and host transmission shown in fig8 will be described . the standard protocol is a communication protocol capable of being used when the device of the host type ( main controller ) communicates with any of the devices whose categories are the keyboard type , the panel type , and the combination keyboard - panel type . any command in the standard protocol is represented in the standard data format . of all the standard protocol commands of the host receiving column , a common protocol command is the same as the common protocol shown in fig7 and therefore , the explanation will be omitted . since they are the same , the device concerned can receive and send the common protocol without switching the operation between the standard protocol and the common protocol . the following sw off command and sw on command are commands for transferring , to the host , off and on events of a panel switch provided in a panel device . for example , when a switch of number n of the panel switch in the panel device is turned off , the sw off command is issued in such a manner that the transmission destination address is “ 0001 000 ” indicating the host , the transmission source address is an address “ 0011 aaa ” of the panel device ( where “ aaa ” is the sub - address of the panel device concerned ), the data 1 as the index is “ bxh ,” the data 2 is the number n of the switch that was turned off ( 8 bits ), and the data 3 is dummy “ 00h .” when the number m switch of the panel switch in the panel device is turned on , the sw on command is issued in such a manner that the transmission destination address is “ 0001 000 ” indicating the host , the transmission source address is an address “ 0011 bbb ” of the panel device ( where “ bbb ” is the sub address of the panel device concerned ), the data 1 as the index is “ 7xh ,” the data 2 is the number m of the switch that was turned on ( 8 bits ), and the data 3 is dummy “ 00h .” since “ xh ” is the port number and the switch number is represented by 8 bits , 16 ports × 256 panel switch sw off commands and sw on commands can be issued . a keyboard off command and a keyboard on command in the standard protocol of the host receiving column are commands for transferring , to the host , a note on event and a note off event on each key in a keyboard device . therefore , when a key corresponding to the note number n is noted off in the keyboard device , the keyboard off command is issued in such a manner that the transmission destination address is “ 0001 000 ,” indicating the host , the transmission source address is an address “ 0010 aaa ” of the keyboard device ( where “ aaa ” is a sub - address of the keyboard device concerned ), the data 1 as the index is “ 8vh ,” the data 2 is the number n of the note that was noted off ( 8 bits ), the data 3 is the eight high - order bits of velocity . since “ vh ” is the four low - order bits , velocity information which is a total of 12 bits is transferred , where the seven high - order bits of the 12 - bit velocity information are made midi - compatible . when a key corresponding to the note number m in the keyboard device is noted on , the keyboard on command is issued in such a manner that the transmission destination address is the address “ 0001 000 ” indicating the host , the transmission source address is an address “ 0010 bbb ” of the keyboard device ( where “ bbb ” is a sub - address of the keyboard devices concerned ), the data 1 as the index is “ 9vh ,” the data 2 is the number m of the note that was noted on ( 8 bits ), the data 3 represents the eight high - order bits of the velocity . in this command , like in the keyboard off command , velocity information which is a total 12 bits is transferred , where the seven high - order bits of the 12 - bit velocity information are made midi - compatible . in either command , since the note number is represented as 8 bits , keyboard off command and keyboard on commands , each of which corresponds to 256 notes , can be issued . the reason why the port number is eliminated and the velocity information is represented in 12 bits is that , when keyboard performance is taken in , 12 - bit velocity resolution higher than that of the midi is necessary to perform processing for a touch curve or the like . a polyphonic after - touch command for transferring the value of a polyphonic after - touch ( an after - touch on each key ) in the keyboard device of host receiving column in the standard protocol is represented in such a manner that the transmission destination address is the address “ 0001 000 ” indicating the host , the transmission source address is the address “ 0010 aaa ” of the keyboard device ( where “ aaa ” is the sub - address of the keyboard device concerned ), the data 1 as the index is “ axh ,” the data 2 is the note number n ( 8 bits ) of the note to which the after - touch is subjected , and the data 3 is an 8 - bit after - value . since “ xh ” is the port number , 16 - port polyphonic after - touch commands can be issued . a continuous controller command for transferring the operation value of a volume , a wheel or the like in a panel device of the host receiving column in the standard protocol is represented in such a manner that the transmission destination address is the address “ 0001 000 ” indicating the host , the transmission source address is an address “ 0011 aaa ” of the panel device ( where “ aaa ” is a sub - address of the panel device concerned ), the data 1 as the index is “ bxh ,” the data 2 represents the kind of the controller such as the volume or wheel ( 8 bits ), and the data 3 represents an 8 - bit operation value of the controller . since “ xh ” is the port number and the kind is represented in 8 bits , 16 ports × 256 continuous controller commands can be issued . a jog controller command for transferring the operation value of a jog controller such as a rotary encoder in the panel device of the host receiving column in the standard protocol is represented in such a manner that the transmission destination address is the address “ 0001 000 ” indicating the host , the transmission source address is the address “ 0011 aaa ” of the panel device ( where “ aaa ” is the sub - address of the panel device concerned ), the data 1 as the index is “ cxh ,” the data 2 represents the kind of the jog controller ( 8 bits ), the data 3 is the relative value ( in 8 bits ) of two &# 39 ; s - complement numbers of the operation value in the controller . since “ xh ” is the port number and the kind is represented in 8 bits , 16 ports × 256 jog controller commands can be issued . an after - touch commands for transferring the value of an after - touch ( a common after - touch of plural keys on a keyboard ) in the keyboard device of the host receiving column in the standard protocol is represented in such a manner that the transmission destination address is the address “ 0001 000 ” indicating host , the transmission source address is the address “ 0010 aaa ” of the keyboard device ( where “ aaa ” is a sub - address of the keyboard device concerned ), the data 1 as the index is “ dxh ,” the data 2 is the eight high - order bits of a touch value , the data 3 is the eight low - order bits of the touch value . since “ xh ” is the port number , 16 - port after - touch commands can be issued . the touch value transferred in this after - touch command is a touch value applied to all the notes that are noted on in a keyboard device as the master ( transmission source ). a 16 - bit continuous controller command for transferring the operation value of a volume , a wheel or the like in the panel device of the host receiving column in the standard protocol is represented in such a manner that the transmission destination address is the address “ 0001 000 ” indicating the host , the transmission source address is the address “ 0011 aaa ” of the panel device ( where “ aaa ” is the sub - address of the panel device concerned ), the data 1 as the index is “ exh ,” the data 2 is the eight high - order bits of the operation value of the controller , and the data 3 is the eight low - order bits of the operation value of the controller . since “ xh ” is the port number , 16 - bit continuous controller commands for 16 ports can be issued . it should be noted that the devices of the combination keyboard - panel type can transmit both commands for the keyboard device and the panel device . further , the continuous controller command and the jog controller command may be sent from the keyboard device . next , commands of the host transmitting column in the standard protocol will be described . a common protocol command of the host transmitting column is the same as the common protocol shown in fig7 and therefore , the explanation will be omitted . an led control command of the host transmitting column is a command used by the host for controlling the intensity of a group to which leds ( light emitting diode ) provided in the panel device belong . the led control command is represented in such a manner that the transmission destination address is the address “ 0011 aaa ” of the panel device whose intensity is controlled ( where “ aaa ” is the sub - address of the panel device concerned ), the transmission source address is the address “ 0001 000 ” indicating the host , the data 1 as the index is “ 6xh ,” the data 2 is a group number ( 8 bits ) of leds whose intensity is controlled , the data 3 is an 8 - bit led intensity value as an intensity control value . since “ xh ” is the port number , 16 - port led control commands can be issued . it should be noted here that since the intensity of a group “ 00h ” is the minimum ( equivalent to off ), and a group “ ffh ” is the maximum ( equivalent to on ), the intensity of these groups can not be changed . an led command of the host transmitting column is a command used by the host for dividing leds provided in the panel device among groups . the led command is represented in such a manner that the transmission destination address is the address “ 0011 aaa ” of the panel device controlled ( where “ aaa ” is the sub - address of the panel device concerned ), the transmission source address is the address “ 0001 000 ” indicating the host , the data 1 as the index is “ 7xh ,” the data 2 represents one of 8 - bit led numbers divided among groups , and the data 3 represents one of 8 - bit group numbers among which the leds are divided . since “ xh ” is the port number and the led number is represented in 8 bits , 16 ports × 256 led control commands can be issued . description will be made here about how to use the led control command and the led command . when the host sends a panel device the led command for dividing an led “ i ” in a group “ ffh ,” the panel device that has received the led command turns on the led whose led number is “ i .” on the other hand , when the host sends the panel device the led command for diving an led “ j ” in a group “ 00h ,” the led command for dividing an led “ i ” in a group “ ffh ,” the panel device that has received the led command turns off the led whose led number is “ j .” further , the host sends the panel device the led control command for setting the intensity of a group “ 01h ” to that of a group “ 00h ” ( minimum value ), and then , two or more of the led commands for dividing required led numbers of leds in the group “ 01h .” finally , the host sends the led control command for setting the intensity of the group “ 01h ” to that of a group “ ffh ” ( maximum value ) so that the leds of the panel device concerned can be turned on at the same time . a keyboard led control command of the host transmitting column is a command used by the host for controlling the intensity of a group to which an led ( performance guiding led ) provided for each key of a keyboard device belongs . the keyboard led control command is represented in such a manner that the transmission destination address is the address “ 0010 aaa ” of the keyboard device whose intensity is controlled ( where “ aaa ” is the sub - address of the keyboard device concerned ), the transmission source address is the address “ 0001 000 ” indicating the host , the data 1 as the index is “ 8xh ,” the data 2 is a group number ( 8 bits ) whose intensity is controlled , the data 3 is an 8 - bit led intensity value as an intensity control value . since “ xh ” is the port number , 16 - port led control commands can be issued . it should be noted here that since the intensity of the group “ 00h ” is the minimum ( equivalent to off ), and the group “ ffh ” is the maximum ( equivalent to on ), the intensity of these groups can not be changed . a keyboard led command of the host transmitting column is a command used by the host for dividing leds provided in the keyboard device among groups . the led command is represented in such a manner that the transmission destination address is the address “ 0010 aaa ” of the keyboard device controlled ( where “ aaa ” is the sub - address of the keyboard device concerned ), the transmission source address is the address “ 0001 000 ” indicating the host , the data 1 as the index is “ 9xh ,” the data 2 represents one of 8 - bit note numbers of keys for which leds are so provided that they are divided among groups , and the data 3 represents one of 8 - bit group numbers among which the leds are divided . since “ xh ” is the port number and the note number is represented in 8 bits , 16 ports × 256 keyboard led control commands can be issued . a mode of control of keyboard leds by the keyboard led control command and the keyboard led command is the same as that of control of panel device leds by the led control command and the led command . since the number of keys of each keyboard device are 256 at the maximum in accordance with the keyboard off command and the keyboard on command , each of port numbers in the keyboard led control command and the keyboard led command , for example , can be used for control of color by preparing two or more colors for each key , or control of led lit - position by providing leds at two or more places on each key . a continuous controller command of the host transmitting command column in the standard protocol is used by the host for controlling the operation value of an electrically - driven volume or wheel in the panel device . the continuous controller command is represented in such a manner that the transmission destination address is the address “ 0011 aaa ” of the panel device controlled ( where “ aaa ” is the sub - address of the panel device concerned ), the transmission source address is “ 0001 000 ” indicative of the host , the data 1 as the index is “ bxh ,” the data 2 represents the kind of controller such as the electrically - driven volume or wheel ( 8 bits ), and the data 3 represents an 8 - bit control value for the electrically - driven controller . since “ xh ” is the port number and the kind is represented in 8 bits , 16 ports × 256 continuous controller commands can be issued . a jog controller command of the host transmitting command column in the standard protocol is used by the host for controlling the operation value of an electrically - driven jog controller such as a rotary encoder in the panel device . the jog controller command is represented in such a manner that the transmission destination address is the address “ 0011 aaa ” of the panel device controlled ( where “ aaa ” is the sub - address of the panel device concerned ), the transmission source address is “ 0001 000 ” indicative of the host , the data 1 as the index is “ cxh ,” the data 2 represents the kind of the electrically - driven jog controller ( 8 bits ), and the data 3 represents a relative value ( in 8 bits ) of two &# 39 ; s - complement numbers for use in controlling the electrically - driven controller . since “ xh ” is the port number and the kind is represented in 8 bits , 16 ports × 256 continuous controller commands can be issued . a 16 - bit continuous controller command of the host transmitting command column in the standard protocol is used by the host for controlling the operation value of the electrically - driven volume or wheel in the panel device . the continuous controller command is represented in such a manner that the transmission destination address is the address “ 0011 aaa ” of the panel device controlled ( where “ aaa ” is the sub - address of the panel device concerned ), the transmission source address is “ 0001 000 ” indicating the host , the data 1 as the index is “ exh ,” the data 2 represents the 8 high - order bits of a control value for the electrically - driven controller , and the data 3 represents the 8 low - order bits of the control value for the electrically - driven controller . since “ xh ” is the port number , 16 - bit continuous controller commands can be issued for 16 ports . next , midi protocol commands shown in fig9 will be described . the midi protocol is a communication protocol capable of being used when the device ( main controller ) of the host type and the device of the midi type communicate with each other . commands in the midi protocol use both the standard data format and the extended data format . in the midi protocol , the commands are shared between host transmission and host reception except that the transmission destination address and the transmission source address are made different between them . in other words , the host receiving commands are such that the transmission destination address is “ 0001 001 ” as the midi protocol address of the host , and the transmission source address is the address of the midi device as the transmitter . on the other hand , the host transmitting commands are such that the transmission destination address is the address of the midi device , and the transmission source address is “ 0001 001 ” as the midi protocol address of the host . for each command of the midi protocol shown in fig9 the transmission destination address and the transmission source address are set in the same manner as stated above . therefore , the following description will be made about only the data format and the data part of each command . a common protocol command in the midi protocol is the same as the common protocol shown in fig7 and therefore , the explanation will be omitted . a system exclusive ( sys ex ) start and continue command and a system exclusive ( sys ex ) end or one packet command are represented in the same data format that is the extended mode of length 17 bytes . the system exclusive ( sys ex ) start and continue command is represented in such a manner that the data 1 is “ 4ih ” as the index indicative of the start and resumption of the system exclusive , and the data 2 through the data 15 transfer data such as timber parameters and sequence data on a byte basis . the system exclusive ( sys ex ) end command is represented in such a manner that the data 1 is “ 5ih ” as the index indicative of the end of the system exclusive or one packet , and in the case of the one packet command , the data 2 through the data 15 transfer one packet of data on a byte basis . in the midi , the start and end of the system exclusive are represented as “ f0h ” and “ f7h ” respectively , while in the e - bus system , the start and end of the system exclusive are represented as “ 4ih ” and “ 5ih ” instead without the use of “ f0h ” and “ f7h .” further , “ ih ” represents the number of midi ports from which the system exclusive is transmitted . a song position ( song pos ) command is a command that indicates the position from which performance is started , and is represented in the standard data format . the song position command is represented in such a manner that the data 1 is “ 6ih ” as the index , the data 2 is the lsb of a pointer of the performance starting position , and the data 3 is the msb of the pointer of the performance starting position . in the midi , a message of the song position pointer is represented as “ f2h ,” and the data 2 and data 3 are made compatible with the message . a midi port select command is to select a current midi port number ( the number of a midi port at which a note - on message and a note - off message are exchanged ), and is represented in the standard data format . the midi port select command is represented in such a manner that the data 1 is “ 7ih ” as the index , the data 2 is “ 00h ” and the data 3 is “ 00h .” for example , if the midi port select command is transmitted from the host to the midi device , the midi device that has received the command sets the current midi port number to “ ih ” contained in the index . in the midi standard , the port select message is not defined ( in an on - board situation , “ f5h ” may be used ). the midi port select command corresponds to the time - piece message function in the midi . two midi - compatible ( note , vel ) commands are compatible with the note - on message and note - off message in the midi , and is represented in the standard data format . in these commands are represented , if the data 1 is “ 8nh ” as the index of note - off in the midi , the data 2 represents a midi - compatible , 8 - bit number of the note that was noted off , and the data 3 represents a midi - compatible , 8 - bit off - velocity , it becomes the note - off command . alternatively , such a command that the data 1 is “ 9nh ” as the index of note - on in the midi , the data 2 represents a midi - compatible , 8 - bit number of the note that was noted off , and the data 3 is “ 00h ” ( zero velocity ) may be used as the note - off command . here , “ nh ” is a midi channel number . a midi - compatible ( note , aft ) command is compatible with a polyphonic key - pressure message in the midi , and is a command capable of sending after - touch information independently provided for each key . the command is represented in the standard data format . in the command , the data 1 is “ anh ” as the index of polyphonic key pressure in the midi , the data 2 represents a note number for use in sending midi - compatible , 8 - bit after - touch information , and the data 3 represents a midi - compatible , 8 - bit touch value . here , “ nh ” is a midi channel number . a midi compatible ( ctnno ., value ) command is compatible with a control change message in the midi , and is represented as a command capable of sending controller information such as a damper , pedal , volume , modulation or wheel . in the command , the data 1 is “ bnh ” as the index of control change in the midi , the data 2 is a midi - compatible , 8 - bit control number indicative of control functions , and the data 3 is a midi - compatible , 8 - bit control value . here , “ nh ” is a midi channel number . a midi compatible ( prgno ., 00 ) command is compatible with a program change message in the midi , and is a command for changing timbres . the command is represented in the standard data format . in the command , the data 1 is “ cnh ” as the index of program change in the midi , the data 2 is a midi - compatible , 8 - bit program number and the data 3 is “ 00h ” because of no need for the program change message in the midi . here , “ nh ” is a midi channel number . a midi compatible ( aft , 00 ) command is compatible with channel pressure in the midi , and is a command for changing timbres . the command is represented in the standard data format . in the command , the data 1 is “ dnh ” as the index of channel pressure in the midi , the data 2 is a midi - compatible , 8 - bit after - touch value and the data 3 is “ 00h ” because of no need for the program change message in the midi . here , “ nh ” is a midi channel number . since this command is to send representative after - touch information , if plural note - on events exist , the after - touch information includes all the note - on events . a midi compatible ( bendl , h ) command is compatible with a pitch bend message in the midi , and is a command for sending information about a pitch bender composed of a wheel and a joystick . the command is represented in the standard data format . in the command , the data 1 is “ enh ” as the index of pitch bend in the midi , the data 2 is the lsb of a midi - compatible , 8 - bit pitch bend value and the data 3 is the msb of the midi - compatible , 8 - bit pitch bend value . here , “ nh ” is a midi channel number . in the midi , statuses “ f0h ” to “ f7h ” are defined except that “ f4h ” and “ f5h ” are undefined . further , as stated above , statuses of the start and end of the system exclusive in the midi , “ f0h ” and “ f7h ” are not used , and they are converted to “ 4ih ” and “ 5ih ” in the e - bus system . similarly , a status “ f2h ” in the midi is converted to an index “ 6xh ” in the e - bus system , or to an index “ 7xh ” in the e - bus system when the status “ f5h ” in the midi is defined as midi time piece . the reason why some of the statuses “ f0h ” to “ f7h ” are converted is that the number of bytes is incremented by one in some of the statues , or specification of a midi port number can be made possible by the increased byte . in the midi standard , it is judged , from the most significant bit of each byte of a message , whether the byte is a status byte or data byte . in contrast , in the above - mentioned midi protocol , the data 1 of the standard data is always a command , which eliminate the need to use the most significant bit for the same purpose . therefore , in the above - mentioned midi protocol , “ 00h ” to “ 7fh ,” which deviate from the midi status bytes , are used as a common protocol command or midi extending command . further , a fi ( midi timecode quarter frame ) command is to send hr / min / sec . information in the midi timecode . the command is represented in the standard data format . in the command , the data 1 is “ fih ” as the index , the data 2 is “ f1h ” indicative of a status of midi timecode quarter frame , and the data 3 represents a midi - compatible , 8 - bit hr / min / sec . value . furthermore , a f3 ( song select ) command is to select a piece of music stored in a memory or storage medium . the command is represented in the standard data format . in the command , the data 1 is “ fih ” as the index , the data 2 is “ f3h ” indicative of a status of song select in the midi , and the data 3 represents a midi - compatible , 8 - bit song number . furthermore , a f6 ( tune request ) command is to tune a midi device with auto - tuning capability . the command is represented in the standard data format . in the command , the data 1 is “ fih ” as the index , the data 2 is “ f6h ” indicative of a status of tune request in the midi , and the data 3 is “ 00h ” because of no need in the midi . furthermore , a system real - time message command is to send a message necessary to be processed in real time . the command is represented in the standard data format . in the command , the data 1 is “ fih ” as the index , the data 2 is any one of “ f8h ” through “ ffh ” indicative of a status of the system real - time message in the midi , and the data 3 is “ 00h ” because of no need in the midi . the data 2 is : here , statuses “ f9h ” and “ fdh ” are undefined , and status “ feh ,” though defined as active sensing , is not used in the e - bus system according to the present invention . in the above - mentioned commands whose data 1 is “ fih ,” “ ih ” represents a midi port number from which the command concerned is sent out . [ 0116 ] fig1 is a flowchart showing an e - bus start - up procedure in the e - bus system according to the present invention . when the e - bus system is switched on ( step s 1 ), power is supplied through four power lines of the e - bus 11 to all the devices connected to the e - bus system . of all the devices , the host ( main controller device 10 ) turns the initial clear line of the e - bus 11 to the l level . as a result , the functions of the devices connected to the e - bus system is stopped and reset , and device hardware is initialized ( step s 2 ). then the host ( main controller device 10 ) turns the initial clear line of the e - bus 11 to the h level to activate the devices connected to the e - bus system . as a result , software in the devices connected to the e - bus system is initialized ( step s 3 ). after that , the host ( main controller device 10 ) makes a general call to transmit the “ e - bus start ” command shown in fig7 ( step s 4 ). upon receipt of the “ e - bus start ” command , each device connected to the e - bus system starts operating to start the operation of the e - bus system . it should be noted that the creation of the above - mentioned table using the category id / sub - address request command in the host type is carried out immediately after the “ e - bus start ” command is sent out . [ 0118 ] fig1 is a flowchart showing host reception processing in the e - bus system according to the present invention . in the host reception processing shown in fig1 , when receiving a signal from the e - bus 11 , the host ( main controller device 10 ) judges in step s 10 whether the transmission destination address received is “ 10h ” or “ 12h .” since this is host reception processing , the transmission destination address in this case becomes the address of the host specified . here , the address of the host judged in step s 10 contains an r / w bit , which is always “ 0 .” if it is judged that the transmission destination address received is “ 10h ” ( equal to “ 0001 0000 ”), since it means that the address of the host for the standard protocol is specified , the procedure advances to step s 11 . in step s 11 , standard protocol reception processing for receiving the transmission source address and the data part consisting of the data 1 to 3 is performed . further , if an effective signal can be obtained , an acknowledge is retuned every byte . in the standard protocol reception processing , the host receives commands such as keyboard off or keyboard on from the keyboard device , or commands such as sw on or continuous controller from the panel device . if it is judged that the transmission destination address received is “ 12h ” ( equal to “ 0001 0010 ”), since it means that the address of the host for the midi protocol is specified , the procedure branches to step s 12 . in step s 12 , midi protocol reception processing for receiving the transmission source address and the data part consisting of the data 1 to 3 or the data 1 through 15 is performed . further , if an effective signal can be obtained , an acknowledge is retuned every byte . after completion of the processing step s 11 or s 12 , the host reception processing is also ended . in the midi protocol reception processing , the host receives midi message commands such as note - on and note - off from the midi input / output device . [ 0121 ] fig1 is a flowchart showing host transmission processing in the e - bus system according to the present invention . in the host transmission processing shown in fig1 , when performing transmission to the e - bus 11 , the host ( main controller device 10 ) judges in step s 20 whether the four high - order bits of the transmission destination address transmitted for addressing are “ 2h ” to “ 4h ” or “ 5h .” since this is host transmission processing , the four high - order bits of the transmission destination address in this case becomes the category id of the transmission destination device addressed by the host . if it is judged that the four high - order bits of the transmission destination address to be transmitted are “ 2h ” to “ 4h ” ( equal to “ 0001 ” to “ 0100 ”), any one of the devices of the keyboard type , panel type or combination keyboard - panel type is the transmission destination device . since the devices of these categories use the standard protocol as their communication protocol as shown in fig5 the procedure advances to step s 21 . in step s 21 , standard protocol transmission processing for adding the standard protocol address “ 0001 000 ” of the host as the transmission source address , and then , transmitting the data part consisting of the data 1 to 3 is performed . in the standard protocol transmission processing , the host transmits , for example , to the panel device , commands such as the led command for turning on the led with the led number i ( the command for dividing the led “ i ” in the group “ ffh ”). if it is judged that the four high - order bits of the transmission destination address to be transmitted are “ 5h ” ( equal to “ 0101 ”), any one of the devices of the midi type becomes the transmission destination device . since the devices of the midi type category use the midi protocol as their communication protocol as shown in fig5 the procedure branches to step s 22 . in step s 22 , midi protocol transmission processing for adding the midi protocol address “ 0001 001 ” of the host as the transmission source address , and then , transmitting the data part consisting of the data 1 to 3 or the data 1 through 15 is performed . after completion of the transmission processing step s 21 or s 22 , the host transmission processing is also ended . in the midi protocol transmission processing , the host transmits , for example , to a midi sequencer , midi message commands such as note - on and note - off . [ 0124 ] fig1 is a flowchart showing keyboard device transmission / reception processing in the e - bus system according to the present invention . in the keyboard device transmission / reception processing shown in fig1 , since the communication protocol is the standard protocol , standard protocol transmission / reception processing is performed in step s 30 . in the standard protocol transmission processing , the standard protocol address “ 0001 000 ” of the host is specified and transmitted as the transmission destination address to be addressed , while the address of its own machine is specified and transmitted as the transmission source address . the address of its own machine is represented in such a manner that the category id is “ 0010 ” and the sub - address is a 3 - bit address set for its own machine . following these addresses , the data part consisting of the data 1 to 3 is transmitted . in the standard protocol reception processing , when the transmission destination address specified for addressing and the address of its own machine coincide with each other , the following transmission source address and the data part consisting of the data 1 to 3 are received . in this case , the standard protocol address “ 0001 000 ” of the host is specified as the transmission source address . in the standard protocol , although the devices of the panel type and combination keyboard - panel type also conduct communication , the transmission / reception processing in this case is the same as the above - mentioned keyboard transmission / reception processing except that the category id is different between them . [ 0128 ] fig1 is a flowchart showing midi device transmission / reception processing in the e - bus system according to the present invention . in the midi device transmission / reception processing shown in fig1 , since the communication protocol is the midi protocol , midi protocol transmission / reception processing is performed in step s 40 . in the midi protocol transmission processing , the midi protocol address “ 0001 001 ” of the host is specified and transmitted as the transmission destination address to be addressed , while the address of its own machine is specified and transmitted as the transmission source address . the address of its own machine is represented in such a manner that the category id is “ 0101 ” and the sub - address is a 3 - bit address set for its own machine . following these addresses , the data part consisting of the data 1 to 3 or the data 1 through 15 is transmitted . in the midi protocol reception processing , when the transmission destination address specified for addressing and the address of its own machine coincide with each other , the following transmission source address and the data part consisting of the data 1 to 3 or the data 1 through 15 are received . in this case , the midi protocol address “ 0001 001 ” of the host is specified as the transmission source address . the host is operative to create a midi note - on message in response to the keyboard on command from the keyboard , controls the creation of a tone in the tone generator unit according to the note - on message , and sends the note - on message to the midi device through the e - bus . when receiving the sw on command from the panel , the host performs various processing according to the kind of the sw on command , such as the selection of sounding timbre data , editing of the timbre data , recording / reproduction of music data for automatic performance , editing of the music data , change in setting of own device and change in setting of each device connected to the e - bus . further , upon selecting timbre data , the host , for example , transmits the led command to the panel device so that an led corresponding to the selected timbre data will be turned on , as well as sending the midi device a program change message corresponding the selection . furthermore , when reproducing music data ( at the time of automatic performance ), the host controls the creation of tones in the tone generator units according to the midi message to be reproduced sequentially , as well as sending the midi device the midi message through the e - bus . in the above description , each led provided in the keyboard or panel device was made to belong to any one of groups , but an led may be made to belong to two or more groups . in such a case , the control value for the led may be the maximum value , minimum value or combined value of the groups to which the led belongs . further , in the above description , the “ host type ,” the “ keyboard type ,” the “ panel type ,” and “ midi type ” were exemplified as devices connected to the e - bus , but any other kind of device may be connected . furthermore , the three protocols , namely the “ common protocol ,” the “ standard protocol ,” and the “ midi protocol ” were exemplified as the data protocols on the e - bus , but any other protocol may be adopted as well . the e - bus system described above and according to the present invention is based on an i 2 c bus , and such points as not to make references to the e - bus system are based on the i 2 c bus standard . the present invention configured as discussed above enables communications through a bus system among devices constituting an electronic musical instrument . in this case , an address inherent in a device as a transmission destination is added to a data signal from a master . the address is composed of category information representative of the category of the device and an sub - address for specifying any one of devices in the same category . thus communications can be carried out among devices of various categories through the bus system . for example , when a new keyboard has been developed for the electronic musical instrument , the new keyboard has only to be connected to the electronic musical instrument bus system to construct an electronic musical instrument provided with a newly developed keyboard . in this case , the devices of the other categories , for example , the devices of the panel type and the host type can be used as they are . further , when a device is added with the addition of a function , the device to be added has only to be connected to the electronic musical instrument to construct an electronic musical instrument with a new device added thereto . therefore , product development costs can be remarkably reduced , and any function can be added in a short time . thus the present invention allows each device to be used in other products , which in turn makes it possible to develop the products on a device basis . according to other aspects of the present invention , the operation / input devices such as the keyboards and panels and the midi devices can be randomly connected to construct the electronic musical instrument . further , major packet lengths exchanged between the operation / input devices such as the keyboards or panels and the midi devices are integrated into the fist predetermined length , which makes it possible to simplify reception processing by each device . furthermore , since only the system exclusive that tends to be longer in byte length is transmitted in the second predetermined length longer than the first predetermined length , communication efficiency of the system exclusive cannot drop . furthermore , the plural visual elements can be controlled at the same time , and if few changes in combination of visual elements to be controlled occur , the number of command issues for controlling the displays can be reduced . in addition , any midi message can be transmitted and received in the electronic musical instrument bus system without affecting the midi message . | 6 |
fig1 shows a work vehicle in the form of a wheel loader 1 . the wheel loader 1 comprises a front 2 and a rear part 3 of the vehicle . the rear part 3 of the vehicle comprises a cab 22 and the vehicle &# 39 ; s driving engine ( not shown ). the wheel loader 1 comprises , in addition , a loading arm unit 6 and a tool 7 , here in the form of a bucket , arranged on the loading arm unit for handling objects and materials . at a first end , the loading arm unit 6 is connected to the first part 2 of the vehicle in such a way that it can move . at the other end of the loading arm unit 6 , the tool 7 is connected to the unit in such a way that it can move . each of parts 2 , 3 of the vehicle has , in addition , a drive shaft 12 , 120 . the parts 2 , 3 of the vehicle are connected to each other in such a way that they can move in relation to each other . the parts 2 , 3 of the vehicle can be rotated in relation to each other around an axis , by means of two first hydraulic components in form of hydraulic cylinders 4 , 5 arranged between the two parts . the hydraulic cylinders 4 , 5 are thus arranged to turn the wheel loader 1 . the loading arm unit 6 can be raised and lowered in relation to the front part 2 of the vehicle by means of two second hydraulic components in form of two hydraulic cylinders 8 , 9 , each of which is attached at one end to the front part 2 of the vehicle and at its other end to the loading arm unit 6 . the bucket 7 can be tilted in relation to the loading arm unit 6 by means of a third hydraulic component in form of a hydraulic cylinder 10 , that is attached at one end to the front part 2 of the vehicle and at its other end to the bucket 7 , via a link arm system that is also connected to the loading arm unit in such a way that it can pivot . fig2 shows , in a simplified drawing , the drive line 13 of the wheel loader 1 . the drive line 13 comprises a combustion engine 14 in the form of a diesel engine , an automatic gearbox 15 and a hydrodynamic torque converter 16 . the gearbox 15 consists of an electrically - controlled automatic gearbox of the “ power - shift ” type . the gearbox 15 comprises a forward and reverse gear 17 . the torque converter 16 is arranged between the engine 14 and the gearbox 15 . an outgoing shaft 19 from the engine 14 thus drives the torque converter 16 . an outgoing shaft 20 from the gearbox 15 is arranged to drive the rear drive shaft 12 , on which the vehicle &# 39 ; s driving wheels 23 are arranged , via a differential gear 21 . fig2 also shows a pump 18 in the vehicle &# 39 ; s hydraulic system that is arranged to provide the hydraulic cylinders 4 , 5 , 8 , 9 , 10 with hydraulic oil . the pump 18 is driven by the outgoing shaft 19 of the engine 14 . fig3 shows a device 25 for controlling the engine 14 and gearbox 15 of the wheel loader 1 . the control device 25 comprises a first control unit 26 ( or ecu ; electronic control unit ) with software for controlling the wheel loader 1 . the control unit 26 comprises a processor and a memory . the control unit 26 is connected to the gearbox 15 for controlling pre - programmed gear modes in response to certain operating parameters . the control device 25 comprises a sensor 27 for detection of the selected forward or reverse gear in the gearbox 15 . the sensor 27 is arranged to generate a signal with this information for the control unit 26 . the control device 25 comprises , in addition , a sensor 32 for detection of the distance that the vehicle has traveled . the sensor 32 can consist of a magnetic pick - up device that detects the movement of a gear tooth in the gearbox , as the speed of rotation of the gear tooth corresponds to the speed of the engine . the sensor 32 is arranged to generate a signal with this information for the control unit 26 . the control unit 26 receives signals from the sensors 27 and 32 , selects a gear mode on the basis of this information and controls the gearbox 15 in accordance with the selected gear mode . the control device 25 comprises , in addition , a gear lever 37 that is operatively connected to the control unit 26 . as an alternative to the sensor 27 being utilized for detection of the selected forward or reverse gear in the gearbox 15 , a sensor 36 can be utilized that detects the position of the gear lever 37 . the sensor 36 is arranged to generate a signal with this information for the control unit 26 . the control device 25 comprises a second control unit 29 , see fig3 , for controlling the speed of the engine 14 via known control means 31 , such as via a fuel pump . the second control unit 29 is functionally ( electrically ) connected to the first control unit 26 and receives information from this concerning the required speed of the engine . in this case , a sensor 33 detects the position of a throttle pedal 38 and generates a signal with information about the position of the throttle pedal for the first control unit 26 . the first control unit 26 thus informs the second control unit 29 about the required engine speed and the second control unit 29 controls the engine speed in a corresponding way . the engine speed is thus increased with increased depression of the throttle pedal . the speed of the engine 14 is detected by a sensor 30 . the sensor 30 is arranged to generate a signal with the engine speed information for the first control unit 26 ( via the second control unit 29 ). the engine speed information is utilized for controlling the gear mode , which will be described in greater detail below . the speed of the vehicle is also detected in a conventional way by the sensor 32 . information about the speed of the vehicle is utilized for controlling the gear mode , which will be described in greater detail below . the control device 25 comprises a plurality of means 35 for controlling the gear modes of the gearbox 15 . these control means 35 are arranged in the gearbox 15 for automatic changing between different gears and are arranged to receive control signals from the first control unit . with reference to fig4 , so - called short - cycle loading for the wheel loader 1 is shown , which wheel loader is equipped with automatic transmission 15 and with software for controlling , among other things , the selection of one of several pre - programmed gear modes on the basis of continuous operating parameter signals that are supplied from the sensors to the first control unit 26 in which the software is installed . the short - cycle loading shown in fig4 is characterized in that the longest distance that the vehicle travels forwards or backwards does not exceed a certain number of meters , in this case of the order of 15 meters . fig5 shows another loading cycle , in which the longest distance that the vehicle travels forwards or backwards lies within a given range . the reference numerals 101 - 104 and 101 ′- 104 ′ in fig4 and 5 respectively relate to load cycles of the wheel loader 1 in the form of four vehicle movements , namely forwards towards and interaction with the material ( gravel or stone ) that is intended to be moved 101 , 101 ′, backwards with the material in the bucket 102 , 102 ′, forwards again to the position ( lorry 105 or stone crusher 105 ′) where the material is intended to be placed 103 , 103 ′, and thereafter backwards 104 , 104 ′ to the initial position . the software in the control unit 26 is arranged to select automatically the mode that at the time is best suited for the work cycle in question . in general , there are four types of work cycle : “ transportation ”, “ load carrying ”, “ close handling ”, and “ short - cycle loading ”. of course , a more or less detailed division can also be carried out , but according to the invention this division is preferred , as it can be considered to be the best compromise at present between accuracy and the number of gear modes that it can be expedient to arrange for an automatic transmission for a vehicle of the type described . it is , however , recognized that completely different limit values can be used for the definition of the different cycles . the different gear modes differ in that changing to the next higher gear is carried out at a relatively lower minimum engine speed , the longer the maximum distance that the vehicle is assumed to travel . this is shown more clearly in fig6 , in which the engine speed is shown in relation to the speed of the vehicle and in which an example of a gear schedule for changing between , for example , 2nd , 3rd and 4th gear is shown . for changing up from 3rd to 4th gear there is a lower changing - up line 111 . this changing - up line is different , is changed , for different gear modes , as shown by the arrow 112 . it is moved , for example , towards a higher engine speed when short - cycle loading is identified and towards a lower engine speed when a transportation cycle has been identified . in other words , the higher the gear mode , the lower the changing - up line . in other words , the line shows the lowest engine speed for changing up to the next higher gear for the respective gear mode . for cycle 1 , that is to say “ transportation ”, the gear mode “ light 1 ” is activated , for which changing up is carried out earlier , that is to say at the lowest engine speed . for “ short - cycle loading ”, the gear mode is activated for which changing up is carried out at the highest engine speed , that is to say the vehicle is driven in relatively low gears as it is not expected that the vehicle will need to change up a gear before the next change of direction is carried out . in accordance with fig6 , the different gear modes also differ in that changing down to the next lower gear is carried out at different minimum speeds for the respective gear modes in association with reducing speed . fig6 shows a changing - down line 113 for changing down from 3rd gear to 2nd gear . the line shows the lowest speed at which changing down is carried out . this changing - down line is different for different gear modes . it is displaced towards a higher vehicle speed when short - cycle loading is identified and is displaced towards a lower speed when a transportation cycle has been identified . in other words , the higher the gear mode , the lower the vehicle speed at which the line is located , as shown by the arrow 114 . the higher the gear mode , starting from “ light 1 ”, that is activated for the working cycle “ transportation ”, the later the changing down , that is to say , the lower the speed before changing down is carried out to the next lower gear . the control unit &# 39 ; s software has a memory for storing the parameter signals that represent the most recent distances driven . how many distances are stored and compared with each other determines the sensitivity of the control unit . a distance driven is defined as the distance driven between two changes of direction . a change of direction is a change from forward gear position to reverse gear position and vice versa . a change of direction is also carried out per definition when starting the vehicle , that is to say also when an initial change is carried out from neutral to any one of the forward or reverse gear positions . by means of the invention , as a result of the control unit &# 39 ; s continual selection of gear mode on the basis of the type of work cycle that is judged to be relevant at the time , the vehicle can adapt its gear - change strategy to the prevailing conditions and in this way can work more efficiently and / or with lower fuel consumption and / or with less environmental damage . for example , unnecessary changing - up is avoided in work cycles of the “ short - cycle loading ” type , which also contributes to smoother running of the vehicle . the invention also relates to a computer program for carrying out the method steps as described above when the program is run on a computer . the program is stored in the control unit &# 39 ; s memory . the computer program could be sent to the control unit 26 via wireless means , for example via the internet . the invention also relates to a computer program product comprising software code stored on a medium that can be read by a computer in order to carry out the method steps when the program is run on a computer . the medium that can be read by a computer can be a floppy disc or a cd - rom . the abovementioned first control unit 26 ( ecu ) is often also called a cpu ( control power unit ) or simply the on - board computer . it is recognized that a plurality of alternative embodiments of the invention will be apparent to an expert within the field . the scope of the invention is not to be limited solely to the embodiment that is described here , but by what is defined in the attached patent claims , supported by the description and the attached drawings . for example , it is reasonable to suppose that the selection of gear mode is not based solely on the measurement of distances between changes of direction , but also on the basis of other operating parameters , such as the gradient of the road , etc . different combinations of operating parameters that form the basis for the selection of gear mode are therefore also covered by the invention . it is also recognized that the signal that represents the operating parameter “ distance driven ” as described in the invention must not be but is preferably directly generated by a sensor for measuring distance . it is quite possible to measure completely different parameters , provided , however , that there is a correlation between these and the distance traveled , in order to select a gear mode , according to the principle described above , on the basis of these . the type of gearbox shown in fig2 is only to be regarded as an example of a gearbox that could be used with the invention . the invention is not limited to controlling gear modes . it could also be possible to control the speed of the engine on the basis of the parameter signal values . in the present application , the use of terms such as “ including ” is open - ended and is intended to have the same meaning as terms such as “ comprising ” and not preclude the presence of other structure , material , or acts . similarly , though the use of terms such as “ can ” or “ may ” is intended to be open - ended and to reflect that structure , material , or acts are not necessary , the failure to use such terms is not intended to reflect that structure , material , or acts are essential . to the extent that structure , material , or acts are presently considered to be essential , they are identified as such . while this invention has been illustrated and described in accordance with a preferred embodiment , it is recognized that variations and changes may be made therein without departing from the invention as set forth in the claims . | 4 |
referring now to fig1 - 4 a rifled launch weapon 10 fires a target activated projectile 12 in a spin stabilized flat trajectory at a distant target 14 . projectile 12 has a pair of diametrically disposed transversely positioned antennae 16 and 18 located in the forward end of projectile 12 scanning a continuously advancing ground search pattern 20 . the projectile is fired from weapon 10 at a muzzle velocity of approximately 1000 feet per second having a spin of approximately 100 revolutions per second . projectile 12 has a double ended warhead 22 operatively disposed therein with a dual ignition system capable of initiating either end of the warhead 22 depending upon a signal generated by logic circuitry contained by a radiometer to be discussed in greater detail hereinafter . double ended warhead 22 is positioned in the projectile 12 so that it will fire in a direction which is transverse to the projectile &# 39 ; s flight axis and in a direction in alignment with the top of the sensed target as shown in fig4 . referring now to fig5 and 6 , the projectile 12 has a forward ogive shaped end 26 and a cylindrically shaped rear end 28 . warhead 22 is operatively positioned intermediate the forward end 26 and the rear end 28 and includes a first and second miznay - shardin type back to back self - forging warhead sections 27 and 29 respectively . the warhead sections 27 and 29 are initiated by peripherially disposed annularly shaped explosive charges 30 and 32 respectively . a radiometer 34 comprises a pair of oppositely disposed antennae 36 and 38 located in forward end 26 and a pair of microwave sensitive receivers 40 and 42 , located in rear end 28 . receivers 40 and 42 have inputs , which are electrically coupled to antennae 36 and 38 via electrical conductors 44 and 46 respectively , which amplify the signals detected by the antennae 36 and 38 . a setback actuated power supply 48 is electrically coupled to receivers 40 and 42 via electrical conductors 50 and 52 respectively and to signal combiner circuit component 54 via electrical conductor 56 . signal combiner 54 upon receiving two substantially similarly sequenced output signals from the output of receivers 40 and 42 , via electrical conductors 58 and 60 , will combine these signals and generate an output signal via electrical conductor 62 to signal processor 64 . signal processor 64 contains analog and digital circuitry for performing target detection and discrimination functions . the signal process 64 operates in response to the output of the signal combiner 54 to provide a &# 34 ; fire &# 34 ; signal via either output leads 66 or 68 which in turn initiates first or second safing and arming devices 70 or 72 . safing and arming devices 70 and 72 activate warhead 22 by initiating detonating fuze cords 74 or 76 respectively depending on the signal received from the signal processor 64 . a self - forging slug , not shown , having a velocity of approximately 8000 feet / second is formed from metal concave shaped liners 78 and 80 contained within the miznay - shardin type double ended warhead 22 . when the projectile is directly over the target , one end of the properly oriented warhead is fired at target 14 . the antennae 36 and 38 are oriented to provide two fixed beams with 180 ° separation in a plane perpendicular to the longitudinal axis 82 and canted 7 ° in a forward direction so that they can search in a direction that the self - forging fragment will fire . the angle at which the self - forging fragment leaves the projectile is given by the equation v 2 = velocity of the fragment and where θ = the angle measured from a perpendicular to the longitudinal axis of the projectile and the path of fragment travel . this angle θ being the angle the sensors look for the target as that in the actual path the warhead fragment will traverse . the portion of the shell skin in front of the antennae includes a pair of transparent radomes 84 , only one of which are shown in fig5 made of such material as reinforced teflon . the antennae 36 and 38 are capable of operating in the 35 gigahertz frequency region , have a 3 db beam width of 7 ° or less , a sidelobe level of - 25 db maximum , a radio frequency loss equal to or less than 1 . 5 db , and a voltage standing wave ratio ( vswr ) of less than 1 . 2 to 1 . 0 . the receivers 40 and 42 operate at 35 ghz , have a noise figure ratio which does not exceed 6 db , a pre - detection bandwidth of 1 ghz and a post - detection bandwidth of 2 . 5 mhz , and an operating range of 20 to 50 meters . radiometers in the present state of art which can meet the aforementioned requirement are available from such companies as aerojet electrosystems co ., airborne instrument laboratories , minneapolis honeywell and the singer co . in operation power supply 48 is activated by the force of setback when projectile 12 is launched from weapon 10 . the projectile 12 is changed from the &# 34 ; safe &# 34 ; condition shown in fig5 to an &# 34 ; armed &# 34 ; condition when rotor members 86 and 88 are rotated 90 ° causing detonators 90 and 92 to change from an out - of - line position to an in - line - position wherein electrical igniting squibs 94 and 96 and explosive leads 98 and 100 are aligned with detonators 90 and 92 respectively to permit initiation of fuze cords 74 and 76 . when antenna 36 or antenna 38 detects a target , the logic circuitry of radiometer 34 is set up such that when the same target is detected by the opposite antenna , signal processor 64 will accept the signal to be processed . the linear distance traveled by the projectile 12 during this interval of time will be approximately 5 feet when the projectile is spinning at a rate of 100 revolutions per second . when for example antenna 36 detects the target 14 first and then antenna 38 sees the same target one half a revolution later the signal processor 64 , one quarter of turn later , will issue a fire signal through electrical conductor 66 which will activate electrical squib 94 and initiate detonator 90 which in turn initiates detonating fuze cord 74 through explosive lead 98 . fuze cord 74 will in turn initiate the miznay - shardin first warhead section 27 through the peripheral annular explosive charge 30 causing a self - forging slug formed from a first - metal concave shaped liner 80 to travel at high speed , 8000 feet per second , toward the target directly underneath projectile 12 , as shown in fig4 . in a similar fashion if antenna 38 detects the target 14 first and antenna 36 confirms the target one half a revolution later , the radiometer 34 one quarter turn later will issue a fire signal through electrical conductor 68 which initiates electrical squib 96 , detonator 92 and detonator fuze 76 through explosive lead 100 and in turn will cause second warhead section 29 to form a self - forging slug from second concave shaped metal liner 78 which would travel the target 14 . the foregoing disclosure and drawings are merely illustrative of the principles of this invention and are not to be interpreted in a limiting sense . i wish it to be understood that i do not desire to be limited to the exact details of construction shown and described for obvious modifications will occur to a person skilled in the art . | 5 |
referring initially to fig1 a system is shown , generally designated 10 , for effecting video surveillance in plural locations 12 and for selectively sending surveillance video , preferably in real time , to one or more requesting clients 14 , which can be mobile or portable clients , via a system hub 16 preferably using wireless transmission principles known in the art . as shown in fig1 at least one respective surveillance video source 18 is disposed in each location 12 . taking the source 18 shown at the top of fig1 as an example , the source 18 includes at least one video camera 20 which generates a video stream or feed composed of video frames . the generated video is sent to a compression module 22 that functions in accordance with the disclosure below to dynamically establish the frame rate and to compress the video . the compressed video is then sent to a transmitter 24 , preferably a wireless transmitter , and if desired is also stored in a local storage 26 . according to the preferred implementation shown in fig1 the transmitter 24 of each video source 18 sends video to the system hub 16 over a wired or wireless link . the hub 16 includes a router 28 that routes video streams to requesting clients 14 using a wireless link . the clients 14 can access the video streams by establishing communication with the hub 16 and authenticating themselves to a conditional access module 30 at the hub 16 . that is , to access a particular stream a client 14 establishes communication with the hub 16 and requests a particular video stream from a client - selected location 12 , with the conditional access module 30 permitting ( or not ) the client 14 to receive the selected stream , depending on the client &# 39 ; s authentication . consequently , access to the surveillance video streams generated by the sources 18 can be controlled by the hub 16 on a client - by - client basis . moreover , the conditional access module 30 can authenticate a source of video by , e . g ., determining whether a source has properly digitally “ signed ” a video stream . in this way , a client can be assured that what he or she is viewing indeed comes from the desired source . with the above discussion in mind , it is to be appreciated that the conditional access module 30 essentially secures the link between source and client . to provide a requested video stream to a properly authenticated client 14 , the hub 16 transmits the video stream over a wireless link to the requesting client 14 . since the link is wireless , the client can be mobile , e . g ., the client can be a portable laptop computer or other computing device that can be borne by a patrolling security guard , e . g ., a data - enabled handset . to this end , each client 14 includes a wireless receiver 32 , a local processor 34 receiving signals from the receiver 32 , and a video monitor 36 that outputs video images . a local storage 38 can also be provided to store video streams . in accordance with the present invention , the system 10 uses wireless data communication techniques such as tdma , cdma , wcdma , or satellite communication systems such as global star ®. in one non - limiting embodiment the system 10 uses code division multiple access ( cdma ) principles and a cdma over - the - air ( ota ) communication air interface , which can include protocols such as are defined in but not limited to is - 95a , is - 95b , wcdma , ix , ixcv , ev and dv , is - 2000 , and others . for instance , the wireless communication systems to which the present invention can apply , in amplification to those noted above , include personal communications service ( pcs ) and the following digital systems : cdma , wcdma , and hybrid time division multiple access ( tdma )/ cdma technologies . a cdma cellular system is described in the telecommunications industry association / electronic industries association ( tia / eia ) standard is - 95 . other communications systems are described in is - 98 and in the international mobile telecommunications system 2000 / universal mobile telecommunications systems ( imt - 2000 / um ), standards covering what are referred to as wideband cdma ( wcdma ), cdma2000 ( such as cdma2000 1 × or 3 × standards , for example ) or td - scdma . the present invention can be used with any wireless system . in general , wireless communication devices which can be incorporated in , e . g ., each client 14 may include but are not limited to a wireless handset or telephone , a cellular phone , a satellite phone , a data transceiver , or a paging and position determination receiver , and can be hand - held , or portable as in vehicle - mounted ( including cars , trucks , boats , planes , trains ), as desired . however , while wireless communication devices are generally viewed as being mobile , it is to be understood that the present invention can be applied to “ fixed ” units in some implementations . also , the present invention applies to data modules or modems used to transfer voice and / or data information including digitized video information , and may communicate with other devices using wired or wireless links . further , commands might be used to cause modems or modules to work in a predetermined coordinated or associated manner to transfer information over multiple communication channels . wireless communication devices are also sometimes referred to as user terminals , mobile stations , mobile units , subscriber units , mobile radios or radiotelephones , wireless units , or simply as “ users ” and “ mobiles ” in some communication systems . [ 0025 ] fig2 and 3 illustrate the structure of the logic of the compression module 22 as embodied in computer program software . those skilled in the art will appreciate that the flow charts illustrate the structures of logic elements , such as computer program code elements or electronic logic circuits , that function according to this invention . manifestly , the invention is practiced in its essential embodiment by a machine component that renders the logic elements in a form that instructs a digital processing apparatus ( that is , a computer , controller , processor , etc .) to perform a sequence of function steps corresponding to those shown . in other words , the logic may be embodied by a computer program that is executed by a processor within , e . g ., the video source 18 as a series of computer - or control element - executable instructions . these instructions may reside , for example , in ram or on a hard drive or optical drive , or the instructions may be stored on magnetic tape , electronic read - only memory , or other appropriate data storage device that can be dynamically changed or updated . commencing at block a in fig2 an indication of motion in a location 12 is received . this indication might come , for example , from a motion sensor 39 ( fig1 ) that is disposed in the location 12 and that communicates with the module 22 . more preferably , the indication of motion is derived from the video image itself , as discussed further below in reference to fig3 . at block b of fig2 the video frame rate can be established , if desired , based on the amount of motion in the location 12 . that is , the more motion , the faster the rate . when little or no motion is sensed , the video frame rate can be minimized to minimize the bandwidth requirements imposed on the wireless transmission system . the video is then compressed after the frame rate is established . [ 0028 ] fig3 shows one exemplary , non - limiting method to establish a video frame rate based on motion . commencing at block 40 , the frame rate can be initialized at a nominal value , e . g ., at a minimum rate . then , plural frames can be received at block 42 for comparison . the frames to be compared can be individual frames , either immediately adjacent to each other in the video stream or separated from each other by other frames . or , frame composites can be used , i . e ., the average pixel values from “ n ” frames can be compared on a pixel - by - pixel basis against the average pixel values from the preceding “ n ” frames . in undertaking the comparison , the entire pixel array can be considered , or only regions of the array , with a single frame rate being established or with different frame rates for different regions of the array being established , respectively . decision diamond 44 represents one comparison that can be made . specifically , at decision diamond 44 it is determined whether the values for a predetermined number of pixels have changed . other heuristics can be used , however , to determine whether motion exists in the location 12 based on a frame - to - frame comparison . for instance , motion might be indicated only if a threshold percentage of pixels has changed in each of three or more successive frames . if the test at decision diamond 44 is positive , meaning that motion above a predetermined threshold has been sensed , the logic moves to block 46 to increase the frame rate of the entire frame or , if regions of the frame are being compared , of the respective region . the frame rate can be increased by a single discreet value or it can be increased in proportion to the amount of motion sensed , i . e ., in proportion to the number of pixels that have changed . additional frames can be received at block 48 and compared to each other at decision diamond 50 to determine whether motion has stopped or otherwise fallen below a predetermined threshold . for example , it can be determined whether less than a predetermined number of pixels has changed , and if so the frame rate is decreased at block 52 . fig3 shows that the logic continues to loop as the video stream is generated . electronic or paper billing documents can subsequently be generated to bill a client 14 for receiving video feeds . the billing information can be collected by the hub 16 and securely transmitted to a billing authority . while the particular surveillance system and method with adaptive frame rate as herein shown and described in detail is fully capable of attaining the above - described objects of the invention , it is to be understood that it is the presently preferred embodiment of the present invention and is thus representative of the subject matter which is broadly contemplated by the present invention , that the scope of the present invention fully encompasses other embodiments which may become obvious to those skilled in the art , and that the scope of the present invention is accordingly to be limited by nothing other than the appended claims , in which reference to an element in the singular is not intended to mean “ one and only one ” unless explicitly so stated , but rather “ one or more ”. all structural and functional equivalents to the elements of the above - described preferred embodiment that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and are intended to be encompassed by the present claims . moreover , it is not necessary for a device or method to address each and every problem sought to be solved by the present invention , for it to be encompassed by the present claims . furthermore , no element , component , or method step in the present disclosure is intended to be dedicated to the public regardless of whether the element , component , or method step is explicitly recited in the claims . no claim element herein is to be construed under the provisions of 35 u . s . c . § 112 , sixth paragraph , unless the element is expressly recited using the phrase “ means for ” or , in the case of a method claim , the element is recited as a “ step ” instead of an “ act ”. | 6 |
the diaphragm means shown in fig1 comprise a first diaphragm plate 1 ( height - limiting ) and a diaphragm assembly ( width - limiting ) consisting of two rectangular diaphragm plates 2 . the diaphragm means screens stray radiation from the film surfaces not to be exposed , and defines the boundaries of an exposure field by imaging its edges on the film . therefore , in the spot - film device 3 ( shown schematically ), the diaphragms are located in planes parallel to each other immediately in front of the film ( not shown ). reference numeral 4 designates the exposure field . this field is the surface in the film plane on which the radiation beam is incident . the maximum possible exposure field , for example 35 × 35 cm , is shown in the drawing . the horizontal center line of the exposure field is designated by reference numeral 41 and the vertical center line is designated by reference numeral 42 . the smaller exposure fields which can be produced with the diaphragm are also symmetrical to the center lines 41 and 42 . the distance between the facing vertically extending longitudinal sides of the two rectangular diaphragm plates 2 determines the width of the exposure field . the diaphragm plates 2 , arranged symmetrically with respect to the vertical center line 42 , are connected to a toothed belt 21 . belt 21 is passed across rollers 22 and 23 , which are secured to the lefthand lower side and to the righthand lower side , respectively , of the spot - film device roller 23 can be driven by a motor 24 . the lefthand diaphragm plate 2 is connected to the part of the toothed belt 21 extending above the rollers , while the righthand diaphragm plate 2 is connected to the part of the toothed belt 21 below the rollers 22 and 23 . as a result , the diaphragm plates 2 are moved horizontally in opposite directions . plates 2 are moved but invariably over the same distance , toward each other when the roller 23 is driven by the motor 24 in clockwise direction . they are moved away from each other when roller 23 is driven counterclockwise . the diaphragm 1 , like the diaphragm plates 2 , preferably consists of lead . plate 1 is connected to a toothed belt 11 , which is passed across rollers 12 and 13 secured to the spot - film device . the roller 13 is driven by a motor 14 . in this manner , the diaphragm 1 can be displaced in the horizontal direction . the diaphragm 1 has three rectangular sections 15 , 16 and 17 , which are arranged symmetrically with respect to the horizontal center line 41 . the rectangular sections join each other directly so that there is no strap between them . the section 17 has a height of , for example , 12 cm . that is , the horizontal diaphragm plates limiting section 17 each extend a distance of 6 cm from the horizontal center line 41 . section 17 has a width of , for example , 15 cm . the section 16 has a height of 9 cm and a width of 12 cm , while the section 15 has a height of about 4 . 5 cm and a width also of about 12 cm . the edges of the sections 15 , 16 and 17 consequently have the form of a staircase ascending in clockwise direction above the center line 41 and descending in the same direction below the center line 41 . in the drawing , the three sections are limited on both sides by the material of the plate , but essentially the plate could be open on the left hand or the righthand side . if the width of the exposure is to be adjusted , the motor 24 is merely switched on and the plates 2 are moved into the radiation path until the desired width is obtained . if , moreover , the height of the exposure is to be adjusted , the diaphragm 1 is also moved into the radiation path until the center of the section of the desired height coincides with the vertical center line 42 . the diaphragm plates 2 are then moved toward each other so that the width of the field limited by them is not larger than the width of the corresponding section of diaphragm 1 . however , the diaphragm plates 2 may also be moved still further toward each other . if , for example , a film format of 24 × 30 cm horizontal ( the term &# 34 ; horizontal &# 34 ; means that the longer side extends in horizontal direction ) should be subdivided four times ( twice in the direction of height and twice in the direction of width ), the diaphragm 1 is moved in a counterclockwise direction until the center of the section 17 coincides with the vertical center line 42 . the diaphragm plates 2 are moved toward each other over such a distance that their distance is about 15 cm . if instead a format of 24 × 24 cm should be subdivided four times , the diaphragm 1 is moved into the same position , but the diaphragm plates 2 are moved closer toward each other because the width of the exposure field must become smaller . it appears from this example that the width of a section 17 is not determinative of the diaphragm aperture . the width of a section must therefore be chosen so that it is larger than or as large as the maximum width of the format of the exposure ( in the example chosen about 15 cm ). if the width is chosen to be larger , the requirements imposed on the accuracy of positioning the diaphragm 1 become less stringent . however , as a result , the occupied space and the weight of the diaphragm 1 become larger . if an exposure of 18 × 24 cm horizontal should be subdivided four times , the diaphragm 1 is moved in counterclockwise direction until the center of the section 16 coincides with the vertical center line 42 . the diaphragms 2 are moved toward each other in a corresponding manner . with colon exposures , in which the format of 18 × 24 cm horizontal should be subdivided eight times ( twice in the direction of width and four times in the direction of height ), the section 15 is moved toward the center line 42 . it is advantageous that subdivisions of different heights are possible without it being necessary to exchange a plate or a cone , which in fact is not possible in given examination methods . fig2 schematically shows a control circuit for the motor 14 , which moves the diaphragm 1 . the motor 14 , which according to fig1 moves the diaphragm 1 in the horizontal direction via a toothed belt 11 , at the same time displaces the tap of a potentiometer 18 . the tap is coupled with , for example , the roller 13 . the potentiometer is connected to a voltage u . the voltage at the tap of the potentiometer 18 is therefore a measure of the instantaneous position of the diaphragm 1 . in a control amplifier 19 , the voltage at the tap of the potentiometer 18 , which corresponds to the actual position value , is compared with a reference position value . the reference is supplied by a reference value generator 20 in the form of a direct voltage . the reference value generator 20 may be a suitable resistance voltage divider . essentially , however , the reference value may also be supplied by a microprocessor through a digital - to - analogue converter . the motor 24 is controlled correspondingly , as is known per se from u . s . pat . no . 3 , 875 , 411 ( corresponding to german offenlegungsschrift no . 2248101 ). | 6 |
here , a general outline of the invention will be described using fig1 illustrating the photomask configuration according to an embodiment of the present invention . subsequently , a first manufacturing method of the photomask will be described using fig5 a to 5 d and fig6 a to 6 d illustrating the mask manufacturing processes by following the cross sectional configuration of mask main parts . the photomask is comprised of a glass substrate 1 such as silica glass , a phase shifter material 2 transparent to exposure light , and a half tone material 3 which attenuates the exposure light . here , “ transparent ” means a condition which transmits 70 % or more of the exposure light , and generally 90 % or more of the exposure light . also , here , “ attenuation of light ” means that the light transmittance is equal to or less than 25 %. however , light transmittance within the range of from 4 % to 9 % provides a required resolution and is also desirable in preventing so - called sub peak transfer . sub peak transfer is a phenomenon that light enters a field region to which pattern transfer should not occur from surrounding patterns and interference of light occurs to cause light spots resulting in the formation of abnormal patterns . the area at which half torn material 3 has been formed forms a field 4 . a main pattern is formed by an opening 5 . a rim region 6 is formed outside of and formed to come in contact with the opening of main pattern 5 . this rim region 6 is formed from the glass substrate and the transparent phase shifter material . therefore , exposure light 8 , which passes thorough the field region , passes thorough the glass substrate , the transparent shifter material and the half tone material . exposure light 9 , which passes thorough the rim region , passes thorough the glass substrate and the transparent shifter material . exposure light 7 , which passes through opening 5 or the main pattern , passes through only the glass substrate . here , transparent shifter material 2 may be a transparent film , for example , sog ( spin on glass ) or sio 2 film formed by cvd ( chemical vapor deposition ), which has been laminated on the glass substrate and also may be the glass substrate itself namely , the glass substrate may be partially trenched and the resultant film thickness difference may be utilized to provide such a function . in the case of forming a film , there may be provided an advantage that an etching selection ratio of the film to the glass substrate may be obtained and the film thickness controllability may be improved , thereby improving the phase controllability . on the other hand , in the case of trenching the glass substrate , there is provided an advantages that blank material cost is low and the problem of the resistance to exposure light irradiation is not induced . the film thickness of transparent phase shifter material 2 is adjusted such that exposure light 7 passing through the main pattern region and exposure light 9 passing through the rim region will have opposite phases , namely there will be a phase difference of 180 ° or an odd multiple of 1800 therebetween . the phase difference is set to 180 ± 5 ° and , in the case there is a need for excellent dimension controllability , to within 180 ± 2 °. the film thickness that inverts the phase is λ /( 2n 1 − 1 ), wherein the refractive index of the transparent phase shifter material with respect to exposure light is n1 and the - wavelength of the exposure light is λ . also , the film thickness of half tone material 3 and the refractive index n 2 of the film of half tone material 3 with respect to exposure light are adjusted such that exposure light 8 passing through the field region and the exposure light passing through the rim region have opposite phases , similarly . the phase difference is set to 180 ± 5 ° and , in the case there is a need for excellent dimension controllability , to within 180 ± 2 °. a 180 ° phase inversion occurs in the case where the film thickness of half tone material is λ /( 2n 2 − 1 ). in this case , there is no phase difference between the exposure light passing through the field region and the exposure light passing through the main opening pattern region , and therefore these lights are in phase ( 0 °). the width of the rim region is set to from ⅙ to ⅓ of the width of the main pattern . in the case where the width of the rim region is greater or smaller than this range , the contrast is decreased when forming a micro - pattern with a dimension of approximately one half the exposure light wavelength . this mask is irradiated with oblique - incident exposure light 10 . the oblique - incident illumination of exposure light may be realized by annular illumination , quadrupole illumination , double - pole illumination or the like . the exposure light passed through the field region and the exposure light passed through the main pattern region interfere with each other to generate an optical image which does not have a sufficient contrast but has a low defocus dependency . the exposure light from the rim region having an inversed phase interferes with the light passed through the main pattern region and a slight amount of light leaked from the field region to increase the contrast of the optical image . as a result , light exposure may be carried out with a high resolution and a light exposure margin . further , in this mask configuration , since the half tone region and the transparent phase shifter region are formed in order to constitute gradual steps , the walls of the respective steps are relatively short , which reduces degradations of optical images due to side wall reflection . thus , transfer with a high contrast and high resolution may be carried out . next , the method for manufacturing this mask will be described using fig5 a to 5 d and fig6 a to 6 d . first , as illustrated in fig5 a , half tone film 3 is formed on glass substrate 1 . here , half tone film 3 is formed such that the aforementioned transmittance and phase difference are provided . a resist 11 is formed thereon and then a desired pattern is drawn by an electron beam 12 or light . then , as illustrated in fig5 b , development is performed to form a resist pattern 13 . then , as illustrated in fig5 c , the half tone film and the glass substrate are partially etched using resist pattern 13 as the mask to form openings 14 in the halftone film and the glass substrate . then , as illustrated in fig5 d , resist 13 is removed . subsequently , as illustrated in fig6 a , a resist 15 is applied . then , a larger region including the main pattern is drawn by an electron beam 16 or light . then , development is performed to form a resist pattern 17 having an opening area larger than main pattern 14 so that the rim region outside of the main pattern is exposed , as illustrated in fig6 b . then , as illustrated in fig6 c , the half tone film is etched using resist pattern 17 as the mask . finally , as illustrated in fig6 d , resist pattern 17 is removed and cleaned . as described above , the mask consisting of field region 4 , rim region 6 and main pattern region 5 was manufactured . the mask included no micro - partition - wall pattern having a width smaller than 100 nm on the mask . the formed pattern had at minimum a line width of 120 nm on the mask and there was caused no problem of pattern abrasions . further , the mask included no micro - opening pattern having a line width of 200 nm or the like , which enabled visual defect inspection . further , any quasi - defect was not observed . exposure and transfer evaluations were performed for this mask using an arf scanner with an na of 0 . 78 . for hole patterns with a diameter of 90 nm , the depth of focus was 250 nm or more for 190 nm pitch to complete isolation . further , there was no resolution defect caused by the shortage of the depth of focus . further , the mef was appropriately 1 and there was no problem of mask accuracy . the width of the rim region was set to 25 nm . however , the aforementioned depth of focus was ensured for the rim region width range of from 20 nm to 35 nm . the rim region width had a small influence on the transferred dimension and thus the mask had excellent controllability . further , the formed hole patterns had a dimension of 90 nm , but the opening width ( w 1 in fig4 b ) of the main opening portion was 440 nm on the scale on the mask ( 110 nm on the scale on the wafer ). a second embodiment will be described using fig7 a to 7 e . according to the present embodiment , there is provided a simplified mask manufacture method . first , as illustrated in fig7 a , half tone film 3 and a resist pattern 13 are formed on glass substrate 1 . here , similarly to the first embodiment , half tone film 3 is formed such that the aforementioned transmittance and phase difference are provided . then , as illustrated in fig7 b , the half tone film is etched using resist pattern 13 as the mask , and subsequently , as illustrated in fig7 c , the glass substrate is etched to form opening portions 14 with a desired main pattern . the etching depth of the glass substrate is selected to satisfy the aforementioned condition which inverts the phase of exposure light relative to that at the glass substrate surface . then , as illustrated in fig7 d , a selective isotopic etching is applied to the half tone film to form a half tone pattern 18 recessed by the amount of desired rim width . then , resist pattern 13 is removed and cleaned . as described above , there was manufactured a mask consisting of field region 4 , rim region 6 and main pattern region 5 as illustrated in fig7 e in which field portion 4 and main pattern portion 5 a are in phase and the rim portion is in an opposite phase . this manufacturing method includes a single drawing process , and a mask having a reduced misalignment between the main pattern and the rim pattern was manufactured . the reduced drawing process provided advantages of low cost and short manufacture tat ( turn around time ). this was effective in manufacturing soc which requires tat , since manufacture of 90 nm - diameter - lsis requires approximately 12 hours to 24 hours drawing time . a third embodiment will be described with reference to fig8 a to 8 e illustrating a wafer process flow . in this embodiment , a mask including a larger ( broadened ) opening portion of the main pattern , based on the photomask illustrated in the first embodiment , was employed . more specifically , while in the first embodiment the width of the opening portion ( w 1 in fig4 b ) of the main hole pattern was set to 440 nm on the mask , in this embodiment a mask having an opening portion with a width of 520 nm ( 130 nm on the scale on the wafer ) was employed . here , the minimum pattern pitch was 200 nm on the wafer , and thus 800 nm on the mask . the rim width ( w 2 in fig4 b ) was set to 100 nm on the scale of mask ( 25 nm on the scale on the wafer ). thus , the minimum half tone pattern width between the patterns ( w 3 in fig4 b ) was 80 nm on the mask . even though the half tone pattern width was 80 nm and was fine , the distance to an adjacent pattern ( w 1 + w 2 + w 2 in fig4 b ) was 720 nm on the mask , and thus abrasions of the fine half tone pattern did not occur . abrasions may occur during wet cleaning processes . however , there was a large distance between patterns , which weaken capillary forces ( capillary forces caused by interfacial tensions ) which generate during drying in the cleaning process . furthermore , the mask included no micro - width pattern such as patterns smaller than 200 nm , which enabled visual mask inspections . further , quasi - defects were not generated . on the other hand , in the case of an ol - psm including field regions and main pattern portions formed to be in phase for exposure light , the main opening pattern was broadened to 80 nm on the mask as in the present embodiment , and accordingly the half tone partition wall pattern width ( d 2 in fig3 b ) and the secondary pattern width ( d 3 in fig3 b ) were 70 nm and 140 nm , respectively , on the mask . since there is a short distance of 140 nm between adjacent half tone partition wall patterns , large capillary forces acted thereon , causing abrasions during mask cleaning . further , since micro - patterns with widths of 70 nm , 140 nm and 70 nm were aligned adjacent to one another , visual mask inspections could not be performed . as illustrated in fig8 a , a photoresist 84 formed on a wafer 82 was exposed to light using a photomask 81 according to the present embodiment . the light exposure was performed through a projection lens . here , an oblique - incident illumination 85 was employed as an illumination . this mask improves the resolution and the light exposure margin when it is irradiated with oblique - incident illumination . here , ⅔ annular illumination was employed as the oblique - incident illumination . alternatively , quadrupole illumination or double - pole illumination may be employed depending on the pattern layout . further , in fig8 a to 8 e , a coating type antireflection film was employed as an antireflection film 83 . also , antireflection film 83 may be an antireflection film formed by cvd . in the case where there is low reflection at the substrate , this antireflection film may be eliminated . then , as illustrated in fig8 b , a resist pattern 86 was formed by performing a development . the hole pattern 87 had a dimension of 110 nm and was larger than the desired dimension 90 nm . since the hole had a larger dimension , the light exposure margin was further improved over the first embodiment . thus , the depth of focus was 300 nm for a 200 - nm - pitch pattern to an isolated pattern . then , as illustrated in fig8 c , a film 88 which forms a mixing layer with the resist when subjected to heat treatment is formed by coating , and then heat treatment was performed . then , development was performed to form a mixing layer 89 surrounding resist pattern 86 to narrow the pattern opening , as illustrated in fig8 d . then , as illustrated in fig8 e , antireflection film 83 was etched to form a resist pattern 90 having a desired hole diameter . the series of hole reduction procedures are called as a hole shrink . in this case , the hole diameter was 90 nm and the minimum pattern pitch was 200 nm . as previously described , the depth of focus was 300 nm . there was no mask defect generated , and also mask defect inspections could be performed , which increased the yield . also , this method was employed to form a pattern with a hole diameter of 80 nm and a minimum pitch of 180 nm . in this case , the depth of focus was 250 nm . while in this embodiment , a method which applies a film which mixes with the resist was employed for the hole shrink , formation of micro - patterns could be achieved by other various methods as follows ; a method which heats the resist in the presence of oxygen to cause cross - linking in order to leave a film , a method which forms a heat shrinkable film by coating and then performs heat treatment to pull the soften resist pattern , and a method which simply performs a heat treatment to cause the resist to flow in order to achieve a hole shrink . the simple heat treatment method has an advantage of ease and low material cost . with the heat shrinkable film coating method , the hole is shrunk depending on the volume of the heat shrinkable film embedded in the hole , and larger patterns shrink largely and smaller patterns shrink little . thus , the pattern dimensions were made nearly constant , and therefore this method was preferable in improving the dimension accuracy . as the heat shrinkable film , a polyvinylpyrrolidone resin - based resin or material may be utilized . an example of application of the present technique to a logic lsi will be described using fig9 and 11 . fig9 , and 11 illustrate the pattern layouts of a logic section , sram ( static random access memory ) memory cell section , and a sram peripheral circuit section , respectively . in these figures , a diffusion layer ( active region ) 101 , a gate wiring 102 , a contact hole ( conducting hole ) 103 , 104 and 105 are disclosed . for 65 - nm nodes , the minimum contact diameter was 90 nm , and the minimum pattern pitch was 200 nm . the present light exposure technique was applied to only the contact holes . the logic section has a relatively small distance between contact holes 103 , the sram memory cell section includes rectangular holes 104 , and the sram peripheral circuit section includes dense contact holes 105 . these contact holes were all formed with a dimension accuracy of ± 11 nm and a high yield . with a conventional half tone phase shift method , pattern resolution was not achieved , and with an ol - psm method , the problem of mask defect was not overcome . a custom lsi was manufactured using a photomask according to a fourth embodiment . the present photomask was applied to a contact hole layer forming process for establishing an electric connection with a diffusion layer and a first via hole layer forming process for establishing an electric connection between a gate wiring and a first wiring layer . a five - layers wiring custom lsi was manufactured and for formation of the via hole layers other than the first via hole layer for establishing connections with other wiring layers , a conventional half tone phase shift mask was employed in which there was a phase difference ( for exposure light ) of π between the field region and the main pattern region . for formation of the contact layer , a mask according to the second embodiment which offers high resolution was employed since the hole diameter is 90 nm and so small . for formation of the first via layer , a mask according to the second embodiment was employed in order to ensure a sufficient light exposure contrast , since the minimum diameter was 100 nm and thus relatively large , but it was necessary to process a thick interlayer film and accordingly a resist film thickness of 300 nm was required . for forming the via layers other than the first via layer , a half tone phase shift mask excellent in the mask manufacture tat was employed since it is subjected to many customer specification changes as a custom device , requiring a mask tat . with this method , it becomes possible to manufacture a custom lsi with a minimum diameter of about 90 nm . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of the present invention being limited only by the terms of the appended claims . | 6 |
adsorbents to be used in the process of this invention will comprise specific crystalline aluminosilicates or molecular sieves , namely x and y zeolites . the zeolites have known cage structures in which the alumina and silica tetrahedra are intimately connected in an open three dimensional network to form cage - like structures with window - like pores . the tetrahedra are cross - linked by the sharing of oxygen atoms with spaces between the tetrahedra occupied by water molecules prior to partial or total dehydration of this zeolite . the dehydration of the zeolite results in crystals interlaced with cells having molecular dimensions and thus the crystalline aluminosilicates are often referred to as &# 34 ; molecular sieves .&# 34 ; in hydrated form , the x and y zeolites used in the process of this invention have the structure described and defined in u . s . pat . nos . 2 , 882 , 244 and 3 , 130 , 007 , respectively , incorporated herein by reference thereto . the x or y zeolites in the hydrated or partially hydrated form can be represented in terms of moles of metal oxides as shown , respectively , by formulas 1 and 2 below : ## str1 ## where &# 34 ; m &# 34 ; is at least one cation having a valence not more than 3 , &# 34 ; n &# 34 ; represents the valence of &# 34 ; m &# 34 ;, &# 34 ; w &# 34 ; is a value from 3 to 6 and &# 34 ; y &# 34 ;, representing the number of moles of water , is a value up to about 9 depending upon the identity of &# 34 ; m &# 34 ; and the degree of hydration of the crystal . the cation &# 34 ; m &# 34 ;, as the zeolite is initially prepared , is usually predominately sodium , but for the purpose of this invention , the sodium may be replaced with calcium , barium , or potassium cations by ion exchange methods well known to those having ordinary skill in the field of crystalline aluminosilicates . such methods are generally performed by contacting the zeolite or an adsorbent material containing the zeolite with an aqueous solution of the soluble salt of the cation or cations desired to be placed upon the zeolite . after the desired degree of exchange takes place , the sieves are removed from the aqueous solution , washed , and dried to a desired water content . the adsorbent may be supported by an inorganic matrix material such as silica , titania , or alumina or mixtures thereof , or compounds , such as clays , which material is present in intimate mixture with the small particles of the zeolite material . this matrix material , or binders , typically in amounts ranging from 2 - 25 wt .%, aids in forming or agglomerating the particles and may be an adjunct of the manufacturing process for zeolite , ( for example , intentionally incomplete purification of either zeolite during its manufacture ) or it may be added to relatively pure zeolite . normally , the adsorbent will be in the form of particles such as extrudates , aggregates , tablets , macrospheres or granules having a desired particle size range . the typical adsorbent will have a particle size range of about 16 - 60 mesh ( standard u . s . mesh ). although it is not clear what properties of the adsorbent are responsible for the dcdps separation herein described , it appears that it cannot be attributed to pore size selectivity alone . since the isomers being separated are of similar size , it appears that steric factors as well as electrostatic attraction action may play an important role in the separation . while it is not possible to conclusively set forth the molecular interaction responsible for the adsorption , one possible explanation is higher polarity of the minor isomers compared to that of the 4 , 4 &# 39 ;- isomers . therefore , both electrostatic interaction as well as physical considerations may provide the mechanism for this separation . we have found that either x or y zeolites with sodium , potassium , calcium or barium cations and amorphous binders possess the selectivity and other necessary requirements for use in our process ; however , a potassium exchanged y type zeolite is particularly preferred , because it is also possible to use the same desorbent in a second pass to separate the two extract components , 2 , 4 &# 39 ;- dcdps in a second stage , with especially advantageous results at a temperature of 180 ° c . in this process , and particularly the preferred continuous simulated moving bed process , the desorbent must be selected to satisfy the following criteria : first , the desorbent material should displace an extract component from the adsorbent with reasonable mass flow rates without itself being so strongly adsorbed as to unduly prevent an extract component from displacing the desorbent material in a following adsorption cycle . secondly , the desorbent material must be compatible with the particular adsorbent and the particular feed mixture . more specifically , it must not reduce or destroy the critical selectivity of the adsorbent for an extract component with respect to a raffinate component . the desorbent should additionally be easily separable from the feed mixture that is passed into the process . both the raffinate stream and the extract stream are removed from the adsorbent in admixture with desorbent material and without a method of separating at least a portion of the desorbent material , the purity of the extract product and the raffinate product would not be very high nor would the desorbent material be available for reuse in the process . it is , therefore , contemplated that any desorbent material used in this process will preferably have a substantially different average boiling point than that of the feed mixture , i . e ., more than about 5 ° c . difference , to allow separation of at least a portion of desorbent material from feed components in the extract and raffinate streams by simple fractional distillation , thereby permitting reuse of desorbent material in the process . finally , desorbent materials should also be materials which are readily available and , therefore , resonable in cost . however , a suitable desorbent or desorbents for a particular separation with a specific adsorbent are not always predictable . in the preferred isothermal , isobaric , liquid - phase operation of the process of my invention , i have found that desorbent material comprising an alcohol having 4 to 8 carbon atoms will result in selectivity for the adsorbed dcdps isomers when used with the above discussed adsorbents . the combination of kx or ky adsorbent and pentanol diluted with about 0 - 80 wt .% toluene was found to be most effective in separating the dcdps isomers . feed mixtures which can be utilized in the process of this invention will comprise a mixture of at least two isomers of dcdps , which have the structure : ## str2 ## potential feed mixtures containing substantial quantities of 4 , 4 &# 39 ;- dcdps will typically contain 2 , 4 &# 39 ;- and 3 , 4 &# 39 ;- dcdps as well . such mixtures may also contain significant quantities of other impurities . a typical feed mixture for this invention is a crystallization residue of the crude reaction mixture and will contain from 51 - 75 %, 4 , 4 &# 39 ;- dcdps , 21 - 37 . 6 %, 2 , 4 &# 39 ;- dcdps and 4 - 11 . 0 % ( by wt .) 3 , 4 &# 39 ;- dcdps . the invention is applicable to other feed mixtures , including crude reaction products containing approximately 95 - 98 % 4 , 4 &# 39 ;- dcdps , 1 - 2 %, 3 , 4 &# 39 ;- dcdps and 1 - 4 % 2 , 4 &# 39 ;- dcdps . although both liquid and vapor phase operations can be used in many adsorptive separation processes , liquid - phase operation is preferred for this process because of the lower temperature requirements and because of the higher yields of extract product that can be obtained with liquid - phase operation over those obtained with vapor - phase operation . adsorption conditions will include a temperature range of from about 20 ° to about 200 ° c . with about 100 ° to about 180 ° c . being more preferred and a pressure sufficient to maintain liquid phase , ranging from about atmospheric to about 500 psig with from about atmospheric to about 25 psig being preferred . desorption conditions will include the same range of temperatures and pressures as used for adsorption conditions . at least a portion of the raffinate stream , which contains the concentrated 4 , 4 &# 39 ;- dcdps product , and preferably at least a portion of the extract stream , from the separation process are passed to separation means , typically fractionators or evaporators , where at least a portion of desorbent material is separated to produce a raffinate product and an extract product , respectively . a static test procedure and apparatus may be employed to test various adsorbents with a particular feed mixture to determine the relative retention by the adsorbent of each component of the mixture . the procedure involves mixing together equal quantities of each component , the relative retention of which is to be determined , and a convenient solvent or desorbent material . a solvent or desorbent is selected that will have a boiling point well separated from those of the isomers being tested . the resulting solution is then placed in a vessel with a quantity of the appropriate adsorbent and is allowed to remain , with occasional stirring , overnight at room temperature . the solution is then analyzed for each component and the selectivity , alpha , thereof is calculated from the following equation : ## equ1 ## a dynamic testing apparatus is employed to test various adsorbents with a particular feed mixture and desorbent material to measure the adsorption characteristics of retention capacity and exchange rate . the apparatus consists of a helical adsorbent chamber of approximately 70 cc volume having inlet and outlet portions at opposite ends of the chamber . the chamber is contained within a temperature control means and , in addition , pressure control equipment is used to operate the chamber at a constant predetermined pressure . quantitative and qualitative analytical equipment such as refractometers , polarimeters and chromatographs can be attached to the outlet line of the chamber and used to detect quantitatively or determine qualitatively one or more components in the effluent stream leaving the adsorbent chamber . a pulse test , performed using this apparatus and the following general procedure , is used to determine data , e . g ., selectively , for various adsorbent systems . the adsorbent is placed in a chamber and filled to equilibrium with a particular desorbent material by passing the desorbent material through the adsorbent chamber . at a convenient time , a pulse of feed containing known concentrations of a tracer and of a particular extract component or of a raffinate component or both , all diluted in desorbent material is injected for a duration of several minutes . desorbent material flow is resumed , and the tracer and the extract component or the raffinate component ( or both ) are eluted as in a liquid - solid chromatographic operation . the effluent can be analyzed on - stream or alternatively , effluent samples can be collected periodically and later analyzed separately by analytical equipment and traces of the envelopes or corresponding component peaks developed . from information derived from the test , adsorbent performance can be rated in terms of void volume , retention volume for an extract or a raffinate component , the rate of desorption of an extract component from the adsorbent and selectivity . the retention volume of an extract or a raffinate component may be characterized by the distance between the center of the peak envelope of the extract or raffinate component and the center of the peak envelope of the tracer component ( void volume ) or some other known reference point . it is expressed in terms of the volume in cubic centimeters of desorbent material pumped during this time interval represented by the distance between the peak envelopes . the rate of exchange or desorption rate of an extract component with the desorbent material can generally be characterized by the width of the peak envelopes at half intensity . the narrower the peak width , the faster the desorption rate . [ the desorption rate can also be characterized by the distance between the center of the tracer peak envelope and the disappearance of an extract component which has just been desorbed . this distance is again the volume of desorbent material pumped during this time interval .] selectivity , β , is determined by the ratio of the net retention volumes of the more strongly adsorbed component to each of the other components . the examples shown below are intended to further illustrate the process of this invention without unduly limiting the scope and spirit of said process . the examples present test results for various adsorbent and desorbent materials when using the above dynamic testing apparatus . a number of static tests were performed as described hereinabove at 25 ° c . to demonstrate that it was possible to separate the isomers by an adsorptive process . the feed consisted of 1 or 3 % crystallizer residue in mesitylene or toluene ; the crystallizer residue contained 58 . 7 % 4 , 4 &# 39 ;- dcdps ; 3 . 4 &# 39 ;% 3 , 4 &# 39 ;- dcdps and 16 . 5 % 2 , 4 &# 39 ;- dcdps . values for alpha of 4 , 4 &# 39 ;- dcdps with respect to 2 , 4 &# 39 ;- dcdps , a measure of selectivity , calculated as stated above for a number of adsorbents , are listed in table 1 . table 1______________________________________ . sup . alpha 4 , 4 &# 39 ;-/ 2 , 4 &# 39 ;- dcdps mesitylene tolueneadsorbent 3 % feed 1 % feed 3 % feed______________________________________nax 0 . 69 0 . 81 -- kx 0 . 56 0 . 35 0 . 48bax 0 . 89 0 . 72 0 . 69nh . sub . 4 x 0 . 49 0 . 40 0 . 57nay 0 . 84 0 . 57 0 . 78cay 0 . 67 0 . 76 0 . 67ky 0 . 75 -- 0 . 53______________________________________ in this example , a pulse test , as described , was run at 150 ° c . using a y type zeolite having potassium ions at cation exchange sites to determine the rejective separation of 4 , 4 &# 39 ;- dichlorodiphenylsulfone from a crystallizer residue . the k - y zeolite of this example was bound with bentonite clay and had an average bulk density of 0 . 56 gm / ml . the feed mixture consisted of 3 g of the crystallizer residue composition given in table 2 diluted with 97 g of the desorbent . the 4 , 4 &# 39 ;- dichlorodiphenylsulfone was removed as raffinate from the column . the 2 , 4 &# 39 ;- dcdps and 3 , 4 &# 39 ;- dcdps isomers were desorbed with 100 % pentanol and recovered as extract . table 2______________________________________ component wt . % ______________________________________ 4 , 4 &# 39 ;- dcdps 51 . 4 2 , 4 &# 39 ;- dcdps 37 . 6 3 , 4 &# 39 ;- dcdps 11 . 0 100 . 0______________________________________ table 3 shows the results of the separation as demonstrated by the net retention volumes of the components . table 3__________________________________________________________________________ net width retention at selectivitycomponent adsorbent desorbent vol . ( nrv ) 1 / 2 ht . ( beta ) __________________________________________________________________________4 , 4 &# 39 ;- dcdps ky pentanol 1 . 5 9 . 99 4 . 802 , 4 &# 39 ;- dcdps 7 . 2 11 . 70 1 . 003 , 4 &# 39 ;- dcdps 4 . 2 9 . 74 1 . 75other 1 . 5 5 . 02 4 . 80 ( unknown , etc . ) __________________________________________________________________________ examples iii through ix were also pulse tests run to illustrate the invention using other adsorbents , desorbents and diluents and temperatures . in each case , except example ix , the feed , 15 g of a crystallizer residue composition given in table 4 , is diluted with 85 g of the desorbent . table 4______________________________________ component wt . % ______________________________________ 4 , 4 &# 39 ;- dcdps 51 . 4 2 , 4 &# 39 ;- dcdps 37 . 6 3 , 4 &# 39 ;- dcdps 11 . 0______________________________________ in example ix , the feed , 8 g of a crude mixture , having the composition of table 5 , obtained from the reaction of dimethylpyrosulfate and monochlorobenzene , is diluted with 92 g of the desorbent . table 5______________________________________ component wt . % ______________________________________ 4 , 4 &# 39 ;- dcdps 96 . 91 3 , 4 &# 39 ;- dcdps 1 . 00 2 , 4 &# 39 ;- dcdps 2 . 09______________________________________ the results for each example are set forth in table 6 . table 6__________________________________________________________________________ retention volume temp . ( width at 1 / 2 peak height ) selectivityex . adsorbent desorbent (° c .) 4 , 4 &# 39 ;- 2 , 4 &# 39 ;- 3 , 4 &# 39 ;- other . sup . β 4 , 4 &# 39 ;-/( __________________________________________________________________________ ) iii k - y 20 / 70 150 45 . 3 70 . 7 55 . 1 41 . 8 0 . 12 ( 2 , 4 &# 39 ;-) pentanol / ( 6 . 24 ) ( 16 . 13 ) ( 9 . 55 ) ( 7 . 86 ) 0 . 26 ( 3 , 4 &# 39 ;-) toluene ( unknown ) iv k - y 30 / 70 150 44 . 6 58 . 7 52 . 9 42 . 4 0 . 14 ( 2 , 4 &# 39 ;-) pentanol / ( 9 . 28 ) ( 16 . 5 ) ( 11 . 13 ) ( 6 . 54 ) 0 . 21 ( 3 , 4 &# 39 ;-) toluene ( unknown ) v k - y 50 / 50 150 44 . 5 53 . 7 49 . 2 41 . 4 0 . 25 ( 2 , 4 &# 39 ;-) pentanol / ( 9 . 51 ) ( 13 . 08 ) ( 9 . 25 ) ( 5 . 03 ) 0 . 40 ( 3 , 4 &# 39 ;-) toluene ( unknown ) vi k - y 30 / 70 150 46 . 5 67 . 7 n / a -- 0 . 18 ( 2 , 4 &# 39 ;-) ( aged ) pentanol ( 12 . 35 ) ( 7 . 58 ) -- -- toluenevii k - y 30 / 70 180 43 . 8 70 . 0 56 . 7 40 . 1 0 . 12 ( 2 , 4 &# 39 ;-) pentanol / ( 9 . 07 ) ( 18 . 31 ) ( 11 . 59 ) ( 5 . 82 ) 0 . 22 ( 3 , 4 &# 39 ;-) toluene ( unknown ) viii k - y 67 / 33 150 52 . 3 86 . 7 62 . 9 -- 0 . 22 ( 2 , 4 &# 39 ;-) n - octanol ( 9 . 88 ) ( 32 . 78 ) ( 7 . 86 ) 0 . 48 ( 3 , 4 &# 39 ;-) tolueneix k - y 30 / 70 150 45 . 5 57 . 2 51 . 6 -- 0 . 21 ( 2 , 4 &# 39 ;-) pentanol / ( 8 . 12 ) ( 15 . 21 ) ( 8 . 06 ) 0 . 34 ( 3 , 4 &# 39 ;-) toluene__________________________________________________________________________ it will be noted that many of the separations provide sufficient selectivity between the extract products , 2 , 4 &# 39 ;- dcdps and 3 , 4 &# 39 ;- dcdps , that these isomers could be separated in a second stage operation using these particular adsorbent - desorbent combinations , e . g ., ky - n - octanol / toluene as in example viii . | 2 |
referring generally to fig1 - 20 , the present disclosure provides convertible entertainment pods 100 comprising a shell 10 and a base 30 rotatably associated with the shell 10 . the convertible entertainment pods 100 of the present disclosure are sized to comfortably fit at least one person , optionally two people or more than two people . a variety of audio and / or visual devices may be incorporated into the convertible entertainment pods 100 , and in some embodiments a user u can customize or modify a particular combination of audio and / or visual devices for inclusion . the shell 10 may be formed of any suitable material and may be formed into any suitable shape . in some embodiments , the shell 10 is formed of a pliable material , such as a metal or metal alloy . in other embodiments , the shell 10 is formed of a moldable material , such as a resin . in some embodiments , the shell 10 is formed of a carvable material such as wood . in some embodiments , the shell 10 comprises more than one type of material , such as a resin and a metal or metal alloy . depending on the type of material ( s ) used , the shell 10 may be formed by , for example , molding ( e . g ., injection molding ), casting , stretching , rolling , braking , joining , carving , welding , fusing , or any combination thereof . in some embodiments , the shell 10 comprises an insulating layer 19 to insulate the interior portion of the pod 100 . the insulating layer 19 can include an acoustical insulating layer for increasing a decibel differential between the interior portion of the pod 100 and the exterior portion of the pod 100 . the insulating layer 19 can include a thermal insulation of the exterior portion of the pod 100 from the interior portion of the pod 100 . the insulating layer 19 can include space or channels for housing electrical wiring , air ducts , and the like . in some embodiments , the shell 10 comprises a door 20 . in some embodiments , the door is a hinged door , such that opening the door 20 includes rotating the door 20 about the hinge ( s ). in other embodiments , such as that shown in fig2 , the door 20 opens by sliding into a channel or space in the shell 10 . in some embodiments , the door 20 opens by sliding into an interior space of the pod 100 . in some embodiments , the door 20 includes a handle 25 . in some embodiments , the open door position permits the user u to interact freely with guests outside of the pod 100 , for example by watching a television in the room while sitting in the pod 100 . in some embodiments , the door 20 is hinged along one side of the door 20 . in some embodiments , the door 20 is hinged along the top edge , such that opening the door 20 comprises lifting the door 20 . in such embodiments , the door 20 may further comprise one or more struts 27 ( e . g ., pressurized strut ( s )) for reducing the amount of lifting force required and / or for enabling the door 20 to remain in an open position until a user u causes the door 20 to close . in some embodiments , the door 20 comprises a latch for securing the door 20 in a closed position . in some embodiments , the latch may be released by a pull or similar latch release mechanism . in some embodiments , the door 20 is in functional communication with a motor , such that opening and closing the door 20 comprises activating the motor . in some embodiments , the door 20 does not include a latch . in some embodiments , the shell 10 comprises a window 17 . the window 17 may be incorporated into any portion ( s ) of the shell 10 . in some embodiments , the window 17 may be covered or partially covered to reduce the amount of ambient light entering the pod 100 and / or the amount of light and / or sound emanating from the pod 100 . the shell 10 comprises an inner surface 15 and an outer surface 12 . in some embodiments , the outer surface 12 includes a texture , a design , a pattern , or a combination thereof . in some embodiments , the outer surface 12 can be easily customized by a user , for example by application of a customized skin . in some embodiments , the outer surface 12 comprises a solar panel 300 . in some embodiments , the solar panel 300 provides enough power to operate at least a portion of the electrical components of the pod 100 , such as lights 55 , ventilation 400 , control units 65 , and / or audio / video components pc . in some embodiments , the inner surface 15 includes a texture . in some embodiments , the texture reduces an echo effect , such as a reverberation effect , of sound provided to the interior portion of the pod 100 . in some embodiments , the inner surface 15 includes a pocket 85 for storing small objects , such as a remote control or mobile phone . in some embodiments , the base 30 includes one or more wheels 35 for enabling the pod 100 to be moved . in some embodiments , the wheels 35 may be lockable , for example to prevent movement of the pod 100 after it has been placed in a desired location . in some embodiments , the wheels 35 automatically lock when a weight above a threshold weight is added to the pod 100 . in some embodiments , the pod 100 includes a solar panel 300 and one or more wheels 35 , such that the pod 100 may be used outdoors using power obtained substantially or exclusively from the solar panel 300 . in some embodiments , the base 30 includes a storage compartment 32 , which may also contain hardware ( electrical components , plugs , amplifier , oxygen system , etc .). in some embodiments , at least one audio speaker 50 is associated with ( e . g ., affixed to ) the shell 10 , such as at the inner surface 15 . in some embodiments , the at least one audio speaker 50 includes a subwoofer . in some embodiments , the subwoofer is positioned beneath or behind the seating portion 40 . in some embodiments , the at least one audio speaker 50 comprises a plurality of speakers 50 configured to provide surround sound audio to a user u . in some embodiments , the at least one audio speaker comprises a 5 / 7 / 12 - speaker surround sound configuration driven by a 3d acoustic protocol . in some embodiments , at least one audio speaker 50 is associated with the outer surface 12 such that the speaker can be heard by guests outside of the pod 100 . in some embodiments , controls permit the user u to separately control one or more of the audio speakers 50 . in some embodiments , the shell 10 comprises a shelf 300 on the inner surface 15 . in some embodiments , the shelf 300 is for securing or docking an audio or video component , such as a gaming system or personal computer pc , to the pod 100 . in some embodiments , door 220 is attached to shell 12 by hinges 227 . handle 225 is located on the exterior side and / or the interior side of the door 220 to open such door . in some embodiments , the inner surface 15 is configured to accommodate virtual or augmented reality systems . in some embodiments , the pod 100 has dimensions suitable to enable a user u to freely stand , sit , lunge , squat , lift arms , kick legs , and / or any combination thereof to interact with the virtual or augmented reality system . in some embodiments , the pod 100 comprises one or more sensors ( e . g ., motion sensors ) for detecting a position and / or movement of a user u or any portion of a user u to enable the user u to interact with the virtual or augmented reality system . in some embodiments , the pod 100 further includes a seating portion 40 . in some embodiments , the seating portion 40 is affixed to the shell 10 , for example by securing ( e . g ., adhering ) the seating portion 40 to the inner surface 15 of the shell 10 . in other embodiments , the seating portion 40 may be formed from a continuous piece of material as the shell 10 , for example by molding the shell 10 and the seating portion 40 in one step . in some embodiments , the seating portion 40 includes a cushion 45 , which in some embodiments may be removable . in some embodiments , the seating portion 40 includes one or more armrests 47 , which may include a cavity 95 for holding a beverage or other small object . in some embodiments , the seating portion 40 can be positioned in a reclined or flat configuration . in some embodiments , the seating portion 40 includes one or more motors for assisting a user u to adjust the position and / or configuration of the seating portion 40 . in some embodiments , the pod 100 further includes at least one light 55 secured to the inner surface 15 of the shell 10 . in some embodiments , the at least one light 55 comprises a sound - activated light . in some embodiments , the at least one light 55 is an led light , such as a white led light , a yellow led light , a green led light , a red led light , a blue led light , a multi - color led light , and / or a dimmable led light . in some embodiments , the at least one light 55 comprises a sound - activated multi - color led light . in some embodiments , the pod 100 further includes a ventilation system 400 . in some embodiments , the ventilation system 400 is incorporated into the shell 10 and recirculates ambient air , provides fresh air , and / or provides a customized atmosphere a to the interior portion of the pod 100 . in some embodiments , the ventilation system 400 includes an artificial atmosphere source 410 ( e . g ., a compressed gas cylinder ) connected to one or more outlets 430 by one or more ducts 420 . in some embodiments , the ventilation system 400 includes a thermal module for providing the atmosphere a at a desired temperature to the interior portion of the pod 100 . in some embodiments , the ventilation system 400 includes an enhanced oxygen source 410 for providing an atmosphere a that has an increased amount of oxygen , compared to the oxygen content of ambient air , to the interior portion of the pod 100 . in some embodiments , the ventilation system 400 further includes an exhaust vent 500 for removing unwanted atmosphere e from the inside portion of the pod 100 to the outside portion of the pod 100 in the form of exhaust e ′. in some embodiments , the pod 100 further includes a heating / cooling system that incorporates a heating coil and / or air conditioning system similar to that of a motor vehicle in order to maintain the internal temperature within a comfortable range . in some embodiments , the pod 100 further comprises a video display 70 . in some embodiments , the video display 70 is secured to the pod 100 by a bracket 75 , such as an articulating arm . in some embodiments , the video display 70 is incorporated into the inner surface 15 of the shell 10 , for example into the inner surface 15 of the door 20 . in some embodiments , the video display 70 is a curved display , optionally wherein at least a portion of the inner surface 15 of the shell includes a contour that is complementary to the curvature of the curved display 70 . in some embodiments , the pod 100 further comprises a video projector 68 . images from the video projector 68 may be projected onto a screen within the pod 100 , and / or onto the inner surface 15 of the shell 10 . in some embodiments , the inner surface 15 is a passive screen or surface inside door 20 onto which images can be projected by projector 68 . in some embodiments , a tray table 72 is attached to the interior of the pod above the seating portion 40 . in some embodiments , tray table 72 is adjustable to the user &# 39 ; s required height and location within the pod . in some embodiments , the pod 100 includes a control unit 65 for enabling a use u to adjust one or more settings of the pod 100 . for example , the control unit 65 may include one or more control displays 60 ( e . g ., gauges , displays , meters , or indicator lights ) corresponding to one or more conditions of the pod 100 , such as the internal ambient temperature , the intensity and / or hue of interior lighting , power status of the ventilation system , ambient oxygen level inside the pod 100 , volume of sound inside the pod 100 , volume of sound outside the pod 100 , etc . in some embodiments , the control unit 65 comprises a touch screen with a graphical user interface ( gui ) for enabling control of any adjustable feature of the pod 100 . in some embodiments , the pod 100 includes at least one jack 90 for receiving or distributing a video or audio signal . for example and without limitation , the at least one jack 90 may be an hdmi port , a usb port , an ethernet port , an rca port , a vga port , a coaxial port , a stereo jack ( e . g ., ¼ ″ or ⅛ ″), a mono jack ( e . g ., ¼ ″ or ⅛ ″), or an optical port . in some embodiments , one or more jacks 19 are located in close proximity to each other . in some embodiments , the at least one jack 19 is provided such that the jack opening is flush or substantially flush with the inner surface 15 of the shell 10 . in some embodiments , the at least one jack 19 is connected to an audio or visual output device , such as the display 70 and / or the at least one speaker 50 . in other embodiments , the at least one jack 19 is in electronic communication with the control unit 65 . in some embodiments , the pod 100 includes one or more ports 19 or wireless connectivity devices for electronically connecting to a computer , such as a personal computer . in some embodiments , the one or more ports 19 includes a vga , rga , hdmi , usb , serial , or other computer - compatible port . in some embodiments , the pod 100 includes one or more ports 19 or wireless connectivity devices for enabling communication between the pod 100 and audio / visual input devices and / or between the pod 100 and data transmitters / receivers . for example and without limitation , the pod 100 may include one or more ethernet ports and / or hardware for enabling data to pass to and from the pod 100 . similarly , the pod 100 may include ( e . g ., may additionally include ) a wireless receiver and / or transmitter for enabling data to pass to wirelessly and from the pod 100 , for example using a bluetooth or wifi ( e . g ., ieee 802 . 11 ) protocol . in some embodiments , the pod 100 includes hdmi , usb , radio wave , telephone , coaxial , and / or other connectivity capabilities . in some embodiments , the pod 100 includes a control 80 for selectably enabling and preventing rotational freedom of the pod 100 relative to the base 30 . in some embodiments , the control 80 includes a lever 85 operably connected to the base 30 , for example by one or more cables 87 . in some embodiments , the control 80 includes a switch or lever 85 in the interior portion of the pod 100 so that it is accessible to a user while the door 20 is closed . in other embodiments , the control 80 automatically prevents rotation of the pod 100 relative to the base 30 when the door 20 is closed . in some embodiments , the control 80 automatically prevents rotation of the pod 100 relative to the base 30 when a weight above a threshold weight is added to the pod 100 . in some embodiments , the pod 100 comprises active noise cancellation for reducing a decibel level outside the pod 100 . in some embodiments , a sound level outside the pod 100 is at least about 40 db lower than the decibel level inside the pod 100 , for example at least 40 db , at least 50 db , at least 60 db , at least 70 db , at least 80 db , or at least 90 db less than the decibel level inside the pod 100 . in some embodiments , the active noise cancellation produces random noise interference , for example according to u . s . pat . no . 2 , 866 , 848 , u . s . pat . no . 2 , 920 , 138 , and / or u . s . pat . no . 2 , 966 , 549 , the entire contents of each of which are incorporated herein by reference . in some embodiments , the present disclosure provides a convertible entertainment pod comprising a shell comprising an inner surface , an outer surface , and a closeable door ; a base rotatably affixed to the outside surface of the shell ; and a seating portion affixed to or integrated into the inner surface of the shell , wherein the convertible entertainment pod adopts a first , enclosed configuration when the closeable door is in a closed position . in some embodiments , the convertible entertainment pod adopts a second , unenclosed configuration when the door is in an open position . in some embodiments , the convertible entertainment pod further comprises at least one audio speaker providing an audio signal from the inner surface of the shell . in some embodiments , the audio signal has a first decibel level observable from outside the convertible entertainment pod when the convertible entertainment pod is in the first , enclosed configuration , and a second decibel level observable from outside the convertible entertainment pod when the convertible entertainment pod is in the second , unenclosed configuration , and wherein the first decibel level is significantly less than the second decibel level . in some embodiments , the first decibel level is at least 40 db less than the second decibel level , optionally wherein the first decibel level is at least 50 db , at least 60 db , at least 70 db , at least 80 db , or at least 90 db , at least db less than the second decibel level . in some embodiments , the at least one audio speaker comprises a subwoofer , optionally positioned between the inner surface of the shell and the seating portion . in some embodiments , the convertible entertainment pod further comprises an insulating layer associated with the shell . in some embodiments , the convertible entertainment pod of any preceding claim further comprises a ventilation system incorporated in the shell . in some embodiments , the ventilation system comprises an enhanced oxygen source for providing an atmosphere inside the convertible entertainment pod having a level of oxygen that is greater than a level of oxygen in an atmosphere outside the convertible entertainment pod . in some embodiments , the convertible entertainment pod further comprises at least one light associated with the inner surface of the shell . in some embodiments , the at least one light comprises sound - activated multi - color led lighting . in some embodiments , the convertible entertainment pod further comprises at least one of : a video display , a video camera , a virtual reality system , and augmented reality system . in some embodiments , the video display is a curved display . in some embodiments , at least a portion of the inner surface of the shell conforms to the curved video display . in some embodiments , the convertible entertainment pod further comprises a window incorporated within the shell . in some embodiments , the convertible entertainment pod further comprises at least one input jack for connecting a video or audio device to the convertible entertainment pod . in some embodiments , the convertible entertainment pod is capable of wirelessly connecting with one or more additional devices via a wireless connectivity protocol . in some embodiments , the one or more additional devices comprises a second convertible entertainment pod . in some embodiments , the wireless connectivity protocol comprises a bluetooth protocol . in some embodiments , the convertible entertainment pod further comprises a control panel for adjusting one or more components of the convertible entertainment pod . in some embodiments , the control panel comprises a graphical user interface . in some embodiments , the inner surface of the shell comprises a texture . in some embodiments , the texture reduces echo and / or reverberation of an audio signal provided within the convertible entertainment pod . in some embodiments , the inner surface of the shell comprises at least one shelf . in some embodiments , the seat portion is adjustable and / or replaceable . in some embodiments , the convertible entertainment pod further comprises at least one seating cushion . in some embodiments , the convertible entertainment pod further comprises a control for selectably enabling and preventing rotational freedom of the shell relative to the stand . in some embodiments , the control for selectably enabling and preventing rotational freedom is accessible to a user within the convertible entertainment pod while the convertible entertainment pod is in a first , enclosed configuration . in some embodiments , the control for selectably enabling and preventing rotational freedom prevents a user within the convertible entertainment pod from enabling rotational freedom while the convertible entertainment pod is in a first , enclosed configuration . in some embodiments , the convertible entertainment pod further comprises a solar panel for providing electrical power to at least one electrical feature or component associated with the pod . while the technology disclosed herein is capable of being embodied in various forms , the several embodiments are described with the understanding that the present disclosure is to be considered as an exemplification of the invention , and is not intended to limit the invention to the specific embodiments illustrated . headings are provided for convenience only and are not to be construed to limit the invention in any manner . embodiments illustrated under any heading may be combined with embodiments illustrated under any other heading . the use of numerical values in the various quantitative values specified in this application , unless expressly indicated otherwise , are stated as approximations as though the minimum and maximum values within the stated ranges were both preceded by the word “ about .” also , the disclosure of ranges is intended as a continuous range including every value between the minimum and maximum values recited as well as any ranges that can be formed by such values . also disclosed herein are any and all ratios ( and ranges of any such ratios ) that can be formed by dividing a disclosed numeric value into any other disclosed numeric value . accordingly , the skilled person will appreciate that many such ratios , ranges , and ranges of ratios can be unambiguously derived from the numerical values presented herein and in all instances such ratios , ranges , and ranges of ratios represent various embodiments of the present invention . from the foregoing , it will be appreciated that specific embodiments of the invention have been described herein for purposes of illustration , but that various modifications may be made without deviating from the scope of the invention . accordingly , the invention is not limited except as by the appended claims . in some embodiments , the pod 100 can be used for listening to music . in some embodiments , the pod 100 can be used for watching television and movies . in some embodiments , the pod 100 can be used for streaming content . in some embodiments , the pod 100 can be used for gaming or interacting with virtual reality and augmented reality systems . in some embodiments , pod 100 can be used as a private environment for mobile computing . in some embodiments , pod 100 can be used as a private environment for video / conference calls . in some embodiments , pod 100 includes a microphone to better enable video / conference calls . in some embodiments , pod 100 can be used as a private environment for software training modules for a professional work environment . in some embodiments , pod 100 may have application in therapeutic use as an enclosed chamber for meditation and treatment , such as aromatherapy , light therapy , oxygen therapy , etc . this embodiment may be used as alternative therapy for stress , anxiety , and other disorders . in some embodiments , pod 100 can provide a quiet place for sleep purposes with a comfortable chair that reclines in which the user can nap . active noise cancellation discussed herein allows for complete isolation in some embodiments . in some embodiments , pod 100 can be used for social interacting via video chatting . in some embodiments , pod 100 can be used for social interacting via multiplayer gaming systems . in some embodiments , pod 100 can be used for social interacting via esports broadcasts . in some embodiments , pod 100 can integrate and control a user &# 39 ; s home control devices such as thermostats , security systems , lighting , etc . in some embodiments , pod 100 has educational applications . in some embodiments , pod 100 can be used to conduct training modules . in some embodiments , pod 100 can be used to conduct flight simulations . in some embodiments , pod 100 can be used to conduct educational material . in some embodiments , pod 100 can be used in athletics , or otherwise , for watching game tape . in some embodiments , pod 100 can be used in athletics , or otherwise , for conducting visualization exercises . in some embodiments , pod 100 can be used in athletics , or otherwise , for conducting motivational exercises . in some embodiments , pod 100 can be used in athletics , or otherwise , for watching footage of past or live games or events . in some embodiments , pod 100 has commercial uses such as sleep clubs , for example , by - hour rentals in public locations . shopping malls , airports , and movie theaters are just some examples of other public locations where pod 100 can be located for short term ( e . g ., rental ) use by a member of the public . in some embodiments , the pod 100 is able to provide noise cancellation . noise cancellation allows sounds from a person &# 39 ; s environment to be diminished or entirely eliminated during work or relaxation . such sounds interfere with a person &# 39 ; s ability to experience silence or other desired audio sounds . other approaches to this problem include “ sound masking ,” in which white or pink noise is introduced to cover external sounds from the environment . noise cancellation can be active or passive . active noise cancellation requires the use of a power source . passive noise cancellation includes the use of materials that absorb and block sound . the disclosure herein includes active noise cancellation . a base rotatably affixed to the outside surface of the shell ; and a seating portion affixed to or integrated into the inner surface of the shell , wherein the convertible entertainment pod adopts a first , enclosed configuration when the closeable door is in a closed position . the convertible entertainment pod of example 1 , wherein the convertible entertainment pod adopts a second , unenclosed configuration when the door is in an open position . the convertible entertainment pod of example 1 or example 2 further comprising at least one audio speaker providing an audio signal from the inner surface of the shell . the convertible entertainment pod of example 4 , wherein the audio signal has a first decibel level observable from outside the convertible entertainment pod when the convertible entertainment pod is in the first , enclosed configuration , and a second decibel level observable from outside the convertible entertainment pod when the convertible entertainment pod is in the second , unenclosed configuration , and wherein the first decibel level is significantly less than the second decibel level . the convertible entertainment pod of example 4 , wherein the first decibel level is at least 40 db less than the second decibel level , optionally wherein the first decibel level is at least 50 db , at least 60 db , at least 70 db , at least 80 db , or at least 90 db less than the second decibel level . the convertible entertainment pod of any one of examples 3 to 5 , wherein the at least one audio speaker comprises a subwoofer , optionally positioned between the inner surface of the shell and the seating portion . the convertible entertainment pod of any preceding example further comprising an insulating layer associated with the shell . the convertible entertainment pod of any preceding example further comprising a ventilation system incorporated in the shell . the convertible entertainment pod of example 8 , wherein the ventilation system comprises an enhanced oxygen source for providing an atmosphere inside the convertible entertainment pod having a level of oxygen that is greater than a level of oxygen in an atmosphere outside the convertible entertainment pod . the convertible entertainment pod of any preceding example further comprising at least one light associated with the inner surface of the shell . the convertible entertainment pod of example 10 , wherein the at least one light comprises sound - activated multi - color led lighting . the convertible entertainment pod of any preceding example further comprising at least one of : a video display , a video camera , a virtual reality system , and augmented reality system . the convertible entertainment pod of example 12 , wherein the video display is a curved display . the convertible entertainment pod of example 13 , wherein at least a portion of the inner surface of the shell conforms to the curved video display . the convertible entertainment pod of any preceding example further comprising a window incorporated within the shell . the convertible entertainment pod of any preceding example further comprising at least one input jack for connecting a video or audio device to the convertible entertainment pod . the convertible entertainment pod of any preceding example , wherein the convertible entertainment pod is capable of wirelessly connecting with one or more additional devices via a wireless connectivity protocol . the convertible entertainment pod of example 17 , wherein the one or more additional devices comprises a second convertible entertainment pod . example 19 the convertible entertainment pod of example 17 or example 18 , wherein the wireless connectivity protocol comprises a bluetooth protocol . the convertible entertainment pod of any preceding example further comprising a control panel for adjusting one or more components of the convertible entertainment pod . the convertible entertainment pod of example 20 , wherein the control panel comprises a graphical user interface . the convertible entertainment pod of any preceding example , wherein the inner surface of the shell comprises a texture . the convertible entertainment pod of example 22 , wherein the texture reduces echo and / or reverberation of an audio signal provided within the convertible entertainment pod . the convertible entertainment pod of any preceding example , wherein the inner surface of the shell comprises at least one shelf . the convertible entertainment pod of any preceding example , wherein the seat portion is adjustable and / or replaceable . the convertible entertainment pod of any preceding example further comprising at least one seating cushion . the convertible entertainment pod of any preceding example further comprising a control for selectably enabling and preventing rotational freedom of the shell relative to the stand the convertible entertainment pod of example 27 , wherein the control for selectably enabling and preventing rotational freedom is accessible to a user within the convertible entertainment pod while the convertible entertainment pod is in a first , enclosed configuration . the convertible entertainment pod of example 27 , wherein the control for selectably enabling and preventing rotational freedom prevents a user within the convertible entertainment pod from enabling rotational freedom while the convertible entertainment pod is in a first , enclosed configuration . the convertible entertainment pod of any preceding example further comprising a solar panel for providing electrical power to at least one electrical feature or component associated with the pod . a method of providing a virtual reality environment to a user , the method comprising providing a convertible entertainment pod to the user , wherein the convertible entertainment pod comprises : a shell comprising an inner surface , an outer surface , and a closeable door ; a base rotatably affixed to the outside surface of the shell ; one or more sensors for detecting a position and / or movement of at least a portion of the user ; and an optional a seating portion affixed to or integrated into the inner surface of the shell , wherein the convertible entertainment pod adopts a first , enclosed configuration when the closeable door is in a closed position . the method of example 31 , wherein the inner surface is configured to accommodate a virtual reality system . the method of example 31 or example 32 , wherein the convertible entertainment pod has dimensions suitable to enable a user to freely stand or sit to interact with the virtual reality system . the method of any one of examples 31 - 33 , wherein the convertible entertainment pod further comprises a video display . the method of example 34 , wherein the video display is mounted to or incorporated into an inner surface of the closeable door . the method of any one of examples 31 - 35 , wherein the convertible entertainment pod further comprises active noise cancellation for reducing a decibel level outside the convertible entertainment pod . a method of treating a subject in need thereof , the method comprising administering a therapeutic environment to the subject via a convertible entertainment pod , wherein the convertible entertainment pod comprises : a shell comprising an inner surface , an outer surface , and a closeable door ; a base rotatably affixed to the outside surface of the shell ; one or more sensors for detecting a position and / or movement of at least a portion of the user ; and an optional a seating portion affixed to or integrated into the inner surface of the shell , wherein the convertible entertainment pod adopts a first , enclosed configuration when the closeable door is in a closed position . the method of example 37 , wherein the therapeutic environment comprises aromatherapy , light therapy , oxygen therapy , and / or reduced ambient noise . the method of example 37 or example 38 , wherein the convertible entertainment pod further comprises a ventilation system for providing an aromatherapy or oxygen therapy atmosphere to the subject . the method of any one of examples 37 - 39 , wherein the convertible entertainment pod further comprises at least one light secured to the inner surface of the shell for providing light therapy to the subject . the method of any one of examples 37 - 40 , wherein the convertible entertainment pod provides noise cancellation for providing reduced ambient noise to the subject . the method of example 41 , wherein the noise cancellation provides sound masking . the method of example 42 , wherein the sound masking comprises introducing white noise to an interior of the convertible entertainment pod . the method of example 42 , wherein the sound masking comprises introducing pink noise to an interior of the convertible entertainment pod . a method of providing sleep therapy to a subject in need thereof , the method comprising providing a convertible entertainment pod to the subject , wherein the convertible entertainment pod comprises : a shell comprising an inner surface , an outer surface , and a closeable door ; a base rotatably affixed to the outside surface of the shell ; one or more sensors for detecting a position and / or movement of at least a portion of the user ; and a seating portion affixed to or integrated into the inner surface of the shell , wherein the convertible entertainment pod adopts a first , enclosed configuration when the closeable door is in a closed position . the method of example 45 , wherein the convertible entertainment pod provides noise cancellation for providing reduced ambient noise to the subject . the method of example 46 , wherein the noise cancellation comprises active noise cancellation for reducing a decibel level outside the convertible entertainment pod . the method of example 46 or example 47 , wherein the noise cancellation provides sound masking . the method of example 48 , wherein the sound masking comprises introducing white noise to an interior of the convertible entertainment pod . the method of example 48 , wherein the sound masking comprises introducing pink noise to an interior of the convertible entertainment pod . | 0 |
the present invention will be now described herein with reference to illustrative embodiments . those skilled in the art will recognize that many alternative embodiments can be accomplished using the teachings of the present invention and that the invention is not limited to the embodiments illustrated for explanatory purposed . fig1 shows a block diagram of a pll frequency synthesizer of the first embodiment according to the present invention . as shown in fig1 , the pll frequency synthesizer of the embodiment includes an oscillator unit ( vco unit ) 1 , a phase control unit ( pll unit ) 2 , a digital tuning control unit 3 , a low pass filter unit ( lpf unit ) 4 , a bias circuit 5 , and a switch circuit 6 . the voc unit 1 includes an lc - tank circuit 11 , a group of fixed - value capacitors 12 and an oscillator circuit 13 . fig2 shows a detailed structure of the vco unit 1 shown in fig1 . the lc - tank circuit 11 includes an inductor l and two variable capacitors cv each of which including a varactor diode , where the variable capacitors cv are connected in series with each other and the inductor l is connected in parallel to the variable capacitors cv . thus , the parallel resonance circuit is constructed . here , the vco unit 1 includes two groups of fixed - value capacitors 12 each of which including a plurality of fixed - value capacitors c 0 , c 1 , c 2 , . . . , and cm - 1 . each of the fixed - value capacitors c 0 , c 1 , c 2 , . . . , and cm - 1 becomes effective when it is grounded by the switch connected therewith . each of the switches is controlled on / off by a selection signal cf [ m - 1 : 0 ]. the oscillating circuit 13 includes a negative mutual conductance (− g ) and oscillates with a frequency f vco determined by the lc - tank circuit 11 and some of the fixed - value capacitors c 0 , c 1 , c 2 , . . . , and cm - 1 selected from the group of fixed - value capacitors 12 . referring back to fig1 , the pll unit 2 includes a buffer 21 , a reference frequency divider ( ref divider ) 22 , a buffer 23 , an oscillating signal divider ( sig divider ) 24 , a phase comparator 25 and a charge pump 26 . the buffer 21 buffers a signal with a reference frequency f ref ( reference signal f ref ) output from a reference signal source 7 and outputs it to the ref divider 22 . the ref divider 22 divides the reference signal f ref by r and outputs the r - divided signal f ref / r . the buffer 23 buffers the vco frequency f vco output from the vco unit 1 and outputs it to the sig divider 24 . the sig divider 24 includes a prescaler 24 a and a na counter 24 b . the prescaler 24 a divides the oscillating signal f vco output from the buffer 23 by p and outputs the p - divided signal f vco / p . the na counter 24 b includes a two - step counter and divides the oscillating signal f vco by n to output the n - divided signal f vco / n . the phase comparator 25 compares the frequency and the phase of the r - divided signal f ref / r output from the ref divider 22 with that of the n - divided signal f vco / n output from the na counter 24 b of the sig divider 24 to outputs the error component thereof . the charge pump 26 generates an output current iout based on the error component of the compared result by the phase comparator 25 . the digital tuning control unit ( or fixed - value capacitor controlling unit ) 3 includes a first counter 31 , a second counter 32 , a comparator 33 , a first calculation circuit 34 and a second calculation circuit 35 . the first counter 31 counts the cycles of the r - divided signal f ref / r output from the ref divider 22 . the first counter 31 outputs the output signal trig set at “ high ” until the count value becomes “ n ”, and outputs the output signal trig set at “ low ” when the count value reaches “ n ”. the count number “ n ” is a variable value set by the first calculation circuit 34 based on the judgment accuracy given as an external signal . the second counter 32 counts the cycles of the p - divided signal f vco / p while the output signal trig output from the first counter 31 is set at “ high ” and outputs the counted result “ q ” to the comparator 33 . the first calculation circuit 34 controls the entire operation of the digital tuning control unit 3 . the first calculation circuit 34 inputs a frequency dividing ratio setting signal ( or a channel selection signal ), a predetermined convergence range , and a judgment accuracy as external signals . in addition , the first calculation circuit 34 inputs an output “ error ” from the comparator 33 . the first calculation circuit 34 outputs a calculated value q_cal ′ to the comparator 33 . the first calculation circuit 34 calculates an initial value “ cf — 0 ′ of the selection signal cf [ m - 1 : 0 ] for the switches of the fixed - value capacitors of the vco unit 1 based on an internal formula and the frequency dividing ratio setting signal . further , the first calculation circuit 34 outputs a termination signal for terminating the process of digital tuning by comparing the output “ error ” from the comparator 33 with the predetermined convergence range . further , the first calculation circuit 34 outputs the dividing number r for the ref divider 22 , the dividing number n for the sig divider 24 and the dividing number p for the prescaler 24 a . the comparator 33 compares the count result “ q ” output from the second counter 32 with the calculated value q_cal ′ to output the differential operator as the output “ error ”. the second calculation circuit 35 corrects the selection signal cf [ m - 1 : 0 ] based on the output “ error ” from the comparator 33 to output the corrected value to the group of fixed - value capacitors 12 of the voc unit 1 . the bias circuit 5 outputs a reference voltage as a bias voltage . the switching circuit 6 includes a switch for selectively connecting the lpf unit 4 to the bias circuit 5 or the charge pump 26 . the switching circuit 6 connects the lpf unit 4 to the bias circuit 5 at the process of digital tuning and connects the lpf unit 4 to the charge pump 26 at the process of analog tuning . the lpf unit 4 includes passive circuits such as capacitances ( c ) and resistances ( r ). the lpf unit 4 outputs the output voltage output from the bias circuit 5 as it is at the process of digital tuning and converts the output current output from the charge pump 26 to the voltage by charging or discharging the output current to the capacitors in the lpf unit 4 at the process of analog tuning . the operation of the pll frequency synthesizer in this embodiment will be explained with reference to fig3 and fig4 . the operation of the pll frequency synthesizer in this embodiment includes two processes , the process of digital tuning and the process of analog tuning , where these processes are executed in this order . although it is not described in the drawing , the pll frequency synthesizer includes a control unit which controls the operation of the components of the pll frequency synthesizer such that the process of digital tuning and the process of analog tuning are executed in this order . fig3 shows a relationship between the selection signal cf [ m - 1 : 0 ] and the vco frequency f vco . in the process of digital tuning , the vco frequency f vco can be discretely changed as the selection signal cf [ m - 1 : 0 ] changes . in this process , the operations of the phase comparator 25 and the charge pump 26 of the pll unit 2 are stopped and the switching circuit 6 connects the lpf unit 4 to the bias circuit 5 . therefore , the control voltage vtune of the vco unit 1 is fixed at a predetermined bias voltage output from the bias circuit 5 . it means that the vco frequency f vco is controlled only by the selection signal cf [ m - 1 : 0 ], hence the digital tuning control unit 3 controls the vco frequency f vco . the selection signal cf [ m - 1 : 0 ] includes a plurality of bits , same bit &# 39 ; s number as the number of the fixed - value capacitors . the combination of the fixed - value capacitors is determined by the value of the respective bits of the selection signal cf [ m - 1 : 0 ], and the selection signal cf [ m - 1 : 0 ] is determined such that the discrete changes of the vco frequency f vco have almost even intervals . fig4 shows a relationship between the control voltage vtune and the vco frequency f vco in the vco unit 1 . in the process of analog tuning , the vco frequency f vco is changed by changing the control voltage vtune . in this process , the operation of the digital tuning control unit 3 is stopped with holding the selection signal cf [ m - 1 : 0 ] fixed at the final process of the digital tuning . the switching circuit 6 connects the lpf unit 4 to the charge pump 26 . at this time , the operations of the phase comparator 25 and the charge pump 26 , which were stopped in the process of digital tuning , are started . it means that the vco frequency f vco is controlled only by the control voltage vtune , hence the pll unit 2 controls the vco frequency f vco . the operation of the pll frequency synthesizer in this embodiment will be explained in more detail with reference to fig5 a and 5b . fig5 a and 5b show flow charts of the operation of the pll frequency synthesizer . the frequency dividing ratio setting signal is input to the pll unit 2 and to the digital tuning control unit 3 . the predetermined convergence range and the judgment accuracy are also input to the digital tuning control unit 3 . calculation of the calculated value “ q_cal ′” and the initial value “ cf — 0 ” by the first calculation circuit 34 ( step s 102 ) the frequency dividing ratio setting signal , the predetermined convergence range and the judgment accuracy are input to the first calculation circuit 34 and two parameters including the calculated value “ q_cal ′” and the initial value “ cf — 0 ” are calculated . as for calculating the calculated value “ q_cal ′ and the initial value “ cf — 0 ”, the equations ( 4 ) and ( 6 ), described hereinafter , are respectively used . switching change of the switching circuit 6 and stopping the operations of the phase comparator 25 and the charge pump 26 ( step s 103 ) the input of the switching circuit 6 is connected to the bias circuit 5 and the operations of the phase comparator 25 and the charge pump 26 of the pll unit 2 are stopped such that the output iout of the pll unit 2 is not input to the switching circuit 6 . setting the repetition number “ k ” for the judgment to “ 0 ” ( step s 104 ) the repetition number “ k ” for the judgment is set to “ 0 ”. resetting the first counter 31 and the second counter 32 ( step s 105 ) the internal count values in the first counter 31 and the second counter 32 are set to “ 0 ”. whether the repetition number “ k ” is equal to zero or not is judged . when the repetition number “ k ” is “ 0 ” ( yes of step s 106 ), the next step will be step s 108 , shown in fig5 b . when the repetition number “ k ” is not “ 0 ” ( no of step s 106 ), the next step will be step s 107 . correction of the cf [ m - 1 : 0 ] by the second calculation circuit 35 ( process of correcting the f vco ) ( step s 107 ) the selection signal cf [ m - 1 : 0 ] to be set in a next step is calculated by the second calculation circuit 35 based on the present selection signal cf [ m - 1 : 0 ] and the output “ error ” from the comparator 33 . the formula for the correction of the cf [ m - 1 : 0 ] is shown as equation ( 8 ) which will be described herein after . the present cf [ m - 1 : 0 ] is input to the group of fixed - value capacitors to determine the f vco ( step s 108 ) the present selection signal cf [ m - 1 : 0 ] is input to the group of fixed - value capacitors 12 of the vco unit 1 to change the vco frequency f vco . dividing the f vco by the prescaler 24 a and inputting the signal f vco / p to the second counter 32 ( step s 109 ) the vco frequency f vco determined in step s 108 is input to the prescaler 24 a of the pll unit 2 . then the divided signal “ f vco / p ” divided by the prescaler 24 a is input to the na counter 24 b . the second counter 32 counts up the signal f vco / p while the output “ trig ” output from the first counter 31 is set at “ high ” ( process of detecting f vco ) ( step s 110 ) the output signal “ trig ” from the first counter 31 is kept at “ high ” until the count value of the first counter 31 becomes “ n ” set in the first counter 31 . the second counter 32 counts up the p - divided signal “ f vco / p ” during the period while the output signal “ trig ” is set at “ high ”. the counted result “ q ” counted by the second counter 32 is output to the comparator 33 . the comparator 33 outputs the differential operator between the counted result “ q ” by the second counter 32 and the calculated value “ q_cal ′” by the first calculation circuit 34 as the output “ error ” ( process of judging the f vco ) ( step s 111 ) the comparator 33 compares the calculated value “ q_cal ′” obtained in step s 102 and the counted value “ q ” obtained in step s 110 to obtain the differential operator therebetween and outputs the result as the output “ error ” to the second calculation circuit 35 . judging whether the output “ error ” is within a predetermined convergence range ( step s 113 ) the output “ error ” obtained in step s 111 is compared with the predetermined convergence range set in step s 102 . when the output “ error ” is within the condition ( yes of step s 113 ), the next step will be step s 114 . when the output “ error ” is not within the condition ( no of step s 113 ), the next step will be step s 105 . process of digital tuning is completed with holding the set selection signal cf [ m - 1 : 0 ] ( step s 114 ) process of digital tuning is completed with holding the present selection signal cf [ m - 1 : 0 ]. then , the next step will be step s 115 and the process of analog tuning is started . switching change of the switching circuit 6 and starting the operations of the phase comparator 25 and the charge pump 26 ( step s 115 ) the input of the switching circuit 6 is connected to the charge pump 6 and the operations of the phase comparator 25 and the charge pump 26 , which have been stopped during the process of digital tuning , are started . starting the process of analog tuning ( where the f vco is controlled by the pll unit 2 ) ( step s 116 ) the pll unit 2 changes the control voltage vtune of the vco unit 1 to make the vco frequency f vco convergent to the frequency provided as the frequency dividing ratio setting signal input in step s 101 . the entire process is terminated when the vco frequency f vco converges . next , the formulas necessary for calculations in the processes described above will be explained . t 1 : period or cycle of the input signal to the first counter 31 ( t 1 = r / f ref ). [ 2 ] t 2 : period or cycle of the input signal to the second counter 32 ( t 2 = p / f vco ). [ 3 ] tg : period while the output “ trig ” to the first counter 31 is kept at “ high ” ( tg = t 1 × n ). [ 4 ] n : setting value for the first counter 31 set by the first calculation circuit 34 . [ 5 ] q : counted result by the second counter 32 . [ 6 ] q_cal ′: calculated ideal value for the counted result q of the second counter 32 . the counted result q obtained by the second counter 32 becomes q_cal ′ when the vco frequency f vco is equal to the frequency set by the frequency dividing ratio setting signal . [ 7 ] freso : changes in the amount of the vco frequency f vco when the counted result q of the second counter 32 changes “ 1 ” ( freso = f vco ( q + 1 )− f vco ( q )). [ 8 ] f vco — 0 : the vco frequency when the selection signal cf [ m - 1 : 0 ]= 0 . [ 9 ] cf — 0 : the selection signal cf [ m - 1 : 0 ] of the initial state of the process of digital tuning . [ 10 ] the internal ideal formula : the relationship between the selection signal cf [ m - 1 : 0 ] and the vco frequency f vco defined by a linear equation . ( f vco = f vco — 0 − freso × cf [ m - 1 : 0 ]) [ 11 ] n : frequency dividing ratio of the sig - divider 24 of the pll unit 2 ( f vco = f ref × n ). fig6 shows the relationship between the counting operation of the first counter 31 and that of the second counter 32 . from the relationship shown in fig6 , it can be obtained that : since the counted result q has an error of ± 1 , the symble “≈” is used in equation ( 1 ), however , the term “≈” will be expressed simply as “=” hereinafter . from the definitions [ 1 ] and [ 2 ] and the equation ( 1 ), ( r / f ref )× n =( p / f vco )× q , thus here , in order to simplify the equation , it is assumed that r = 1 . and then , from the definition [ 11 ] and the equation ( 2 ), q =( f vco / f ref )×( n / p ), thus considering the right side of the equation ( 3 ), only “ n ” is changed when the vco frequency f vco is changed . hence , it is possible to obtain the calculated ideal value “ q_cal ′” based on the frequency dividing ratio setting signal with the equation ( 3 ). the calculated value “ q_cal ′” which is the ideal value for the q can be calculated as follows . f vco = f vco — 0 −( f ref × p / n )× cf [ m - 1 : 0 ] cf [ m - 1 : 0 ]=( f vco — 0 / f ref )×( n / p )−( n × n / p ) ( 6 ) here , considering the right side of the equation ( 6 ), if the vco frequency f vco — 0 obtained when the selection signal cf [ m - 1 : 0 ]= 0 is previously stored , only “ n ” is changed when the vco frequency f vco is changed . hence , it is possible to calculate the value cf — 0 which is the initial value of the selection signal cf [ m - 1 : 0 ] with the equation ( 6 ). the initial value cf — 0 of the selection signal cf [ m - 1 : 0 ] is obtained by the following equation . cf — 0 =( f vco — 0 / f ref )×( n / p )−( n × n / p ) hence , the following equation is calculated in the second calculation circuit 35 , here , as it is necessary to add weighted value to the value of the error based on the set judgment accuracy , the selection signal cf [ m - 1 : 0 ] becomes as follows , as mentioned above , there has been a problem that “ wider bandwidth ” and “ high - speed responsibility ” cannot be compatible with each other in the conventional pll frequency synthesizers . however , this trade - off is solved in the pll frequency synthesizer of the embodiment according to the present invention . the mechanism to solve this trade - off will be explained hereinafter . the “ wider bandwidth ” of the pll frequency synthesizer can be realized by increasing the number of the fixed - value capacitors composing the group of fixed - value capacitors 12 as shown in fig2 . increase of the fixed - value capacitors composing the group of fixed - value capacitors 12 means that the range of the selection signal cf [ m - 1 : 0 ], the horizontal axis of the graph shown in fig3 , is increased , with the gradient characteristic of the vco frequency f vco kept as it is . for example , when the selection signal cf [ m - 1 : 0 ] is given in binary value , the range of the selection signal cf [ m - 1 : 0 ] becomes 0 to 2 m − 1 . when m = 3 ( when three fixed - value capacitances are included , defined by the weighted value in the binary value , in the group of fixed - value capacitors 12 ), the range of the selection signal cf [ m - 1 : 0 ] becomes 0 to 7 . when m = 10 ( when ten fixed - value capacitances are included , defined by the weighted value in the binary value , in the group of fixed - value capacitors 12 ), the range of the selection signal cf [ m - 1 : 0 ] becomes 0 to 1023 . assuming that the gradient characteristic of the vco frequency f vco to the selection signal cf [ m - 1 : 0 ] in fig3 does not change , the range of the vco frequency f vco is increased by 128 times . the “ high - speed responsibility ” of the pll frequency synthesizer , in addition to the “ wider bandwidth ” can be realized as follows . as described above , when m = 10 and the selection signal is expressed in 10 bits binary value , where the “ wider bandwidth ” of the pll frequency synthesizer is realized , the selection signal cf [ 9 : 0 ] becomes 0 to 1023 . in this case , conventionally , the process of judging the vco frequency f vco needs to be repeated 1023 times at a maximum when the initial value of the selection signal cf [ m - 1 : 0 ] is “ 0 ”. even if the initial value of cf [ m - 1 : 0 ] is set at “ 511 ” in order to reduce the repetition number , the process of judging the vco frequency f vco needs to be repeated 512 times at a maximum . on the other hand , it is possible to reduce the convergence time of the pll frequency synthesizer by applying the following three methods in the present embodiment of the pll frequency synthesizer . 1 . the initial value of the selection signal cf [ m - 1 : 0 ] is obtained by the dividing number “ n ” of the sig divider 24 of the pll unit 2 which is determined based on the frequency dividing ratio setting signal input to the pll unit 2 and the equation ( 6 ). it means that the value cf — 0 calculated based on the latest value of the vco frequency f vco with the equation ( 6 ) is used , the initial value for the process of judging the selection signal cf [ m - 1 : 0 ] can be set close to the final expected value , hence it is possible to reduce a number of repetition time for the convergence time of the pll frequency synthesizer . 2 . it is possible to calculate the differential operator between the present vco frequency f vco and an expected value of the vco frequency f vco to cause a feedback based on the differential operator . as shown in the flow chart of the present embodiment in fig5 a and 5b , if the predetermined convergence range is not satisfied after the process of detecting the vco frequency f vco in step s 110 and the process of judging the vco frequency f vco in step s 111 , the corrected selection signal cf [ m - 1 : 0 ] is calculated with the equation ( 8 ) in the process of correcting the vco frequency f vco of step s 107 . it means that , it is possible to correct the vco frequency f vco by the differential operator between the present vco frequency f vco and the expected value of the vco frequency f vco according to the present embodiment , although the vco frequency f vco can be changed by “+ 1 ” or “− 1 ” in the conventional process of correcting the vco frequency f vco with the binary test . therefore , the repetition number for judging the vco frequency f vco can be reduced . as shown in fig7 , the judgment accuracy and the time required for the judgment have a trade - off relationship ( good accuracy = long time ). therefore , by setting the judgment accuracy bad ( rough ) at first and good ( fine ) at last , it is possible to minimize the time required for the judgment . thus , it is possible to realize “ high - speed responsibility ” of the pll frequency synthesizer even if “ wider bandwidth ” is realized in the present embodiment of the pll frequency synthesizer . the pll frequency synthesizer of the present invention includes an oscillator ( lc oscillator ) with an lc resonator . the vco frequency of the lc oscillator is determined by the following equation . where π is ludolphian number . when the lc oscillator is formed on a semiconductor substrate , variations of the inductor ( l ) and the capacitor ( c ) generated in the manufacturing process cause variations of the characteristics of the vco frequency f vco for the same selection signal cf [ m - 1 : 0 ] as shown in fig8 . the initial value cf — 0 is calculated by the first calculation circuit 34 based on the above described internal ideal formula shown as the definition [ 10 ]. the variations of the products caused during the manufacturing process , as shown in fig8 , causes the error between the calculated initial value cf — 0 and actual characteristics of the relationship between the selection signal cf [ m - 1 : 0 ] and the vco frequency f vco . such the error causes , in turn , increases of the repetition times for the convergence test . thus the time required for the convergence is also increased . in this embodiment , it is impossible to prevent increases of the repetition times for the convergence test or the time required for the convergence , even if there is the error between the calculated initial value cf — 0 and actual characteristics of the relationship between the selection signal cf [ m - 1 : 0 ] and the vco frequency f vco . fig9 shows a block diagram of a pll frequency synthesizer of the second embodiment according to the present invention . as shown in fig9 , the present pll frequency synthesizer includes an oscillator unit ( vco unit ) 1 , a phase control unit ( pll unit ) 2 , a digital tuning control unit 3 a , a low pass filter unit ( lpf unit ) 4 , a bias circuit 5 and a switching circuit 6 . referring to fig9 , similar components to those illustrated in fig1 referred to in the first embodiment are given the identical numerals , and description thereof shall be omitted as the case may be . the digital tuning control unit 3 a includes a first counter 31 , a second counter 32 , a comparator 33 , a first calculation circuit 34 , a second calculation circuit 35 a and an f vco initial value register . the second calculation circuit 35 a corrects the selection signal cf [ m - 1 : 0 ] based on the output “ error ” from the comparator 33 , and calculates the differential value acf of the selection signal cf [ m - 1 : 0 ] based on the output “ error ” from the comparator 33 at the beginning of the process . the f vco initial value register 36 stores the differential value δcf of the selection signal cf [ m - 1 : 0 ] calculated by the second calculation circuit 35 a . the operation of the pll frequency synthesizer in this embodiment will be explained in more detail with reference to fig1 and fig1 . data input ( frequency dividing ratio setting signal , predetermined convergence range , and judgment accuracy ) ( step s 201 ) the frequency dividing ratio setting signal is input to the pll unit 2 and the digital tuning control unit 3 a . the predetermined convergence range and the judgment accuracy are also input the digital tuning control unit 3 a . judging whether it is the first operation after the power is on ( step s 202 ) if it is the first operation ( yes of step s 202 ), the step goes to step s 203 . if it is the second or later operation ( no of step s 202 ), the step goes to step s 214 . setting the center frequency of the objective bandwidth as the expected value of the f vco ( step s 203 ) the expected value of the f vco is a finally obtainable vco frequency f vco after the process of digital tuning and the process of analog tuning . here , the center frequency of objective bandwidth is set as the expected value of the f vco . then , in the following step , the differential value between the selection signal cf [ m - 1 : 0 ] obtained by the internal ideal formula and the actual selection signal cf [ m - 1 : 0 ] is detected . calculation of the calculated value “ q_cal ′” and the initial value “ cf — 0 ” by the first calculation circuit 34 ( step s 204 ) two parameters including the calculated value “ q_cal ′” and the initial value “ cf — 0 ” are calculated based on the expected value of the f vco obtained in step s 203 . the formulas ( 4 ) and ( 6 ), described above , are respectively used to obtain the “ q_cal ′” and the “ cf — 0 ”. switching change of the switching circuit 6 and stopping the operation of the phase comparator 25 and the charge pump 26 . ( step s 205 ) the input of the switching circuit 6 is connected to the bias circuit 5 and the operation of the phase comparator 25 and the charge pump 26 of the pll unit 2 are stopped such that output iout of the pll unit 2 is not input to the switching circuit 6 . resetting the first counter 31 and the second counter 32 ( step s 206 ) the internal count values in the first counter 31 and the second counter 32 are set to “ 0 ” ( counter reset ). the vco frequency f vco is determined as the cf — 0 is input to the group of fixed - value capacitors ( step s 207 ) the initial value “ cf — 0 ” of the selection signal cf [ m - 1 : 0 ] is input to the group of fixed - value capacitors 12 of the vco unit 1 . then , the vco frequency f vco is determined . dividing the f vco by the prescaler 24 a and inputting the signal f vco / p to the second counter 32 ( step s 208 ) the vco frequency f vco determined in step s 207 is input to the prescaler 24 a of the pll unit 2 . then the divided signal “ f vco / p ” divided by the prescaler 24 a is input to the second counter 32 . the second counter 32 counts up the signal f vco / p while the output “ trig ” from the first counter 31 is set at “ high ” ( a first process of detecting f vco ) ( step s 209 ) the output signal “ trig ” from the first counter 31 is kept at “ high ” until the count value of the first counter 31 becomes “ n ” set in the first counter 31 . the second counter 32 counts up the p - divided signal “ f vco / p ” during the period while the output signal “ trig ” is set at “ high ”. the counted result “ q ” counted by the second counter 32 is output to the comparator 33 . the comparator 33 outputs the differential operator between the counted result “ q ” by the second counter 32 and the calculated value “ q_cal ′” by the first calculation circuit 34 as the output “ error ” ( a first process of judging f vco ) ( step s 210 ) the comparator 33 compares the calculated value “ q_cal ′” obtained in step s 204 and the counted value “ q ” obtained in step s 209 to obtain the differential operator therebetween and outputs the result as the output “ error ” to the second calculation circuit 35 a . obtaining the “ δcf ” from the output “ error ” and storing it to the f vco initial value - register 36 ( step s 211 ) the output “ error ” obtained in step s 210 is the differential operator between the internal ideal formula where the f vco is the center of the vco frequency and the actual characteristics of the vco frequency f vco . this difference operator is stored in the f vco initial value register as the differential value “ δcf ” of the selection signal cf [ m - 1 : 0 ]. after this , this “ δcf ” will be always used to calculate the initial value “ cf — 0 ”. resetting the expected value of the f vco to the frequency obtained based on the frequency dividing ratio setting signal ( step s 212 ) although the center frequency of the objective bandwidth is set as the expected value of the f vco in steps s 203 to s 211 , the expected value of the f vco is reset to the frequency obtained based on the frequency dividing ratio setting signal . calculation of the “ q_cal ′” and the initial value “ cf — 0 ”, and correction of the “ cf — 0 ” with the differential value “ δcf ” by the first calculation circuit 34 ( step s 213 ) the frequency dividing ratio setting signal , the predetermined convergence range and the judgment accuracy are input to the first calculation circuit 34 and two parameters including the calculated value “ q_cal ′” and the initial value “ cf — 0 ” are calculated . as for calculating the calculated value “ q_cal ′ the formula ( 4 ) described above is used . as for calculating the initial value “ cf — 0 ”, the following equation ( 9 ) is used . cf — 0 =( f vco — 0 / f ref )×( n / p )−( n × n / p )− δ cf ( 9 ) calculation of the “ n ”, the calculated value “ q_cal ′”, and the initial value “ cf — 0 ” by the first calculation circuit 34 and correction of the “ cf — 0 ” with the differential value “ δcf ” ( step s 214 ) the frequency dividing ratio setting signal , the predetermined convergence range and the judgment accuracy are input to the first calculation circuit 34 and two parameters including the calculated value “ q_cal ′” and the initial value “ cf — 0 ” are calculated . as for calculating the calculated value “ q_cal ′ and the initial value “ cf — 0 ”, the equations ( 4 ) and ( 9 ), described above , are respectively used . switching change of the switching circuit 6 and stopping the operations of the phase comparator 25 and the charge pump 26 . ( step s 215 ) the input of the switching circuit 6 is connected to the bias circuit 5 and the operations of the phase comparator 25 and the charge pump 26 of the pll unit 2 are stopped such that the output of the pll unit 2 is not input to the switching circuit . setting the repetition number “ k ” for the judgment to “ 0 ” ( step s 216 ) the repetition number “ k ” for the judgment is set to “ 0 ”. resetting the first counter 31 and the second counter 32 ( step s 217 ) the internal count values in the first counter 31 and the second counter 32 are set to “ 0 ”. whether the repetition number “ k ” is equal to zero or not is judged . when the repetition number “ k ” is “ 0 ” ( yes of step s 218 ), the step goes to step s 220 . when the repetition number “ k ” is not “ 0 ” ( no of step s 218 ), the step goes to step s 219 . correction of the cf [ m - 1 : 0 ] by the second calculation circuit 35 a ( process of correcting the f vco ) ( step s 219 ) the selection signal cf [ m - 1 : 0 ] to be set in a next step is calculated by the second calculation circuit 35 a based on the present selection signal cf [ m - 1 : 0 ] and the output “ error ” from the comparator 33 with the equation ( 8 ). the f vco is determined when the present cf [ m - 1 : 0 ] is input to the group of fixed - value capacitors ( step s 220 ) the present selection signal cf [ m - 1 : 0 ] is output to the group of fixed - value capacitors 12 of the vco unit 1 to change the vco frequency f vco . dividing the f vco by the prescaler 24 a and inputting the signal f vco / p to the second counter 32 ( step s 221 ) the vco frequency f vco determined in step s 220 is input to the prescaler 24 a of the pll unit 2 . then the divided signal “ f vco / p ” divided by the prescaler 24 a is input to the second counter 32 . the second counter 32 counts up the signal f vco / p while the output “ trig ” from the first counter 31 is set at “ high ” ( second process of detecting the f vco ) ( step s 222 ) the output signal “ trig ” from the first counter 31 is kept at “ high ” until the count value of the first counter 31 becomes “ n ” set in the first counter 31 . the second counter 32 counts up the p - divided signal “ f vco / p ” during the period while the output signal “ trig ” is set at “ high ”. the counted result “ q ” counted by the second counter 32 is output to the comparator 33 . the comparator 33 outputs the differential operator between the counted result “ q ” by the second counter 32 and the calculated value “ q_cal ′” by the first calculation circuit 34 ( second process of judging the f vco ) ( step s 223 ) the comparator 33 compares the calculated value “ q_cal ′” obtained in step s 213 and the counted value “ q ” obtained in step s 214 to obtain the differential operator therebetween and outputs the result as the output “ error ” to the second calculation circuit 35 a . judging whether the output “ error ” is within the predetermined convergence range ( step s 225 ) the output “ error ” obtained in step s 223 is compared with the predetermined convergence range set in step s 201 . when the output “ error ” is within the condition ( yes of step s 225 ), the next step will be step s 226 . when the output “ error ” is not within the condition ( no of step s 225 ), the next step will be step s 217 . process of digital tuning is completed with holding the set selection signal cf [ m - 1 : 0 ] ( step s 226 ) process of digital tuning is completed with holding the present selection signal cf [ m - 1 : 0 ]. then , the next step will be step s 227 . switching change of the switching circuit 6 and starting the operations of the phase comparator 25 and the charge pump 26 ( step s 227 ) the input of the switching circuit 6 is connected to the charge pump 6 and the operations of the phase comparator 25 and the charge pump 26 , which have been stopped during the process of digital tuning , are started . starting the process of analog tuning ( the f vco is controlled by the pll unit 2 ) ( step s 228 ) the pll unit 2 changes the control voltage vtune of the vco unit 1 to make the vco frequency f vco convergent to the frequency provided as the frequency dividing ratio setting signal input in step s 201 . the entire procedure is terminated when the vco frequency f vco converges . thus , as shown in fig1 , the characteristics of the internal formula varies in accordance with the differential value δcf stored in the f vco initial value register 36 . with the pll frequency synthesizer of the second embodiment , the following merits are obtained in addition to those of the first embodiment . the initial value “ cf — 0 ” of the selection signal cf [ m - 1 : 0 ] close to the expected value of the f vco can be obtained by using the differential value “ δcf ” between the internal ideal formula and the actual characteristics of the f vco . as the initial value “ cf — 0 ” of the selection signal cf [ m - 1 : 0 ] close to the expected value thereof is obtained , it is possible to reduce the judging time . therefore , in this embodiment , it is possible to prevent increase of the number or the time for the judging even when the variations of the inductor ( l ) and the capacitor ( c ) generated in the manufacturing process cause variations of the characteristics of the vco frequency f vco for the same selection signal cf [ m - 1 : 0 ]. although the present invention has been described referring to the preferable embodiment , it is apparent to those skilled in the art that the embodiment is only exemplary , and that various modifications may be made without departing from the scope of the present invention . for example , the number of fixed - value capacitors included in each of the group of fixed - value capacitors 12 may be arbitrary set , and a bit length of the selection signal cf [ m - 1 : 0 ] may also be arbitrary set . the pll frequency synthesizer according to the present invention is applicable widely in a mobile - phone and various radio communication equipments with multiple sent and received frequencies . | 7 |
referring to fig1 and 1a , the present debagging apparatus 10 is shown mounted in combination with an automatic package feeder apparatus 12 constructed from a rotofeeder manufactured by fleetwood systems , countryside , ill ., and a conventional apparatus for handling unwrapped articles such as a can end seamer 14 . the ends are arranged in the package feeder in a cylindrical package wrapped in paper and having a longitudinal and lateral axis . the packages are transferred into a receiving means through lateral movement . the unwrapped articles are transferred through lateral movement from the receiving means to the feeding means for further transport . the debagger apparatus comprises generally a receiving means 16 , for laterally receiving bagged , stacked ends from the feeder apparatus 12 ; positioning means 18 at a first , or lower , end of the package for positioning the wrapper at a second , or top , end at a clamping means ; a clamping means 20 at the second end of the wrapper for holding the wrapper during debagging ; rod means 22 for penetrating the wrapper and engaging the articles therein to hold them relative to the clamping means ; and transporting means 24 for longitudinally transporting the clamping means , with the wrapper end in the clamping means , relative to the rod means , thus causing separation of the wrapper from the articles in the receiving means and displacing the wrapper for further handling . the receiving means 16 , as shown in fig1 , 5 , and 6 , comprise a pair of opposing outwardly flanged , angled members 26 , 28 extending substantially the length of the wrapper and the articles therein . each member is angled to form sections comprising , from inwardmost to outwardmost , a planar , rearmost inwardly angled portion 30 ( fig6 ), a laterally extending portion 32 , an inwardly curved lip portion 34 , and an outwardly curved flange portion 36 . the members 26 , 28 thereby provide a package receiving pocket of uniform longitudinal cross section around a vertical receiving pocket center line 38 . each member 26 , 28 is longitudinally pivotal and supported on an upper and a lower hinge 40 , 42 mounted through mounting plates 44 , 46 to the inwardly angled portion 30 of the member . the mounting plates are secured to a vertically extending main apparatus support 48 . the members 28 , 30 are made resiliently deflectable to retain therebetween the packages and the unwrapped articles by an upper and lower pair of opposed spring assemblies 50 , 52 . the spring assemblies are mounted in axial displacement from the central portion 30 of each member through a bracket 53 extending normally outwardly from the central portion . the spring assemblies further comprise a compression spring 54 extending from the bracket 53 to a centrally inwardly angled pivot arm 56 pivotally mounted through a bearing unit 58 to a hinge and spring mounting plate 44 , 46 connected to the main apparatus support 48 . as shown in fig6 the bearing units comprise ball lock pins 60 , 62 to permit wider service access to the receiving pocket by spreading the elongated members 26 , 28 . the compression springs are adjusted to position the elongated members 26 , 28 with their central portions parallel to the direction of package feed as indicated by arrow 74 and spaced apart a distance approximating the diameter of the package to be received . lateral movement of a cylindrical package will thus cause the members to spread through entry or exit force and return through compression spring force to rest position with an entering package laterally supported by , but longitudinally freely movable within , the receiving pocket . the positioning means 18 , as shown in fig1 , 5 , 9 , and 10 , longitudinally orient the package and the unwrapped articles in the apparatus . the positioning means comprise a horizontal , planar support surface 64 comprised in the upper surface of a plate and bracket member 66 extending outwardly from the main apparatus support 48 beneath the receiving means . a wrapper restraining bail 68 is mounted to pivot against the support surface 64 below a laterally inward portion of the receiving means . the wrapper restraining bail 68 comprises an angled rod member 70 terminating upwardly in a linear portion 72 extending parallel to the support surface 64 , just above the support surface , and transverse to the direction of package feed as indicated by arrow 74 ( fig5 ). from the upper linear portion 72 , the angled rod member 70 is curved downwardly and curved again outwardly , oppositely of the direction of arrow 74 , to a fixed pivot bearing 76 . from pivot 76 the angled rod member extends upwardly and outwardly to a cylinder rod 78 , to which the rod member is pivotally attached . the cylinder rod 78 operatively extends from a restraining clamp cylinder 80 fixedly mounted to a plate 82 extending from the feeding means discussed below . the cylinder 80 is a reciprocating , fast acting , double acting pneumatic cylinder , as are all other cylinders referred to in the present specification unless otherwise noted . the angled rod member 70 is arranged to securely engage the support surface 64 upon extension of cylinder rod 78 . the lower wrapper restraining bail thus restrains the bottom flap of a wrapper resting in the receiving pocket between the support surface 64 and the angled rod member 70 . as shown in fig9 the support surface , apart from supporting the package also guides the bottom flap into and under the restraining clamp by an outward foot portion 84 . the upper surface 86 of the outward foot portion is parallel to and longitudinally upwardly displaced from the main support surface 64 . the upper surface 86 is aligned with the support surface 88 of the feeder means . the foot portion terminates laterally inwardly in an inwardly downwardly linearly tapered portion 90 extending to the main support surface 64 . the bottom flap of the entering package is thus guided along the upper support surface 86 , down the tapered portion 90 , along the main support surface 64 , and under the raised tubular member . a positioning cylinder 92 longitudinally moves the wrapped articles upwardly from the support surface 64 , 86 along an axis parallel to the central longitudinal axis 38 of the receiving pocket . the positioning cylinder 92 is vertically mounted to the plate and bracket member 66 . the rod 94 extending from the positioning cylinder 92 terminates in a broadly flattened tip 96 for supporting the package during extension of the rod 94 . during extension , the tip 96 passes through an aperture 98 in the foot portion 84 of the support surface and engages a laterally outward portion of the bottom surface 100 of a package contained in the receiving means to move the package along the central axis 38 within the receiving means to a proper position with regard to the clamping means . referring now to fig1 , 3 , 7 and 8 , the clamping means 20 comprises a first clamp 102 for circumferentially surrounding an end portion of the wrapper , a second clamp 104 for engaging an upper end portion of the wrapper between the second clamp and the first clamp , and a longitudinally movable platform 106 on which the first and second clamps are mounted . the first clamp 102 comprises a pair of opposed semicylindrical clamping members 108 , 110 centered about and extending longitudinally parallel to the receiving means center line 38 . the clamping members open and close through arcuate hinged movement about a common central split hinge 112 . the hinge 112 is located along a central lateral line 114 extending through the center of the receiving pocket , the center of the cylinder formed by the clamping members 108 , 110 , and parallel to the rearward direction of feeding movement indicated by arrow 74 . the hinge 112 is rearward of the clamping members 108 , 110 . each clamping member is attached to the hinge 112 by a short , tapered swing arm portion 116 extending inwardly from a rearward , central edge portion of the member and terminating in an annular sleeve portion 118 , 120 which is above the swing arm portion 116 of one clamping member and below the swing arm portion of the other member , so that both sleeve portions have a common central longitudinal axis 122 parallel to the central axis 38 of the clamping means and on the central lateral line 114 . a pin 124 extends along the common central axis 122 , through the sleeve portions from the platform 106 to a hinge support member 126 mounted through a spacer block 128 on the lower side , facing the receiver means , of the platform . the upper and lower surfaces of the clamping members 108 , 110 are approximately coplanar with the upper surface of the platform 106 and the lower surface of the support member 126 , respectively . the upper edge surfaces 128 , 130 of the clamping members define , in the closed position , a circle normal to the central axis 38 and bounded by the smooth parallel inner and outer surfaces of the clamping members . the upper edge surfaces 128 , 130 form a second clamp abutment surface . the clamping members 108 , 110 are pivotally opened and closed by a pair of clamping member cylinders 132 , 134 . each cylinder is rearwardly secured to a pin 136 extending downwardly from the lower side of the platform 106 . a cylinder rod 138 extends forwardly outwardly from each cylinder and is threadably adjustably received in a cylinder rod attachment member 140 pivotally attached to a tab portion 142 extending radially outwardly from the clamping member 108 , 110 at a rearward angle to the central lateral line 114 . the clamping member cylinders 132 , 134 are thus arranged to extend and retract along lines parallel to the central lateral line 114 to close and open , respectively , the clamping members 108 , 110 between a closed position in which the members are in opposing abutment to form a circumferentially continuous clamp and an open position in which the forward edge abutting surfaces 144 , 146 of the members are widely spread , outwardly and rearwardly of the receiving pocket and thereby freely permit disassociation of the removed wrapper from the clamping means . the second clamp 104 comprises longitudinally movable plate means 148 ( fig2 ) of generally circular cross section , of a diameter slightly larger than the diameter of the two closed clamping members 108 , 110 , and having a planar lower surface for engagement with the upper clamping member surfaces 128 , 130 . the plate means 148 is centered on the receiving pocket center line 38 and is fixed to a cylindrical support member 150 having a diameter approximately two thirds that of the plate means and having a planar lower abutment surface for firmly supporting the plate means . the support member 150 and plate means 148 bear therethrough a cylindrical bore 152 containing a bushing for freely slidably receiving a rod member 154 acting as part of the rod means described below . an apertured cover plate 156 is mounted across the upper surface of the support member 150 to protect the bushing and guide the rod member 154 through the support member bore 152 . the support member 150 is mounted on a forked , reciprocating support arm 158 having forks extending oppositely parallel to the lateral central line 114 and pivotally attached through pins 159 to radially opposite sides of the support member . the forked arm 158 extends inwardly to a bearing sleeve portion 160 , parallel to the receiver pocket axis 38 . the bearing sleeve portion 160 contains a cylindrical aperture 162 for freely slidably receiving therethrough a clamp guide shaft 164 extending upwardly from a central outward portion of the platform 106 . the second clamp 104 is actuated by a singly acting second clamp cylinder 166 having a rod end cylinder surface 168 facing downwardly and abutting an upper surface of the forked arm 158 . a cylinder rod 170 operatively extends from the second clamp cylinder 166 freely through the forked arm 158 to a threadably adjustable mounting nut 172 which secures the cylinder rod to the platform 106 . a compression spring 174 is axially fitted around the cylinder rod 170 between the forked arm 158 and the platform 106 . the upper end of the cylinder is fixed on upper end of the cylinder rod 170 . thus the single action cylinder is activated to retract the cylinder arm which in turn forces the cylinder and the plate means 148 operatively associated therewith down on the clamp guide shaft 164 towards the platform 106 . the mounting nut 172 is adjusted to provide secure engagement during retraction between the plate means 148 and the second clamp abutment surface of the clamping members 108 , 110 . referring now to fig1 and 2 , the rod means 22 comprises a rod member 154 having a generally conical tip 176 and an end connected to a rod means cylinder 178 . the rod member 154 extends and reciprocates along the receiving pocket axis 38 through the second clamp as described above . it terminates downwardly in a generally conical tip 176 which is gradually tapered and has a bluntly rounded bottom for penetrating a wrapper and engaging the articles therein . the rod member 154 terminates upwardly in a threaded connecting member 180 threadably adjustably attached to a short rod means cylinder rod 182 extending from the rod means cylinder 178 . the rod means cylinder 178 is secured to a longitudinally fixed , laterally pivotal upper plate member 184 by a side bar member 186 mounted to the side of the cylinder perpendicularly to the upper plate member and by an adjustment nut 188 surrounding the cylinder rod shaft 182 to force the cylinder 178 against the plate member . the rod means may be fully extended to position the rod tip 176 downward of the clamping members 108 , 110 to the top of a package resting on the support surface 64 , partially fixably extended to lie approximately within the clamping members 108 , 110 to engage and retain articles therein , and retracted to a position within the second clamp 104 . referring now to fig1 , and 3 , the transporting means 24 comprises the longitudinally fixed , laterally pivotally mounted upper plate member 184 serving to support the rod means and a motor means 190 for rotating a drive shaft 192 extending to and through the platform 106 , a linear actuator 194 associated with the drive shaft , a guide shaft 196 for guiding the longitudinal movement of the platform , and a pivotal axis 198 about which the platform and upper plate member may laterally rotate . the shafts and axis extend parallel to the central receiving pocket axis 38 . the upper plate member 184 is supported longitudinally above the platform 106 at a distance at least equal to the length of the wrapper to be separated . the upper plate member is supported by the drive and guide shafts and the pivot assembly . the drive shaft 192 bears at its uppermost end a relatively large diameter pulley wheel 195 rotatably mounted above the upper plate member 184 and driven in an approximate 3 : 1 ratio by a belt from a smaller pulley wheel 200 from the motor means 190 . the drive shaft 192 extends freely rotatably through the upper plate member , where it is surrounded by a mounting and bearing housing 202 , through the platform 106 to a receiving socket 204 mounted on a longitudinally fixed , pivotal lower shaft plate 206 extending parallel to the central lateral axis 114 a short distance below the platform 106 . a linear actuator 194 is circumferentially mounted around the drive shaft 192 and fixed to the platform 106 through a mounting bracket 208 extending downwardly from the linear actuator . the preferred linear actuator comprises a rohlix brand actuator having a cylindrical housing 210 and off - center cams 212 mounted at an angle to the drive shaft and riding on the drive shaft so that rotation of the drive shaft causes upward or downward movement of the actuator . rotation of the drive shaft is controlled by an electric motor 190 mounted shaft downward to a laterally innermost portion of the upper plate member 184 and spaced thereabove by a short mounting arm 214 . the small pulley wheel 200 is mounted on the motor shaft and is connected by a pulley belt 216 to the large pulley wheel 194 fixed on the upper end of the drive shaft 192 above the upper plate member . the lower shaft plate 206 rotatably receives and partially supports the drive shaft 192 . the guide shaft 196 also is pivotally and supportively received in a laterally inward socket portion 218 of the lower shaft plate 206 . the guide shaft 196 extends upwardly to a laterally inward portion of the upper plate member 184 just outwardly spaced of the shaft of the motor 190 , where the guide shaft 196 is rotatably received by an upper socket portion 220 facing downwardly from the upper plate member . the guide shaft 196 also extends through a longitudinally extending cylindrical bearing sleeve portion 197 of the platform 106 . the bearing sleeve portion 197 is secured to the platform 106 through an outwardly tapered , upwardly extending brace plate 199 . as shown in fig3 the guide shaft 196 and drive shaft 192 are on the central lateral axis 114 of the device . the guide shaft 196 serves to guide the platform 106 and associated structure up the drive shaft 198 and also to prevent pivotal rotation of the platform 106 , upper plate 184 , and lower plate 206 resulting from torque from the motor 190 as the motor turns the drive shaft 198 to raise and lower the platform 106 and the clamping means associated therewith . the lower shaft plate 206 receives therethrough a lower pivot assembly constructed around the pivotal axis 198 . the assembly comprises a pivot support brace 222 fixedly mounted on the main apparatus support 48 . the brace 222 comprises a pivot bearing pin 224 extending upwardly therefrom . an open ended cylindrical pivot tube 226 is rotatably fitted over the pin and extends upwardly to a similar pin extending downwardly from a laterally inward portion 226 of the upper plate member 184 . the pivot tube is transversely offset from the guide shaft and the platform 106 . the brace 222 further comprises a bearing surface 228 on which the lower plate 206 is pivotally supported . as shown in fig3 the upper plate member 184 , lower plate 206 , and platform 106 are laterally rotatably axially displaced about pivot axis 198 through the action of a platform rotating cylinder rod 230 pivotally connected to a rotatable rectangular carriage plate 232 laterally parallel to the center line 114 and fixedly mounted to the pivot tube 226 . a pivotal cylinder 234 ( fig1 ) is secured to the main apparatus support 48 at a position longitudinally intermediate of the platform 106 and the upper plate member 184 . extension of the pivotal cylinder 234 thus rotates the pivot tube 226 to rotate the platform 106 through approximately 45 ° of arc and to laterally inwardly displace the clamping means at the laterally outward portion of the platform 106 due to the transversely offset pivot axis 198 . the foregoing apparatus , wherein the receiving means is fixed in a longitudinally upright position , is particularly constructed for feeding and ejecting means which laterally transport incoming packages and outgoing unwrapped articles in an upright position and which feed and eject along a common lateral axis 114 . referring now to fig1 and 1a , the preferred feeding means 12 comprises a pair of axially spaced upper and lower driven endless chain belts 236 , 238 , a plurality of upright , generally semicylindrical article carrying members as indicated at 240 extending between and movable by the belts , and a first push means 242 for laterally pushing the wrapped articles into the receiving means 16 . the upper and lower endless chain belts 236 , 238 are driven by a feeding means motor 244 which drives a shaft 246 extending between the two belts , which are driven by sprockets 247 connected to secondary belts 248 , 250 from the shaft . the belts and motor are supported by a feeder frame 252 comprising an upper brace 254 and a lower channel member 256 which support a number of belt sprockets 257 . the frame 252 comprises vertical struts 258 extending between the parallel upper brace 254 and lower channel member 256 . the channel member 256 guides and supports the carrying members 240 as they are driven by the endless chain belts 248 , 250 around the feeder in an endless loop counterclockwise , or from left to right in the view of fig1 . the first push means 242 comprises a thin , upright bar member 260 supported on upper and lower ball bushing guides 262 and laterally reciprocably operable along the central lateral line 114 by a feeding cylinder 264 which is laterally inwardly facing and mounted at a longitudinally midway position on the feeder frame 252 . the bar member 260 is relatively thin and extends substantially the entire length of the carrying members and operates by passing through a slot 261 in the rear of each carrying member and extending into the carrying member . the carrying members 240 are constructed to be laterally alignable with the receiving pocket . as shown in fig4 and 5 , the bottom support surface 88 of a carrier member is essentially coplanar with the outer foot portion 86 of the receiving means . a bottom flap guide bar 268 is angled inwardly downwardly along a transversely offset portion of the foot portion to guide the wrapper bottom flap onto the support surface 64 . the inward end 267 of the flap guide is aligned with the restraining clamp rod 72 when the latter is in the upper position . the feeding means motor 244 is stopped when a carrying member 240 is directly opposite the receiving pocket defined by the angled members 26 , 28 . assuming a package in the carrying member 240 and an empty receiving pocket , the feeding cylinder 264 extends to push the bar member 260 through the carrying member thereby transfering the package onto the receiving slot . after the package is unwrapped , the articles are ejected by ejecting means from the receiving slot onto an empty carrying member . the ejecting means comprise an elongated thin bar member 270 similar to the ejecting bar member 260 and extending substantially the length of the receiving members 26 , 28 . the bar is positioned inwardly of the receiving members 26 , 28 and operates between the receiving member hinges and springs . the bar member 270 is slidably mounted on upper and lower ball bushings 272 for reciprocal movement along the pocket center line 114 . the bar member is connected through a mounting hub 274 to the rod of an ejecting means cylinder 276 . the ball bushings 272 and cylinder 276 are mounted to the main apparatus support 48 by mounting plates 278 , 280 . ejecting cylinder 278 thus extends to slide the articles from the receiving pocket along the receiving means support surface 86 onto the bottom surface 88 of a carrying member 240 . the carrying members travel around the periphery of the feeder to transport packages from a loading station to the debagging apparatus and to concurrently transport unwrapped articles , as shown at 240a , to an apparatus 14 for further handling . as shown in fig1 a , articles are delivered to this apparatus through an article ejection assembly 282 at an end of the feeder opposite to the debagging apparatus . the ejection assembly comprises a push bar 284 mounted to a frame strut 286 through a ball bushing 288 and operated by an article ejection cylinder 290 in an manner similar to the feeding and ejecting means described above . the ejected articles enter a chute 292 through which they fall to the article apparatus 14 . the present apparatus is provided with control means to make its operation essentially automatic . the feeder 12 , driven by motor 244 is indexed to the article ejecting means 282 and to the package ejecting means . the motor is activated in response to a demand photocell 294 which is triggered when the apparatus 14 is to receive more articles . the photocell 294 extends the article ejection cylinder 290 to supply more articles to the article apparatus 14 and , upon retraction of the cylinder , advances the next article carrying member . upon activation of motor 244 , the indexing of a carrying member 240 with the receiving means 16 is controlled by a mere switch triggered by a pin on each carrying member . a first control means controls the ejecting means 270 and feeding means 12 in response to the presence or absence of articles in the indexed receiving means or in a feeding means carrier member opposite the receiving means . the control means comprises a limit switch ( a ) 296 for sensing the retracted position of the feeding cylinder 264 , a limit switch ( b ) 298 for sensing the retracted position of the ejecting cylinder 276 , a first photocell 300 and an associated reflector 302 ( fig4 and 5 ) looking through an opposed pair of apertures 304 in the receiving members 26 , 28 to sense the presence of articles therein , and a similar photocell arrangement ( not shown ) looking through apertures 306 in the carrying member 240 for the presence of articles therein . if both cylinders are retracted , the carrying member 240 contains an object and the receiving means 12 does not , the feeding cylinder 264 will extend to feed the apparatus . similarly , if both cylinders are retracted , an object is in the receiving means , and the carrying member 240 opposite the receiving means is empty , the ejecting cylinder 276 will extend to empty the receiving means . the photocells may indicate articles in both the receiving means 16 and in the next adjacent carrier member because the feeder 12 has advanced a carrying member to supply the article handling apparatus 14 . in this case , neither the feeding nor the ejecting cylinder will be actuated . upon extension and retraction of the feeding cylinder 264 and given retraction of ejecting cylinder 276 , indicating the presence of wrapped articles in the receiving means , an unwrapping control sequence comprising positioning , clamping , and transporting is initiated as the restraining clamp cylinder 80 extends to restrain the wrapper flap on the support surface and rod means cylinder 178 extends until the rod tip 176 engages the top of the wrapper . a limit switch ( c ) on the restraining clamp cylinder 80 begins slow extension of the positioning cylinder 92 , thereby raising the package and the rod member 154 associated with the rod means cylinder 178 . a limit switch ( d ) on the rod means cylinder is tripped when the rod tip indicates that the package is just above the upper surfaces 128 , 130 of the clamping means . limit switch ( d ) admits air to both sides of the positioning cylinder 92 to hold the package in place . the raising of the package has caused the bag flap to be pulled down or loosened by the restraining bail associated with the cylinder 80 . the limit switch ( d ) extends the clamping member cylinders 132 , 134 to clamp the upper portion of the package with a portion of the wrapper extending above the clamping members 108 , 110 . an extension limit switch ( e ) on the clamping member cylinder 132 retracts the second clamp cylinder 166 to trap an upper portion of the wrapper , including the &# 34 ; ears &# 34 ; of the wrapper , between the clamps . a limit switch ( f ) on the second clamp cylinder 166 retracts the positioning cylinder 92 . retraction of this cylinder 92 trips a limit switch ( g ) which causes a short burst of air to be delivered to the rod means cylinder 178 , extending the cylinder and causing the tip of the rod 154 to penetrate the wrapper and engage the top of the stacked wrapped articles . approximately two seconds after limit switch ( g ) is activated , the drive motor 190 is started to raise the platform 106 and the clamping means and the wrapper associated therewith . the clamping means is raised along the drive shaft 192 and guide shaft 196 , separating the wrapper from the articles therein , until the platform 106 reaches an upper magnetic proximity switch 308 ( fig2 ). the upper proximity switch 308 retracts the rod means cylinder 178 . after retraction of the rod means cylinder , the first control sequence is repeated with limit switches ( a ) and ( b ) and the photocells looking for an empty carrier member to cause the unwrapped articles to be ejected into the first available carrier member . ejection occurs through extension of the ejection cylinder 276 , which is immediately retracted . retraction of this cylinder 276 activates a limit switch ( h ) to retract the pivotal cylinder 234 to axially displace the wrapper clamped by the clamping means on the platform 106 . at the same time , the second clamp cylinder 166 is de - energized and spring returned and the clamping member cylinders 132 , 134 are retracted to free the wrapper . limit switches ( i , j ) on the clamping means cylinder 134 , 166 indicate unclamping and activate drive motor 190 to lower the platform 106 and strip the wrapper from the rod . the platform is lowered until a lower magnetic proximity switch 310 indicates that the platform has returned to its initial level , at which time the pivotal cylinder 234 is extended to return the clamping assembly to its original position and a receiving sequence is initiated . the limit switches used in the present apparatus may be selected from any type of switch capable of opening and closing a solenoid - controlled air line valve in response to cylinder piston position . suitable limit switches include magnetic reed switches responsive to a magnetic band on the cylinder piston and mechanical pin switches activated by physical displacement of the pin by the piston . a reed switch is presently preferred for limit switch ( d ) so that , during positioning , undue force is not exerted on the wrapped articles . the solenoids , air valves and air lines for carrying out the above control sequences are housed in a feeder cabinet 312 for the feeder and article ejecter cylinders 264 , 290 and a main cabinet 314 for the remaining cylinders . the main air supply enters through a valve 316 , a filter 318 , and a lubricator 320 to the feeder cabinet 312 and through a tee connection 322 to the main cabinet 314 . lines 324 lead from the cabinet to opposing ends of the various cylinders . air is exhausted through filtered , silenced exhausts 326 . the present method and apparatus , as described hereinabove , separates a wrapper from articles wrapped therein with a minimum amount of article and wrapper handling . furthermore , the apparatus operates substantially from pneumatic or hydraulic cylinders and therefore requires a minimum amount of maintenance and repair . in addition , the present apparatus does not destroy or slit the wrapper as it is removed , permitting recycling of the wrapper by repair of the damaged end of the pieced bag and refolding of the restrained flap . as a further advantage , the present apparatus adapts easily to operations which already make use of a conventional rotofeed apparatus and does not require the replacement of existing transporting apparatus . a debagging cycle can be carried out in ten to fifteen seconds . while the inventive concepts have been disclosed herein with reference to an illustrative and presently preferred embodiment thereof , it is to be understood that many of the inventive concepts may be carried out other than as specifically described . for instance , the apparatus need not operate in a vertical mode , but may be variously angled and adapted to other manufacturing equipment . instead of the limit switch ( d ) used to sense the position of the top of the wrapper , an rf proximity switch near the clamping means could be used . instead of a linear actuator 194 used to raise the clamping means , an air cylinder could be used . the receiving means 16 could be included as part of the carrying member 240 . this is advantageous in eliminating the feeding and ejecting cylinders but disadvantageous in tying up the feeding apparatus during the debagging operation . thus , it is intended that the appended claims be construed to include alternative embodiments except insofar as limited by the prior art . | 1 |
turning first to fig1 there is illustrated a pair of hubs used in a unique flexible coupling 10 . the coupling 10 connects two aligned shafts ( not illustrated ), one normally a drive shaft and the other , a driven shaft . the coupling is comprised of a first cylindrical hub 12 and a second cylindrical hub 14 which are substantially identical to each other . each cylindrical hub has a central bore 16 , 18 which is adapted to receive its respective shaft . the bores 16 and 18 can be of different diameters . it is only necessary that they be the proper size to receive the shaft to which it is to be fastened . the hubs 12 and 14 are secured to the shafts by conventional means such as a keyway 20 . however , other conventional manners of affixing the hubs to the shaft can be used such as a set screw or other such similar means . when the hubs 12 and 14 are mounted to their respective shafts , they are in substantially axial alignment as shown in fig1 . a first set of teeth 22 are located on the first face 24 of the hub 12 . the cylindrical hub 14 has a second set of teeth 26 projecting from a second face 28 . the first teeth 22 terminate at ends 30 and the second teeth 26 terminate at ends 32 . the teeth 22 and 26 and their respective ends 30 and 32 are axially aligned with each other when the hubs are assembled to their respective shafts . however , they will normally be spaced a short distance from each other so that there is no metal to metal contact between the ends 30 and 32 . when assembled , the sides of the teeth 22 and 26 lie in the same plane as seen in fig1 . the teeth 22 and 26 are not rectangular or square when viewed from their ends . rather , they are wedge shaped with their exterior edge nearer the outer circumference of the hub 12 or 14 being greater than the interior edge nearer the bores 16 or 18 . in fig2 there is illustrated an elastomeric belt 34 which transmits power from the drive shaft to the driven shaft . the elastomeric belt 34 is usually made of rubber , synthetic rubber , plastic material , or polyurethane . the particular material chosen depends upon the size , load , resistance to oils and chemicals , and temperature for a given application . the belt 34 terminates at split ends 36 and 38 . along the interior of the belt 34 are a plurality of wedge shaped projections 40 . the projections 40 are separated by openings 42 defined by side walls 44 of the projections 40 . except for where the split ends 36 , 38 join together in butting relationship , the projections 40 are connected to adjacent projections 40 by means of a bridging piece or bridging member 41 . the bridging piece 41 is preferably made of the same material as the elastomeric belt 34 and is formed integrally with the belt 34 . the bridging piece 41 has a pleated or serpentine configuration when viewed in cross - section as seen in fig3 . the purpose of the pleating is to act as a shock absorber when the drive shaft starts up and begins transmitting torque to the driven shaft . the pleating flexes when the initial start - up torque is applied and dissipates the shock force . this results in increased life of the elastomeric belt 34 and less shock applied to the driven load . although a pleated configuration is illustrated , other flexible , shock absorbing designs are available . for example , flexible strips of the same or different material can be interposed for the bridging piece 41 . alternatively , a softer material than that of which the projections 40 are made can be used . the main objective is to use a flexible , shock absorbing material as the bridging piece 41 . the number of projections 40 equals the number of teeth on the hubs 12 or 14 . the wedge shaped projections 40 are dimensioned to be closely received in gaps 45 formed between adjacent pairs of aligned teeth . the teeth 22 and 26 are dimensioned to be closely received within the openings 42 in the elastomeric belt 34 . thus , a close frictional fit is realized between the teeth 22 and 26 and openings 42 with the wedge shaped projections 40 closely received within the gaps 45 . after assembly , the sides of the projections 40 lie in a planar surface closely adjacent to and parallel to the plane of the sides of the teeth 22 and 26 . the elastomeric belt 34 , when it is properly installed on the teeth 22 and 26 , retains the respective teeth in substantially axial alignment with each other . furthermore , the elastomeric belt 34 serves to transmit the torque from the drive shaft to the driven shaft in the manner intended . the elastomeric belt accommodates slight misalignment of the shafts without causing undue stress within the belt itself . the belt 34 is easily wrapped around the hubs 12 and 14 when the hubs are mounted to their respective shafts . in this manner , the ends 36 , 38 are spread apart such that the belt 34 is positioned with the projections 40 within their respective gaps 45 . the teeth 22 , 26 are received within the openings 42 . the ends 36 , 38 will remain slightly spaced from each other when the elastomeric belt is completely assembled to the hubs 12 and 14 . nubs 47 on the faces of the belt 34 keep the teeth ends 30 , 32 apart . this avoids metal to metal contact between the ends 30 to 32 . a metal collar 54 maintains the belt 34 in a locked position . the metal collar 54 has an outside surface 56 and an inside surface 58 . the inside surface 58 of the collar 54 is shaped and dimensioned so that the collar 54 is slid axially relative to the hubs 12 and 14 during assembly and disassembly of the coupling 10 so that the metal collar 54 fits very snugly around the belt 34 . the elastomeric coupling 10 allows the elastomeric belt 34 to be replaced without requiring the disassembly or removal of the cylindrical hubs 12 or 14 . all that is required is that the metal collar 54 be removed in the reverse sequence of events used for mounting it and then sliding it off the elastomeric belt 34 . the ends 36 and 38 are spread apart from each other and the belt 34 pulled off from the first and second teeth 22 and 26 . a new belt 34 is installed and the metal collar 54 slid back over the belt 34 . there may also be locating pins 60 on the inside surface 58 that are received in a groove 46 cut into the exterior surface of the belt 34 . this assists in positioning and locking the collar 54 in place . thus , while there has been provided a flexible coupling that has been described in conjunction with a specific embodiment , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , it is intended to embrace all such alternatives , modifications and variations as fall within the spirit and scope of the appended claims . | 8 |
fig1 shows a sideloader liftgate system 10 formed in accordance with an embodiment of the present invention , wherein the liftgate system 10 is installed on a trailer 2 . liftgate system 10 generally comprises a liftgate 12 and a stabilizer leg 20 . liftgate 12 includes a linkage 14 adjustably supporting a cargo platform 16 . stabilizer leg 20 may be , for example , a hydraulic jack . fig2 shows liftgate 12 of liftgate system 10 in greater detail . liftgate 12 is connected to subframe members 4 of trailer 2 by a deployment mechanism 18 that is adjustable to move liftgate 12 sidewise relative to trailer 2 between a storage position and a usage position . in the illustrated embodiment , deployment mechanism 18 includes a push - pull hydraulic cylinder pair 36 and laterally extending tracks 37 on which liftgate 12 is slidably mounted . for example , linkage 14 of liftgate 12 may include a mounting member 28 slidably coupled to tracks 37 , and hydraulic cylinder pair 36 may have a first hydraulic linear actuator 36 a and a second hydraulic linear actuator 36 b arranged to operate in tandem with one another to push liftgate 12 laterally outward from under trailer 2 for deployment , and to pull liftgate 12 laterally inward under trailer 2 for storage . in the embodiment of fig2 , linkage 14 includes a lift arm 24 and a parallel arm 26 adjustably linked to each end of mounting member 28 to provide a pair of parallelogram linkages for adjusting the position of platform 16 relative to mounting member 28 . height adjustment of platform 16 may be powered by a hydraulic lift actuator 30 associated with each lift arm 24 . tilt adjustment of platform 16 may also be provided , and may be powered by another pair of hydraulic actuators 32 not shown in fig2 , but represented schematically in fig4 and 7 . platform 16 may be a folding platform having a primary portion 16 a coupled to arms 24 and 26 , and a folding portion 16 b pivotally coupled to primary portion 16 a by hinges 34 . fig2 also shows constituents of an actuation system 22 operable to adjust both the deployment mechanism 18 and the stabilizer leg 20 . in the exemplary embodiment , actuation system 22 is a hydraulic system having a hydraulic pump box 50 enclosing a motorized hydraulic pump , and a battery box 52 enclosing a power sources therefor . details of hydraulic system 22 will be described below with reference to fig4 , and 7 . fig3 a through 3c provide an operational overview of liftgate system 10 . fig3 a shows liftgate system 10 when liftgate 12 is in a storage position under trailer 2 . as may be seen , stabilizer leg 20 is in a retracted state off of ground g . fig3 b shows liftgate 12 deployed laterally outward to a usage position . when liftgate 12 is moved outward to the usage position by deployment mechanism 18 , stabilizer leg 20 is automatically extended downward to meet ground g . extension of stabilizer leg 20 may take place simultaneously with the deployment motion of liftgate 12 , or may be performed sequentially before or after the deployment motion of liftgate 12 . as will be explained below , deployment of liftgate 12 and extension of stabilizer leg 20 are caused by a single user input command ; a separate command to extend stabilizer leg 20 is not necessary . as may be understood , a reverse process is followed for storing liftgate 12 after use . a single command entered by a user adjusts deployment mechanism 18 to bring liftgate 12 laterally inward underneath trailer 2 , and retracts stabilizer leg 20 out of engagement with ground g . fig4 schematically represents liftgate system 10 . as may be seen , a user interface 80 is provided allowing a user to input commands to a controller 70 which controls a pump and directional valves of hydraulic actuation system 22 to operate deployment mechanism 18 , stabilizer leg 20 , lift actuators 30 , and tilt actuators 32 . fig5 shows one form of user interface 80 , wherein the user interface includes three rotary knobs , each having a neutral position and two opposite operating positions . a top knob 82 is manually rotatable to tilt platform 16 up or down by way of hydraulic tilt actuators 32 . a bottom knob 86 is manually rotatable to raise or lower the height of platform 16 by way of hydraulic lift actuators 30 . in accordance with the present invention , a third knob 84 is manually rotatable in one direction to deploy liftgate 12 by way of deployment mechanism 18 and extend stabilizer leg 20 downward , and is manually rotatable in an opposite direction to store liftgate 12 by way of deployment mechanism 18 and retract stabilizer leg 20 upward . thus , stabilizer leg 20 is automatically extended and retracted in coordination with deployment and storage of liftgate 12 . fig6 and 7 are schematic diagrams of hydraulic actuation system 22 . fig6 illustrates hydraulic flow associated with deployment of liftgate 12 to a usage position and corresponding extension of stabilizer leg 20 , whereas fig7 illustrates hydraulic flow associated with movement of liftgate 12 to a storage position and corresponding retraction of stabilizer leg 20 . looking first at fig6 , a motor 58 is signaled to drive a pump 56 to pump fluid from reservoir 54 , and a directional valve 62 is opened to allow hydraulic fluid to travel to hydraulic actuator s 36 a , 36 b . as may be understood , actuators 36 a and 36 b are oppositely arranged and hydraulic fluid is delivered such that the fluid causes both actuators to extend in opposite directions . as a result , liftgate 12 is deployed laterally outward . pressurized hydraulic fluid is also delivered through valve 64 to stabilizer leg 20 , causing a piston 40 of stabilizer leg 20 to extend downward relative to a cylinder 38 of the stabilizer leg . valve 64 may be a one - way check valve arranged such that when the valve is in its non - actuated state , the valve allows flow to extend stabilizer leg 20 , and prevents opposite flow in order to maintain pressure in cylinder 38 . fluid on an opposite side of piston 40 is forced out of cylinder 38 . similarly , fluid is forced out of actuators 36 a and 36 b . this discharged fluid from cylinder 38 and actuators 36 a and 36 b is circulated through directional valve 62 . turning now to fig7 , directional valve 62 is closed and directional valve 60 is opened . valve 64 is also actuated to permit reverse flow . consequently , pumped hydraulic fluid is directed to the counter side of the pistons of hydraulic actuators 36 a , 36 b and the counter side of piston 40 of stabilizer leg 20 . as may be understood , this causes actuators 36 a , 36 b to retract and pull liftgate 12 back to its storage position , and further causes stabilizer leg 20 to retract . retraction causes fluid to exit actuators 36 a , 36 b and stabilizer leg 20 . actuation of valve 64 allows flow out of the top portion of cylinder 38 . the discharged fluid is routed back through directional valve 60 to reservoir 54 . as will be appreciated from the foregoing description , the present invention enhances safety by ensuring that stabilizer leg 20 is extended when liftgate 12 is deployed for use , and by also ensuring that the stabilizer leg is retracted when liftgate 12 is stored . consequently , human error is eliminated . while the invention has been described in connection with an exemplary embodiment , the detailed description is not intended to limit the scope of the invention to the particular forms set forth . the invention is intended to cover such alternatives , modifications and equivalents of the described embodiment as may be included within the scope of the invention . | 1 |
further scope of applicability of the present invention will become apparent from the detailed description given hereinafter . however , it should be understood that the detailed description and specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only , since various changes and modifications will become apparent to those skilled in the art from the detailed description . fig1 is a block diagram showing an lsi circuit 100 which includes a testing circuit according to the first embodiment of the present invention ( i . e ., a circuit which can perform a testing method according to the first embodiment ). as shown in fig1 , the lsi circuit 100 includes an adc 11 which converts an analog input signal a in1 to a digital signal ( i . e ., a converted value ) d b1 having a plurality of bits ( e . g ., 16 bits ) and an internal logic circuit 12 which operates according to the converted value d b1 outputted from the adc 11 . the lsi circuit 100 also includes a subtracter 13 which calculates an absolute value ( i . e ., a subtraction output value ) | d b1 − d a1 | of a difference between the converted value d b1 outputted from the adc 11 and an expected value d a1 having a plurality of bits ( e . g ., 16 bits ), which is outputted from an external device 30 through an expect terminal . the lsi circuit 100 further includes an exclusive - nor ( enor ) circuit which includes a plurality of enor gates 14 . the enor circuit ( i . e ., the enor gates 14 ) performs an exclusive - nor operation between adjacent bits in the plurality of bits ( e . g ., 16 bits ) constituting the subtraction output value | d b1 − d a1 | which is outputted from the subtracter 13 . in the first embodiment , the number of the enor gates 14 is fifteen . the subtracter 13 and the enor gates 14 constitute the testing circuit of the adc 11 . the expected value d a1 is a digital signal having a plurality of bits ( e . g ., 16 bits ) and corresponds to the analog input signal a in1 inputted to the adc 11 . although fig1 shows that the elements 11 to 14 are formed in a single lsi circuit , the subtracter 13 and the enor gates 14 constituting the testing circuit can be an external device which is separated from the lsi circuit having the adc 11 and the internal logic circuit 12 . the converted value d b1 outputted from the adc 11 is inputted to the subtracter 13 and at the same time , the expected value d a1 is inputted to the subtracter 13 through the expect terminal . the subtracter 13 calculates the absolute value ( i . e ., the subtraction output value having a plurality of bits ) of the difference between the converted value d b1 outputted from the adc 11 and the expected value d a1 . adjacent bits in the plurality of bits constituting the subtraction output value are inputted to the enor gates 14 respectively , as shown in fig1 . each of the enor gates 14 outputs high level to the chk terminals when the adjacent bits agree , and outputs low level to the chk terminals when the adjacent bits do not agree . fig2 is a timing chart for explaining operation of the testing circuit according to the first embodiment ( i . e ., the testing method according to the first embodiment ). in fig2 , strobes st 1 to st 5 indicate timings of monitoring an ad - converted signal ( i . e ., a converted value outputted from the adc 11 ). in this description , binary numbers are put in double quotation marks (“ ”), and hexadecimal numbers are marked with ( h ). with reference to fig2 , operation will be described with reference to a case where a zero - level voltage as an analog input signal a in1 is inputted to the adc 11 and the converted value d b1 outputted from the adc 11 exhibits variations such as 0000 ( h ), 0001 ( h ), ffff ( h ), 0002 ( h ), and fffe ( h ), where a 1 - lsb conversion error is permitted in the adc 11 by the specification . an expected value 0000 ( h ) which corresponds to the zero - level analog input signal a in1 is inputted to the subtracter 13 through the expect terminal . accordingly , if the converted value d b1 outputted from the adc 11 is any of values 0000 ( h ), 0001 ( h ), and ffff ( h ), it is determined as a pass result . on the other hand , if the converted value d b1 outputted from the adc 11 is any of values 0002 ( h ) and fffe ( h ), it is determined a fail result . when the converted values d b1 outputted from the adc 11 , to which the analog input signal a in1 with a zero - level voltage is inputted , are 0000 ( h ), 0001 ( h ), ffff ( h ), 0002 ( h ), and fffe ( h ), the subtracter output values outputted from the subtracter 13 are 0000 ( h ), 0001 ( h ), 0001 ( h ), 0002 ( h ), and 0002 ( h ) respectively , as shown in the timing chart of fig2 . the chk terminals receive and outputs a result of determination whether adjacent bits in the subtracter output value outputted from the subtracter 13 agree or not ( i . e ., exclusive - nor ), such as 7fff ( h ), 7ffe ( h ), 7ffe ( h ), 7ffc ( h ), and 7ffc ( h ), as shown in the timing chart of fig2 . if an expected value of the chk terminals ( e . g ., 15 bits ) is “ 11111111111111 ”, where x indicates a “ don &# 39 ; t care ” bit , the converted values d b1 outputted from the adc 11 , 0000 ( h ), 0001 ( h ), and ffff ( h ) having an error within 1 - lsb are determined as pass results , while the converted values d b1 , 0002 ( h ) and fffe ( h ) having a 2 - lsb error are determined as fail results . as has been described above , according to the testing circuit or testing method according to the first embodiment , accurate pass / fail decision can be made with respect to all converted values outputted from the adc 11 without using an external circuit . also , test time can be shortened because a test can be performed at the same speed as the ad - conversion speed of the adc 11 . fig3 is a block diagram showing an lsi circuit 200 which includes a testing circuit according to the second embodiment of the present invention ( i . e ., a circuit which can perform a testing method according to the second embodiment ). in fig3 , the same reference symbols denote the same or corresponding elements in fig1 . the testing circuit according to the second embodiment differs from that of the first embodiment in the following point . the testing circuit according to the second embodiment includes a bitmask decoder 15 which outputs a mask value having a plurality of bits according to a mask signal dm inputted through a mask terminal from an external circuit ( not shown in the figure ). the testing circuit also includes a logical sum circuit which includes a plurality of or gates 16 and performs a logical sum operation between output values from the enor gates 14 and the output values from the bitmask decoder 15 . the testing circuit further includes a logical product circuit which includes an and gate 17 and performs a logical product operation of the output values from the or gates 16 . the bitmask decoder 15 produces the mask value having a plurality of bits . the mask value can include high level bits . the number , which is counted from the lsb , of the high level bits corresponds to the mask signal dm inputted to the bitmask decoder 15 through the mask terminal . for example , when a 4 - bit 5 ( h ) signal is inputted through the mask terminal to the bitmask decoder 15 , the bitmask decoder 15 outputs a signal having high level in the lower five bits , i . e ., “ 000000000011111 ”. an output of the and gate 17 is connected to a chk terminal . fig4 is a timing chart for explaining operation of the testing circuit according to the second embodiment ( i . e ., the testing method according to the second embodiment ). in fig4 , strobes st 1 to st 5 indicate timings of monitoring an ad - converted signal ( i . e ., a converted value outputted from the adc 11 ). with reference to fig4 , operation will be described with reference to a case where a zero - level voltage as an analog input signal a in2 is inputted to the adc 11 and the converted values d b2 having a plurality of bits outputted from the adc 11 exhibits variations such as 0000 ( h ), 0001 ( h ), ffff ( h ), 0002 ( h ), and fffe ( h ), where a 1 - lsb error is permitted in the adc 11 by the specification . an expected value 0000 ( h ) which corresponds to the zero - level analog signal is inputted through the expect terminal to the subtracter 13 . accordingly , the converted values 0000 ( h ), 0001 ( h ), and ffff ( h ) outputted from the adc 11 are determined as pass results . on the other hand , the converted values 0002 ( h ) and fffe ( h ) outputted from the adc 11 are determined as fail results . the mask terminal is supplied with a mask signal dm “ 0001 ” as the number of a “ don &# 39 ; t care ” bit . the subtracter 13 outputs an absolute value | d b2 − d a2 | of a difference between the converted value d b2 having a plurality of bits and being outputted from the adc 11 and an expected value d a2 having a plurality of bits ( e . g ., 16 bits ) and being inputted from an external device through an expect terminal . the exclusive - nor circuit ( i . e ., the enor gates 14 ) performs an exclusive - nor operation between adjacent bits in the subtraction output value | d b2 − d a2 | having a plurality of bits ( e . g ., 16 bits ) and being outputted from the subtracter 13 . then , the or gate 16 receiving the agreed bits outputs high level , and other or gate 16 receiving the bits which do not agree outputs low level . in this case , an output of the bitmask decoder 15 has high level in the bit or bits which are set as a “ don &# 39 ; t care ” bit . therefore , input values ( i . e ., output values of the enor gates 14 ) of the or gates 16 which do not receive a “ don &# 39 ; t care ” bit are valid . if all the bits are high level , the chk terminal is high level , which means a pass result . when the adc 11 , to which a zero - level voltage as the analog input signal a in2 is inputted , outputs the converted value d b2 , 0000 ( h ), 0001 ( h ), ffff ( h ), 0002 ( h ) and fffe ( h ), the subtracter 13 outputs the subtraction output value 0000 ( h ), 0001 ( h ), 0001 ( h ), 0002 ( h ), and 0002 ( h ), as shown in the timing chart of fig4 . a result of determination whether adjacent bits in the subtraction output value of the subtracter 13 agree or not ( i . e ., exclusive - nor ) are inputted to the or gates 16 ( not shown in fig4 ; it is the same as the chk output shown in fig2 ) and then outputs 7fff ( h ), 7ffe ( h ), 7ffe ( h ), 7ffc ( h ), and 7ffc ( h ) are obtained . the mask terminal is supplied with “ 0001 ”, and therefore the bitmask decoder 15 outputs a 15 - bit signal “ 00000000000000 ”, with high level in the lsb . since the bitmask decoder 15 has the lsb of the or gates fixed to high level , data other than the lsb of the or gates 16 are valid for input values to the and gate 17 . accordingly , signals high , high , high , low , and low in that order are outputted to the chk terminal , as shown in fig4 . when high indicates a pass result and low indicates a fail result , the converted values 0000 ( h ), 0001 ( h ), and ffff ( h ) having an error within 1 - lsb are determined as pass results while the converted values 0002 ( h ) and fffe ( h ) having a 2 - lsb error are determined as fail results . as has been described above , in addition to the advantage of the first embodiment , according to the testing circuit or the testing method according to the second embodiment in which a single chk terminal is used , the tolerable error in the adc 11 can be variably set and the number of test terminals can be reduced . the second embodiment is the same as the first embodiment except for the points described above . fig5 is a block diagram showing an lsi circuit 300 which includes a testing circuit according to the third embodiment ( i . e ., a circuit which can perform a testing method according to the third embodiment ). in fig5 , the same reference symbols denote the same or corresponding elements in fig3 . the testing circuit according to the third embodiment differs from that of the second embodiment in the point that the testing circuit according to the third embodiment includes an internal expected value generator 18 and a test terminal as a substitute for the expect terminal in the first or second embodiment . when the test terminal is high level , the expected value generator 18 , in which a code corresponding to an analog input voltage a in3 is stored in advance , outputs an expected value d a3 having a plurality of bits ( e . g ., 16 bits ) to a subtracter 13 at the same intervals as the ad - conversion by an adc 11 , to which a predetermined signal a in3 is supplied . fig6 is a timing chart for explaining operation of the testing circuit according to the third embodiment ( i . e ., the testing method according to the second embodiment ). in fig6 , strobes st 1 to st 5 indicate timings of monitoring an ad - converted signal ( i . e ., a converted value outputted from the adc 11 ). first , an analog input signal a in3 , which is a predetermined voltage shown in fig6 , is inputted to the adc 11 . here , operation will be described with reference to a case where the analog input signal a in3 is inputted to the adc 11 so that the expected values d a3 are 0002 ( h ) 0004 ( h ), 0001 ( h ), and 0000 ( h ), and the converted values d b3 after the ad - conversion by the adc 11 are 0002 ( h ), 004 ( h ), 0003 ( h ), and ffff ( h ). a conversion error of 1 - lsb are permitted in the adc 11 by the specification , a mask terminal is set to “ 0001 ”, and an lsb in the outputs of a plurality of or gates 16 are fixed to high level . next , when the test terminal is high level , the expected value generator 18 outputs 0002 ( h ), 0004 ( h ), 0001 ( h ), and 0000 ( h ) in synchronization with the ad - conversion cycles . at that time , the subtracter 13 outputs 0000 ( h ), 0000 ( h ), 0002 ( h ), and 0001 ( h ), and a chk terminal outputs high , high , low , and high levels . when the chk terminal outputs high level , it is determined as a pass result and when the chk terminal outputs low level , it is determined as a fail result . accordingly , the converted values 0002 ( h ), 0004 ( h ), and ffff ( h ) which have an error within 1 - lsb are determined as pass results and the converted value 0003 ( h ) which has a 2 - lsb error is determined as fail result . as has been described above , according to the testing circuit or the testing method according to the third embodiment in which the expected value d a3 is generated in an internal circuit , i . e ., the expected value generator circuit , the number of test terminals can be reduced and a simple test program , in which the test terminal is set to be high level and high level of the chk terminal is monitored , can be used . the third embodiment is the same as the second embodiment except for the points described above . fig7 is a block diagram showing an lsi circuit 400 which includes a testing circuit according to the fourth embodiment of the present invention ( i . e ., a circuit which can perform a testing method according to the fourth embodiment ). in fig7 , the same reference symbols denote the same or corresponding elements in fig1 . as shown in fig7 , the lsi circuit 400 includes an adc 11 which converts an analog input signal a in4 into a digital signal ( i . e ., a converted value ) d c having a plurality of bits , and an internal logic circuit 12 which operates according to the converted value d c outputted from the adc 11 . the lsi circuit 400 also includes a delay flip - flop ( dff ) circuit 19 which delays the converted value d c outputted from the adc 11 and output a delayed converted value d d having a plurality of bits . the lsi circuit 400 further includes a comparator 20 which compares the delayed converted value d d outputted from the dff circuit 19 and the current converted value d c outputted from the adc 11 . a clock input of the dff circuit 19 is connected to a clk terminal and an output of the comparator 20 is connected to a chk terminal . the comparator 20 outputs high level when the converted value d c is greater than the delayed converted value d d , and outputs low level when the converted value d c is not greater than the delayed converted value d d . although fig7 shows that the elements 11 , 12 , 19 , and 20 form an lsi circuit 400 , the dff 19 and the comparator 20 forming the testing circuit can be an external device which is separated from the lsi circuit including the adc 11 and the internal logic circuit 12 . fig8 is a timing chart for explaining operation in a testing circuit according to the fourth embodiment ( i . e ., a testing method according to the fourth embodiment ). in fig8 , strobes st 1 to st 5 denote timings of monitoring an ad - converted signal ( i . e ., a converted value outputted from the adc 11 ). an analog input voltage a in4 which is a predetermined voltage shown in fig8 is inputted to the adc 11 . here , operation will be described with reference to a case where the analog input voltage a in4 is inputted to the adc 11 so as to obtain values after the ad - conversion 0000 ( h ), 0001 ( h ), 0002 ( h ), 0001 ( h ), and 0001 ( h ) and one - cycle delayed signals d d , 0000 ( h ), 0001 ( h ), 0002 ( h ), 0001 ( h ), and 0001 ( h ). the analog input voltage a in4 may takes on values increasing step by step within the ad - conversion period , from the minimum value of an input range to the maximum value . at the comparator 20 , the converted value after the ad - conversion is compared . as a result of the comparison between a current data ( converted value ) d c having a plurality of bits and the one - cycle preceding data ( delayed converted value ) d d having a plurality of bits , if the current converted value d c is grater than the one - cycle preceding data d d ( i . e ., if d c & gt ; d d ), the comparator 20 supplies the chk terminal with high level , as the strobes st 2 and st 3 in fig8 show . if current converted value d c is not greater than the one - cycle preceding converted value d d , the comparator 20 outputs low level to the chk terminal , as the strobes st 4 and st 5 in fig8 show . as has been described above , according to the testing circuit or the testing method according to the fourth embodiment in which pass / fail decision is made by a comparison of the previous and the current data , the pass / fail decision can be performed regardless of whether or not outputs of the adc 11 are around zero - crossing and can be performed by less number of circuit elements . for this reason , the testing circuit or the testing method according to the fourth embodiment is suitable for a simple test ( i . e ., a test for which high accuracy is not required ). the fourth embodiment is the same as the first embodiment except for the points described above . although the subtracter 13 calculates the absolute value of the difference in the first to third embodiments , the calculation of the absolute value are not necessarily required for some data forms . although the parallel data transmission is used in the lsi circuits 100 , 200 , and 300 of the first to third embodiments , the serial data transmission can be used in the lsi circuits of the first to third embodiments as a substitute for the parallel data transmission . although the testing circuits in the first to third embodiments includes the enor gates 14 , the or gates 16 or the and gate 17 , these gates can be replaced by other circuits which can perform the same processing . although the testing circuit in the lsi circuit 400 of the fourth embodiment checks the adc 11 while the input signal to the adc 11 increases step by step , the testing circuit can check the adc 11 while the input signal to the adc 11 decreases step by step . in the first to fourth embodiments , although the 16 - bit adc is used , the any bit number can be adopted by the adc 11 . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of following claims . | 7 |
with particular reference to the drawings , there is illustrated in fig1 a food processor embodying this invention and comprising a base housing 10 , a working bowl 12 removably mounted thereon for holding food material to be processed , and a removable cover 14 on the bowl . the base housing 10 comprises three basic structural elements . the first of these is a box - like enclosure , best illustrated in fig3 and including spaced , parallel sidewalls 16 , 18 , rear wall 20 , and front wall 22 , the latter including an angled portion 22a having a plurality of ventilation slots 24 therethrough . the second element of base housing 10 is a substantially rectangular base plate 26 ( fig2 ) having a vertical flange 28 positioned inside of the vertical walls and having on its bottom surface four rubber - like feet 30 conventionally mounted through holes 32 formed in bosses 34 . the third element making up base housing 10 is a top closure 36 which is essentially rectangular to conform to the shape of the housing , but includes an upwardly , extending circular turret 38 which defines a central , circular opening 40 and has molded into its outer periphery at least two spaced locking lugs 42 . extending upwardly through the opening 40 in top closure 36 is a spindle 44 having a flat 46 along one side and driven by a drive unit within the base housing 10 to be described more fully infra . the bowl 12 has a cylindrical sidewall 48 and a raised bottom 50 , thereby forming a depending skirt 52 . extending inwardly from the skirt 52 are a plurality of projections 54 positioned to lock under the lugs 42 on the base housing when the bowl is rotated thereon . the bowl base 50 defines a central opening bounded by a cylindrical socket 56 which surrounds the spindle 44 . on the outer surface of the cylindrical sidewall 48 is a vertical boss 58 defining a bore 60 having therein a sliding rod 62 spring loaded upwardly by means of spring 64 . when bowl 12 is locked into position on base housing 10 , the end of rod 62 is aligned with an opening 66 in the top closure 36 of base housing 10 . the upper rim of the cylindrical sidewall 48 carries a plurality of spaced , radially outwardly extending locking tabs 68 . the cover 14 for the bowl is substantially circular with a depending inner flange 70 which fits within the cylindrical sidewall 48 and an outer flange 72 which carries a plurality of depending locking fingers 74 positioned such that , when the cover 14 is rotated , they engage respective locking tabs 68 . also depending from the outer flange 72 is a camming member 76 positioned to engage and depress the sliding rod 62 when cover 14 is rotated to its fully closed and locked position . a vertical hopper or well 78 extends through the cover 14 for the insertion of food which may be pressed inwardly by means of a movable pusher 80 . as will be seen from fig2 the spindle 44 comprises a steel core 82 with an outer plastic sleeve 84 having a sealing flange 85 covering opening 40 . various tools may be positioned over this spindle , as shown in fig1 each comprising one or more blades 86 mounted on a hub 88 . further details of the construction of bowl 12 , cover 14 , and the tool assemblies will be found in the above - referenced u . s . pat . no . 3 , 892 , 365 of verdun . the drive unit of this invention is mounted in the base housing 10 by means of motor mount 90 shown in fig3 . it comprises front 92 and rear 94 cross members , each of which extends between , and is secured at its ends to , the sidewalls 16 , 18 . the cross members 92 , 94 are interconnected by means of an upwardly bowed bridging member 96 which has an integral stub shaft 98 extending upwardly therefrom for alignment with the opening 40 in the top closure 36 when it is mounted on the base housing 10 . the rear cross member 94 defines a central , circular opening 100 . aligned therewith , and defined by the front cross member 92 , is an opening 102 in the form of an inverted u extending through the bottom edge of cross member 92 . on either side of the opening 102 is a bolt hole 104 . the opening 100 in the rear cross member is provided with a rubber grommet 106 ( fig2 ) and the bolt holes 104 in the front cross member 92 are provided with similar but smaller grommets 108 ( fig4 ). a universal motor 110 is carried by the motor mount 90 at three support points . this universal motor 110 is positioned within the base housing 10 with its axis of rotation as defined by a rotatable motor shaft 118 extending horizontally parallel with the base plate 26 . the frame 111 of this motor includes a circular boss 112 encircling and concentric with the motor shaft 118 at one end of the motor , this boss 112 being inserted through and held snuggly by the resilient grommet 106 . a similar boss 114 at the other end of the motor fits within , but is spaced from , the opening 102 where it is retained by means of bolts 116 which extend through the grommeted holes 104 , as shown in fig4 . the resilient grommets 108 are symmetrically located on opposite sides of the axis of motor shaft 118 , and the other grommet 106 is concentric with the axis . in this manner , a rigid but vibration - absorbing three - point mounting is provided by the grommeted opening 100 and bolt holes 104 . extending horizontally toward the front of the base housing is the motor shaft 118 upon which is mounted by means of a key 120 , a bevelled pinion gear 122 . mounted atop the stub shaft 98 of the motor mount 90 is a bearing assembly 124 comprising an inner race mounted on shaft 98 and an outer race secured to the central hub 126 of a rotatable saucer - shaped , concavo - convex gear support member 128 . member 128 has a horizontal annular rim 130 from which depends a bevelled ring gear 132 whose teeth mesh with the pinion gear 122 and encircle the motor 110 . the ring gear 132 may be secured to member 128 , as shown , by any suitable means . alternatively , it may be integral therewith . the upper surface of the hub 126 has a circular recess 134 within which is fixedly secured a steel disk 136 which forms the head of the core 82 of spindle 44 . thus , it is seen that the bearing assembly 124 rotatably supports the spindle 44 with the spindle axis of rotation extending vertically and also rotatably supports the ring gear 132 for revolving in a horizontal plane . this ring gear 132 encircles the entire motor frame 111 in a compact configuration . the upwardly arched bridging member 96 and the inverted saucer - shaped ring gear support member 128 both are nested down around the motor 110 in overlapping relationship with one of them nested within the other . their nested relationship contributes to the compact configuration of the drive unit and advantageously reduces the required headroom within the base housing 10 . the gear support member 128 and its hub 126 serve for coupling the rotating ring gear 132 to the spindle 44 for rotating the spindle about its axis . formed on the inner surface of front wall 22 of base housing 10 is a boss 138 ( fig5 ) which supports the motor switch and the brake assembly which will now be described with particular reference to fig5 - 7 . mounted against the boss 138 by means of an l - shaped bracket 140 and screws 142 is a conventional electric motor switch 144 having a vertically extending actuator button 146 which is aligned with the opening 66 in top closure 36 . formed on the inner surface of top closure 36 and surrounding the opening 66 is a lip 148 defining a recess 150 within which is retained a flexible diaphragm 152 . diaphragm 152 seals the opening 66 so as to prevent the entry of food , liquid , or other deleterious substances into the base housing 10 . mounted to the boss 138 by means of a pivot pin 154 is a brake lever 156 which overlies switch button 146 and is urged into its upward position by means of a coil spring 158 seated on bracket 140 . near its distal end , the brake lever 156 defines an opening 160 therethrough . secured to the bottom of boss 138 by means of screws 162 is a brake band support arm 164 which has a slot 166 therethrough . the slot 166 is aligned substantially vertically with one edge of a brake drum 168 secured to the outer end of shaft 118 . a flexible brake band 170 is secured by one end to the support arm 164 , encircles the brake drum 168 , and its other end is releasably secured to brake lever 156 . it is illustrated in detail in fig6 . it includes a relatively wide body portion 172 having a longitudinal slot 174 , and an elongated narrow tongue 176 having a width slightly less than that of slot 174 . it is formed of a suitable plastic material and has molded into its end in the wide body portion 172 a pair of spaced ridges 178 by means of which the end is retained in the slot 166 of support arm 164 as illustrated . the band is wrapped around the brake drum 168 one and a half times , the tongue 176 being inserted through the slot 174 and lying therein along the lower half circumference of the brake drum . both sides of the end of tongue 176 are formed with serrations 180 thereon and this end extends upwardly through the opening 160 in brake lever 156 . by reference to fig7 it will be seen that the brake lever 156 carries a pair of cooperating , resilient clamp members 182 positioned on either side of the opening 160 . each of clamp members 182 is substantially z - shaped and includes a flat mounting base 184 secured to lever 156 , an outwardly biased resilient center section 186 , and an inwardly angled clamping end 188 . the normal configuration of clamp members 182 would cause them to assume the dotted line positions indicated at 182 &# 39 ;. however , extending outwardly from the inner side of the base housing 10 are a pair of clamping bars 190 . these bars are substantially rectangular in cross section , but their lower inside edges are rounded to form camming surfaces 192 . thus , when the brake lever 156 is pivoted downwardly into position 156 &# 39 ; illustrated in fig5 the clamp members 182 are in their open positions , out of engagement with the brake band 170 . when the lever 156 is raised by the action of spring 158 , the clamping ends 188 of clamp members 182 engage the camming surface 192 and are forced inwardly , thereby causing the clamping ends 188 to engage the serrations 180 in the brake band 170 for pulling the brake band snug around the drum 168 . this drum 168 is shown as being formed by an extended hub portion on the pinion gear 122 . the action of the clamping ends 188 engaging the serrations 180 each time that the brake band is pulled serves to provide compensation for wear of the brake band . fig3 illustrates the central portion of base housing 10 with its integral motor mount 90 . the rubber grommets 106 , 108 are inserted in the openings 100 , 104 , and the motor 110 is inserted through the bottom , the boss 110 being positioned in the grommeted opening 100 . the front end of the motor is then lifted into the opening 102 and screws 116 are engaged as shown in fig4 by means of a suitable tool such as a screwdriver , socket wrench , or allen wrench , which may be inserted through one of the ventilation slots 24 or through openings specially provided . the base plate 26 may thereafter be attached . the manner in which the remaining portions of the drive unit are assembled will be apparent to those skilled in the art from the foregoing description and drawings and need not be further explained . it is important to note that the gear support member 128 overlies and surrounds the universal motor 110 in such a manner that a very compact assembly is achieved . however , it is equally important to note that a very favorable gear ratio is achieved which makes possible the use of a high speed universal motor . in one actual embodiment , the pinion and ring gears are spiral bevel gears , the pinion being of steel and having 22 teeth and the ring gear being of delrin and having 130 teeth , thereby obtaining a speed reduction of nearly 6 : 1 . the operation of the brake will be most apparent from the following description taken in conjunction with the illustration of fig5 . as explained in the above referenced verdun patent , the cover 14 is rotatably secured to the bowl 12 and , in the act of rotatably locking it into position , the camming member 76 depresses the sliding rod 62 . rod 62 is forced through the opening 66 , stretching the diaphragm 152 and forcing down the button 146 of switch 144 , thereby starting the motor . in the present invention , the brake lever 156 which is interposed between the rod 62 and the switch button 146 is also depressed into position 156 &# 39 ;. the clamp members 182 spring apart when they move away from the confines of clamping bars 190 , thereby releasing the upper end of the brake band 170 . the brake band 170 thus loosens its grip around the brake drum 168 , permitting the motor 110 to operate unimpeded . upon completion of the food processing operation , the cover 14 is rotated in the opposite direction for removal . this releases the sliding rod 62 which is withdrawn into the boss 58 as shown in fig5 . simultaneously , the spring 158 forces the brake lever 156 back into the illustrated solid - line position . as the clamp members 182 make contact with the camming surfaces 192 on the clamping bars 190 , they are forced inwardly and engage the serrations 180 in the brake band 176 . this contact is made before brake lever 156 completes its upward movement . accordingly , as this movement is completed under the force of spring 158 , the end of the brake band 170 is pulled upward and tightens securely around the brake drum 168 . the 6 : 1 mechanical advantage of the gearing very rapidly brakes the drive unit and the rotating processing tool to a quick stop , even before the cover can be removed , thereby preventing injury to the user . in the alternative brake assembly as shown in fig8 there are a pair of opposed brake shoes 194 which are pivoted at 196 to a mounting bracket 198 which is attached to the motor mount 90 so that the pivot 196 is aligned with and below the motor shaft 118 . a curved friction pad 200 lines each of the brake shoes . these pads engage the brake drum 168 whenever a brake applying spring 202 is allowed to pull the brake shoes toward the drum . the tension spring 202 is attached to the opposite ends 203 of the curved brake shoes 192 from the pivot 196 . a modified motor switch 144a has a straight - through actuator plunger 146a with a wedge - shaped lower end 204 . whenever the plunger 146a is depressed for closing the circuit for energizing the motor 110 , the wedge portion 204 moves downwardly between the ends 203 of the brake shoes 194 , thereby overcoming the spring force and moving the brake shoes apart . in this way the braking pressure of pads 200 is released . conversely , whenever the cover 14 is removed from its working position on the bowl , the plunger 146a is allowed to be raised by an internal spring ( not shown ) within the switch 144a . the wedge portion 204 is withdrawn upwardly allowing the spring 202 to apply the braking pressure . in the further embodiment of this invention shown in fig9 through 18 the various elements performing functions corresponding to those in fig1 through 8 have the same reference numbers . the working bowl 12 and the turret 38 on which the bowl is mounted during operation may be identical to those components described above , and so their description will not be repeated . also , the spindle 44 and the food processing tool mounted on it are shown the same as described above . it is noted that more than one flat surface 46 may be provided on the spindle 44 , or it may have a spline configuration for providing a driving engagement with the hub 88 of the tool . it is also noted that the base housing 10a and motor mount 90a may be arranged so that the bowl 12 is mounted on the turret 38 with the vertical boss 58 and sliding push rod 62 positioned toward the front of the base housing or may be arranged so that the bowl is mounted with the boss 58 and sliding rod 62 positioned toward the rear of the base housing . from a mechanical point of view either arrangement is equally acceptible , but it is my preference to employ the latter arrangement because i think a more attractive over - all appearance for the food processor is provided when the sliding push rod 62 is located toward the rear . accordingly , in this description it is assumed that the right side of fig9 is the front of the food processor . it is also to be understood that the components in the food processor shown in fig1 - 8 can be rearranged so that the working bowl could be mounted with the push rod 62 located at the rear of the base housing 10 . the drive unit is mounted in the base housing 10a ( fig9 and 10 ) by means of a motor mount 90a , which is also shown in fig1 and 12 . the base housing 10a comprises three basic structural elements . the first of these is a box - like enclosure including spaced sidewalls 16 , 18 , rear wall 20 and front wall 22 . the second element of the base housing 10a is a substantially rectangular base plate 26 having a vertical flange 28 positioned inside of the walls . on the bottom of the base plate 26 are four feet 30 of relatively soft , resilient material , such as rubber . these resilient feet 30 are associated with a vibration isolating mounting assembly for isolating the motor mount from the housing 10a as will be described more fully infra . the third element making up the base housing 10a is a top closure 36 , which is essentially rectangular to conform to the shape of the housing , but includes the circular turret 38 . it is to be understood that ventilation openings ( not shown ) are provided in the base plate 26 or in one or more of the walls 16 , 18 , 20 , 22 for cooling of the motor 110 . another way in which ventilation may be provided is to space the vertical flange 28 away from the walls 16 , 18 , 20 , 22 in one or more places to define vertical channels adjacent to the inner surface of these walls through which air can flow . it is my present preference to provide openings in the base plate 26 and also to shape the flange 28 for defining such air flow channels to assure that the motor 110 receives adequate cooling air flow , because this motor in the drive arrangement as shown is capable of performing relatively prodigious food processing tasks in which heavy motor loads are involved . if desired , the walls 16 , 18 , 20 and 22 may be made integral with the top closure 36 . for example , the top closure and walls of the housing 10a may be injection molded as an integral structure from suitable tough , durable , injection - moldable material such as in now commercially employed for making kitchen appliance housings . the motor mount 90a includes rigid bridging members 201 , 202 , 203 and 204 ( see also fig1 ) which arch up and over the motor 110 , and they unite at a center portion 206 forming a bearing mount which they support concentric with the axis of rotation of the spindle 44 . in this bearing mount 206 is a socket 208 for holding the outer race of a bearing assembly 124 , and the inner race of this bearing assembly holds the steel shaft 82 of the spindle 44 . the lower end of this steel shaft 82 carries an enlarged head 210 having a flange 212 on which is secured the concavo - convex gear support member 128 by suitable fastening means , for example a plurality of machine screws 214 . this gear support member 128 is shown formed of tough , rigid plastic material , for example such as delrin , and it has a horizontal annular rim 130 from which depends a bevelled ring gear 132 whose teeth mesh with the pinion gear 122 and encircle the motor 110 . the ring gear 132 may be secured to the rim 130 by any suitable means . alternatively , the ring gear may be integral with the member 128 . in this example , as shown in fig1 , the ring gear is formed of delrin and is secured to the horizontal rim 130 by a plurality of machine screws 216 ( fig1 ). it is my preference that in commercial production the spiral bevel ring gear 132 and gear support member 128 be moulded as an integral member from rigid low - friction plastic material , for example such as delrin . it is seen that the bearing assembly 124 rotatably supports the spindle 44 with the axis of spindle rotation extending vertically and also supports the ring gear 132 for revolving in a horizontal plane . this ring gear 132 encircles the entire motor frame 111 in a compact assembly . the upwardly arched structure of the bridging members 201 , 202 , 203 , 204 , 206 and the inverted saucer - shaped ring gear support member 128 both are nested down around the motor in overlapping relationship with one of them nested within the other . their nested relationship contributes to the compact configuration of the drive unit and advantageously reduces the required headroom within the base housing 10a . in this embodiment the arching bridging structure 201 , 202 , 203 , 204 , 206 is nested above the ring gear support members 128 ; whereas in fig1 and 2 the ring gear support member 128 is nested above the arched bridging member 96 . the universal motor 110 shown in fig9 and 10 may be similar to the motor 110 in fig1 and 2 , except that the conventional end bell which normally supports the shaft bearing at the left end of the motor is removed . this universal motor 110 in fig9 and 12 has a no load speed of approximately 18 , 000 rpm , and the ratio of the spiral bevel ring gear 132 to the spiral bevel steel pinion gear 122 is approximately 6 to 1 . thus , the no load speed of the spindle 44 is approximately 3 , 000 rpm , and this spindle delivers a torque output which is approximately six times greater than the torque capability of the motor itself . the removed end bell of the motor is replaced by a frame member 220 , whose overall shape is seen most clearly in fig1 and 12 . the motor frame 111 is directly fastened to this frame member 220 by a pair of machine screws 218 . these screws 218 are located in the same position in the motor 110 as the screws which are usually employed for holding the left end bell in place . the shaft bearing for the left end of the motor shaft 118 in fig9 is mounted in a central boss 221 ( fig1 ) of the frame member 220 and located near the pinion gear 122 . this pinion gear 122 is secured to the motor shaft 118 by any suitable attachment , for example by a force fit key , or as shown by a set screw 223 . the outer end of the hub of the pinion gear 122 has two flat surfaces 225 ( fig1 ) for providing driving engagement with a friction disc of the brake assembly as will be explained later . in order to cool the motor 110 , the frame member 220 includes a fan casing section 222 of generally circular cylindrical configuration surrounding a bladed fan 224 ( fig1 ). as seen in fig1 there are a plurality of air discharge openings 226 in the fan casing section . these discharge openings are spaced around the motor shaft 118 and allow the fan 224 to discharge cooling air which has been drawn through the motor 110 in an axial direction between the stator and armature . the frame member 220 also includes a pair of arms 228 extending out generally horizontally from either side of the fan casing section 222 . these arms 228 each have an outer end 230 with a threaded drill hole for receiving a machine screw 232 which holds one of the resilient feet 30 . in order to isolate the motor mount 90a from the base housing 10a , there is a resilient bushing 234 positioned between the outer end 230 of each arm 228 and the base plate 26 . these resilient bushings 234 are held by the screws 232 and by openings 236 in the base plate 26 and serve as vibration absorbing pedestals for supporting the motor mount 90a vibrationally isolated from the base housing 10a . the right end of the motor 110 as shown in fig9 includes a conventional end ball structure for supporting the electrical brush assemblies 238 for the commutator and also for supporting a boss 112 which holds the shaft bearing for the right end of the motor shaft 118 . this boss 112 is mounted in a resilient grommet 106 seated in a socket portion 239 of a front frame member 240 , whose overall configuration can be seen most clearly in fig1 . this frame member 240 includes a pair of arms 248 extending out generally horizontally from either side of the socket portion 239 . each arm has an outer end 250 with a threaded drill hole for receiving a machine screw 232 which holds one of the vibration - isolating resilient pedestal bushings 234 and also holds one of the resilient feet 30 in a manner similar to screw 232 shown at the right in fig1 . the arched bridging members 201 and 202 ( fig1 ) are firmly secured to the outer ends 250 of the arms 248 of the front frame member 240 by the screws 232 and by an additional pair of screws 252 ( fig1 and 12 ). similarly , the rear arched bridging members 203 and 204 are firmly secured to the outer ends 230 of the arms 228 of the rear frame member 220 by a pair of machine screws 254 . the outer ends of these bridging members 203 and 204 include depending leg portions 256 ( fig1 ) containing threaded drill holes for receiving the attachment screws 254 . in order to adjust the engagement of the teeth of the pinion gear 122 with the teeth of the ring gear 132 there is a hollow adjustment screw 258 ( fig1 ) which concentrically surrounds each attachment screw 254 and is threaded through the outer end 230 of the arm 228 of the rear frame member 220 . the lower end of the adjustment screw 258 has a square head as seen in fig1 , and its upper end abuts up against the bottom of the depending leg 256 . thus , in effect , the adjustment screws 258 act like jacks for raising or lowering the two legs 256 of the respective bridging members 203 and 204 for raising or lowering the ring gear where it engages the pinion gear . when the inner screws 254 are tightened , they lock the adjustment screws in place . although two such adjustment screws 258 are shown , it is to be understood that only one such screw may be employed . for example , washers can be inserted between one of the legs 256 and the frame member 220 for achieving a coarse adjustment of the gear engagement , and then the adjustment screw serves to make a fine adjustment by acting against the other leg 256 . as illustrated , the bridging members 201 , 202 , 203 , 204 and the frame members 220 and 240 each include various stiffening ribs 260 for providing the desired overall stiffness for the motor mount 90a . as shown in fig9 further vibration isolation is provided by a large mounting ring 262 of soft resilient material such as sponge rubber which seats down around an annular shoulder 264 on the central portion 206 of the bridging members 201 , 202 , 203 and 204 and which seats up within an annular shoulder 266 in the turret 38 of the top closure 36 . this mounting ring 262 serves to hold the motor mount 90a accurately centered and spaced with respect to the turret 38 . the brake assembly 270 ( fig9 and also fig1 - 16 ) is mounted to the rear frame member 220 by screws 271 and is located adjacent to the pinion gear 122 at the rear of the motor . a friction disc 272 mates with the flats 225 on the hub of the pinion gear so that this disc 272 is rotated whenever the motor is running . the brake assembly 270 includes a first plate 274 which forms a frame for the brake assembly and also supports a motor energizing switch 276 . a second plate 278 is movably mounted on the screws 271 . it can move toward and away from the first plate 274 . when the brake 270 is applied , as shown in fig1 , the friction disc 272 is clamped between the first and second plates 274 , 278 . this disc 272 is formed of stiff fibrous material , and offers a high coefficient of friction . thus , when the plates 274 , 278 clamp against the disc , the motor 110 is brought to a stop immediately . a leaf spring 279 is held by the screws 271 , and the ends of this leaf spring urge the second plate 278 toward the first plate 274 for clamping against the brake disc 272 . in order to release the brake plates 274 and 278 from the disc 272 , there is a generally e - shaped actuator plate 280 having three leg portions 281 , 282 and 283 . this actuator plate 280 is movable vertically , and it resides in its upper position as shown in fig9 and 14 when the brake is applied . when the bowl 12 is mounted on the turret 38 with its cover in position and the food processor is ready for operation , then the push rod 62 ( fig9 ) is depressed through the opening 66 deflecting the stretchable diaphragm 152 and depressing the actuator plate 280 as shown by the arrow 284 in fig1 and 18 , thereby releasing the brake , as will be explained . as the actuator leg portion 283 moves down , it deflects a switch arm 286 ( fig1 ), thereby closing the switch 276 for energizing the motor 110 . the center leg portion 282 of the actuator plate serves as a guide for it extends vertically in sliding relation through slots in two vertically spaced horizontal tabs 288 which are bent over from the top and bottom edges of the first plate 274 . in order to move the first and second plates 274 and 278 away from each other to release the brake disc 272 , there are four actuator balls 290 ( fig1 ) which ride in inclined grooves or tracks 292 and which are captured by the plates 274 and 278 on opposite sides of each leg portion 281 and 283 . these inclined grooves 292 are formed in both sides of the leg portions 281 and 283 and in the opposed surfaces of the first and second plates 274 and 278 . as shown in fig1 and 18 , the inclined grooves 292 are sloped so that the balls 290 are rolled toward their shallow ends for spreading ( arrows 294 in fig1 ) the brake plates 274 and 278 further apart , when the actuator plate 280 is depressed by the push rod 62 ( fig9 ). accordingly , when the food processor is ready for operation , the actuator plate 280 is moved downwardly for releasing the brake disc 272 as illustrated in fig1 and for closing the switch 276 as shown in fig1 . conversely , when the bowl cover is removed , or the food processor is otherwise rendered unready for operation , the actuator plate 280 is allowed to move up to its normal position , thereby applying the brake and opening the switch 276 for deenergizing the motor 110 . it is believed that the many advantages of this invention will now be apparent to those skilled in the art . by means of this invention , it has become possible to employ an inexpensive ac / dc universal motor in a food processor . at the same time , the drive unit , including the motor , has been made extremely compact while still obtaining a very highly desirable gear ratio between the motor and the driven tool . in addition , there has been provided an automatic brake which substantially minimizes risk of injury to the user of the apparatus . it will also be apparent to those skilled in the art that various modifications may be made in this invention without departing from its spirit and scope . accordingly , the foregoing description is to be construed as illustrative only , rather than limiting . this invention is limited only by the scope of the following claims . | 0 |
the system according to a preferred embodiment of the present invention comprises an air flow sensor module and a measurement instrument that interfaces therewith . referring to fig1 , a block diagram of the system , the air flow sensor module 10 comprises a microcontroller 11 , provided with a digital signal processing block 12 , a comparator 13 , an analog to digital converter ( adc ) block 14 , a pulse width modulation ( pwm ) source 16 and a digital interface 18 , which interfaces with measurement instrument 20 . pwm source 16 supplies signal to a pwm to dc converter block 22 , the output thereof being supplied to analog signal conditioning block 24 and also to a wheatstone bridge 26 as a bridge supply voltage . output from analog signal conditioning block 24 is supplied as an input to adc 12 in the microcontroller . the microcontroller 11 supplies a signal to a digital potentiometer 28 , which inputs to wheatstone bridge 26 . output from wheatstone bridge 26 is provided as input to comparator 13 in the microcontroller and also to an air flow sensor 30 . air temperature sensor block 32 provides a signal input to adc 12 ( as does wheatstone bridge 26 ). in operation , the sensor element is 30 supplied voltage by wheatstone bridge 26 , and that supply voltage from the wheatstone bridge is received by the microcontroller comparator 13 . these readings are then used to control the duty cycle of the signal generated by pwm source 16 . the wheatstone bridge supply voltage is proportional with the air flow velocity across the sensor element , and this value as fed to comparator 13 is converted to an air velocity reading . the temperature sensor also provides a temperature reading of the air flow . these measured values may then be provided to the measurement instrument 20 via the digital interface 18 . the air flow sensor operating is based on wind chill factor principles , wherein a sensor element body is heated to a fixed temperature , and exposed to the air velocity . the amount of energy required to maintain the sensor element body at the fixed temperature provides an indication of air speed , where higher air speed will required more energy to maintain the temperature of the sensor body . since at zero air velocity , the bridge supply voltage will have a non - zero voltage output , analog signal conditioning block 24 receives the bride supply voltage from pwm to dc converter 22 and performs an offset adjustment to compensate for the zero value so that the maximum adc range will be available for measurement determinations . also , the voltage value may be amplified by block 24 . the bridge supply voltage operation is now described . the airflow sensor is connected to the wheatstone bridge , which is kept in balance by modifying the bridge supply voltage , as monitored by the microcontroller via the input to comparator 13 . the state of the wheatstone bridge is monitored by the microcontroller via the controller 13 , to achieve a higher resolution or sensitivity that would be achievable by using the dac provided on the microcontroller . the bridge supply voltage is a result of block 22 dc filtering the pwm signal generated by the microcontroller . a pid loop controls the voltage by adjusting the pwm duty cycle based on the output state of the comparator . in a preferred embodiment , the pwm signal has a base frequency of 8 khz . fig2 illustrates the pwm to dc converter 22 in more detail . the pwm signal from the pwm source 16 is filtered to dc by a two stage rc low - pass filter . the filter comprises resistors 34 and 36 in series between the input from pwm source 16 and output to the wheatstone bridge , with capacitor 40 connected between ground and the junction of resistors 34 and 36 , and capacitor 42 connected between ground and the end of resistor 36 distal from resistor 34 . unlike prior art control loops which employ difference amplifiers to measure how much out of balance a bridge would be , in operation of the present system , the comparator 13 is used to monitor the bridge voltage . in the illustrated embodiment , the comparator state is sampled every 50 ms . if the current sampled state of the comparator is the same as the previous state , then a state counter is incremented toward a positive ( or negative ) value . when the comparator state changes , the state counter is reset . the pwm duty cycle is controlled with a pid loop . the error measure for the pid loop “ e ” ( input parameter ) is the comparator state counter . the ideal value for the pid setpoint , “ gd ” is 0 . the error can be measured as the difference between the output and the desired output : to transform to discrete form , let t = kt where k = 1 , 2 , . . . , n . the integral evaluated from ( k − 1 ) t to kt can be approximated using the trapezoidal integration rule . the derivative of the error term is the rate of change of error , but this can be noisy over one period . using a four - point central - weighted average for the difference term is a practical way to deal with the noise . when a system with only proportional control is off the specified set point , the controller will increase the control voltage until the error signal is zero , and the system thus returns to the set point with more applied voltage than is required for maintaining equilibrium . this causes overshoot and , as the process continues , under - damped ringing . a system that has a steady state error when tracking a ramping input function can use an integral term to integrate the error over time and compensate for it . in steady state , the biggest contribution to the pid output noise is the noise introduced by the proportional component . accordingly , to ensure minimal pid steady state noise , an attenuated proportional gain is used which will be high if the error is high and low if the error is under a preset value . sampling of air flow and air temperature signals are made via adc 12 , suitably at 120 ms timing in the preferred embodiment . the sensor outputs standard air flow velocity in meters per second [ m / s ] as well as air flow temperature in [ c ]. the measurement instrument 20 includes an onboard barometric pressure meter . for the standard air flow to actual air flow conversion it is presumed that the barometric pressure measured by the instrument 20 is the same as the pressure where the air flow is measured . the instrument converts standard air velocity to actual air velocity using the following formula : the nist defined standard conditions are t nist = 20 . 0 c and p nist = 101 . 325 kpa . the measurement instrument suitably includes a display and user interface to accept user commands for operation thereof . power supply and operational controls are also provided . the instrument may be constructed to receive the air flow sensor module 10 as a removable plug - in measurement module , whereby the functionality of the instrument can be changed to measure other phenomena by changing to a different plug - in module . the sensor of the preferred embodiment suitably has an air velocity measurement range of 0 to 15 meters / second and a temperature range of − 200 to 60 ° c . the voltage output range is 0 to 5v . an example of a suitable sensor is an fs1 air flow sensor marketed by ist ag of wattwil , switzerland . the temperature sensor is suitably based on a fairchild fm50 analog temperature sensor . thus , in accordance with the invention , an improved thermal air flow sensor is provided . while a preferred embodiment of the present invention has been shown and described , it will be apparent to those skilled in the art that many changes and modifications may be made without departing from the invention in its broader aspects . the appended claims are therefore intended to cover all such changes and modifications as fall within the true spirit and scope of the invention . | 6 |
the present invention is directed to plunger having dual sealing flanges for use with an otherwise conventional syringe , wherein the sealing flanges are configured to prevent pressurized liquid trapped between the sealing flanges from compromising the sealing ability of the plunger during a dispensing procedure . in particular , the plunger has a pressure relief mechanism , which is operable to preferentially eject any trapped liquid when a dispensing force is applied to the plunger . more particularly , one sealing flange is configured to have a reduced contact pressure with the interior of the syringe barrel . pressurized trapped liquid is preferentially exhausted by this sealing flange without affecting the sealing ability of the plunger . as a result , the phenomenon known as blow - by is eliminated during a dispensing procedure . as used hereinafter , blow - by is defined as allowing a significant amount of liquid to leak past the sealing flanges of the plunger during a dispensing procedure . referring to fig1 - 3 , a syringe 20 includes an elongated , tubular barrel 22 extending along a longitudinal axis between a distal end 21 and a proximal end 23 . a discharge outlet 26 is attached to a frustoconical portion 28 of distal end 21 and terminates with a discharge tip 30 . tip 30 is adapted to attach the interior of barrel 22 in fluid communication with a cannula or a luer connector interfaced with a length of tubing and a catheter ( not shown ). inserted through an access opening 31 in proximal end 23 of syringe 20 is a plunger 32 , which comprises a piston - like structure positioned for sliding movement within the interior of barrel 22 and along a longitudinal axis thereof . the portion of the interior of barrel 22 between tip 30 and plunger 32 defines a volume for containing a quantity of a liquid 24 . this portion of the interior of barrel 22 may be either prefilled with liquid 24 or filled with liquid 24 by placing discharge outlet 26 in fluid communication with a liquid reservoir and moving plunger 32 in a proximal direction to siphon liquid 24 through discharge outlet 26 . alternatively , syringe 20 may be filled by pouring liquid 24 directly into the rear access opening 31 of barrel 22 and inserting the plunger 32 . syringe 20 may hold , for example , a maximum volume of 125 ml , 200 ml , etc . depending on the amount of liquid 24 to be delivered to the patient . it will be understood that the dimensions and capacity of syringe 20 may be varied without departing from the spirit and scope of the present invention . liquid 24 may comprise a substance suitable for injection into a patient , such as a pharmaceutical liquid or an imaging contrast agent . if liquid 24 is an imaging contrast agent , liquid 24 should be provided in barrel 22 with a quantity sufficient to facilitate an imaging operation . the proximal side of the plunger 32 includes an attachment tab 38 adapted to couple plunger 32 with a gripper carried by a plunger ram ( not shown ). when a dispensing force of a sufficient magnitude is applied to the attachment tab 38 in a direction indicated by arrow 40 , plunger 32 urges liquid 24 through outlet 26 . in particular , syringe 20 may be configured for use with a power injector and the plunger ram may be attached to a power injector ( not shown ), for supplying the dispensing force to move plunger 32 within barrel 22 . as best shown in fig3 one embodiment of the plunger 32 includes an outer sheath 34 having a cylindrical sidewall 41 and a conical head 43 integrally interconnected with the proximal end of sidewall 41 . a substantial portion of conical head 43 contacts the liquid 24 contained within barrel 22 . conical head 43 has a predetermined included angle that , in the embodiment 10 shown in fig1 tapers to an included angle , φ , of about 120 °. however , it is understood that other included angles may be selected without departing from the spirit and scope of the present invention . it is further understood that head 43 may have a geometrical shape other than that of a conical without departing from the spirit and scope of the present invention . sheath 34 is configured be received and held in a snug , resilient fit by an inner member 36 . to that end , sheath 34 includes an annular ridge 41 a extending about the interior of sidewall 41 and projecting in a radially inward direction . annular ridge 41 a engages an annular notch 36 a provided on the exterior of inner member 36 . sheath 34 is formed of a low durometer elastomer , such as a natural rubber or an isoprene , and inner member 36 is formed of a higher durometer polymer , such as a delrin , a polycarbonate , or preferably a polypropylene . a first sealing flange 44 and a second sealing flange 46 are circumferentially positioned about an outer surface 39 of sidewall 41 . as best shown in fig2 and 3 , sealing flanges 44 , 46 are positioned in a spaced relationship and each projects radially outwardly from outer surface 39 . each sealing flange 44 , 46 has a barrel - contacting sealing surface 45 , 47 , respectively , that compressively engages an interior surface 37 of barrel 22 . the first sealing flange 44 is substantially circumferentially continuous and sealing surface 45 exerts a sufficient first contact pressure to normally provide a fluid - tight compressive engagement with the interior of barrel 22 . first sealing flange 44 has a generally semi - circular cross - sectional profile with a predetermined radius of curvature rc 1 when in an uncompressed state . the second sealing flange 46 also has a substantially circumferentially continuous sealing surface 47 that exerts a second contact pressure on the interior of barrel 22 . second sealing flange 46 has a generally circular cross - sectional profile with a predetermined radius of curvature rc 2 , when in an uncompressed state . the compressive engagement with the interior surface 37 deforms and distorts sealing surfaces 45 , 47 such that , when plunger 32 is inserted into barrel 22 , each of the sealing surfaces 45 , 47 and the interior surface 37 is substantially coplanar . when plunger 32 is moved by a dispensing force in a proximal - to - distal direction , the frictional force between each of the sealing surfaces 45 , 47 and the interior surface 37 of barrel 22 is determined by an appropriate coefficient of dynamic friction characteristic of the combination of respective materials and the radially outward force produced by the respective first or second contact pressure . an annular chamber 48 is defined between the first and second sealing flanges 44 , 46 . chamber 48 is an continuous , annular open volume disposed about the circumference of outer surface 39 . it will be understood that chamber 48 may comprise multiple subchambers partitioned by sections of the outer surface 39 of cylindrical wall 41 without departing from the spirit and scope of the present invention . annular chamber 48 is susceptible to trapping a portion of the liquid 24 that would otherwise reside in barrel 22 , when plunger 32 is in motion . in one embodiment of the present invention , the first and second flanges 44 , 46 are configured to exhaust any trapped liquid 50 ( fig5 ) trapped by the annular chamber 48 in a distal - to - proximal direction toward access opening 31 . trapped liquid 50 is exhausted from chamber 48 without substantially disturbing the fluid - tight sealing ability of the first sealing flange 44 . in particular , the sealing surface 47 of second sealing flange 46 exerts a contact pressure against the interior surface 37 of barrel 22 that is smaller than the contact pressure exerted by the sealing surface 45 of first sealing flange 44 against the interior surface 37 of barrel 22 when a dispensing force is applied to move plunger 32 in a proximal - to - distal direction for dispensing liquid 24 through the discharge outlet 26 . the relative contact pressures of the first and second sealing flanges 44 , 46 may be controlled by adjusting their respective radial distances , measured with respect to the longitudinal axis of barrel 22 . in particular the radial distance , measured relative to the longitudinal axis of barrel 22 , of the first sealing flange 44 is adjusted to be greater than the radial distance of the second sealing flange 46 . the difference in radial distance can be accomplished by mismatching the radius of curvature rc 1 and rc 2 of the sealing flanges 44 and 46 , respectively . however , it is understood that the mismatch could be otherwise accomplished , such as by inserting a radial spacer between the curved portion of sealing flange 44 and outer surface 39 , without departing from the spirit and scope of the present invention . according to the present invention , the ability to exhaust trapped liquid 50 in a proximal direction toward access opening 31 is optimized by adjusting the radial distance of the second sealing flange 46 to be about 10 mils ( 0 . 010 ″) less than the radial distance of the first sealing flange 44 , when sealing flanges 44 , 46 are in an uncompressed state . this 10 mil difference in radial distance rd ( see fig3 ) has been found to eliminate blow - by without significantly altering the dynamic frictional force between the sealing surfaces 45 , 47 and the interior surface 37 of barrel 22 . by way of example , and not by way of limitation , a plunger 32 adapted for a syringe 20 having a capacity of 200 ml may have a first sealing flange 44 with a radial distance of about 0 . 951 ″ and a second sealing flange 46 with a radial distance of about 0 . 9 ″, wherein the radii of curvature rc 1 , rc 2 of the respective sealing flanges 44 , 46 are 20 mils and 30 mils , respectively . in this specific embodiment , sheath 34 has a side wall 45 with a radial distance of about 0 . 9135 ″ and a wall thickness of about 80 mils to about 100 mils , preferably about 90 mils . the operation of plunger 32 according to the present invention is diagrammatically illustrated in fig4 - 6 . referring to fig4 the plunger 32 is moved in a proximal direction , indicated by arrow 52 , to fill the barrel 22 with liquid 24 by aspiration during a filling operation . under certain circumstances , the vacuum generated by the aspiration induces the barrel - contacting sealing surface 45 of first sealing flange 44 to lose contact with the interior surface 37 of barrel 22 . a quantity of liquid 24 can pass between the first sealing flange 44 and interior surface 37 of barrel 22 and become trapped in annular chamber 48 , as shown in fig5 . alternatively , trapped fluid 50 can originate from canting of the plunger 32 during a dispensing procedure if either the attachment tab 38 is slightly off - center or the frictional force between the sealing flanges 44 , 46 and the interior surface 37 of barrel 22 is circumferentially nonuniform . as shown in fig6 if a quantity of trapped liquid 50 otherwise sufficient to produce blow - by during a dispensing procedure becomes trapped in annular chamber 48 , the reduced contact pressure between the sealing surface 47 of the second sealing flange 46 and the interior surface 37 of the barrel 22 permits all or a portion of the trapped liquid 50 to pass as in a proximal direction when a dispensing force is applied to plunger 32 . as plunger 32 is advanced by the dispensing force in a distal direction , indicated by arrow 54 , the liquid 24 in barrel 22 exerts a hydrostatic pressure on the conical head 43 of sheath 34 . the hydrostatic pressure axially compresses the sheath 34 so that cylindrical sidewall 41 distends radially outwardly toward the interior surface 37 of barrel 22 . as a result , the volume of annular chamber 48 is reduced and any trapped fluid 50 is pressurized . the axial compression increases the contact pressure exerted on the interior surface 37 of barrel 22 by sealing surface 45 of the first sealing flange 44 , which is urged radially outwardly in proportion to the hydrostatic pressure . the axial compression also increases the contact pressure exerted on the interior surface 37 of barrel 22 by sealing surface 47 of the second sealing flange 46 , which is urged radially outwardly in proportion to the hydrostatic pressure . due to the difference in radial distance rd , sealing surface 47 of the second sealing flange 46 exerts a weakened contact pressure against the interior surface 37 of barrel 22 relative to the contact pressure exerted by the first sealing flange 44 . as a result , sealing surface 47 may preferentially lose contact with the interior of barrel 22 so that all or a portion of the pressurized trapped liquid 50 can be exhausted in a proximal direction as exhausted fluid 56 . however , the contact pressure exerted by sealing surface 45 of the first sealing flange 44 against the interior surface 37 of barrel 22 is not significantly effected by the trapped fluid 50 . sealing surface 45 remains compressively engaged against the interior surface 37 of barrel 22 with a contact pressure sufficient to resist leakage of fluid 24 . according to the present invention , an alternative embodiment of a plunger 59 having a sheath 60 covering an inner member 36 is presented in fig7 in which like parts have like numerals as in fig1 - 3 . sheath 60 may carry a circumferential lip 58 having a spaced relationship with respect to a generally semi - circular sealing flange 62 . sealing flange 62 has a barrel - contacting sealing surface 62 a that compressively engages the interior surface 37 of barrel 22 with a contact pressure sufficient to establish a fluid - tight engagement during a dispensing procedure . circumferential lip 58 projects in a radially outwardly and proximal direction from an outer surface 64 of a cylindrical sidewall 66 . a contact portion 58 a of lip 58 contacts the interior surface 37 of the barrel 22 , with a contact pressure . during a dispensing operation with a sufficient amount of a trapped liquid 68 confined in an annular chamber 70 between lip 58 and sealing flange 62 , the proximally - directed force exerted by trapped liquid 68 deflects lip 58 in a distal - to - proximal direction indicated by arrow 72 on fig7 so that contact portion 58 a loses contact with the interior surface 37 of barrel 22 to create a gap therebetween . all or a portion of the trapped liquid 68 flows through the gap and past the deflected lip 58 in a proximal direction toward the access opening 31 ( fig1 ). in accordance with the present invention , a plunger 79 having a sheath 80 covering an inner member 81 is presented in fig8 in which like parts have like numerals as in fig1 - 3 . an outer surface 83 of sheath 80 carries a first sealing flange 82 and a second sealing flange 84 , which have barrel - contacting sealing surfaces 82 a , 84 a , respectively . an annular chamber 90 is defined in the space bounded by the sealing flanges 82 , 84 , the interior surface 37 of barrel 22 , and the outer surface 83 of sheath 80 . the contact pressure exerted by the sealing surface 84 a of the second sealing flange 84 against the interior surface 37 of barrel 22 is reduced , relative to the contact pressure exerted by sealing surface 82 a , by removing material from the exterior of inner member 81 . specifically , material is removed at a location beneath the second sealing flange 84 to provide an annular recess 86 of a semi - circular cross - sectional profile positioned radially inward from the second sealing flange 84 . it is understood that the shape or size of recess 86 may be varied without departing from the spirit and scope of the present invention . for example , recess 86 may have a rectangular cross - sectional profile , rather than the semi - circular cross - sectional profile illustrated in fig8 . during a dispensing procedure with a sufficient quantity of a pressurized trapped fluid 88 trapped in annular chamber 90 , second sealing flange 84 will preferentially yield under the force applied by trapped fluid 88 . as a result , the trapped fluid 88 will exhaust in a proximal direction , as indicated by arrow 92 , through the gap created between the sealing surface 84 a of the second sealing flange 84 and the interior surface 37 of barrel 22 . sealing surface 86 a will remain compressively engaged against the interior surface 37 of barrel 22 with a contact pressure sufficient to resist the hydrostatic pressure exerted in a proximal direction by liquid 24 held by barrel 22 . in accordance with the present invention , a plunger 99 having a sheath 100 covering an inner member 101 is presented in fig9 in which like parts have like numerals as in fig1 - 3 . an outer surface 102 of sheath 100 carries a first sealing flange 104 and a second sealing flange 106 having respective barrel - contacting sealing surfaces 104 a , 106 a . an annular chamber 108 is defined in the space bounded by the sealing flanges 104 , 106 , the interior surface 37 of barrel 22 , and the outer surface 102 of sheath 100 . material is removed from the interior of sheath 100 radially inward from the second sealing flange 106 to provide an annular recess 110 . recess 110 functions to reduce the contact pressure that the sealing surface 106 a of second sealing flange 106 exerts against the interior surface 37 of barrel 22 . it is understood that the shape or size of recess 110 may be varied without departing from the spirit and scope of the present invention . for example , recess 110 may have a rectangular cross - sectional profile , rather than the semi - circular cross - sectional profile illustrated in fig9 . during a dispensing procedure , second sealing flange 106 will preferentially yield under the force applied by pressurized trapped fluid 112 , if trapped fluid 112 is present in a sufficient quantity in annular chamber 108 . as a result , the trapped fluid 112 will exhaust in a proximal direction , as indicated by arrow 114 on fig9 through the gap created between the sealing surface 106 a of second sealing flange 106 and the interior surface 37 of barrel 22 . barrel - contacting sealing surface 104 a of first sealing flange 104 will remain compressively engaged against the interior surface 37 of barrel 22 with a contact pressure sufficient to resist the hydrostatic pressure exerted proximally by liquid 24 within barrel 22 . in accordance with the present invention , a plunger 119 having a sheath 120 covering an inner member 121 is presented in fig1 in which like parts have like numerals as in fig1 - 3 . an outer surface 122 of sheath 120 carries a first sealing flange 124 and a second sealing flange 126 in a spaced relationship and having respective barrel - contacting sealing surfaces 124 a , 126 a . an annular chamber 128 is defined in the space bounded longitudinally by the sealing flanges 124 , 126 , and bounded radially between the interior surface 37 of barrel 22 and the outer surface 122 of sheath 120 . an annular ridge 127 on the interior of sheath 120 engages an annular notch 129 provided on the exterior of inner member 121 for securing sheath 120 to inner member 121 . an annular recess 130 is positioned radially inward of second sealing flange 126 and provides a circumferential cavity that separates annular notch 129 and annular ridge 127 . recess 130 is created by removing material from either sheath 120 to increase the inner radial distance of annular ridge 127 or , in the alternative , by removing material from inner member 121 to reduce the outer radial distance of the annular notch 129 . it is understood that the shape or size of recess 130 may be varied without departing from the spirit and scope of the present invention . during a dispensing procedure , recess 130 functions to reduce the contact pressure exerted by the barrel - contacting sealing surface 126 a of second sealing flange 126 against the interior surface 37 of barrel 22 . recess 130 permits annular ridge 127 to move radially inward in response to the axial compression of sheath 120 . as a result , sealing surface 126 a of second sealing flange 126 will preferentially yield under the force applied by pressurized trapped fluid 132 , if a sufficient quantity of trapped fluid 132 is present in annular chamber 128 . trapped fluid 132 exhausts in a proximal direction , as indicated by arrow 134 on fig1 , through the gap created between sealing surface 126 a and the interior surface 37 of barrel 22 . barrel - contacting sealing surface 124 a of first sealing flange 124 will remain compressively engaged against the interior surface 37 of barrel 22 with a contact pressure sufficient to resist the hydrostatic pressure exerted proximally by liquid 24 within barrel 22 . while the present invention has been illustrated by the description of embodiments thereof , and while the embodiments have been described in considerable detail , they are not intended to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . for example , the present invention is not limited to dispensing pharmaceutical liquids and may be used in conjunction with a syringe for dispensing non - pharmaceutical liquids , such as adhesives . the invention in its broader aspects is therefore not limited to the specific details , representative apparatus and method and illustrative examples shown and described . accordingly , departures may be made from such details without departing from the scope or spirit of applicant &# 39 ; s general inventive concept . | 0 |
intercom systems , e . g ., wireless intercom systems , used at establishments , e . g ., quick service restaurants , typically can have several parameters which govern the operation of the intercom system . as shown in fig1 , establishment 10 is served by intercom system 12 . base station 14 communicates wirelessly with a plurality of headsets 16 a , 16 , . . . 16 n . headsets 16 a , 16 , . . . 16 n are worn by personnel , or staff of establishment 10 and , in a preferred embodiment can be used by such personnel to receive orders taken from a drive - through facility ( not shown ). at least one of the staff members communicates with a customer in the drive - through facility to obtain an order from the customer . this staff members may be wearing , and communicating through , one of headsets 16 a , 16 , . . . 16 n or may be in wired communication with base station 14 . other staff members will wear headsets 16 a , 16 , . . . 16 n or the remaining ones of headsets 16 a , 16 , . . . 16 n , primarily to listen , or monitor communication between the customer and staff member taking the order . intercom system 12 at establishment 10 , e . g ., a quick service restaurant , has several parameters which govern the operation of the system . for example , each of headsets 16 a , 16 , . . . 16 n can be in full duplex communication with base station 14 and each of headsets 16 a , 16 , . . . 16 n may have a receive audio level , or volume , and / or a transmit audio level associated with it . separate volume , or gain , controls , may be available to each of headsets 16 a , 16 , . . . 16 n for each direction of communication . many other parameters are also possible , such as lane assignment , receive volume , transmit volume , master volume for a speaker associated with the drive - through facility , individual volume for each channel received by the drive - through facility , base station receive volume , base station transmit volume , page , greeter , vehicle detection alert , vehicle approaching alert , for examples . many , if not all , of these parameters may be available to one or more staff members for individual adjustment . it is recognized , however , that an intercom system 12 involving a drive - through facility , drive - through lane , a base station 14 and , potentially , several headsets 16 a , 16 , . . . 16 n with each unit located in a potentially unique environment and unique conditions can be complex to set up and adjust properly . failure to perform proper set - up and balance could result in unsatisfactory operation , e . g ., resulting in annoying feedback and / or instability perhaps making communication difficult , if not impossible . providing a staff member or staff members with adjustment control of at least one parameter , e . g ., volume of their headset 16 , is desirable to take into account individual speaking patterns and hearing capabilities . however , it is possible for individual adjustments to throw the balance of intercom system 12 and , possibly , to render it unstable and / or unusable . since the location of the establishment 10 may be a significant distance geographically from the location of a qualified service technician , it may take a considerable amount of time for such service technician , once summoned , to arrive at the location of establishment 10 in order to begin repairs . in some cases establishment 10 may be located hours away from a service technician . even if establishment 10 is not located a significant distance from a qualified service technician , sending a service technician on - site to perform a repair can still be a significant expense in terms of both time and money . however , intercom system 12 allows personnel from establishment 10 to call a technical service facility 18 located remotely from the location of establishment 10 . however , a technical service facility 18 located remotely from the location of establishment 10 may be alerted , by personnel of establishment 10 , automatically or by other means , to access the parameters controlling intercom system 12 remotely via a wide area network 20 , such as by way of the internet . the service technician may be able to access the parameters associated with intercom system 12 , review the parameters of intercom system 12 , and potentially make adjustments to the parameters to place intercom system 12 back in operation or to improve the operation of intercom system 12 . the service technician may be able to resolve the issue with intercom system 12 quickly without a need to dispense a service technician to the site of establishment 10 . if the site of establishment 10 is remote , many hours of establishment down time may be saved , perhaps even a day if it is necessary to fly or otherwise transport a service technician to a very remote site . even if the site of establishment is not remote , a service technician may be able to service many more establishments and solve many more issues more efficiently by making remote adjustments than by incurring site visits . remote adjustment of parameters of intercom system 12 may minimize , or eliminate altogether , service interruption by establishment 10 . it is to be recognized and understood that one or more than one parameter of intercom system 12 may be accessed , reviewed and , potentially , modified or adjusted . one parameter , e . g ., the master volume of intercom system 12 , may be the only parameter reviewed and / or adjusted . on the other hand , it is also contemplated that multiple parameters may be reviewed , and one or more of the parameters reviewed may be adjusted . for example , the volume levels of all of headsets 16 a , 16 , . . . 16 n may be reviewed . following review , it may be necessary to adjust the volume level of a single headset 16 , say headset 16 a , or it may be desirable to adjust the volume of more than one or all of headsets 16 a , 16 , . . . 16 n . since multiple parameters may be involved in the setting up , adjusting and balancing of intercom system 12 and because one parameter may have an effect on other aspects of the intercom system , it may be desirable to form multiple parameters into parameter sets . a given set of parameters for intercom system 12 may form a template 22 , i . e ., a set of parameters for intercom system 12 that , when implemented , will give rise to a particular operational characteristic for intercom system 12 . for example , known settings for parameters which provide for a particular response or performance of intercom system 12 or which may typically eliminate common issues associated with maladjustment of parameters may be formed as a template . such a template of parameters may be utilized , for example , either in a later point in time in the same establishment or another establishment having a similar intercom system 12 or a similar facility , structure and / or layout . individual parameters or a template 22 or templates of parameters may be saved or stored for later recall . template 22 may be saved to memory 24 located locally with respect to establishment 10 . once saved in memory 24 , template 22 , or one of a plurality of templates 22 , may be recalled later to reset intercom system 12 or to bring about a desired change of operational parameters . if intercom system 12 parameters are adversely adjusted , then a previously stored template may be recalled from memory 24 and utilized to provide a new operational guidebook for intercom system 12 . in particular , a service technician , located remote from the location of establishment 10 , may access memory 24 and recall a template 22 previously stored and make the parameters associated with that template 22 active . additionally , a remotely located service technician may recall a previously stored template 22 from memory 24 and then , perhaps , make further adjustments or modifications to one or more individual parameters in order to improve or optimize the performance characteristics of intercom system 12 . it is also contemplated that parameters for establishment 10 may be stored remotely from establishment 10 . for example , the same wideband communication network allowing a service technician at remote facility 18 to access parameters of intercom system 12 may also or alternatively used to transmit parameters , preferably in a template 22 , to remote facility to be saved or stored in memory 26 . such parameters or templates 22 may be subsequently recalled as discussed to bring about an operational scheme for intercom system 12 as discussed above with respect to locally stored parameters and / or templates 22 . further , memory 26 associated with remote facility 18 may be used to store a template or templates 22 which may apply to more than one of establishments such as establishment 10 . for example , a particular brand or chain of establishment may store a template 22 that may be pertinent for a “ standard ” quick service restaurant of which many may be constructed in different locations . thus stored , it would be relatively easy for a service technician to recall the template 22 in order to initially setup and make intercom system 12 operational in a new location or a new establishment meeting that brand &# 39 ; s or chain &# 39 ; s “ standard ” layout . as above , of course , the service technician may fine tune the operational parameters for intercom system 12 . however , the standard template 22 may have provided the service technician with a substantial head start and made the entire process easier and faster . it is to be recognized and understood that while memory 26 is illustrated connected directly to remote facility 18 , that memory 26 may also be remote , not only from establishment 10 , but also from remote facility 18 . memory 26 may be physically located in remote facility 18 or may be located elsewhere and accessed by remote facility 18 remotely . communication occurring on intercom system 12 may be monitored by other personnel in or associated with establishment 12 , either by listening through base station 14 or one or more of headsets 16 a , 16 , . . . 16 n . in the alternative or in addition , personnel associated with remote facility 18 may monitor communication occurring on intercom system 12 , particularly communication used in receiving orders from customers . such personnel associated with remote facility 18 , in addition to performing normal quality control of ordering functions , may also analyze the quality of the communications and may preemptively access parameters associated with intercom system 12 and adjust or modify such parameters , if desired , to maintain or improve the operational characteristics of intercom system 12 . in this case , personnel associated with establishment 10 do not need to request assistance from a service technician and may not even know that a service technician from remote facility 18 performed service on intercom system 12 . further , intercom system 12 may contain hardware and / or software used for the purpose of determining if a fault condition exists , i . e ., that it is desired that a service technician inspect intercom system 12 . if so , intercom system 12 may notify a service technician at remote facility 18 of the existence of a fault condition as determined by commonly available hardware and / or software and a service technician at remote facility 18 may review parameters and / or other aspects of intercom system 12 remotely . the service technician may be able to adjust and / or repair intercom system 12 , again preemptively , by reviewing and / or adjusting or modifying parameters associated with intercom system 12 . fig2 is a flow chart illustrating a method of remotely configuring a wireless communication system , such as that used in intercom system 12 of establishment 10 . the wireless intercom system is configured ( 110 ), in part by setting the parameters associated with the system . such configuration can be done locally through conventional techniques or by recalling or installing a template 22 , may be done remotely , e . g ., using remote facility 18 , or in any other way . once configured , the wireless intercom system is then ready to perform communications ( 112 ) for establishment 10 . optionally , communications occurring on the wireless intercom system may be monitored ( 114 ), either locally or remotely as , for example , by remote facility 18 . in response to a request from establishment 10 , in response to an indication of a fault condition or preemptively , remote facility 18 remotely reviews ( 116 ) communication parameters associated with the wireless intercom system by way of wideband communications network 20 . a service technician , or automated equipment , associated with remote facility 18 may then analyze the setting of such parameters and the operation of the wireless intercom system and , if necessary , may remotely adjust or modifying ( 118 ) one or more of the communication parameters . typically such adjustment is performed in order to improve the operation of the wireless intercom system or in order to make the wireless intercom system operational . fig3 is a flow chart illustrating a method of configuring a wireless intercom system with saved and subsequently recalled parameters . the wireless intercom system is configured ( 130 ), in part by setting communication parameters associated with the system . again , such configuration can be locally through conventional techniques or by recalling or installing a template 22 , may be done remotely , e . g ., using remote facility 18 , or in any other way . once configured , the wireless intercom system is then ready to perform communications for establishment 10 . communication parameters associated with the wireless intercom system are saved ( 132 ), either in local memory or memory located remote from establishment 10 . such parameters are preferably saved as a set of parameters in a template 22 . subsequent to saving such parameters , one or more of such parameters are recalled ( 134 ) from memory and utilized to establish , at least in part , the operational characteristics of the wireless intercom system . once established , the wireless intercom system may then be utilized to communicate ( 136 ) in the operational environment of the establishment . fig4 is a flow chart illustrating a method of remotely configuring a wireless intercom system responsive to a fault condition . the wireless intercom system is configured ( 150 ), in part by setting communication parameters associated with the system . again , such configuration can be done locally through conventional techniques or by recalling or installing a template 22 , may be done remotely , e . g ., using remote facility 18 , or in any other way . remote facility 18 remotely reviews ( 152 ) communication parameters associated with the wireless intercom system by way of wideband communications network 20 . a service technician , or automated equipment , associated with remote facility 18 may then analyze the setting of such parameters and the operation of the wireless intercom system to determine ( 154 ) if a fault condition exists . a fault condition could be the result of one or more inappropriate settings of communication parameters or another hardware and / or software fault condition . upon determination of a fault , remote facility may then reset ( 156 ) the communication parameters associated with the wireless communication system in order to attempt to eliminate the fault condition . thus , embodiments of the remotely configurable wireless intercom system for an establishment are disclosed . one skilled in the art will appreciate that the present invention can be practiced with embodiments other than those disclosed . the disclosed embodiments are presented for purposes of illustration and not limitation , and the present invention is limited only by the claims that follow . | 7 |
the hand truck 10 of the present invention includes a frame having a pair of parallel pipe - like members 11 and 12 , which have handles 13 and 14 at the upper end , and which , at their lower ends 15 and 16 , are secured to a foot plate 17 which extends generally at a right angle to the bottom of the pipes 11 and 12 . a pair of plates 18 and 19 are welded to the pipes 11 and 12 and extend away from the pipes in a direction opposite to that of the foot plate 17 . these plates 18 and 19 support an axle 20 and a pair of wheels 21 and 22 . this arrangement forms the frame of the hand truck . slidably mounted on the pipes 11 and 12 is a bracket 23 which is formed of a pair of tubular members 24 and 25 connected by cross members 26 and 27 , thus forming a generally rectangular bracket which can move longitudinally along the pipes 11 and 12 , upwardly away from and downwardly toward the foot plate 17 , as indicated in the arrow 28 in fig7 . a portion 29 of the foot plate 17 extends away from the bottoms 15 and 16 of the pipes 11 and 12 to form a base on which a elevator 30 can rest . the elevator 30 extends upwardly away from the base 29 parallel to and generally between the pipes 11 and 12 , as is shown particularly in fig6 . the elevator 30 includes a tube 31 which is securely welded at 32 to the member 27 of the bracket 23 . at the top 33 of the elevator 30 a screw ( not shown ) is placed within the tube 31 to engage a mating member on the crank 34 so that by turning the crank 34 the screw causes the tube 31 , and thus the bracket 23 , to move upwardly on the member 30 . the pitch of the screw arrangement is such that a very strong mechanical advantage is achieved , and a relatively small amount of energy is required to turn the crank 34 in order to lift the tube 31 and the bracket 23 away from the foot plate 17 . thus a heavy object placed on the foot plate 17 is easily elevated from it . a pair of cradles 35 and 36 are mounted on the face of the bracket 23 against which the surface of a cylinder ( such as an oxygen cylinder ) 37 may rest when the base of the cylinder is on the foot plate 17 . as is shown in fig2 a relatively small 12 volt motor 38 may replace the crank 34 . that motor 38 may be powered by a 12 volt battery 39 with an appropriate switch ( not shown ) by which the bracket 23 , along with any object held against the brackets 35 and 36 , may be elevated . it is to be understood that the movement of the bracket 23 may be by an hydraulic elevator 46 as well as by mechanical or electrical means . in order to hold the cylinder 37 firmly against the bracket 23 in the cradles 35 and 36 , a chain 40 is held , at one end , in the member 26 , by a turn screw 41 . the other end 42 of the chain 40 passes through a key hole slot 43 in the member 26 and can be locked at an appropriate position along the link - length of the chain as is shown particularly in fig8 . by turning the thumbscrew 41 after the appropriate link of the chain has been placed in a keyhole slot , the chain can be tightened so as firmly to hold the cylinder 37 in the cradles 35 and 36 . thus it can be seen that when the hand truck as shown in fig3 is used to carry a cylinder 37 , the cylinder can be rolled on top of the foot plate 17 and against the bracket 23 so that the sides of the cylinder 37 rest in the cradles 35 and 36 , as shown in fig4 . then the chain 40 can be wrapped around the cylinder with the free - end drawn through the keyhole slot 43 and the chain tightened by turning the thumbscrew 41 as shown particularly in fig4 and 5 . it will be noted that the bottom cradle 36 extends slightly farther away from the bracket 26 than does the upper cradle 35 , and this causes a slight inclination of the tank 37 which makes it easier to handle when the assembly is moved from one place to another . when the cylinder is mounted on the hand truck , as shown in fig4 the hand crank 34 can be turned ( or alternately the motor 38 operated ) so that the screw arrangement of the member 30 and tube 31 can be actuated to elevate the tube 31 , and thus to lift the cylinder above the footplate 17 , all as shown in fig5 . once the cylinder is firmly fastened on the cradles 35 and 36 , as shown in fig4 and before elevating the cylinder , the hand truck can be operated in the customary manner by tilting the handles 13 and 14 so as to pivot around the axle 20 , and thus the heavy object may be moved from one place to another . after the cylinder is moved to its new , desired location ( which may , for example , be adjacent a welding machine ) and it is desired to remove the cylinder from the hand truck , the cylinder is elevated to the position shown in fig5 . after the cylinder is properly placed on the machine , the crank 34 ( or the motor 38 ) is operated so as to lower the cylinder from the position shown in fig5 to the desired position ( i . e . adjacent a welding machine ). then the tension on the chain 40 can be relieved by reverse operation of the thumb screw 41 and the chain can then be removed from the keyhole slot 43 . the foot plate 17 can then be moved away from beneath the cylinder , leaving the cylinder in place and permitting the hand truck to be used for another purpose . it is furthermore to be understood that the present invention may be embodied in other specific forms without departing from the spirit or special attributes ; and it is , therefore , desired that the present embodiments be considered in all respects as illustrative and , therefore , not restrictive , reference being made to the appended claims rather than to the foregoing description to indicate the scope of the invention . | 1 |
a preferred embodiment of the invention includes a capacitively - coupled touch sensor device that provides capacitive coupling between capacitive plates , especially between plates in which the capacitive coupling is continuously , linearly proportional to the location of a user &# 39 ; s finger touch as it moves along an insulative touch surface disposed on or over the capacitive plate or plates . the effects of finger touch pressure variations ( and the effects of variations in certain other “ environmental ” parameters such as humidity or skin conductivity ) are automatically canceled so they do not affect the amplitude of a linear output signal that represents the location of the finger touch on the touch surface . fig2 a shows a capacitively - coupled touch sensor system 10 - 2 that eliminates the effect of variations in finger touch pressure on the amplitude of an output signal that represents the finger touch location . in fig2 a , system 10 - 2 includes a capacitively - coupled touch sensor 4 - 2 which includes a triangular capacitive plate 3 a , a substantially similar , but oppositely oriented , triangular capacitive plate 3 b , and an elongated center plate 2 . that is , plates 3 a and 3 b are symmetrically , oppositely aligned along opposite edges of center plate 2 , respectively . the longitudinal axis of center plate 2 is aligned with an x axis , as illustrated . each of plates 3 a and 3 b is spaced from center plate 2 by a corresponding narrow gap . plates 2 , 3 a , and 3 b are disposed on a suitable insulative substrate 1 , and are covered by a suitable insulative layer 5 , the top surface of which is the touch surface of touch sensor 4 - 2 . a controller 30 generates a first excitation signal v 1 on a conductor 31 that is connected to plate 3 a , and also generates a second non - overlapping excitation signal v 2 on a conductor 32 that is connected to plate 3 b . thus , outer plates 3 a and 3 b are separately excited with two different non - overlapping excitation signals v 1 and v 2 , which are shown in fig2 b . as the tip of a user &# 39 ; s finger 19 slides in either direction along the surface of insulative layer 5 from one end to the other along the longitudinal axis of center plate 2 of touch sensor 4 - 2 ( i . e ., along its x axis ), the amount of capacitive coupling from a first one of plates 3 a and 3 b ( depending on the direction of movement of finger 19 ) to center plate 2 increases as the width of the first plate increases . simultaneously , the amount of capacitive coupling from the second plate decreases as its width decreases . with the finger touch located over the left end of center plate 2 , there is minimal capacitive coupling between center plate 2 and outer plate 3 a and maximum capacitive coupling between center plate 2 and outer plate 3 b . conversely , at the right end of center plate 2 , there is minimal capacitive coupling between center plate 2 and outer plate 3 b and maximum capacitive coupling between center plate 2 and outer plate 3 a . thus , the amount of capacitive coupling of each of non - overlapping excitation signals v 1 and v 2 to center plate 2 is different for each value of x at which finger 19 touches the surface of insulative layer 5 ( except for one center position along the x axis at which the capacitive coupling to center plate 2 from each of transmitting plates 3 a and 3 b is identical ). center plate 2 is connected by conductor 6 to one terminal of resistor r load and to the input of amplifier 8 . the signal v 6 is produced on conductor 6 as a result of capacitive coupling of excitation signals v 1 and v 2 onto center plate 2 . amplifier 8 amplifies and otherwise conditions the signal v 6 to produce a signal v 9 which is applied by conductor 9 to one input of a conventional peak detector circuit 12 . ( for example , amplifier 8 may include a bandpass filter that selectively amplifies and attenuates signals of interest .) peak detector circuit 12 produces a detected peak signal v 13 , which is applied by conductor 13 to the input of an adc ( analog - to - converter ) 15 . during the excitation pulse trains of non - overlapping excitation signals v 1 and v 2 , adc 15 is commanded to produce a digital output signal d out on bus 17 which represents peak values of the pulse train envelopes of excitation signals v 1 and v 2 . digital processor 32 then uses the results of the adc conversion along with the results of a subsequent conversion to ratiometricly calculate the x position of the touch point of finger 19 . outer plates 3 a and 3 b can be thought of as “ transmitting ” plates . capacitive coupling between outer plates 3 a and 3 b is received by center plate 2 , which can be thought of as a “ receiving ” plate . only excitation signal v 1 is capacitively coupled from outer plate 3 a to center plate 2 during the periodic pulses or bursts of pulses of excitation signal v 1 . similarly , only excitation signal v 2 is capacitively coupled from outer plate 3 b to center plate 2 during the periodic pulses or bursts of pulses of excitation signal v 2 . by alternately applying pulses or short bursts of pulses of excitation signals v 1 and v 2 to plates 3 a and 3 b , respectively , a ratio x of the amount of capacitive coupling between outer plate 3 a and center plate 2 divided by the amount of capacitive coupling between outer plate 3 b and center plate 2 can be readily calculated by processor 32 to determine the present finger touch location . fig2 b is a timing diagram that is useful in describing the operation of the touch sensor system of fig2 a . the illustrated waveforms include the v 1 and v 2 waveforms generated by controller 30 in fig2 a , the amplified waveform v 9 generated by amplifier 8 on conductor 9 , and the detected peak waveform v 13 generated by peak detector 12 on conductor 13 . during each signal burst a sample is collected by processor 30 . however , several samples may be taken and averaged during the v 1 and v 2 signal bursts to reduce noise and other signal variations . the v 13 ′ waveform in fig2 b includes exaggerated replicas a ′ and d ′ of the two pulses a and the two pulses d of the v 13 waveform , to illustrate the effect of a finger touch pressure variation δp on the detected peak waveform v 13 . the multiple lines at the tops of the pulses of v 13 represent the finger pressure variations δp , and also include components that represent additional “ environmental ” information , including noise and parameter variations due to the physical structure of the sensor device . however , the position variable x is an independent variable and can be extracted from the ratio x of the two signal amplitudes , as subsequently explained with reference to fig4 . the number of pulses in each of the bursts of excitation signals v 1 and v 2 may depend on the amount of time required for the output of amplifier 8 to settle , the amount of time required for peak detector 12 to stabilize , and the amount of time required for adc 15 to digitize the analog output v 13 of peak detector 12 . the period of v 13 , including the delay between the bursts of excitation signals v 1 and v 2 , may be roughly 10 - 15 milliseconds . the two excitation signals v 1 and v 2 applied to sensor 4 - 2 in fig2 a as alternate , non - overlapping square wave pulses or bursts of pulses are rich in harmonic content . the high frequency content of excitation signal v 1 applied to outer plate 3 a couples energy into center plate 2 through the capacitances of those two plates , and similarly for excitation signal v 2 and plates 2 and 3 b . ( as the harmonic content of the excitation signal increases , more energy is transferred from outer plates 3 a and 3 b to center plate 2 as the user &# 39 ; s finger 19 is introduced into the electric field between the outer plates 3 a and 3 b . sliding finger 19 on touch surface 5 along the x axis from the left end of sensor 4 - 2 to the right end results in the capacitive coupling between plates 3 a and 2 being increased proportionally to the increasing width of outer plate 3 a , and hence to the x position of the touch point of finger 19 . conversely , sliding finger 19 on touch surface 5 along the x axis from right to left results in the capacitive coupling between plates 3 a and 2 being decreased proportionally to the decreasing width of outer plate 3 a and the decreasing x position of finger 19 . similarly , sliding finger 19 on touch surface 5 along the x axis from the left end of sensor 4 - 2 to the right end results in the capacitive coupling between plates 3 b and 2 being decreased proportionally to the decreasing width of outer plate 3 b and the increasing x position of finger 19 , and conversely , sliding finger 19 on touch surface 5 along the x axis from right to left results in the capacitive coupling between plates 3 b and 2 being increased proportionally to the increasing width of outer plate 3 b with the decreasing x position of finger 19 . the “ receiving circuitry ” of sensor system 10 - 2 includes amplifier 8 , peak detector 12 , and adc 15 . amplifier 8 amplifies and otherwise conditions the signal v 6 produced on conductor 6 by center plate 2 , detects the peak value of v 9 during each alternate non - overlapping phase of excitation signals v 1 and v 2 , respectively , by means of peak detector 12 and adc 15 converts each peak value to a digital value . processor 32 then can store the detected peak magnitudes and use them to perform the algorithm indicated in fig4 so as to eliminate the effects of variations in finger pressure ( and certain other parameters ) that affect the digitized peak values and also compute the above - mentioned ratio x which represents the value of x that represents the present finger touch location . the effect of finger touch pressure on the accuracy of the value of x of the present finger touch location is described next . it should be noted that as the finger touch pressure increases , the location of finger 19 along a z axis ( which is perpendicular to touch surface 5 ) may very slightly , and therefore cause the shape and size of the portion of the tip of finger 19 at the touch surface to increase slightly . this causes the capacitive coupling caused by finger 19 to increase . similarly , as the touch pressure of finger 19 decreases , the capacitive coupling caused by finger 19 also decreases . processor 32 of fig2 a operates to perform computations which ( 1 ) compute suitable averages of peak amplitudes of the pulses or bursts of pulses of excitation signals v 1 and v 2 , ( 2 ) determine changes in the averaged peak amplitudes of the pulses or bursts of pulses of excitation signals v 1 and v 2 due to variations in finger touch pressure on that surface 5 ( and other “ environmental ” parameters ), ( 3 ) cancel the effects of variations in finger touch pressure , etc ., on the peak amplitudes of the pulses or bursts of pulses of excitation signals v 1 and v 2 , and ( 4 ) compute the above - mentioned ratio x of corrected peak amplitude of each v 1 pulse or burst of pulses and the next v 2 pulse or burst of pulses . the ratio x then may be used to determine the location x of the corresponding finger touch . the foregoing measuring , digitizing , and cancellation process is performed on a continuous basis . the algorithm of fig4 executed by processor 32 utilizes the digitized peak amplitude data d out to compute finger touch pressure changes δp , which are indicated on the v 13 ′ waveform in fig2 b to compute the ratios of the detected peaks of the v 1 and v 2 burst signals which represent the present finger touch location x . ( note that δp usually represents mainly variations in the amplitude of the detected peak signal v 13 due to variations in finger touch pressure , but also includes variations in the amplitude of the detected peak signal v 13 due to certain variations in certain other environmental parameters .) averaging the values of the digitized peak amplitude data eliminates electrical noise . referring to fig4 , the program / algorithm executed by processor 32 in fig2 a samples the peak values of the v 1 bursts of pulses a predetermined number n of times and then also samples the peak values of the subsequent non - overlapping v 2 bursts a predetermined number n of times , as indicated in blocks 51 and 52 , respectively . the algorithm then goes to block 53 and removes and thereby “ saturates ” large deviations in the v 1 and v 2 data set sampled in accordance with blocks 51 and 52 , by limiting certain sampled v 1 and v 2 values that are too large ( due for example , to noise that has been injected into the data set ). when that happens , the samples that are at or near a maximum value or a minimum value are omitted and are not used in the averaging process . then , in accordance with block 54 , the algorithm uses the data from the process of block 53 to compute a short - term average of the sampled peak values of v 1 and v 2 . next , the algorithm goes to block 55 and calculates values of δp , where δp represents increments of finger touch pressure and is illustrated in the v 13 ′ waveform in fig2 b . ( after the “ saturated ” values have been omitted , the smallest sample is subtracted from the largest to obtain δp .) next , the algorithm goes to decision block 56 and compares the foregoing short - term average of v 1 and v 2 to a present value of a touch threshold level . if the comparison indicates that the short term average exceeds the touch threshold level , the decision is affirmative and indicates that the present touch is “ active ”. otherwise , the decision is negative and indicates that the present touch is “ inactive ”. if the present touch is inactive , the algorithm goes to block 58 and averages the new data resulting from the process of block 54 with the previous value of a “ long - term non - touch average . the algorithm then goes to block 59 and generates an interrupt signal which is sent to the user application , with the touch status inactive . if the current touch status is active , the algorithm goes to block 60 and averages the new data resulting from the process of block 54 with a previous “ long - term touch average ”. the “ long term non - touch average ” is a number which indicates that the sensor is not activated , in which case the capacitive coupling will be low and the number will be small and slowly increasing and decreasing . this occurs because there will be some environmental variables that change and cause this value to increase or decrease . for example , as the humidity increases , the long term non - touch average value will increase . the sensor does not interpret this increasing value as a touch . the long term non - touch average has a very long time constant and changes very slowly . the “ long term touch average ” is a number which indicates that the sensor is activated . it tracks the short term average calculated in block 54 , with a longer time constant . there are two of these averages , one for the v 1 interval and one for the v 2 interval . the algorithm then goes to block 61 and computes new touch threshold levels . to calculate the touch threshold , the long term non - touch average is added to the δp value and increased by a small offset . then the algorithm goes to block 62 and removes both the previously mentioned long - term non - touch average value and the value ( δp ) from the short term average of block 54 , in order to obtain the x ratio . to accomplish this , the long term non touch average is subtracted from the sum of the short term and long term averages and one half of − δp . this removes the environmental factors and some noise . the numerator and dominator are treated the same and form the x ratio . the algorithm then goes to block 63 and computes the ratio x of the present touch . the algorithm then goes to block 64 and calls a “ touch active ” routine , generating an interrupt signal which is sent to the user application along with the x position data . the ratio x of the stored amplitude data generated in response to any v 1 burst and the next v 2 burst is proportional to the x location of the corresponding touch . the finger touch pressure change δp ( and changes in certain environmental parameters ) equally affect the above - mentioned stored amplitude data that is generated in response to any v 1 burst and the next v 2 burst . once computed , the values of the ratio x for the present finger touch location x , the present direction of movement of the finger touch location , and the presence or absence of any finger touch may be decoded to provide a unique linear signal that may represent pressing of a button switch or a slider at that particular point . such information also may be segmented and decoded by processor 32 to simulate various individual control button presses or a linear control signal such as a volume control signal . relatively long - duration or long term average peak values represented by v 13 can be used to indicate the presence or absence of a touch on touch surface 5 . thus , fig2 a demonstrates a ratiometric configuration of two “ partial sensors ” 3 a , 2 and 3 b , 2 that share center plate 2 as a common element , wherein the first partial sensor comprised of outer plate 3 a and inner plate 2 increases the capacitive coupling as the touch input moves from left to right at the same time the second partial sensor comprised of outer plate 3 b and inner plate 2 decreases the capacitive coupling . touch sensor 4 - 2 in fig2 a differs structurally from touch - sensor 4 - 1 in fig1 in such a way as to provide the ratiometric coupling between inner plate 2 and outer plates 3 a and 3 b , respectively . this structural difference along with the alternate excitation of outer plates 3 a and 3 b enables variations of amplifier output voltage v 9 and peak detector output voltage v 13 due to variations in finger touch pressure and various other environmental parameters to be determined and then eliminated or canceled from the stored amplitudes used to compute the ratio representing the value of x which represents the present finger touch location . fig3 shows an implementation of a capacitively - coupled touch sensor system 10 - 3 which includes a capacitively - coupled sensor 4 - 3 that is a “ stretched out ” version of touch sensor 4 - 2 of fig2 a . touch sensor system 10 - 3 of fig3 also eliminates the effect of variations in finger touch pressure and other environmental parameters on the amplitude of an output signal that represents the finger touch location in basically the same way as sensor system 10 - 2 of fig2 a . in fig3 , capacitively - coupled touch sensor 4 - 3 includes five elongated , triangular outer plates 27 a , 3 a , 27 b , 3 b , and 27 c and a center plate 2 which includes four segments 2 - 1 , 2 - 2 , 2 - 3 , and 2 - 4 arranged in a zig - zag fashion . outer plates 3 a and 3 b are located on one side of center plate 2 , and outer plates 27 a , 27 b , and 27 c are located on the other side of center plate 2 . base edge 34 of outer plate 3 a is aligned with base edge 37 of outer plate 3 b . edge 35 of outer plate 3 a is parallel to and spaced from a first edge of center plate segment 2 - 1 , and edge 36 of outer plate 3 a is parallel to and spaced from a first edge of center plate segment 2 - 2 . similarly , edge 38 of outer plate 3 b is parallel to and spaced from a first edge of center plate segment 2 - 3 , and edge 39 of outer plate 3 b is parallel to and spaced from a first edge of center plate segment 2 - 4 . base edge 43 of outer plate 27 a is aligned with base edges 45 and 48 of outer plates 27 b and 27 c . edge 44 of outer plate 27 a is parallel to and spaced from a second edge of center plate segment 2 - 1 , and edge 46 of outer plate 27 b is parallel to and spaced from a second edge of center plate segment 2 - 2 . similarly , edge 47 of outer plate 27 b is parallel to and spaced from a second edge of center plate segment 2 - 4 , and edge 49 of outer plate 27 c is parallel to and spaced from a second edge of center plate segment 2 - 4 . each of outer plates 3 a and 3 b is spaced from a first side of center plate 2 by a first narrow gap , and each of outer plates 27 a , 27 b , and 27 c by a second narrow gap . a controller 30 a generates non - overlapping excitation signals v 1 , v 2 , v 3 , v 4 . v 1 is applied to outer plates 27 a and 27 c . v 2 is applied to outer plate 3 a , v 3 is applied to outer plate 27 b , and v 4 is applied to outer plate 3 b . as the tip of a user &# 39 ; s finger 19 slides in either direction along segment 2 - 1 of the center plate 2 of touch sensor 4 - 3 , the amount of capacitive coupling from one of plates 3 a and 27 a to center plate 2 increases as the width of that plate 3 a or 27 a increases . simultaneously , the amount of capacitive coupling from the other of these two plates decreases as its width decreases . with the finger touch located over the left end of segment 2 - 1 of center plate 2 , there is minimal capacitive coupling between center plate 2 and outer plate 3 a and maximum capacitive coupling between center plate 2 and outer plate 27 a . conversely , at the right end of segment 2 - 1 of center plate 2 , there is minimal capacitive coupling between center plate 2 and outer plate 27 a and maximum capacitive coupling between center plate 2 and outer plate 3 a . similarly , as the tip of the user &# 39 ; s finger 19 slides in either direction along segment 2 - 2 of center plate 2 of touch sensor 4 - 3 , the amount of capacitive coupling from one of plates 3 a and 27 a to center plate 2 increases as the width of that plate 3 a or 27 a increases . simultaneously , the amount of capacitive coupling from the other of these two plates decreases as its width decreases . with the finger touch located over the left end of segment 2 - 2 of center plate 2 , there is minimal capacitive coupling between center plate 2 and outer plate 27 b and maximum capacitive coupling between center plate 2 and outer plate 3 a . conversely , at the right end of segment 2 - 2 of the center plate 2 , there is minimal capacitive coupling between center plate 2 and outer plate 3 a and maximum capacitive coupling between center plate 2 and outer plate 27 b . operation is essentially the same as the tip of the user &# 39 ; s finger 19 slides in either direction along segments 2 - 3 and 2 - 4 of center plate 2 . thus , the amount of capacitive coupling of each of non - overlapping excitation signals v 1 , v 2 , v 3 , and v 4 to center plate 2 is different for each value of the location x at which finger 19 presses against the touch surface insulative layer 5 . as in fig2 a , center plate 2 is connected by a conductor 6 to one terminal of a resistor r load and to the input of an amplifier 8 . the signal v 6 is produced on conductor 6 as a result of sequential capacitive coupling of non - overlapping excitation signals v 1 , v 2 , v 3 , and v 4 onto center plate 2 . amplifier 8 amplifies v 6 to produce a signal v 9 that is applied by conductor 9 to one input of peak detector circuit 12 . peak detector circuit 12 produces detected peak signal v 13 , which is applied by conductor 13 to the input of an adc 15 . the output 17 of adc 15 may go to a processor which executes an algorithm that is basically the same as the algorithm of fig4 executed by the processor in fig2 a . the present invention thus provides a single ratio - metric coupled sensor that operates with as few as three signals but nevertheless provides an output signal value which is proportional to the position of the user &# 39 ; s touch and which requires relatively little computing hardware and software to obtain a linear response from the user &# 39 ; s sliding finger touch . in contrast , to implement a slider function with prior art capacitively - coupled touch systems , several individual capacitively - coupled sensors are required , and a relatively large amount of interpolation software and digital computing capability are required to interpolate a linear position in response to a user &# 39 ; s touch . while the invention has been described with reference to several particular embodiments thereof , those skilled in the art will be able to make various modifications to the described embodiments of the invention without departing from its true spirit and scope . it is intended that all elements or steps which are insubstantially different from those recited in the claims but perform substantially the same functions , respectively , in substantially the same way to achieve the same result as what is claimed are within the scope of the invention . for example , the variation in the width of outer plates 3 a and 3 b as a function of x may be different than the “ triangular ” variation shown in fig2 a and 3 and may result in the computed values of x which are a nonlinear function of the user &# 39 ; s actual finger position . in some cases it may be practical to provide the center conductor of the touch sensor with a circular or arcuate axis so that the user touch would need to traverse the circular or arcuate axis . also , an element other than a human finger , e . g ., a robotic element , can be utilized to perform a touch , as long as the element sufficiently influences the capacitive coupling between each outer plate and the center plate 2 . furthermore , the finger or other element need not actually touch the touch surface 5 as long as it is sufficiently close to the outer plates and the inner plate to sufficiently influence the capacitive coupling between them . in some cases , peak detector 12 could be omitted and the peak detecting function could be performed by a sufficiently fast adc and processor . | 6 |
this invention pertains to pigment micro - agglomerate coloring systems for coloring synthetic fibers and textile materials , either permanently or temporarily . in the invention certain starch and cellulosic derivatives are softened with poly hydric alcohols to form glycolate modified derivatives ( gmd ). the gmd &# 39 ; s serve as thickener which encapsulates pigment particles to form a pigment - gmd agglomerate which in itself can be used for the temporary coloring of synthetic textile materials . the pigment - gmd agglomerate may be colloidally combined with a latex binder to form a complex pigment - gmd - binder agglomerate . this pigment micro - agglomerate complex may be deposited on textile materials from print rolls or pad rolls to yield a coloring system which is soft , durable and fast to washing and dry cleaning . referring now to the drawings , the three figures illustrate in a diagrammatic way the steps in the formation of the pigment micro - agglomerate complex of the present invention . fig1 illustrates the first or modification step . non - colloidial , hydrophilic molecules of poly hydric compounds , such as glycerin , 1 , 3 butylene glycol , 1 , 4 butylene glycol and 1 , 2 propylene glycol are solvated into hydrophilic colloidal molecules or particles by heating the components for 60 to 90 minues between 100 ° and 140 ° f . with an acid added to maintain a ph between 4 and 6 . the resultant particles are permanently modified and are called glycolate modified derivatives , gmd . the next step is the pigment sensitization step , as illustrated in fig2 . the glycolate modified derivatives are combined colloidally with pigment particles by heating between 100 °- 140 ° f . for 60 to 90 minutes maintaining a ph of 6 . 5 to 7 . 5 . the resultant pigment sensitive particles , psp , may be used for temporary coloring , as described hereinafter . the third step is the pigment agglomeration step , as illustrated in fig3 . in this step the psp are agglomerated with lyophilic colloidal molecules or particles by mixing under mild agitation for 60 to 90 minutes while maintaining a ph of 6 . 5 to 7 . 5 . the resulting pigment agglomerate particles , pap , are very hydrophilic , complexing numerous water molecules , such that a thickening action still prevails of the required viscosity for effective application by print rolls or pad rolls to textile materials . this resultant pap , when deposited on the surface of the textile materials will be firmly affixed by the function of the binder which bonds the whole complex in place . the glycolate modified derivative , gmd , as part of this complex is also affixed , and is soft , and contributes to providing good properties of color yield , comfort , hand , and wet crock . the inventon includes a very effective means to form soft , flexible starch and cellulose derivatives . the ability to make these soft , thickener type derivatives is crucial to this invention . the glycolate modified derivatives , as we have termed them , are made by the acid reaction of low molecular weight glycols with starch or cellulosic derivatives . the starch or cellulosic derivatives are reacted under acid conditions with the glycols . we believe the mechanism of reaction to be the formation of hydrocellulose by the hydrolysis attack of the acid of the 1 , 4 ether linkage of the cellulose and starch chains , of course cellulose chains being composed of beta - glucose molecules , and starch of alpha - glucose molecules . the beta - glucose molecules of cellulose we can represent by r b and the alpha glucose molecules of starch as r s . therefore , the structured formula for cellulose and starch can be represented as such : ## str1 ## we must understand that the r b unit of cellulose -- ## str2 ## can form various derivatives with the available hydroxy groups being reacted . the same for the r s unit of starch -- ## str3 ## hence , in this specification , we will represent the various derivatives as they are reacted with the available hydroxyl groups . for hydroxy ethyl cellulose , we have ## str4 ## for acetylated starch , we have -- ## str5 ## in the making of the glycolate modified derivative -- gmd , hydroxy ethyl cellulose and acetylated starch are reacted with glycerine , 1 , 3 propylene glycol , 1 , 4 butylene glycol , or 1 , 3 butylene glycol . the reaction is carried out at an acid ph . for hydroxy ethyl cellulose and 1 , 3 propylene glycol -- ## str6 ## for acetylated starch and 1 , 3 propylene glycol -- ## str7 ## the essential result of the above reactions is that the unmodified hydroxy ethyl cellulose , and acetylated starch derivatives give films that are clear , but brittle and stiff . after reaction or modification with the propylene glycol , they give films that are clear , but flexible , not brittle . the reacton conditions are to dissolve the hydroxy ethyl cellulose , or acetylated starch , in water at a concentration of anywhere from 0 . 05 - 20 %, add formic acid to adjust the ph to 4 - 5 , add the 1 , 3 propylene glycol at a concentration of 0 . 01 - 10 %, and react at a temperature of 160 °- 180 ° for 30 - 90 minutes . as the reaction proceeds , a definite change can be noted . at first , the viscosity of the reacting solution will drop , and become increasingly clear , but then begins to increase and take on a haze . we theorize that the derivatives are first hydrolzed , and then crosslinked with the glycols to form glycolates . the kinds of products that can be made are numerous , by varying the reaction conditions and the reactants . many different acids besides formic can be used , such as acetic , oxalic , tartaric , citric , i . e ., the organic acids , not the mineral acids . different glycols besides propylene glycol can be used such as glycerin , 1 , 2 and , 1 , 4 butylene glycol , dihydroxy acetone and others , as long as there are two hydroxy groups in terminal reactive positions , and the molecular weight is not to high to lose solubility in water . after the formation of the glycolate modified derivative , gmd , the next step is pigment sensitization . the pigment color is added to the gmd solution , at a concentration of 0 . 25 - 15 % dependent on the depth of shade required , and the corresponding concentration of the gmd . the ph is adjusted with ammonia to 6 . 5 - 7 . 5 . the temperature is brought to 120 °- 140 ° f ., and the solution is held under mild agitation for 60 to 90 minutes . the gmd will migrate and encapsulate , colloidally , the pigment particles . the viscosity of the solution will adjust at this point , becoming lower . the pigment is completely encapsulated , and we refer to this as sensitizing the pigment particles . interestingly enough , if pigment sensitized particles , psp &# 39 ; s in solution form , colloidally suspended , are cast onto a surface and dried , they are completely redispersible with water upon subsequent rewetting . in fact , the cleanup , either off the hands or off various surfaces , is easy and total . this property illustrates the complete encapsulation of the pigment , and this feature can be utilized to good purpose when it is desired to only temporarily color a substance , and then be able to remove said coloring without staining . the gmd &# 39 ; s of this invention are uniquely capable of sensitizing pigment particles , or encapsulating them . this action will work equally well on non - colored pigments or fillers as they are called . in fact , sensitized filler particles are easily incorporated into foam systems , so that they do not destabilize the foam , and in foam printing or coating , it is a distinct advantage to incorporate a high level of filler . after the sensitizing step , the next step is to form what we term the pigment agglomerate . to the psp solution , as made above , we now add binder which is in latex form . the binder is usually a film forming elastomer , and can be of any composition . this does not matter , nor does it restrict or confine the workings of this invention . what is important is that the polymeric binder be a latex or colloidal dispersion . this is added to a concentration of 0 . 25 - 20 %, and held at room ambient temperature , under mild agitation for 60 - 120 minutes . after awhile , it is apparent that the colloidal nature of the solution or mix has changed . the viscosity drops even lower , and a clear layer of liquid will form at the top of mix when agitation is stopped and the suspended particles begin to show signs of settling . this is typical of the situation of forming a larger agglomerate particle . instead of being in the particle size range of less than one micron , the particles now , if examined under a microscope and measured , are in the particle size range of 1 to 8 microns , more normally around 2 - 3 microns . the sensitized pigment - binder agglomerate is now formed . the pigment agglomerate particles , pap , so formed , are now very intimately admixed in a very unique and permanent manner . the efficiency of intermixing is intermolecular , such that secondary valence forces are holding the particles intermolecularly together , and much more effectively , or efficiently than could be accomplished by simple dispersion mixing . in this agglomerate form the glycolate derivatives , the pigment colors and the binders are so tightly bound up intermolecularly together , that they cannot now be separately extracted fron one another . upon subsequent application of this coloring system to textile substrates , and driving off the water , and heat curing to further adhesion , the system is very durable , and fast to washing and drycleaning . surprisingly , even the wet and dry crock resistance , or rub off of color , is markedly improved , and what is so important , the hand is soft and supple , due to the flexible nature of the glycolate derivatives , as opposed to other thickeners that are non - flexible and brittle . ______________________________________i making the gmdformulaingredients parts by weight______________________________________1 . water 10202 . kofilm 80 , 90 % 100 - acetylated starch3 . formic acid , 90 % 44 . diethylene glycol 20______________________________________ the kofilm 80 is an acetylated starch made by national starch company , plainfield , n . j ., which is dissolved in the water first by adding it slowly to the water , cold , under adequate agitation until completely dispersed . formic acid is added , followed by the diethylene glycol . the ph is checked to make certain it is in the range of 4 - 5 . the temperature is gradually raised to 180 ° f ., and held at this temperature , under mild agitation , for 90 minutes . the heat is removed , and the batch is allowed to drop in temperature to 120 ° f . the viscosity of the solution prior to the cook was 25 , 000 cps . ; after the cook 18 , 000 cps . ______________________________________ii making the pspformulaingredients parts by weight______________________________________1 . gmd solution , 10 % 11442 . cu phythocayamine bluedispersion , 40 % 553 . ammonia to ph 6 . 5______________________________________ the blue pigment concentrate is added to the gmd solution , and then the solution adjusted with ammonia to a ph of 6 . 5 . the temperature of the solution is held at 120 ° f . for 60 minutes under mild agitation . the temperature is allowed to drop to ambient room temperature . the viscosity of the psp solution as made is 9 , 000 cps . ______________________________________iii making the pap . formulaingredients parts by weight______________________________________1 . psp solution , 11 % 11992 . hycar 1561 , 40 % 100 - nitryl rubber______________________________________ the above solution is held at ambient temperatures . the hycar 1561 is an elastomeric copolymer composed of about 55 % butadiene , and 45 % acrylonitrile , in the form of a latex , made by b . f . goodrich company , akron , ohio . the above solution is mildly agitated for 120 minutes , at which time distinct 3 - 8 micron agglomerate particles have formed . ______________________________________iv . print formulaingredients parts by weight______________________________________1 . pap solution , 13 % 12992 . carbopol k - 934 - 5 % solution 13 . triton x100 14 . dodecyl alcohol . 55 . defoamer . 2______________________________________ additional chemicals are added to form the final print mix . the carbopol k - 934 is a thickener which is a copolymer of acrylic acid and acrylonitrile , made by b . f . goodrich company , added to adjust the print mix to a viscosity of 20 , 000 cps . the triton x - 100 is a nonionic wetting agent which is a condensation product of nonophenol and ethylene oxide , made by rohm and haas company , philadelphia , pa ., which is added to provide better print mix penetration and wetting of the textile goods . do decyl alcohol is added to give smoothness , and further wetting . a defoamer is added to control or prevent foaming during printing . ______________________________________i . making the gmdformulaingredients parts by weight______________________________________1 . water 10002 . kofilm 80 , 90 % 50 - acetylated starch3 . formic acid , 90 % 44 . diethylene glycol 10______________________________________ the above is cooked at 160 ° f . for 70 minutes , under mild agitation . the viscosity of this gmd solution is 2800 cps . ______________________________________ii . making the pspformulaingredients parts by weight______________________________________1 . gmd solution , 5 . 5 % 10642 . cu phthocyanine bluedispersion 40 % 373 . ammonia to ph 7 . 0______________________________________ this solution is cooked for 40 minutes at 135 ° f . under mild agitation then dropped to ambient temperatures . ______________________________________iii . making the papformulaingredients parts by weight______________________________________1 . psp solution , 6 . 7 % 11002 . hycar 2679 , 50 % 50 - polyacrylic polymer3 . hycar 1561 , 40 % 12 . 5 - nitryl rubber______________________________________ the above solution is held at room temperature , under mild agitation , for 120 ° f . minutes , after which time a distinct 3 - 8 micron agglomerate particles form . after this time interval , the pad dye solution is prepared as follows : ______________________________________iv . pad dyeformulaingredients parts by weight______________________________________1 . pap solution 9 % 11602 . triton x100 0 . 53 . methocel , 15 cps . 0 . 94 . cymel 303 , 80 % ( mf resin ) 1 . 2 - butylated mela - mine resin5 . defoamer 0 . 3______________________________________ the gmd solution is made the same as example i , and so also the psp solution . the pigment agglomerate particles were made as follows : ______________________________________pap solutionformulaingredients parts by weight______________________________________1 . psp solution of ex . 1 10002 . rhoplex ha - 8 , 46 % 32 - polyacrylic resin3 . hycar 1561 , 40 % 37 - nitryl rubber______________________________________ this solution is held at ambient temperatures , under mild agitation , for 120 minutes . rhoplex ha - 8 is a self crosslinking polyethyl acrylate polymer in latex form from the rohm & amp ; haas company , philadelphia , pa . after the pigment agglomerate particles have formed , at from 3 - 10 microns , in size , the following print formula is made . ______________________________________print formulaingredients parts by weight______________________________________1 . above pap solution , 13 % 10002 . alcogum l - 11 , 30 % 1 - polyacrylic acid3 . butylated melamine - formaldehyde resin 50 % 34 . defoamer 0 . 4______________________________________ the viscosity of the print paste is 18 , 000 cps . this formula is particularly good on rayon or cotton goods . the gmd and psp solutions are made the same as example ii . the pap solution is made as follows : ______________________________________pap solution formulaingredients parts by weight______________________________________1 . psp solution of ex . 2 10002 . darex 410 , 46 % 47 - polyacrylic resin3 . hycar 1561 , 40 % 10 - nitryl rubber______________________________________ this is stirred at room temperature for 100 minutes , after which time the desired pigment agglomerate particles are formed at a particle size range of 2 - 8 microns . from this is made the following pigment pad formula . ______________________________________pad dye formulaingredients parts by weight______________________________________1 . pap solution from above8 . 7 % 10002 . methocel , 4000 cps . 0 . 93 . keltex 0 . 45 - protein gum4 . urea 0 . 45 . ammonium hydroxide , 28 % 2 . 76 . trimethyol melamineresin , 80 % 3 . 07 . triton x100 0 . 48 . ammonium stearate , 30 % 0 . 129 . defoamer 0 . 4______________________________________ this formula had a viscosity of 600 - 800 cps . this pigment pad formula is particularly good on polyester / cotton goods , giving a soft hand with good wash performance . ______________________________________i . making the gmdformulaingredients parts by weight______________________________________1 . water 10002 . cellosize qp 5200h , 90 % 10 - hydroxy ethyl cellulose3 . formic acid , 90 % 24 . diethylene glycol 4______________________________________ the cellosize qp5200 h , is an hydroxy ethyl cellulose made by union carbide corp ., new york , n . y ., which is dissolved in the water by first adding it to cold water to disperse it under adequate agitation , then adding the formic acid , followed by diethylene glycol . the temperature is gradually raised to 160 ° f . and held for 60 minutes under mild agitation . the heat is removed , and the batch let cool to 120 ° f . the viscosity of the batch prior to the cook was 50 , 000 cps . and after the cook 30 , 000 cps . ______________________________________ii . making the pspformulaingredients parts______________________________________1 . gmd solution 1 . 47 % 10002 . calcium phthocyanineblue dispersion , 40 % 503 . ammonium hydroxide , 28 % to ph 6 . 7______________________________________ the blue pigment dispersion is added to the gmd solution , and then this solution is adjusted with ammonia to a ph of 6 . 7 . the temperature of the solution is held at 120 ° f . for 60 minutes under mild agitation . after the 60 minute interval , the temperature is dropped to room temperature . the viscosity of the psp solution is 20 , 000 cps . ______________________________________iii . making the papformulaingredients parts by weight______________________________________1 . psp solution , 3 . 5 % 10002 . hycar , 1561 , 40 % 100 - nitryl rubber______________________________________ the above solution is held at room temperature , under mild agitation for 120 minutes , after which time agglomerated particles are formed range in size from 2 - 10 microns . this is now made up in a print formula . the solution viscosity is 12 , 000 cps . ______________________________________iv print formulaingredients parts by weight______________________________________1 . pap solution , 7 . 5 % 10002 . carbopol k - 934 , 5 % solution 33 . triton x - 100 14 . xylene 1 . 55 . defoamer 0 . 2______________________________________ this print mix has a viscosity of 20 , 000 cps . it prints very well from engraved rolls . the resultant prints are soft , and display excellent sharpness of print definition . ______________________________________i . making the gmdformulaingredients parts by weight______________________________________1 . water 10002 . cellosize qp5200h 73 . formic acid 24 . diethylene glycol 3______________________________________ the above is cooked for 90 minutes at 180 ° f ., under mild agitation . the viscosity of this solution is 25 , 000 cps . ______________________________________ii . making the pspformulaingredients parts by weight______________________________________gmd solution , 1 . 2 % 10002 . cuphthocyanine bluedispersion 40 % 353 . ammonium hydroxide , 28 % to ph 6 . 7______________________________________ this solution is cooked for 60 minutes at 160 ° f ., under mild agitation , then dropped to room temperature . viscosity is 17 , 000 cps . ______________________________________iii making the papformulaingredients parts by weight______________________________________1 . psp solution , 3 . 0 % 10002 . hycar 2679 , 50 % 393 . hycar 1561 , 40 % 21______________________________________ the above solution is held at room temperature , under mild agitation , for 120 minutes . after this time interval , a distinct range of agglomerate particles from 3 - 8 microns form . from this is now prepared the dye solution . viscosity 300 cps . ______________________________________iv . pad dyeformulaingredients parts by weight______________________________________1 . pap solution 5 . 8 % 10002 . triton x100 0 . 53 . methocel , 15 cps . 0 . 94 . cymel 303 , 80 % ( mf resin ) 1 . 95 . defoamer 0 . 3______________________________________ the viscosity of the pad dye solution is 700 - 900 cps . this pad dye solution goes on very well , with excellent color yield and uniformity , with no migration of pigment upon drying . the gmd solution is made the same as cited in example v ., and so also for the psp solution . the pap solution is made as follows : ______________________________________pap solutionformulaingredients parts by weight______________________________________1 . psp solution of ex . 5 ( 3 . 5 %) 10002 . darex 410 , 46 % 483 . hycar 1561 , 40 % 14______________________________________ this solution is mildly agitated at room temperature for 120 minutes to form the pigment agglomerate particles of size of 2 - 8 microns . this is now made up into the following print formula . ______________________________________print formulaingredients parts by weight______________________________________1 . above pap solution , 6 % 10002 . alcogum l - 11 , 30 % 33 . butylated melamine - formal - dehyde resin , 50 % 3 . 04 . defoamer 0 . 2______________________________________ viscosity of this print paste is 22 , 000 cps . this print paste gives good definition of color , and a soft feel . the color yield was excellent . the gmd and psp solutions are made the same as example vi . the pap solution is made as follows : ______________________________________pap formulaingredients parts by weight______________________________________1 . psp solution of ex . 6 , 3 . 0 % 10002 . darex 410 , 46 % 243 . hycar 1561 , 40 % 7______________________________________ this solution is stirred at room temperature for 120 minutes , the pigment agglomerate particles form at a size of 2 - 8 microns . from this is made the following pigment pad formula . ______________________________________pad dye formulaingredients parts by weight______________________________________1 . pap solution from above , 4 . 5 % 10002 . keltex 1 . 23 . triton x100 0 . 44 . ammonium hydroxide , 28 % 2 . 45 . ammonnium stearate , 30 % 3 . 06 . trimethylol melamineresin , 80 % 2 . 47 . defoamer 0 . 4______________________________________ this formula had a viscosity of 400 - 600 cps . it padded on very well , gave a pleasing soft hand and excellent uniform coloring . the wash fastness is very good . at this point it is important to present comparative test data of the above pigment print and padding mixes as made by this invention versus conventional pigment print and padding systems . the evaluation data is presented in the following tables : ______________________________________ ratings wash lightprint color fast - dry wet fast - systems yield ness crock crock hand ness______________________________________example i 5 4 4 3 - 2 4 4example iii 4 4 4 4 - 3 4 - 3 4example v 4 4 4 3 - 2 5 - 4 4______________________________________ ______________________________________ ratings wash lightprint color fast - dry wet fast - systems yield ness crock crock hand ness______________________________________example vii 5 4 4 4 - 3 4 - 3 4conventionalphthlo blue 4 4 4 2 3 4conventional2phthlo blue 3 - 4 4 4 2 2 4______________________________________ ratings : 5excellent , 4good , 3mod . good , 2fair , 1poor from the above table it can be seen that this invention has a desirable effect on hand and color yield . the wet crock is also improved over two conventional phthlo blue pigment print formulas supplied to the textile industry . the washfastness and dry crock are equivalent . ______________________________________ ratings wash lightpad dye color fast - dry wet fast - systems yield ness crock crock hand ness______________________________________example ii 4 4 4 3 3 - 4 4example iv 3 - 4 4 4 3 - 4 3 4example vi 4 4 4 3 3 - 4 4example 3 - 4 4 4 3 - 4 3 4viiiconventionalphthlo blue 3 - 4 4 4 2 2 - 1 4conventional2phthlo blue 3 - 4 4 4 2 2 - 1 4______________________________________ for pigment pad dyeing the examples of this invention are superior to conventional systems , the wet crock is improved , and the hand is dramatically better . the improvement in hand is very important for pigment pad dyeing , because the thickening agents that are currently used , even in very small amounts of actual deposition on the textile goods , cause stiffening . this has always been a drawback to pigment pad dyeing . also , in conventional systems to obtain washfastness , a substantial level of binding resin has to be employed . hence pigment pad dyeings that have good washfastness , have firm hands . by using the glycolate derivatives of this invention , and forming the pigment agglomerate with the binder , much less binder has to be used to achieve an equivalent level of washfastness , and coupled with glycolate derivative as a thickener , is softer in hand . this double effect now allows one to design pigment dye systems that are pleasing in hand and washfast . the glycolate derivatives are good as foam stabilizers , so as such are useful in foam print systems . ______________________________________i . making the gmdformulaingredients parts by weight______________________________________1 . water 10002 . kofilm 80 , 90 % 1403 . formic acid , 90 % 64 . citric acid , 90 % 25 . diethylene glycol 30______________________________________ this cooked in the usual manner at 160 ° f . for 90 minutes , under mild agitation . the viscosity at the end of the cook is 40 , 000 cps . ______________________________________ii . making the pspformulaingredients parts by weight______________________________________1 . gmd solution , 15 % 10002 . itr red , 25 % 783 . ammonium hydroxide to ph 7 . 0______________________________________ this is cooked for 60 minutes at 160 ° f ., with mild agitation . the viscosity at the end of this cook is 30 , 000 cps . ______________________________________iii . making the papformulaingredients parts by weight______________________________________1 . psp solution , 15 % 10002 . hycar 2679 , 50 % 623 . hycar 1561 , 40 % 19______________________________________ this solution is held at room temperature for 35 minutes , under mild agitation . the pigment agglomerate particle range in size from 1 . 5 - 4 . 0 microns . the viscosity of the pap solution is 8000 cps . ______________________________________iv . foam print compoundformulaingredients parts by weight______________________________________1 . pap solution , 15 % 20002 . dupanol me , 20 % 12 - lauryl sulfate3 . melamine formaldehyderesin , 50 % 84 . ammonium stearate , 30 % 1 . 5______________________________________ the above mix can be shipped into a foam with the use of a high speed mixer to give a foam of a density of 0 . 43 . this foam print compound is very stable , applys well with excellent pore structure and once applied yields a soft , flexible print . an interesting property of the pigment sensitized particle ( psp ) is that the pigment is completely encapsulated by the glycolate modified derivative . this means that if the psps are deposited upon a textile substrate , they can later be removed completely by water . this property can be used to advantage for the making of fugitive or nonstaining tints . there are times when it is desirable to tint a kind , or lot of fiber to identify it during the processing . after the processing is complete , then it is desirable to remove the tint completely without any staining . with dyes or pigments that are selected to have no affinity to a certain kind of fiber , staining still results ; and the wash procedure is quite involved to try to remove all of the dyestuff or pigment completely . however , the pigment sensitized particles ( psp ) will not stain the fiber regardless of composition and will wash out completely and easily with hot water , or mild soaping , hot or cold . this property has proved most effective in creating a craft for children , permitting them to color the hair of dolls . the hair coloring of dolls was not possible with prior art dyestuffs and pigments , since they would stain the doll &# 39 ; s hair no matter what fiber was used -- polypropylene , nylon , polyester , etc . in fact , the search to find dyestuffs or pigments that would easily wash out without staining has been long and unfruitful . the psp concept was tested and worked perfectly with a full range of colors . so the invention of micro - encapsulation of pigment particles with glycolate modified derivatives provides the development of a fugitive , non - staining hair coloring system , that can be used as a child &# 39 ; s activity . the making of this doll hair coloring system is as follows : ______________________________________i . making the glycolate modified derivativeformulaingredients parts by weight______________________________________1 . water 10002 . cellosize qp100m , 90 % 153 . citric acid , 90 % 34 . glycerin 20______________________________________ this solution is cooked under mild agitation for 90 minutes at a temperature of 180 ° f . the viscosity of this cook is 36000 cps . ______________________________________ii . making the pigment sensitized particles______________________________________formula for redingredients parts by weight______________________________________1 . gmd solution , above , 4 % 10002 . hercules red t . 10dispersion3 . ammonium hydroxide , 20 to ph 7 . 0______________________________________formula for violetingredients parts by weight______________________________________1 . gmd solution above , 4 % 10002 . carbizol violet 25dispersion3 . ammonium hydroxide , 20 % to ph 7 . 0______________________________________formula for browningredients parts by weight______________________________________1 . gmd solution , above 4 % 10002 . burnt umber dispersion 303 . black dispersion 34 . ammonium hydroxide , 20 % to ph 7 . 0______________________________________ the above solutions are cooked under mild agitation for 60 - 70 minutes at a temperature of 120 ° f . after this cook , the viscosity of this solution drops to range from 6 - 9000 cps . this makes for an excellent hair coloring mix or solution . it has just the right coverage viscosity to give an excellent comb thru application or coverage . the coloring mix is allowed to dry , whereby the artificial hair , usually nylon fiber , is uniformly colored . this coloring can be very easily and completely removed by washing in warm water , or a mild , cold water soap solution . this feature is essential to the haircoloring activity for children , whereby they can change the color of the hair on the doll at will , without staining or hurting the condition of the hair fiber . the glycolate derivative has added features of being soft , and flexible with dry surface feel , and acts like a hair conditioner to add high lite , suppleness and smoothness of feel . without the ability of the glycolate modified deriviative to act as a soft hair conditioner , and also , able to form a micro agglomerate and encapsulation of the coloring pigment , the hair coloring activity for dolls for children would not be a commercial reality . | 3 |
fig1 illustrates a prior art retainer 14 inserted into the opening 12 of a substrate 10 . the substrate can comprise , for example , a printed circuit board and the retainer 14 can extend from a component to be mounted ( not shown ) such as a telephone jack , transformer , relay , or the like . the retainer 14 includes two legs 16 which terminate in wedge shaped feet 18 . the tips 19 of the feet 18 extend slightly over the opening 12 to provide the retention function . a problem with the prior art design illustrated in fig1 is that due to tolerance variations in the retainer itself or in the opening 12 , the tips 19 may not extend sufficiently over the edges of the opening in order to provide the required retention force . from testing , it has been determined that the proper retention force required to mount a telephone modem connector , for example , to a printed circuit board is obtained only if the span across the wedge shaped feet 18 is a minimum of 0 . 003 inches larger than the hole 12 , after insertion of the retainer and in a compressed state . this foot to hole overlap condition must be maintained while accommodating the manufacturing tolerance of the hole and retainer , which may each be , for example , on the order of 0 . 004 inches . worst case tolerance samples of prior art devices either deformed to a failure mode or fell out during insertion into the printed circuit board . the present invention overcomes the problems of the prior art by providing two unique features illustrated , for example , in fig2 . the first feature is a thin &# 34 ; crush rib &# 34 ; 24 that partially deforms to varying degrees during insertion of the retainer 21 into hole 12 , depending on the exact dimensions of the retainer and the hole being mated . the crush ribs 24 deform more for larger feet and / or for smaller holes . this feature effectively eliminates a portion of the required tolerance since the wedge shaped feet 22 of the retainer 21 are allowed to resize themselves during assembly . the second feature of the present invention is a reshaping of the wedge shaped feet 22 , in order to change the way that the legs 20 deform due to forces created during insertion into the substrate opening . more particularly , the foot is lengthened as compared to the prior art to the point that the product of the new length and the normal force of the walls of the substrate opening against the foot during insertion creates a bending moment sufficient to elastically deflect the portion of the leg near the widest part ( i . e ., shoulder 36 ) of the foot . this elastic deflection narrows the gap 28 near the shoulder 36 of the retainer as it is being inserted into the opening 12 . the feet 22 of the present invention also contain varying slopes , as best illustrated in fig5 . a first slope 30 is provided at an angle ( α 1 ) to facilitate the initial insertion of the retainer into the opening 12 of the substrate 10 . this angle is preferably on the order of 40 ° to 60 °. the engagement of the first slope with the opening 12 as the retainer is inserted into the substrate 10 is illustrated in fig6 . fig7 illustrates the further insertion of the retainer to the point at which the interior surfaces 26 of the legs make contact via crush ribs 24 at the distal ends of legs 20 . a second slope 32 which follows first slope 30 at a different angle ( α 2 ) establishes a first applied force from the inside wall of opening 12 prior to the time at which the interior surfaces 26 of the legs make contact as the feet are pushed through the opening . the angle α 2 can be , for example , on the order of 12 ° to 20 °. a third slope 34 follows slope 32 at yet another angle ( α 3 ). the third slope 34 establishes a second applied force from the inside wall of opening 12 after the interior surfaces 26 make contact via ribs 24 and while the legs are deflecting toward each other in the area 40 between the base 23 and the shoulder 36 of the retainer , as the feet continue to be pushed through the opening 12 . the angle α 3 is preferably in a range of about 6 ° to 12 °. a goal of the slopes 32 and 34 is to minimize the insertion force of the retainer by decreasing the slope as the value of the applied force ( p applied ) increases during insertion . fig1 illustrates , in graphical form , the force applied to the foot portions 22 of the retainer as a function of the displacement of the retainer into the substrate opening . the slope 50 in fig1 illustrates the initial force imparted by the edges of opening 12 as the retainer is inserted into the opening along slope 30 . the slope 52 of fig1 illustrates the force imparted along the slope 32 of the retainer . the slope 54 of fig1 illustrates the force imparted as the retainer is pushed into the opening along slope 34 . the shape of slope 34 on the retainer provides a more glancing angle than the prior art , so that the normal force of the circumferential wall of the substrate opening against the foot during insertion is in a more perpendicular direction . this increases the bending moment that displaces the legs toward each other in the area 40 illustrated in fig8 . an additional benefit of the redirection of the normal force is the reduction in the overall force it takes to install the retainer into the substrate opening . since the retention force provided by shoulder 36 overlapping the edge of the substrate opening 12 ( as shown in fig2 ) acts in a parallel direction , it cannot create a bending moment large enough to cause the legs to deflect as shown in fig8 . thus , the retainer does not easily release from the opening while being pulled on after installation in a direction opposite to the insertion direction . the structure of the foot in accordance with the present invention effectively turns the retainer into an elastic spring , which is elastic to compressive radial loading ( such as the normal force from the substrate opening during insertion ) but is insensitive to axial loading ( as required for retention ). fig9 illustrates the dimensions of the leg 20 and foot 22 of a retainer in accordance with the present invention . also illustrated is the crush rib 24 , which is optional . the spring rate for the retainer after the tips of the feet contact consists of two parts . these involve the crushing of the deformable rib 24 ( when provided ) and elastic deformation of the leg in the area 40 illustrated in fig8 . for the deformable rib , the rate of plastic deformation of the rib at the point where p crush is applied is calculated as follows : ## equ1 ## where &# 34 ; 1 &# 34 ; is the actual length over which the crush occurs , which will be something less than 1 max shown in fig9 and &# 34 ; deformation &# 34 ; is the amount the rib deforms in height . combining and rearranging : ## equ2 ## further , to convert from the point of view of p crush to p applied : p applied = t * p crush , where t is a constant derived from the geometry of the foot . thus , from the point of view of the applied load : ## equ3 ## since the legs are still elastically bending in a cantilevered manner from the base 23 as the deformable rib ( s ) 24 is crushing , the overall spring rate k 1 is : k 1 = k crush + k bend , where k bend is the spring rate of the cantilevered leg , the derivation of which is well known . in order to compute the total equivalent spring rate for both plastic deformation ( i . e ., the crushing of the deformable rib ( s )) and elastic deformation ( i . e ., the mid - span deflection of the legs in area 40 ), the mid - span deflection k 2 must also be determined . the approximate mid - span deflection is determined from the relationship : ## equ4 ## where &# 34 ; e &# 34 ; is young &# 39 ; s modulus ( i . e ., the modulus of elasticity ) and &# 34 ; deformation &# 34 ; is the amount of deformation directly under the application of the load , i . e ., under p applied . the total equivalent spring rate k total is then : ## equ5 ## it should now be appreciated that the present invention provides a resilient snap fitting retainer that can be successfully mated with an opening in a substrate over a wide tolerance range while maintaining the necessary retention force . a crush rib allows larger retainer feet to partially resize themselves to smaller holes . typically , the crush rib can accommodate about 35 percent of any needed tolerance . the elastic nature of the elongated legs and feet absorb the balance ( e . g ., up to about 65 percent ) of the needed tolerance . a further advantage of the invention is that material on the exterior surface of the wedge shaped feet will not be shaved off of the retainer as it is installed into the substrate opening . prior art devices typically resulted in the shearing of the external surface of the feet if the retainer was too big for the hole . this can make it very difficult , if not impossible , to fully insert the retainer into the hole . in the structure of the present invention , instead of the insertion force causing shearing of the surface material , the gap between the legs narrows due to the mid - span bending in order to prevent shearing . more particularly , once the tips of the feet touch , the insertion force causes mid - span bending due to the extended length of the legs , while the crush ribs simultaneously deform to accommodate a tight fit . the insertion force is kept relatively constant by the gradual slope of the feet during this process . although the invention has been described in connection with various preferred embodiments , those skilled in the art will appreciate that numerous adaptations and modifications may be made thereto without departing from the spirit and scope of the invention as set forth in the claims . | 7 |
the present invention is aimed at optimizing optical measurements of features / parameters of small targets , e . g . in patterned structures . in some applications , for example measurements on patterned structures such as semiconductor wafers , a target may be a located in a test site and configured in accordance with the operative ( e . g . patterned ) region of the structure . reference is made to fig1 illustrating schematically a measurement system 100 suitable for using the technique of the invention . the measurement system 100 includes an optical system 102 appropriately accommodated with respect to a measurement plane mp where a test structure ( target ) 104 is located ; and a control unit 106 in communication ( via wires or wireless signal transmission ) with the optical system 102 . the optical system 102 includes an illumination unit 102 a and a detection unit 102 b . the illumination unit 102 a includes a light source with its associated light directing assembly 104 a ; and the detection unit 102 b includes a detector with its associated light collecting assembly 104 b . the light directing / collecting assembly may include one or more apertures ( e . g . lenses ), as well as any other suitable optical elements providing desired parameters / conditions of light propagation through the system . the illumination unit 102 a and the detection unit 102 b define , respectively , an illumination channel c 1 for focusing an illuminating light onto a measurement spot on the target plane with a numerical aperture na 1 , and a collection channel c 2 for collecting light from the measurement spot onto a detection plane with a numerical aperture na 2 . the illumination channel is configured such that the configuration of the measurement spot corresponds to the shape and size of the target the control unit 106 is typically an electronic device including inter alia such software / hardware utilities / modules as data input ( or data readout ) and output 106 a / 106 b , memory 106 c , and data processor 106 d . the control unit 106 may also include one or more controller utilities for controllably adjusting / varying an effective aperture of the optical system . as exemplified in the figure , such one or more controller utilities may include a numerical aperture controller 106 e for controllably varying either one or both of the illumination and collection numerical apertures na 1 and na 2 to provide a desired ratio between them ; and / or may include aperture orientation controller 106 f for controllably adjusting / varying a position and / or shape of either one or both apertures in the illumination and collection channels to provide a desired relative orientation thereof ( orientation offset ). the control unit 106 may be configured and operable to receive and analyze input data indicative of the configuration ( size and shape ) of the target to be measured , as well as other measurement conditions ( e . g . given illumination conditions ; given ( required ) illumination or collection aperture ) and generate data indicative of the optimal effective numerical apertures of the illumination and collection to be used in the measurements . for example , as will be exemplified further below , the control unit can analyze the given illumination - channel numerical aperture to be used and / or the shape and size of the physical aperture in the illumination channel , and generate data about corresponding parameters of the collection channel . this data may be provided to the either one or both of the controllers 106 e and 106 f to operate the optical system accordingly . for example , the system may utilize a set of apertures , for selecting the optimal one , or an aperture of variable shape / size and the operating signal from the controller is used to optimally adjust the shape and size of the aperture of the respective one or both of the illumination and collection channels . thus , the control unit may be configured for controlling the numerical aperture ratio r = na 1 / na 2 and / or a relative orientations and shapes of the apertures in the illumination and collection channels to provide a desired size of the measurement spot ms required for a given size and geometry of the test structure and a desired relation between the measurement and collection spots . further , the control unit may be configured for receiving and processing measured data from the detector for determining one or more conditions / parameters of the structure under measurements . it should be understood that the illustration in fig1 is schematic and does not limit the invention to any specific configuration of the optical system . the invention may be used in an optical system utilizing oblique or normal incidence mode , as well as optical system operating with either dark - or bright - field mode or both of them ; and as indicated above the optical system may be configured for colleting light of a specific polarization state . in other words , the present invention can optimize ( maximize ) the ensquared energy of an optical system with any configuration of the illumination and collection channels , by optimizing the effective numerical aperture of the system taking into account the size and geometry of the target , and thus optimizing the interplay of the collection and illumination psfs . reference is made to fig2 showing an example of optimizing the phase difference for a specific optical system . this figure shows a graph of the ensquared energy as a function of the numerical aperture of the collection channel , while keeping the numerical aperture of the illumination channel unchanged , for the measured target in the form of a pad ( rectangular geometry ) of 0 . 9 μm × 35 μm dimensions . it can be seen that ensquared energy of ˜ 1 can be attained for a constant illumination na 1 of 0 . 1 and a collection na 2 of 0 . 107 , and also collection na 2 of 0 . 16 and higher . it should thus be understood that complexity , cost , calculation efforts , etc . can be significantly improved with the selection of the collection numerical aperture na 2 lower than 0 . 107 . it is also instructive to observe the ensquared energy is increased even for reducing the na 2 ( in this example , reducing collection na 2 to 0 . 09 improves the ensquared energy from 95 to 98 %). this effect is substantially different than increasing the collection numerical aperture due to simple diffraction first order principles as used in the conventional systems . the principles of the technique of the present invention , or the physical effect on which the optimization is based , is associated with the coherent summation of the signal due to psf multiplication . reference is made to fig3 a to 3d . fig3 a shows the psf behavior in the optical system utilizing the same numerical aperture of the illumination and connection channels of na 1 = na 2 = 0 . 1 . the psfs of the illumination and collection channels in this example are actually identical and therefore are presented by the same graph g 1 / g 2 . also shown in fig3 a is their multiplication ( graph g 3 ). the psfs are positive and negative , and display the typical diffraction solution of a bessel function . the collected power in the detector is the square amplitude of the summation of the psf multiplication across the entire object plain . fig3 b shows a zoom in on the multiplication of the psf . since the area differential is proportional to r , the radius , the graphs are multiplied by r . it will be appreciated that the multiplication yields a function that is positive in every point across the object plain . this means that when the psf multiplication extends out of the pad ( vertical line l at 17 . 5 um ), the detector will collect light from outside the pad . since the psf multiplication is positive and the sum is coherent , no destructive interference occurs and energy can be collected efficiently from outside the pad . in contrast , fig3 c and 3d illustrate similar analysis with illumination na 1 of 0 . 1 and collection na 2 of 0 . 11 . it will be appreciated that the multiplication of both psf yields a function that starts in initial point as positive (“ in phase ”), but due to different periods between the multiplied psf , a gradual phase builds up between the two psfs , resulting in oscillations from negative to positive values ( fig3 d ). when summing over the entire object field , these areas are canceled out do to the contribution of positive and negative values , and contribute very little to the overall results . thus , the out of pad energy to the detector is “ nulled out ” and ensquared energy can easily be increased with very little increase in the numerical aperture of collection ( and even decrease of the numerical aperture , as described above ). this optimization can be used to optimize the system to any confined energy specification of arbitrary shape , across single , several , multiple wavelengths . reference is now made to fig4 a to 4h showing another example further illustrating the above described principles of the invention . in this example , optimization of ensquared energy is demonstrated based on the principle of geometric separation of the psf tails that optimizes the confinement of collected light . fig4 a - 4d show the simulation results for standard circular apertures with 0 . 96 ensquared energy , and fig4 e - 4h show similar simulations for tilted ( angular shift ) square configurations , yielding 0 . 995 ensquared energy . more specifically , fig4 a and 4b show the configuration of apertures in the illumination and collection , which are round apertures with central obscuration ( the obscuration might be a result of using reflective optics ), and fig4 c and 4d show the corresponding illumination - and collection - channel psfs . the resultant ensquared energy for a particular pad ( target ) size and wavelength is 0 . 96 . fig4 e - 4h exemplify a specific tilted square configuration of the aperture , designed to minimize the overlap of the long tails of the psf function of the collection and illumination . more specifically , fig4 e and 4f show the apertures &# 39 ; configurations in the illumination and collection channels , and fig4 g and 4h show the corresponding illumination - and collection - channel psfs . comparing the psf function obtained with the round and square apertures , it is seen that while the round aperture seems to decrease the intensity of light in the tails of the psf function of each of the collection and illumination separately ( with respect to the square aperture ), the multiplication of the illumination and collection is much smaller in the tails in the tilted square aperture since the high intensity tails do not overlap geometrically . this leads to 0 . 995 ensquared energy for the square aperture configuration using tilt between collection and illumination square apertures . the optimization of each psf separately as considered in the conventional approach , leads to much inferior solution as compared to the optimization of the multiplication of both collection and illumination psfs . the above is a specific but not limiting example of the principle of the present invention using shapes of the apertures , numerical aperture differences to minimize the multiplication function of the illumination and collection psfs and thus to optimize the optical power confinement in an optical system . | 6 |
for the purposes of the present description , the terms &# 34 ; cultivar &# 34 ; and &# 34 ; variety &# 34 ; are used synonymously to refer to a group of plants within a species ( e . g ., glycine max ) which share certain constant characters that separate them from the typical form and from other possible varieties within that species . while possessing at least one distinctive trait , a variety is also characterized by a substantial amount of overall variation between individuals within the variety , based primarily on the mendelian segregation of traits among the progeny of succeeding generations . a &# 34 ; line ,&# 34 ; as distinguished from a &# 34 ; variety ,&# 34 ; denotes a group of plants which display less variation between individuals , generally ( although not exclusively ) by virtue of several generations of self - pollination . in addition , a &# 34 ; line &# 34 ; is defined , for the purpose of the present invention , sufficiently broadly to include a group of plants which carry a mutation for a particular trait , specifically the pink flowered trait as disclosed herein . as used herein , the terms &# 34 ; co - segregate ,&# 34 ; &# 34 ; hybrid ,&# 34 ; &# 34 ; crossing ,&# 34 ; &# 34 ; recovering progeny ,&# 34 ; and &# 34 ; selfing &# 34 ; refer to their conventional meanings as understood in the art ( see , for instance , knowles , p . f . and f . n . briggs , introduction to plant breeding ( reinhold publication corp ., new york , n . y ., 1967 ). &# 34 ; substantial &# 34 ; is defined as statistically significant . most soybean cultivars have either purple or white flowers . woodworth , c . m . ( 1923 ) &# 34 ; inheritance of growth habit , pod color , and flower color in soybeans ,&# 34 ; j . am . soc &# 39 ; y agron . 15 : 481 - 495 . hartwig , e . e . and k . hinson ( 1962 ) &# 34 ; inheritance of flower color in soybeans ,&# 34 ; crop sci . 2 : 152 - 153 , described dilute - purple and near - white flowers , but these flowers appear white and identification requires close examination of the separated standard . in addition , buzzel , r . i ., et al . ( 1977 ) &# 34 ; inheritance and linkage of a magenta flower gene in soybeans ,&# 34 ; can . j . genet . cytol . 19 : 749 - 751 , report a magenta flower color mutant . a description of a new flower color , denoted as pink , is presented by stephens , p . a . and c . d . nickell ( 1991 ) &# 34 ; a pink flower color mutant in soybean ,&# 34 ; soybean genet . newsl . 18 : 226 - 228 . this pink flower was first observed during the summer of 1989 in two f4 : 5 - derived plant rows ( designated ln89 - 5320 and ln89 - 5322 ) segregating for purple and pink flower pigmentation while homozygous for gray pubescence and imperfect black hilum . these lines had originated from the cross (` sherman `×` asgrow a2943 `)×` elgin 87 `. all f4 plant selections from this cross were purple in flower color . for the two f4 : 5 plant rows having the pink flower mutation , f5 plants in both rows were classified as pink or purple in flower color , harvested individually , and planted in the spring of 1990 . to determine if the pink flower trait is different in appearance from known color genes , pink flowered plants were planted alongside ` clark ` and ` harosoy ` flower color isolines ( bernard , 1978 ; table 2 ). the pink flower color disclosed herein is quite distinct from all previously reported flower colors . pink flowers are uniform in color throughout the petals , in contrast to purple , magenta , dilute - purple , and near - white flowers which have increased pigmentation in the veins when compared to the interveinal areas . &# 34 ; pink &# 34 ; flowers , as used herein , refers to soybean flowers which appear pink in color and uniform in pigmentation throughout the petals , as distinguished from the soybean flowers of known varieties . the novel soybean plant of the present invention exhibits , among other things , a unique flower color . the gene controlling the pink flower trait is not allelic to any of the known flower color genes . flower color segregation data for f 2 plants demonstrates that the pink flower trait is novel , is not linked to other flower color genes , and is not influenced by cytoplasm ( table 5 ). segregation data for selfed progeny indicates that the pink flower trait is controlled by a single recessive gene ( table 3 ). selfed progeny from ten heterozygous rows , classified as segregating 3 : 1 ( purple : pink ) for flower color ( stephens and nickell , supra ), segregated 5 : 3 ( purple : pink ) as expected for single recessive gene inheritance . when this pink - flowered plant was crossed with all reported flower color genes and f 2 populations classified for flower color ( table 5 ), results indicated that the pink flower gene was independent of known flower color genes and acted as a modifier gene to decrease pigment expression at the w1 locus , required for purple flower pigmentation , thereby reducing normal purple pigmentation to pink ( stephens and nickell , supra ). the pink flower gene thus interacts with other flower color genes to dilute the intensity of their expression . as used herein , the gene symbol wp means pink flower color inheritance . as noted above , the pink flowered soybean plant of the present invention was crossed with all known flower color genes and the f 2 generation classified according to flower color . the results are shown in table 5 . when w1 - wpwp is in combination with wmwm ( magenta ) the phenotype appears pink , in combination with w3 - w4w4 ( purple - throat ) the phenotype appears near - white , and in combination with w3w3w4w4 ( near - white ) the flowers appear white . this interaction is demonstrated in the three gene segregation model for the cross ln89 - 5322 - 2 × l70 - 4422 . contributing to the theoretical 6 / 64 near - white class are 3 / 64 w3 - w4w4wpwp individuals which are phenotypically difficult to distinguish from the 3 / 64 w3w3w4w4wp individuals , and the 1 / 64 white class appears due to the w3w3w4w4wpwp combination . the novel soybean line of the present invention is further distinguished from other soybean varieties on the basis of hypocotyl pigmentation . hypocotyl and flower color pigmentation are closely associated ( hartwig and hinson , supra ). soybean plants having purple and magenta flowers have purple hypocotyls , and purple - throat types have dilute - purple hypocotyls . the other flower color types , including pink , lack purple pigmentation in the hypocotyl when grown under a 14 - hour photoperiod . anthocyanin malvidin is the predominant pigment responsible for purple coloration in the hypocotyls and is the final product in the anthocyanin pathway ( peters , d . w ., et al . ( 1984 ) &# 34 ; hypocotyl pigments in soybeans ,&# 34 ; crop sci . 24 : 237 - 239 ). the pink phenotype therefore likely represents a change in the anthocyanin production pathway resulting in a lower level of pigment intensity . in addition to the unique pink flower color , the novel soybean plant of the present invention possesses high protein seed content , high yield , and large seeds . seed size and protein content have not been previously found to be associated , and association of flower color with agronomic traits has never been reported . it is interesting and most surprising , therefore , to note that the two agronomic traits identified herein , large seed size and high protein seed content , co - segregate with the novel pink flower trait . the association of these two traits with pink flower color creates a unique situation where the plant breeder can select for improved soybean varieties based on flower color . a primary advantage of the present invention is therefore the ease with which plant breeders can follow the pink flower trait , along with the associated increases in seed size , protein content , and yield . it is further surprising and unexpected that the increased seed protein content , associated with the pink flower trait of the present invention , it not accompanied by a decrease in yield . protein increase is usually associated with a yield decrease , making it difficult to maintain or increase yield while improving protein content . thus , the discovery that these two phenomena are not synchronous with respect to the pink - flowered soybean represents yet another advantage of the present invention . soybean varieties possessing specific , desirable traits are often developed by traditional plant breeding techniques . two cultivars are typically selected for particular traits and then interbred , one cultivar being employed as male and the other as female . after the first cross , the f 2 generation plants are normally screened for the traits of interest . seeds are saved from the f 2 plants selected and subsequent generations are grown up , again selecting desirable plants from each generation . in the case of variety development for increased seed protein , a minimum of seven years and considerable resources are needed to develop improved varieties . protein content must be constantly monitored by analyzing the seed , typically with near - infrared reflectance . in addition , yield decrease is usually associated with a protein increase , making it difficult to maintain or increase yield while improving protein content . a large seeded , high protein soybean plant possessing the novel pink flower color has been isolated and identified . progeny plants ( designated ln89 - 5320 and ln89 - 5322 ) possessing the pink flower color were selected and their seeds analyzed for both size and protein content . the seed produced by the pink - flowered progeny possess a 25 % increase in size and a 1 . 5 percentage point increase in protein content relative to their purple - flowered counterparts ( table 1 ). protein percentage is the percent by weight of the total dry weight of the seed , as measured by near - infrared reflectance . seed size is measured in cg , based on the average seed weight of a 100 seed sample . a pink - flowered plant was crossed with each of the five clark flower color isolines ( bernard , r . l . ( 1978 ) &# 34 ; notice of release of clark and harosoy isolines ,&# 34 ; soybean genet newsl . 1 : 66 - 75 ). a pink - flowered , gray pubescence plant served as the female while clark isolines were used as the male parent . although the pink - flowered plant was employed as the female , the clark isolines could have been employed as the female and the pink - flowered plant could have served as the male . the present invention encompasses these alternative possibilities . progeny plants possessing the pink flower color are selected and their seeds analyzed for both size and protein content . the seed produced by the pink - flowered progeny retain the desired traits , i . e ., a 25 % increase in size and a 1 . 5 percentage point increase in protein content . the pink - flowered soybean line of the present invention is used efficiently to produce parent lines and hybrids possessing the desired agronomic traits . the breeding and selection methods described herein are applicable to all soybean varieties , including wild - type and commercial cultivars . the pink flower phenotype is controlled by a single recessive gene , which segregates according to normal mendelian genetic principles . conventional plant breeding techniques can therefore be used to introduce the phenotypes of large seed size and high protein seed content into any soybean variety . thus , by conventional plant breeding techniques , the ordinary artisan can cross a pink - flowered soybean plant with any variety to produce a soybean line possessing the desired phenotypes . the present invention is exemplified by its application to soybean ( glycine max ); however , its operating principles may be applied to other species of soybean . the invention is not limited to any particular soybean cultivar , but may be applied generally to any plant variety of the genus glycine , whether wild , domestic or hybrids of the two . although the instant invention is applicable to all soybean varieties , the breeding and selection methods are preferably carried out by crossing the pink - flowered soybean line with varieties possessing other valuable agronomic traits , including varieties specifically adapted to the particular climate area . soybean varieties are widely available in commerce from several manufacturers , providing progenitor strains suitable for all climate conditions . the present invention thus provides a practical and efficient method for producing and selecting for large seeded , high protein , high yield soybean plants , based on the characteristic pink flower color . a soybean breeder can increase seed size and protein content efficiently and quickly by crossing with the pink flowered soybean line of the present invention , then selecting for plants with pink flowers . the pink - flowered soybean plant produced by the novel breeding process is a part of this invention . the seeds and progeny plants produced by crossing with the pink - flowered soybean line are also a part of this invention . specific aspects and features of the present invention will become more clear from consideration of the following examples which are set forth to further illustrate the principles of the invention and are not intended , in any way , to be limitative thereof . the desired phenotypes of the novel pink - flower soybean , i . e ., large seed size and high protein seed content , are transferred to other wild - type or commercial cultivars by conventional plant breeding methods to achieve a new variety combining these desired phenotypes with other valuable agronomic traits . a soybean plant possessing the pink flower trait is crossed , for example , with a variety specifically adapted to the particular climate area . the desired wild - type soybean , commercial cultivar , or hybrid thereof is crossed by conventional plant breeding methods with a soybean plant having the pink flower phenotype . breeding methods used in accordance with the present invention include , for example , methods described in knowles , p . f . and f . n . briggs , introduction to plant breeding ( reinhold publication corp ., new york , n . y ., 1967 ), incorporated herein by reference , or any like methods known in the art . hybrid progeny exhibiting the pink flower trait are selected ; seeds from these hybrid progeny will have increased size and protein content . thus , the seed size and protein content of any soybean variety is efficiently and quickly increased by crossing with the pink flowered soybean line , then selecting for pink flowers . seeds of glycine max ln89 - 5322 - 1 , ln89 - 5322 - 2 and ln89 - 5322 - 3 have been deposited with the american type culture collection ( atcc ), rockville , md ., in accordance with 37 c . f . r . § 1 . 801 et , seq . seeds of glycine max ln89 - 5322 - 2 were deposited on oct . 22 , 1993 , as atcc 75579 . seeds of glycine max ln89 - 5322 - 1 and ln89 - 5322 - 3 were deposited on apr . 5 , 1995 , as atcc 97108 and atcc 97109 , respectively . all restrictions on the availability to the public of the materials so deposited will be irrevocably removed upon the granting of the patent . access to the material on deposit will be available during the pending period of the patent application to one determined by the commissioner to be entitled thereto under 37 c . f . r . § 1 . 14 and u . s . c . § 112 . these deposits were made to further exemplify the invention . they are not intended as in any way limiting the scope of the invention . soybean plants described in stephens , p . a . and c . d . nickell ( 1991 ) &# 34 ; a pink flower color mutant in soybean ,&# 34 ; soybean genet . newsl . 18 : 226 - 228 , were individually harvested , allowed to mature , and additional seeds were collected . twelve progeny lines were selected for performance evaluation . of these twelve lines , several were heterozygous for flower color while others were homozygous for either purple or pink flower color . the cultivars &# 34 ; kenwood &# 34 ; ( cianzio , s . r ., et al . ( 1990 ) &# 34 ; registration of kenwood soybean ,&# 34 ; crop sci 30 : 1162 ), &# 34 ; burlison &# 34 ; ( nickell c . d ., et al . ( 1990 ) &# 34 ; registration of burlison soybean ,&# 34 ; crop sci . 30 : 232 ), and &# 34 ; resnik &# 34 ; ( mcblain , b . a ., et al . ( 1990 ) &# 34 ; registration of resnik soybean ,&# 34 ; crop sci . 30 : 424 - 425 ) were included as standards for a total of 15 entries . entries were planted in 4 - row plots in a randomized complete block design . each location consisted of two blocks with each entry entered once per block . plots were 3 m long with a 76 - cm spacing between rows . the two center rows were harvested and seed yield was adjusted for 13 % moisture . the eight traits studied were ( i ) yield ( kg ha - 1 ), ( ii ) plant height at harvest ( cm ), ( iii ) maturity ( date when at least 95 % of the plants have mature pod color ), ( iv ) lodging ( scored on the basis of 1 = all plants erect to 5 = all plants prostrate ), ( v ) 100 - seed weight ( g ), ( vi ) seed quality ( on a scale of 1 = good to 5 = poor ), ( vii ) percentage seed protein , and ( viii ) percentage seed oil . protein and oil composition data were collected at the usda northern regional research center , peoria , ill . to obtain oil and protein percentages of the seeds , two replications from each location were composited , then approximately 7 g of the composited sample was placed in a thelco forced air oven for 3 hours at 130 ° c . the seeds were then transferred to 50 - g bottles , sealed , and allowed to cool for 1 hour . samples were then ground in a varco model mx - 228 electric dry - food grinder and returned to the 50 - g bottles . the ground meal was analyzed by near - infrared reflectance in a pacific - scientific feed - grain analyzer . prior to sample processing , the analyzer was calibrated with two sealed standards ( wheatmeal and soymeal ) and a freshly ground soymeal standard . the following table presents agronomic data on the pink and purple flower soybean lines , compared with two soybean cultivars . it can be seen that the seeds from pink flowered plants show a 25 % increase in size and a 1 . 5 unit increase in protein content relative to their purple counterparts ; no statistically substantial decrease in yield is observed with the increased seed protein . it will be understood that the number of additional biochemical and physiological traits associated with the pink flower phenotype is not exhausted by the present data disclosed herein . therefore , any additional traits found to be associated with the pink flower phenotype is deemed to fall within the scope of the claims . table 1__________________________________________________________________________agronomic performance of pink and purple flower soybean lines comparedwith two soybean cultivars atfour locations in illinois . 1991 . seed ( a ) seed ( b ) yield lodging ( a ) height quality weight protein oilentry kg / ha rank maturity score cm score cg % % __________________________________________________________________________ ( c ) ln89 - 5322 - 1 pkg 3520 8 sept . 13 1 . 9 85 1 . 6 19 . 9 41 . 9 20 . 6 ( c ) ln89 - 5322 - 2 pkg 3733 2 sept . 12 1 . 6 86 1 . 7 20 . 9 41 . 1 20 . 9 ( c ) ln89 - 5322 - 3 pkg 3560 6 sept . 13 1 . 7 84 1 . 7 20 . 1 41 . 6 20 . 5burlison 3907 1 sept . 8 1 . 1 74 2 . 0 19 . 2 42 . 6 19 . 5 ( d ) ln89 - 5322 - 6 pg 3733 2 sept . 10 1 . 7 89 1 . 6 16 . 9 39 . 9 21 . 3 ( d ) ln89 - 5322 - 11 pg 3533 7 sept . 11 1 . 7 87 1 . 4 16 . 1 40 . 6 20 . 6 ( d ) ln89 - 5320 - 5 pg 3680 4 sept . 10 1 . 7 83 1 . 6 15 . 9 39 . 5 20 . 8kenwood 3660 5 sept . 9 1 . 5 84 1 . 9 14 . 8 38 . 5 21 . 1average 3666 sept . 11 1 . 6 84 1 . 7 17 . 9 40 . 7 20 . 6lsd (. 05 ) 327 2 ns 5 0 . 3 2 . 0 1 . 3 0 . 7cv % 9 . 2 0 . 2 30 . 8 5 . 7 15 . 5 5 . 2 1 . 5 1 . 7burlison 3907 sept . 8 1 . 1 74 2 . 0 19 . 2 42 . 6 19 . 5kenwood 3660 sept . 9 1 . 5 84 1 . 9 14 . 8 38 . 5 21 . 1 ( c ) ln89 - 5322 - 2 pkg 3733 sept . 12 1 . 6 86 1 . 7 20 . 9 41 . 1 20 . 9pink ( average ) 3604 sept . 12 1 . 7 85 1 . 7 20 . 3 41 . 5 20 . 6purple ( average ) 3649 sept . 10 1 . 7 86 1 . 5 16 . 3 40 . 0 20 . 9__________________________________________________________________________ cruse urbana g . city dekalb entry yield rank yield rank yield rank yield rank__________________________________________________________________________ ( c ) ln89 - 5322 - 1 pkg 3907 2 3607 6 3720 3 2940 8 ( c ) ln89 - 5322 - 2 pkg 3607 7 4313 1 3667 5 3460 5 ( c ) ln89 - 5322 - 3 pkg 3520 8 3767 5 3680 4 3393 6 burlison 4073 1 4000 3 3633 6 4047 1 ( d ) ln89 - 5322 - 6 pg 3820 4 3913 4 3627 7 3707 2 ( d ) ln89 - 5322 - 11 pg 3773 6 3380 8 3807 1 3293 7 ( d ) ln89 - 5320 - 5 pg 3793 5 4120 2 3440 8 3487 4 kenwood 3840 3 3593 7 3747 2 3580 3 average 3792 3837 3665 3488 lsd (. 05 ) 533 720 433 ns cv % 6 . 6 8 . 8 5 . 7 11 . 7 burlison 4073 4000 3633 4047 kenwood 3840 3593 3747 3580 ( c ) ln89 - 5322 - 2 pkg 3607 4313 3667 3460 pink ( average ) 3678 3896 3689 3264 purple ( average ) 3796 3804 3624 3496__________________________________________________________________________ ( a ) score : lodging is rated at maturity : 1 = all plants erect to 5 = all plants laying flat on soil surface . seed quality is rated considering the amount and degree of wrinkling , defective seed coat ( growth cracks ), greenishness , and moldy or rotten seeds : 1 = very good to 5 = very poor . ( b ) average of two locations , urbana and dekalb , in illinois . 1991 . seed weight in eg based on 100 seed sample from each replication . seed composition is measured on samples submitted to the usda northern regiona research center , peoria , il . a 7 g sample of clean seed is prepared by compositing an equal volume or weight of seed from each replication withi a location . protein and oil percentages ( dry weight ) are measured using nearinfrared reflectance . ( c ) pink flower soybean lines . ( d ) purple flower soybean lines . ( e ) pink flowered soybean line being increased during 1992 for possible release . purple and pink - flowered soybean plants described in stephens , p . a . and c . d . nickell ( 1991 ) &# 34 ; a pink flower color mutant in soybean ,&# 34 ; soybean genet newsl . 18 : 226 - 282 , were individually harvested . seeds of these purple and pink - flowered soybean plants were planted alongside &# 34 ; clark &# 34 ; and &# 34 ; harosoy &# 34 ; flower color isolines ( bernard , r . l . ( 1978 ) &# 34 ; notice of release of clark and harosoy isolines ,&# 34 ; soybean genet . newsl . 1 : 66 - 75 ) for comparison of color and appearance . none of the clark and harosoy flower color isolines resembled the pink - flowered soybean . the results of the comparative color evaluation are set out in the table 2 . table 2______________________________________clark and harosoy isolines for flower color . designation genotype . sup . { 3 phenotype______________________________________clark 63 w1 w3 w4 wm purplel70 - 4422 w1 w3 w4 wm purple throat . sup .‡ l68 - 1774 w1 w3 w4 wm near - whitel72 - 2181 w1 w3 w4 wm magental69 - 4776 w1 w3 w4 wm whiteharosoy 63 w1 w3 w4 wm purplel72 - 1078 w1 w3 w4 wm purple throatl72 - 1138 w1 w3 w4 wm near - whitet235 w1 w3 w4 wm magental64 - 2139 w1 w3 w4 wm white______________________________________ . sup .† lines are homozygous for flower color genotype . sup .‡ purple throat = dilutepurple table 3 presents segregation data for flower color . the 16 f 4 : 5 purple plants segregated in a 1 : 2 ratio ( homozygous : heterozygous ) as expected and the 10 heterozygous rows segregated 3 : 1 ( purple : pink ) as expected for single gene inheritance . segregation for flower color thus confirmed that the pink flower color is controlled by a single gene . table 3______________________________________combined flower color data for ln89 - 5320 and ln89 - 5322 flower color chi purple seg . pink square no . ratio probability______________________________________1989 plants 16 7 3 . 1 . sup .† 0 . 55 ( 9 + 7 ). sup .§ ( 4 + ( 0 . 63 , 0 . 72 ) 3 ) 1990 f . sub . 4 : 6 6 10 7 1 : 2 : 1 . sup .‡ 0 . 79plant row1990 segregation 6 10 1 : 2 0 . 72for f . sub . 4 : 5 purpleplants1990 individual 350 128 3 : 1 0 . 37plant data for10 segregatingrows______________________________________ . sup .† ratio = purple to pink . sup .‡ ratio = purple to segregating to pink . sup .§ data in parenthesis for ln895322 and ln895320 respectively to test if the pink flower gene is allelic to the known flower color genes , a pink - flowered plant described in stephens , p . a . and c . d . nickell ( 1991 ) &# 34 ; a pink flower color mutant in soybean ,&# 34 ; soybean genet . newsl . 18 : 226 - 228 , was crossed to each of the five clark flower color isolines ( bernard , r . l . ( 1978 ) &# 34 ; notice of release of clark and harosoy isolines &# 34 ; soybean genet newsl 1 : 66 - 75 ). table 4 lists parents used in this study and their flower colors . table 4______________________________________flower color and genotype for soybean lines used asparents in crosses . parental line flower color genotype † ______________________________________ln89 - 5322 - 2 pink t w1 w3 w4 wm wp ‡ clark 63 purple t w1 w3 w4 wm wpl70 - 4422 purple - throat § t w1 w3 w4 wm wpl68 - 1774 near - white t w1 w3 w4 wm wpl72 - 2181 magenta t w1 w3 w4 wm wpl69 - 4776 white t w1 w3 w4 wm wpburlison white t w1 w3 w4 wm wp______________________________________ † each locus is considered homozygous for genes as indicated . ‡ t , t = tawny and gray pubescence respectively . w1 , w3 , w4 and wm have been previously documented , wp is our proposed designation . § purplethroat = dilutepurple a pink - flowered , gray pubescence plant served as the female while clark isolines were used as the male parent since they possessed the phenotypic marker , tawny pubescence . a cross was confirmed by an f 1 plant having tawny pubescence . to test for cytoplasmic effects , reciprocal crosses were made between the pink - flowered plant and the cultivar &# 34 ; burlison &# 34 ; ( nickell , c . d ., et al . ( 1990 ) &# 34 ; registration of burlison soybean ,&# 34 ; crop sci . 30 : 232 ) which has white flowers and tawny pubescence . f 1 plants were grown in a green house ; harvested f 2 seed were grown in the field for flower color classification . flowers on f 2 plants were classified by comparing flower phenotype to flowers on clark isoline parents . after classification for flower and pubescence color , the plants were labelled with coded plant tags . plant tags and flower color were periodically reviewed to confirm proper color classification , and additional tags were added to later flowering plants . table 5 presents flower color segregation data for the f 2 generation . it can be seen that the pink flower trait is novel , is not linked to other flower color genes , and is not influenced by cytoplasm . in addition , a 3 : 1 ( purple : pink ) ratio in the f 2 generation of ln89 - 5322 - 2 x clark 63 confirms the occurrence of a recessive allele controlling pink flower color . based on the data in table 5 , the flower color genotype for ln89 - 5322 - 2 is w1w1w3w3w4w4wmwmwpwp . table 5__________________________________________________________________________soybean plants classified in the f2 generation according to their flowercolor total purple - near - alleles plants purple magenta throat pink white white theoreticalcross segr . no . ratio x . sup . 2 p__________________________________________________________________________ln89 - 5322 - 2x clark 63 ## str1 ## 125 88 -- -- 37 -- -- 3 : 1 1 . 4 0 . 27ln89 - 5322 - 2x l70 - 4422 ## str2 ## 115 60 -- 21 17 151 2 36 : 9 : 12 : 6 : 1 7 . 3 0 . 13ln89 - 5322 - 2x l68 - 1774 ## str3 ## 129 75 -- -- 20 27 7 9 : 3 : 3 : 1 1 . 2 0 . 81ln89 - 5322 - 2x l72 - 2181 ## str4 ## 123 70 23 -- 30 -- -- 9 : 3 : 4 0 1 . 00ln89 - 5322 - 2x l69 - 4776 ## str5 ## 111 61 -- -- 15 -- 45 9 : 3 : 4 3 . 5 0 . 18ln89 - 5322 - 2x burlison ## str6 ## 124 73 -- -- 21 -- 30 9 : 3 : 4 0 . 4 0 . 88burlison x ln89 - 5322 - 2 ## str7 ## 83 40 -- -- 16 -- 27 9 : 3 : 4 2 . 8 0 . 27__________________________________________________________________________ since the w3w4w4wpwp phenotype is light purple throat due to the presence of wp , it cannot be distinquished from nearwhite and therefore phenotypically becomes part of the nearwhite class | 8 |
fig1 shows a widely known configuration of a typical helicopter 10 . while the typical helicopter 10 , for example , in this description is a blackhawk ™ helicopter as manufactured for the united states by sikorsky aircraft company , stratton , conn ., it will be appreciated that the invention is useful for numerous aircraft and helicopter configurations of other makes and models . in this configuration the helicopter 10 has a cabin 12 ( dashed outline ) in which passengers , equipment and cargo can ride during operation . located just above the cabin 12 is at least one engine 14 which supplies power to a rotor transmission 16 . the rotor transmission 16 is connected to a shaft 18 which imparts rotary motion to the main rotor 20 . the rotor transmission 16 is also connected via a drive shaft ( not shown ) to a tail rotor 22 . it will be appreciated the rotor transmission 16 requires frequent inspection and maintenance to ensure proper operation of the transmission . to facilitate easy and ready access to the rotor transmission , rotor transmission access openings are provided on both the exterior and interior of the helicopter . for example , structural opening 24 is located within the cabin 12 , providing the requisite access to the rotor transmission 16 situated directly above the cabin . structural opening 24 generally has some type of removable covering to seal the transmission area 16 from the cabin area 12 . to accommodate attachment of a removable covering , a flexible skirt 26 ( fig2 ) is fixedly secured around the periphery of structural opening 24 by rivets 28 . skirt 26 is many times more flexible than the structural opening 24 to which it attaches . as can be further appreciated the rotor transmission 16 as well as the engine 14 require various fluids during their respective operations . generally , these fluids provide the rotor transmission 16 and the engine 14 with lubrication , cooling , and the like . during operation these fluids may leak and drip from either the engine 14 or rotor transmission 16 or both . to prevent leakage of fluid into the cabin 12 via structural opening 24 , a drip pan apparatus 30 , as shown in fig2 is used to cover and seal the structural opening 24 . with specific reference to fig2 - 6 , the drip pan apparatus 30 according to one preferred embodiment of the invention has a frame member 32 , a drip pan 34 , and a seal member 36 cooperating together to provide a fluid tight sealing arrangement for structural opening 24 . frame member 32 has a plurality of lugs 38 disposed about the exterior periphery of frame member 32 . four lugs 38 are disposed on two sides of the frame member 32 and three lugs 38 are disposed on the other two sides of the frame member 32 . fasteners 40 cooperating with lugs 38 and threaded retention members 42 ( fig4 ) secure frame member 32 to skirt 26 attached to structural opening 24 . once installed , frame member 32 typically remains in place and is not routinely removed from structural opening 24 , although it could be readily removed by simply extracting fasteners 40 . frame member 32 is many times more rigid than the flexible skirt 26 . drip pan 34 has a plurality of resilient members 50 which serve to hold drip pan 34 in sealing engagement with frame member 32 . each resilient member 50 has elongated arms 52 with curved portions 54 . resilient members 50 are free to pivot about brackets 58 . curved portions 54 selectively engage slots 56 opening toward and located about the interior periphery of frame member 32 . to secure drip pan 34 to frame member 32 , the drip pan 34 is pushed into the interior of frame member 32 until the drip pan 34 contacts lip 60 ( fig4 ) which extends around frame member 32 and acts as a stop for drip pan 34 . only part of the curved portions 54 are resiliently inserted into slots 60 . the installation and the removal of the drip pan 34 can be accomplished rather quickly using the resilient members 50 because no tools such as screwdrivers or wrenches are required . equally important , resilient members 50 are permanently secured to the drip pan 34 by brackets 58 , so the resilient members 50 cannot be lost or misplaced when the drip pan 34 is removed to gain full access to the engine 14 and rotor transmission 16 . seal member 36 is disposed in an outwardly - facing groove 62 which extends around the outer periphery of drip pan 34 . in this application , outwardly - facing represents a direction substantial parallel to the plane of the drip pan 34 and extending away from the drip pan 34 . as illustrated in fig2 and 3 , the outer periphery of drip pan 34 , which has four straight edges or side 35 a , 35 b , 35 c , 36 d connected by curved portions 37 a , 37 b , 37 c , 37 d , conforms to frame member 32 which is comprised of four straight sides or rails 39 a , 39 b , 39 c , 39 d connected by curved portions 41 a , 41 b , 41 c , 41 d . when drip pan 34 is installed into frame member 32 , seal member 36 sealing engages inwardly - facing surface 64 of frame member 32 to achieve a fluid tight sealing arrangement between drip pan 34 and the frame member 32 . in this application , inwardly - facing represents a direction substantial parallel to the plane of the frame member 32 and extending toward the interior of the frame member 32 . unexpectedly , seal member 36 provides the necessary sealing engagement between outwardly - facing seal member 36 and inwardly - facing surface 64 despite the fact that groove 62 and surface 64 respectively run along straight sides 35 a , 35 b , 35 c , 36 d and 39 a , 39 b , 39 c , 39 d . typically , peripheral seals are used in cooperation with annular or curved sealing surfaces such as those defined by curved portions 37 a , 37 b , 37 c , 37 d and 41 a , 41 b , 41 c , 41 d . it was previously felt that peripheral seals used along straight sealing surfaces would provide unacceptable sealing integrity . in one prior drip pan design , a seal was located in a groove opening in a direction perpendicular to the plane of the drip pan . the seal would engage a surface which was parallel to the plane the dip pan . with this arrangement , flexure of the helicopter frame associated with structural opening 24 may breach the seal integrity between the drip pan and the attachment frame causing fluid to leak into the helicopter cabin . seal member 36 of the present invention , however , is a peripheral seal located in outwardly - facing groove 62 to form a fluid seal between the periphery of the drip pan 34 and the inwardly - facing surface 64 of frame member 32 . with this arrangement , flexure of the helicopter frame associated with structural opening 24 does not breach the integrity of the sealing arrangement between the drip pan 34 and the frame member 32 . it can be appreciated that while the sealing member 36 could be any suitable cross - sectional geometry , seal member 36 is preferably an o - ring . routine maintenance and inspection of the rotor transmission 16 , does not ordinarily require removal of the entire drip pan 34 . to accommodate limited access for routine maintenance or inspection , a plurality of small , removable access covers 70 are provided in drip pan 34 to allow access through access openings 72 to mechanical linkages in and around the rotor transmission and to allow inspection of the fluid levels associated with the rotor transmission 16 . an access cover 70 for each access opening 72 is removably disposed in sealing engagement covering the access opening 72 . to secure access cover 70 to the access opening 72 in drip pan 34 , each access cover 70 has a resilient member 74 which functions much like resilient member 54 which secures the drip pan 34 to the frame member 32 . access opening 72 has an annular groove 76 for resiliently receiving curved portion 78 of resilient member 74 to sealingly secure access cover 70 to access opening 72 . advantageously , no tools are required to operate the resilient members 74 to install or remove the access covers 70 . in addition , brackets 80 permanently secure resilient member 74 to access covers 70 so resilient members 74 cannot be lost or misplaced . each access cover 70 is attached to the drip pan 32 by a suitable attachment device such as a cable or chain 82 so when an inspection procedure is complete the access cover 70 is readily retrieved and positioned into access opening 72 . each access cover 70 includes a seal member 84 disposed in an annular groove 86 extending around the outer periphery of access cover 70 . when access cover 70 is placed into access opening 72 , seal member 84 sealing engages surface 88 of drip pan 34 which forms part of access opening 72 . like seal member 36 , seal member 84 forms a peripheral seal between the access cover 70 and the surface 88 . this arrangement improves on prior sealing arrangements which located the seal member between an access cover surface parallel to the plane of the access cover and the drip pan , i . e ., a face seal . as discussed above , the peripheral seal arrangement provides improved seal integrity even if the drip pan 34 flexes . preferably , seal member 84 is an o - ring . to facilitate the removal of accessing covers 70 from access openings 72 , pull handles 90 are attached to access covers 70 . fasteners 92 fixedly secured pull handles 90 to access covers 70 . preferably , pull handles 90 are cable or chain . during the preflight procedure of a helicopter , critical filters must be checked and determined operational before the helicopter is allowed to fly . to facilitate this inspection process , at least one of the access covers 70 has a transparent cover member 94 ( fig5 ) so that a bypass button or valve associated with a particular filter can be checked visually through the access cover 70 without physically removing the access cover 70 from the access opening 72 . a seal member 96 is dispose between the transparent cover member 94 and access cover 70 to prevent fluid leakage therebetween . preferably , the transparent cover member 94 is made from acrylic such as plexiglass ™. with reference to fig2 - 4 , drip pan 34 has a drain hole 100 to drain fluid collected by the drip pan 34 . drain hole 100 includes strainer members 102 to keep foreign objects that may come to rest on the drip pan 34 from clogging the drain hole 100 . a drain tube 104 may be attached to the drain hole 100 to direct the collected fluid to a catch basin ( not shown ) or to the exterior of the helicopter . the drain tube 104 is made preferably from metal tubing having a diameter of about 0 . 625 inches . alternatively , a removable stopper could be used with drain hole 100 for selective drainage . in at least one application , the drip pan apparatus 30 may be used on helicopters having carrousel bars added to the interior of the helicopter cabin 12 to support , for example , litters used for transporting patients in need of medical attention . typically , at least one carrousel bar passes directly under the drip pan apparatus 34 . to accommodate a carrousel bar 108 ( phantom ), elongated recesses 110 are provided in frame member 32 s o that the frame member 32 does not interfere with the installation and operation of the carrousel bar 108 . in still another application , the drip pan apparatus 30 , and more specifically the frame member 32 , may interfere with access to an oil filter associated with the rotor transmission 16 when the drip pan apparatus 30 is installed . to provide for removal of an oil filter 112 ( fig6 ) from the rotor transmission 16 , a portion of frame member 32 is machined away as shown by numeral 114 so that the oil filter 112 can be removed along a line not perpendicular to the drip pan apparatus 30 . during the removal or installation of oil filter 112 , the drip pan 34 is removed to provide even greater access to the oil filter 112 . frame member 34 is machined just enough to permit removal of oil filter 112 , and maintain sealing engagement between seal member 36 and surface 64 of frame member 34 . to provide further access to the oil filter 112 , the geometry of frame member 32 can be modified . more specifically and with reference to fig3 frame member 32 is comprised of four straight sides or rails 39 a , 39 b , 39 c , 39 d connected by curved portions 41 a , 41 b , 41 c , 41 d , where each rail 39 a , 39 b , 39 c , 39 d has a respective width indicated by w 1 , w 2 , w 3 , w 4 . to provide imporved access to the oil filter 112 , the opening defined by rails 39 a , 39 b , 39 c , 39 d is shifted to the left in fig3 such that the respective widths w 1 , w 2 , w 3 , w 4 of rails 39 a , 39 b , 39 c , 39 d are not all equal to one another . specifically , w 1 equals w 3 , w 4 is greater than w 1 and w 3 , and w 4 is less than w 1 and w 3 . preferably , the difference between w 2 and w 4 is about one quarter of an inch . this transverse shift of the opening helps to accommodate removal of the oil filter 112 which is generally located in the compartment above the drip pan apparatus 30 near the upper left hand corner of the drip pan apparatus 30 shown in fig3 . accordingly , the invention provides an improved cover and seal for the interior access opening of a helicopter such as the blackhawk ™ helicopter . as such , the drip pan apparatus of the invention seals against fluid passage from the engine or transmission compartment to the cabin section of a helicopter . in addition , the drip pan apparatus of the invention permits quick access to the engine or transmission compartment of a helicopter , such as the blackhawk ™, without requiring modification to the existing aircraft structure . these and other embodiments and modifications will become readily apparent to those of ordinary skill in the art without departing from the scope of this invention and the applicant intends to be bound only by the claims appended hereto . | 5 |
referring to fig1 there is shown a package liner 10 of the present invention formed into its desired shape and filled with a stack 12 of frangible , nestable , saddle - shaped , uniformly shaped and sized , chip - type snack food products , each of the same being hereinafter referred to as chip 14 . this type of chip 14 is described with particularity in the above - cited bauer et al . u . s . pat . no . 3 , 498 , 798 , the disclosure of which is hereby incorporated by reference . briefly stated , however , and with reference to fig2 and 3 , chips 14 are curved in both longitudinal and transverse planes . in the orientation shown , the transverse curvature is downwardly concave whereas the longitudinal curvature is upwardly concave . because of the stack 12 orientation the lower chip 14 of the stack 12 has support points 14a , 14b at opposite sides of its transverse or minor axis . the entire weight of the stack 12 is carried by such support points 14a , 14b . this type of chip 14 provides the nested stack 12 with a resistance to transversely applied loads and , hence , the stack 12 tends to maintain its integrity and shape very well in a package . while the illustrated shape of chip 14 is well adapted to be packed within the liner 10 , other non - planar shapes of chips , such as that illustrated in fig7 and 8 of the aforesaid baur et al . patent , or even flat or otherwise shaped fragile objects can also be packed in , and therefore benefit by the use of , the protective package liner of the present invention . as shown in fig4 the bottom view of the stack 12 is generally eliptical , having a major axis of length m and a minor axis of length m . for potato chips 14 of the illustrated shape , m can conveniently be about 21 / 2 &# 34 ; and m can be about 17 / 8 &# 34 ;. while such sizes are not critical , they serve to provide a basis for understanding the size interrelationship with respect to the liner and , more particularly , with respect to the central region thereof , which will be discussed more fully hereinafter . referring to fig5 the package liner 10 is constructed of an elongated generally rectangular sheet of packaging material having physical properties sufficient to permit the material to be manipulated in the manner to be described . these properties may be varied over a wide range depending on the final dimensions of the liner 10 desired , the type and physical parameters of the lines of weakness to be impressed therein , the manner in which the liner 10 is to be formed , etc . generally speaking , however , packaging materials will suffice so long as they have a stiffness which is at least equivalent to that of common cartonboard of a thickness of about 0 . 016 &# 34 ; and sufficient flexibility to permit the material to be readily bent into the desired formed tubular shape without damage . as shown in fig1 , 7 and 8 the liner is a sheet of single faced corrugated paper . the corrugations extend longitudinally to provide considerable stiffness lengthwise and flexibility widthwise , which are properties well - suited for use in connection with the subject invention . such materials are obtainable from malanco inc ., blue island , ill ., which identifies the same as ws 35 / pkw 202 &# 34 ; b &# 34 ; flute . in such a material the backing sheet is 35 # white sulfite paper and the corrugated sheet is 25 # white sulfite paper having &# 34 ; b &# 34 ; size flutes . either or both of the sheets can be treated for grease resistance for food use in a manner well known to those skilled in the art . such treatment can be done with fluorocarbons or other material for providing the desired grease resistant properties for packaging chip - type snacks such as those illustrated . in connection with potato chips 14 of the illustrated shape provided in a stack 12 which is 71 / 2 inches high , the chips 14 being sized as described previously in connection with fig4 the liner 10 material can be 31 / 4 &# 34 ; wide by 171 / 8 &# 34 ; long . it will be noted that the width of the sheet is obviously less than one - half the circumference of the stack 14 and that if the sheet is to cover two sides of the stack 14 , this leaves slightly over 2 &# 34 ; of sheet to cross the bottom of the stack . the liner 10 is provided with a pair of spaced , oppositely disposed , centrally located , outwardly bowed , lines of weakness 16 , 18 impressed therein from the corrugated sheet side . the lines of weakness 16 , 18 extend across the full width of the liner 10 . when made of the single face corrugated paper material described , such lines of weakness preferably can comprise cut scores made with a 10 tooth per inch perforating score . where perforations are used they should be sufficient in number and adjacency to form the line of weakness without risk of preliminary failure of the sheet during its later forming procedure , as will be understood from subsequent description . alternatively , the line of weakness can be formed by simply scoring the liner 10 material using a scoring rule , preferably from the corrugated sheet side . for example , a scoring rule the size of that which would be used in scoring 16 point cartonboard ( 0 . 016 &# 34 ; thick ) can be used for this purpose . from the standpoint of manufacturing the liner 10 , scoring is preferred . the lines of weakness 16 , 18 define therebetween a support surface 20 of a generally eliptical shape slightly larger than the dimensions of the stack 12 described in connection with fig4 . end portions 22 , 24 are interconnected with support surface 20 along the lines of weakness 16 , 18 , respectively . the preferred arrangement of the lines of weakness 16 , 18 is shown in fig6 where for the described liner and the dimensions of the stack 12 of potato chips 14 already set forth , the indicated dimensions to define the shape of the lines of weakness 16 , 18 are as follows : it will be noted that light construction lines are shown extending to points beyond the limits of the liner 10 at the distance of 17 / 8 &# 34 ; from the longitudinally extending central axis of the liner 10 . these are an aid to laying out the preferred lines of weakness and , of course , form no part of the structure . as shown , the lines of weakness 16 , 18 each comprise a central arc having a radius of curvature of 23 / 4 &# 34 ; and a length which would be subtended by a chord 2 3 / 16 &# 34 ; long , and two straight ends . the radius of curvature of each arc is slightly greater than that of the corresponding portion of the periphery of the stack 12 . the straight ends of the lines of weakness are designed to converge on the edges of the liner 10 at angles α which are more acute than those which would be the case if the central arc had been made full width of the liner 10 . it is not essential that the ends be straight . for example , curved lines having the same effect ( the changed angle of convergence ) would also be suitable in place of the straight ends . for the liner structure described , the angles α should be about 45 °. when so constructed and when the liner 10 is folded as indicated hereinafter , the flat sides 26 , 28 of support surface 20 tuck inwardly , within the confines of the cylindrical configuration of the formed liner 10 . this would not be the case if the arcs were made full width . while this may be of no consequence in relation to some uses for the protective liner 10 , it is significant if the item is to be handled and applied by automated equipment . in such case any outwardly projecting portions of the formed liner 10 could very well cause numerous problems . for example , if the liner 10 is to be loaded with the stack 12 automatically and enclosed within a pouch in a vertical form , fill and seal machine , it is apparent that hang - up of the liner in the filling mandrel or tube because of projections could cause serious problems . ( such machines are generally described in u . s . pat . no . 2 , 145 , 941 which issued to d . e . maxfield on feb . 7 , 1939 .) this difference is also significant from the standpoint of providing a formed support surface which is more deeply dished than would be the case if the arc portions had been extended full width and , thus , is believed to be capable of providing greater shock absorbing properties . the liner 10 described is formed by folding end portions 22 , 24 upwardly , out of the plane of support portion 20 , while flexing them transversely into curved surfaces similar in cross section to the curvature of the adjacent line of weakness 16 or 18 . this produces a tubular conformation of the liner 10 as shown in fig1 . it has a support surface which is bowed widthwise of the liner into the downwardly concave condition illustrated in fig1 and 7 . the formation can be done by hand or machine , but in any event the formed liner 10 is loaded with the stack of 12 of chips 14 . the support points 14a , 14b bear on the support surface 20 at locations closely adjacent the lines of weakness 16 , 18 at their centers . as shown in fig8 the liner 10 contacts the periphery of stack 12 of chips 14 at four locations 30 , 32 , 34 , 36 , which are thought to correspond with the ends of the straightest sections which can be taken through the chips 14 along intersecting diagonal planes . this belief is based on the theory that the columnar strength will be greater across such planes than across others . it is believed that this protects the chips 14 against breakage because of the fact that lateral contact and impact is made principally at locations 30 , 32 , 34 , 36 . in use , the loaded package liner 10 can be placed in a can , a bag , a pouch or any other enveloping package which is appropriate to the type of article packaged therein . in the case of chip - type food products such as the potato chips 14 described above , it would be most appropriate to place the loaded package liner 10 in a pouch constructed of a foil laminate . because of the package liner 10 , the stack 12 is cushioned from damage caused by dropping or by laterally directed impact forces , the latter having been discussed hereinabove . upon dropping , for example , the momentum of the stack 12 can cause the support points 14a , 14b to exert sufficient force on the central parts of the lines of weakness to fracture them . the fracturing and any subsequent dislocation of the support surface 20 in effect absorbs energy which would otherwise have damaged the stack . in addition , the depending portions of the support surface 20 , i . e . those terminating in flat sides 26 , 28 , are springy and tend to absorb shock loads , minimizing damage to the stack 12 . while a particular preferred embodiment of the present invention has been illustrated and described , it will be obvious to those skilled in the art that various changes and modifications can be made without departing from the spirit and scope of the invention . it is intended to cover in the appended claims all such changes and modifications that are within the scope of this invention . | 1 |
at least the following details will become apparent from descriptions of this specification and of the accompanying drawings . fig1 is a diagram showing a configuration of a transmission device 10 , which is an embodiment of the present invention . the transmission device 10 is a device for outputting an output signal out ( output signal ) to an antenna ( not shown ) so as to transmit audio signals rin ( first audio signal ) and lin ( second audio signal ) input from , for example , a music reproduction device ( not shown ), based on levels of a first control signal cont 1 ( selection signal ) and a second control signal cont 2 ( update control signal ) each of which is input from an external switch ( not shown ) such as a toggle switch . the transmission device 10 includes a data generation circuit 20 , an fm transmission circuit 21 , and a switch sw 1 . in an embodiment of the present invention , the audio signals rin and lin respectively correspond to a right - side audio signal and a left - side audio signal of stereo audio signals . first , outlines of circuits included in the transmission device 10 are described . the data generation circuit 20 is a circuit for generating a clock signal sclk ( first output signal ) and data sda ( second output signal ) that are digital signals respectively according to levels of audio signals rin and lin input from a music reproduction device ( not shown ), based on the first control signal cont 1 . the data generation circuit 20 includes nmos transistors 30 , 31 , resistors 32 , 33 , and a switch sw 2 . it is assumed that the first control signal cont 1 is set either to a high level ( hereinafter , h - level ) or a low level ( hereinafter , l - level ) by an external switch ( not shown ) being operated by a user . the data generation circuit 20 corresponds to a set - data output circuit of the present invention . the fm transmission circuit 21 is a circuit for outputting the audio signals rin and lin , as the output signal out that can be received by an fm radio ( not shown ,) based on the clock signal sclk and data sda output from the data generation circuit 20 , and an enable signal ce ( instruction signal ) output from the switch sw 1 . the fm transmission circuit 21 includes a first setting circuit 40 , an output circuit 41 , and terminals 80 - 85 . it is assumed that the fm transmission circuit 21 is an integrated circuit . the first setting circuit 40 is a circuit for outputting to the output circuit 41 latch data ld for setting a frequency , a level , etc ., of the output signal out output from the fm transmission circuit 21 , based on the clock signal sclk , data sda , and enable signal ce . the first setting circuit 40 includes and circuits 50 and 51 , a shift register 52 , an address decoder 53 , and a latch circuit 54 . the clock signal sclk , data sda , and enable signal ce are input respectively via the terminals 80 - 82 . the output circuit 41 is a circuit for performing processing such as modulation and amplification for the audio signals rin and lin input via the terminals 83 , 84 from the music reproduction device ( not shown ,) based on the latch data ld input from the first setting circuit 40 , to be output as the output signal out which can drive the antenna ( not shown ) connected to the terminal 85 . the output circuit 41 includes a second setting circuit 60 , a stereo modulation circuit 61 , a frequency modulation circuit 62 , and a power amplifier 63 . the switch sw 1 outputs the enable signal ce to the terminal 82 based on the second control signal cont 2 which is set either to a high level ( hereinafter , h - level ) or a low level ( hereinafter , l - level ) by operating the external switch ( not shown .) in an embodiment of the present invention , it is assumed that the enable signal ce is h - level when the second control signal cont 2 is h - level , and the enable signal ce is l - level when the second control signal cont 2 is l - level . in other words , when the second control signal cont 2 is h - level , the switch sw 1 is so operated that a power supply vcc is connected with the terminal 82 , and when the second control signal cont 2 is l - level , the switch sw 1 so operated that a ground gnd is connected with the terminal 82 . next , the circuits included in the transmission device 10 are described in detail . the switch sw 2 of the data generation circuit 20 is connected to each of source electrodes of the nmos transistors 30 and 31 at one end thereof . the switch sw 2 is connected , at the other end thereof , to the ground gnd when the first control signal cont 1 is h - level , and to the power supply vcc when the first control signal cont 1 is l - level . firstly , an operation is described of the data generation circuit 20 when the first control signal cont 1 is h - level . since the nmos transistor 30 and resistor 32 make up an inverter , a clock signal sclk is output , which is a digital signal according to a level of the audio signal rin input to a gate electrode of the nmos transistor 30 . more specifically , when the level of the audio signal rin is higher than a threshold voltage of the inverter made up of the nmos transistor 30 and resistor 32 , the clock signal sclk is l - level , and when the level of the audio signal rin is lower than the above threshold voltage , the clock signal sclk is h - level . similarly , since the nmos transistor 31 and resistor 33 also make up an inverter , the data sda is output , which is a digital signal according to a level of the audio signal lin , from the inverter made up of the nmos transistor 31 and resistor 33 . secondly , when the first control signal cont 1 is l - level , each of the source electrodes of the nmos transistors 30 and 31 and each of the drain electrodes thereof are connected to the power supply vcc . thus , the clock signal sclk and data sda are always h - level irrespective of the levels of the audio signals rin and lin to be input . the enable signal ce input to the first setting circuit 40 of the fm transmission circuit 21 is changed to h - level or l - level by the external switch ( not shown ) being switched in state by the user , as described above . the enable signals ce are input to one input of the and circuit 50 and one input of the and circuit 51 . thus , when the enable signal ce is h - level , the clock signal sclk is output as a clock signal clk from the and circuit 50 , and the data sda is output as data da from the and circuit 51 . on the other hand , when the enable signal ce is l - level , each of the clock signal clk output from the and circuit 50 and the data da output from the and circuit 51 is l - level . the shift register 52 is an n - bit register , and is a circuit for sequentially shifting and holding the data da output from the and circuit 51 in timing of a rising edge of the clock signal clk output from the and circuit 50 . it is assumed that the shift register 52 outputs n1 - bit data , which is input earlier in time in n - bit data held therein , as an address selection signal ao to the address decoder 53 , and outputs n2 - bit data , which is input later in time in the n - bit data , as set data do to the latch circuit 54 . it is assumed that a predetermined n1 - bit address is assigned to the address decoder 53 , and when the address selection signal ao matches the predetermined address , the address decoder 53 outputs a decode signal dec for updating the data held by the latch circuit 54 to the latch circuit 54 . it is assumed that the latch circuit 54 is a circuit which , when the decode signal dec is output thereto , latches the n2 - bit set data do output from the shift register 52 to output the set data do , as latch data ld , to the output circuit 41 . firstly , an operation is described of the first setting circuit 40 when the enable signal ce is h - level . since one input of the and circuits 50 and one input of the and circuit 51 are h - level , the clock signal sclk is output as the clock signal clk from the and circuit 50 , and the data sda is output as the data da from the and circuit 51 . in the shift register 52 , the data da , which is input in the timing of the rising edge of the clock signal clk , is sequentially shifted and held . when the address selection signal ao output from the shift register 52 matches the predetermined address of the address decoder 53 , the latch circuit 54 outputs , as the latch data ld , the n2 - bit set data do which is input later in time in the data da input to the shift register 52 . on the other hand , when the address selection signal ao output from the shift register 52 does not match the predetermined address of the address decoder 53 , the decode signal dec is not input to the latch circuit 54 , and therefore , the latch data ld is not updated . secondly , when the enable signal ce is l - level , one input of the and circuits 50 and one input of the and circuit 51 are l - level . accordingly , the clock signal clk and the data da output from the and circuits 50 and 51 are l - level irrespective of a clock signal sclk and data sda to be input , and therefore , the data held in the shift register 52 are not updated . consequently , since the decode signal is not output from the address decoder 53 , the latch data ld are not updated . the second setting circuit 60 in the output circuit 41 is a circuit which outputs predetermined n3 - bit data as a first set signal set 1 to the stereo modulation circuit 61 , predetermined n4 - bit data as a second set signal set 2 to the frequency modulation circuit 62 , and predetermined n5 - bit data as a third set signal set 3 to the power amplifier 63 , in the n2 - bit latch data ld input from the latch circuit 54 . the stereo modulation circuit 61 is a circuit which sets the audio signals rin and lin input from the music reproduction device ( not shown ) to levels that are based on the first set signal set 1 of n3 bits , and then generates a stereo composite signal so . the stereo modulation circuit 61 according to an embodiment of the present invention includes an attenuator ( not shown ) capable of attenuating the levels of the audio signals rin and lin based on the first set signal set 1 of n3 bits . the frequency modulation circuit 62 is a circuit which generates a carrier wave of a frequency that is based on the second set signal set 2 of n4 bits to modulate the carrier wave with the stereo composite signal so from the stereo modulation circuit 61 . in an embodiment of the present invention , the carrier wave modulated with the stereo composite signal so is denoted by a modulated signal mod . the power amplifier 63 is a circuit which amplifies power of the modulated signal mod with an amplification factor which is based on the third set signal set 3 of n5 bits , to be output as an output signal out from an antenna ( not shown ) connected to the terminal 85 . according to an embodiment of the present invention , a configuration is made , as mentioned before , such that each of the stereo modulation circuit 61 , the frequency modulation circuit 62 , and the power amplifier 63 can be set as to a circuit state . however , it is not necessary that all of the circuits are changed in state every time the latch data ld is updated . that is , it is possible that one or two circuits among the stereo modulation circuit 61 , the frequency modulation circuit 62 , and the power amplifier 63 are changed in state . specifically , for example , when changing only the amplification factor in the power amplifier 63 , in the latch data which has already been held , such data may be updated that only the n5 - bit data for the third set signal set 3 is changed while the n3 - bit data for the first set signal set 1 and the n4 - bit data for the second set signal set 2 are not changed , as a new latch data ld in the latch circuit 54 . here , an operation is described of the transmission device 10 according to an embodiment of the present invention . hereinafter , in an embodiment of the present invention , a description is made assuming that the shift register 52 is a 10 - bit register and that , in data input to the shift register 52 , 4 - bit datft input earlier in time is used as the address selection signal ao , and the 6 - bit data input later in time is used as the set data do . it is also assumed that , in the 6 - bit set data do , 2 - bit dat which is input to the shift register 52 just after the address selection signal ao is data for setting an attenuation amount of the attenuator ( not shown ), and the following 2 - bit data is data for setting a frequency of the carrier wave , and the last 2 - bit one is data for setting an amplification factor of the power amplifier 63 . furthermore , an address assigned to the address decoder 53 is represented by , for example , ( 1 , 0 , 1 , 0 ), which is hereinafter denoted as first address data ad 1 , in an embodiment of the present invention . in addition , data for a desirable attenuation amount of the attenuator ( not shown ) is represented by , for example , ( 1 , 1 ), data for a desirable frequency of the carrier wave is represented by , for example , ( 0 , 1 ), and data for desirable amplification factor of the power amplifier 63 is represented by , for example , ( 1 , 0 ). accordingly , in an embodiment of the present invention , in order to set the above desirable data respectively for the stereo modulation circuit 61 , the frequency modulation circuit 62 , and the power amplifier 63 , the data ( 1 , 0 , 1 , 0 ) and the data ( 1 , 1 ), ( 0 , 1 ), and ( 1 , 0 ) need to be input sequentially as the serial data sda to the shift register 52 on the rising edge of the clock signal sclk , in the first setting circuit 40 . in an embodiment of the present invention , the data ( 1 , 1 ), ( 0 , 1 ), and ( 1 , 0 ), which are sequentially input so as to desirably set each of the stereo modulation circuit 61 , the frequency modulation circuit 62 , and the power amplifier 63 , are put together to be represented as a first data dl ( 1 , 1 , 0 , 1 , 1 , 0 ). as described before , the data generation circuit 20 inverts the levels of the input signals rin and lin by the inverters to be rendered the clock signal sclk and data sda , respectively . accordingly , in order to output the first address data ad 1 and first data dl as the data sda from the data generation circuit 20 on the rising edge of the clock signal sclk , the data obtained by inverting each bit of the first address data ad 1 and first data dl needs to be input as the audio signal lin to the data generation circuit 20 on the falling edge of the inverted clock signal sclk . in an embodiment according to the present invention , data ( 0 , 1 , 0 , 1 ) obtained by inverting each bit of the first address data ad 1 is denoted by second address data ad 2 , and data ( 0 , 0 , 1 , 0 , 0 , 1 ) obtained by inverting each bit of the first data d 1 is denoted by second data d 2 . in an embodiment of the present invention , it is assumed that in the music reproduction device ( not shown ) a setting music file is saved in advance so that the second address data ad 2 and second data d 2 are output as the audio signal lin , in synchronization with the falling edge of a predetermined clock signal output as the audio signal rin . firstly , the user operates the external switch ( not shown ) so that both of the first control signal cont 1 and enable signal ce are h - level , as shown in a timing chart of major signals in the transmission device 10 shown in fig2 . then , the above setting music file saved in the music reproduction device ( not shown ) is read and the setting music file is reproduced . as a result , the predetermined clock signal is input as the audio signal rin , and the second address data ad 2 and second data d 2 are input as an audio signal lin , to the data generation circuit 20 , respectively . as described before , the data generation circuit 20 inverts a level of the audio signal rin and a level of the audio signal lin respectively by inverters . accordingly , the first address data ad 1 and first data dl are output as the data sda from the data generation circuit 20 in synchronization with the rising edge of the clock signal sclk . since the enable signal ce is h - level , the first address data ad 1 and then the first data dl are sequentially input to the shift register 52 in the first setting circuit 40 . since the first address data ad 1 is so set as to match the address assigned to the address decoder 53 , when the first address data ad 1 and first data dl are all held by the shift register 52 , the address decoder 53 outputs the decode signal dec . the shift register 52 outputs the first data dl as the set data do to the latch circuit 54 . when the decode signal dec is input to the latch circuit 54 , the latch circuit 54 outputs the first data dl as the latch data ld to the second setting circuit 60 in the output circuit 41 . thus , the second setting circuit 60 , based on the first data dl , outputs the first set signal set 1 , second set signal set 2 , and third set signal set 3 to the stereo modulation circuit 61 , frequency modulation circuit 62 , and power amplifier 63 , respectively , and therefore , the above circuits are set in desirable states . secondly , the user operates the external switch ( not shown ) so that the first control signal cont 1 and the enable signal ce are l - level . in an embodiment according to the present invention , since the numbers of bits of the first address data ad 1 and first data dl and a period of the clock signal sclk are determined in advance , the user can operate the external switch ( not shown ) so that the first control signal cont 1 and enable signal ce become l - levels after the latch data ld is updated . then , the user operates the music reproduction device ( not shown ) so that a desirable music file saved in the music reproduction device ( not shown ) is selected and the audio signals rin and lin are output based on the desirable music file from the music reproduction device ( not shown .) at this time , the first control signal cont 1 is l - level , and therefore , outputs of the data generation circuit 20 are h - level irrespective of the levels of audio signals rin and lin . furthermore , since the enable signal ce is l - level , data held in the shift register 52 is not updated , and therefore , the output circuit 41 is not changed in state . as a result , the output circuit 41 modulates the carrier wave of the desirable frequency with the stereo composite signal so according to the audio signals rin and lin , to output the output signal out of a desirable level to the antenna ( not shown .) the transmission device 10 according to an embodiment of the present invention having a configuration described above can set the attenuation amount of the audio signals rin and lin input to the fm transmission circuit 21 , the frequency of the carrier wave , and the amplification factor of the modulated signal mod , by inputting the predetermined clock signal as the audio signal rin and the second address data ad 2 and second data d 2 as the audio signal lin from a music reproduction device ( not shown .) generally speaking , in order to set the frequency , etc ., as described above , for an fm transmission circuit , a microcomputer is needed . in order to set a frequency of a carrier wave , it is required to provide a setting device for setting the frequency of the carrier wave , a display screen ( not shown ) for displaying the frequency of the carrier wave , a driving circuit for driving the display screen , etc ., as described in japanese patent laid - open publication no . 2007 - 88657 , for example . in the transmission device 10 according to an embodiment of the present invention , a mounting area can be made smaller , as compared with the above common transmission device . in addition , the above display screen , etc ., for displaying the frequency of the carrier wave are not required , and therefore , costs can be reduced . in an embodiment of the present invention , the switches sw 1 and sw 2 are provided . however , a configuration may be made such that the terminal 82 is connected with the power supply vcc , and the source electrodes of the nmos transistors 30 and 31 are connected with the ground gnd , respectively , without using the switches sw 1 and sw 2 , for example . in a case where a common music file is reproduced , digital signals having waveforms illustrated in fig2 are not likely to be output as the audio signals rin and lin . accordingly , even in a case of a configuration where the above switches sw 1 and sw 2 are not used , data held in the latch circuit 54 is not likely to be updated by the audio signals rin and lin , and thus , there is a low probability that data are erroneously set for the second setting circuit 60 in the output circuit 41 . in the transmission device 10 according to an embodiment of the present invention , after the frequency being set of the carrier wave of the fm transmission circuit 21 , the external switch ( not shown ) is so operated that the first control signal cont 1 becomes l - level . therefore , while a music file being reproduced , the clock signal sclk and data sda of h - level are always output from the generation circuit 20 , thereby extremely decreasing a probability that the data held in the latch circuit 54 are erroneously updated . furthermore , when the first control signal cont 1 is l - level , even during the reproduction of a music file , a current is not passed through the inverter made up of the nmos transistor 30 and resistor 32 , nor in the inverter made up of the nmos transistor 30 and resistor 32 , and therefore , power consumption can be reduced . in the fm transmission circuit 21 according to an embodiment of the present invention , the latch data ld of the output circuit 41 is updated only when the address decoder 53 outputs the decode signal dec . therefore , for example , in the case of a configuration where the switches sw 1 and sw 2 are not provided , and the terminal 82 is connected with the power supply vcc and each of the source electrodes of the nmos transistors 30 and 31 is connected with the ground gnd , and even in a case of erroneously operating the switches sw 1 and sw 2 in an embodiment of the present invention , data of the second setting circuit in the output circuit 41 is not likely to be set erroneously . the transmission device 10 according to an embodiment of the present invention is provided with the switch sw 1 capable of changing the level of the enable signal ce by operating the external switch ( not shown .) therefore , for example , in a case where the frequency of the carrier wave of the fm transmission circuit 21 is set with the clock signal sclk , data sda , and enable signal ce , that is , in a case where the frequency is set by means of common three - wire system data transmission , the user can implement the setting by operating the external switch ( not shown ) in accordance with inputs of the clock signal sclk and data sda . the above embodiments of the present invention are simply for facilitating the understanding of the present invention and are not in any way to be construed as limiting the present invention . the present invention may variously be changed or altered without departing from its spirit and encompass equivalents thereof . for example , in the fm transmission circuit 21 according to an embodiment of the present invention , the user operates the external switch ( not shown ) in accordance with inputs of the clock signal sclk and data sda to change the enable signal ce . however , in a case of common two - wire system data transmission , only the clock signal sclk and data sda are input to the fm transmission circuit 21 . accordingly , in a case where the fm transmission circuit 21 is only used for the two - wire system data transmission , a configuration may be made such that the clock signal sclk and data sda are directly input to the shift register 52 . consequently , in the transmission device 10 , the switch sw 1 and the external switch ( not shown ) for controlling the switch sw 1 , the and circuits 50 and 51 in the fm transmission circuit 21 , and the terminal 82 can be eliminated . even in the above case where the switch sw 1 , etc ., are eliminated , if the first control signal cont 1 is rendered l - level after the clock signal sclk and data sda are directly input to the shift register 52 , both the clock signal sclk and data sda become h - level , thereby decreasing a probability that erroneous data is input to the shift register 52 . in the transmission device 10 according to an embodiment of the present invention , only the fm transmission circuit 21 is an integrated circuit , however , the data generation circuit 20 and switch sw 1 can also be integrated . in a case where the data generation circuit 20 and switch sw 1 are integrated , the terminals 80 and 81 can be eliminated . the output circuit 41 according to an embodiment of the present invention includes a configuration that the attenuation amount of the attenuator ( not shown ) in the stereo modulation circuit 61 , the frequency of the carrier wave in the frequency modulation circuit 62 , and the amplification factor of the power amplifier 63 are set based on the latch data ld , however , this is not limitative . for example , a configuration may be made such that the output circuit 41 includes a bias current circuit ( not shown ) for supplying a bias current according to a reference current to each of circuits included in the output circuit 41 and a reference current value of the bias current circuit ( not shown ) is set based on the latch data ld . in this case , for example , if the reference current value of the second setting circuit 60 is set at o ( zero ) based on the latch data ld , a consumption current of the output circuit 41 is suppressed . furthermore , a configuration may be made such that , the second setting circuit 60 can change the stereo composite signal so output from the stereo modulation circuit 61 from a stereo signal to a monaural signal based on latch data ld . the attenuator ( not shown ) of the stereo modulation circuit 61 according to an embodiment of the present invention attenuates both the levels of the input audio signals rin and lin based on the latch data ld . however , a configuration may be made , for example , such that a first attenuator ( not shown ) and a second attenuator ( not shown ) are provided as the attenuator ( not shown ) so that each of the levels can be attenuated of the audio signals rin and lin , thereby changing the attenuation amount of one of the above two attenuators based on the latch data ld . as mentioned before , the music reproduction device ( not shown ) according to an embodiment of the present invention outputs the second address data ad 2 and second data d 2 as the audio signal lin in synchronization with the falling edge of the predetermined clock signal output as the audio signal rin by reproducing the stored setting music file . however , some music reproduction devices output first address data ad 1 and first data d 1 , which are inverted , and an inverted audio signal rin , instead of the second address data ad 2 and second data d 2 , which are desirable , even when reproducing the above setting music file . in the other words , when reproducing a setting music file , some music reproduction devices output desirable logical data , etc ., while some music reproduction devices output logical data obtained by inverting the desirable logic , etc . here , the music reproduction device which outputs the desirable logical data in reproducing the setting music file is referred to as a positive - logic output music reproduction device , and the music reproduction device which outputs the logical data obtained by inverting the desirable logic is referred to as a negative - logic output music reproduction device . accordingly , in a case where the music reproduction device used by the user is the negative - logic output music reproduction device , data obtained by inverting the audio signal lin is input to the shift register 52 in synchronization with the rising edge of the predetermined clock signal output as the audio signal rin . for this reason , even in a case of reproducing the setting music file so as to update the latch data ld , the first address data ad 1 assigned to the address decoder 53 is not input , and accordingly , the latch data ld is not updated . therefore , instead of the above setting music file , a setting music file may be used , which is capable of outputting data compatible with each of the positive - logic output and negative - logic output music reproduction devices . hereinafter , an operation is described of the transmission device 10 when using such a setting music file referring to fig3 and fig4 . fig3 shows an example of waveforms when the positive - logic output music reproduction device reproduces the above setting music file . here , the right side audio signal output from the positive - logic output music reproduction device corresponds to an audio signal rin 1 and the left side audio signal output therefrom corresponds to an audio signal lin 1 , respectively . in addition , it is assumed herein that when the setting music file is reproduced , data for a positive - logic output and data for a negative - logic output are output in turn . the positive - logic output music reproduction device firstly outputs the second address data ad 2 and second data d 2 , which are data for the positive - logic output , in synchronization with the falling edge of the predetermined clock signal output as the audio signal rin 1 . then , the positive - logic output music reproduction device outputs the first address data ad 1 and first data d 1 , which are data for the negative - logic output , in synchronization with the rising edge of the predetermined clock signal output the audio signal rin 1 . the audio signals rin 1 and lin 1 are inverted in the data generation circuit 20 into the clock signal sclk and data sda . accordingly , the first address data ad 1 and first data d 1 are input to the shift register 52 in synchronization with the rising edge of the clock signal sclk , and the data obtained by inverting the audio signal lin 1 is input in synchronization with the rising edge of the clock signal sclk . however , as described before , the address assigned to the address decoder 53 is the first address data ad 1 , and therefore , only the first data d 1 is stored in the latch circuit 54 based on the data for the positive - logic output , as a result . that is , the data obtained by inverting the audio signal lin 1 based on the data for the negative - logic output is not input to the latch circuit 54 . fig4 shows an example of waveforms when the negative - logic output music reproduction device reproduces the setting music file capable of outputting data compatible with each of the positive - logic output and negative - logic output music reproduction devices . here , the right side audio signal output from the negative - logic output music reproduction device corresponds to an audio signal rin 1 and the left side audio signal output therefrom corresponds to an audio signal lin 2 . when the above setting music file is reproduced , the negative - logic output music reproduction device outputs the audio signals rin 2 and lin 2 obtained by inverting logics of the audio signals rin 1 and lin 1 . that is , firstly , the first address data ad 1 and first data dl are output as data for the positive - logic output from the music reproduction device in synchronization with the rising edge of the predetermined clock signal . then , the second address data ad 2 and second data d 2 are output as data for a negative - logic output from the music reproduction device in synchronization with the falling edge of the predetermined clock signal . thus , firstly , data obtained by inverting the audio signal lin 2 is input to the shift register 52 in synchronization with the rising edge of the clock signal sclk . then , the first address data ad 1 and first data dl are input to the shift register 52 in synchronization with the rising edge of the clock signal sclk . as a result , only the first data dl which is based on the data for the negative - logic output is stored in the latch circuit 54 . on the other hand , the data obtained by inverting the audio signal lin 2 which is based on the data for the positive - logic output is not input to the latch circuit 54 . thus , the latch data ld can be updated with reliability , by using the setting music file compatible with each of the positive - logic output and negative - logic output music reproduction devices , in either of the cases where the positive - logic output music reproduction device is used or the negative - logic output music reproduction device is used . | 7 |
the present application discloses compounds useful as potent , yet selective allosteric modulators of adenosine receptors , with activity as ador agonists , and in some cases , ador antagonists , and methods of preparation and use thereof . the compounds can be used in a method for allosterically modulating adenosine receptors in a mammal , including a human . the methods involve administering an effective amount of a compound of formula ia , ib , or ic sufficient to moderate adenosine receptors to the mammal . the compounds can be used in a pharmaceutical formulation that includes a compound of formula ia , ib , or ic and one or more excipients . various chemical intermediates can be used to prepare the compounds of formula ia , ib , or ic . as used herein , a compound is an agonist of an adenosine a 1 receptor if it is able to fully inhibit adenylate cyclase ( a 1 ) and is able to displace [ 125 i ]- ab - meca in a competitive binding assay . as used herein , a compound is a partial agonist of an adenosine a 1 receptor if it is able to partially inhibit adenylate cyclase ( a 1 ) and is able to displace [ 125 i ]- ab - meca in a competitive binding assay . as used herein , a compound is an antagonist of an adenosine a 1 receptor if it is able to prevent the inhibition due to an agonist and is able to displace [ 125 i ]- ab - meca in a competitive binding assay . as used herein , the term “ alkyl ” refers to monovalent straight , branched or cyclic alkyl groups preferably having from 1 to 20 carbon atoms , more preferably 1 to 10 carbon atoms (“ lower alkyl ”) and most preferably 1 to 6 carbon atoms . this term is exemplified by groups such as methyl , ethyl , n - propyl , iso - propyl , n - butyl , iso - butyl , n - hexyl , and the like . the terms “ alkylene ” and “ lower alkylene ” refer to divalent radicals of the corresponding alkane . further , as used herein , other moieties having names derived from alkanes , such as alkoxyl , alkanoyl , alkenyl , cycloalkenyl , etc when modified by “ lower ,” have carbon chains of ten or less carbon atoms . in those cases where the minimum number of carbons are greater than one , e . g ., alkenyl ( minimum of two carbons ) and cycloalkyl , ( minimum of three carbons ), it is to be understood that “ lower ” means at least the minimum number of carbons . as used herein , the term “ substituted alkyl ” refers to an alkyl group , preferably of from 1 to 10 carbon atoms (“ substituted lower alkyl ”), having from 1 to 5 substituents , and preferably 1 to 3 substituents , selected from the group consisting of alkoxy , substituted alkoxy , cycloalkyl , substituted cycloalkyl , cycloalkenyl , substituted cycloalkenyl , acyl , acylamino , acyloxy , amino , substituted amino aminoacyl , aminoacyloxy , oxyacylamino , cyano , halogen , hydroxyl , keto , thioketo , carboxyl , carboxylalkyl , thiol , thioalkoxy , substituted thioalkoxy , aryl , aryloxy , heteroaryl , heteroaryloxy , heterocyclic , hydroxyamino , alkoxyamino , nitro , — so - alkyl , — so - substituted alkyl , — so - aryl , — so - heteroaryl , — so 2 - alkyl , — so 2 - substituted alkyl , — so 2 - aryl , — so 2 - heteroaryl , and mono - and di - alkylamino , mono - and di -( substituted alkyl ) amino , mono - and di - arylamino , mono - and di - heteroarylamino , mono - and di - heterocyclic amino , and unsymmetric di - substituted amines having different substituents selected from the group consisting of alkyl , aryl , heteroaryl and heterocyclic . as used herein , other moieties having the prefix “ substituted ” are intended to include one or more of the substituents listed above . as used herein , the term “ alkoxy ” refers to the group “ alkyl - o —”, where alkyl is as defined above . preferred alkoxy groups include , by way of example , methoxy , ethoxy , n - propoxy , iso - propoxy , n - butoxy , tert - butoxy , sec - butoxy , n - pentoxy , n - hexoxy , 1 , 2 - dimethylbutoxy , and the like . as used herein , the term “ alkenyl ” refers to alkenyl groups preferably having from 2 to 10 carbon atoms and more preferably 2 to 6 carbon atoms and having at least 1 and preferably from 1 - 2 sites of alkenyl unsaturation . preferred alkenyl groups include ethenyl (— ch ═ ch 2 ), n - propenyl (— ch 2 ch ═ ch 2 ), iso - propenyl (— c ( ch 3 )═ ch 2 ), and the like . as used herein , the term “ alkynyl ” refers to alkynyl groups preferably having from 2 to 10 carbon atoms and more preferably 2 to 6 carbon atoms and having at least 1 and preferably from 1 - 2 sites of alkynyl unsaturation . as used herein , the term “ acyl ” refers to the groups alkyl - c ( o )—, substituted alkyl - c ( o )—, cycloalkyl - c ( o )—, substituted cycloalkyl - c ( o )—, aryl - c ( o )—, heteroaryl - c ( o )— and heterocyclic - c ( o )— where alkyl , substituted alkyl , cycloalkyl , substituted cycloalkyl , aryl , heteroaryl and heterocyclic are as defined herein . as used herein , the tenn “ acylamino ” refers to the group — c ( o ) nrr where each r is independently hydrogen , alkyl , substituted alkyl , aryl , heteroaryl , or heterocyclic wherein alkyl , substituted alkyl , aryl , heteroaryl and heterocyclic are as defined herein . as used herein , the term “ aryl ” refers to an unsaturated aromatic carbocyclic group of from 6 to 14 carbon atoms having a single ring ( e . g ., phenyl ) or multiple condensed ( fused ) rings ( e . g ., naphthyl or anthryl ). preferred aryls include phenyl , naphthyl and the like . unless otherwise constrained by the definition for the aryl substituent , such aryl groups can optionally be substituted with from 1 to 5 substituents and preferably 1 to 3 substituents selected from the group consisting of acyloxy , hydroxy , acyl , alkyl , alkoxy , alkenyl , alkynyl , substituted alkyl , substituted alkoxy , substituted alkenyl , substituted alkynyl , amino , substituted amino , aminoacyl , acylamino , alkaryl , aryl , aryloxy , azido , carboxyl , carboxylalkyl , cyano , halo , nitro , heteroaryl , heteroaryloxy , heterocyclic , heterocyclooxy , aminoacyloxy , oxyacylamino , thioalkoxy , substituted thioalkoxy , thioaryloxy , thioheteroaryloxy , — so - alkyl , — so - substituted alkyl , — so - aryl , — so - heteroaryl , — so 2 - alkyl , — so 2 - substituted alkyl , — so 2 - aryl , — so 2 - heteroaryl , trihalomethyl . preferred substituents include alkyl , alkoxy , halo , cyano , nitro , trihalomethyl , and thioalkoxy . as used herein , the term “ cycloalkyl ” refers to cyclic alkyl groups of from 3 to 12 carbon atoms having a single cyclic ring or multiple condensed rings . such cycloalkyl groups include , by way of example , single ring structures such as cyclopropyl , cyclobutyl , cyclopentyl , cyclooctyl , and the like , or multiple ring structures such as adamantanyl , and the like . as used herein , the terms “ halo ” or “ halogen ” refer to fluoro , chloro , bromo and iodo and preferably is either fluoro or chloro . as used herein , the term “ heteroaryl ” refers to an aromatic carbocyclic group of from 1 to 15 carbon atoms and 1 to 4 heteroatoms selected from the group consisting of oxygen , nitrogen and sulfur within at least one ring ( if there is more than one ring ). unless otherwise constrained by the definition for the heteroaryl substituent , such heteroaryl groups can be optionally substituted with from 1 to 5 substituents and preferably 1 to 3 substituents selected from the group consisting of acyloxy , hydroxy , acyl , alkyl , alkoxy , alkenyl , alkynyl , substituted alkyl , substituted alkoxy , substituted alkenyl , substituted alkynyl , amino , substituted amino , aminoacyl , acylamino , alkaryl , aryl , aryloxy , azido , carboxyl , carboxylalkyl , cyano , halo , nitro , heteroaryl , heteroaryloxy , heterocyclic , heterocyclooxy , aminoacyloxy , oxyacylamino , thioalkoxy , substituted thioalkoxy , thioaryloxy , thioheteroaryloxy , — so - alkyl , — so - substituted alkyl , — so - aryl , — so - heteroaryl , — so 2 - alkyl , — so 2 - substituted alkyl , — s 2 - aryl , — so 2 - heteroaryl , trihalomethyl . preferred substituents include alkyl , alkoxy , halo , cyano , nitro , trihalomethyl , and thioalkoxy . such heteroaryl groups can have a single ring ( e . g ., pyridyl or furyl ) or multiple condensed rings ( e . g ., indolizinyl or benzothienyl ). “ heterocycle ” or “ heterocyclic ” refers to a monovalent saturated or unsaturated group having a single ring or multiple condensed rings , from 1 to 15 carbon atoms and from 1 to 4 hetero atoms selected from the group consisting of nitrogen , sulfur or oxygen within the ring . unless otherwise constrained by the definition for the heterocyclic substituent , such heterocyclic groups can be optionally substituted with 1 to 5 substituents selected from the group consisting of alkyl , substituted alkyl , alkoxy , substituted alkoxy , aryl , aryloxy , halo , nitro , heteroaryl , thiol , thioalkoxy , substituted thioalkoxy , thioaryloxy , trihalomethyl , and the like . such heterocyclic groups can have a single ring or multiple condensed rings . as to any of the above groups that contain 1 or more substituents , it is understood , of course , that such groups do not contain any substitution or substitution patterns which are sterically impractical and / or synthetically non - feasible . “ pharmaceutically acceptable salts ” refers to pharmaceutically acceptable salts of a compound of formulas ia , ib , or ic , which salts are derived from a variety of organic and inorganic counter ions well known in the art and include , by way of example only , sodium , potassium , calcium , magnesium , ammonium , tetraalkylammonium , and the like ; and when the molecule contains a basic functionality , salts of organic or inorganic acids , such as hydrochloride , hydrobromide , tartrate , mesylate , acetate , maleate , oxalate and the like can be used as the pharmaceutically acceptable salt . the term “ protecting group ” or “ blocking group ” refers to any group which when bound to one or more hydroxyl , amino or carboxyl groups of the compounds ( including intermediates thereof such as the aminolactams , aminolactones , etc .) prevents reactions from occurring at these groups and which protecting group can be removed by conventional chemical or enzymatic steps to reestablish the hydroxyl , amino or carboxyl group . preferred removable amino blocking groups include conventional substituents such as t - butyoxycarbonyl ( t - boc ), benzyloxycarbonyl ( cbz ), and the like which can be removed by conventional conditions compatible with the nature of the product . as used herein , a “ negative dromotropic effect ” is a decrease in the conduction velocity of the nerve tissue in the heart . as a consequence of this slow down of the conduction velocity , the s — h interval is prolonged . as used herein the term “ amino acid ” means an alpha amino acid selected from those amino acids which naturally occur in proteins but without regard for specific stereochemical properties . the term “ protected amino acid ” means an amino acid in which the alpha amine group has been protected with a protecting group , as defined above . the terms “ amino acid residue ” and “ amino acid moiety ” are used synonymously herein . certain of the compounds arc sufficiently basic , ( e . g ., amino derivatives ) or acidic ( e . g ., carboxylic acid derivatives ) to form salts . pharmaceutically acceptable salts of the compounds of formulas ia , ib and ic are within the scope of the present invention . as will be understood by those skilled in the art , pharmaceutically acceptable salts include , but are not limited to , salts with inorganic acids such as hydrochloride , sulfate , phosphate , hydrobromide , and nitrate or salts with an organic acid such as malate , maleate , fumarate , tartrate , succinate , citrate , acetate , lactate , methanesulfonate , p - toluenesulfonate , palmoate , salicylate , and stearate . the compound have the following general formulas ia , ib , and ic : r 2 , r 3 , and r 4 are independently hydrogen , halogen , alkyl , substituted alkyl , aryl , heteroaryl , heterocyclic , lower alkenyl , lower alkanoyl , amino , trifluoromethyl , amino alkyl , nitro , or cyano ; z is nh , n — c ( x )— nh - aryl , nc ( x )— nh - alk , n — c ( x )— o - alk , n — c ( x )— o - alkaryl , n — c ( x )— o - aryl , n ( alk ) 2 ( + ) ( and an associated pharmaceutically acceptable anion such as f − , cl − , br − or i − ), n —( gr ) m ( am ) n ( alk ) p ( ar ) q , or ch —( gr ) m ( am ) n ( alk ) p ( ar ) q , am is — ch ( nh 2 )—, an amino acid residue , or an amino protected amino acid residue , ar is aryl or substituted aryl , wherein the substituents include one or more alkyl or substituted alkyl groups or one or more nitro groups , provided that at least one of m , n , p , and q is other than 0 ; r 5 and r 6 are independently hydrogen , alkyl , substituted alkyl , or taken together form a lower alkenyl ring of 5 or 6 members , provided that if r 2 , r 3 , and r 4 are hydrogen , then , both r 5 and r 6 may be neither hydrogen nor methyl ; further provided that if r 2 and r 3 are hydrogen while r 4 is trifluoromethyl or if r 2 and r 4 are hydrogen while r 3 is chloro , then both r 5 and r 6 may not be methyl ; r 7 is hydrogen , alkyl , n ( alk ) 2 , substituted alkyl or oh ( and the resulting tautomeric form in which the oh is tautomerized to a carbonyl and the imine is tautomerized to an nh group ); r 2 , r 3 , and r 4 are independently hydrogen , halogen , or trifluoromethyl , z is nh , n —( ch 2 ) 1 - 3 phenyl , n -( ethoxycarbonylmethyl ), n -( 2 - t - butoxycarbonylamino - 3 -( 4 - hydroxyphenyl )- propion - 1 - yl ), n -( 3 - methylbut - 2 - en - 1 - yl ), n -( 4 - methylphenylsulfonyl ), n -( 4 - nitro -( 2 - phenyleth - 1 - yl ), or n -( benzyloxycarbonyl ); r 5 and r 6 are both hydrogen or both methyl , or r 5 and r 6 together form a cyclopentyl or cyclohexyl ring ; those skilled in the art of organic chemistry will appreciate that reactive and fragile functional groups often must be protected prior to a particular reaction , or sequence of reactions , and then restored to their original forms after the last reaction is completed . usually groups are protected by converting them to a relatively stable derivative . for example , a hydroxyl group may be converted to an ether group and an amine group converted to an amide or carbamate . methods of protecting and de - protecting , also known as “ blocking ” and “ de - blocking ,” are well known and widely practiced in the art , e . g ., see t . green , protective groups in organic synthesis , john wiley , new york ( 1981 ) or protective groups in organic chemistry , ed . j . f . w . mcomie , plenum press , london ( 1973 ). compounds of formula ib may be conveniently prepared according to scheme 1 . in step 1 a compound of formula ( ii ) is reacted with a compound of formula ( iii ) in the presence of morpholine and molecular sulfur in a protic solvent , such as ethanol , at about 50 ° to about 65 ° c . for about an hour to yield a compound of formula ia wherein r1 is hydrogen . compounds of formula ( ia ) wherein r 1 is other than hydrogen may be prepared according to step 2 by reacting a compound of formula ( ib ) from step 1 , wherein r 1 is hydrogen , with r 1 x ( wherein r 1 is other than hydrogen , and x is a leaving group ). for a discussion of nuclcophilic displacement reactions and leaving groups , see standard organic chemistry texts such as j . march , advanced organic chemistry , chapter 10 , john wiley & amp ; sons , new york ( 1985 ). compounds of formula ( ii ) are commercially available or may be prepared by methods known to those of skill in the art . compound of formula ( iii ), benzophenone derivatives , may be prepared by methods known to those of skill in the art or conveniently according to scheme 2 . in scheme 2 , a compound of formula ( iv ), a substituted acetophenone , is alpha brominated with molecular bromine in a protic , polar solvent , such as acetic acid to yield the corresponding alpha bromo compound of formula ( v ). the compound of formula ( iii ) is produced by reacting the compound of formula ( v ) with a source of cyanide ions , such as sodium or potassium cyanide , in a polar solvent , such as water , ethanol , or a mixture thereof . as shown in scheme 3 , a compound of formula ( ia 1 ) wherein z is nh may be prepared by hydrolyzing the co — n urethane linkage of a compound of formula ( vi ) under acidic conditions , e . g ., hydrogen bromide in acetic acid . in turn , a compound of formula ( vi ) may be prepared in a similar manner as the reaction of scheme 1 by substituting a compound of formula ( ii ) with a corresponding amount of a compound of formula ( vii ). it may be necessary to protect the carbonyl group of the piperidinonc moiety during the synthesis of a precursor compound , e . g ., by converting it to an ethylenedioxy derivative as seen in formula ( viii ). the protecting or blocking group is removed after the synthesis of a compound of formula ( viii ) to generate a compound of formula ( vii ). compounds of formula ( ia ) wherein z is a substituted nitrogen , i . e ., n —( gr ) m ( am ) n ( alk ) p ( ar ) q , may be prepared by nucleophilic displacement by reacting a compound of the formula x —( gr ) m ( am ) n ( alk ) p ( ar ) q , wherein x is a leaving group ( see march , supra ), in a polar solvent in thc presence of a weak base such as sodium or potassium carbonate or a tertiary amine . according to scheme 4 , a compounds of formula ( ic ), can be prepared from the corresponding compound of formula ( ib ), wherein r 1 is hydrogen , by reacting with a compound of formula ( ix ) in a protic , polar solvent , such as ethanol , in the presence of a strong base such as sodium ethoxide to form the pyridine moiety . ( if y is nitrogen , then r 8 ′ is h 2 , and if y is ch , then r 8 ′ is — c ( o ) or 8 ). this reaction can conveniently be carried out by mixing the reactants , solvent and base at about 0 ° c . followed by heating at reflux for about 10 hours . a compound of formula ( ic ) wherein y is nitrogen , i . e ., r 8 is h 2 , can be prepared from the corresponding compound of formula ( ib ) by reaction with a compound of formula r 7 — c ( o ) nh 2 , e . g ., formamide , if r 7 is hydrogen , at about 180 ° c . for about 5 hours . compounds of formula ( ia ) wherein z is n —( gr ) m ( am ) n ( alk ) p ( ar ) q , and am is an amino acid or an amino acid with the amino group protected , and m , p , and q are 0 , may be prepared by reacting the corresponding compound wherein z is nh with a protected derivative of an amino acid . an example of a protected amino acid is boc - tyrosine (“ boc - tyr - oh ”) wherein “ boc ” is — c ( o ) oc ( ch 3 ) 3 . preferably the reaction is run in a polar , aprotic solvent , such as dimethylformamide . preparation of boc derivatives of amino acids are well known in the art of protein and peptide chemistry . if desired the boc moiety may be removed by standard means known in the art to restore the amino acid residue . compounds which include quaternary ammonium salts , for example , at the 6 - position , can be prepared by reacting the amine at the desired position with excess alkyl halides using routine alkylation conditions . compounds with urea linkages can be prepared by reacting the amine at the 6 - position with the desired isocyanate . urethanes can be prepared by reacting the amine at the 6 - position with the desired alkyl chlorocarbonate ( as shown , for example , in morrison & amp ; boyd , organic chemistry , fourth edition , allyn & amp ; bacon , inc ., boston , 1983 , page 840 ). cardioprotection , short term ( e . g ., prior to percutaneous angioplasty ( ptda ), angioplasty , and cardiac surgeries ) and long term ( prevention of myocardial infarction , especially in high risk patients , reduction of infarct damage , especially in high risk patients ); pain management generally , including different forms of neuropathic pain , e . g ., diabetic neuropathy , post herpetic neuralgia ; adjunct therapy in diabetes , including insulin and non - insulin dependent diabetes mellitus : stimulation of insulin secretion from the pancreas , increase in tissue sensitivity to insulin ; treatment of gi disorders such as diarrhea , irritable bowel disease , irritable bowel syndrome , irritable bladder , incontinence such as urge incontinence ; diagnostic uses , for example , to determine the presence of one or more of the above described medical conditions , or in a screening assay to determine the effectiveness of other compounds for binding to the a1 ado receptor ( i . e ., through competitive inhibition as determined by various binding assays ); and the compounds can be administered via any medically acceptable means . suitable means of administration include oral , rectal , topical or parenteral ( including subcutaneous , intramuscular and intravenous ) administration , although oral or parenteral administration are preferred . the amount of the compound required to be effective as an allosteric modulator of an adenosine receptor will , of course , vary with the individual mammal being treated and is ultimately at the discretion of the medical or veterinary practitioner . the factors to be considered include the condition being treated , the route of administration , the nature of the formulation , the mammal &# 39 ; s body weight , surface area , age and general condition , and the particular compound to be administered . however , a suitable effective dose is in the range of about 0 . 1 μg / kg to about 10 mg / kg body weight per day , preferably in the range of about 1 mg / kg to about 3 mg / kg per day . the total daily dose may be given as a single dose , multiple doses , e . g ., two to six times per day , or by intravenous infusion for a selected duration . dosages above or below the range cited above are within the scope of the present invention and may be administered to the individual patient if desired and necessary . for example , for a 75 kg mammal , a dose range would be about 75 mg to about 220 mg per day , and a typical dose would be about 150 mg per day . if discrete multiple doses are indicated , treatment might typically be 50 mg of a compound given 3 times per day . the compounds described above are preferably administered in formulation including an active compound , i . e ., a compound of formula ( ia ), ( ib ) or ( ic ), together with an acceptable carrier for the mode of administration . suitable pharmaceutically acceptable carriers are known to those of skill in the art . the compositions can optionally include other therapeutically active ingredients , such as antibiotics , antivirals , healing promotion agents , anti - inflammatory agents , immunosuppressants , growth factors , anti - metabolites , cell adhesion molecules ( cams ), cytotoxic agents , antibodies , vascularizing agents , anti - coagulants , and anesthetics / analgesics . the carrier must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof . the formulations can include carriers suitable for oral , rectal , topical or parenteral ( including subcutaneous , intramuscular and intravenous ) administration . preferred carriers are those suitable for oral or parenteral administration . formulations suitable for parenteral administration conveniently include sterile aqueous preparation of the active compound which is preferably isotonic with the blood of the recipient . thus , such formulations may conveniently contain distilled water , 5 % dextrose in distilled water or saline . useful formulations also include concentrated solutions or solids containing the compound of formula ( i ) which upon dilution with an appropriate solvent give a solution suitable for parental administration above . for enteral administration , the compound can be incorporated into an inert carrier in discrete units such as capsules , cachets , tablets or lozenges , each containing a predetermined amount of the active compound ; as a powder or granules ; or a suspension or solution in an aqueous liquid or non - aqueous liquid , e . g ., a syrup , an elixir , an emulsion or a draught . suitable carriers may be starches or sugars and include lubricants , flavorings , binders , and other materials of the same nature . a tablet may be made by compression or molding , optionally with one or more accessory ingredients . compressed tablets may be prepared by compressing in a suitable machine the active compound in a free - flowing form , e . g ., a powder or granules , optionally mixed with accessory ingredients , e . g ., binders , lubricants , inert diluents , surface active or dispersing agents . molded tablets may be made by molding in a suitable machine , a mixture of the powdered active compound with any suitable carrier . a syrup or suspension may be made by adding the active compound to a concentrated , aqueous solution of a sugar , e . g ., sucrose , to which may also be added any accessory ingredients . such accessory ingredients may include flavoring , an agent to retard crystallization of the sugar or an agent to increase the solubility of any other ingredient , e . g ., as a polyhydric alcohol , for example , glycerol or sorbitol . the compounds can also be administered locally by topical application of a solution , ointment , cream , gel , lotion or polymeric material ( for example , a pluronic ™, basf ), which may be prepared by conventional methods known in the art of pharmacy . in addition to the solution , ointment , cream , gel , lotion or polymeric base and the active ingredient , such topical formulations may also contain preservatives , perfumes , and additional active pharmaceutical agents . formulations for rectal administration may be presented as a suppository with a conventional carrier , e . g ., cocoa butter or witepsol s55 ( trademark of dynamite nobel chemical , germany ), for a suppository base . alternatively , the compound may be administered in liposomes or microspheres ( or microparticles ). methods for preparing liposomes and microspheres for administration to a patient are well known to those of skill in the art . u . s . pat . no . 4 , 789 , 734 , the contents of which are hereby incorporated by reference , describes methods for encapsulating biological materials in liposomes . essentially , the material is dissolved in an aqueous solution , the appropriate phospholipids and lipids added , along with surfactants if required , and the material dialyzed or sonicated , as necessary . a review of known methods is provided by g . gregoriadis , chapter 14 , “ liposomes ,” drug carriers in bioloy and medicine , pp . 287 - 341 ( academic press , 1979 ). microspheres formed of polymers or proteins are well known to those skilled in the art , and can be tailored for passage through the gastrointestinal tract directly into the blood stream . alternatively , the compound can be incorporated and the microspheres , or composite of microspheres , implanted for slow release over a period of time ranging from days to months . see , for example , u . s . pat . nos . 4 , 906 , 474 , 4 , 925 , 673 and 3 , 625 , 214 , the contents of which are hereby incorporated by reference . preferred microparticles are those prepared from biodegradable polymers , such as polyglycolide , polylactide and copolymers thereof . those of skill in the art can readily determine an appropriate carrier system depending on various factors , including the desired rate of drug release and the desired dosage . the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy . all methods include the step of bringing the active compound into association with a carrier which constitutes one or more accessory ingredients . in general , the formulations are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier or a finely divided solid carrier and then , if necessary , shaping the product into desired unit dosage form . in addition to the aforementioned ingredients , the formulations may further include one or more optional accessory ingredient ( s ) utilized in the art of pharmaceutical formulations , e . g ., diluents , buffers , flavoring agents , binders , surface active agents , thickeners , lubricants , suspending agents , preservatives ( including antioxidants ) and the like . the activity of the compounds can be readily determined using no more than routine experimentation using any of the following assays . the prototypical allosteric enhancer pd 81 , 723 , ( prepared in example 4 ; see bruns et al ., mole . pharm ., 38 : 939 ( 1990 ), cao et al ., gen pharmac . 26 : 1545 ( 1995 ), and amoah - apraku et al ., j . pharm . exper . ther . 266 ( 2 ): 611 ( 1993 )) has both enhancing and inhibitory activity at the a 1 ador . therefore , the effect of a novel series of benzoylthiophene derivatives was determined on both the agonist [ 3 h ] ccpa and the antagonist [ 3 h ] cpx binding to membranes prepared from cho cells stably expressing the human a 1 ador ( cho — hua 1 ador ). the enhancing activity was estimated by the magnitude of the increase in [ 3 h ] ccpa binding whereas the inhibitory and ( or antagonistic ) activity was evaluated by the potency of the benzoylthiophene derivatives to compete for the specific binding of [ 3h ] cpx . the method used for the preparation of the membranes of cho cells expressing hua 1 ador , and the protocols for the radioligand binding assays are described by kollias - baker et al ., ( jpet , 281 , 761 ( 1997 ) and circ . res ., 75 , 961 ( 1994 )). in previous studies ( amoah - apraku et al ., j . pharmacol exp . ther ., 266 , 611 ( 1993 ) and kollias - baker , supra ) the prototypical allosteric enhancer pd 81 , 723 was shown to selectively enhance a 1 ador - mediated prolongation of the stimulus to his ( s — h ) bundle interval ( negative dromotropic effect ) but did not increase the a 2a ador - mediated coronary vasodilation caused by ado . therefore , the effect of compound 20 on the negative dromotropic action of ado in guinea pig isolated perfused hearts was determined . the guinea pig isolated perfused heart preparation and the methods for recording his bundle electrograms and measuring the s — h intervals have been previously reported . the effect of the benzoylthiophene derivative compound 20 on agonist and antagonist binding to cho cells expressing the recombinant hua 1 ador was investigated . specifically , the effects of compound 20 on the binding of the agonist radioligand [ 3 h ] ccpa ( 2 nm ) and the antagonist radioligand [ 3 h ] cpx ( 1 nm ) to recombinant cho — hua 1 ador were determined . as shown in fig1 a , the effect of compound 20 on the specific binding of [ 3 h ] ccpa was biphasic , at concentrations up to 7 μm it increased but thereafter it decreased the specific binding of [ 3 h ] ccpa . in contrast , compound 20 did not enhance the binding of the antagonist radioligand [ 3 h ] cpx and at concentrations greater than 1 μm decreased the specific binding of [ 3 h ] cpx , see fig1 b . the values are mean ± sem of 4 hearts . each data point represents mean ± sem specific binding with determinations from 2 - 3 experiments . fig2 a - d and 3 a - d are similar to fig1 a but show the result of [ 3 h ] ccpa studies on other compounds . consistent with the results of the radioligand binding assays , compound 20 enhanced the negative dromotropic effect ( s — h interval prolongation ) caused by ado in a concentration - dependent manner ( fig4 a ). in pressure of 1 μm compound 20 , 3 μm adenosine caused 2 ° a - v block in 2 of 4 hearts . the values are mean ± sem of 4 guinea pigs . for instance , 0 . 1 , 0 . 5 and 1 . 0 μm compound 20 enhanced the s — h prolongation induced by 3 μm ado by 32 %, 77 %, and 31 1 %, respectively . at 1 . 0 μm compound 20 , the negative dromotropic effect of ado was maximal , eliciting 2 ° a - v block in 2 of 4 hearts . in contrast , in the absence of compound 20 , the same concentration of ado ( 3 μm ) prolonged the s — h interval by 11 ± 3 msec . to demonstrate that the enhancement of the dromotropic effect of ado by compound 20 was mediated by activation of a 1 adors , prolongation of s — h interval caused by ado in the presence of compound 20 was shown to be reversed by 10 μm of the a 1 ador antagonist cpx ( fig4 b ). the reversal of the effects of compound 20 by cpx establishes that the enhancement was mediated through the a 1 ador . the following examples illustrate aspects of this invention but should not be construed as limitations . the symbols and conventions used in these examples are intended to be consistent with those used in the contemporary , international , chemical literature , for example , the journal of the american chemical society (“ j . am . chem . soc .”) and tetrahedron . a . general procedure for the preparation of phenacyl - bromides , the compounds of formula ( v ). a solution of bromine ( 55 mmol ) in acetic acid ( 50 ml ) is added dropwise to a acetophenone ( 50 mmol ), which is a compound of formula ( iv ), in glacial acetic ( 100 ml ) in half an hour , with stirring . the resulting suspension is heated at 50 ° c . for an hour , and then poured into ice water ( 500 ml ). the precipitated phenacyl bromide , a compound of formula ( v ), is filtered and washed with cold water three times , and finally crystallized from ethanol . ( see rather and reid , j . am . chem . soc . 41 , 77 ( 1919 )). b . general procedure for the preparation of substituted benzoyl acetonitriles , the compounds of formula ( iii ) a solution of the phenacyl bromide as prepared in step a , above , in ethanol is reacted with an aqueous solution of potassium cyanide dissolved in distilled water . the reaction is monitored by tlc control and during this time the solution changes color from yellow - orange to yellow - red . when the reaction is complete , crushed ice is added in a large amount and the solution is acidified with acetic acid . the precipitated corresponding benzoyl acetonitriles are filtered , washed with cold water and then air dried . a mixture of equimolar amounts of methylethyl ketone ( 0 . 01 mol ), which is a compound of formula ( ii ) wherein r 5 and r 6 are methyl , benzoyl acetonitrile ( 0 . 01 mol ), which is a compound of formula ( iii ) wherein r 2 , r 3 , and r 4 are hydrogen , sulfur ( 0 . 01 mol ) and morpholine ( 0 . 01 mol ) in ethanol ( 4 ml ) was stirred and heated at 60 ° c . for an hour ( tlc control ). after this time , the suspension was left standing overnight and the mixture was poured into water and the precipitated solid was extracted with ethyl acetate ( 3 × 50 ml ). the organic layers were dried over magnesium sulfate and evaporated under vacuum . the crude product was chromatographed on silica gel column using mixtures of ethyl acetate and petroleum ether . ( m . p . 140 - 141 ° c ., 80 % yield ). 1 h - nmr : ( cdcl 3 ): 1 . 53 ( s , 3h ), 2 . 13 ( s , 3h ); 6 . 44 ( sb , 2h ); 7 . 43 - 7 . 54 ( m , 5h ). the following compounds of formula ( ib ) were prepared using the procedure of scheme 1 taught herein above , and in an analogous manner to example 1 using appropriate precursor compounds of formula ( ii ) and formula ( iii ). if the desired compounds of formulas ( ii ) and ( iii ) are not commercially available , they may be prepared according to example 1 , sections a and b . 2 : preparation of ( 2 - amino - 4 , 5 - dimethyl - 3 - thienyl )-[( 3 , 5 - dichloro - 4 - amino )- phenyl )] methanone ( m . p . 155 - 157 ° c ., 88 % yield ). 1 h - nmr : ( cdcl 3 ): 1 . 71 ( s , 3h ), 2 . 16 ( s , 3h ); 4 . 79 ( sb , 2h ); 6 . 03 ( sb , 2h ); 7 . 48 ( s , 2h ). 3 : preparation of ( 2 - amino - 4 , 5 - dimethyl - 3 - thienyl )-( 4 - chloro - phenyl ) methanone ( m . p . 128 - 130 ° c ., 89 % yield ). 1 h nmr : ( cdcl 3 ): 1 . 54 ( s , 3h ), 2 . 13 ( s , 3h ); 4 : preparation of ( 2 - amino - 4 , 5 - dimethyl - 3 - thienyl )-[ 3 -( trifluoromethyl )- phenyl ] methanone ( m . p . 103 - 105 ° c ., 78 % yield ); 1 hnmr : ( cdcl 3 ): 1 . 48 ( s , 3h ), 2 . 13 ( s , 3h ); 6 . 67 ( sb , 2h ); 7 . 54 - 7 . 75 ( m , 4h ). 5 : preparation of ( 2 - amino - 3 - thienyl )-( 4 - chlorophenyl ) methanone ( m . p . 178 - 180 ° c ., 81 % yield ). 1 h nmr : ( dmso - d6 ) 6 . 27 ( d , 1 h ), 6 . 72 ( d , 1 h ); 7 . 52 - 7 . 63 ( m , 4h ); 8 . 39 ( sb , 2h ). 6 : preparation of ( 2 - amino - 3 - thienyl )- phenylmethanone ( m . p . 150 - 152 ° c ., 75 % yield ). 1 h nmr : ( cdcl 3 ): 6 . 11 ( d , 1h ), 6 . 87 ( d , 1h ); 7 . 05 ( sb , 2h ); 7 . 3 - 7 . 7 ( m , 5h ). to a well - stirred and ice - cooled solution of 1 , 4 - dioxa - 8 - azaspiro [ 4 . 5 ] decane ( 34 . 9 mmol , 5 g ) in dichloromethane ( 200 ml ) under an argon atmosphere , was added triethylamine ( 52 . 4 mmol , 7 . 3 ml ) and then benzyloxycarbonyl chloride ( 42 mmol , 5 . 93 ml ) dropwise . the suspension was stirred at room temperature for 24 hours and the precipitated solid was filtered . the organic solution was evaporated under vacuum to give an oily residue which was chromatographed on silica gel eluting with a mixture of ethyl ether and petroleum ether to afford 8 - benzyloxycarbonyl 1 , 4 - dioxa - 8 - azaspiro [ 4 , 5 ] decane in quantitative yield . 1 h - nmr ( cdcl 3 ): 1 . 63 ( m , 4h ); 3 . 56 ( m , 4h ); 3 . 89 ( s , 4h ); 5 . 09 ( s , 2h ); 7 . 28 ( s , 5h ). to a stirred solution of 8 - benzyloxycarbonyl 1 , 4 - dioxa - 8 - azaspiro [ 4 , 5 ] decane ( 0 . 037 mol , 10 g ) in tetrahydrofuran ( 150 ml ) was added a solution of hydrochloric acid 5 % ( 20 ml ) dropwise at room temperature . the solution was stirred for 18 h ( tlc control ) and then evaporated under vacuum to small volume ( 20 ml ) and neutralized with a saturated sodium bicarbonate solution . the aqueous solution was extracted with ethyl acetate ( 3 × 100 ml ) and the organic layers were dried over sodium sulfate and finally evaporated under vacuum to give 1 - benzyloxycarbonyl piperidin - 4 - one which was substantially pure and which was used in the next step without any purification ( 92 % yield ). 1 h - nmr ( cdcl 3 ): 1 . 63 ( m , 4h ); 3 . 56 ( m , 4h ); 5 . 09 ( s , 2h ); 7 . 28 ( s , 5h ). a mixture of equimolar amounts of 1 - benzyloxycarbonyl piperidine ( 0 . 01 mol ), benzoyl acetonitrile ( 0 . 01 mol ), sulfur ( 0 . 01 mol ) and morpholine ( 0 . 01 mol ) in ethanol ( 4 ml ) was stirred and heated at 60 ° c . for 1 h ( tlc control ). after this time , the suspension was left to stand overnight and the mixture was poured into water and the precipitated solid was extracted with ethyl acetate ( 3 × 50 ml ). the organic layers were dried over magnesium sulfate and evaporated under vacuum . the crude product was chromatographed on a silica gel column using mixtures of ethyl acetate and petroleum ether . ( m . p . 138 - 140 ° c ., 80 % yield ). 1 h - nmr ( cdcl 3 ): 1 . 92 ( m , 2h ), 3 . 42 ( t , 2h ); 4 . 43 ( s , 2h ); 5 . 14 ( s , 2h ); 6 . 87 ( sb , 2h ); 7 . 35 - 7 . 46 ( m , 5h ). to a cooled and stirred suspension of protected 2 - amino - 3 - benzoyl - 6 - benzyloxycarbonyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine ( 0 . 01 mol ) in acetic acid ( 2 ml ), as prepared in example 7 , was added a solution of hbr ( 33 %) in acetic acid ( 10 ml ). after stirring at room temperature for 4 h ( tlc control ), n - hexane was added and the resulting suspension was evaporated under vacuum to give a solid which was dissolved in water ( 10 ml ) and neutralized with naoh ( 5 % solution ). the precipitated solid was chromatographed on a silica gel column eluting with ethyl acetate and petroleum ether mixture to give 2 - amino - 3 - benzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine . ( m . p . 160 - 162 ° c ., 92 % yield ). 1 h - nmr ( cdcl 3 ): 1 . 86 ( m , 1 h ); 1 . 95 ( m , 2h ); 2 . 79 ( t , 2h ); 3 . 79 ( s , 2h ). the procedure of example 7 was followed except that a corresponding amount of the 4 - chloro - derivative of benzoyl acetonitrile was used in place of benzoyl acetonitrile to yield 2 - amino - 3 -( 4 - chloro - benzoyl )- 6 - benzyloxycarbonyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine . ( m . p . 60 - 62 ° c ., 88 % yield ). 1 h - nmr ( cdcl 3 ): 1 . 94 ( m , 2h ), 3 . 45 ( t , 2h ); 4 . 44 ( s , 2h ); 5 . 16 ( s , 2h ); 6 . 85 ( sb , 2h ); 7 . 36 - 7 . 45 ( m , 4h ). the procedure of example 8 was followed except that a corresponding amount of 2 - amino - 3 -( 4 - chloro - benzoyl )- 6 - benzyloxycarbonyl - 4 , 5 , 6 , 7 - tetrahydro - thieno [ 2 , 3 - c ] pyridine , prepared as in example 9 , was used in place of 2 - amino - 3 - benzoyl - 6 - benzyloxycarbonyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine . ( m . p . 164 - 166 ° c ., 90 % yield ). 1 h - nmr ( cdcl 3 ): 1 . 74 ( m , 1 h ); 1 . 89 ( m , 2h ); 2 . 84 ( t , 2h ); 3 . 82 ( s , 2h ); 6 . 85 ( sb , 2h ), 7 . 29 - 7 . 48 ( m , 5h ). a mixture of equimolar amounts of 3 - phenylpropylpiperidin - 4 - one ( 0 . 01 mol ) ( prepared by a procedure corresponding to that of example 7 , steps a and b ), 3 - trifluoromethyl benzoyl acetonitrile ( 0 . 01 mol ), sulfur ( 0 . 01 mol ) and morpholine ( 0 . 01 mol ) in ethanol ( 4 ml ) was stirred and heated at 60 ° c . for 1 hour ( tlc control ). after this time , the suspension was allowed to stand overnight and the mixture was poured into water and the precipitated solid was extracted with ethyl acetate ( 3 × 50 ml ). the organic layers were dried on magnesium sulfate and evaporated under vacuum . the crude product was chromatographed on silica gel column using mixtures of ethyl acetate and petroleum ether . ( m . p . 176 - 178 ° c . ; 78 % yield ). 1 h - nmr ( cdcl 3 ): 1 . 88 - 2 . 00 ( m , 4h ); 2 . 45 - 2 . 71 ( m , 6h ); 3 . 44 ( s , 2h ); 6 . 83 ( sb , 2h ); 7 . 17 - 7 . 48 ( m , 9h ). the same procedure as example 11 was used except that a corresponding amount of benzylpiperidin - 4 - one was used in place of 3 - phenylpropylpiperidin - 4 - one and a corresponding amount of 4 - chlorobenzoyl acetonitrile was used in place of 3 - trifluoromethyl benzoyl acetonitrile . ( m . p . 155 - 157 ° c . ; 78 % yield ). the same procedure as example 11 was used except that a corresponding amount of benzylpiperidin - 4 - one was used in place of 3 - phenylpropylpiperidin - 4 - one . ( m . p . 58 - 60 ° c . ; 88 % yield ). 1 h - nmr ( chcl 3 ): 1 . 78 - 1 . 87 ( m , 2h ); 2 . 48 ( t , 2h ); 3 . 42 ( s , 2h ); 3 . 63 ( s , 2h ); 7 . 01 ( sb , 2h ); 7 . 28 - 7 . 74 ( m , 9h ). the same procedure as example 11 was used except that a corresponding amount of phenylethylpiperidin - 4 - one was used in place of 3 - phenylpropylpiperidin - 4 - one and a corresponding amount of 4 - chlorobenzoyl acetonitrile was used in place of 3 - trifluoromethyl benzoyl acetonitrile . ( m . p . 148 - 150 ° c . ; 62 % yield ). the same procedure as example 11 was used except that a corresponding amount of benzylpiperidin - 4 - one was used in place of 3 - phenylpropylpiperidin - 4 - one . ( m . p . 137 - 138 ° c . ; 81 % yield ). 1 h - nmr ( chcl 3 ): 1 . 89 ( m , 2h ); 2 . 54 ( t , 2h ); 2 . 67 - 2 . 87 ( m , 4h ); 3 . 51 ( s , 2h ); 6 . 99 ( sb , 2h ); 7 . 17 - 7 . 33 ( m , 5h ); 7 . 53 - 7 . 74 ( m , 4h ). the same procedure as example 11 was used except that a corresponding amount of 4 - chlorobenzoyl acetonitrile was used in place of 3 - trifluoromethyl benzoyl acetonitrile . ( m . p . 98 - 100 ° c . ; 65 % yield ). 2 - amino - 3 - benzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine ( 2 mmol ), as prepared in example 8 , and methyl iodide ( 3 mmol ) were dissolved in dry dimethyformamide ( 20 ml ). finely ground anhydrous potassium carbonate ( 1 . 9 g ) and sodium iodide ( 0 . 2 g ) were added to the solution and the resulting mixture was warmed to 65 ° c . overnight under nitrogen . after this period ( tlc control ), the reaction mixture was cooled , diluted with water , extracted with diethyl ether ( 3 × 50 ml ), and dried on sodium sulfate . the crude product was isolated and then purified by column chromatography eluting with ethyl acetate and petroleum ether solutions to give the desired compound . ( m . p . 164 - 165 ° c . ; 77 % yield ). the same procedure as example 17 was used except an equivalent amount of 2 - amino - 3 -( 4 - chloro - benzoyl ) 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine was used in place of 2 - amino - 3 - benzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine ( 2 mmol ), and an equivalent amount of ethoxycarbonylmethyl iodide was used in place of methyl iodide ( 3 mmol ). ( m . p . 105 - 106 ° c . ; 70 % yield ). the same procedure as example 17 was used except an equivalent amount of ethoxycarbonylmethyl iodide was used in place of methyl iodide ( 3 mmol ). ( m . p . 115 - 117 ° c . ; 83 % yield ). the same procedure as example 17 was used except an equivalent amount of dimethylallyl iodine was used in place of methyl iodide ( 3 mmol ). ( m . p . 76 - 78 ° c . 90 % yield ). 1 h - nmr ( cdcl 3 ): 1 . 63 ( s , 3h ); 1 . 73 ( s , 3h ); 1 . 94 ( m , 2h )); 2 . 44 ( t , 2h ); 3 . 06 ( d , 2h ); 3 . 42 ( s , 2h ); 5 . 26 ( t , 1 h ); 6 . 80 ( sb , 2h ); 7 . 35 - 7 . 50 ( m , 5h ). the same procedure as example 17 was used except an equivalent amount of 2 - amino - 3 -( 4 - chloro - benzoyl ) 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine was used in place of 2 - amino - 3 - benzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine ( 2 mmol ), and an equivalent amount of p - nitrophenylethyl iodide was used in place of methyl iodide ( 3 mmol ). ( m . p . 150 - 152 ° c . ; 72 % yield ). the same procedure as example 17 was used except an equivelent amount of p - nitrophenylethyl iodide was used in place of methyl iodide ( 3 mmol ). ( m . p . 89 - 91 ° c . ; 70 % yield ). to an ice - cooled and stirred solution of 2 - amino - 3 - benzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine ( 0 . 775 mmol ) in dry dmf ( 11 ml ), was added boc - tyr - oh ( 0 . 08 mmol ) and edci ( 0 . 08 , 0 . 445 g ) under argon atmosphere . after stirring overnight , the mixture was evaporated under vacuum to give a solid residue , which was dissolved in saturated sodium bicarbonate solution and was extracted with ethyl acetate ( 3 × 20 ml ), then dried on magnesium sulfate . the organic layers were evaporated under vacuum to give a solid which was chromatographed on silica gel column eluting with ethyl acetate and petroleum ether solution to afford 2 - amino - 3 - benzoyl - 6 -[ 2 - t - butoxycarbonylamino - 3 -( 4 - hydroxyphenyl )- propion - 1 - yl ]- 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine as a yellow solid . ( m . p . 143 - 145 ° c ., 84 % yield ). the same procedure as example 1 was used except a corresponding amount of cyclohexanone was used in place of methylethyl ketone . ( m . p . 150 - 152 ° c ., 75 % yield ). 1 h - nmr ( cdcl 3 ): 1 . 46 - 1 . 49 ( m , 2h ), 1 . 69 - 1 . 80 ( m , 4h ); 2 . 47 - 2 . 54 ( m , 2h ); 6 . 71 ( sb , 2h ); 7 . 37 - 7 . 50 ( m , 5h ). a suspension of 2 - amino - 3 - thienyl )- phenylmethanone ( 5 mmol ) in formamide ( 7 ml ) was heated at 180 ° c . for 5 hours in an open vessel . the residue was diluted with dimethylformamide ( 5 ml ), treated with charcoal , and filtered over a small pad of celite 503 ( brand of filter aid ). the cyclized compound was precipitated by addition of water ( 30 ml ) to the filtrate and recrystallized from the same solvents . ( m . p . 135 - 137 ° c .). to an ice - cooled and stirred solution of 2 - amino - 3 - thienyl )- phenylmethanone in absolute ethanol ( 20 ml ), ethyl acetoacetate ( 0 . 055 mol ) was added . to the mixture sodium ethylate ( 100 mg ) was added at 0 ° c . and the solution was refluxed for about 10 hours . after completion of the reaction ( tlc control ), the solution was evaporated under vacuum and the residue was taken up with water ( 50 ml ) and the aqueous solution was extracted with ethyl acetate ( 3 × 100 ml ). the combined organic layers were dried and evaporated under vacuum to give a yellow residue which was crystallized from tetrahyrofuran / hexane . ( m . p . 118 - 120 ° c .). the same procedure as example 1 was used except a corresponding amount of cyclopentanone was used in place of methylethyl ketone and an equivalent amount of 4 - bromo - benzoyl acetonitrile was used in place of benzoyl acetonitrile . ( m . p . 205 - 206 ° c ., 87 % yield ). ( cdcl 3 ): 2 . 1 - 2 . 13 ( m , 4h ), 2 . 63 - 2 . 68 ( m , 2h ); 6 . 99 ( sb , 2h ); 7 . 34 ( d , 2h ); 7 . 53 ( d , 2h ). to a well - stirred and ice - cooled solution of 2 - amino - 3 - benzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine ( 0 . 78 mmol , 0 . 2 g ) in dichloromethane ( 20 ml ) under an argon atmosphere , was added triethylamine ( 0 . 162 ml ) and then p - toluenesulfonyl chloride ( 0 . 93 mmol , 177 mg ) portionwise . the suspension was stirred at room temperature for 24 h and the precipitated solid was filtered . the organic solution was evaporated under vacuum to give a solid residue which was chromatographed on silica gel eluting with ethyl ether and petroleum ether mixture to afford 2 - amino - 3 - benzoyl - 6 -( 4 - methylphenylsulphonyl )- 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine . ( m . p . 165 - 167 ° c ., 85 yield ). 1 h - nmr ( cdcl 3 ): 1 . 95 ( m , 2h ); 2 . 43 ( s , 3h ); 3 . 07 ( t , 2h ); 3 . 51 ( s , 2h ); 6 . 76 ( sb , 2h ); 7 . 3 - 7 . 67 ( m , 9h ). the same procedure as example 25 was used except a corresponding amount of 2 - amino - 3 - benzoyl - cyclopenta [ b ] thiophene was used in place of 2 - amino - 3 - thienyl )- phenylmethanone ( 5 mmol ). in turn , 2 - amino - 3 - benzoyl - cyclopenta [ b ] thiophene can be prepared by the procedure of example 1 . to a stirred solution of 2 - amino - 3 -( 4 - chlorobenzoyl )- 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ) ( 1 . 02 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 eq ) and phenylisocyanate ( 1 . 2 eq ) were added . the mixture was stirred at room temperature for 4 hours , then was concentrated at reduced pressure and the residue purified by flash chromatography ( etoac / light petroleum 3 / 7 ) to afford the desired compound as a solid ( mp 216 - 217 ° c .). to a stirred solution of 2 - amino - 3 -( 4 - chlorobenzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ( 0 . 7 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 equiv .) and 3 - methyl - but - 2 - en - yl bromide were added . the solution was stirred at room temperature for 4 hours , then concentrated and the residue purified by crystallization to afford the title compound as a solid ( mp 118 - 120 ° c 1 h nmr ( cdcl 3 ) 1 . 63 ( s , 3h ); 1 . 73 ( s , 3h ); 1 . 94 ( m , 2h ); 2 . 45 ( m , 2h ); 3 . 06 ( d , 2h , j = 7 ); 3 . 41 ( s , 2h ); 5 . 26 ( m , 1h ); 6 . 77 ( bs , 2h ); 7 . 39 ( d , 2h , j = 6 . 4 ); 7 . 42 ( d , 2h , j = 6 . 4 ) to a stirred solution of 2 - amino - 3 -( 4 - chlorobenzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ( 0 . 7 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 equiv .) and prop - 2 - en - yl bromide ( 1 . 2 eq .) were added . the solution was stirred at room temperature for 4 hours , then concentrated and the residue purified by crystallization to afford the title compound as a solid ( mp 118 - 120 ° c .). 1 h nmr ( cdcl 3 ) 1 . 96 ( m , 2h ); 2 . 47 ( m , 2h ); 3 . 12 ( d , 2h , j = 6 ); 3 . 42 ( s , 2 . h ); 5 . 14 - 5 . 24 ( m , 2h ); 5 . 82 - 5 . 95 ( m , 1h ); 6 . 82 ( bs , 2h ); 7 . 35 ( d , 2h , j = 8 ); 7 . 43 ( d , 2h , j = 8 ) to a stirred solution of 2 - amino - 3 -( 4 - iodobenzoyl )- 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ) ( 1 . 02 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 eq ) and phenylisocyanate ( 1 . 2 eq ) were added . the mixture was stirred at room temperature for 4 hours , then was concentrated at reduced pressure and the residue purified by flash chromatography ( etoac / light petroleum 3 / 7 ) to afford the desired compound as a solid ( mp 89 - 90 ° c .). to a stirred solution of 2 - amino - 3 -( 4 - bromobenzoyl )- 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ) ( 1 . 02 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 eq ) and phenylisocyanate ( 1 . 2 eq ) were added . the mixture was stirred at room temperature for 4 hours , then was concentrated at reduced pressure and the residue puri fied by flash chromatography ( etoac / light petroleum 3 / 7 ) to afford the desired compound as a solid ( mp 89 - 90 ° c .). using , the procedures in examples 7 and 8 , substituting p - bromobenzoyl acetonitrile for benzoyl acetonitrile , the title compound was prepared as a solid ( mp 185 - 187 ° c .). to a stirred solution of 2 - amino - 3 -( 4 - bromobenzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ( 0 . 7 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 equiv .) and 3 - methyl - but - 2 - en - yl bromide ( 1 . 2 eq .) were added . the solution was stirred at room temperature for 4 hours , then concentrated and the residue purified by crystallization to afford the title compound as a solid ( mp 73 - 75 ° c . 1 h nmr ( cdcl 3 ) 1 . 64 ( s , 3h ); 1 . 74 ( s , 3h ); 1 . 95 ( m , 2h ); 2 . 47 ( m , 2h ); 5 . 07 ( d , 2h , j = 7 ); 3 . 41 ( s , 2h ); 5 . 27 ( m , 1h ); 6 . 91 ( bs , 2h ); 7 . 34 ( d , 2h , j = 8 . 4 ); 7 . 52 ( d , 2h , j = 8 . 4 ) to a stirred solution of 2 - amino - 3 -( 4 - bromobenzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ( 0 . 7 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 equiv .) and prop - 2 - en - yl bromide ( 1 . 2 eq .) were added . the solution was stirred at room temperature for 4 hours , then concentrated and the residue purified by crystallization to afford the title compound as a solid ( mp 116 - 118 ° c . 1 h nmr ( cdcl 3 ) 1 . 96 ( m , 2h ); 2 . 47 ( m , 2h ); 3 . 12 ( d , 2h , j = 6 . 6 ); 3 . 42 ( s , 2h ); 5 . 15 - 5 . 25 ( m , 2h ); 5 . 80 - 6 . 00 ( m , 1h ); 6 . 81 ( bs , 2h ); 7 . 36 ( d , 2h , j = 8 . 2 ); 7 . 53 ( d , 2h , j = 8 . 2 ) using the procedures in examples 7 and 8 , substituting p - iodobenzoyl acetonitrilc for benzoyl acetonitrile , the title compound was prepared as a solid mp 230 - 231 ° c . to a stirred solution of 2 - amino - 3 -( 4 - iodobenzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ( 0 . 7 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 equiv .) and 3 - methyl - but - 2 - en - yl bromide ( 1 . 2 eq .) were added . the solution was stirred at room temperature for 4 hours , then concentrated and the residue purified by crystallization to afford the title compound as a solid ( mp 148 - 150 ° c .). 2 - amino - 3 -( 4 - phenylbenzoyl )- 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine was reacted with benzyloxycarbonyl chloride and triethylamine to afford the title compound as a solid ( mp 83 - 85 ° c .). 1 h nmr ( cdcl 3 ) 2 . 05 ( m , 2h ); 3 . 45 ( m , 2h ); 4 . 46 ( s , 2h ); 5 . 15 ( s , 2h ); 6 . 72 ( bs , 2h ) 7 . 35 - 7 . 66 ( m , 14h ) to a stirred solution of 2 - amino - 3 -( 4 - phenylbenzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ( 0 . 7 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 equiv .) and prop - 2 - en - yl bromide ( 2 . 4 eq .) were added . the solution was stirred at room temperature for 4 hours , then concentrated and the residue purified by crystallization to afford the title compound as a solid ( mp 183 - 185 ° c .). 1 h nmr ( cdcl 3 ) 1 . 82 ( s , 6h ); 1 . 85 ( s , 6h ); 2 . 30 ( m , 2h ); 3 . 70 ( m , 2h ); 4 . 07 ( m , 4h ); 4 . 75 ( s , 2h ); 5 . 26 ( m , 2h ); 7 . 40 - 8 . 50 ( m , 11h ). using the procedures in examples 7 and 8 , substituting p - fluorobenzoyl acetonitrile for benzoyl acetonitrile , 2 - amino - 3 -( 4 - fluorobenzoyl )- 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine was prepared . this compound was reacted with benzyloxycarbonyl chloride to yield the title compound as a solid ( mp 90 - 92 ° c ). 1 h nmr ( cdcl 3 ) 1 . 96 ( m , 2h ); 3 . 45 ( m , 2h ); 4 . 45 ( s , 2h ); 5 . 15 ( s , 2h ); 6 . 71 ( bs , 2h ); 7 . 05 - 7 . 52 ( m , 9h ). using the procedures in examples 7 and 8 , substituting p - phenylbenzoyl acetonitrile for benzoyl acetonitrile , the title compound was prepared as a solid ( mp 185 - 187 ° c .). 1 h nmr ( cdcl 3 ) 1 . 75 ( m , 2h ); 2 . 40 ( bs , 1h ); 2 . 6 ( m , 2h ); 3 . 59 ( s , 2h ); 7 . 44 - 7 . 776 ( m , 9h ); 8 . 16 ( bs , 2h ). to a stirred solution of 2 - amino - 3 -( 4 - phenylbenzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno ( 2 , 3 - c ) pyridine ( 0 . 7 mmol ) in dry ch 2 cl 2 ( 20 ml ), et 3 n ( 1 . 2 equiv .) and prop - 2 - en - yl bromide ( 2 . 4 eq .) were added . the solution was stirred at room temperature for 4 hours , then concentrated and the residue purified by crystallization to afford the title compound as a solid ( mp 149 - 151 ° c .). the title compound was prepared by reacting 2 - amino - 3 - benzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine , as prepared in example 8 , with the carbanion of malonodinitrile to yield a solid ( mp 152 - 154 ° c .). the title compound was prepared by reacting 2 - amino - 3 - benzoyl - 4 , 5 , 6 , 7 - tetrahydrothieno [ 2 , 3 - c ] pyridine , as prepared in example 8 , with the carbanion of ethylcyanoacetate to yield a solid ( mp 206 ° c .). the silicone fluid and active compound are mixed together and the colloidal silicone dioxide is added to increase viscosity . the material is then dosed into a subsequent heat sealed polymeric laminate including the following : polyester release liner , skin contact adhesive composed of silicone or acrylic polymers , a control membrane which is a polyolefin , and an impermeable backing membrane made of a polyester multilaminate . the resulting laminated sheet is then cut into 10 sq . cm patches the active compound and the starch are granulated with water and dried . magnesium stearate is added to the dried granules and the mixture is thoroughly blended . the blended mixture is compressed into tablets . the active compound and buffering agents are dissolved in the propylene glycol at about 50 ° c . the water for injection is then added with stinring and the resulting solution is filtered , filled into ampules , sealed and sterilized by autoclaving . the compounds described in examples 1 - 29 above were assayed for their allosteric enhancing ability at the adenosine a , receptor . these are listed as t1 through t29 below . compounds t1 through t29 were provided by medco research , inc . the adenosine a 1 receptor agonist n 6 cyclopentyladenosine ( cpa ) and the adenylyl cyclase activator forskolin were purchased from research biochemicals , inc . rolipram was a gift from berlex labs . adenosine deaminase was purchased from sigma chemical . ham &# 39 ; s f - 12 culture medium and fetal bovine serum were purchased from gibco life technologies . cell culture plasticware and antibiotic g - 418 were from fisher scientific . the preparation chosen for the assay of the compounds was the chinese hamster ovary ( cho ) cell expressing human recombinant adenosine a 1 receptors at a density of around 8000 fmol / mg protein . these cells were cultured using known techniques ( shryock et al ., mol . pharmacol ., 1998 , 53 : 886 - 893 , the contents of which are hereby incorporated by reference ). the effect of each compounds on camp content of cultured cho cells was determined in the presence of forskolin ( 1 - 1 . 5 μm ), rolipram ( 20 μm ), the adenosine receptor agonist cpa ( 0 . 05 - 0 . 1 μm ) and adenosine deaminase ( 2 u / ml ). forskoline was used to increase the activity of adenylyl cyclase and the content of camp in cells , and rolipram was used to inhibit the activity of camp phosphodiesterases that degrade camp . adenosine deaminase was used to degrade endogeneous adenosinein the incubation medium . to begin an experiment , cho cells grown in individual wells of 12 - well culture plates were washed once with hank &# 39 ; s buffered saline solution to remove growth medium . the hank &# 39 ; s solution was itself then removed and replaced with fresh hank &# 39 ; s solution at 36 ° c . containing forskolin , rolipram , cpa , adenosine deaminase , and the compound to be assayed . after an incubation of six minute duration , this solution was removed and replaced with 50 mm hydrochloric acid to terminate the effect of the drug , lyse the cells , and prevent further enzymatic formation and metabolism of camp . the cam content of acid extracts of cells was determined by radioimmunoassay as previously described ( shryock et al ., mol . pharmacol ., 1998 , 53 : 886 - 893 ). in each experiment , 4 - 5 compounds were tested in parallel , at each of four concentrations , 0 . 01 , 0 . 1 , 1 and 10 μm . as a control , the effect of cpa ( 0 . 1 - 10 nm ) was determined in each experiment . protein content of cell samples was measured by the method of bradford using a kit form bio - rad with albumin as a reference standard . the compounds acted to both enhance and antagonize the effect of the adenosine a 1 receptor agonist , cpa , on cho cells expressing adenosine a 1 receptors . the effects of all twenty nine compounds are shown in fig5 - 10 ( bar graphs ) and fig1 - 16 ( concentration response plots ). compounds t3 , t5 , t7 , t9 , t13 , t19 and t21 decreased camp content in the presence of a low concentration of cpa ( 0 . 05 - 0 . 1 nm ). these compounds are thus indicated by the cho cell assay to be allosteric enhancers of the action of an adenosine a 1 receptor agonist . compounds t5 , t7 , t9 , and t13 appear to be the best enhancers . compound t7 had the highest potency and efficacy ( maximal effect ). several compounds ( i . e ., t11 , t12 , t23 , t24 , and t27 ) acted as antagonists of the action of cpa . two compounds ( t6 and t15 ) at a low concentration enhanced the action of cpa , but at a higher concentration antagonized the action of cpa . those skilled in the art will recognize , or be able to ascertain using no more than routine experimentation , many equivalents to the specific embodiments of the invention described herein . such equivalents are intended to be encompassed by the following claims . | 2 |
the present invention is a class of resins which are useful for crosslinking and adhesion promotion in coating and adhesive applications . the resins comprise one or more polymers which have members represented by the structural formula ( i ): ## str2 ## wherein r 1 is aryl , c 1 - c 20 alkyl , c 1 - c 8 alkoxy , acetate , halide , or ester ; r 2 is a c 1 - c 6 alkyl group ; x is from 1 to 6 ; m is from 0 . 05 to 0 . 95 ; n is from 0 . 00 to 0 . 25 ; and 0 is from 0 . 10 to 0 . 80 . these polymers can be prepared by addition of aminoacetals to a polymer containing anhydride functionality . the degree of amination of the polymers is controlled by the amount of anhydride present in the polymer . the carboxylic acid moiety formed as a result of the amination of the anhydride provides a convenient handle for solubilizing the polymer in aqueous systems by titrating the polymer with a base such as sodium hydroxide , ammonia , or an amine . for example , the addition of an amine represented by the formula ( r 3 ) 2 nh wherein each r 3 is independently h or c 1 - c 6 alkyl or hydroxyalkyl , to the polymer of formula i above affords the corresponding ammonium salt in quantitative yield . the resulting polymers can be represented by the following structural formula ( ii ): ## str3 ## maleic anhydride compolymers which have been completely animated with the aminoacetal ( n = 0 . 00 ) can be titrated with either tertiary amines or alkali bases . the tertiary amines used for titration can be represented by the structural formula ( r 3 ) 3 n wherein each r 3 is independently c 1 - c 6 alkyl or hydroxyakyl . the resultant polymer can be represented by the following structural formula ( iii ): ## str4 ## alkali bases used for titration are those represented by the chemical formula m + oh - wherein m + is selected from the group consisting of li + , na + and k + . the polymers which result from titration with these alkali bases can be represented by the structural formula ( iv ): ## str5 ## resins comprising these polymers provide for formaldehyde - free crosslinking systems . additionally , resins comprising polymers represented by structural formulas ii , iii and iv are compatible with water - based coating systems and can be incorporated into the aqueous phase of an emulsion coating system . such aqueous solutions have been found to be relatively stable ; i . e ., 4 to 5 weeks , at room temperature without undergoing uncontrolled , self - crosslinking reactions . the following examples illustrate this invention and are not intended to limit its scope . a 30 . 00 g portion of a styrene / maleic anhydride copolymer ( 1 : 1 molar ratio of styrene to maleic anhydride ; mw = 5 , 600 , mn = 1 , 800 ; 0 . 153 mol of anhydride functionality ) was dissolved in 300 g of tetrahydrofuran contained in a 500 ml round - bottomed flask . with magnetic stirring , 20 . 37 g ( 0 . 153 mol ) of 4 , 4 - dimethoxybutylamine was added over 30 min . the solution was then heated to reflux for 5 hr . after which time , the solvent was removed via evaporation under reduced pressure and the residual yellowish - white product was dried in vacuo ( 30 * c , 0 . 02 mm hg ) overnight . infrared spectroscopy of the polymer ( kbr pellet ) revealed no anhydride functionality in the polymer , but the spectrum possessed a band at 1715 cm - 1 ( carboxylic acid stretch ) and at 1640 cm - 1 ( amide stretch ). the isolated polymer had a mass of 48 . 40 g and had the composition listed in table 1 . the procedure described in example 1 was repeated with styrene / maleic anhydride copolymers of differing composition and molecular weight and with differing amounts of 4 , 4 - dimethoxybutylamine addition . infrared spectroscopy of the polymers prepared revealed bands at 1780 cm - 1 ( anhydride stretch ), at 1715 cm - 1 ( carboxylic acid stretch ) and at 1640 cm - 1 ( amide stretch ) in intensities relative to the respective polymer composition . the properties of the polymers produced by these procedures are listed in table 1 . table 1__________________________________________________________________________oligomers prepared from amination of styrene / maleic anhydridecopolymers with 4 , 4 - dimethoxybutylamine . starting g of oligomer g ( mol ) styrene / malic ( mol of of 4 , 4 - exampleanhydride anhydride dimethoxy isolated compositionno . oligomer functionality ) butyl amine mass ( g ) m n o__________________________________________________________________________1 a 30 . 00 20 . 37 48 . 40 0 . 50 0 . 00 0 . 50 ( 0 . 153 ) ( 0 . 153 ) 2 a 30 . 00 10 . 19 39 . 85 0 . 50 0 . 25 0 . 25 ( 0 . 153 ) ( 0 . 0765 ) 3 a 30 . 00 5 . 10 36 . 57 0 . 50 0 . 37 0 . 13 ( 0 . 153 ) ( 0 . 0383 ) 4 a 30 . 00 2 . 04 31 . 01 0 . 50 0 . 45 0 . 05 ( 0 . 153 ) ( 0 . 0153 ) 5 b 30 . 00 13 . 58 42 . 21 0 . 67 0 . 00 0 . 33 ( 0 . 102 ) ( 0 . 102 ) 6 b 30 . 00 6 . 79 36 . 34 0 . 66 0 . 17 0 . 17 ( 0 . 102 ) ( 0 . 0510 ) 7 b 30 . 00 3 . 40 32 . 73 0 . 67 0 . 25 0 . 08 ( 0 . 102 ) ( 0 . 0255 ) 8 b 30 . 00 1 . 36 30 . 00 0 . 67 0 . 30 0 . 03 ( 0 . 102 ) ( 0 . 0102 ) 9 c 30 . 00 10 . 19 39 . 97 0 . 75 0 . 00 0 . 25 ( 0 . 0765 ) ( 0 . 0765 ) 10 c 30 . 00 5 . 09 37 . 21 0 . 75 0 . 12 0 . 12 ( 0 . 0765 ) ( 0 . 0382 ) 11 c 30 . 00 2 . 54 31 . 21 0 . 75 0 . 19 0 . 06 ( 0 . 0765 ) ( 0 . 0191 ) 12 c 30 . 00 1 . 02 31 . 68 0 . 75 0 . 23 0 . 02 ( 0 . 0765 ) ( 0 . 0077 ) __________________________________________________________________________ starting oligomers wer obtained from atochem , inc . : ( a ) sma1000 1 : 1 styrene / maleic anhydride molar ratio ; mw = 5 , 600 ; mn = 1 , 600 ; tg = 138 ° c . ( b ) sma2000 2 : 1 styrene / maleic anhydride molar ratio ; mw = 7 , 700 ; mn = 1 , 700 ; tg = 124 ° c . ( c ) sma3000 3 : 1 styrene / maleic anhydride molar ratio ; mw = 10 , 300 ; mn = 1 , 900 ; tg = 124 ° c . a 50 . 00 g portion of a methyl vinyl ether / maleic anhydride copolymer ( 1 : 1 molar ratio of methyl vinyl ether to maleic anhydride ; gantrez an - 119 ; mw = 20 , 000 ; 0 . 3202 mol of anhydride functionality ) was laminated with 42 . 65 g ( 0 . 3202 mol ) of 4 , 4 - dimethoxybutylamine in 1400 ml of thf according to the procedure described in example 1 . infrared spectroscopy of the polymer ( kbr pellet ) revealed no anhydride functionality in the polymer , but the spectrum possessed a band at 1730 cm - 1 ( carboxylic acid stretch ) and at 1650 cm - 1 ( amide stretch ). the isolated polymer had a mass of 96 . 06 g . a 20 . 00 g portion of a vinyl acetate / maleic anhydride copolymer ( 0 . 9115 : 0 . 0885 molar ratio of vinyl acetate to maleic anhydride ; dajac9184 ; 0 . 0204 mol of anhydride functionality ) was aminated with 2 . 717 g ( 0 . 0204 mol ) of 4 , 4 - dimethoxybutylamine in 45 ml of thf according to the procedure described in example 1 . infrared spectroscopy of the polymer ( kbr pellet ) revealed no anhydride functionality in the polymer , but the spectrum possessed a band at 1740 cm - 1 ( carboxylic acid stretch ) and at 1650 cm - 1 ( amide stretch ). the isolated polymer had a mass of 15 . 37 g . a 25 . 00 g portion of a 1 - octadecene / maleic anhydride copolymer ( 1 : 1 molar ratio of 1 - octadecene to maleic anhydride ; chevron pa - 18 ; mw = 35 , 000 ; 0 . 0713 mol of anhydride functionality ) was aminated with 9 . 50 g ( 0 . 0713 mol ) of 4 , 4 - dimethoxybutylamine in 500 ml of thf according to the procedure described in example 1 . infrared spectroscopy of the polymer ( kbr pellet ) revealed no anhydride functionality in the polymer , but the spectra possessed a band at 1720 cm - 1 ( carboxylic acid stretch ) and at 1640 cm - 1 ( amide stretch ). the isolated polymer had a mass of 34 . 57 g . an aqueous suspension of the oligomer prepared in example 1 was completely titrated with 28 % aqueous ammonium hydroxide - to provide an aqueous solution ( 30 , solids ) of the oligomer with 1 . 00 equivalent of the carboxylic acid groups converted to their ammonium salts . this aqueous oligomer solution was then combined with aqueous pentaerythritol and para - toluenesulfonic acid monohydrate ( p - tsa ) according to the amounts presented in table 2 . table 2__________________________________________________________________________composition of aqueous solutions of oligomer , pentaerythritol , and para - toluenesulfonic acid . exampleg of aqueous mmol of acetal g of 10 % aqueous mmol of hydroxyl g of p - no . oligomer sol &# 39 ; n functionality pentaerythritol functionality tsa__________________________________________________________________________16 10 . 0 8 . 76 10 . 0 7 . 34 -- 17 10 . 0 8 . 76 10 . 0 7 . 34 0 . 1018 10 . 0 8 . 76 10 . 0 7 . 34 -- 19 8 . 67 7 . 59 8 . 67 6 . 37 0 . 10__________________________________________________________________________ the aqueous solutions of examples 16 and 17 were maintained at room temperature while the aqueous solutions of examples 18 and 19 were maintained at 75 ° c . overnight . after which time , examples 16 and 17 maintained their clear , colorless appearance while examples 18 and 19 were yellowish solutions with the presence of minor amounts of precipitate . the solutions of examples 16 and 17 were then cast as thin films on mylar sheets and permitted to air dry overnight . portions of each film were then heated to 100 ° c . in an air convection oven overnight . after which , the films were then placed in water ( 0 . 25 g of film in 10 g of water ) , agitated , and the properties recorded as noted in table 3 . table 3______________________________________properties of untreated and treated films . film pre - film heatexample pared from treated to film properties afterno . example no . 100 ° c . re - exposure to water______________________________________20 16 no dissolved rapidly in water ; afforded a clear colorless solution . 21 16 yes very minor solubility in water ; yellowish , brittle film . 22 17 no dissolved rapidly in water ; afforded a clear colorless solution . 23 17 yes no solubility in water ; yellowish , brittle film ; no evidence of swelling . ______________________________________ examples 16 - 23 illustrate that aqueous solutions of the acetal containing oligomers can be prepared by base titration of the carboxylic acid moiety , and that these aqueous solutions are relatively stable at room temperature . at higher temperatures , these solutions begin to undergo acetal exchange reactions in solution . the thermal treatment of films of these oligomers and pentaerythritol , with or without the presence of additional acid , also affords acetal exchange reactions . this is reflected in the formation of crosslinks in the oligomer and the lack of water solubility . an aqueous suspension of the oligomer prepared in example 1 was partially titrated with 28 % aqueous ammonium hydroxide to provide an aqueous solution ( 30 % solids ) of the oligomer with 0 . 50 equivalent of the carboxylic acid groups converted to their ammonium salts . a 3 . 27 g portion of the aqueous oligomer solution ( 2 . 80 mmol of acetal functionality ) was added to an aqueous solution of 2 . 00 g ( 45 . 40 mmol of hydroxyl functionality ) of polyvinyl alcohol ( airvol 325 , 98 - 98 . 8 % hydrolyzed , mw 85 , 000 - 146 , 000 ) in 18 . 00 g of water then mixed thoroughly . the resultant aqueous solution was cast as a thin film on a mylar sheet and allowed to air dry at room temperature overnight . the film was found to be clear and flexible and readily ( 20 min ) redissolved in water with minor agitation . a portion of the film was heated in an air oven at 90 ° c . for 3 hrs . after which time , the heat treated film was found to be clear and brittle . after placing in water ( 100 mg of heat treated film in 10 g of water ) and agitating overnight , the heat treated film swelled but did not dissolve . this example illustrates the utility of these acetal containing oligomers as crosslinking agents for water - based systems . the control formulation was an elevated temperature cure amino crosslinking system containing cargill water reducible oil - free polyester 72 - 7289 buffered with dimethylethanolamine . cymel 303 from american cyanamid was the hexamethoxymethylmelamine crosslinker . this gloss white baking enamel is usually formulated with ˜ 40 % titanium dioxide pigment , but was made pigment - free for these application studies . to prepare a nominal 80 / 20 resin / melamine curative coating , 10 . 67 g cargill 72 - 7289 resin , containing 8 . 00 9 of resin solids , was well mixed with 0 . 54 g dimethylethanolamine , 6 . 79 g of deionized distilled water and 2 . 0 g cymel 303 . for effective wetting , leveling and flow control ˜ 50 mg of 3m &# 39 ; s fc - 430 fluorad fluoroaliphatic polymeric ester was added and well mixed . the coating formulation was spread onto a 4 &# 34 ;× 12 &# 34 ; 22 gauge unpolished cold - rolled steel test panel which had been wiped down with 1 / 1 methyl ethyl ketone / toluene to remove the last traces of oils . a bird type film applicator with nickel - chrome finish was used to generate a 3 &# 34 ; wide by 0 . 0015 &# 34 ; thick wet film . for a final film of ˜ 1 mil , a 3 mil drawdown bar was used for this 500 % solids in water mixture . the plate was allowed to stand 10 minutes in a fume hood , then placed in a vented , forced air convection oven at 350 ° f . for 10 minutes . film hardness by pencil test was done following astm d 3363 - 74 . adhesion by tape test was measured according to astm d 3359 - 87 , method b , with 1 mm grid spacing . reverse impact data expressed in inch - pounds were generated using method astm d 2794 - 84 . the indenter steel punch hemispheric head was 5 / 8 inch . coating 1 prepared from mixing 10 . 67 g cargill 72 - 7289 polyester resin with 0 . 54 g dimethylethanolamine , 6 . 79 g deionized distilled water and 2 . 00 g cymel 303 hexamethoxymethylmelamine was tested as noted above ; tabulated data summarize critical parameters : __________________________________________________________________________coat - resin melamine curative solids 10 min . thickness pencil scratch reverseing % % % % cure (° f .). ( mil ) hardness adhesion impact__________________________________________________________________________1 80 . 0 20 . 0 0 50 . 0 350 0 . 95 4h 5 130__________________________________________________________________________ an aqueous suspension of the oligomer prepared in example 1 was titrated completely with triethylamine to provide an aqueous solution ( 39 % solids ) of the oligomer with 1 . 00 equivalent of the carboxylic acid groups converted to their triethylammonium salts . this was used to replace hexamethoxymethylmelamine on a 1 : 1 dry weight solids basis . a test resin formulation was made with a quarter of the melamine withdrawn and replaced by the styrene maleamide curative ; the components were 10 . 67 g cargill 72 - 7289 polyester resin with 0 . 54 g dimethylethanolamine , 6 . 01 g deionized distilled water , 6 . 40 g of the 30 % styrene maleamide oligomer in water and 1 . 50 g cymel 303 hexamethoxymethylmelamine ( coating 2 ). also made was a coating with 50 % of the melamine withdrawn and replaced by an equal weight of dialkyl acetal amide oligomer ( coating 3 ). __________________________________________________________________________coat - resin melamine curative solids 10 min . thickness pencil scratch reverseing % % % % cure (° f .). ( mil ) hardness adhesion impact__________________________________________________________________________2 80 . 0 15 . 0 5 . 0 50 . 0 350 0 . 90 2h 5 1603 80 . 0 10 . 0 10 . 0 50 . 0 350 0 . 85 2h 5 150__________________________________________________________________________ in another series of tests , an aqueous suspension of the oligomer prepared in example 1 was titrated completely with aqueous ammonia to provide an aqueous solution ( 30 % solids ) of the oligomer with 1 . 00 equivalent of the carboxylic acid groups converted to their ammonium salts . again a control resin formulation was made , approximately duplicating the mix ratios of coating 1 , then a total replacement of melamine crosslinker was attempted in coating 5 . __________________________________________________________________________coat - resin melamine curative solids 10 min . thickness pencil scratch reverseing % % % % cure (° f .). ( mil ) hardness adhesion impact__________________________________________________________________________4 80 . 0 20 . 0 0 50 . 0 350 1 . 25 3h 5 1705 80 . 0 0 20 . 0 50 . 0 350 1 . 25 2h 4 240__________________________________________________________________________ replacement of hexafunctional melamine with polyfunctional formaldehydefree oligomer led to increased reverse impact strength with only slightly lower hardness and reduced scratch adhesion . this total replacement of formaldehyde - generating crosslinker with formaldehyde - free oligomer which is also multifunctional generated , overall , unexpectedly equivalent coating physical properties . the ability of the styrene maleic anhydride oligomer reacted with aminobutryaldehyde dimethyl acetal and neutralized with ammonia to self crosslink was demonstrated by simply drawing down , using ˜ 50 mg fc - 430 for 4 . 0 g of 30 % solution , then thermally curing the oligomer ( coating 6 ). the low reverse impact resistance is indicative of a high degree of brittleness , consistent with overly efficient crosslinking . __________________________________________________________________________coat - resin melamine curative solids 10 min . thickness pencil scratch reverseing % % % % cure (° f .). ( mil ) hardness adhesion impact__________________________________________________________________________6 0 0 100 30 . 0 350 0 . 90 3h 3 & lt ; 1__________________________________________________________________________ addition products of aminobutyraldehyde dimethyl acetal ( abaa ) to styrene / maleic anhydride ( sma ) copolymers dissolved in tetrahydrofuran could be obtained as stable solids by evaporation of the reaction solvent . the acid amide product could then be redissolved in methoxy propanol acetate at ˜ 50 % solids for formulation with polyester polyol resin to test crosslinkability . in one experiment an sma / abaa adduct from addition of abaa equivalent to the maleic anhydride content in a 75 / 25 styrene / maleic anhydride resin was mixed in various proportions with aroplaz 6755 - a6 - 80 polyester provided by reichhold chemicals , inc . aroplaz 6755 - a6 - 80 resin is mixed with 13 % by weight methoxy propanol acetate ( arcosolv pm acetate , cas # 108 - 65 - 6 ) and 7 % by weight toluene ( cas # 108 - 88 - 3 ). dilution with pm acetate solvent allowed film formation starting at the same solids level for all formulations . no external acid catalyst was added as the coatings were flash evaporated in a hood after drawdown , then cured for 20 minutes at 350 ° f . __________________________________________________________________________ resin sma / abaa solids thickness pencil scratch mek doubleentry wt % wt % (%) ( mils ) hardness adhesion rubs__________________________________________________________________________ 7 0 100 33 . 3 . 80 h 4 & gt ; 200 8 10 90 35 . 1 . 90 h 5 & gt ; 200 9 20 80 35 . 1 . 85 h 5 19010 30 70 35 . 0 . 85 h 5 13011 40 60 35 . 2 . 80 h 4 5012 50 50 35 . 0 . 85 h 3 3013 60 40 35 . 1 . 85 h 2 1514 70 30 35 . 0 . 85 f 3 10__________________________________________________________________________ the greatest crosslink density , as measured by methyl ethyl ketone ( mek ) double rubs , is from self - crosslinking of the sma / abaa oligomer , crosslinking induced solely by the oligomer &# 39 ; s carboxylic acid group catalytic effect , for no external acid such as paro - toluenesulfonic acid was added . upon dilution with resin the scratch adhesion improves , so that a balance of property optimization appears to lie between entries 8 and 10 . with more complete dilution by resin the physical property benefits of carboxylic acid - induced crosslinking are reduced due to limited crosslinking sites in the sma resin which initially contained only 25 % maleic anhydride . having thus described the present invention , what is now deemed appropriate for letters patent is set out in the following appended claims . | 2 |
while the present invention is susceptible to various modifications and alternative forms , certain embodiments are shown by way of example in the drawings and these embodiments will be described in detail herein . it will be understood , however , that this disclosure is not intended to limit the invention to the particular forms described , but to the contrary , the invention is intended to cover all modifications , alternatives , and equivalents falling within the spirit and scope of the invention defined by the appended claims . fig1 illustrates a perspective view of a microphone assembly generally indicated by the numeral 100 . the microphone assembly 100 includes a housing 102 having a cover 104 and a cup or base 106 . the housing 102 can be manufactured in a variety of configurations such as , a roughly square shape , a cylindrical shape , a rectangular shape or any other desired geometry . in addition , the scale and size of the housing 102 may be varied based on the intended application , operating conditions , required components , etc . moreover , the housing 102 can be manufactured from a variety of materials such as , for example , stainless steel , alternating layers of conductive materials , alternating layers of non - conductive materials ( e . g ., metal particle - coated plastics ). the microphone assembly 100 further includes a mounting frame 108 sized to engage a top edge 110 of the base 106 . the mounting frame 108 supports a printed circuit board ( pcb ) 112 . the mounting frame 108 may be a single layer of stainless steel , as shown , or may utilize alternating layers of conductive and / or non - conductive materials such as metal particle - coated plastics . further , the mounting frame 108 may have various shapes and a number of different of sizes corresponding to the overall shape of the housing 102 . the pcb 112 extends though an opening 114 formed in a bottom edge 116 of the cover 104 . an exposed portion 118 of the pcb 112 supports a plurality of contact points or electrical connection terminals 120 . the electrical connection terminals 120 provide an electrical connection to a preamplifier circuit assembly 122 shown in fig2 . fig2 illustrates an exploded view of the microphone assembly 100 . the base 106 may include a plurality of supporting members 106 a - 106 b to serve as a support for the diaphragm assembly 124 . it will be understood that a variety of supporting structures such as a u - shaped plate , two deformed corners , or a glue fillet , may be utilized to support the diaphragm assembly 124 . the base 106 further includes a sound inlet port 126 positioned distal to the top edge 110 . a sound inlet tube 128 that includes a mounting plate 130 and a sound passage 132 can be positioned adjacent to the sound inlet port 126 to direct the received acoustic waves into the base 106 . the mounting plate 130 secures the sound inlet tube 128 to the base 106 . the mounting plate 130 can be fixedly attached using , for example , a glue or epoxy , or removably attached using any known fastener . the sound passage 132 provides an acoustic path to the sound inlet port 126 . the sound passage 132 can be formed through the sound inlet tube 128 in any suitable manner such as drilling , punching or molding . a damping element or filter 135 ( see fig4 ) positioned within the sound passage 132 provides an acoustical resistance to the microphone assembly 100 . in operation , sonic energy or acoustic waves enter the microphone assembly 100 via the sound passage 132 . thereafter , the sonic energy or acoustic waves communicates to the sound inlet port 126 . the sound inlet tube 128 , as discussed above in connection with the housing 102 , can be manufactured from a variety of materials such as , for example , stainless steel , alternating layers of conductive materials , alternating layers of non - conductive materials ( e . g ., metal particle - coated plastics ). the microphone assembly 100 further includes a diaphragm assembly 124 , and a backplate assembly 134 . the shape of the diaphragm assembly 124 generally corresponds to the base 106 and mounting frame 108 , but may take the form of the various shapes and sizes in different embodiments . the diaphragm assembly 124 includes a support plate 136 and a diaphragm 138 fixedly attached to the support plate 136 . the diaphragm assembly 124 positioned within the base 106 and supported by the support members 106 a , 106 b . the support plate 136 can consist of any electrically conductive material such as stainless steel , however , any material that includes a conductive coating may be utilized . the diaphragm 138 comprises an electrically conductive material or a thin polymer film peripherally attached to the bottom surface of the support plate 136 . the backplate assembly 134 may include a connecting wire 142 fixedly attached to a backplate 140 . in particular , the connecting wire 142 attaches to a top surface the backplate 140 by , for example , bonding with adhesive . the connecting wire 142 , in turn , extends through an opening 144 of the mounting frame 108 to electrically couple an input point 146 of the preamplifier assembly 122 . in other words , the backplate assembly 134 and diaphragm assembly 124 are communicatively coupled to the preamplifier assembly 122 via the connecting wire 142 through the opening 144 to transmit and provide acoustic signals thereto . the bottom surface of the backplate 140 can be plated with any polarized dielectric film or electret material such as , for example , teflon ®. the plated backplate 140 forms a fixed electrode and is mounted by adhesive fillets ( not shown ) to the support plate 136 of the diaphragm assembly 124 and , in turn , to peripheral portions of the diaphragm 138 . the dielectric film or electret material on the bottom surface of the backplate 140 cooperates with the diaphragm 138 to develop an acoustic signal . the resulting combination of the backplate assembly 134 and the diaphragm assembly 124 define an electret microphone portion . it will be understood that the operation of the microphone assembly 100 is generally based on the fixed electrode of the backplate assembly 140 and the movement of the diaphragm 138 in response to exposure to acoustic waves or sonic energy to generate a representative electrical signal . the preamplifier assembly 122 may include a preamplifier such as , for example , a source - follower field effect transistor ( fet ) 150 integrated circuit . the preamplifier assembly 122 further includes the plurality of electrical connection terminals 120 , the input point 146 , the ground point 148 , and the pcb 112 . the pcb 112 electrically connects the plurality of electrical connection terminals 120 positioned external to the cover 104 with the fet 150 positioned internal to the cover 104 . the preamplifier assembly 122 , in turn , electrically connects to the mounting frame 108 by means of a conductive adhesive 152 , 154 . the conductive adhesives 152 , 154 cooperate with a wire bonding 156 affixed within the housing 102 to effectively short - circuit rfi generated by nearby communication devices . fig3 illustrates an enlarged exploded view of the microphone assembly of fig1 . the backplate assembly 134 and the diaphragm assembly 124 are affixed adjacent to the support members 106 a , 106 b within the base 106 . in particular , the backplate assembly 134 attaches to the diaphragm assembly 124 , the resulting combination is , in turn , positioned opposite the opening 144 of the mounting frame 108 . the mounting frame 108 , the preamplifier assembly 122 and the cover 104 collectively constitute a back volume portion arranged to convert the electrical capacitance generated by the electret microphone portion to the acoustic signal indicative of the acoustic wave transmitted to the diaphragm assembly 124 . as discussed above , the preamplifier assembly 122 electrically connects via the input point 146 and the connecting wire 142 to the backplate assembly 134 . moreover , the preamplifier assembly 122 is grounded to the diaphragm 138 via the ground point 148 , the mounting frame 108 , and the base 106 . the plurality of electrical connection terminals 120 can comprise an input connection 158 , an output connection 160 , and a ground connection 162 . the input connection 158 supplies electric power to the preamplifier assembly 122 . the input connection 158 and the output connection 160 are communicatively connected to an input ( not shown ) the preamplifier assembly 122 . the ground connection 162 connects the ground point 148 to reduce the sensitivity to low and high radio frequency interference signals generated by communications devices such as , for example , cellular phones . to further reduce the sensitivity to low and high radio frequency interference signals , the preamplifier assembly 122 connects to the base 106 via the mounting frame 108 by means of the conductive adhesive 152 , 154 to ground the rfi signals caused by communications device . the cover 104 is , in turn , grounded to the preamplifier assembly 122 by the wire bond 156 . thus , the rfi present with the amplifier output signal supplied by the output connection 160 is suppressed . the preamplifier assembly 122 can be a capacitively coupled circuit including the fet 150 adapted to reduce the rfi generated by communications devices . the circuit can further include an electrical ground path between the ground connection 162 and the cover 104 via the wire bond 156 . the electrical ground path formed between the cover 104 and the ground connection 162 effectively short - circuits undesirable rfi generated by any nearby communication devices . the wire bond 156 fixedly connects to the opening 114 of the cover 104 using a conductive adhesive such as an epoxy with suspended metallic flakes . in particular , the conductive adhesive can be a two - part silver epoxy adhesive that provides high electrical conductivity and strong conductive bonding . conductive adhesive can replace traditional tin lead ( sn — pb ) solder and can further act as an effective heat sink . the preamplifier assembly 122 can further include a first resistance - capacitance network and a second resistance - capacitance network ( not shown ) communicatively connected to the fet 150 . the first resistance - capacitance network connects to the ground point 148 by means of conductive adhesive 152 to suppress the undesirable rfi generated by nearby communication devices . the second resistance - capacitance network connects to the base 106 via the mounting frame 108 by means of conductive adhesive 154 to suppress the undesirable rfi generated by nearby communication devices . fig4 illustrates a cross - sectional view the exemplary microphone assembly 100 . the diaphragm assembly 124 attaches within the base 106 adjacent to the sound inlet 126 . the sound inlet port 126 is fluidly connected to a first side 164 of the diaphragm 138 to provide acoustic waves received through the sound inlet tube 128 . the backplate assembly 134 mounts to the top surface the diaphragm assembly 124 . as previously discussed , the backplate assembly 134 and the diaphragm assembly 124 constitute the electret microphone portion . the mounting frame 108 mounts to the top edge 110 of the base 106 and supports the preamplifier assembly 122 . the preamplifier assembly 122 attached to the mounting frame 108 by means of conductive adhesive 152 , 154 to provide an electrical path to ground and thereby effectively short - circuit rfi generated by nearby communication devices . the input point 146 of the preamplifier assembly 122 couples to the wire connection 142 of the backplate assembly 134 to provide an acoustic signal thereto . the preamplifier assembly 122 partially protrudes through the opening 114 of the cover 102 ( as shown in fig1 ) to provide electrical access to the plurality of electrical terminals 120 including the ground connection 162 . the preamplifier assembly 122 is further grounded to the cover 104 by means of wire bonding 156 . the mounting frame 108 , the preamplifier assembly 122 and the cover 104 collectively constitute a back volume portion 166 to convert the electrical capacitance generated by the electret microphone portion to the acoustic signal indicative of the acoustic wave transmitted to the diaphragm assembly 124 . in other words , the diaphragm assembly 124 and the backplate assembly 134 electrically connect to the preamplifier assembly 122 through the connecting wire 142 to communicate the acoustic signal generated by the diaphragm 138 . all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extend as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . it should be understood that the illustrated embodiments are exemplary only , and should not be taken as limiting the scope of the invention . | 7 |
the following description and figures are meant to be illustrative only and not limiting . other embodiments of this invention will be apparent to those of ordinary skill in the art in view of this description . fig1 shows the preferred embodiment of the container and applicator . the preferred embodiment of the container and applicator comprises an elongated housing 1 with a first sealed end and a second open end . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the first sealed end . if the substance 2 is evaporative , a high viscosity sealer 3 such as silicone may be used to separate the substance 2 from the second open end to prevent evaporation . an applicator 4 is affixed to the first end of a hollow tube 5 . when the second end of the hollow tube 5 with the applicator 4 is inserted into the elongated housing 1 , the contents of the elongated housing 1 will be forced into the applicator 4 through the hollow tube 5 with the applicator 4 due to the displacement of the content in the elongated housing 1 by the inserted hollow tube 5 . fig2 shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first sealed end and a second open end . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the first sealed end separated from the first sealed end with a high viscosity substance 6 such as silicone . if the substance 2 is evaporative , another high viscosity sealer 3 such as silicone may be used to separate the substance 2 from the second open end to prevent evaporation . an applicator 4 is affixed to the first end of a hollow tube 5 . when the second end of the hollow tube 5 with the applicator 4 is inserted into the elongated housing 1 , the contents of the elongated housing 1 will be forced into the applicator 4 through the hollow tube 5 with the applicator 4 due to the displacement of the content in the elongated housing 1 by the inserted hollow tube 5 . the high viscosity substance 6 near the first sealed end is the last to enter the hollow tube 5 and is designed to force the remaining content of the elongated housing 1 out of the inserted hollow tube 5 and into the applicator 4 . fig3 shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first sealed end and a second sealed end with an opening means 7 near the second sealed end . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the first sealed end . an applicator 4 is affixed to the first end of a hollow tube 5 . when the second end of the hollow tube 5 with the applicator 4 is inserted into the elongated housing 1 after the elongated housing 1 is opened through the opening means 7 near the second sealed end of the elongated housing 1 , the contents of the elongated housing 1 will be forced into the applicator 4 through the hollow tube 5 with the applicator 4 due to the displacement of the content in the elongated housing 1 by the inserted hollow tube 5 . fig4 shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first sealed end and a second sealed end with an opening means 7 near the second sealed end . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the first sealed end . if the substance 2 has low viscosity , a high viscosity sealer 3 such as silicone may be used to separate the substance 2 from the second sealed end to retain the substance 2 near the first sealed end . an applicator 4 is affixed to the first end of a hollow tube 5 . when the second end of the hollow tube 5 with the applicator 4 is inserted into the elongated housing 1 after the elongated housing 1 is opened through the opening means 7 near the second sealed end of the elongated housing 1 , the contents of the elongated housing 1 will be forced into the applicator 4 through the hollow tube 5 with the applicator 4 due to the displacement of the content in the elongated housing 1 by the inserted hollow tube 5 . fig5 shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first sealed end and a second end with an opening means 8 such as a screw - on cap . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the first sealed end . an applicator 4 is affixed to the first end of a hollow tube 5 . when the second end of the hollow tube 5 with the applicator 4 is inserted into the elongated housing 1 after the elongated housing 1 is opened through the opening means 8 at the second end of the elongated housing 1 , the contents of the elongated housing 1 will be forced into the applicator 4 through the hollow tube 5 with the applicator 4 due to the displacement of the content in the elongated housing 1 by the inserted hollow tube 5 . fig6 shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first sealed end and a second open end . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the first sealed end . if the substance 2 is evaporative , a high viscosity sealer 3 such as silicone may be used to separate the substance 2 from the second open end to prevent evaporation . a plug 9 with a hole through its center is placed immediately next to the substance 2 or the high viscosity sealer 3 , if one is utilized . an applicator 4 is affixed to the first end of a hollow tube 5 . when the second end of the hollow tube 5 with the applicator 4 is inserted into the elongated housing 1 , the hollow tube 5 will force the plug 9 to apply pressure and scrub the contents of the elongated housing 1 from the inside walls of the elongated housing 1 to fully force all the contents into the applicator 4 through the hollow tube 5 with the applicator 4 due to the displacement of the content by the inserted hollow tube 5 . fig7 a shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first sealed end and a second sealed end with an opening means 7 between the first sealed end and the second sealed end . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the first sealed end separated from the opening means 7 with a high viscosity substance 3 such as silicone . a substance 11 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the second sealed end separated from the opening means 7 with a high viscosity substance 10 such as silicone . an applicator 4 is affixed to the first end of a hollow tube 5 . when the second end of the hollow tube 5 with the applicator 4 is inserted into either end of the elongated housing 1 after the elongated housing 1 is opened through the opening means 7 , the contents of the elongated housing 1 will be forced into the applicator 4 through the hollow tube 5 with the applicator 4 due to the displacement of the content in the elongated housing 1 by the inserted hollow tube 5 . the substance 2 in elongated housing 1 near the first sealed end may be the same as or a different substance than the substance 11 near the second sealed end . fig7 b shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first sealed end and a second sealed end with an opening means 7 between the first sealed end and the second sealed end . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the first sealed end separated from substance 11 near the second sealed end with a high viscosity substance 3 such as silicone with an opening means 7 at the location of the high viscosity substance 3 . an applicator 4 is affixed to the first end of a hollow tube 5 . when the second end of the hollow tube 5 with the applicator 4 is inserted into either end of the elongated housing 1 after the elongated housing 1 is opened through the opening means 7 , the contents of the elongated housing 1 will be forced into the applicator 4 through the hollow tube 5 with the applicator 4 due to the displacement of the content in the elongated housing 1 by the inserted hollow tube 5 . the substance 2 in elongated housing 1 near the first sealed end may be the same as or a different substance than the substance 11 near the second sealed end . fig8 shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first sealed end and a second open end . one or more small holes 14 are located on the elongated housing 1 near the second open end . an elongated member 12 with at least one sealed end is inserted into the elongated housing 1 and rests on the first sealed end . an opening means 7 on the elongated housing 1 is located at a predetermined location along the position of the elongated member 12 . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the sealed end of the elongated member 12 . if the substance 2 is evaporative , a high viscosity sealer 13 such as silicone may be used to separate the substance 2 from the second open end to prevent evaporation . an applicator 4 may be affixed to the second open end of the elongated housing 1 . when the elongated housing 1 is opened through the opening means 7 , the elongated member 12 is exposed and can be depressed to extract the content of the elongated housing 1 into the applicator 4 . fig9 shows another embodiment of the container and applicator . in this embodiment , the container and applicator comprises an elongated housing 1 with a first open end and a second open end . one or more small holes 14 are located on the elongated housing 1 near the second open end . an elongated member 12 is inserted into the elongated housing 1 and positioned near the first open end . an opening means 7 on the elongated housing 1 is located at a predetermined location along the position of the elongated member 12 . a stopper 15 is attached to the end of the elongated member 12 near the second open end . a substance 2 such as cream , lotion , make - up , or other liquid is contained within the elongated housing 1 near the stopped 15 at the end of the elongated member 12 . if the substance 2 is evaporative , a high viscosity sealer 13 such as silicone or a rubber stopper may be used to separate the substance 2 from the second open end to prevent evaporation . an applicator 4 may be affixed to the second open end of the elongated housing 1 . when the elongated housing 1 is opened through the opening means 7 , the elongated member 12 is exposed and can be depressed to extract the content of the elongated housing 1 into the applicator 4 through the one or more holes 14 near the end of the second open end . although the invention has been described in terms of particular embodiments and applications , one of ordinary skill in the art , in light of this teaching , can generate additional embodiments and modifications without departing from the spirit of or exceeding the scope of the claimed invention . accordingly , it is to be understood that the drawings and descriptions herein are proffered by way of example to facilitate comprehension of the invention and should not be construed to limit the scope thereof . | 6 |
the present invention is described in the following with a specific embodiment , so that one skilled in the pertinent art can easily understand other advantages and effects of the present invention from the disclosure of the invention . the present invention may also be implemented and applied according to other embodiments , and the details may be modified based on different views and applications without departing from the spirit of the invention . fig1 to 5 are diagrams drawn according to the preferred embodiments of the light - guiding device of the present invention . these drawings are simplified diagrams schematically illustrating the basic structure of the present invention , therefore , only display the compositions related to the present invention . further , the displayed compositions are not drawn in accordance with the amount , shape , and dimensional ratio during implementing . the actual amount , shape , and dimensional ratio during implementing may be a kind of selective design , and the types of composition layout may be more complicated . fig1 is an explosive view illustrating a panel 1 and a light - guiding device of the preferred embodiment according to the present invention . the panel 1 has at least a through hole 11 . the light - guiding device comprises a sleeve part 2 and a light guide 3 . in general , the panel 1 has a plurality of through holes 11 equally spaced on a surface of the panel 1 for acting as heat exchanging paths and observation holes from which users are able to monitor statuses of an indicator light . in the preferred embodiment embodiment , the through holes 11 corresponding to the positions of the indicator lights are all in the shape of an ellipse , that may function as marking the installation position of the light - guiding device and bring the effect of directivity orientation after installation . however , one skilled in the pertinent art can easily understand that the shape of the through hole 11 does not affect the applied scope of the present invention . in other embodiments , the through hole with , such as circular shape , may be applied to a panel , and it is not limited by this embodiment . fig2 is a schematic diagram illustrating the sleeve part 2 of the light - guiding device according to the present invention . the sleeve part 2 comprises a first combining portion 21 and a positioning portion 23 corresponding to the panel 1 for positioning the sleeve part 2 on the panel 1 . in the preferred embodiment , the sleeve part 2 further comprises a holding portion 25 . the holding portion 25 comprises two holding parts symmetrically installed a predetermined distance apart from each other for generating corresponding recovery elasticity after being expanded and distorted . the first combining portion 21 is formed on an inner side of the holding portion 25 and has for example a groove structure . more particularly , the first combining portion 21 ( such as a groove ) is installed in a middle region of the holding portion 25 ( such as two holding parts ) and perpendicular to the holding portion 25 . the first positioning portion 23 is used to fix to the panel 1 . according to the preferred embodiment , the positioning portion 23 comprises a sleeve head 231 formed at an end of the sleeve part 2 , and an inverted hook 233 formed on an outer side of the holding portion 25 . the sleeve head 231 has an annular structure and is larger than the through hole 11 of the panel 1 in width . moreover , the inverted hook 233 keeps away from the sleeve head 231 a distance equal to a depth of the through hole 11 of the panel 1 . fig3 is a schematic diagram illustrating the light guide 3 of the light - guiding device according to the present invention . the light guide 3 comprises a second combining portion 31 , which is able to engaged with the first combining portion 21 . according to the preferred embodiment , the light guide 3 is a light - guiding pillar . the second combining portion 31 is for example a bump formed on an outer side of the light guide 3 . the light guide 3 further comprises an expanding portion 33 having a conical structure and is formed at an end of the light guide 3 . the expanding portion 33 expands a light reception area on the end of the light guide 3 , and thus enhances light reception and light conduction efficiencies . furthermore , in order to obtain a better light - guiding effect , the light guide 3 is made of acrylic , and has a photo - resistive layer attached on the outer surface of the light guide 3 to prevent conductive light inside the light - guiding 3 from leaking to a region outside of the light guide 3 , such that affects the effect of light conduction or interferes other light guides 3 . fig4 is a side view illustrating an installation of the sleeve part 2 on the light guide 3 according to the present invention . the light guide 3 is held in the holding portion 25 of the sleeve part 2 and fixed to the sleeve part 2 by the first combining portion 21 and the second combining portion 31 . an end of the light guide 3 is inserted in the sleeve head 231 of the sleeve part 2 . since the first combining portion 21 is formed on the inner side ( i . e . holding side ) of the holding portion 25 , when the light guide 3 holds open the holding portion 25 and is installed on a corresponding position , the first combining portion 21 holds the second combining portion 31 automatically due the recovery elasticity of the holding portion 25 , and the light guide 3 is positioned on the sleeve part 2 accordingly . thus , the installation of the light guide 3 on the sleeve part 2 becomes very convenient . on the other hand , the light guide 3 is easily escaped from sleeve part 2 by expanding the holding portion 25 outward . moreover , since the holding portion 25 comprises two symmetrically holding parts , which generate the recovery elasticity after being expanded or being compressed , when the light guide 3 is installed in and held by the holding portion 25 , a compression space of the holding portion 25 is limited , so as to realize the function of locating the positioning portion 23 on the panel . fig5 a is a schematic diagram illustrating the light - guiding device and the panel 1 after the light - guiding device has been fixed to the panel 1 . fig5 b is a side view the light - guiding device and the panel 1 after the light - guiding device has been fixed to the panel 1 . firstly , the sleeve part 2 is installed in the corresponding through hole 11 from a region outside of the panel 1 , and is fixed to the panel 1 by the positioning portion 23 . since the inverted hook 233 has an oblique guiding surface design , the holding portion 25 will be guided to shrink inward when the sleeve part 2 is passing through the through hole 11 , and the inverted hook 233 is hooked to an inside surface of the panel 1 by the recovery elasticity of the holding portion 25 when the sleeve head 231 presses against the outside surface of the panel 1 , so as to realize the function of locating the positioning portion 23 on the panel 1 . after the sleeve part 2 is positioned on the panel 1 as described above , then the light guide 3 is assembled to the sleeve part 2 , such that the light - guiding device of the present invention is fixed to the panel 1 . since the compressed space of the holding space 25 is limited by holding the light guide 3 in the holding portion 25 after the installation of the light guide 3 and the sleeve part 2 , the holding portion 25 cannot be compressed at that time , and then the inverted hook 233 of the positioning portion 23 is relative in a fixed status , so as to ensure the locating effect of the positioning portion 23 and the panel 1 . although the implementation technique of the first and second combining portions is described by for example , a groove - bump fasten design in the above embodiment , however , one skilled in the pertinent art can easily understand the fastening design of the groove and bump is only an example of combining structures , any design such as , buckle groove and protruding edge , internal thread and external thread , and tightly co - operated taper , may realize the same combining effect . therefore , the first and second combining portions of the present invention are not limited by the groove and bump of the above embodiment . furthermore , although the implementation technique of the positioning portion is described by for example , a sleeve head and an inverted hook design in the above embodiment , however , one skilled in the pertinent art can easily understand the clamping design of the sleeve head and an inverted hook is only an example of combining structures , any design that utilizes the sleeve part &# 39 ; s shape design or matches the installation of the light guide can implement the same clamping locating effect , such as matching the sleeve head and the shoulder part preformed on the light guide , or simply utilizing the mutual installation of the sleeve part and light guide to force the sleeve head to expansively locate , and so on . therefore , the positioning portion of the present invention is not only limited by the design including the sleeve head and inverted hook of the above embodiment . it can be understood by synthesizing the above embodiments , the light - guiding device of the present invention utilizes a design of the second combining portion of the light guide to match with a design of the first combining portion and positioning portion , so as to realize the effect of fixedly installing on the panel , to provide the effect of assembling and disassembling easily , and to provide the effect of reusable light guide and sleeve part . at the same time , since the structure design is simple and the whole panel does not need to be replaced when the light guide damages , it has the effect to reduce the cost , so as to overcome the defects of the conventional technique , such as hard to assemble and disassemble , complicated structure , low reuse ability , high cost , and so on . although the foregoing embodiment was chosen and described in order to best explain the principles of the invention and its practical application , it is not intended to limit the scope of the present invention , but rather to enable others skilled in the art to best understand and utilize the invention with various modifications as are suited to the particular use contemplated . the scope of the invention is defined by the following claims and their equivalents . | 6 |
one such use for digital broadcasts is to satisfy an existing demand for traffic information . proposals that involve the use of digital broadcasts for this purpose contemplate the use of standardized formatting of traffic information to be broadcast . this approach may be used to enable the use of traffic information receiving terminals made by different manufacturers , which each could be configured to detect and interpret traffic information broadcast in the same way . fig1 is a schematic diagram of a network through which traffic information is provided . a traffic information providing server 100 in a broadcast station may transmit traffic information , e . g ., traffic congestion information collected from various sources ( e . g ., operator input , or information received from another server or probe cars through a network 101 ) wirelessly so that a traffic information receiving terminal ( e . g ., navigation system installed in a car 200 ) may receive the traffic information . in the below explanation about implementations , the traffic information means traffic congestion information . the traffic information wirelessly transmitted from the traffic information providing server 100 may be of the form of a component frame . as shown in fig2 a , a component frame may include a field 201 indicative of the number of messages included therein and a sequence of transport protocol expert group messages 202 , the number of the messages being equal to the value stored in the field 201 . the transport protocol expert group message will be referred to as the tpeg - ctt message hereinafter . as shown in fig2 b and 2 c , one message segment of the sequence 202 , i . e ., one tpeg - ctt message , may include a message management container including information on date and time , the message occurrence time , etc ., a congestion and travel - time information ( ctt ) container , and a tpeg - ctt location container . the ctt container may include a field 211 indicative of the number of ctt components included in the ctt container and the tpeg - ctt location container . the field 211 may be followed by ctt components , the number of which is equal to the value stored in the field 211 . in various implementations , if a ctt component includes traffic congestion information , the ctt component is given an id of 0x80 , as shown in fig2 b , and includes one or more status components therein . each status component may include an id indicative of the information included therein . for example , a status component including an id of 0x00 delivers the average speed in a link ( a road unit including no branch therein ). a status component including an id of 0x01 delivers link travel time . a status component including and id of 0x03 delivers information on the degree or type of congestion . in the description , specific ids are described as assignments to structures associated with specific information . the actual value of an assigned id ( e . g ., 0x80 ) is exemplary , and different implementations may assign different values for specific associations or circumstances . thus , the ctt component may be used to provide various different types of data that may be signaled based on an identifier . for example , fig2 b illustrates components with identifiers of 0x00 and 0x01 signaling , respectfully , speed and travel - time information . further , according to the various implementations if a ctt component includes link location information , the ctt component is given an id of 0x90 as shown in fig2 c and includes one or more tpeg - ctt location sub - containers . each tpeg - ctt location sub - container ‘ tpeg_loc_container ’ includes one or more tpeg - ctt location components , each of which includes one or more coordinate components having an id of 0x00 . each coordinate component delivers information on a link or links for which the status component includes traffic information . a link may refer to a road segment which starts and ends at junctions and has no junction in between . a coordinate component including an id of 0x00 includes information on the link type ( e . g ., express way , national road , etc ). a coordinate component including an id of 0x01 includes coordinate information which may be expressed in the wgs84 format . a coordinate component including an id of 0x03 includes link description information and a coordinate component including an id of 0x10 includes link identification information . the server 100 may construct the tpeg - ctt information as shown in fig2 a through 2 c from traffic information collected from various sources and may transmit the constructed tpeg - ctt information to traffic information receiving terminals wirelessly . information may be provided at a macroscopic scale . for example , if there are two or more possible commutation routes ( e . g ., olympic highway , ‘ gangbyeonbukro ’ in seoul ), the driver may be likely to choose one route from among the possible routes based on an indication of an average speed along an aggregation of the routes rather than the average speed in each road segment within the routes . if the traffic information receiving terminal is equipped with the function of providing the average speed in principal roads , the driver may make a request for the average speed in a specific principal road . for another example , a user may view the congestion of multiple highways from the dulles airport , va to the smithsonian museum , washington d . c . in order to recognize an advantageous route . to meet the need for traffic information at a macroscopic scale , the sever 100 , which may collect traffic information in a centralized manner and provide for a terminal , may generate a composite link composed of a plurality of links on a specific road and may provide traffic congestion information for the composite link in a similar manner as traffic congestion information for each link . a process , according to various implementations , for providing traffic information on a virtual composite link that does not correspond to a single actual link will now be described in detail . to provide traffic information on a composite link defined from a set of links , the server 100 may construct a link information component including an id of 0x01 as shown in fig3 a and may deliver the link information component via a tpeg - ctt location sub - container . the link information container , as shown in fig3 b , may deliver a link allocating sub - component 303 for allocating a composite link comprising successive links via the link information component . the link allocating sub - component 303 has an id of 0x02 and may include a composite link id , the number of links included in the composite link , the ids of the links included in the composite link , and / or a descriptor . in particular , the link allocating sub - component id 0x02 is used to trigger recognition of the component as a link allocation sub - component . the server 100 may construct the tpeg - ctt information as shown in fig2 a through 2 c from traffic information collected from various sources and may transmit the constructed tpeg - ctt information to traffic information receiving terminals wirelessly . under various circumstances , such as , for example , according to operator input or predefined conditions , the server 100 may create the link allocating sub - component 303 for establishing a composite link comprising a plurality of links ( e . g ., a set of road segments belonging to a principal road ) and delivers the link allocating sub - component 303 via the link information component 300 . it is possible to make composite links for a principal road in one direction or in both directions . making a composite link which has a low demand for traffic information in only one direction helps reduce the size of traffic information , simplify server processing , and provide useful information to a user wishing to perceive travel options along an intended direction of travel . in another implementation , information on allocation of a composite link may be carried by a coordinate component including id of 0x00 , as shown in fig3 c . in this case , id of , for example , 0x13 is allocated to a coordinate component carrying information of a composite link information to distinguish from other coordinate components carrying road - type list , wgs84 , link description , and link identification . in this implementation , information that may be needed for allocating a composite link , for example , information on a composite link description , may be included dispersedly in a description component shown in fig2 c . the server 100 may calculate traffic information ( e . g ., average speed , link travel time , the degree of congestion , etc ) for the composite link based on traffic information for individual links and transmit the traffic information for the composite link in a similar manner to other links . since the server 100 may have more powerful performance than traffic information receiving terminals equipped with limited resources , it may be faster and more efficient for the server 100 to obtain traffic information for the composite link . according to various implementations , if there is a change in the set of links included in a composite link , e . g ., a link is added to or removed from the composite link , the server 100 may create and transmits a link allocating sub - component ( or composite link allocating coordinate component ) for reallocating a composite link composed of the changed set of links . in this case , the server 100 may allocate the sub - component an id , e . g ., 0x03 ( or 0x14 ) instead of 0x02 ( or 0x13 indicative of a composite link allocating coordinate component ) to inform traffic information receiving terminals that a pre - allocated composite link is reallocated . in order to cancel an existing composite link , the server 100 may create and transmits a link allocating sub - component for canceling the existing composite link . canceling an existing sub - component may be useful in reducing the size of traffic information . for example , if a road is congested in one direction in the morning and the same road is congested in the opposite direction in the evening , a composite link for the opposite direction may be unlikely to be of high demand in the morning . as a result , the size of traffic information may be reduced by canceling the composite link for the opposite direction in the morning . in this case , the link allocating sub - component has the id of the existing composite link to be canceled and the information on the number of links set to 0 . it is also possible to create a link canceling sub - component including an id of 0x04 instead of the link allocating sub - component including the id of the existing composite link and the number of links set to 0 , in which case the link canceling sub - component only includes the id of the composite link to cancel . in another implementation , a composite link canceling coordinate component including id of , for example , 0x15 indicative of cancellation of a composite link may be provided . after a composite link is allocated , the traffic information for each of the links included in the composite link may also be provided . because a composite link may be treated as an actual link , the data update interval for a composite link may be made equal to the data update interval for individual links . hence , drivers may be rapidly informed of the traffic conditions on principal roads , each of which may be managed as composite links . fig4 - 6 are example implementations of systems for receiving and utilizing traffic information . other systems may be organized differently or include different components . specifically , fig4 is an example of a block diagram of a navigation terminal that receives traffic information transmitted from the server 100 . the navigation terminal includes a tuner 1 for receiving modulated traffic information signals by resonating at the required frequency band , a demodulator 2 for outputting traffic information signals by demodulating the modulated signals from the tuner 1 , a tpeg - ctt decoder 3 for extracting traffic information by decoding the demodulated traffic information signals , a gps module 8 for calculating the current position ( i . e ., latitude , longitude , and altitude ) by receiving signals from a plurality of satellites , storage structure 4 for storing various graphic data and an electronic map including information on links and nodes , an input unit 9 for receiving user input , a navigation engine 5 for controlling screen display based on the user input , the current position , and extracted traffic information , a memory 5 a for storing data temporarily , an lcd panel 7 for displaying data , and an lcd drive 6 for driving the lcd panel 7 according to data to be presented . the input unit 9 may be a touch screen incorporated into the lcd panel 7 . the tuner 1 tunes to the frequency of the signals transmitted by the server 100 and the demodulator 2 demodulates the tuned signals in a predetermined manner . the tpeg - ctt decoder 3 extracts tpeg - ctt messages , as shown in fig2 a through 2 c and fig3 a and 3 b ( or 3 c ), and stores the tpeg - ctt messages temporarily . interpreting the temporarily stored tpeg - ctt messages , the tpeg - ctt decoder 3 sends the extracted information and / or control data to the navigation engine 5 . though various kinds of information is provided for the navigation engine 5 by the tpeg - ctt decoder 3 , for purposes of brevity , the following description will focuses on the method for allocating composite links and the method for processing traffic information for composite links . the tpeg - ctt decoder 3 extracts data / time and message occurrence time included in the message management container of each tpeg - ctt message and determines if the following container is a ctt event container based on ‘ message element ’ information ( i . e . an identifier ). if it is determined that the following container is a ctt event container , the tpeg - ctt decoder 3 provides the navigation engine 5 with the information extracted from the ctt component included in the ctt event container so that the navigation engine 5 may display congestion and travel - time information and link information , which will be described below . providing the navigation engine 5 with the information may include determining , based on identifiers , that the traffic information includes a message management container including status or composite information within various message components within the message management container . the components may each include different status or composite information associated with different links , composite links , or locations and identifiers associated with the different status or composite information . the containers and components may each include information associated with a generation time , version number , data length , and identifiers of included information . the tpeg - ctt decoder 3 then extracts information on the link location about which the previously extracted information may be created from the following tpeg - ctt location container . the position information may be , for example , the coordinates ( i . e ., latitudes and longitudes ) of the start and end positions or a link id , depending on the type of the tpeg - ctt location container . if the navigation terminal is equipped with the storage structure 4 , the navigation engine 5 finds the link location about which the received information is created with reference to information on each link and node stored in the storage structure 4 . the navigation engine 5 may convert the coordinates of the link into the link id or vice versa . in the implementation of fig3 b , the tpeg - ctt decoder 3 may determine if a link information component including an id of 0x01 is delivered via a tpeg - ctt location sub - container and if so , extract each sub - component from the link information component . if the extracted sub - component is a link allocating sub - component ( e . g ., includes an appropriate identifier ), such as including an id of 0x02 for allocating a composite link , the tpeg - ctt decoder 3 may extract the id of the composite link to allocate , the number of links included in the composite link , the ids of the links included in the composite link , and a descriptor ( e . g ., the road name ) and may provide the extracted information for the navigation engine 5 so that the extracted information may be stored as a temporary link entry in the memory 5 a . if the extracted sub - component is a link canceling sub - component for canceling an existing composite link or a link allocating sub - component including the number of links set to 0 , the tpeg - ctt decoder 3 may make a request for removing a temporary link entry including an id that is the same as the composite link id of the sub - component so that the navigation engine 5 may remove the composite link entry from the memory 5 a . in the implementation of fig3 c , a composite link allocating coordinate component or a composite link cancellation coordinate component may be extracted from a tpeg - ctt location component including id of 0x00 included in a tpeg - ctt location sub container , and the above - explained operations may be conducted according to information included in the extracted component . the navigation engine 5 reads a part of the electronic map centered around the position coordinates received from the gps module 8 from the storage structure 4 and displays the map on the lcd panel 7 via the lcd drive 6 . a particular graphic symbol is displayed at the location corresponding to the current position on the lcd panel 7 . the navigation engine 5 may display the average speed or average travel time in a link received from the tpeg - ctt decoder 3 at a location corresponding to the coordinates or link id delivered via the tpeg - ctt location container following the container delivering the average speed or average travel time information . in this case , the navigation engine 5 may search the storage structure 4 for the link corresponding to the coordinates or link id received from the tpeg - ctt location container . if the link is not found , then the navigation engine 5 may determine if there is a matched temporary link entry in the memory 5 a . in this search operation , temporarily allocated composite links as well as actual links may be searched . the traffic information for the link and / or the composite link specified by the search operation may be extracted from the corresponding status component included in a ctt component including an id of 0x80 . there are various alternative methods for the navigation engine 5 to display traffic information . for example , the navigation engine 5 may show links in different colors according to the average speed in the links as shown in fig5 a and 5 b , or may show the average speed with number in each link , as shown in fig5 c . in fig5 a and 5 b , the red , orange , green , blue colors indicate average speeds of 0 ˜ 10 km , 10 ˜ 20 km , 20 ˜ 40 km , over 40 km , respectively . if the navigation terminal is not equipped with the storage structure 4 for storing an electronic map , the terminal may show the average speed or the travel time in links located in front of the current position with different colors as shown in fig5 b , or with figures as shown in fig5 c . if the route of the car with the navigation terminal installed is determined , the navigation terminal may show the average speed in the links included in the determined route instead of the links located in front of the current position . if the traffic information for a temporary link entry stored in the memory 5 a , i . e ., a composite link , is received , the navigation engine 5 may display the traffic information for the composite link on a road or graphic near each of the links included in the composite link with colors or with figures , as marked ‘ a ’ in fig5 a to 5 c . the descriptor for the composite link may also be displayed near the route corresponding to the composite link . instead of displaying the traffic information for the composite link together with the traffic information for each of the individual links , the navigation engine 5 may first store the traffic information in the memory 5 a in association with the temporary link entry and may display only the traffic information for the composite link as shown in fig6 when the traffic information for the composite link is requested . if the terminal in fig4 is equipped with a voice output device , the terminal may output received traffic information for a specified link , links , or composite link included in a specified route in voice . if several links included in the specified route are grouped into a composite link and the descriptor in the link allocating sub - component ( or description component ) shown in fig3 b is “ xxx ”, the voice message may be “ the average speed in xxx road is nn ”. the present disclosure enable a driver to choose the less congested route from among many possible routes . in the previous discussion , wherever average speed has been referenced , it may be replaced with other status or component based information , such as , for example , travel time . the foregoing description has been presented for purposes of illustration . thus , various implementations with improvements , modifications , substitutions , or additions within the spirit and scope as defined by the following appended claims . | 7 |
in fig1 a frame of a winding store ( not otherwise illustrated any more specifically ) for receiving banknotes is designated by 10 . on its front side , the frame 10 has a slightly convexly curved surface 12 , which constitutes one boundary surface of a first transporting path 14 for banknotes 16 , which are indicated by dashed lines . the other boundary surface of the first transporting path 14 is formed by one or more belt drives 18 , which may be part of the store itself or of the arrangement in which the store is installed . in a bottom region of the front side 12 of the frame 10 , a second transporting path , which is designated in general terms by 20 , branches into the interior of the frame 10 from the first transporting path 14 such that the two transporting paths 14 and 20 butt against one another in the form of a t . the second transporting path leads to the actual winding store ( not illustrated here specifically ). the wall parts 22 and 24 , forming the front side 12 of the frame 10 , on either side of the access and outlet opening of the second transporting path 20 are curved convexly toward the frame interior , with the formation of a first frame - side directing surface 26 and a second frame - side directing surface 28 , such that they converge in the direction of a gap between two transporting rollers 30 of the second transporting path 20 . located in the inlet and outlet gap of the second transporting path , said gap being formed between the convexly curved frame - side directing surfaces 26 and 28 , is a diverter arrangement which is designated in general terms by 32 . by means of this diverter arrangement , individual sheets or banknotes 16 arriving in the direction of the arrow a either are routed further on the first transporting path , beyond the open - out location of the second transporting path 20 , or are transferred , in the direction of the arrow b , from the first transporting path 14 onto the second transporting path 20 and / or , in the direction of the arrow c , from the second transporting path 20 onto the first transporting path 14 . the construction and the functioning of the diverter arrangement 32 will now be explained in more detail hereinbelow . according to fig1 the diverter arrangement 32 comprises a first diverter body 34 , in the form of an elongate strip , and a second diverter body 36 , which is parallel to the first diverter body . the two diverter bodies 34 and 36 extend over the entire width of the two transporting paths 14 and 20 and each has an at least more or less triangular cross section . the first diverter body 34 has a wall which is directed toward the first frame - side directing surface 26 , is curved at least more or less coaxially with the latter , forms a first diverter surface 38 and , together with the frame - side directing surface 26 , bounds a first connecting path 40 , which leads from the first transporting path 14 to the second transporting path 20 . the second diverter body has a wall which is directed toward the second frame - side directing surface 28 , is curved at least more or less coaxially with the latter and forms a second diverter surface 42 which bounds a second connecting path 44 , which leads from the second transporting path 20 to the first transporting path 14 . as far as the adjustability of the two diverter bodies 34 and 36 is concerned , you are now referred to fig2 and 3 . at its two longitudinal ends , the first diverter body 34 is fastened in each case on one leg 46 of a right - angled lever 48 . by way of their other leg 50 in each case , the two levers 48 are guided , via slots 52 formed in the leg 50 and frame - side pins 54 , on the side walls of the frame 10 such that they can be displaced linearly in the direction of the double arrow d . on its inside , the leg 50 is provided in each case with a toothing arrangement 56 , with the result that it forms a rack which meshes with a gear wheel 58 which is arranged in a rotationally fixed manner on a pivot shaft 60 parallel to the longitudinal direction of the diverter body 34 and to the axes of the transporting rollers 30 . rotation of the gear wheel 58 causes linear displacement of the angle lever 48 and thus adjustment of the first diverter body 34 , essentially perpendicular to the front side 12 of the frame 10 , between the positions illustrated in fig2 and 3 . the second diverter body 36 is mounted in the side walls of the frame 10 such that it can be pivoted about a pivot spindle 62 parallel to the pivot shaft 60 . furthermore , at its longitudinal ends , the second diverter body 36 is connected in each case to a sheet - like toothed segment 64 , of which the toothed rim is curved coaxially with the pivot spindle 62 and meshes with a gear wheel 66 , which is likewise seated in a rotationally fixed manner on the shaft 60 . a rotary movement of the gear wheel 66 thus causes a pivoting movement of the second diverter body 36 , about the pivot spindle 62 , between the positions illustrated in fig2 and 3 . the gear wheels 58 and 66 are rotated , together with the pivot shaft 60 , via a pivot drive 68 , which comprises an electromagnet 70 , which operates the tension , and a drawing element 72 , which is connected to said electromagnet , acts on the circumference of the gear wheel 58 and is connected to the latter in an articulated manner at 74 . the two gear wheels 58 and 66 are preferably produced , together with the drawing element 72 , from plastic in a single piece , the point of articulation 74 being formed by an elastic material bridge . the drawing element 72 has a head part 76 with a c - groove 78 , in which a head 80 of the plunger - type armature 82 of the electromagnet 70 engages . in the opposite direction , the pivot shaft 60 , together with the gear wheels 58 and 66 , is adjusted by a spring 84 , which acts , on the one hand , on a flange 86 , connected in a rotationally fixed manner to the shaft 62 , and , on the other hand , on a frame - side point 88 . arranged between the gap between the transporting rollers 30 and those borders of the two diverter bodies 34 and 36 which are oriented toward the frame interior is a blocking strip 90 , which is directed parallel to the pivot spindle 60 and , at its longitudinal ends , is connected to a rocker 92 in each case . the two rockers are mounted such that they can be pivoted about a spindle 94 parallel to the pivot spindle 60 and , at their end which is remote from the axis , bear a toothed segment 96 via which they engage with the gear wheel 58 . when the gear wheel 58 is rotated , the two rockers 92 , and thus the blocking strip 90 , are thus also adjusted between the positions illustrated in fig2 and 3 . the apparatus which has been described thus far operates as follows : in the case of that position of the diverter bodies 34 and 36 which is illustrated in fig1 and 3 , the first diverter body 34 is fully incorporated in the open - out opening of the second transporting path , with the result that its outside 98 is aligned with the front side 12 of the frame 10 , and thus with one boundary surface of the first transporting path 14 . this position has been reached by rotation of the gear wheels 58 and 66 in the clockwise direction , the angle lever 48 having been displaced to the extent where the pins 54 butt against the left - hand ends of the slots which are illustrated in fig3 . this limits the adjustment movement . rotation of the gear wheel 66 in the clockwise direction has , at the same time , pivoted the diverter body 36 in the anticlockwise direction , with the result that the second connecting path 44 between the second transporting path 20 and the first transporting path 14 has been opened . finally , the same movement of the gear wheels 58 and 66 has adjusted the blocking strip 90 downward , with the result that the latter is now located in front of that edge of the second diverter body 36 which is oriented toward the transporting rollers 30 . banknotes 16 arriving on the first transporting path 14 in the direction of the arrow a are guided past the diverter arrangement 32 and thus remain on the first transporting path 14 . in the same position of the diverter arrangement 32 , however , it is also possible for banknotes to be discharged from the second transporting path 20 , through the second connecting path 44 , in the direction of the arrow c ( fig1 ), onto the first transporting path , on which they are then guided away in the direction of the arrow a . if the pivot shaft 60 , together with the gear wheels 58 and 66 , is adjusted in the anticlockwise direction , counter to the action of the spring 84 , via the electromagnet 70 and the drawing element 72 , then the angle lever 48 and thus also the first diverter body 34 are adjusted to the left in fig2 and 3 . as a result , the outer surface 98 of the first diverter body 34 is lifted out of the front side 12 of the frame 10 , said front side bounding the first transporting path 14 , with the result that the first connecting path 40 opens . at the same time , the second diverter body 36 is pivoted in the clockwise direction and the blocking strip 90 is lifted by virtue of the rockers 92 being pivoted in the clockwise direction about the spindle 94 . this releases the path for banknotes which arrive on the first transporting path in the direction of the arrow a and are then deflected , by way of the first diverter surface 38 , into the first connecting path 40 in the direction of the arrow b , with the result that they pass into the gap between the transporting rollers 30 of the second transporting path 20 . if the electromagnet 70 is deactivated , then all the parts spring back , under the action of the spring 84 , into the position illustrated in fig1 and 3 . | 6 |
preferred embodiments will now be described with reference to the drawings . fig1 is a system block diagram of a preferred embodiment of a multiple technology data reader 10 . the multiple technology data reader 10 shown in fig1 includes an optical code reader , such as a bar code reader 12 , a low frequency rfid reader 14 a , and / or a high frequency rfid reader 14 b . the bar code reader 12 , a low frequency rfid reader 14 a , and / or a high frequency rfid reader 14 b are each connected to a device communications , control and power unit 16 . while it is convenient to combine communications , control and power functionality within the device communications , control and power unit 16 , such functionality can also be separated into different units , either in the fig1 embodiment or the other embodiments described later herein . the device communications , control and power unit 16 is preferably connected to a host device 30 over a usb 20 , which comprises a serial communications signal line 27 and a set of power signal lines 29 . the usb 20 supplies power from the host computer 30 , and establishes a two - way communication link between the multiple technology data reader 10 and the host computer 30 . as an alternative to the host computer 30 supplying power via the usb 20 , or in addition thereto , an independent power source ( not shown ) may be included within the multiple technology data reader 10 , either in the fig1 embodiment or the other embodiments described later herein . in operation , the device communications , control and power unit 16 receives data signals from the bar code reader 12 and the rfid readers 14 a and 14 b , and provides power to each of these readers . the device communications , control and power unit 16 may also be used to activate the bar code reader 12 and the rfid readers 14 a and 14 b independently , simultaneously or concurrently . fig2 is a functional block diagram of a multiple technology data reader 10 , which can read a bar code 72 or an rfid tag 74 . the bar code 72 is read and detected by an optics means 42 , which sends the detected signal to an analog front end means 52 . the analog signal is then converted to a digital signal by a conversion to digital means 62 . the converted digital signal is decoded by a bar code decoder 28 a , and then sent to a host computer 30 via a usb 20 . the rfid tag 74 is detected by an antenna 44 . the antenna transmits an electromagnetic signal 75 and detects a response signal 76 from the rfid tag 74 . the response signal 76 is sent to an rfid transmitter / receiver 64 through an impedance matching network 54 , which matches the impedance of the antenna 44 with the impedance of the rfid transmitter / receiver 64 . the response signal 76 is then decoded by an rfid decoder 28 b , and then sent to a host computer 30 via the usb 20 . fig3 is a block diagram illustrating a preferred configuration of logical connections for a multiple technology data reader 10 a according to one embodiment utilizing a compound interface between the data reading components and the host device . in fig3 a multiple technology data reader 10 a includes an rfid reader 14 , connected to one port of an internal hub 18 , and a bar code reader 12 , connected to another port of hub 18 . the internal hub 18 is connected to a usb 20 , which supplies power from a host computer 30 and establishes a two - way communication link between the compound multiple technology data reader 10 a and the host computer . the rfid reader 14 and bar code reader 12 are logically addressable over the usb 20 via the internal hub 18 . the multiple technology scanner 10 a shown in fig3 operates in a manner as described with regard to fig1 . fig4 is a block diagram illustrating a preferred configuration of logical connections for a multiple technology data reader 10 b according to another embodiment utilizing a composite or complex interface between the data reading components and the host device . in the fig4 embodiment , the multiple technology data reader 10 b includes an rfid reader 14 , and a bar code reader 12 , both connected to a usb 20 . the rfid reader 14 and bar code reader 12 are logically addressed without the use of an internal hub ( such as used in the embodiment shown in fig3 ). in the fig4 embodiment , the usb 20 supplies power from a host computer 30 and establishes a two - way communication link between the composite multiple technology data reader 10 b and the host computer . in a variation of the fig4 embodiment , the multiple technology data reader 10 b uses a complex interface implementation that is based on human interface device ( hid ) report descriptors , and is specific to hid class usb devices ( i . e . a keyboard , mouse , etc .). in all other respects , this variation operates in the same manner as the fig4 embodiment as described above . fig5 - 10 illustrate six alternative system architectures in accordance with a multiple technology data reader 10 such as shown in fig1 and described herein . in a first embodiment , as shown in fig5 the multiple technology data reader 100 includes a bar code reader subsystem 120 , and an rfid reader sub - system 140 , each serially connected to a device microcontroller 125 . the device microcontroller 125 includes a device interface 126 a for the bar code reader subsystem , and a device interface 126 b for the rfid reader subsystem , each of which is connected to a device communications , control and power unit 160 . the multiple technology data reader 100 also includes a trigger unit 170 , which sends and receives control signals and power , both to and from the device communications , control and power unit 160 on the device microcontroller 125 . the device microcontroller 125 is connected to a host computer 130 via usb 150 . in the embodiment shown in fig5 the reader device interfaces 126 a has an input / output endpoint zero 110 a , which enables the host computer 130 to use a default control method to initialize and configure the reader device interface 126 a . in addition , the reader device interface 126 a has an endpoint one 111 , which allows the host computer 130 to send data to the reader device interface 126 a , and an endpoint 112 , which allows the reader device interface 126 a to send data to the host computer 130 . furthermore , data can be sent in either direction between the reader device interface 126 a and the barcode reader subsystem 120 via a serial communication line 105 a . in a similar manner , reader device interface 126 b has an input / output endpoint zero 110 b , which enables the host computer to use a default control method to initialize and configure the reader device interface 126 b . in addition , endpoint three 113 and endpoint four 114 , respectively allow the host computer to send data to the reader device interface 126 b , and the reader device interface 126 b to send data to the host computer . data can be sent in either direction between the reader device interface 126 b and the rfid reader subsystem 140 via the serial communication line 105 b . this first embodiment is an example of how the multiple technology data reader 300 may be readily implemented using off - the - shelf components . in a second embodiment , as shown in fig6 the multiple technology data reader 200 includes the optical and analog front end components of a bar code reader 220 , and the antenna and transmitter / receiver components of an rfid reader 240 , which are connected to a device microcontroller 225 . the device microcontroller 225 includes a decoder and control unit 228 a for the bar code reader , and another decoder and control unit 228 b for the rfid reader . the decoder and control units 228 a and 228 b are each connected to a device communications , control and power unit 260 . the multiple technology data reader 200 also includes a trigger unit 270 , which sends and receives control signals and power , both to and from the device communications , control and power unit 260 on the device microcontroller 225 . the device microcontroller 225 is connected to a host computer 230 via usb 250 . in the embodiment shown in fig6 the bar code decoder and control unit 228 a has the same endpoints as the reader device interface 126 a described in fig5 . likewise , the rfid decoder and control unit 228 b has the same endpoints as the reader device interface 126 b described in fig5 . in a third embodiment , as shown in fig7 the multiple technology data reader 300 includes the optical and analog front end components of a bar code reader 320 , and the antenna and transmitter / receiver of an rfid reader 340 , which are connected to a device microcontroller 325 . the device microcontroller 325 includes a bar code pre - processor 322 and an rfid pre - processor 324 , both of which are connected to a common decoding and control unit 328 . the decoding and control unit 328 is connected to a device communications , control and power unit 360 . the multiple technology data reader 300 also includes a trigger unit 370 , which sends and receives control signals and power , both to and from the device communications , control and power unit 360 on the device microcontroller 325 . the device microcontroller 325 is connected to a host computer 330 via usb 350 . in the embodiment shown in fig7 the decoding and control unit 328 has an input / output endpoint zero 310 , which enables the host computer to use a default control method to initialize and configure the decoding and control unit 328 . in addition the decoding and control unit 328 has four additional endpoints , which enable data to be sent to and from the host computer 330 . by integrating the bar code pre - processor 322 , the rfid pre - processor 324 , and the decoding and control unit 328 into the device microcontroller 325 , the manufacturing costs for the multiple technology data reader 300 may be reduced . moreover , integration of these components enables optimal performance from the multiple technology data reader 300 . in a fourth embodiment , as shown in fig8 the multiple technology data reader 800 includes a bar code reader sub - system 820 , and an rfid reader sub - system 840 , each serially connected to a bus add - on card 825 . the bus add - on card 825 includes a device interface 826 a for the bar code reader subsystem , and a device interface 826 b for the rfid reader subsystem , each of which is connected to a device communications , control and power unit 860 . the multiple technology data reader 800 also includes a trigger unit 870 , which sends and receives control signals and power , both to and from the device communications , control and power unit 860 on the bus add - on card 825 . the bus add - on card 825 is connected to a host computer 830 via a computer bus 850 . the computer bus 850 may be any one of a variety of computer buses , including parallel or serial buses . in the embodiment shown in fig8 the reader device interfaces 826 a has a controls input line 810 a , which enables the host computer 830 to send control commands to the reader device interface 826 a . in addition , the reader device interface 826 a has a data output line 812 , which allows the reader device interface 826 a to send data to the host computer 830 . furthermore , data can be sent in either direction between the reader device interface 826 a and the barcode reader subsystem 820 via a serial communication line 805 a . in a similar manner , reader device interface 826 b has a controls line 810 b , which enables the host computer 830 to send control commands to the reader device interface 826 b . in addition , the reader device interface 826 b has a data line 812 b , which allows the reader device interface 826 b to send data to the host computer 830 . data can be sent in either direction between the reader device interface 126 b and the rfid reader subsystem 840 via the serial communication line 805 b . in a fifth embodiment , as shown in fig9 the multiple technology data reader 900 includes the optical and analog front end components of a bar code reader 920 , and the antenna and transmitter / receiver components of an rfid reader 940 , which are connected to a device bus add - on card 925 . the bus add - on card 925 includes a decoder and control unit 928 a for the bar code reader , and another decoder and control unit 928 b for the rfid reader . the decoder and control units 928 a and 928 b are each connected to a device communications , control and power unit 960 . the multiple technology data reader 900 also includes a trigger unit 970 , which sends and receives control signals and power , both to and from the device communications , control and power unit 960 on the bus add - on card 925 . the bus add - on card 925 is connected to a host computer 930 via a computer bus 950 . the computer bus 950 may be any one of a variety of computer buses , including parallel or serial buses . in the embodiment shown in fig9 the bar code decoder and control unit 928 a has the same input and output lines as the reader device interface 826 a described in fig8 . likewise , the rfid decoder and control unit 228 b has the same input and output lines as the reader device interface 826 b described in fig8 . in a sixth embodiment , as shown in fig1 , the multiple technology data reader 1000 includes the optical and analog front end components of a bar code reader 1020 , and the antenna and transmitter / receiver of an rfid reader 1040 , which are connected to a bus add - on card 925 . the bus add - on card 925 includes a bar code pre - processor 1022 and an rfid pre - processor 1024 , both of which are connected to a common decoding and control unit 1028 . the decoding and control unit 1028 is connected to a device communications , control and power unit 1060 . the multiple technology data reader 1000 also includes a trigger unit 1070 , which sends and receives control signals and power , both to and from the device communications , control and power unit 1060 on the bus add - on card 925 . the bus add - on card 925 is connected to a host computer 1030 via a computer bus 1050 . the computer bus 1050 may be any one of a variety of computer buses , including parallel or serial buses . in the embodiment shown in fig1 , the decoding and control unit 1028 has a controls input line 1010 , which enables the host computer to send control commands to the decoding and control unit 1028 . in addition the decoding and control unit 1028 has a data output line 1012 , which enables data to be sent from the decoding and control unit 1028 to the host computer 1030 . in any of the embodiments depicted in fig5 - 7 , the device communications , control and power unit 16 may be used to activate the bar code reader 12 and the rfid reader 14 independently , simultaneously or concurrently . in one embodiment , the device may be configured such that when a user pulls a trigger ( not shown ) on the outer body of the multiple technology data reader 10 , one of the following actions is initiated : ( 1 ) the bar code reader 12 alone is activated ; ( 2 ) the rfid reader 14 alone is activated ; or ( 3 ) both the bar code reader 12 and the rfid reader 14 are activated . alternatively , when a user pulls the trigger located on the outer body of the multiple technology data reader 10 , the bar code reader 12 is briefly activated to test for the presence of a bar code symbol . the presence of a bar code symbol may be indicated by the satisfaction of certain pre - set , user - defined criteria from among the following possible conditions : ( a ) presence of certain levels of reflected light ( i . e . from laser , led or ambient sources ); or ( b ) presence of certain light modulation in response to printed symbols . if the test conditions are satisfied , then the bar code reader 12 remains activated until the trigger is released or a bar code is detected . alternatively , if the test conditions are not satisfied , then the rfid reader 14 is activated for a pre - configured test or read operation . in yet another alternative embodiment , the device may be configured such that when a user pulls the trigger located on the outer body of the multiple technology data reader 10 , the rfid reader 14 is briefly activated to test for the presence of an rfid tag based on the following set of pre - defined , user specified criteria : ( a ) return signals are detected that appear to be from decodable radio tags ; or ( b ) packets of data are received which match certain pre - selected protocols . if the test conditions are satisfied , then the rfid reader 14 remains activated until the trigger is released or an rfid tag is detected . alternatively , if the test conditions are not satisfied , then the bar code reader 12 is activated for a pre - configured test or read operation . in any of the embodiments depicted in fig5 - 7 , the user may specify which type of rfid tags should be read , and which should be ignored . for example , it is well known by those in the art that read / write tags can send an identification code , via a response signal , with multiple fields . the user may specify that the rfid reader 14 remain activated only if certain fields of the identification code sent by the rfid tag match user - defined criteria . in addition , the user can also specify that the rfid reader 14 remain activated only if it appears that there is a single rfid tag in the read area . for instance , if there are multiple rfid tags in the read area , each rfid tag will send a response signal back to the rfid reader 14 . generally , when this occurs there will be a collision between the multiple response signals . in this case , the user may specify that the rfid reader 14 be deactivated if such a collision is detected . in the case where multiple rfid tags are detected by the rfid reader 14 , there may be an ambiguity as to which rfid tag is being read . to solve this problem , both an rfid tag and a bar code label may be placed on items to be identified . then to avoid reading the wrong rfid tag , or having to physically separate the rfid tags , bar code reader operation may be automatically invoked instead when two or more rfid tags are detected . by activating the bar code reader 12 automatically , the user is able to obtain more precise and accurate information . one advantage of this method of combining two automatic identification technologies into a single device is that the user is assured that a more accurate and reliable method of data acquisition is being employed for the specific task being performed . while embodiments and applications of the present invention have been shown and described , it will be apparent to one skilled in the art that other modifications , alternatives and variations are possible without departing from the inventive concepts set forth herein . therefore , the invention is intended to embrace all such modifications , alternatives and variations that fall within the scope and spirit of the appended claims . | 6 |
referring to fig1 , a transmission 10 is schematically depicted . the transmission 10 includes a first planetary gearset 12 , a second planetary gearset 14 , and a third planetary gearset 16 . each of the first , second , and third planetary gearsets have respective first , second , and third members . more specifically , the first planetary gearset includes a sun gear member 18 , a ring gear member 20 , and a planet carrier assembly member 22 . planet carrier assembly member 22 rotatably supports a plurality of planet gear members 24 that meshingly engage sun gear member 18 and ring gear member 20 . the second planetary gearset 14 includes a sun gear member 26 , a ring gear member 28 , and a planet carrier assembly member 30 . planet carrier assembly member 30 rotatably supports a plurality of planet gear members 32 that meshingly engage sun gear member 26 and ring gear member 28 . the third planetary gearset 16 includes a sun gear member 34 , a ring gear member 36 , and a planet carrier assembly member 38 . planet carrier assembly member 38 rotatably supports a plurality of planet gear members 40 that meshingly engage sun gear member 34 and ring gear member 36 . shaft 42 is an interconnecting member that continuously connects sun gear members 26 and 34 for unitary rotation . input member 44 is connectable to an engine ( not shown ), either directly or through a torque convertor . output member 46 is connectable to the final drive system of a vehicle to drive wheels or other tractive device . interconnecting member 48 continuously interconnects the input member 44 and sun gear member 18 for unitary rotation . transmission 10 also includes a stationary member such as transmission housing 50 . ring gear member 20 is continuously grounded to the housing 50 to prevent rotation of ring gear member 20 . planet carrier assembly member 30 is continuously connected to ring gear member 36 for unitary rotation . output member 46 is continuously connected to planet carrier assembly member 38 for unitary rotation . the transmission 10 further includes a plurality of selectively engageable torque transmitting devices , or clutches c 1 - c 7 . clutch c 1 selectively couples sleeve 48 , input member 44 , and sun gear member 18 to sun gear member 26 and sun gear member 34 for unitary rotation . clutch c 2 selectively couples sleeve 48 , input member 44 , and sun gear member 18 to planet carrier assembly member 30 and ring gear member 36 for unitary rotation . clutch c 3 selectively couples planet carrier assembly member 22 with ring gear member 28 for unitary rotation . clutch c 4 is a brake that selectively couples ring gear member 28 to the housing 50 . clutch c 5 is a brake that selectively couples ring gear member 36 and planet carrier assembly member 30 to the housing 50 . clutch c 6 selectively couples planet carrier assembly member 22 to planet carrier assembly member 30 and ring gear member 36 for unitary rotation . clutch c 7 is a brake that selectively couples sun gear member 26 and sun gear member 34 to the housing 50 . referring to fig2 , a shift logic sequence for clutches c 1 - c 7 is depicted that provides eight forward speed ratios and one reverse speed ratio between the input member 44 and the output member 46 . referring to fig1 and 2 , a first forward speed ratio is achieved when clutches c 3 and c 7 are engaged . a second forward speed ratio is achieved when clutches c 6 and c 7 are engaged . a third forward speed ratio is achieved when clutches c 3 and c 6 are engaged . a fourth forward speed ratio is achieved when clutches c 1 and c 6 are engaged . a fifth forward speed ratio is achieved when clutches c 1 and c 3 are engaged . a sixth forward speed ratio is achieved when clutches c 1 and c 2 are engaged . a seventh forward speed ratio is achieved when clutches c 2 and c 3 are engaged . an eighth forward speed ratio is achieved when clutches c 2 and c 4 are engaged . a reverse speed ratio is achieved when clutches c 3 and c 5 are engaged . it should be noted that the omission of clutch c 4 yields a six clutch / seven speed transmission , i . e ., speed ratios 1 - 7 . in the embodiment depicted , ring gear members 20 , 28 , and 36 each have 81 teeth , sun gear member 18 has 51 teeth , sun gear member 26 has 49 teeth , and sun gear member 34 has 31 teeth . referring to fig3 , an alternative transmission 110 is schematically depicted . the transmission 110 includes a first planetary gearset 112 , a second planetary gearset 114 , and a third planetary gearset 116 . each of the first , second , and third planetary gearsets have respective first , second , and third members . more specifically , the first planetary gearset includes a sun gear member 118 , a ring gear member 120 , and a planet carrier assembly member 122 . planet carrier assembly member 122 is compound and thus rotatably supports a first set of planet gear members 124 a that meshingly engage sun gear member 118 . planet carrier assembly member 122 also rotatably supports a second set of planet gear members 124 b that meshingly engage the first set of planet gear members 124 a and ring gear member 120 . the second planetary gearset 114 includes a sun gear member 126 , a ring gear member 128 , and a planet carrier assembly member 130 . planet carrier assembly member 130 rotatably supports a plurality of planet gear members 132 that meshingly engage sun gear member 126 and ring gear member 128 . the third planetary gearset 116 includes a sun gear member 134 , a ring gear member 136 , and a planet carrier assembly member 138 . planet carrier assembly member 138 rotatably supports a plurality of planet gear members 140 that meshingly engage sun gear member 134 and ring gear member 136 . shaft 142 is an interconnecting member that continuously connects sun gear members 126 and 134 for unitary rotation . interconnecting member 148 continuously interconnects the input member 144 and sun gear member 118 for unitary rotation . transmission 110 also includes a stationary member such as transmission housing 150 . planet carrier assembly member 122 is continuously grounded to the housing 150 to prevent rotation of planet carrier assembly member 122 . planet carrier assembly member 130 is continuously connected to ring gear member 136 for unitary rotation . output member 146 is continuously connected to planet carrier assembly member 138 for unitary rotation . the transmission 110 further includes a plurality of selectively engageable torque transmitting devices , or clutches c 1 - c 7 . clutch c 1 selectively couples sleeve 148 , input member 144 , and sun gear member 118 to sun gear member 126 and sun gear member 134 for unitary rotation . clutch c 2 selectively couples sleeve 148 , input member 144 , and sun gear member 118 to planet carrier assembly member 130 and ring gear member 136 for unitary rotation . clutch c 3 selectively couples ring gear member 120 with ring gear member 128 for unitary rotation . clutch c 4 is a brake that selectively couples ring gear member 128 to the housing 150 . clutch c 5 is a brake that selectively couples ring gear member 136 and planet carrier assembly member 130 to the housing 150 . clutch c 6 selectively couples ring gear member 120 to planet carrier assembly member 130 and ring gear member 136 for unitary rotation . clutch c 7 is a brake that selectively couples sun gear member 126 and sun gear member 134 to the housing 150 . referring to fig4 , a shift logic sequence for clutches c 1 - c 7 is depicted that provides eight forward speed ratios and one reverse speed ratio between the input member 144 and the output member 146 . the clutch engagement sequence of fig4 is identical to that of fig2 , but different speed ratios between input member 144 and output member 146 are achieved . in the embodiment depicted , ring gear member 120 has 80 teeth , sun gear member has 40 teeth , ring gear members 128 and 136 each have 81 teeth , sun gear member 126 has 41 teeth , and sun gear member 134 has 31 teeth . referring to fig5 , transmission 210 includes a first planetary gearset 212 , a second planetary gearset 214 , and a third planetary gearset 216 . each of the first , second , and third planetary gearsets have respective first , second , and third members . more specifically , the first planetary gearset includes a sun gear member 218 , a ring gear member 220 , and a planet carrier assembly member 222 . planet carrier assembly member 222 is compound and thus rotatably supports a first set of planet gear members 224 a that meshingly engage sun gear member 218 . planet carrier assembly member 222 also rotatably supports a second set of planet gear members 224 b that meshingly engage the first set of planet gear members 224 a and ring gear member 220 . the second planetary gearset 214 includes a sun gear member 226 , a ring gear member 228 , and a planet carrier assembly member 230 . planet carrier assembly member 230 rotatably supports a plurality of planet gear members 232 that meshingly engage sun gear member 226 and ring gear member 228 . the third planetary gearset 216 includes a sun gear member 234 , a ring gear member 236 , and a planet carrier assembly member 238 . planet carrier assembly member 238 rotatably supports a plurality of planet gear members 240 that meshingly engage sun gear member 234 and ring gear member 236 . shaft 242 is an interconnecting member that continuously connects sun gear members 226 and 234 for unitary rotation . interconnecting member 248 continuously interconnects the input member 244 and planet carrier assembly member 222 for unitary rotation . transmission 210 also includes a stationary member such as transmission housing 250 . sun gear member 218 is continuously grounded to the housing 250 to prevent rotation of sun gear member 218 . planet carrier assembly member 230 is continuously connected to ring gear member 236 for unitary rotation . output member 246 is continuously connected to planet carrier assembly member 238 for unitary rotation . the transmission 210 further includes a plurality of selectively engageable torque transmitting devices , or clutches c 2 - c 8 . clutch c 1 as found in the transmissions 10 , 110 of fig1 and 3 , respectively , i . e ., selectively interconnecting an input member and a member of the first planetary gearset with the sun gear members of the second and third planetary gearsets , is not present in transmission 210 . clutch c 2 selectively couples sleeve 248 , input member 244 , and planet carrier assembly member 222 to planet carrier assembly member 230 and ring gear member 236 for unitary rotation . clutch c 3 selectively couples ring gear member 220 with ring gear member 228 for unitary rotation . clutch c 4 is a brake that selectively couples ring gear member 228 to the housing 250 . clutch c 5 is a brake that selectively couples ring gear member 236 and planet carrier assembly member 230 to the housing 250 . clutch c 6 selectively couples ring gear member 220 to planet carrier assembly member 230 and ring gear member 236 for unitary rotation . clutch c 7 is a brake that selectively couples sun gear member 226 and sun gear member 234 to the housing 250 . clutch c 8 selectively couples planet carrier assembly member 222 , member 248 , and input member 244 with ring gear member 228 for unitary rotation . in the embodiment depicted , ring gear members 220 , 228 , and 236 each have 81 teeth , and sun gear member 218 has 39 teeth , sun gear member 226 has 37 teeth , and sun gear member 234 has 26 teeth . fig6 depicts a preferred shift logic to provide seven forward speed ratios between the input member 244 and the output member 246 , and one reverse speed ratio . referring to fig5 and 6 ; a first speed ratio is achieved when clutchs c 3 and c 7 are engaged ; a second speed ratio is achieved when clutches c 6 and c 7 are engaged ; a third speed ratio is achieved when clutches c 8 and c 7 are engaged ; a fourth speed ratio is achieved when clutches c 2 and c 7 are engaged ; a fifth speed ratio is achieved when clutched c 8 and c 2 are engaged ; a sixth speed ratio is achieved when clutches c 2 and c 3 are engaged ; and a seventh speed ratio is achieved when clutches c 2 and c 4 are engaged . a reverse speed ratio is achieved when clutches c 3 and c 5 are engaged . clutch c 4 may be omitted , whereby six forward speed ratios are provided . referring to fig7 , transmission 310 includes a first planetary gearset 312 , a second planetary gearset 314 , and a third planetary gearset 316 . each of the first , second , and third planetary gearsets have respective first , second , and third members . more specifically , the first planetary gearset includes a sun gear member 318 , a ring gear member 320 , and a planet carrier assembly member 322 . planet carrier assembly member 322 rotatably supports planet gear members 324 that meshingly engage sun gear member 318 and ring gear member 320 . the second planetary gearset 314 includes a sun gear member 326 , a ring gear member 328 , and a planet carrier assembly member 330 . planet carrier assembly member 330 rotatably supports a plurality of planet gear members 332 that meshingly engage sun gear member 326 and ring gear member 328 . the third planetary gearset 316 includes a sun gear member 334 , a ring gear member 336 , and a planet carrier assembly member 338 . planet carrier assembly member 338 rotatably supports a plurality of planet gear members 340 that meshingly engage sun gear member 334 and ring gear member 336 . shaft 342 is an interconnecting member that continuously connects sun gear members 326 and 334 for unitary rotation . interconnecting member 348 continuously interconnects the input member 344 and ring gear member 320 for unitary rotation . transmission 310 also includes a stationary member such as transmission housing 350 . sun gear member 318 is continuously grounded to the housing 350 to prevent rotation of sun gear member 318 . planet carrier assembly member 330 is continuously connected to ring gear member 336 for unitary rotation . output member 346 is continuously connected to planet carrier assembly member 338 for unitary rotation . the transmission 310 further includes a plurality of selectively engageable torque transmitting devices , or clutches c 1 - c 7 . clutch c 1 selectively couples sleeve 348 , input member 344 , and ring gear member 320 to shaft 342 , sun gear member 326 and sun gear member 334 for unitary rotation . clutch c 2 selectively couples sleeve 348 , input member 344 , and ring gear member 320 to planet carrier assembly member 330 and ring gear member 336 for unitary rotation . clutch c 3 selectively couples planet carrier assembly member 322 with ring gear member 328 for unitary rotation . clutch c 4 is a brake that selectively couples ring gear member 328 to the housing 350 . clutch c 5 is a brake that selectively couples ring gear member 336 and planet carrier assembly member 330 to the housing 350 . clutch c 6 selectively couples planet carrier assembly member 322 to planet carrier assembly member 330 and ring gear member 336 for unitary rotation . clutch c 7 is a brake that selectively couples shaft 342 , sun gear member 326 and sun gear member 334 to the housing 350 . in the embodiment depicted , ring - gear members 320 , 328 , and 336 each have 81 teeth , and sun gear member 318 has 51 teeth , sun gear member 326 has 41 teeth , and sun gear member 334 has 29 teeth . fig8 depicts a shift logic sequence to provide eight forward speed ratios between the input member 344 and the output member 346 , and one reverse speed ratio . the clutch engagement for the shift logic of fig8 is identical to the clutch engagement shown in fig2 . referring to fig9 , transmission 410 includes a first planetary gearset 412 , a second planetary gearset 414 , and a third planetary gearset 416 . each of the first , second , and third planetary gearsets have respective first , second , and third members . more specifically , the first planetary gearset includes a sun gear member 418 , a ring gear member 420 , and a planet carrier assembly member 422 . planet carrier assembly member 422 is compound and thus rotatably supports a first set of planet gear members 424 a and a second set of planet gear members 424 b . the first set of planet gear members 424 a meshingly engage sun gear member 418 , and the second set of planet gear members 424 b meshingly engage the first set of planet gear members 424 a and ring gear member 420 . the second planetary gearset 414 includes a sun gear member 426 , a ring gear member 428 , and a planet carrier assembly member 430 . planet carrier assembly member 430 rotatably supports a plurality of planet gear members 432 that meshingly engage sun gear member 426 and ring gear member 428 . the third planetary gearset 416 includes a sun gear member 434 , a ring gear member 436 , and a planet carrier assembly member 438 . planet carrier assembly member 438 rotatably supports a plurality of planet gear members 440 that meshingly engage sun gear member 434 and ring gear member 436 . shaft 442 is an interconnecting member that continuously connects sun gear members 426 and 434 for unitary rotation . input member 444 is continuously connected to sun gear member 418 for unitary rotation . transmission 410 also includes a stationary member such as transmission housing 450 . planet carrier assembly member 422 is continuously grounded to the housing 450 . planet carrier assembly member 430 is continuously connected to ring gear member 436 for unitary rotation . output member 446 is continuously connected to planet carrier assembly member 438 for unitary rotation . the transmission 410 further includes a plurality of selectively engageable torque transmitting devices , or clutches c 1 - c 6 . clutch c 1 selectively couples input member 444 and sun gear member 418 to shaft 442 , sun gear member 426 and sun gear member 434 for unitary rotation . clutch c 2 selectively couples input member 444 and sun gear member 418 to planet carrier assembly member 430 and ring gear member 436 for unitary rotation . clutch c 3 selectively couples ring gear member 420 with ring gear member 428 for unitary rotation . clutch c 4 is a brake that selectively couples ring gear member 428 to the housing 450 . clutch c 5 is a brake that selectively couples ring gear member 436 and planet carrier assembly member 430 to the housing 450 . clutch c 6 selectively couples ring gear member 420 to planet carrier assembly member 430 and ring gear member 436 for unitary rotation . in the embodiment depicted , ring gear members 420 , 428 , and 436 each have 81 teeth , and sun gear member 418 has 35 teeth , sun gear member 426 has 35 teeth , and sun gear member 434 has 31 teeth . fig1 depicts a shift logic sequence to provide seven forward speed ratios between the input member 444 and the output member 446 , and one reverse speed ratio . a first speed ratio is achieved when clutches c 1 and c 5 are engaged ; a second speed ratio is achieved when clutches c 1 and c 4 are engaged ; a third speed ratio is achieved when clutches c 1 and c 6 are engaged ; a fourth speed ratio is achieved when clutches c 1 and c 3 are engaged ; a fifth speed ratio is achieved when clutches c 1 and c 2 are engaged ; a sixth speed ratio is achieved when clutches c 2 and c 3 are engaged ; and a seventh speed ratio is achieved when clutches c 2 and c 4 are engaged . a reverse speed ratio is achieved when clutches c 3 and c 5 are engaged . referring to fig1 , transmission 510 includes a first planetary gearset 512 , a second planetary gearset 514 , a third planetary gearset 516 , and a fourth planetary gearset 554 . each of the first , second , third , and fourth planetary gearsets have respective first , second , and third members . more specifically , the first planetary gearset includes a sun gear member 518 , a ring gear member 520 , and a planet carrier assembly member 522 . planet carrier assembly member 522 rotatably supports a plurality of planet gear members 524 that meshingly engage sun gear member 518 and ring gear member 520 . the second planetary gearset 514 includes a sun gear member 526 , a ring gear member 528 , and a planet carrier assembly member 530 . planet carrier assembly member 530 rotatably supports a plurality of planet gear members 532 that meshingly engage sun gear member 526 and ring gear member 528 . the third planetary gearset 516 includes a sun gear member 534 , a ring gear member 536 , and a planet carrier assembly member 538 . planet carrier assembly member 538 rotatably supports a plurality of planet gear members 540 that meshingly engage sun gear member 534 and ring gear member 536 . the fourth planetary gearset 554 includes a sun gear member 556 , a ring gear member 558 , and planet carrier assembly member 538 . planet carrier assembly member 538 is common to the third and fourth planetary gearsets 516 , 554 , and thus the planet carrier assemblies of the third and fourth planetary gearsets 516 , 554 are continuously connected for unitary rotation . alternatively , and within the scope of the claimed invention , the third and fourth planetary gearsets may employ separate , interconnected planet carrier assembly members . planet carrier assembly 538 rotatably supports a plurality of planet gear members 560 that meshingly engage sun gear member 556 and ring gear member 558 . shaft 542 is an interconnecting member that continuously connects sun gear members 526 , 534 , and 556 for unitary rotation . input member 544 is continuously connected to sun gear member 518 for unitary rotation . transmission 510 also includes a stationary member such as transmission housing 550 . ring gear member 520 is continuously grounded to the housing 550 . planet carrier assembly member 530 is continuously connected to ring gear member 536 for unitary rotation . output member 546 is continuously connected to planet carrier assembly member 538 for unitary rotation . the transmission 510 further includes a plurality of selectively engageable torque transmitting devices , or clutches c 1 - c 7 . clutch c 1 selectively couples input member 544 and sun gear member 518 to shaft 542 , sun gear member 526 , sun gear member 534 , and sun gear member 556 for unitary rotation . clutch c 2 selectively couples input member 544 and sun gear member 518 to planet carrier assembly member 530 and ring gear member 536 for unitary rotation . clutch c 3 selectively couples planet carrier assembly member 522 with ring gear member 528 for unitary rotation . clutch c 4 is a brake that selectively couples ring gear member 528 to the housing 550 . clutch c 5 is a brake that selectively couples ring gear member 536 and planet carrier assembly member 530 to the housing 550 . clutch c 6 selectively couples planet carrier assembly member 522 to planet carrier assembly member 530 and ring gear member 536 for unitary rotation . clutch c 7 is a brake that selectively couples ring gear member 558 to the housing 550 . in the embodiment depicted , ring gear members 520 , 528 , 536 , and 558 each have 85 teeth , and sun gear member 518 has 55 teeth , sun gear member 526 has 37 teeth , sun gear member 534 has 29 teeth , and sun gear member 556 has 45 teeth . fig1 depicts a shift logic sequence to provide eight forward speed ratios between the input member 544 and the output member 546 , and one reverse speed ratio . a first speed ratio is achieved when clutches c 1 and c 5 are engaged ; a second speed ratio is achieved when clutches c 1 and c 7 are engaged ; a third speed ratio is achieved when clutches c 1 and c 4 are engaged ; a fourth speed ratio is achieved when clutches c 1 and c 6 are engaged ; a fifth speed ratio is achieved when clutches c 1 and c 3 are engaged ; a sixth speed ratio is achieved when clutches c 1 and c 2 are engaged ; a seventh speed ratio is achieved when clutches c 2 and c 3 are engaged ; and an eighth speed ratio is achieved when clutches c 2 and c 4 are engaged . a reverse speed ratio is achieved when clutches c 3 and c 5 are engaged . fig1 depicts a shift logic sequence for use with the transmission 510 of fig1 that does not employ clutches c 6 and c 7 . referring to fig1 and 13 , a first speed ratio is achieved when clutches c 1 and c 5 are engaged ; a second speed ratio is achieved when clutches c 1 and c 4 are engaged ; a third speed ratio is achieved when clutches c 1 and c 3 are engaged ; a fourth speed ratio is achieved when clutches c 1 and c 2 are engaged ; a fifth speed ratio is achieved when clutches c 2 and c 3 are engaged ; and a sixth speed ratio is achieved when clutches c 2 and c 4 are engaged . a reverse speed ratio is achieved when clutches c 3 and c 5 are engaged . referring to fig1 , transmission 610 includes a first planetary gearset 612 , a second planetary gearset 614 , a third planetary gearset 616 , and a fourth planetary gearset 654 . each of the first , second , third , and fourth planetary gearsets have respective first , second , and third members . more specifically , the first planetary gearset includes a sun gear member 618 , a ring gear member 620 , and a planet carrier assembly member 622 . planet carrier assembly member 622 rotatably supports a first set of planet gear members 624 a that meshingly engage sun gear member 618 ; planet carrier assembly member 622 also rotatably supports a second set of planet gear members 624 b that meshingly engage the first set of planet gear members 624 a and ring gear member 620 . the second planetary gearset 614 includes a sun gear member 626 , a ring gear member 628 , and a planet carrier assembly member 630 . planet carrier assembly member 630 rotatably supports a plurality of planet gear members 632 that meshingly engage sun gear member 626 and ring gear member 628 . the third planetary gearset 616 includes a sun gear member 634 , a ring gear member 636 , and a planet carrier assembly member 638 . planet carrier assembly member 638 rotatably supports a plurality of planet gear members 640 that meshingly engage sun gear member 634 and ring gear member 636 . the fourth planetary gearset 654 includes a sun gear member 656 , a ring gear member 658 , and planet carrier assembly member 638 . planet carrier assembly member 638 rotatably supports a plurality of planet gear members 660 that meshingly engage sun gear member 656 and ring gear member 658 . shaft 642 is an interconnecting member that continuously connects sun gear members 626 , 634 , and 656 for unitary rotation . input member 644 is continuously connected to sun gear member 618 for unitary rotation . transmission 610 also includes a stationary member such as transmission housing 650 . planet carrier assembly member 622 is continuously grounded to the housing 650 . planet carrier assembly member 630 is continuously connected to ring gear member 636 for unitary rotation . output member 646 is continuously connected to planet carrier assembly member 638 for unitary rotation . the transmission 610 further includes a plurality of selectively engageable torque transmitting devices , or clutches c 1 - c 7 . clutch c 1 selectively couples input member 644 and sun gear member 618 to shaft 642 , sun gear member 626 , sun gear member 634 , and sun gear member 656 for unitary rotation . clutch c 2 selectively couples input member 644 and sun gear member 618 to planet carrier assembly member 630 and ring gear member 636 for unitary rotation . clutch c 3 selectively couples ring gear 620 with ring gear member 628 for unitary rotation . clutch c 4 is a brake that selectively couples ring gear member 628 to the housing 650 . clutch c 5 is a brake that selectively couples ring gear member 636 and planet carrier assembly member 630 to the housing 650 . clutch c 6 selectively couples ring gear member 620 to planet carrier assembly member 630 and ring gear member 636 for unitary rotation . clutch c 7 is a brake that selectively couples ring gear member 658 to the housing 650 . in the embodiment depicted , ring gear members 620 has 80 teeth and ring gear members 628 , 636 , and 658 each have 85 teeth ; sun gear member 618 has 35 teeth , sun gear member 626 has 24 teeth , sun gear member 634 has 29 teeth , and sun gear member 656 has 47 teeth . fig1 schematically depicts a shift logic sequence for use with the transmission 610 of fig1 to achieve eight forward speed ratios and one reverse speed ratio between the input member 644 and the output member 646 . the clutch engagement sequence of fig1 is identical to the clutch engagement sequence of fig1 . while the best modes for carrying out the invention have been described in detail , those familiar with the art to which this invention relates will recognize various alternative designs and embodiments for practicing the invention within the scope of the appended claims . | 5 |
referring to the drawings of fig1 an intermittent alert and alarm clock device 10 designates one complete assembly of the invention . the invention comprises a clock housing 20 , formed from rigid plastic , such as abs resin . disposed on housing 20 are push button minute setting ( or count - up ) switch 21 , push button hour setting ( or count - up ) switch 22 , and push button alarm stop switch 25 . push button alarm stop switch 25 also serves as a light switch . also disposed on housing 20 are a 3 - position slide time setting switch 23 having a stop position 23a for setting the clock , a stop position 23b for setting the alarm and a stop position 23c for locking all time setting modes , and a 3 - position slide alarm mode switch 24 having a stop position 24a for arming the intermittent alert mode , a stop position 24b for arming the alarm mode and a stop position 24c for disarming all modes . set in the face of housing 20 is liquid crystal display ( lcd ) 26 having appropriate alphanumeric displays indicating the current time and whether the alarm is armed . closure of switch 25 activates a light ( not shown ) which illuminates lcd 26 thus permitting viewing in environments with little or no lighting . the clock itself is a standard digital alarm clock . the model utilized in the invention is sold by general time corporation , inc . attached to housing 20 is an alarm mechanism generally designated as alarm mechanism 30 . alarm mechanism 30 comprises a housing 31 , formed from rigid plastic , such as abs resin , wherein housing 31 has an opening 32 for emitting the sound generated by alarm mechanism 30 . rotatably attached adjacent opening 32 is shutter 34 which can be adjusted to regulate the size of opening 32 . encased within housing 31 is a standard piezoelectric buzzer 33 which is simply constructed and can produce a loud sound with comparatively low power consumption . the specifics of piezoelectric buzzer 33 will not be further described except for the operating parameters required by the invention . leads 38 , 39 run between the alarm mechanism 30 and battery connector 40 disposed for receiving the electrical contacts ( not shown ) of a standard 9 volt battery 42 . battery holder 44 secures battery 42 and is attached to housing 20 adjacent alarm mechanism 30 . clock housing 20 can be split in a conventional manner to allow disassembly and reassembly of the housing to provide access to the interior of the clock housing . disposed in clock housing 20 is the electronic power circuity 6 ( schematically illustrated in fig3 ) of the present invention , as well as digital alarm clock circuitry 8 found in conventional digital alarm clock modules . the digital alarm clock circuitry 8 functions as timing circuit and generates an output signal which is received by the electronic power circuitry 6 of the present invention . the digital alarm clock circuitry 8 is not an aspect of the present invention and is not further described herein . the purpose of electronic power circuitry 6 is to ensure that no current backflow reaches alarm clock circuitry 8 . fig2 . shows another embodiment of the invention . replacing battery connector 40 and 9 volt battery 42 at the end of leads 38 , 39 is a standard 12 volt automotive cigarette lighter adapter 46 which is adapted to be inserted into a standard cigarette lighter socket 80 on a standard automotive vehicle so as to connect with a 12 volt battery of the automobile . the cigarette lighter is provided with the necessary connections ( not shown ) for connecting with the output voltage in the standard socket ( not shown ) referred to above . the cigarette lighter adaptor 46 provides a 12 volt dc source of power for alarm mechanism 30 through leads 38 , 39 . electronic power circuity 6 can be adapted to operate with a 12 volt power source for alarm mechanism 30 . of course , battery holder 44 is not required when the 12 volt embodiment of the invention is practiced . turning to fig3 electronic power circuitry 6 ( fig1 ) of the present 9 volt embodiment of the invention is schematically illustrated . with the exception of the piezoelectric buzzer 33 , 9 volt battery 42 and alarm clock circuitry 8 , all the elements shown in fig3 are mounted on a printed circuit board which is mounted into the interior of housing 20 . the electronic power circuitry 6 comprises signal input terminals 66 , 68 , power output terminals 70 , 72 , power input terminals 74 , 76 , transistors 62 , 64 , capacitors 59 , 60 , and resistors 52 , 56 and 58 . the arrangement depicts a two - stage transistor amplifier in which resistor 52 is used to limit the input current to the base of transistor 62 and resistors 56 , 58 are used to limit the input current to the base of transistor 64 . power from 9 volt battery 42 is received across terminals 74 , 76 from leads 38 , 39 . output signals generated by electronic clock circuitry 8 are received across terminals 66 , 68 . power output terminals 70 , 72 are connected to the piezoelectric buzzer 33 . when a signal is received across terminals 66 , 68 , capacitor 59 discharges , generating a signal which is received by the base of transistor 62 , causing transistor 62 to activate . when transistor 62 activates it produces a signal which is received by capacitor 60 . the 9 volt power signal received across terminals 74 , 76 will be transmitted to power output terminals 70 , 72 and activate piezoelectric buzzer 33 when capacitor 60 discharges in response to output from transistor 62 . this arrangement prevents power from the 9 volt input across power input terminals 74 , 76 from backflowing through terminals 66 , 68 and damaging alarm clock circuit 8 . alarm clock circuit 8 performs in the conventional manner . its power is received from two 1 . 5 volt batteries ( not shown ). the clock time can be set by adjusting switch 23 to stop position 23a and simultaneous closure of switches 21 or 22 . similarly , the alarm time can be preselected by adjusting switch 23 to stop position 23b and simultaneous closure of switches 21 or 22 . once the clock time and the alarm time are set , switch 23 can be moved to position 23c to prevent accidently altering either the clock time or the alarm time . the intermittent alert mode of the device can be activated by moving switch 24 to position 24a . the alarm mode of the device can be activated by moving switch 24 to position 24b . if neither the intermittent alert or alarm modes are desired , moving switch 24 to position 24c disarms both modes . if the intermittent alert mode of the invention is armed , alarm clock circuit 8 will generate a signal across input terminals 66 , 68 when a preselected time is attained . this will cause the electronic power circuitry 6 to direct the power across input terminal 74 76 to power output terminal 70 , 72 , which , in turn , will activate piezoelectric buzzer 33 of alarm device 30 . alarm device 30 will produce two - tone , intensity - variable signal of at least 50 db . in the preferred embodiment , alarm device 30 can produce a 100 db signal . this signal is much louder than other sounds which are typically present in the cab of diesel trucks , thus permitting one to clearly hear the alarm when it activates . the intensity of the signal can be varied from 60 db to 100 db by altering the position of rotatable shutter 34 over opening 32 . fully closed , the device will produce a signal of approximately 60 db ; fully opened , the device will produce a signal of approximately 100 db . if the device is in intermittent alert mode , closure of switch 25 will re - set alarm clock circuitry 8 to again generate a signal across input terminals 66 , 68 after four minutes have elapsed . this intermittent alert process can continue in four minute intervals for as long as the user desires . when the alarm mode is armed , alarm clock circuitry 8 will also generate a signal across terminals 66 , 68 when a preselected time is attained . in this case , however , closure of switch 25 will deactivate the alarm mode , resulting in termination of power to piezoelectric buzzer 33 of alarm mechanism 30 . the circuitry shown in fig3 will prevent the power for the piezoelectric buzzer 30 from interfering with the alarm clock circuitry 8 by backflowing across input terminals 66 , 68 . the circuitry of the present invention is necessary because the components of the invention , namely piezoelectric buzzer 33 and alarm clock circuitry 8 , require different amounts of power to operate properly . as mentioned above , alarm clock circuitry 8 is powered by two 1 . 5 volt batteries , while the piezoelectric buzzer 33 is powered by a 9 volt battery . alarm clock circuitry 8 may malfunction if the power required for the piezoelectric buzzer 33 is fed into the alarm clock circuitry 8 . in this embodiment , the power source for both alarm clock circuitry 8 and piezoelectric buzzer 33 is self - contained , permitting mobility . fig4 illustrates the electronic power circuity 6 ( fig2 ) required for the 12 volt embodiment of the invention . in this embodiment , an additional resistor 54 is added to the 9 volt electronic power circuitry of fig3 . the 12 volt electronic power circuitry operates in the same way as the 9 volt circuitry . again , the purpose of the 12 volt circuitry is to prevent the power for the alarm mechanism from interfering with the clock circuitry . in yet another embodiment of the invention , a digital alarm clock having a light emitting diode ( led ) display replaces the lcd type digital alarm clock . the led display permits viewing in environments with little or no light , thus replacing the lighting function of switch 25 . although the above device is described for use by truck drivers and others operating motor vehicles , the device may be used equally well in any environment characterized by high sound levels . additionally , the device is suitable for use by hearing impaired individuals . an intermittent alert and alarm clock for use by truck drivers is described above . it will be understood that various other changes of the details , materials , steps , arrangements of parts , and uses , which have been herein described and illustrated in order to explain the nature of the invention , will occur to and may be made by those skilled in the art , upon reading this disclosure , and such changes are intended to be included within the principles and scope of this invention . | 6 |
referring now specifically to the drawings , there is illustrated a hole cutting device , generally designated as 10 , for accurately recovering targets located with a metal detector , wherein like reference numerals refer to like components throughout the drawings . as illustrated in fig1 through 3 , the hole cutting device 10 includes a cylindrical cutting tube 12 for cutting and removing a captured plug of grass and soil from the ground , and for subsequently reinserting the cut plug into its corresponding hole . the upper rim of the cylindrical cutting tube 12 includes a semicircular , concave indentation 14 for symmetrically receiving sections of a handle member 16 therein , wherein the handle member 16 is utilized to rotatably drive the cutting edge 18 of the cylindrical cutting tube 12 into the ground . as detailed hereinafter , a cylindrical hole is formed in the ground upon removal of the cylindrical cutting tube 12 and the captured plug . preferably , the opposing end sections of the handle are each enclosed within a soft , comfortable , dumbbell - shaped foam cover 20 which is designed to prevent or reduce operator hand slippage , thereby facilitating the operation of the hole cutting device 10 as the cylindrical cutting tube 12 is rotatably inserted into the ground . a hand actuated ejection mechanism , comprising a piston head 22 , a piston rod 24 and a ratcheting system 26 , is utilized to free the cylindrical cutting tube 12 from the ground after the reinsertion of the captured plug . the hand actuated ejection mechanism is bolted or otherwise suitably secured to a mounting bar 28 which spans the inner diameter of an upper portion of the cylindrical cutting tube 12 . the distal end of the piston rod 24 includes a head portion 30 having a diameter substantially larger than the diameter of the piston rod 24 . the head portion 30 may be fastened in any known manner to the end of the piston rod 24 or may be formed integrally therewith . preferably , the head portion 30 of the piston rod is symmetrically mounted to the piston head 22 using a plurality of rivets 32 or other fastening hardware . generally , i have found that at least three rivets 32 should be utilized to maintain the piston head 22 perpendicular to the piston rod 24 . the piston rod 24 includes a graduated upper portion 34 which serves the additional function of a depth indicator . specifically , the graduated upper portion 34 of the piston rod 24 incorporates a plurality of indicia 36 designed to provide an instantaneous indication of the depth of the tube cutting edge 18 as it is being driven into the ground . this function will be addressed further hereinbelow with reference to fig8 and 9 . disposed on the upper end of the piston rod 24 is a loop 38 for securing the hole cutting device 10 to the belt of an operator . the operation of the ratcheting system 26 is most clearly illustrated in fig4 and 5 . the ratcheting system 26 incorporates a stationary handle portion 40 , a movable handle portion 42 pivotable about pivot point 44 , and first and second biasing springs 46 and 48 , respectively , for biasing the movable handle portion 42 toward its forwardmost operational position ( fig4 ). a pair of apertured ratcheting bars 50 , each including an opening 52 having a diameter slightly larger than the diameter of the piston rod 24 , are utilized to selectively drive the piston rod 24 and attached piston head 22 longitudinally toward the cutting edge 18 of the cylindrical cutting tube 12 in response to a rearwardly directed displacement of the movable handle portion 42 . a piston locking mechanism 53 , comprising a piston rod engaging section 54 and a latch 56 , is provided to selectively limit the longitudinal displacement of the piston rod 24 within the cylindrical cutting tube 12 . the latch 56 is rotatably secured to the stationary handle portion 40 of the ratcheting system by a rivet 58 . the upper end of the piston rod engaging section 54 includes an opening 60 , having a diameter slightly larger than the diameter of the piston rod 24 , for slidably receiving the piston rod therethrough . as illustrated in fig4 the piston rod 24 and attached piston head 22 are freely displaceable longitudinally along the length of the cylindrical cutting tube 12 when the rotatable latch 56 is secured over the lower end of the piston rod engaging section 54 . in this configuration , the piston rod 24 is concentrically disposed within the openings 52 and 60 and , as depicted by direction arrow 62 , slides easily through each opening . accordingly , the piston head 22 is forced into the tube 12 , away from the tube cutting edge 18 , when pressure is applied against the bottom edge of the piston head 22 as the cutting edge 18 of the cylindrical cutting tube 12 is inserted into the ground ( fig8 and 9 ). of course , when the rotatable latch 56 is disengaged from the lower end of the piston rod engaging section 54 , the hole 60 is no longer concentric with the piston rod 24 . consequently , the upper and lower opposing surfaces of the hole 60 tightly engage the outer surface of the piston rod 24 , thereby limiting the displacement of the piston rod 24 within the cylindrical cutting tube 12 . when the movable handle portion 42 is pivoted in a rearward direction about pivot point 44 ( directional arrow 64 ), and the rotatable latch 56 is disengaged from the lower end of the piston rod engaging section 54 ( fig5 ), the pair of apertured ratcheting bars 50 are rotated about the piston bar 24 . as such , the upper and lower opposing surfaces of each bar opening 52 engage the outer surface of the piston bar 24 , thereby propelling the piston bar and attached piston head 22 forward ( directional arrow 66 ) toward the cutting edge 18 of the cylindrical cutting tube 12 . it should be noted that piston rod 24 is not freely movable within the cylindrical cutting tube 12 when the rotatable latch 56 in its disengaged position . however , the forwardly directed force provided by the rotation of the pair of apertured ratcheting bars 50 is sufficient to overcome the locking action of the piston locking mechanism 53 , thereby enabling the forward displacement of the piston head and rod 22 , 24 . upon the release of the movable handle portion 42 , the first and second biasing springs 46 , 48 , bias the movable handle portion 42 and the ratcheting bars 50 toward their original orientation . as should by readily apparent , the piston head 22 may be displaced along substantially the entire length of the cylindrical cutting tube 12 by repeatedly actuating the movable handle portion 42 . the target recovery operation of the present invention is fully illustrated with reference to fig6 through 12 . in fig6 a metal detector 68 is utilized to initially pinpoint a metal target 70 in the ground 72 . typically , older targets are buried in the ground 72 several inches below the level of the grass 74 and grass roots 76 . after the target 70 has been accurately pinpointed , the cylindrical cutting tube 12 is centered over the location of the target ( fig7 ), with the rotatable latch 56 secured over the lower end of the piston rod engaging section 54 , and the piston head 22 flush against the ground . as is well known in the metal detecting field , most newer metal detectors are designed to accurately determine not only the location of a target , but also the depth of the target in the ground . advantageously , by predetermining the depth of the target , the target recovery operation is greatly simplified using the hole cutting device 10 of the present invention . as depicted in fig8 the cutting edge 18 of the cylindrical cutting tube 12 is designed to be rotatably driven into the ground 72 through the grass 74 and grass roots 76 . handle member 16 is utilized by the operator to apply a downwardly , rotating force - on the cutting edge 18 . as the cutting edge 18 penetrates the ground , the piston head 22 and attached piston rod 24 are propelled upwardly through the cylindrical cutting tube 12 a distance x . as should be readily apparent , the distance x corresponds to the depth of the cutting edge 18 in the ground 72 . as the piston head and rod 22 , 24 , are propelled upwardly through the cylindrical cutting tube 12 , the graduated upper portion 34 of the piston rod 24 extends an identical distance x from the top of the stationary handle portion 40 . by observing the indicia 36 on the graduated upper portion 34 of the piston rod 24 , an operator is provided with an instantaneous indication of the cutting depth of the hole cutting device 10 . when the indicia 36 correspond to the predetermined depth x &# 39 ; of the detected target ( fig9 ), the plug 78 , enclosed within the cylindrical cutting tube 12 , is removed from the ground ( fig1 ) by pulling upwardly on the handle member 16 . upon removal of the plug 78 , the metal target 70 should be located either in the bottommost section of the captured plug 78 or proximate the bottom of the hole 80 formed by the removal of the plug 78 . after plug removal , the hole 80 should be scanned with a metal detector to determine whether the metal target 70 is located within the hole 80 . if the metal detector determines that the target is disposed within the hole 80 , the target is easily recovered with a probe or the like . if the metal detector produces a negative response , the detectorist is assured that the metal target 70 is located in the bottommost section of the captured plug 78 . once again , the target is easily recovered from the bottom on the plug using a probe or the like . after the successful recovery of the metal target , the substantially undisturbed captured plug 78 is reinserted into the ground as illustrated in fig1 and 12 . first , the cylindrical cutting tube 12 is fully inserted in the hole 80 , and the rotatable latch 56 is detached from the lower end of the piston rod engaging section 54 ( fig1 ). thereafter , the movable handle portion 42 is repeatedly actuated , thereby forcing the piston head 22 toward the cutting edge 18 of the cylindrical cutting tube 12 and against the top of the enclosed plug 78 ( fig . 12 ). as a result , the cylindrical cutting tube 12 is forced upward out of the hole 80 as indicated by directional arrows 82 . as illustrated in fig1 , the plug 78 is barely noticeable after reinsertion ; the grass 74 and grass roots 76 located on top of and adjacent the plug 78 remain substantially undisturbed , thereby minimizing any ancillary grass damage . referring finally to fig1 , there is illustrated the removable attachment of the hole cutting device 10 to the belt 84 of an operator . specifically , a hook 86 , which is suitably secured about the belt 84 , is inserted through the loop 38 located on the upper end of the piston rod 24 . when attaching the loop 38 of the hole cutting device 10 to an operator &# 39 ; s belt 84 via hook 86 , the rotatable latch 56 should be disengaged from the lower end of the piston rod engaging section 54 to prevent any unwanted displacement of the piston rod 24 . the foregoing description of the preferred embodiments of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and obviously many modifications and variations are possible in light of the above teaching . such modifications and variations that may be apparent to a person skilled in the art are intended to be included within the scope of this invention as defined by the accompanying claims . | 4 |
in this specification , words such as “ a ” and “ comprises ” are to be construed in an open - ended sense and are to be considered as meaning at least one but not limited to just one . herein , in a quantitative context , the term “ about ” should be construed as being in the range up to plus 10 % and down to minus 10 %. “ natural frequency ” is the rate at which an object will vibrate when it is not disturbed by an outside force . it has been found that as the number of cells increases in typical conventional solid polymer fuel cell stacks for use in vehicles , the natural frequency of the stacks becomes so low that they become unacceptably susceptible to vibration damage . fig1 shows a perspective view of such a conventional fuel cell stack in which two compression bands circumscribe the stack ( this figure has been reproduced from u . s . pat . no . 5 , 789 , 091 ). exemplary prior art fuel cell stack 110 includes end plate assemblies 115 and 120 and a plurality of fuel cell assemblies or fuel cells 125 interposed between the end plate assemblies 115 , 120 . two compression bands 130 extend tightly around the end plate assemblies and fuel cells and retain and secure stack 110 in its assembled state . according to u . s . pat . no . 5 , 789 , 091 , the end plate assemblies 115 , 120 preferably have rounded edges 115 a , 120 a to reduce the stress on the bands . in fuel cell stack 110 , reactant and coolant fluid streams are supplied to and exhausted from internal manifolds and passages in stack 110 via a central fluid distribution plate 150 . compression bands 130 can desirably be formed from rolled stainless steel strapping , which can be pre - welded to the desired length to circumscribe the stack . strips of electrically insulating material ( not shown ) are interposed between the bands 130 and the edges of the fuel cells 125 . the compression bands may be applied to the stack in various ways , for example by slightly over - compressing the stack initially in a fixture during assembly , placing and then welding together the ends of the compression bands around the stack , and finally releasing the stack from the fixture . instead of circumscribing the stack with continuous or endless compression bands , an alternative arrangement to that shown in fig1 uses compression straps on either side of the fuel cell stack that are attached at opposite ends to each end plate assembly 115 and 120 . this arrangement is generally less preferred because the attachment hardware increases parts count and modestly increases weight and volume . the fuel cell stack in fig1 comprises fuel cells whose lengths are much greater than their widths . this provides for a simple , desirable flow field arrangement within and also can be a desired profile for incorporation into a vehicle . further , the stack height ( the dimension in the stacking direction ) is also much greater than the cell widths or stack width . while such stack configurations can be desirable for operation and integration reasons , they may be susceptible to damage from driving induced vibration . for automotive purposes for instance , a component is generally considered unsuitable if its natural frequency is less than about 50 hz because such frequencies can be encountered in typical driving duty cycles . it is thus required to somehow increase the natural frequency of such components to be greater than about 50 hz , and preferably significantly greater than 50 hz , to use them in automotive applications . as illustrated in the following examples , fuel cell stacks like that shown in fig1 can have an unsuitably low natural frequency if enough fuel cells are included in the stack and result in the stack height being of order of 50 cm or more . an elegant solution to this problem however comprises inserting a simple , appropriately shaped electrically insulating support bar between the compression strap and the fuel cell stack , preferably on each side of the stack , such that the opposing compression straps apply enough load through the support bars to the opposite sides of the stack to substantially increase its natural frequency . fig2 shows an exemplary support bar shape suitable for use in fuel cell stacks like that shown in fig1 . support bar 2 has an arc shape along face 2 a , which is the face that will be adjacent the compression strap when inserted in the stack . support bar 2 is flat along face 2 b , which is the face that will be adjacent the series stack of fuel cells when inserted in the stack . support bar 2 is made of a suitable electrically insulating material ( so as not to electrically short out the cells in the stack ) that is also capable of handling the sustained loads involved . for instance , polymers such as polypropylene , polyethylene , glass filled nylon , and the like can be employed . the length and width of support bar 2 matches that of the stack ( or most of the stack ) and the compression straps employed respectively . the height of support bar 2 is selected such that , in combination with the tensile loading applied by the opposing compression straps , the load applied to the sides of the stack raises the natural frequency of the stack to a sufficient value . in actual embodiments , as shown in the examples following , the support bar 2 can be of sufficient size if its height at the centre 2 c is between about 2 . 5 and 5 cm . greater ( or lesser ) heights can of course be considered and may be appropriate in other circumstances . greater or lesser heights would be expected to result in a greater or lesser increase respectively in the natural frequency of the stack . while a greater increase in natural frequency is preferred , larger support bars may add unnecessary volume and weight . fig3 shows a perspective view of a fuel cell stack comprising two endless compression straps in which four support bars similar to those shown in fig2 have been inserted between the straps and the sides of the series stack of fuel cells . in fig3 , fuel cell stack 3 comprises a series stack of fuel cells 4 between opposing end plates 5 , 6 . two endless compression straps 7 , 8 encircle stack 3 and secure the components in a compressed state . support bars 9 , 10 are inserted between compression straps 7 , 8 and series stack of cells 4 . similar support bars are used on the opposite side of fuel cell stack 3 but are not visible in fig3 . ( coordinate axes x , y , and z are provided in fig3 to help indicate the orientation of the support bars and correspond to the coordinate axes shown in fig2 .) note that as shown , compression straps 7 , 8 are similar but not identical to those shown in fig2 . here , although not readily visible in the figure , compression straps 7 , 8 have been shortened slightly near the end plate 6 end of the stack . further , although not readily visible in the figure , compression straps 7 , 8 have been notched at their other end in order to locate into receiving grooves formed in end plate 5 . further as shown , two additional endless compression straps 11 , 12 also encircle stack 3 in order to assist in securing the components in a compressed state . however , support bars are not employed between compression straps 11 , 12 and series stack of cells 4 . tension in compression straps 7 , 8 provide a distributed load to support bars 9 , 10 which in turn preferably provide a roughly uniform load to the sides of the cells in the stack . again as illustrated in the following examples , tensile loads of greater than about 3 kn in the compression straps can provide sufficient loading in actual exemplary stacks to effect a satisfactory increase in natural frequency . and this is accomplished in a tidy manner without an undue increase in weight or volume of the fully assembled stack . the embodiment shown in fig3 represents a presently preferred stack configuration and uses support bars with a specific effective choice of geometry . however , those of ordinary skill will appreciate that other embodiments may have a significantly different stack configuration and may comprise additional straps in a different range of tension . further , such embodiments may employ support bars with significantly different geometry and relative dimensions . the following examples are illustrative of the invention but should not be construed as limiting in any way . the natural frequency of an exemplary automotive fuel cell stack was calculated as a function of stack length ( or alternatively the number of cells in the stack ). the cells were assumed to be essentially rectangular solid polymer electrolyte fuel cells with long and short dimensions of about 40 cm and 10 cm respectively . the length of the series of cells in the stack was considered to vary from about 45 to 65 cm . the overall stack length is about 4 cm greater than the height of the series stack of cells , so the stack length was considered to vary from about 49 to 69 cm . the stack was similar to that shown in fig3 but employed only two endless compression straps and was absent any support bars . the fuel cell stack was assumed to behave as a simply supported uniform beam characterized by the following parameters : modulus of rigidity of 27 mpa , a moment of inertia of 6260 cm 4 , a mass / length of 0 . 977 kg / cm , and a length l in the stacking direction . using the appropriate equation for natural frequency from marks &# 39 ; standard handbook for mechanical engineers , mcgraw hill professional , 1987 , the natural frequencies for such a stack , in the stacking direction , was calculated for several values of length l . the results are tabulated in table 1 below . next , the natural frequency of a fuel cell stack like the above was calculated assuming various support bars similar in shape to that shown in fig2 were employed between each of the two compression straps and on both sides of the fuel cell stack . the stack length was always assumed to be 58 cm and the tension in the compression straps to be 3750 n . however the height at the centre of the support bars was considered to vary from 2 . 5 to 5 cm . table 2 shows the calculated range of pressure load applied by the compression straps to the support bars and , in turn , the range of load from the support bars to the stacked cells , along with the calculated natural frequencies in the stacking direction . the natural frequency increases substantially as the height of the support bar increases . in all cases considered , the natural frequency of the stack has been acceptably increased to significantly greater than 50 hz . a mock up experimental automotive fuel cell stack was assembled as described in the preceding calculated examples with a stack length of 58 cm . the stack was mounted on a vibration table and a sine sweep was performed to determine its actual natural frequency along the stack length axis . here , and as shown in fig3 , the long side dimension of the fuel cells lies along the z axis , the short side dimension lies along the x axis , and the stack length dimension lies along the y axis . support bars like that shown in fig2 and whose height at the centre was 3 . 6 cm were then incorporated between the two compression straps and the series stack of cells on both sides of the stack . again , the stack was mounted on the vibration table and a sine sweep was performed to determine the natural frequency along the stack length axis of the actual fuel cell stack . for comparison , the natural frequencies for each of the tested stacks along the stack length axis was calculated as above . the results obtained for this actual fuel cell stack are tabulated in table 3 . in an actual embodiment , the calculated natural frequency was reasonably close to the actual natural frequency along the important stack length direction ( y axis in fig2 and 3 ). and , incorporating support bars of the invention resulted in a substantial increase in natural frequency ( from about 37 to 90 hz ) in the stack length direction . all of the above u . s . patents , u . s . patent application publications , u . s . patent applications , foreign patents , foreign patent applications and non - patent publications referred to in this specification , are incorporated herein by reference in their entirety . while particular elements , embodiments and applications of the present invention have been shown and described , it will be understood , of course , that the invention is not limited thereto since modifications may be made by those skilled in the art without departing from the spirit and scope of the present disclosure , particularly in light of the foregoing teachings . such modifications are to be considered within the purview and scope of the claims appended hereto . | 8 |
both the structure and operation of the preferred embodiments of the present invention will now be described in greater detail with reference to the figures . fig1 illustrates the inspection plug , generally designated by reference numeral 102 , in accordance with the present invention . the inspection plug is for attachment to a panel , such as a manhole cover , as will be described herein . in this embodiment of the invention , the inspection plug 102 is comprised of a body 104 , a peripheral shoulder or outwardly directed flange 106 , and an openable cap 108 . the body 104 , peripheral shoulder 106 , and cap 108 may be made of plastic , stainless steel , aluminum , rubber , a composite material , or a combination of such materials that preferably are non - corrosive . the cap 108 is preferably made of stainless steel or aluminum alloy and may be formed by a stamping machine . as shown in fig1 the body 104 of the plug 102 is cylindrical having a top end 110 , a bottom end 112 , and a passage 114 extending axially through the plug between its ends and terminating at an internal ledge 118 proximate to the top end 110 . the top end 110 of the cylindrical member has an inspection internal ledge 118 that defines an aperture 120 of smaller diameter than the passage 114 . an inspection port 120 is sized for inserting an inspection probe or other device into and / or through the inspection plug 102 . the length of the body 104 may vary depending on the thickness of the panel 300 ( fig3 ) to which the inspection plug 102 is to be attached , as illustrated in fig4 . although described here as being cylindrical , the body 104 may be square , hexagonal , or any shape with a passage through it from one end to the other . the plug has an external peripheral shoulder 106 extending radially outwardly from the accessible end of the plug . when installed on a panel such as a manhole cover , the shoulder 106 may have a tapered top side 122 designed to allow vehicle tires to ride over the inspection plug 102 with minimal impediment and to prevent pedestrians from tripping on the inspection plug 102 . preferably , the inspection plug can be installed flush mounted as shown in fig4 that is , not protruding on the exterior side 302 ( fig3 ) of the manhole cover or panel . the underside 124 of the shoulder 106 supports the inspection plug 102 when attached to a panel and also helps to locate the inspection plug &# 39 ; s placement in the panel port , opening or hole . the length of the plug may vary depending on the thickness of the panel 300 ( fig3 ) to which the plug 102 is to be attached . inspection plugs used in electrical connection boxes , or other defined enclosures , which usually have thin walls , will be relatively short in length , e . g ., about ¾ inch from the top end 110 to the bottom end 112 . however , the plugs used in manhole covers will usually be longer in length , e . g ., about 3 inches . naturally , this invention can be miniaturized depending on the needs of the particular device requiring inspection . the openable cap 108 within the aperture 120 forms a hat - shaped body having a circular disc 126 sized for insertion into the aperture 120 . the edge of the circular disc 126 curves downward and forms a cylindrical body 128 of about the same diameter as the circular disc 126 . the bottom of the cylindrical body 128 curves outward into a radially extending rim 130 having a diameter greater than the aperture 120 and smaller in diameter than the passageway 114 . a gasket may be fitted to the top side 131 of rim 130 to provide an improved seal between the cap 108 and the internal ledge 118 when the inspection plug 102 is not in use and its cap is in the normally closed position . a portion of the rim 130 extends laterally to form one or more pivot arms 132 as depicted in fig2 . the pivot arms 130 wrap partially around a spring pin 134 thereby creating a hinge axis . preferably , two pivot arms 132 extend parallel to each other from the rim 130 to the spring pin 134 as illustrated in fig2 . in this embodiment , the cap 108 is hingably attached through the spring pin 134 to the cylindrical member . in other embodiments , the cap may be of a different shape , e . g ., flat disk , square , hexagonal , etc . the spring pin 134 is located in a spring compartment 136 located within a portion of the body 104 . a spring 138 having an inner end 140 and an outer end 142 is wound around the spring pin 134 and cooperates with the cap 108 . the inner end 140 of the spring 138 extends generally toward the center of the circular disc 126 and applies a resilient upward pressure against the underside of the circular disc 126 thereby causing the radially extending rim 130 to normally press against the internal ledge 118 . thus , the cap 108 is normally biased in a closed position as illustrated in fig1 . the outer end 142 of the spring 138 extends generally away from the cap 108 and contacts the edge 144 of a downwardly facing step 146 located in the spring housing compartment 136 . the spring 138 may be made of stainless steel or music wire . although described here in terms of a horizontally coiled spring mechanism , other spring - type embodiments may be used in the present invention to exert a force for facilitating closure of the cap . the spring compartment 136 has a side slot 156 which facilitates access to the spring compartment 136 . the spring 138 and spring pin 134 may be inserted into the spring housing compartment 136 through the side slot 156 during assembly of the inspection plug 102 . the cap 108 can be inserted through the body 104 passageway 114 for assembly . the spring pin 134 is then attached by spot welding , liquid steel , glue , epoxy , or similar means to the sides of the spring housing compartment 136 . fig2 illustrates an appropriate position for the spring pin 134 in the spring housing compartment 136 . of course , the pin also can be threaded and screwed into a drilled and tapped hole in the body ( not shown ). if desired , the cap can be provided with a locking mechanism , such as a simple tab that can be pivoted into engagement with a slot in the way of the aperture 120 to prevent accidental depression of the cap . alternatively , a locking tab can be pivotally mounted on the plug body for locking engagement with the cap . as shown in fig3 the inspection plug 102 may be attached to a panel 300 in one of several ways . the term “ panel ” as used herein shall be understood in a relative sense and is intended to designate any movable or fixed partition , such as a manhole cover or connection box wall , that partially or totally obscures an area requiring inspection . the term “ connection box ” as used herein shall also be understood in a relative sense and is intended to designate a substantially enclosed box including , but not limited to , the following : electric meter service boxes , electric switchgear panels , metering closets , electrical throughputs , electric service shut - off switches , circuit breaker boxes , main breaker panels and transformer cubicles . the panel 300 , as illustrated in fig3 has an exterior side 302 , an interior side 306 , and a hole 304 having a diameter slightly larger than the diameter of the inspection plug body . the panel 300 also has a circular shelf 312 , illustrated in fig4 designed to accommodate the peripheral shoulder 106 of the inspection plug 102 . the circular shelf 312 allows the peripheral shoulder 106 to be recessed or submerged in the panel 300 . this embodiment minimizes disturbances , possible tripping , etc . created when automobiles or pedestrians pass over the plug . the inspection plug 102 may also be attached to the panel 300 by force - fitting the plug 102 into the panel hole 304 . this embodiment is preferred when the plug 102 is made of a soft or malleable metal or other relatively soft material . the plug 102 may also be affixed to the hole 304 in the panel 300 by glue , epoxy , liquid steel , mechanical crimping , or similar affixing arrangements . the inspection plug 102 may be attached to the panel 300 by a nut assembly , which includes a washer 148 , a nut 150 , and optionally a gasket ( not shown ). in this embodiment , illustrated in fig3 and 4 , the cylindrical member has a threaded exterior portion 152 near its bottom end 112 . the nut 150 has a threaded bore 154 for engagably receiving the threaded exterior portion 152 of the cylindrical member . to attach the inspection plug 102 to the panel 300 , the user inserts the bottom end 112 of the plug into the hole 304 in the panel 300 until the under - side 124 of the peripheral shoulder 106 contacts the exterior side 302 of the panel 300 at which point the threaded exterior portion 152 of the cylindrical member will extend into the internal atmosphere 308 , which is the area requiring inspection . a gasket made of rubber , plastic , composite material , or other material , may optionally then be placed over the bottom end 112 of the plug 102 to improve the seal between the plug 102 and the washer 148 and / or nut 150 . the washer 148 is then placed over the threaded exterior portion 152 of the cylindrical member , and the nut 150 is screwed onto the threaded exterior portion 152 of the cylindrical member of the inspection plug 102 thereby securing the inspection plug 102 to the panel 300 as illustrated in fig4 . to use the invention , as illustrated in fig5 the user inserts an inspection probe 502 through the aperture 120 into the internal atmosphere 308 . by applying pressure against the top edge of the circular disc 126 , the spring force is overcome and the cap will open on its hinge axis . as it opens , the user may further insert the inspection probe 502 or other device through the inspection plug 102 and into the internal atmosphere 308 . after the inspection probe 502 has been inserted to required depths , the user may inspect the contents of the internal atmosphere 308 . after the inspection is complete , the probe is retracted from the inspection plug whereby the cap proceeds to its normally closed position by the force exerted by the internal spring member and seals the entranceway thereby substantially preventing dirt , water , or other contaminants from entering the structure . additionally or alternatively , the radius of the hole 114 in the body 104 may gradually decrease or taper from the top end 110 of the cylindrical member to the bottom end 112 of the cylindrical member thereby aiding in guiding the inspection probe 502 or other device through the hole 114 of the inspection plug 102 and into the internal atmosphere 308 . in an alternate embodiment , illustrated in fig6 the openable cap is a threaded insert 602 which may be unscrewed from the inspection plug 102 to allow the user to insert the inspection probe or other device into the hole 114 . in this embodiment , the outer surface of the insert 602 is threaded to mate with interior threads 604 of the inspection port 120 . to gain access to the interior environment , a user unscrews the insert 602 by hand , screwdriver , or other device , and removes it from the inspection plug 102 . once the inspection is complete , the user closes the inspection plug 102 by screwing the insert 602 back into the inspection plug 102 . in the embodiment of fig7 the interior of the plug body 104 is filled with a gel material 710 , the purpose of which is to provide a probe - penetrable seal at the inspection plug . in this embodiment , the closure of the inspection port is an elastic or resilient flexible top insert 702 having one or more slits 704 sized for receiving inspection probes or other devices . the bottom end 112 of the body 104 has a similar elastic or flexible resilient insert 706 which normally substantially seals the hole 114 and similarly contains one or more slits 708 sized for receiving inspection probes or other devices . the gel material 710 occupies the volume within the hole 114 between the inserts 702 and 706 . the interior space of the plug may be filled with the gel material 710 through either of these slits with a syringe or other device . alternatively , one of the closure inserts may be put in place after the gel material 710 is loaded . in either case , the inserts house the gel to allow the user to insert and retract an inspection probe or other device through the inspection plug 102 . the gel material is preferably self - adhering or has other adhesive characteristics for sticking to the internal wall of the body and thereby minimizing flow or leakage while maintaining a paste - like consistency . the material can be formed of silicone polymers to form a silicone grease - like formulation such as silicone sealants . the gel material preferably has the following characteristics : water repellency , atmospheric and chemical resistance , good elasticity , and thermal resistance over a wide temperature range . the flexible top insert described above also may be employed in non - gel embodiments of the present invention . the cap or top closure element may be made of an elastic or flexible material such as a foam , rubber , or neoprene material and fixed within the port 120 by glue , epoxy , or other adhesive . alternatively , inwardly directed flanges at the periphery of the port 120 can be provided to securely locate a resilient or compressible top closure element within the inspection port . in another embodiment , illustrated in fig8 the plug body 104 may be secured to the panel 300 by a bayonet - type lock member 802 . in this embodiment , the outer surface of the body 104 includes a plurality of radially extending tabs 804 at its lower end . a plurality of tab - mating slots 808 in the inner wall 810 of the lock member bore 806 are spatially aligned with the tabs 804 . of course , the tabs and slots can also reverse positions , with tabs on the lock member and complementary slots in the plug body . to attach the body 104 to the panel 300 , the body 104 is inserted through the hole 304 in the panel 300 , and the slots 808 on the lock member 802 are aligned with the tabs 804 on the body 104 . the slots 808 receive the tabs 804 , after which the inspection plug 102 may be rotated so that the tabs and slots are engaged . in another alternative embodiment , illustrated in fig9 the inspection plug 102 is attached to the panel 300 by flexible prongs 902 that are dimensioned to engage the underside of the panel and that radially compress as the plug is inserted through the panel hole . once in place , the prongs snap outwardly into place . in this embodiment , the body 104 is formed with one or more inwardly compressible resilient prongs 902 extending from the exterior end to the interior end of the plug . each prong 902 includes a shaft 904 terminating in a barb or clasp hook 906 . the clasp hook 906 preferably tapers to a point 908 in the direction of the bottom end 112 of the body 104 to provide a camming surface for directing the prongs inwardly as the plug is inserted into the panel hole . thus , as the inspection plug 102 is inserted into the panel hole 304 , the clasp hook 906 will be forced inwardly causing the shaft 904 to yield radially inwardly . to that end , the plug body , or simply the prongs 902 are constructed of a resilient material such as spring steel or plastic , having strong elastic memory properties . once the clasp hooks 906 pass the internal side 306 of the panel 300 , they snap radially outward thereby securing the inspection plug 102 to the panel 300 . one benefit of this embodiment is that an inspection plug 102 may be quickly inserted into pre - existing holes 304 without panel 300 modification or manipulation . the inspection plug may also be attached to the panel 300 through a solid impact riveting process as shown in fig1 . in this embodiment , the cylindrical member is formed of a malleable metal . in solid impact riveting , a compressive axial load is applied to the end of the rivet shank 1004 ( here , the cylindrical body ) causing the shank 1004 to swell throughout its length as it shortens under the load . the rivet shank 1004 continues to expand until the walls 006 of the panel port or bole 304 restrict the shank 1004 from further radial expansion . the unrestricted rivet end outside the panel port or hole 304 then expands , forming a rivet clinch 1002 which secures the cylindrical member to the panel 300 . in another embodiment , the plug shown in fig1 a may be attached to the panel using a “ c - ring ,” which is illustrated in fig1 b . in this embodiment , the c - ring 1102 is a solid flexible or malleable semi - circular disc made of plastic , stainless steel , aluminum or a composite material . the c - ring 1102 is sized for engaging a circular groove 1104 in the outer wall of the cylindrical member which extends around the cylindrical member parallel to the top end 110 and the bottom end 112 of the body 104 . the circular groove 1104 is oriented on the cylindrical member such that the distance between the downwardly facing side 124 of the peripheral shoulder 106 and the circular groove 1104 is equal to or slightly greater than the width of the panel 300 . to attach the plug to the panel 300 , the plug is inserted into the hole 304 in the panel 300 . the open end 1106 of the c - ring 1102 is then aligned with the circular groove 1104 and pressed against the cylindrical member until the c - ring 1102 snaps onto the cylindrical member and rests partially within the circular groove 1104 . in various alternate embodiments , the cap 108 may be situated at or near the bottom end 112 of the body 104 . similarly , the peripheral shoulder 106 may be situated at the bottom end 112 of the body 104 . accordingly , the nut assembly or other attaching mechanism may be located at the top end 110 of the body 104 . the inspection plug may be used in conjunction with an alarm system as illustrated in fig1 a . an alarm 1204 , which may detect toxic , flammable or combustible gases or detect the buildup of a particular gas , is also attached to the panel wall 1200 in close proximity to the inspection plug . alternatively , the alarm 1204 may be positioned directly over the interior portion of the inspection plug as shown in fig1 b . additionally , the alarm 1204 may have a warning light 1206 which passes through a second hole 1208 in the panel . the warning light may indicate that a concentration of a certain gas has been exceeded or that the battery is low , or that no source exists . by orienting the alarm and the inspection plug together or near one another , a user can easily test the internal atmosphere of an area requiring inspection . for example , if the alarm detects that a certain concentration of an undesirable ( or desirable ) gas has been exceeded , the alarm sounds and / or the warning light becomes lit thereby informing the user that the predetermined gas concentration has been exceeded . subsequently , the user may insert an inspection probe into the inspection plug to inspect the contents of the internal atmosphere and measure the concentration of gaseous mixture therein . the alarm 1204 and inspection plug 1202 combination may be attached to a panel wall 1200 through any of the above - described attaching methods . as shown in fig1 a , a first nut 1210 may be used to attach the plug to the panel . if the alarm 1204 is placed directly over the inspection plug , a second nut 1212 may be used to secure the alarm wall 1214 to the inspection plug 1202 as shown in fig1 b . having described the invention in detail , those skilled in the art will appreciate that modifications may be made without departing from the spirit and scope of the invention . therefore , it should be understood that the scope of the invention is not limited to the specific embodiments illustrated and described but is defined in the appended claims . | 1 |
as those having ordinary skill in the art will appreciate , although certain example apparatus and methods are disclosed herein , the scope of coverage of this patent is not limited thereto . on the contrary , this patent covers all methods , apparatus , and articles of manufacture fairly falling within the scope of the appended claims either literally or under the doctrine of equivalents . one example object of the present disclosure is to provide a tool in which the heat transfer between tool and environment or between individual tool parts that are heated to different temperatures for hardening is further improved in relation to the prior art . likewise , the present disclosure enables more energy - efficient use of tools such as , for instance , in the hot forming of sheets . various objects of the present disclosure are achieved by a tool for the hot forming of a workpiece . in some examples , the tool comprises a first tool part and / or a second tool part , wherein , for heating of the workpiece , the first tool part for heating of the workpiece assumes a different temperature from the second tool part or from an environment of the tool , wherein the tool has a device for manipulating the thermal radiation . as those having ordinary skill in the art will understand , “ first tool part ” and “ second tool part ” may be shortened , respectively , to “ first part ” and “ second part .” the tool provides a device for manipulating thermal radiation , with which the loss of heat , induced by thermal radiation , between the first tool part and the environment , or the transfer of heat from the first to the second tool part , can be advantageously reduced in relation to the prior art . in this way , the maintenance of an existing temperature difference between the tool parts and of the temperature control of the entire tool can be supported , so that a particularly energy - efficient use of the tool is ultimately enabled . through the reduction of heat transfer , a temperature profile along the first or second tool part can also be advantageously improved in terms of spatial homogeneity . in addition , in the tool can be obtained spatially clearly discernible temperature zones , which , in the course of the hardening , advantageously lead to narrow transition regions between workpiece regions of different hardness . the tool may be designed for hot forming or for “ tailored tempering .” in particular , with the first and the second tool part , the pre - heated workpiece is maintained during the forming at a certain temperature on a regionally selective basis , or is cooled only down to tool temperature and is subsequently kept at the appropriate temperature . for instance , the workpiece is a sheet that is heated to a temperature within the range from 720 ° c . to 900 ° c ., is subsequently arranged in the tool , and acquires its final shape through the forming effected by the tool . in this case , by virtue of the tool parts at different temperatures , and the therewith associated different cooling rates or dwell times , purposefully different material properties are obtained in the regions of the workpiece . in addition , the tool may have a die - like tool effective area , against which in the operating state the workpiece bears and by the action of which the workpiece is then worked . further , the shape of the tool effective area may be tailored to the subsequent shape of the formed workpiece . in particular , the tool may be designed at least partially as a press . in this example , the device for manipulating the thermal radiation is , at least in some regions , part of the first and / or second tool part , or can be disposed between the first and the second tool part . in particular , the device may be a feature of the first and / or second component . in some examples , a surface character of the first tool part , in particular of the tool effective area , and / or of the second tool part for manipulating the thermal radiation , may be modified . in such examples , by virtue of the surface character , the device for manipulating the thermal radiation is formed . in particular , the first and / or the second tool part , following a treatment , in particular an after - treatment , such as , for example , polishing , coating or roughening , may have at least in some places an altered surface character . in particular , the surface characters of the tool parts at different temperatures , e . g ., of the first and the second tool part , can mutually differ . through the modification of the surface character , the quantity of thermal radiation exchanged between the tool parts at different temperatures , as well as delivered to the environment , can be advantageously controlled or manipulated . in other examples , the first tool part and the second tool part may be at least partially spatially separated from each other by a gap . by virtue of the gap , a direct heat transfer from the second tool part to the first tool part is advantageously reduced . in particular , the device for manipulating the thermal radiation may be disposed within the gap . the device may then be introduced into and / or arranged exchangeably in the gap for the manipulation of the thermal radiation , whereby the device for manipulating the thermal radiation can be adapted as optimally as possible to the prevailing circumstances . in a further example , a device of this type can likewise be disposed between tool parts and the environment . in some examples , the tool for manipulating the thermal radiation has a coating . the coating in this example forms the device for manipulating the thermal radiation . such a coating can be advantageously applied comparatively easily to the first and / or the second tool part and takes up little space . the coating may be designed such that the coating absorbs or reflects the thermal radiation . in particular , the coating may be tailored to a spectral distribution of the thermal radiation , wherein the coating absorbs or reflects over a wide band within the infrared spectral range . by adapting the coating to the spectral distribution of the thermal radiation , it is possible to manipulate the thermal radiation particularly effectively . in addition , the coating is chosen such that it at least partially co - determines an emission of the thermal radiation . in particular , the first or the second tool part is coated with a material having a specific emission coefficient in order to manipulate the emission radiating from the first or second tool part . in this example , the coating may be comprise a lacquer and / or a structured primer . in particular , the coating can advantageously have the effect that the thermal radiation between the tool parts at different temperatures is manipulated , in particular reduced . in some examples , the first tool part has a coating which varies from the coating of the second tool part . in particular , the second tool part has a higher temperature than the first tool part and , as a result of the coating , the second tool part assumes or has at least in part a darker colour than the first tool part , in particular is coloured black . the second tool part thereby becomes , for instance , a type of black body , and as much radiation as possible is absorbed by the coating of the first tool part . moreover , if the first tool part has a lower temperature than the second tool part , the first tool part may assume or have at least in part a lighter colour than the second tool part , by virtue of the coating , for example . the first tool part thereby becomes , for instance , a type of white body , which reflects as much radiation as possible . in some examples , a secondary surface of the second tool part may have a greater roughness compared to a primary surface of the first tool part . as a result of the increased roughness of the secondary surface , its ability to absorb thermal radiation is advantageously further enhanced . the primary surface , on the other hand , may be polished and may reflect the thermal radiation in the direction of the first tool part . in some examples , the secondary surface may lie opposite the primary surface . in particular , the secondary surface and the primary surface lie at least partially opposite each other along the gap . the secondary surface and the primary surface may be of complementary configuration . in particular , the secondary surface may be rougher and , in terms of colouring , darker than the primary surface . this can advantageously have the effect of reducing the heat transfer from the second tool part to the first tool part . in some examples , a device is arranged between the first tool part and the second tool part that reflects thermal radiation . in particular , the device reflecting the thermal radiation , such as a mirror , for example , may be disposed within the gap . the reflective properties of the device may be tuned to the anticipated , spectral distribution of the thermal radiation . the device reflecting the thermal radiation may reflect over a wide band within the infrared spectral range . in addition , the device reflecting the thermal radiation may be arranged exchangeably in the gap . as a result , a device , tuned to the desired operating temperature , for manipulating the thermal radiation can be inserted into the gap . according to some examples , a reflective side of the device reflecting the thermal radiation may be directed towards the second tool part . further , the device reflecting the thermal radiation may have on its rear side an absorbent part , which absorbs the thermal radiation emanating from the first tool part . through the alignment of the device reflecting the thermal radiation , a heat transfer between the tool parts at different temperatures is advantageously reduced . a further subject of the present disclosure is a method for the regionally selective hot forming of a workpiece with a tool , wherein in a method step a the heated workpiece is disposed in the tool , wherein in a method step b the workpiece is worked , and / or at least in some regions maintained at a certain temperature or cooled at different speeds , with the first tool part and / or the second tool part , and wherein in a method step c the workpiece is removed and , if need be , after - treated for further microstructure adjustment . the workpiece may be cooled at different speeds via tool parts at different temperatures , for instance the first and second tool part , or may be maintained at a certain temperature , whereby material properties , such as hardness or ductility , on the shaped and ultimately hardened workpiece can be purposefully co - determined . with reference now to the figures , like parts are provided with like reference symbols and are therefore also generally respectively named or mentioned only once . in the figures , the curved lines are used to indicate that only a detail from the respective tool is viewed . furthermore , the representations are heavily simplified for better comprehension and are not necessarily to scale or proportion . as merely an example , in many cases a second tool part 12 does not encompass a first tool part 11 . fig1 depicts an example tool 1 . in this example , the tool 1 serves to hot - form a workpiece 10 , such as a steel sheet , for example and without limitation . that is to say , the tool 1 maintains the heated workpiece 10 at or above a certain temperature and works the workpiece 10 into a shaped workpiece 10 ′. in this example , the tool 1 may at least partially have a die - like configuration . to this end , the tool 1 may comprise a shaping tool effective area , which in an operating state enters into operative connection with the workpiece 10 such that the workpiece 10 is at least partially worked and , in particular , assumes a shape predefined by the tool effective area . the tool effective area in this example forms one side of the tool 1 , against which the workpiece 10 bears . the deformation may be performed , e . g ., pressed , at a pressure that acts on the workpiece 10 . the heated workpiece 10 , in a method step a , may be placed into the tool 1 . in a method step b , the workpiece 10 may be worked and in some regions may be maintained at a certain temperature or cooled at different speeds . to this end , the tool may have a first tool part 11 and a second tool part 12 , with which different regions of the workpiece 1 may be brought to different temperatures , in some cases within the range from 450 ° c . to 550 ° c ., after which , in a method step c , the workpiece 10 may in some cases be removed from the tool 1 and cooled external to the tool 1 . the workpiece 10 in this example may be cooled by the air surrounding the tool 1 . with continued reference to fig1 , a part of the tool 1 and a part of the workpiece 10 are shown . the part of the tool is represented in which the first tool part 11 and the second tool part 12 are disposed adjacent to each other . for instance , the second tool part 12 comprises at least partially a tool effective area with which the workpiece 10 is worked . in particular , the first and the second tool part 11 and 12 comprise tool effective areas with which the workpiece 10 can be worked . as a result , tool regions which have been heated to different temperatures can respectively be worked with the appropriate tool parts . in order to avoid heat losses , the tool 1 may comprise a device for manipulating the thermal radiation 2 . in particular , in the example shown in fig1 , it is provided to prevent , with the device for manipulating the thermal radiation 2 , the transfer of heat in the form of thermal radiation 2 from the second tool part 12 to the first tool part 11 , wherein the second tool part 12 for controlling the temperature of the workpiece is warmer than the first tool part 11 , e . g ., possesses a higher intrinsic temperature than the first tool part 11 . in this example , the second tool part 12 and the first tool part 11 are mutually separated by a gap 4 , and in the gap 4 is arranged a device 5 which reflects the thermal radiation 2 , such as a mirror for the reflection of infrared light , for example . in another example , the tool comprises the device for manipulating the thermal radiation in order to prevent the heat loss to the environment . the device 5 reflecting the thermal radiation 2 may comprise a side that is highly reflective for the thermal radiation 2 radiating from the second tool part 12 . this highly reflective side may in some examples be directed towards the second tool part 12 , so that the thermal radiation 2 is reflected back onto the second tool part 12 . the highly reflective side may comprise a material and / or a coating 3 for the reflection of infrared light . in addition , the highly reflective side may be tailored to an operating temperature assumed by the second tool part 12 in the operating state , and the therewith associated spectral distribution of the thermal radiation 2 , in that , for instance , a wavelength for which the highly reflective side provides maximum reflection falls into a wavelength range in which the workpiece 10 , at operating temperature , most emits thermal radiation 2 . by virtue of the highly reflective side , a heat loss of the second tool part 12 can be advantageously avoided , which ultimately ensures an efficient operation of the total tool 1 . further , the device 5 reflecting the thermal radiation 2 may have an absorbent side that lies opposite the highly reflective side and is directed towards the first tool part 11 . in particular , the absorbent side is tailored to the thermal radiation radiating from the first tool part 11 , in particular to the spectral thermal radiation profile thereof . as a result of the manipulation of the thermal radiation 2 between the first and the second tool part 11 and 12 , a temperature difference can be advantageously maintained in an energy - efficient manner . apart from the device for manipulating the thermal radiation 2 between the first and the second tool part 11 and 12 , an insulating layer may be installed . fig2 shows another example tool 1 according to the present disclosure . the tool 1 shown in fig2 differs from that shown in fig1 by the measure which is adopted to manipulate the thermal radiation 2 . those having ordinary skill in the art will recognize that different measures for manipulating the thermal radiation 2 may be combined . furthermore , as shown in fig2 , a surface character of the tool 1 may be designed to manipulate the thermal radiation 2 . in particular , the first tool part 11 may be coated or coloured white . as a white body , thermal radiation can thereby be advantageously reflected , and thus radiation losses avoided . for instance , the second tool part 12 for lowering the thermal radiation emission is at least partially coated with a black coating 3 , whereby the second tool part 12 advantageously at least partially assumes the thermal radiation emission characteristics of a black body . the surface of the second tool part 12 may be roughened and the thermal radiation 2 that is potentially transferable from the second tool part 12 to the first tool part 11 is thereby reduced . the surface character along a secondary surface may be modified , e . g ., roughened or coated , wherein the secondary surface is disposed opposite a primary surface of the first tool part 11 along the gap 4 . in addition , in some instances , the surface character of the first tool part 11 may be at least in part , along the primary surface , complementary to the modified surface character of the second tool part 12 . in particular , the surface of the second tool part 12 has along the primary surface a smooth surface , or is coated or lined with a reflective coating 3 . the absorbent coating 3 may be at least partially white , whereby the first tool part 11 advantageously assumes the thermal radiation emission characteristics of a white body . fig3 shows another example tool 1 . the tool 1 shown in fig3 , in the form of a warm punch , comprises a first tool part 11 and , in the form of a cold punch , comprises a second tool part 12 , wherein the first tool part 11 is separated from the second tool part 12 by a gap 4 . in this example , the workpiece 1 , in the region of the first tool part 11 , can be maintained at a certain temperature or only intended to be cooled to a tool temperature . as a result of the different cooling speeds or dwell times , different microstructures are formed in the workpiece , whereby the material properties can be adjusted . in this example , the tool may interact with a die - like , companion part of the tool 1 , wherein the first tool part 11 comprises an effective area . via this effective area , heat energy is lost whenever the tool 1 , for instance for the reception of the workpiece 10 , is opened , e . g ., the companion part is distanced from the effective area . therefore , the thermal radiation 2 to the environment is lessened , wherein principally that heat loss is lessened which occurs via the effective area to the environment , in particular when the tool 1 is open . likewise , the thermal radiation between the first tool part 11 and the second tool part 12 is lessened , wherein the temperature exchange between the first tool part 11 and the second tool part 12 is reduced . | 2 |
hereinafter , exemplary embodiments of the invention are described in detail with reference to the accompanying drawings , detailed descriptions of well - known functions and structures incorporated herein may be omitted to avoid obscuring the subject matter of the invention . the terms or words described in this description and the claims should not be limited by a general or lexical meaning , instead should be analyzed as a meaning and a concept through which the inventor defines and describes the invention at his most effort , to comply with the idea of the invention . therefore , one skilled in the art will understand that the embodiments disclosed in the description and configurations illustrated in the drawings are only preferred embodiments , instead there may be various modifications , alterations , and equivalents thereof to replace the embodiments at the time of filing this application . although the following embodiments will be described based on advanced e - utra ( or lte - a ) systems that support carrier aggregation , it should be understood that the invention is not limited to the embodiments . that is , the invention can also be applied to various types of communications that support channels similar to the idea of the invention , for example , multicarrier hspa . the invention provides a system and method that rapidly enables user equipment to perform a transmission / reception operation regarding one single preset carrier , which is hereinafter called ‘ single component carrier fallback ,’ where the user equipment has been activated by setting the multi - carriers , in a wireless communication system that supports a wide range of bandwidth via carrier aggregation . in particular , the system and method according to the invention can perform the single component carrier fallback with a high level of reliability and without additional uplink feedback overhead , thereby minimizing electric power consumption in the user equipment . multiple carriers each include a number of component carriers that are aggregated . in single component carrier fallback , one of the preset component carriers is called an anchor carrier or anchor component carrier . an anchor carrier is processed according to a predefined protocol between a base station and user equipment . the other component carriers are called non - anchor carriers or non - anchor component carriers . single component carrier fallback refers to an operation where transmission / reception is performed via the anchor carrier and is stopped via non - anchor carriers . in an lte - a systems supporting carrier aggregation , data transmission and dci transmission for supporting data transmission is performed according to corresponding component carriers , as shown in fig2 . however , in order to achieve highly reliable reception performance in user equipment , dci may be transmitted via component carriers for transmitting data and the other component carriers . this is described referring to fig3 . fig3 shows an example where a scheduling operation is performed in lte - a user equipment that aggregates downlink component carrier # 1 ( dl cc # 1 ) 309 and downlink component carrier # 2 ( dl cc # 2 ) 319 . since downlink interference occurs in dl cc # 2 ( 319 ) more often than in dl cc # 1 ( 309 ), if dci for data transmission is transmitted via dl cc # 2 ( 319 ), it is difficult to achieve a certain level of dci reception performance . in that case , the base station can transmit dci via dl cc # 1 ( 309 ). since data errors can be corrected via harq re - transmission , data can be transmitted via dl cc # 2 ( 319 ). to do this , the base station adds a carrier indicator ( ci ), indicating that dci represents scheduling information regarding a component carrier , to dci that represents the resource allocation information regarding scheduled data , the transmission format , etc . for example , ci =‘ 00 ’ means that it is scheduling information regarding dl cc # 1 ( 309 ) therefore , dci 301 , representing the resource allocation information regarding scheduled data 307 to dl cc # 1 ( 309 ), and the transmission format , is coupled with a carrier indicator 302 , thereby creating extended dci . the dci is channel - coded ( 303 ). the channel coded dci 303 is processed to form pdcch by a modulation process and an interleaving process . after that , it is mapped to the pdcch area 305 of dl cc # 1 ( 309 ) and then transmitted . dci 311 , representing the resource allocation information regarding scheduled data 317 to dl cc # 2 ( 319 ), and the transmission format , is coupled with a carrier indicator 312 , thereby creating extended dci . the dci is channel - coded ( 313 ). the channel coded dci 313 is processed to form pdcch by a modulation process and an interleaving process . after that , it is mapped to the pdcch area 305 of dl cc # 1 ( 309 ) and then transmitted . in order to support a single component carrier fallback where user equipment activating multi - carriers deactivates the aggregation of multi - carriers and receives data via only the anchor carrier , a specific codeword of the carrier indicator is defined to report the ‘ single component carrier fallback .’ that is , the carrier indicator allows user equipment to receive data via the anchor carrier of multi - carriers and to stop receiving data at the non - anchor carriers . for example , ci =“ all one ” is defined for reporting the ‘ single component carrier fallback .’ alternatively , the control information to report a ‘ single component carrier fallback ’ may be defined separately from the carrier indicator . this is described referring to fig4 . fig4 shows an example where user equipment , where dl cc # 1 ( 411 ) and dl cc # 2 ( 413 ) are activated , performs a ‘ single component carrier fallback ’ via a carrier indicator and dci of the dl cc # 1 ( 411 ). the base station instructs the single component carrier fallback in various states according to the determination of the scheduler . examples of the states are a case where the base station does not have sufficient data to be transmitted to user equipment or available system resources . base station couples dci 400 and ci =“ all one ” 401 and creates extended dci . base station channel - codes ( 403 ), modulates and interleaves the extended dci , thereby configuring pdcch . after that , base station maps the pdcch to the pdcch area 405 of the dl cc # 1 ( 411 ) and transmits it . dci 400 indicates scheduling information regarding data 407 of dl cc # 1 . ci =“ all one ” 401 indicates the deactivation regarding the remaining component carriers other than the dl cc # 1 serving as an anchor carrier . when user equipment successfully received pdcch , it stops performing the pdcch reception regarding non - anchor carriers , and thus reduces electric power consumption . as described above , the invention can be applied to the number of component carriers forming a wide bandwidth , via carrier aggregation . in the following description , a system and method for switching an operation to a single carrier mode according to a single component carrier fallback command is explained . a multi - carrier mode refers to a transmission / reception operation via multi - carriers where a number of component carriers are aggregated . a single carrier mode refers to a transmission / reception operation via one of the components , i . e ., an anchor carrier . each component carrier includes a control channel and a data channel . the reception operation includes a control reception operation for the control channel and a data reception operation for the data channel . in embodiment 1 , user equipment where multi - carriers are activated performs the deactivation via a ‘ single component carrier fallback ’ command and performs a single carrier mode , in an lte - a system supporting carrier aggregation . user equipment performs downlink control information via extended dci that always includes ci , regardless of whether user equipment performs a multi - carrier mode or a single carrier mode . embodiment 1 has a feature that does not require , from the user equipment , a feedback indicating whether the user equipment has successfully received a ‘ single component carrier fallback .’ fig5 illustrates a first embodiment of a procedure where a base station allows user equipment to switch the mode from the current multi - carrier mode to a single carrier mode and then to the multi - carrier mode , via the ‘ single component carrier fallback .’ at step 502 , the base station activates multi - carriers with respect to user equipment to be scheduled . when an lte - a user equipment first accesses a system , the base station determines whether it can support carrier aggregation of the user equipment , and notifies the user equipment of the number of component carriers to be aggregated and the activation state of multi - carriers including the type of component carrier to be aggregated and the determination as to whether a multi - carrier mode is performed . at step 504 , the base station determines whether to allow the user equipment to maintain the activation state of multi - carriers or to deactivate the activation and to switch the current mode to a single carrier mode to receive data , via only a preset anchor carrier . for example , when the base station does not have sufficient data to be transmitted to the user equipment or the available system resources , it instructs the user equipment to perform a single carrier mode . when the base station allows the user equipment to maintain the activation state of multi - carriers at step 504 , it returns to and proceeds with step 502 . on the contrary , when the base station allows the user equipment to operate in a single carrier mode at step 504 , it sets the carrier indicator for the user equipment as a value preset as a ‘ single component carrier fallback ,’ and creates extended dci by adding dci for scheduling data transmitted via an anchor carrier , at step 506 . the extended dci is channel - decoded , modulated and interleaved , thereby creating pdcch . the pdcch is transmitted to the user equipment via the anchor carrier . the carrier indicator , preset for the ‘ single component carrier fallback ’ command , may be set as ci =“ all one ,” for example . at step 508 , when the base station intends to schedule data additionally transmitted via an anchor carrier , with respect to the user equipment , it creates extended dci by aggregating a carrier indicator , set to instruct a ‘ single component carrier fallback ,’ with dci for scheduling data transmitted via an anchor carrier . the extended dci is channel - decoded , modulated and interleaved , thereby creating pdcch . the pdcch is transmitted to the user equipment via the anchor carrier . once the carrier indicator is set for a ‘ single component carrier fallback ’ at step 506 , the set state is maintained while the user equipment is operated in a single carrier mode . therefore , although the user equipment does not receive pdcch and thus immediately detects the ‘ single component carrier fallback ’ at step 506 , it has an additional opportunity to successfully acquire the ‘ single component carrier fallback ’ at step 508 . the base station does not request the feedback from the user equipment if it has received the ‘ single component carrier fallback ,’ thereby minimizing the additional signal overhead . at step 510 , the base station determines whether to allow the user equipment to maintain the single carrier mode or to reactivate the multi - carrier mode . if the base station has sufficient data to be transmitted to the user equipment or a sufficient amount of available system resources , it instructs the user equipment to reactivate multi - carriers . when the base station allows the user equipment to maintain the single carrier mode at step 510 , it returns to and proceeds with step 508 . on the contrary , when the base station allows the user equipment to reactivate the multi - carrier mode at step 510 , it notifies the user equipment of the specific activation state for the multi - carrier mode by an upper layer signaling operation at step 512 . the notification procedure will be described , in detail , later , referring to fig7 . fig6 illustrates a first embodiment of a procedure where user equipment switches the current multi - carrier mode to a single carrier mode and then to the multi - carrier mode , according to instructions from a base station . referring to fig6 , the user equipment activates the multi - carriers according to the command from the base station at step 602 . at step 604 , the user equipment receives pdcch from the base station and determines whether the carrier indicator is set to a ‘ single component carrier fallback .’ when the user equipment ascertains that the carrier indicator is not set to a ‘ single component carrier fallback ’ at step 604 , it returns to and proceeds with step 602 . on the contrary , when the user equipment ascertains that the carrier indicator is set to a ‘ single component carrier fallback ’ at step 604 , it stops receiving data via the remaining component carriers other than the anchor carrier and operates in a single carrier mode at step 606 . in that case , the user equipment does not transmit , to the base station , a feedback whether it has successfully received the ‘ single component carrier fallback ’ command ; however , it transmits , to the base station , an ack / nack feedback indicating whether there is error in data received via pdsch . after that , the user equipment determines whether to reactivate multi - carrier mode via an upper layer signaling operation from the base station at step 608 . when the user equipment ascertains that a multi - carrier mode is not reactivated at step 608 , it returns to and proceeds with step 606 . on the contrary , when the user equipment ascertains that a multi - carrier mode is reactivated at step 608 , it operates in a multi - carrier mode according to the command from the base station at step 610 . according to the commands for activating a multi - carrier mode from the base station , the user equipment operates in the mode , which will be described , in detail , referring to fig8 . in order to allow user equipment to switch the operation mode from the single carrier mode to a multi - carrier mode according to a ‘ single component carrier fallback ,’ the base station , described referring to fig5 and 6 , reactivates the multi - carrier mode by an upper layer signaling operation . in addition , the operation can also be achieved by the following methods . method 1 : when a base station reactivates a multi - carrier mode of user equipment , it configures extended dci , via dci serving as scheduling information regarding data transmitted via an anchor carrier , and a carrier indicator indicating component carriers to be activated . the base station creates pdcch based on the extended dci , and transmits it to the user equipment , via the anchor carrier and a phsch serving as a dedicated channel for scheduled data transmission . the user equipment feed basks the base station an ack / nack signal indicating whether to successfully receive the pdsch , and then operates in a multi - carrier mode . after successfully receiving the pdsch , the user equipment can decode it . when the base station receives a feedback of ack / nack regarding the pdsch from the user equipment , it can detect that the user equipment has successfully received the pdcch and thus operates in a multi - carrier mode . method 2 : when the base station reactivates a multi - carrier mode of user equipment , it configures extended dci by coupling a carrier indicator , indicating a component carrier to be activated , with a preset pattern . the preset pattern is used as virtual cyclic redundancy check ( crc ) and reinforces an error detection ability regarding the extended dci . that is , the pattern can be used to minimize the possibility that user equipment detects the extended dci in error and activates multi - carriers , although the base station didn &# 39 ; t instruct the user equipment to activate multi - carriers . the extended dci doesn &# 39 ; t include resource allocation information regarding data that the base station will transmit , scheduling information , transmission format , etc . when the user equipment has successfully received the extended dci via the pdcch , it transmits ack to the base station and operates in a multi - carrier mode . on the contrary , when the user equipment fails to receive the extended dci via the pdcch , it doesn &# 39 ; t feed back and maintains operating in a single carrier mode . only if the base station receives ack for the pdcch from the user equipment , it detects that the user equipment switches the mode to a multi - carrier mode . method 3 : the base station defines a specific codeword of a carrier indicator , included in extended dci , as a ‘ multi - carrier re - activation ’ command . when user equipment receives a ‘ multi - carrier re - activation ’ command , it switches the mode to a multi - carrier setting state immediately before being switched to a single carrier mode . for example , when user equipment has been operated a multi - carrier mode including dl cc # 1 , dl cc # 2 , dl cc # 3 , and dl cc # 4 , immediately before being switched to a single carrier mode , it can re - operate the multi - carrier mode including dl cc # 1 , dl cc # 2 , dl cc # 3 , and dl cc # 4 , according to the ‘ multi - carrier re - activation ’ command . when the base station creates extended dci , via dci regarding data scheduled via an anchor carrier , and transmits the extended dci and the ‘ multi - carrier re - activation ’ command to user equipment via pdcch , the user equipment feeds back the base station an ack / nck regarding pdsch , accompanied by the pdcch , thereby informing the base station of the successful reception of the ‘ multi - carrier re - activation ’ command . the base station creates extended dci by coupling the ‘ multi - carrier re - activation ’ command with a preset pattern , and transmits it via pdcch . the extended dci doesn &# 39 ; t include resource allocation information regarding data that the base station will transmit , scheduling information , transmission format , etc . in that case , only if the base station receives ack for the pdcch from the user equipment , it detects that the user equipment switches the mode to a multi - carrier mode . fig7 illustrates a first embodiment of a procedure of methods 1 , 2 , and 3 , described above , where the base station enables the user equipment to switch the current single carrier mode to a multi - carrier mode , according to a ‘ single component carrier fallback ’ command . at step 702 , the current base station allows user equipment to be scheduled to operate in a single carrier mode . at step 704 , the base station determines whether to allow the user equipment to maintain the single carrier mode or to reactivate a multi - carrier mode . for example , if the base station has sufficient data to be transmitted to the user equipment or a sufficient amount of available system resources , it instructs the user equipment to reactivate a multi - carrier mode . when the base station allows the user equipment to maintain the single carrier mode at step 704 , it returns to and proceeds with step 702 . on the contrary , when the base station allows the user equipment to reactivate a multi - carrier mode at step 704 , it configures extended dci , via a ‘ multi - carrier reactivation ’ command or a carrier indicator that indicates component carriers to be activated , instead of a ‘ single component carrier fallback ’ command , and transmits it via pdcch , at step 706 . when the extended dci includes scheduling information regarding data scheduled via an anchor carrier , the base station additionally transmits the scheduled data via pdsch . at step 708 , the base station determines whether the user equipment has successfully received the extended dci . if the base station has transmitted pdsch and received ack / nack regarding the pdsch from the user equipment at step 706 , it detects whether the user equipment has successfully received the extended dci according to the ack / nack . if the base station has not scheduled pdsch at step 706 but receives ack regarding pdcch , through which the extended dci is transmitted , from the user equipment , it detects that the user equipment has successfully received the extended dci . when the base station ascertains that the user equipment fails to receive the extended dci at step 708 , it returns to and proceeds with step 704 . on the contrary , when the base station ascertains that the user equipment has successfully received the extended dci at step 708 , it executes a multi - carrier mode with respect to the user equipment at step 710 . fig8 illustrates a first embodiment of a procedure of methods 1 , 2 , and 3 , described above , where the user equipment switches the mode from a single carrier mode to a multi - carrier mode , according to a ‘ single component carrier fallback ’ command . at step 802 , the user equipment stops receiving data via the remaining component carriers other than the anchor carrier and operates in a single carrier mode . at step 804 , the user equipment determines whether to receive a carrier indicator that indicates a specific component carrier or a ‘ multi - carrier reactivation ’ command , instead of a ‘ single component carrier fallback ’ command , from the base station , via pdcch . when the user equipment has received a ‘ single component carrier fallback ’ command or fails to receive data via pdcch at step 804 , it returns to and proceeds with step 802 . on the contrary , when the user equipment has received a carrier indicator or a ‘ multi - carrier reactivation ’ command at step 804 , it identifies whether the received pdcch data includes scheduling information regarding data at step 806 . when the user equipment ascertains that the received pdcch data includes scheduling information , it feeds back the base station an ack or nack signal indicating whether the data has been successfully received via pdsch or not . on the contrary , when the user equipment ascertains that the received pdcch data doesn &# 39 ; t include scheduling information , it feeds back the base station an ack . as step 808 , when the user equipment activates a component carrier , indicated by a carrier indicator received via the pdcch , or a ‘ multi - carrier reactivation ’ command via the pdcch , it switches the mode to a multi - carrier state immediately before executing a ‘ single component carrier fallback .’ in embodiment 2 , user equipment where multi - carriers are activated performs the deactivation and performs a single carrier mode , in an lte - a system supporting carrier aggregation . user equipment transmits downlink control information : via extended dci including carrier indicators ( cis ), in a multi - carrier mode ; and via usual dci that does not include cis , in a single carrier mode . unlike embodiment 1 , embodiment 2 has a feature that requires , the user equipment , a feedback indicating whether the user equipment has successfully received a ‘ single component carrier fallback .’ fig9 illustrates a second embodiment of a procedure where a base station allows user equipment to switch the mode from the current multi - carrier mode to a single carrier mode and then to the multi - carrier mode , via the ‘ single component carrier fallback .’ at step 902 , the base station activates multi - carriers with respect to user equipment to be scheduled . when an lte - a user equipment first accesses a system , the base station determines whether it can support carrier aggregation of the user equipment , and notifies the user equipment of the number of component carriers to be aggregated and the activation state of multi - carriers including the type of component carrier to be aggregated and the determination as to whether a multi - carrier mode is performed . at step 904 , the base station determines whether to allow the user equipment to maintain the activation state of multi - carriers or to deactivate the activation and to switch the current mode to a single carrier mode to receive data via only a preset anchor carrier . for example , when the base station does not have sufficient data to be transmitted to the user equipment or the available system resources , it instructs the user equipment to perform a single carrier mode . when the base station allows the user equipment to maintain the activation state of multi - carriers at step 904 , it returns to and proceeds with step 902 . on the contrary , when the base station allows the user equipment to operate in a single carrier mode at step 904 , it sets the carrier indicator for the user equipment as a value preset as a ‘ single component carrier fallback ,’ and creates extended dci at step 906 . the extended dci is channel - decoded , modulated and interleaved , thereby creating pdcch . the pdcch is transmitted to the user equipment via the anchor carrier . the carrier indicator , preset for the ‘ single component carrier fallback ’ command , may be set as ci =“ all one ,” for example . the extended dci includes dci , serving as scheduling information regarding data scheduled via an anchor carrier , or a preset pattern instead of scheduling information regarding data . if the extended dci includes dci serving as scheduling information regarding data scheduled via an anchor carrier , the base station additionally transmits the scheduled data via pdsch . the preset pattern is used as virtual cyclic redundancy check ( crc ) and reinforces an error detection ability regarding the extended dci . that is , the pattern can be used to minimize the possibility that user equipment detects the extended dci in error and operates in a single carrier mode , although the base station didn &# 39 ; t instruct the user equipment to execute a ‘ single component carrier fallback ’ command . at step 908 , the base station determines whether the user equipment has successfully received extended dci including the ‘ single component carrier fallback ’ command . if the base station has transmitted pdsch and received ack / nack regarding the pdsch from the user equipment at step 906 , it detects whether the user equipment has successfully received the extended dci according to the ack / nack . if the base station has not scheduled pdsch at step 906 but receives ack regarding pdcch , through which the extended dci is transmitted , from the user equipment , it detects that the user equipment has successfully received the extended dci . when the base station ascertains that the user equipment fails to receive the extended dci at step 908 , it returns to and proceeds with step 906 . on the contrary , when the base station ascertains that the user equipment has successfully received the extended dci at step 908 , it executes a single carrier mode with respect to the user equipment at step 910 . at step 910 , when the base station intends to schedule data additionally transmitted via an anchor carrier , with respect to the user equipment , it creates downlink control information by only dci for scheduling data transmitted via the anchor carrier without a carrier indicator . the created downlink control information is channel - coded , modulated , and interleaved , thereby creating pdcch . the pdcch is transmitted to the user equipment via the anchor carrier . at step 912 , the base station determines whether to allow the user equipment to maintain the single carrier mode or to reactivate the multi - carrier mode . if the base station has sufficient data to be transmitted to the user equipment or a sufficient amount of available system resources , it instructs the user equipment to reactivate multi - carriers . when the base station allows the user equipment to maintain the single carrier mode at step 912 , it returns to and proceeds with step 910 . on the contrary , when the base station allows the user equipment to reactivate the multi - carrier mode at step 912 , it notifies the user equipment of the specific activation state for the multi - carrier mode by an upper layer signaling operation at step 914 . the notification procedure will be described , in detail , later , referring to fig1 . fig1 illustrates a second embodiment of a procedure where user equipment switches the current multi - carrier mode to a single carrier mode and then to the multi - carrier mode , according to instructions from a base station . referring to fig1 , the user equipment activates the multi - carriers according to the command from the base station at step 1002 . at step 1004 , the user equipment receives pdcch from the base station and determines whether the carrier indicator is set to a ‘ single component carrier fallback .’ when the user equipment ascertains that the carrier indicator is not set to a ‘ single component carrier fallback ’ at step 1004 , it returns to and proceeds with step 1002 . on the contrary , when the user equipment ascertains that the carrier indicator is set to a ‘ single component carrier fallback ’ at step 1004 , it identifies whether the received pdcch data includes scheduling information regarding data at step 1006 . when the user equipment ascertains that the received pdcch data includes scheduling information , it feeds back the base station an ack or nack signal indicating whether the data has been successfully received via pdsch or not . on the contrary , when the user equipment ascertains that the received pdcch data doesn &# 39 ; t include scheduling information , it feeds back the base station an ack . at step 1008 , the user equipment stops receiving data via the remaining component carriers other than the anchor carrier and operates in a single carrier mode . after that , the user equipment determines whether to reactivate multi - carrier mode via an upper layer signaling operation from the base station at step 1010 . when the user equipment ascertains that a multi - carrier mode is not reactivated at step 1010 , it returns to and proceeds with step 1008 . on the contrary , when the user equipment ascertains that a multi - carrier mode is reactivated at step 1010 , it operates in a multi - carrier mode according to the command from the base station at step 1012 . according to the commands for activating a multi - carrier mode from the base station , the user equipment operates in the mode , which will be described , in detail , referring to fig1 . in order to allow user equipment to switch the operation mode from the single carrier mode to a multi - carrier mode according to a ‘ single component carrier fallback ,’ the base station , described referring to fig9 and 10 , reactivates the multi - carrier mode by an upper layer signaling operation . in addition , the operations can also be achieved by the following embodiments described in fig1 and 12 . fig1 illustrates a second embodiment of a procedure where the base station enables the user equipment to switch the current single carrier mode to a multi - carrier mode , according to a ‘ single component carrier fallback ’ command . at step 1102 , the current base station allows user equipment to be scheduled to operate in a single carrier mode . at step 1104 , the base station determines whether to allow the user equipment to maintain the single carrier mode or to reactivate a multi - carrier mode . for example , if the base station has sufficient data to be transmitted to the user equipment or a sufficient amount of available system resources , it instructs the user equipment to reactivate a multi - carrier mode . when the base station allows the user equipment to maintain the single carrier mode at step 1104 , it returns to and proceeds with step 1102 . on the contrary , when the base station allows the user equipment to reactivate a multi - carrier mode at step 1104 , it must use usual dci without a carrier indicator , as downlink control information , during the single carrier mode at 1106 . in that case , the base station instructs the user equipment to return to the multi - carrier mode , by fixing part of the dci to a preset pattern or all of the dci to a preset pattern to reinforce the error detection . if part of the dci is fixed to a preset pattern , the base station informs the user equipment of scheduling information regarding data scheduled via an anchor carrier , via the remaining dci areas , and then transmits the scheduled data via pdsch . if all of the dci is fixed to a preset pattern , the base station doesn &# 39 ; t schedule data . at step 1108 , the base station determines whether the user equipment has successfully received the dci . if the base station has transmitted pdsch and received ack / nack regarding the pdsch from the user equipment at step 1106 , it detects whether the user equipment has successfully received the dci according to the ack / nack . if the base station has not scheduled pdsch at step 1106 but receives ack regarding pdcch , through which the dci is transmitted , from the user equipment , it detects that the user equipment has successfully received the dci . when the base station ascertains that the user equipment fails to receive the dci at step 1108 , it returns to and proceeds with step 1106 . on the contrary , when the base station ascertains that the user equipment has successfully received the dci at step 1108 , it executes a multi - carrier mode with respect to the user equipment at step 1110 . in that case , the user equipment switches the mode to a multi - carrier setting state immediately before being switched to a single carrier mode . for example , when the user equipment has been operated a multi - carrier mode including dl cc # 1 , dl cc # 2 , dl cc # 3 , and dl cc # 4 , immediately before being switched to a single carrier mode , it can re - operate the multi - carrier mode including dl cc # 1 , dl cc # 2 , dl cc # 3 , and dl cc # 4 , at step 1110 . fig1 illustrates a second embodiment of a procedure where the user equipment switches the mode from a single carrier mode to a multi - carrier mode , according to a ‘ single component carrier fallback ’ command . at step 1202 , the user equipment stops receiving data via the remaining component carriers other than the anchor carrier and operates in a single carrier mode . at step 1204 , the user equipment detects dci from pdcch transmitted from the base station . if the user equipment ascertains that the dci is not set to a preset pattern to notify the base station of the switching operation to a multi - carrier mode , it returns to and proceeds with step 1202 . on the contrary , if the user equipment ascertains that par or all of the dci is set to a preset pattern to notify the base station of the switching instruction to a multi - carrier mode , it detects that it must return to a multi - carrier mode at step 1206 . that is , the user equipment identifies whether the received pdcch data includes scheduling information regarding data at step 1206 . when the user equipment ascertains that the received pdcch data includes scheduling information , it feeds back the base station an ack or nack signal indicating whether the data has been successfully received via pdsch or not . on the contrary , when the user equipment ascertains that the received pdcch data doesn &# 39 ; t include scheduling information , it feeds back the base station an ack . as step 1208 , the user equipment witches the mode to a multi - carrier state immediately before executing a ‘ single component carrier fallback .’ fig1 illustrates a configuration of a base station according to the invention . referring to fig1 , the base station includes a carrier aggregation controller 1302 , a scheduler 1304 , a number of dci processors 1312 and 1314 , a multiplexer 1316 , a scrambler 1318 , a modulator 1320 , a resource mapper 1322 , and an ofdm signal creator 1324 . a dci processor 1312 , one of a number of dci processors 1312 and 1314 , is related to user equipment , ue # 1 , and includes a dci creating unit 1306 , a channel coding unit 1308 , and a rate matching unit 1310 . the other dci processors 1314 , related to ue # 2 to ue # n , have the same components as dci processor 1312 for ue # 1 . the carrier aggregation controller 1302 determines the carrier aggregation with respect to user equipment to be scheduled , referring to amount of data to be transmitted to user equipment and the amount of available system resources , and informs the scheduler 1304 of the determination . if the carrier aggregation controller 1302 intends to notify ue # 1 operating in a multi - carrier mode of the determination of a ‘ single component carrier fallback ,’ the scheduler 1304 controls the dci creating unit 1306 to configure extended dci by setting a carrier indicator to a preset codeword for a ‘ single component carrier fallback .’ the extended dci is equipped with an error correction ability by the channel coding unit 1308 , rate - matched by the rate matching unit 1310 with the amount of mapped resources to be mapped , and multiplexed with dci of the other user equipment by the multiplexer 1316 . the multiplexed signal is processed via the scrambler 1318 and the modulator 1320 and mapped to time - frequency resources to be transmitted by the resource mapper 1322 . the ofdm signal creator 1324 creates an ofdm signal from the mapped signal and transmits it to the user equipment . fig1 illustrates a configuration of user equipment according to the invention . referring to fig1 , the user equipment includes an ofdm signal receiver 1402 , a resource re - mapper 1404 , a demultiplexer 1406 , a descrambler 1408 , a demultiplexer 1410 , a de - rate matching unit 1412 , a channel decoding unit 1414 , a dci acquiring unit 1416 , and a carrier aggregation controller 1418 . the ofdm signal receiver 1402 receives signal from the base station . the resource re - mapper 1404 extracts pdcch from the signals received by the ofdm signal receiver 1402 . the demultiplexer 1406 and the descrambler 1408 process the pdcch . the demultiplexer 1410 extracts corresponding allocated pdcch from the processed pdcch from the descrambler 1408 . the de - rate - matching unit 1412 re - rate - matches the pdcch extracted by the user equipment . the channel decoding unit 1414 decodes the re - rate - matched pdcch . the dci acquiring unit 1416 extracts dci from the decoded result . the dci is output to the carrier aggregation controller 1418 and used to control the carrier aggregation state of the user equipment . if the dci indicates a ‘ single component carrier fallback ,’ the carrier aggregation controller 1418 controls the ofdm signal receiver 1402 to receive data via only an anchor carrier , thereby reducing electric power consumption . although the embodiments were described where downlink component carriers are aggregated , it should be understood that the invention can also applied to the aggregation of uplink component carriers . the embodiment where the base station instructs user equipment to operate according to the ‘ single component carrier fallback ’ may be modified in such a way that the base station can define part or all of the extended dci to be transmitted to a preset pattern and deactivates a specific component carrier indicated by a carrier indicator . as described above , the system and method according to the invention can allow user equipment to rapidly deactivate the carrier aggregation in a wireless communication system that supports a wide range of bandwidth via carrier aggregation , thereby reducing electric power consumption in the user equipment . although exemplary embodiments of the invention have been described in detail hereinabove , it should be understood that many variations and modifications of the basic inventive concept herein described , which may be apparent to those skilled in the art , will still fall within the spirit and scope of the exemplary embodiments of the invention as defined in the appended claims . | 7 |
while this invention is susceptible of embodiment in many different forms , there are shown in the drawings and will be described herein in detail specific embodiments thereof with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the invention to the specific embodiments illustrated . fig1 and 2 illustrates a trailer - mounted crane apparatus 20 in accordance with the present invention . the apparatus 20 includes a trailer 22 supporting a crane 26 . the trailer 22 includes a platform 24 which surrounds the crane 26 . the trailer 22 is supported on wheels 32 , 34 ( shown in fig3 ). the trailer 22 can be further supported or stabilized by two or more outriggers 36 , 38 , 40 , 42 ( shown in fig3 ) extending from the platform 24 , which can be used to increase the overturning capacity of the crane , or to level the crane as needed . attached to the platform 24 is an operator &# 39 ; s seat 46 which is disposed adjacent to , and laterally of , a control panel 50 . the control panel includes control actuators 51 . in a prototype trailer - mounted crane apparatus , a salvaged , solid body trailer ( non - tilt ) was utilized . the trailer is a standard trailer used in the cable industry for hauling 4000 - 5000 pound spools of cable and having a capacity of 12 , 000 pounds . the crane 26 is of a known configuration such as disclosed in u . s . pat . no . 4 , 183 , 712 . it is of a hydraulically operated boom configuration having an arm or boom 52 which can telescopically extend outwardly , pivot upwardly and pivot about a vertical centerline 62 of a central post 64 of the crane 26 . the crane arm 52 preferably has a 16 foot reach . a hydraulic power unit 65 ( shown schematically as a box ) drives the crane and is in control communication with the panel 50 . the power unit typically includes a gasoline or diesel powered engine which drives a hydraulic pump for generating pressurized hydraulic fluid . the crane center post 64 is welded or otherwise connected to an elongated , cylindrical actuator 68 which is located above , and welded or otherwise connected to , an outrigger cylinder 69 , which is mounted and fastened to the trailer 22 as described below . the actuator 68 contains a two - way piston ( not shown ) which is operatively connected to the center post 64 , such as by a rack and pinion arrangement , to cause corresponding rotation of the center post upon linear actuation of the two - way piston . the outrigger cylinder 69 has a substantially rectangular cross - sectional profile . a hydraulic fluid reservoir 70 is fastened or otherwise connected to the outrigger cylinder 69 . the center post 64 and reservoir 70 are substantially aligned on a longitudinal centerline 71 of the platform 24 , as shown in fig3 . the outrigger cylinder 69 is not used for outrigging in the apparatus 20 . in the prototype trailer - mounted crane apparatus , the crane 26 was salvaged from a lifting vehicle which utilized the outrigger cylinder in a laterally extending orientation such that side outriggers could be deployed laterally to either side of the vehicle and then adjusted vertically to contact the ground . although the outrigger cylinder was not utilized for deploying outriggers in the prototype , the weight of the outrigger cylinder , arranged longitudinally , assists in stabilizing the trailer and resisting overturning forces . additionally , the salvaged crane 26 with its outrigger cylinder 69 arranged longitudinally , conveniently bolts to the cross bracing of the trailer 2 , as described hereinafter . at a distal end of the crane arm 52 , a support chain , cable or line 74 holds a vibratory device 78 which is used for driving piling sheets 79 . the vibratory device 78 includes a hydraulically actuated jaw 82 for gripping a top edge of the piling sheet 79 . the vibratory device 78 includes an internal vibrational drive motor ( not shown ) which , combined with the weight of the vibrational device 78 pressed down on the sheet , causes vibration to drive the sheet 79 into the ground as shown in fig2 . such vibratory drivers are known in the industry , such as available from american pile driving equipment corporation and weighing about 900 lbs . fig3 and 4 illustrate the layout of the trailer - mounted crane apparatus 20 . the platform 24 is supported on an undercarriage 102 ( shown in fig5 ). the platform includes a surrounding rectangular steel frame 103 and two longitudinal spaced apart deck 105 , 107 , separated by an open central space 109 . the crane 26 , including the control panel 50 , the actuator 68 , the outrigger cylinder 69 , the center post 64 , and the reservoir 70 , as an integral unit , is mounted within the central space 109 onto the undercarriage 102 . the undercarriage 102 includes an a - shaped frame 104 having a hitch attachment 106 at an apex thereof . additionally , two lifting jacks 110 , 112 are located adjacent the hitch attachment 106 for lifting the frame 104 in order to engage the hitch attachment 106 to a vehicle hitch . between the lifting jacks 110 , 112 and the platform 24 , a vibrational driver hydraulic power unit or power pack 116 ( shown schematically as a box ) is mounted on the undercarriage and is dedicated to driving the vibrational driver 78 . the power unit 116 typically includes a gasoline or diesel powered engine driving a hydraulic pump to produce pressurized hydraulic fluid . hydraulic lines 120 schematically indicated in fig3 by a single line , and shown in fig8 , communicate hydraulic fluid control and power from the power unit 116 to the vibrational driver 78 . hydraulic and / or electrical control lines 126 communicate between the control panel 50 and the power unit 116 . thus , an operator siting in the seat 46 can control both the movement and operation of the crane arm 52 and the operation of the vibrational driver 78 . a vibrational driver cradle 130 is located at a rear of the platform 24 and is used for receiving and fixedly holding the vibrational driven 78 during road transportation of the apparatus 20 . the cradle has a surrounding wall 131 and an interior plate 132 for clamping by the jaw 82 of the driver 78 . an alternate driver retainer in the form of a rod 134 extends rearwardly from the platform 24 and is supported by a support bar 135 within the space 109 , and a rear bar 103 a of the frame 103 . during movement in the field , the vibrational driver can be temporarily held securely onto the rod 134 by the jaw 82 . thus , the more secure , but more time consuming , placement of the driver 78 into the cradle 130 is avoided for short trips in the field . the driver 78 can be quickly and easily clamped to the rod 134 and held thereby . for transportation on the roadway , the driver 78 can be installed into the cradle 130 and the rod 134 can be recessed behind the rear bar 103 a of the frame 103 as shown in phantom . in front of the cradle 130 , and laterally of the crane center post 64 , is a hydraulic tubing accumulator box 136 . especially when the driver 78 is stored in the cradle 130 , the box 136 can hold hydraulic lines otherwise extending between the power unit 116 and the driver 78 as shown in fig8 . an onboard tool storage box 140 can be provided in the space between the control panel 50 and the power unit 116 . fig5 illustrates the undercarriage 102 and lower crane components supported thereon . the undercarriage comprises longitudinal beams 140 , 142 which are laterally spaced apart and connected together by lateral beams 146 , 148 . the beams 140 , 142 support the platform 24 shown in fig1 - 4 . the beams 140 , 142 , 146 , 148 can be rectangular tubular members . the connection between the beams can be welded connections . the crane components supported include : the outrigger reservoir 69 arranged longitudinally , the fluid reservoir 70 , a support bracket 152 , and a base 64 a for the rotatable center post 64 all integrally fastened or welded together as a unit . the crane components described are set onto the lateral beams 146 , 148 and fastened thereto . as shown in fig6 the lateral outrigger reservoir 69 includes longitudinally arranged bolt channels 158 , 160 having open top and bottom faces . a rectangular washer plate 162 is place against opposite faces of each channel 158 , 160 , the washer plate 162 having a width wider than the open top and bottom faces of the channels . a bottom surface 166 of the lateral outrigger reservoir 69 is supported on the lateral beams 146 , 148 . a pair of through bolts 172 and associated nuts 173 clamp the bottom surface 166 to the lateral beam 146 , 148 using the two plate washers 162 respectively . as shown in fig7 , the support bracket 152 is mounted to the lateral beams 146 , 148 in the same fashion . thus , the crane 26 is bolted in a four point grid on the undercarriage 102 . the lateral beams 146 , 148 are spaced approximately equidistant to , and on opposite sides of , an axle 149 which supports the undercarriage 102 from the wheels 32 , 34 . fig9 illustrates an alternate embodiment trailer - mounted crane apparatus 200 which is substantially identical to the apparatus 20 except that the outriggers 36 , 38 , 40 , 42 are replaced with outwardly extending , pivotable outriggers 238 at all four corners which pivot downwardly to press rectangular pads 240 onto the ground . these outriggers 238 allow a wider support , extending out about 5 feet from the platform 24 . these outriggers 238 each utilize an arm 244 pivotally connected to the pad 240 . the arm is pivotally connected at a point 246 to the platform 24 and to a channel - shaped riser 248 . the riser is braced by a column 252 fixedly connected to the platform 24 . a hydraulic cylinder 258 is pivotally connected at a connection 262 to the riser 248 and at a connection 266 to lugs 267 welded to the arm 244 . thus , expansion or contraction of the hydraulic cylinder 258 will cause pivotal lowering or raising of the arm . the arm 244 can be raised to a substantial vertical position for road travel . the outriggers 238 can be controlled from the control panel 50 . it is also encompassed by the invention that outriggers 238 are only provided at the rear corners , which has been demonstrated to work satisfactorily . it is also encompassed by the invention to provide the vertically movable outriggers 36 , 38 , 40 , 42 along with the outriggers 238 , at the rear corners only or at all four corners . depending on the surface encountered , the outriggers 36 , 38 , 40 , 42 and / or the outriggers 238 can then be deployed . the major components for the crane apparatus 20 , 200 are commercially available . for example , the crane 26 can be a hiab - fogo ( sweden ) model 650 ( year 1971 ) or similar . the vibratory driver 78 and the driver hydraulic power unit 116 can be a model 6 vibratory hammer and model 14 power pack from american piledriving equipment , inc . of kent , washington . the trailer platform 24 can be a vermeer single axle ( 6 foot by 9 foot platform ) trailer having a 16 ′ overall length , such as salvaged from a trailer used to transport large electrical coils . the preferred dimensions for the apparatus 20 are as follows ( referring to fig3 and 4 ). the wheel base dimension a is about 108 inches . the longitudinal dimension b between the rear outriggers 36 , 38 and the wheel centerline is about 55 inches . the longitudinal distance c between the wheel centerline and the front outriggers 40 , 42 is about 53 inches . the longitudinal distance d between the front outriggers 40 , 42 and the hitch 106 is about 7 feet . the wheels 32 , 34 use tires 32 a , 34 a which are oversized and are particularly useful in travel throughout a golf course where damage to delicate or pristine areas of the course must be avoided . for example , the tires 32 a , 34 a will not damage the surface of a putting green . the width of the tires of the preferred embodiment are effective to dissipate the trailer load over a wide ground surface area . the tires are nearly twice the width of the street tires ( using 8 . 75 inch rims for road use ) which are used to transport the trailer on roadways . in this regard , the tires have a tread width f of 16 inches . the ground height g to the support point of the crane 26 is about 19 2 inches . the prototype crane apparatus 20 has a total weight of approximately : 5600 pounds . the crane assembly , including the components 26 , 50 , 65 , weighs about 2700 pounds . the vibratory driver 78 weighs about 900 pounds . the vibratory driver power unit 116 weighs about 700 pounds . the trailer weighs about 600 pounds . the outriggers shown in fig9 ( rear only ) together weigh about 650 pounds . the present invention provides a compact , lightweight yet effective trailer - mounted crane apparatus especially suited for soft or delicate terrains . the compact trailer - mounted crane apparatus has a lifting capacity of at least 1200 pounds at a reach of 16 feet which is well suited for driving sheet piling using a 900 pound vibratory driver . the present invention is particularly useful in driving sheet piling on golf courses . using a vibratory driver , sheets can be driven at night without generating an excessive amount of noise . the present invention apparatus 20 , 200 effectively combines a lifting apparatus with a vibratory driver device into a single , compact and effective piece of equipment . a single operator seated on the trailer can control both the crane and the vibratory driver . heretofore , the vibratory driver was lifted by an operating piece of equipment such as a back hoe , and the vibratory drive was controlled by a second operator with the vibratory hydraulic power unit located separate from the back hoe . this unnecessarily used staging area which could be better suited in storing materials or staging other equipment participating in the sheet piling installation . from the foregoing , it will be observed that numerous variations and modifications may be effected without departing from the spirit and scope of the invention . it is to be understood that no limitation with respect to the specific apparatus illustrated herein is intended or should be inferred . it is , of course , intended to cover by the appended claims all such modifications as fall within the scope of the claims . | 1 |
fig1 is a skeleton diagram schematically showing an automatic which forms the subject of the present invention . the automatic transmission , as shown , is equipped as its shift mechanism with a torque converter 20 , a second transmission assembly 40 and a first transmission assembly 60 for effecting three - forward and one reverse gear changes . the torque converter 20 is equipped with a pump impeller 21 , a turbine runner 22 , a stator 23 and a lockup clutch 24 . the pump impeller 21 is connected to the crankshaft 10 of an engine e , and the turbine runner 22 is connected to the carrier 41 of a planetary gear set in the second transmission assembly 40 . in this second transmission assembly 40 , a pinion gear 42 held rotatably by the carrier 41 is meshing with a sun gear 43 and a ring gear 44 . moreover , a clutch c0 and a one - way clutch f0 are interposed between the sun gear 43 and the carrier 41 , and a brake b0 is interposed between the sun gear 43 and a housing hu . the first transmission assembly 60 is equipped with two front and rear planetary gear sets . these planetary gear sets share a sun gear 61 and are equipped , respectively , with pinion gears 64 and 65 for meshing with the common sun gear 61 , carries 66 and 67 for holding the pinion gears 64 and 65 , and ring gears 62 and 63 for meshing with the pinion gears 64 and 65 . the ring gear 44 of the second transmission assembly 40 is connected through a clutch c1 to the aforementioned ring gear 62 . another clutch c2 is interposed between the ring gear 44 and the sun gear 61 . moreover , the aforementioned carrier 66 and ring gear 63 are connected to each other and together to an output shaft 70 . between the aforementioned carrier 67 and housing hu , on the other hand , there are interposed a brake b3 and a one - way clutch f2 . moreover , a brake b2 is interposed through another one - way clutch f1 between the sun gear 61 and the housing hu , and a brake b1 is interposed between the sun gear 61 and the housing hu . the automatic transmission is equipped with the shift mechanism thus far described and has its individual clutches and brakes engaged and / or released , as presented at the column b in fig2 to perform the shift control . this shift control is effected by controlling solenoid valves s1 to s3 and ssln and a linear solenoid valve sslu in an oil pressure control circuit 106 in accordance with a present shift pattern , by means of an electronic control unit ( ecu ) 104 which is made receptive of the signals of a throttle opening sensor 100 for detecting a throttle opening θ representation of a load state of the engine e and a vehicular velocity sensor 102 for detecting the running velocity of the vehicle . in the clutch and brake application chart of fig2 : symbols ◯ indicate the engaged state ; symbols x indicate the engaged state to be taken only at the time of engine braking ; and blanks indicate the released state . considering the balance between the difficulty in the control of simultaneous shifts and the benefit of multiple gear changes , the present invention is exemplified by an automatic transmission capable of effecting five - forward gear changes of 1st , 2nd , 3rd , 5th and 6th speeds while abolishing the 4th speed appearing in the clutch and brake application chart of fig2 . the aforementioned solenoid valves s1 and s2 control the first and second shift valves of the first transmission assembly 60 , and the solenoid valve s3 controls a third shift valve for shifting the second transmission assembly 40 from high to low gears , as shown in fig3 a and 3b . on the other hand , the solenoid valve ssln controls the back pressures of the individual accumulators including the accumulator of the brake b0 . moreover , the linear solenoid valve sslu controls the oil pressure of the brake b0 . in fig1 reference numeral 110 designates a shift position sensor for detecting such one of positions including the neutral range ( n ), the drive range ( d ) or the reverse range ( r ), as is selected by the driver . numeral 112 designates a pattern select switch for selecting one of shift patterns including the economy mode ( e ) and the power mode ( p ). moreover , numeral 114 designates a water temperature sensor for detecting the temperature of the cooling water of the engine e . numeral 116 designates a brake switch for detecting the depression of the foot brake . numeral 118 designates a brake switch for detecting the pull of the side brake . for the gear change from 2nd to 3rd speeds , the automatic transmission thus constructed is controlled , as is apparent from fig2 to engage the brake b2 of the first transmission assembly 60 and to release the brake b0 of the second transmission 40 . if , in this case , no control is elaborately performed like the prior art for releasing the brake b0 , this release of the brake b0 is stated earlier than the engagement of the brake b2 of the first transmission assembly 60 so that the down shift of the second transmission assembly 40 goes ahead irrespective of the upshift from 2nd to 3rd speeds . this gives the automatic transmission the overall characteristics , in which a small downshift is accompanied by a large upshift . in this automatic transmission , therefore , the brake b0 has its oil pressure modulated at its release time so that it may be release while maintaining the balance with the brake b2 . this control is exemplified by feeding back the oil pressure on the basis of a control signal coming from the electronic control unit 104 while monitoring the actual shifted state such as the revolving states of the rotary members . as a result , the following two pressure modulating mechanisms are connected with the hydraulic servomechanism for engaging and releasing the brake b0 : an accumulator acting as the pressure modulating means for functioning when in the ordinary engagement control ; and a control valve acting as the pressure modulating means for functioning when in the release . in order to avoid the interference between these two pressure modulating mechanisms , there is adopted the following oil passage structure . fig3 a and 3b show an essential portion of the aforementioned hydraulic system . in fig3 a and 3b : reference numeral 210 designates a shift valve for switching supply and discharge of the oil pressure to and from the brake b0 ; numeral 220 designates a b0 control valve for modulating the oil pressure at the time of releasing the brake b0 ; numeral 230 designates a first relay valve ; numeral 240 designates an accumulator control valve for controlling the back pressures of the plural accumulators ; numeral 250 designates a b0 accumulator for controlling the oil pressure at the time of engaging the brake b0 ; numeral 250 designates a b2 accumulator for controlling the oil pressure at the time of engaging the brake b2 ; numeral 270 designates a manual valve to be operated in association with the shift lever disposed sideways of the driver &# 39 ; s seat ; numeral 280 designates a solenoid relay valve ; numeral 290 designates a second relay valve ; and numeral 300 designates a check valve . the engagement and release of the brake b0 are controlled in the following manners . first of all , the engagement of the brake b0 will be described in the following . the shift for engaging the brake b0 is divided into two cases , in which only the second transmission assembly 40 shifts by itself while the first transmission assembly 60 being left as it is and in which the first transmission assembly 60 shifts down whereas the second transmission assembly 40 shifts up to a high gear . the former case is exemplified by the shift from the 1st to 2nd speeds or from the 5th to 6th speeds , and the latter case is exemplified by the downshift from the 3rd to 2nd speeds . in the shift for achieving the shift of the automatic transmission in its entirety by shifting the second transmission assembly 40 simultaneously with the first transmission assembly 60 , the time lag till the engagement of the brake b0 is desirably suppressed to be as short as possible for the sequence control of the shift . in the shift for the second transmission assembly 40 only , on the other hand , such desire is not demanded , but a rather relatively slow engagement is preferable for the shifting characteristics . for engaging the brake b0 , therefore , this embodiment switches the oil passage between the cases in which only the second transmission assembly 40 shifts by itself and in which the second transmission assembly 40 is shifted together with the first transmission assembly 60 . these operations will be specifically described in the following . when the brake b0 is to be engaged , the solenoid valve s3 is turned off to apply the oil pressure to one end of the shift valve 210 so that the shift valve 210 is brought into the lefthand state of fig3 a to output a line pressure pl at a port 212 from a port 211 . the b0 control valve 220 is of the spool type , in which a spool 225 is formed with : a land 226 for opening or closing a port 221 to be fed with the line pressure pl ; a land 227 for opening or closing a drain port ex which is formed adjacent to a port 223 for outputting a modulated oil pressure ; and a land 228 having a larger diameter than the land 227 . at the axially opposed end to a spring fs2 for urging the spool 225 axially , there is formed a port 229 which communicates with the port 223 . moreover , a control pressure port 224 is opened between the larger - diameter land 228 and the adjacent land 227 . as a result , the line pressure pl is modulated to a level according to the elastic force of the spring fs2 so that the modulated pressure is outputted from the port 223 , in case the control pressure is not applied to the control pressure port 224 . in case the control pressure is applied to the control pressure port 224 , on the other hand , the pressure modulating level is reduced according to the control pressure . here , the control pressure for the control pressure port 224 is generated by the linear solenoid valve sslu and is fed through the solenoid relay valve 280 . moreover , the spool 225 is forced into the state , as shown at the lefthand side of fig3 a , to block the pressure modulating action by applying the oil pressure to a port 222 , which is located at the lower side of fig3 a , by the action of the spring fs2 . incidentally , this state is achieved by feeding from the first relay valve 230 to the port 222 the d - range pressure which is generated when the shift lever ( although not shown ) is in the drive range . the aforementioned first relay valve 230 is provided for augmenting the oil supply passage to the brake b0 when the automatic transmission is shifted down from the 3rd to 2nd speeds . this first relay valve 230 effects the connection and disconnection between ports 236 and 237 and the connection and disconnection between ports 231 and 232 according to the balance among the oil pressure of the brake b2 acting upon a port 233 , the oil pressure of the the clutch c0 acting upon a port 234 , the oil pressure of the clutch c2 acting upon a port 235 , and the elastic force of a spring fs3 . if the shift from the 3rd to 2nd speeds is decided , more specifically , a higher gear shift command signal of the second transmission assembly 40 is outputted at first to turn off the solenoid valve s1 and the solenoid valve s3 and on the solenoid valve s2 . simultaneously with this , the output pressure pslu of the linear solenoid valve sslu is minimized . in this state , not the oil pressure of the clutches c2 and c0 but only the oil pressure of the brake b2 is established and applied to the port 233 of the first relay valve 230 . then , this first relay valve 230 takes its righthand position , as shown , to provide the communication between the port 236 and the port 237 . this provides the oil passages of a smaller orifice 310 and a larger orifice 320 for the oil passages for the brake b0 so that the oil passage resistances are reduced to effect a rapid engagement of the brake b0 . since , moreover , the output pressure pslu of the linear solenoid valve sslu is minimized , the output pressure of the b0 control valve 220 can be maximized to shorten the time lag till the oil supply to and the engagement of the brake b0 . this occurs not only because the oil passage resistance is dropped but also because the supply oil pressure itself is raised . after a predetermined time period has elapsed from the shift decision from the 3rd to 2nd speeds , a downshift command signal of the first transmission assembly 60 is outputted to turn on the solenoid valve s1 and the solenoid valve s2 and off the solenoid valve s3 . then , the b2 oil pressure of the port 233 of the first relay valve 230 is drained so that the first relay valve 230 takes the lefthand position of fig3 a . as a result , the communication between the port 236 and the port 237 is shut off , but the communication between the port 231 and the port 232 is established . then , the oil passage through the larger orifice 320 of the oil passages to the brake b0 is closed so that the oil is supplied by way of only the oil passage through the smaller orifice 310 . as a result , the shift of only the second transmission assembly 40 by the engagement of the brake b0 is slowly effected to reduce the shifting shocks . in other words , in case of the shift from the 3rd to 2nd speeds , the oil is supplied not only via the oil passage through the smaller orifice 310 but also via the oil passage through the larger orifice 320 for the predetermined time period from the decision of the shift to the output of the shifting command of the first transmission assembly 60 , so that the oil passage resistance is reduced . after lapse of this predetermined time period , the oil is supplied to the brake b0 only via the oil passage through the smaller orifice 310 so that the oil passage resistance is increased to reduce the shocks at the time of the high gear shift of the second transmission assembly 40 . incidentally , for a shift other than that from the 3rd to 2nd speed , e . g ., the shift from the 1st to 2nd speeds or the shift from the 5th to 6th speeds for bringing the brake b0 from released to engaged states , the individual ports of the first relay valve 230 takes the lefthand positions , as shown , so that the oil supply passage to the brake b0 is restricted to that through the smaller orifice 310 only . here , the automatic transmission shown in fig1 has its b0 accumulator 250 functioning no matter whether the oil might be supplied to the brake b0 only by way of the oil passage through the smaller orifice 310 or additionally by way of the oil passage through the larger orifice 320 . specifically , the second relay valve 290 is of spool type , which is formed with : a port 291 communicating with the check valve 300 at its portion housing a spring 295 for urging a spool 294 axially ; and a port 296 for applying a control oil pressure generated by the linear solenoid valve sslu , at its end portion opposed to the end having the former port 291 . the second relay valve 290 is further formed at its axially middle portion with : a port 292 communicating with the hydraulic servomechanism of the brake b0 ; and a port communicating with the b0 accumulator 250 . the communication between the ports 292 and 293 is established or shut off . the second relay valve 290 thus constructed has its port 291 fed with the output pressure of the check valve 300 and takes the righthand position of fig3 a at all times except for the shift from the 2nd to third speeds . the check valve 300 outputs the oil pressure to the second relay valve 290 when the oil pressure of the clutch c0 , the l - range oil pressure and the &# 34 ; 2nd &# 34 ; range oil pressure are individually generated . this automatic transmission uses the gear ratios other than the 4th speed shown in fig2 the second relay valve 290 takes the righthand position , as shown , at the gear changes other than that from the 2nd to 3rd speeds . as a result , in these other gear changes , the oil supplied to the hydraulic servomechanism of the brake b0 is also fed to the port 250 to cause the accumulator 250 to perform its function . thus , in this embodiment , when the brake b0 has its hydraulic servomechanism supplied with the oil , i . e ,. is to be engaged , its transitional characteristics are basically controlled by the b0 accumulator 250 . moreover , this b0 accumulator 250 has its pressure modulating characteristics controlled in the well - known manner by the solenoid valve ssln and the accumulator control valve 240 . on the other hand , as has been described hereinbefore , the b0 control valve 220 never fails to be fixed in the shown lefthand position by the first relay valve 230 , when the brake b0 is to be engaged , to execute no pressure modulation . as a result , the oil pressure at the engagement of the brake b0 is controlled exclusively by the pressure modulating function of the b0 accumulator . next , the control of the oil pressure when the brake b0 has its hydraulic servomechanism drained of its oil , namely , is to be released will be described in the following . since , in this automatic transmission , the gear ratio corresponding to the 4th speed of fig2 is cut off , the shifts for releasing the brake b0 are restricted to the gear changes from the 2nd to 1st speeds , from the 6th to 5th speeds , and from the 2nd to 3rd speeds . of these , the shifts from the 2nd to 1st and from the 6th to 5th are kept away from any change in the first transmission assembly 60 so that no problem will arise even if the release of the brake b0 is not accurately timed . on the contrary , the shift from the 2nd to 3rd speeds is required to have a strictly dimed pressure modulation control because the first transmission assembly 60 is shifted up from the 1st to 2nd speeds concurrently with the release of the brake b0 . for this shift from the 2nd to 3rd speeds , therefore , the second relay valve 290 is brought into the lefthand position , as shown , to have its port 291 kept away from the oil pressure outputted from the check valve 300 , so that the second relay valve 290 has its ports 292 and 293 shut off . as a result , the oil passage between the b0 accumulator 250 and the brake b0 is shut off , and the oil passage between the b2 accumulator and the brake b0 is accordingly shut off so that the b2 accumulator 260 attached to the brake b2 for effecting the gear changes of the first transmission assembly 60 can be freely controlled by the solenoid valve ssln and the accumulator control valve 240 while exerting none of its influences upon the brake b0 . on the other hand , the first relay valve 230 is brought into the shown righthand position so that the d - range pressure at the port 222 of the b0 control valve 220 is drained to enable the b0 control valve 220 to modulate its pressure . as a result , the brake b0 has its releasing oil pressure controlled finely through the b0 control valve 220 by the control pressure pslu which is generated by the linear solenoid valve sslu . fig4 plots the shifting characteristics in case the hydraulic servomechanism of the brake b0 is left connected to the b0 accumulator 250 , and fig5 plots the shifting characteristics in the disconnected case . in case of connection to the accumulator , as seen from fig4 a considerable difference is created between the output pressure of the b0 control valve 220 and the actual oil pressure of the brake b0 . this difference is found , as hatched in fig4 and implies that the oil pressure of the brake b0 is deviated from the target pressure and accordingly that the shift controlling accuracy is all the more deteriorated . in case of a shift with the brake b0 and the accumulator 250 being shut off , on the contrary , little difference arises between the output pressure of the b0 control valve 222 and the actual oil pressure of the brake b0 . this implies that the oil pressure of the brake b0 can be controlled to hit the target , and supports that an arbitrary pressure - modulated state can be accurately realized by properly controlling the control oil pressure pslu which is established by the linear solenoid valve sslu . according to the present embodiment , the communication of the b0 accumulator 250 with the brake b0 can be shut off by the second relay valve 290 , and the b0 control valve 220 can be brought out of its pressure modulation by the first relay valve 230 . thus , the two valve modulating mechanisms of the brake b0 , which might otherwise interfere with each other , are disconnected so that their interferences can be prevented to provide excellent shifting characteristics . | 8 |
with reference to the accompanying drawings , numeral 1 denotes a tool - holder , in its entirety . the tool - holder 1 is mounted preferably to a multi - axis machine tool with numerical control , described below in general terms only , being of conventional type , and not illustrated in the drawings . the machine tool generally comprises a bed on which a spindlehead is mounted , carrying the tool - holder 1 , with freedom of movement relative to the selfsame bed along a plurality of positioning axes . the spindlehead and tool - holder 1 are positionable on the various axes by drive means connected to a processing and control unit and serving also to govern the rotation of the tool about a relative machining axis , on the basis of data programmed into the control unit . the spindlehead comprises a support component to which a chuck is mounted , the tool - holder 1 being associated removably with the chuck . the spindle chuck is rotatable thus about a relative machining axis and set in rotation by suitable drive means , not indicated , in such a way that a milling cutter type tool u carried by the tool - holder 1 can be set in rotation and perform the machining operation . the generic term “ milling ” is used in the present specification to indicate a mechanical machining operation in which the rotation of a milling tool about its longitudinal axis x is accompanied by a feed motion of the tool - holder along a direction extending skew relative to the longitudinal axis x , and generally transverse to this same axis x . the feed motion is induced along an actual surface ‘ sr ’ on or in which the cut is to be made , in such a way as to obtain , for example , a groove , a radius ‘ r ’ or a bevel ‘ s ’ on an already formed corner edge , or to remove a burr or flash ‘ b ’ ( fig3 b ). with reference to fig2 , in particular , the tool - holder 1 comprises a first rotating portion 2 with a coupler 3 attachable to the drive take - off of a conventional milling centre ( not illustrated ) such as will generate the power needed in order to set a milling tool u in rotation about a machining axis x . a second portion 4 of the tool - holder 1 , aligned on the machining axis x , is set in rotation together with the first portion 2 and capable also of axial movement relative to the first portion 2 . the second portion 4 terminates in a chuck 5 by which the milling tool u is received and clamped . in the preferred embodiment of the tool holder described and illustrated , the first rotating portion 2 occupies a first housing 6 , with which it is also coupled rotatably by way of bearings 7 . the first housing 6 is restrained axially , relative to the first rotating portion 2 , and furnished with an appendage 8 by way of which it is connected rigidly to the toolhead of the machine . accordingly , the first housing 6 remains anchored fixedly to the toolhead , whilst the first rotating portion 2 is coupled to the drive take - off and turns within the housing 6 . an outer end 9 of the first rotating portion 2 , remote from the end with the coupler 3 , presents an axial bore 10 slidably accommodating a shaft 11 projecting from the second rotating portion 4 . the bore 10 and the shaft 11 are shaped in such a way as to transmit rotation from the first portion 2 to the second portion 4 and to the tool u . the second rotating portion 4 occupies a second housing 12 with which it is coupled rotatably , for example by way of bearings 7 . the second housing 12 is disallowed angular movement in relation to the first housing 6 , while capable of axial movement relative to the selfsame first housing 6 . thus , as the second rotating portion 4 turns within the second housing 12 , the housing itself is able also to shift axially in relation to the first housing 6 and to the first rotating portion 2 . in the example of fig2 , the first housing 6 and the second housing 12 are restrained angularly one relative to another by guide rods 13 ( one only of which is visible in the drawings ) associated rigidly with the second housing 12 and slidable in sockets 14 afforded by the first housing 6 , which extend parallel to the machining axis x . the guide rods 13 also ensure that the two housings 6 and 12 are maintained in coaxial alignment and therefore in faultless mutually sliding association . also , the second housing 12 is accommodated partly within the first housing 6 , telescopically . more exactly , a radially peripheral surface 15 presented by one end 16 of the second housing 12 , near the shaft 11 of the second rotating portion 4 , will be breasted in contact with an inner surface 17 of the first housing 6 , preferably together with interposed seal means 18 such as a ring . to advantage , the tool - holder 1 is also equipped with means 19 by which to detect undulations or irregularities ‘ o ’ in the actual surface ‘ sr ’ being milled , in such a way that the axial movement of the second rotating portion 4 relative to the first rotating portion 2 will allow the tool to follow the undulations ‘ o ’ and maintain a constant milling depth . it happens indeed that during milling operations , which may involve sinking a groove on a surface , or forming a bevel ‘ s ’ or a radius ‘ r ’ on corner edges generated by previous cuts , or removing burrs ‘ b ’ left by other machining operations , the toolhead of the milling machine and the first portion 2 of the tool - holder 1 rigidly associated with the toolhead are caused to move across the actual surface ‘ sr ’ being milled , following a predetermined trajectory referable to a corresponding nominal surface ‘ si ’ ( the flat surface of fig3 a ; this same surface ‘ si ’ is deliberately omitted from fig3 b for the sake of clarity ), that is to say , a surface devoid of undulations and irregularities . in the case of machines with numerical control , the mathematical equation for the nominal surface ‘ si ’ is programmed into the control unit , which will then pilot the operation of suitable actuators to shift the head as mentioned above . accordingly , the detection means 19 will detect the undulations ‘ o ’ in the actual surface ‘ sr ’ being milled ( the undulating surface shown in fig3 a and 3 b by solid lines ), which deviates from the nominal surface ‘ si ’ ( the flat surface shown by phantom lines in fig3 a ), and allow the second portion 4 of the tool - holder 1 , rotating together with the first portion 2 , to shift axially with respect to this same first rotating portion 2 and follow the undulations ‘ o ’, maintaining a constant milling depth as the toolhead advances bodily over the actual surface . given that in the case of a bevel ‘ s ’ ( fig3 b ), the angle of the bevel is constant , a constant cutting depth ‘ p ’ will produce a constant width ‘ l ’ of the bevel . in the case of deburring , a pass executed at constant depth will ensure that the burr ‘ b ’ ( fig3 b ) is removed accurately , and without marking the remainder of the material . in the preferred embodiment illustrated , the detection means 19 are of mechanical type , and are one and the same as the means by which the second rotating portion 4 is displaced mechanically in relation to the first portion 2 . in particular , the detection means 19 comprise a follower 20 capable of axial movement in relation to the first rotating portion 2 and together with the second rotating portion 4 , and at least one resilient element 21 interposed between the second rotating portion 4 and the first rotating portion 2 in such a manner as to bias the second rotating portion 4 toward an extended position of the tool - holder 1 , against a reaction force exerted on the follower 20 by the actual surface ‘ sr ’ during the milling operation . in the example of the drawings , accordingly , where the follower 20 is associated rigidly and axially with the second rotating portion 4 , it is the undulations ‘ o ’ themselves that impinge on the follower 20 and induce the displacement of the second portion 4 against the action of the resilient element 21 . the resilient element 21 consists preferably in a coil spring located between the first housing 6 and the second housing 12 and disposed parallel to the longitudinal axis x . more exactly , as illustrated in fig2 , the tool - holder 1 would incorporate a plurality of coil springs 21 , of which one only is visible , arranged around the longitudinal machining axis x of the chuck 5 and around the axial bore 10 of the first rotating portion 2 . each spring 21 is presents a first end registering against a seat 22 afforded by the first housing 6 and a second end , opposite to the first end , registering against a seat 23 afforded by the second housing 12 . alternatively , the resilient element 21 might consist in a cushion of fluid , typically a gas such as air , incorporated directly between the first housing 6 and the second housing 12 or contained in a pneumatic cylinder , not illustrated , interposed between the two housings 6 and 12 in the same way as for the coil spring . the firmness offered by the fluid cushion is set by varying the pressure of the fluid . the follower 20 is rigidly associated with the second housing 12 , so that axial movement induced by contact with the surface ‘ sr ’ being milled can be transmitted through the bearings 7 to the second rotating portion 4 . in the example of the drawings , the follower 20 appears as a cylindrical element 24 lockable to the second housing 12 and presenting an active surface 25 that extends around the spindle chuck 5 and encircles the tool ‘ u ’. in the course of machining , the active surface 25 rests upon and slides over the actual surface ‘ sr ’ being milled , as the toolhead of the machine moves in a direction perpendicular to the axis ‘ x ’ of the spindle chuck 5 . the active surface 25 is pressed against the actual surface ‘ sr ’ so as to give the tool ‘ u ’ a certain preload dependent on the predetermined distance at which the tool - holder is positioned relative to the nominal surface ‘ si ’, as well as on the properties of the single coil spring 21 and on the number of springs installed . to advantage , the active surface 25 is adjustable axially , relative to the chuck 5 and to the tool u , so that the milling depth can be set as needed . to this end , the cylindrical element 24 can be fitted to the second housing 12 , for example , by way of a micrometrically adjustable screw collar 26 . where a bevel ( fig3 b ) needs to be milled at constant depth , the tool employed will be conical ( as in fig2 ) or possibly frustoconical ( not illustrated ) and must project beyond the active surface 25 of the follower 20 by a predetermined distance , set with the screw collar 26 . to form a radius ( fig4 ), similarly , the milling tool u will project beyond the active surface 25 . if the bevel or radius is milled on one edge of a thin panel , it may be necessary to bevel the corner edge on the side of the panel opposite from the undulated surface ‘ sr ’ using this same surface as a positional reference . in this instance , the tool u utilized will present an inverted profile , with the frustoconical cutting face 27 tapering toward the tool - holder 1 and toward the shank 28 by which the tool is connected to the chuck 5 ( fig7 and 8 ). the principle of operation remains unchanged , in that the follower 20 still engages the undulating or irregular actual surface ‘ sr ’. finally , these same beveling and radiusing cuts can also be made with a milling tool ( fig5 and 6 ) having two opposed cutting faces 27 tapering one toward the other , so that both corner edges of the panel can be machined simultaneously . if on the other hand the purpose of the machining pass is to remove excess material from the actual surface ‘ sr ’, typically resin , as in the case of flashes left by molding processes ( fig3 b ), the tool u will present a substantially flat cutting face 27 set flush with the active surface 25 of the follower 20 ( fig9 ). in the case of a groove , finally , this would be milled using a tool u with a cylindrical cutting face 27 projecting beyond the active surface 25 of the follower 20 ( fig1 ). alternatively , and in accordance with a further embodiment illustrated in fig1 , the depth control might be electronic . in other words , the means 19 by which to detect the undulations ‘ o ’ on the surface could comprise at least one sensor , optical for example , in which case the tool - holder would also incorporate a control unit , connected to the sensor , and an actuator interposed between the first and second rotating portions 2 and 4 , such as will displace the second rotating portion 4 axially in relation to the first portion 2 when piloted by the control unit in response to signals received from the sensor . likewise in this instance , the sensor will be mounted to the tool - holder 1 in such a way as to precede the tool u along the milling pass and relay information electronically to the control unit indicating its axial movements , which are then replicated after a programmed delay by the second rotating portion 4 of the tool - holder 1 . the milling procedure implemented by way of a tool - holder 1 as described above is applicable preferably to the machining of pieces manufactured from composite materials that consist of a matrix and , embedded in the matrix , fibers preferably of carbon based composition . the procedure is applied advantageously to milling operations carried out on carbon fiber panels , in particular . in effect , by reason of the fibers being embedded in the panel , maximum care must be taken over the milling depth , in order to ensure that fibers will not be cut and the panel thus rendered unfit for use . accordingly , the tool - holder to which the present invention relates will operate advantageously in conjunction with an extractor , mounted externally of or incorporated into the toolhead , or into the holder itself , to guarantee the continuous removal of carbon dust , which is not only a health hazard to operators but also abrasive and deleterious to machinery and equipment . the tool - holder 1 will also be pressurized internally so as to prevent any ingress of abrasive particles , for example via the annular area of mutual contact between the first housing 6 and the second housing 12 . in particular , the chamber 29 created between the first and second rotating portions 2 and 4 would be maintained at an overpressure sufficient to prevent the carbon dust entering past the seal 18 . the objects stated at the outset are overcome by the present invention . first and foremost , the tool - holder , the milling machine and the milling procedure according to the present invention will allow machining passes to be made automatically and at a controlled depth in relation to a reference surface on which a locating face of the tool - holder is caused to slide , even when the surface in question is irregular and its position is unknown and variable in relation to the machine references . whilst the tool - holder , the milling machine and the milling procedure according to the present invention can be utilized to process any material suitable for machining , the stated advantage is especially evident in the case of composites such as carbon fiber , given that the process by which composites are manufactured involves generating surfaces that can differ from the ideal geometry determined at the design stage . moreover , an error committed when machining a part made of composite material can cause some of the reinforcing fibers to break and lead ultimately to structural failure of the part . with the machining process automated , moreover , rates of production can be increased in comparison to those obtainable with manual procedures , while also avoiding the exposure of operators to direct contact with hazardous carbon dust generated by milling . finally , the tool - holder disclosed is able to perform machining operations at controlled depth using standard tools and can be mounted to milling machines of conventional design . | 8 |
all solvents were anhydrous and other reagents were from the sources summarized in the preceding contribution ( pettit et al ., 2000 ). gravity column chromatography was performed using silica gel ( 70 - 230 mesh ) from vwr scientific . all melting points were determined with an electrochemical digital melting point apparatus , model ia 9200 , and are uncorrected . nmr spectra were recorded employing varian gemini 300 or varian unity 400 instruments . chemical shifts are reported in ppm downfield from tetramethylsilane as internal standard . high resolution fab mass spectra were obtained with a kratos ms - 50 unit ( midwest center for mass spectrometry , university of nebraska - lincoln ). elemental analyses were obtained from galbraith laboratories , inc ., knoxville , tenn . abbreviations : lah , lithium aluminum hydride ; pcc , pyridinium chlorochromate ; tbdms - cl , t - butylchlorodimethylsilane ; tbdms , t - butyldimethylsilane ; dipea , diisopropylethyl amine ; dmf , n , n - dimethylformamide ; thf , tetrahydrofuran ; dcm , dichloromethane ; tlc , thin layer chromatography . to a flame - dried 5l rb flask was added dmf ( 1 l ), tbdms - cl ( 72 g , 0 . 476 mol ) and dipea ( 80 ml , 0 . 46 mol ). the solution was stirred ( magnetically ) for 10 minutes , methyl gallate ( 80 g , 0 . 43 mmol ) was added , stirring continued ( under argon ) for 2 hours and nah ( 60 %, 56 g , 1 . 4 mol ) was added ( over 30 minutes while the solution turned green ). iodomethane ( 90 ml , 1 . 44 mol ) was added and the solution turned red while stirring was continued for 4 hours . the reaction was terminated by the addition of water ( 500 ml ) and extracted with hexane ( 4 × 1 l ). the solvent was removed in vacuo and the residue purified by column chromatography ( 5 : 95 ethyl acetate - hexane as eluent ) to afford 54 . 7 g of a clear oil ( 2 , 39 % yield ); 1h nmr ( 300 mhz , cdcl3 ) δ 0 . 19 ( s , si ( ch3 ) 2 ), 1 . 00 ( s , c ( ch3 ) 3 ), 3 . 83 ( s , och3 ), 3 . 88 ( s , och3 ), 3 . 89 ( s , och3 ), 7 . 20 ( d , arh , j = 1 . 8 hz ), 7 . 25 ( d , arh , j = 1 . 8 hz ); 13c nmr ( 75 mhz , cdcl3 ) δ − 4 . 88 , 18 . 08 , 25 . 46 , 51 . 84 , 55 . 82 , 60 . 15 , 106 . 60 , 115 . 68 , 124 . 95 , 144 . 49 , 148 . 49 , 153 . 27 , 166 . 37 . ir 2955 , 2860 , 1718 , 1585 , 1498 , 14 . 21 , 1350 cm - 1 . anal . calcd for cl6h26o5si : c , 58 . 87 ; h , 8 . 03 ; o , 24 . 50 . found : c , 58 . 95 ; h , 8 . 10 . thf ( 200 ml ) and lah ( 3 . 6 g , 97 mmol ) were added to a flame - dried 1 l rb flask . the solution was stirred 10 minutes ( under argon ) and methyl ester 3 ( 29 g , 89 mmol , in 20 ml thf ) was added ( dropwise ) over 30 minutes . after 3 hours the reaction was terminated by the addition ( dropwise ) of 5 ml of water followed by brine ( 300 ml ). the solution was filtered through a 5 cm bed of silica gel and the chromatographic substrate was extracted with ethyl acetate . solvent was removed in vacuo to afford 26 g of a clear oil ( 4 , 98 % yield , cf pettit and singh , 1987 , canadian journal of chemistry , 65 , 2390 ); 1h nmr ( 300 mhz , cdcl3 ) δ 0 . 18 ( s , si ( ch3 ) 2 ), 1 . 01 ( s , c ( ch3 ) 3 ), 3 . 78 ( s , och3 ), 3 . 86 ( s , och3 ), 4 . 58 ( s , arch2 ), 6 . 50 ( s , arh ), 6 . 59 ( s , arh ). to a stirred solution of pcc ( 3 g , 14 mmol ) and sodium acetate ( 1 . 2 g , 14 mmol ) in dcm ( 100 ml ) was added ( dropwise ) benzyl alcohol 4 ( 3 . 8 g , 13 mmol ) in dcm ( 20 ml ). the reaction mixture was stirred 16 hours at room temperature , passed through a 5 cm layer of silica gel and the solvent removed in vacuo . the residue was purified by column chromatography employing 1 : 9 ethyl acetate - hexane as eluent to afford aldehyde 5 , 3 . 4 g , 98 % yield ( cf . singh and pettit , 1989 ,) as a colorless oil ; 1h nmr ( 300 mhz , cdcl3 ) δ 0 . 20 ( s , si ( ch3 ) 2 ), 1 . 02 ( s , c ( ch3 ) 3 ), 3 . 87 ( s , och3 ), 3 . 92 ( s , och3 ), 7 . 02 ( d , arh , j = 1 . 8 hz ), 7 . 11 ( d , arh , j = 1 . 8 hz ), 9 . 82 ( s , c ( o ) h ). to a 1 l round - bottom flask was added dmf ( 400 ml ), isovanillin ( 50 g , 329 mmol ), tbdps - cl ( 100 g , 365 mmol , 1 . 1 eq ) and imidazole ( 45 g , 661 mmol , 2 eq ). the reaction mixture was stirred for 16 hours under argon . the reaction was terminated by the addition of water ( 500 ml ), followed by extraction with hexane . the solvent was removed in vacuo and the residue purified by column chromatography ( 9 : 1 hexane - ethyl acetate as eluant ) to afford 117 g ( 6 , in 92 % yield ) as a colorless solid , m . p . 96 - 97 ° c . ( from hexane ); ir 2858 , 1687 , 1595 , 1510 , 1429 , 1282 , 1116 , 910 cm - 1 ; 1h nmr ( 300 mhz , cdcl3 ) δ 1 . 12 ( s , c ( ch3 ) 3 ), 3 . 55 ( s , och3 ), 6 . 79 ( d , arh , j = 8 . 1 hz ), 7 . 25 ( d , arh , j = 1 . 8 hz ), 73 . 9 ( m , 7 arh ), 7 . 68 ( m , 4 arh ), 9 . 66 ( s c ( o ) h ); 13c nmr 19 . 76 , 26 . 60 , 55 . 10 , 111 . 17 , 120 . 08 , 125 . 57 , 127 . 51 , 129 . 73 , 129 . 86 , 133 . 05 , 135 . 25 ; 145 . 42 , 155 . 98 , 190 . 73 . hrms ( m +) 391 . 1740 ; anal . calcd for c24h26o3s : c , 73 . 81 ; h , 6 . 71 . found : c , 73 . 94 ; h , 6 . 74 . a solution of aldehyde 6 ( 111 . 5 g , 285 mmol ) in ethanol ( 700 ml ) was stirred 10 minutes and nabh4 ( 13 g , 343 mmol , 1 . 2 eq ) was added ( portionwise ) to the cloudy mixture over 30 minutes . after stirring for 3 hours , solid nahco3 was added until effervescence stopped . the solution phase was filtered and the solvent removed in vacuo to afford alcohol 7 ( 112 g ) in 99 % yield as a colorless solid : mp 111 - 113 ° c . ; 1h nmr ( 300 mhz , cdcl3 ) δ 1 . 11 ( s , c ( ch3 ) 3 ), 3 . 51 ( s , och3 ), 4 . 39 ( s , ch2 ), 7 . 16 ( d , arh , j = 8 . 1 hz ), 7 . 10 ( d , arh j = 1 . 5 hz ), 6 . 82 ( dd , arh j = 8 . 1 , 1 . 5 hz ), 7 . 33 ( m , 6 arh ), 7 . 68 ( m , 4 arh ); 13c nmr 19 . 74 , 26 . 65 , 55 . 28 , 64 . 88 , 112 . 18 , 119 . 41 , 120 . 31 , 127 . 43 , 129 . 53 , 133 . 38 , 133 . 62 , 134 . 76 , 135 . 33 , 145 . 03 , 150 . 06 . hrms ( m + li )+ 399 . 1959 ; anal . calcd for c24h28o3si : c , 73 . 43 ; h , 7 . 19 . found : c , 73 . 20 ; h , 7 . 13 . a solution benzyl alcohol 7 ( 84 g , 214 mmol ) in dcm ( 400 ml ) was added pbr3 ( 10 ml , 106 mmol , 0 . 5 eq ). the reaction mixture was stirred 16 hours and the reaction was terminated by the addition of 10 % nahco followed by extraction with dcm . the solvent was removed ( in vacuo ) and to the resulting benzyl bromide dissolved in toluene ( 500 ml ) pph3 ( 62 g , 236 mmol , 1 . 1 eq ) was added . the mixture was heated at reflux for 1 hour , then stirred for 15 hours . the precipitate was collected and triturated with ether to afford phosphonium bromide 8 ( 132 g ) in 86 % yield . recrystallization from methanol afforded a colorless solid , mp 150 - 151 ° c . ; 1h nmr ( 300 mhz , cd3od ) 1 . 00 ( s , 9h ), 3 . 51 ( s , 3h ), 4 . 69 ( d , jpch2 , 7 . 4 hz ), 6 . 34 ( dt , j = 2 . 4 , 8 . 2 hz ), 6 . 59 ( d , j = 8 . 1 hz ), 6 . 65 ( t , j = 2 . 4 hz ); 13c nmr ( 75 mhz , cd3od ) δ 20 . 47 , 27 . 07 , 55 . 60 , 102 . 20 , 113 . 15 , 118 . 48 , 119 . 60 , 123 . 43 , 126 . 56 , 126 . 85 , 128 . 17 , 128 . 74 , 131 . 07 , 131 . 12 , 131 . 29 , 133 . 91 , 135 . 10 , 135 . 23 , 136 . 17 , 136 . 55 , 146 . 55 , 152 . 76 . anal . calcd for c42h42bro2psi : c , 70 . 28 ; h , 5 . 90 . found : c , 69 . 83 ; h . 6 . 05 . a mixture composed of thf ( 250 ml in a 1 l 3 neck flask ) and phosphonium bromide 8 ( 38 g , 53 mmol ) was stirred and cooled to − 78 ° c ., at which time 2 . 5 m n - butyllithium ( 21 ml , 53 mmol ) was added . stirring was continued 2 hours and benzaldehyde 5 ( 13 g , 44 mmol dissolved in 50 ml of thf ) was added ( dropwise over 30 minutes ). the reaction was allowed to warm to room temperature and stirred an additional 2 hours . the reaction was completed by the addition of water ( 100 ml ), followed by extraction with ethyl acetate and removal of the organic solvent ( in vacuo ). separation of the residue by column chromatography ( 3 : 97 ethyl acetate - hexane as eluent ) afforded 9 ( 3 . 3 g , 29 %); b . p . dec 290 ° c . ( 0 . 1 mm ); 1h nmr ( 300 mhz , cdcl3 ), δ 0 . 11 ( s , si ( ch3 ) 2 ), 0 . 97 ( s , c ( ch3 ) 3 ), 1 . 07 c ( ch3 ) 3 ), 3 . 43 ( s , och3 ), 3 . 63 ( s , och3 ), 3 . 76 ( s , och3 ), 6 . 27 ( s , 2 vinyl h ), 6 . 38 ( d , arh , j = 2 . 1 hz ), 6 . 43 ( d , arh , j = 2 . 1 hz ), 6 . 56 ( d , arh , j = 8 . 1 hz ), 6 . 72 ( d , arh , j = 2 . 1 hz ), 6 . 77 ( dd , arh , j = 2 . 1 , 8 . 4 hz ), 7 . 33 ( m , 6 arh ), 7 . 65 ( m , 4 arh ); 13c nmr − 5 . 09 , 17 . 87 , 19 . 37 , 22 . 16 , 25 . 27 , 26 . 27 , 28 . 58 , 54 . 86 , 55 . 46 , 59 . 96 , 102 . 60 , 111 . 71 , 112 . 05 , 117 . 09 , 120 . 02 , 126 . 00 , 126 . 91 , 127 . 06 , 129 . 00 , 129 . 14 , 129 . 78 , 132 . 71 , 133 . 30 , 134 . 80 , 134 . 99 , 139 . 49 , 144 . 75 , 148 . 96 , 149 . 85 , 153 . 26 . a solution prepared from thf ( 50 ml ), disilyl ether 9 ( 3 . 3 g , 5 mmol ) and 1 m tbaf ( 11 ml , 11 mol ) was stirred for 3 hours . termination of the reaction was performed by the addition of 6n hcl ( 40 ml ). ethyl acetate extract of the mixture was dried over sodium sulfate and the solvent removed in vacuo . separation by column chromatography using 1 : 1 hexane - ethyl acetate as eluent afforded combretastatin a - 3 ( 2a , 1 . 5 g , 99 %) as an oil ( lit ., oil , pettit and singh , 1987 ); b . p . dec 243 ° c . ( 0 . 1 mm ); 1h nmr ( 300 mhz , cdcl3 ), δ 3 . 68 ( s , och3 ), 3 . 88 ( s , och3 ), 3 . 90 ( s , och3 ), 5 . 50 ( s , aroh ), 5 . 66 ( s , aroh ), 6 . 38 ( d , vinyl h , j = 12 hz ), 6 . 46 ( d , vinyl h , j = 12 hz ), 6 . 44 ( s , arh ), 6 . 54 ( d , arh , j = 1 . 8 hz ), 6 . 74 ( d , arh , j = 8 . 4 hz ), 6 . 80 ( dd , arh , j = 8 . 4 , 1 . 8 hz ), 6 . 91 ( d , arh , j = 1 . 8 hz ). diisopropylethyl amine ( 6 . 6 ml , 38 mmol ), dimethylaminopyridine ( 226 mg , 1 . 9 mmol ) and following 1 minute dibenzylphosphite ( 6 ml , 27 mmol ) was added ( dropwise over 5 minutes ) to a solution prepared ( consecutively ) from acetonitrile ( 30 ml ) bis - phenol 2a ( 2 . 8 g , 9 . 3 mmol ) and ccl4 ( 9 ml , 93 mmol ), cooled to − 10 ° c . and stirred 10 minutes . the reaction mixture was stirred 3 hours at − 10 ° c . and treated with kh 2 po 4 ( 50 ml , 0 . 5 m ), stirred 10 minutes and then extracted with ethyl acetate . removal ( in vacuo ) of solvent and separation by column chromatography ( 1 : 1 hexane - ethyl acetate elution ) gave 5 . 8 g ( 2b , 76 % yield ) as a colorless oil ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 3 . 59 ( s , och 3 ), 3 . 72 ( s , och 3 ), 3 . 80 ( s , och 3 ), 5 . 10 ( s , 2ch 2 ), 5 . 13 ( s , 2ch 2 ), 6 . 33 ( d , vinyl h , j = 12 hz ), 6 . 40 ( d , vinyl h , j = 12 hz ), 6 . 63 ( s , arh ), 6 . 73 ( s , arh ), 6 . 76 ( s , arh ), 7 . 04 ( d , arh , j = 8 . 7 hz ), 7 . 09 ( s , arh ); 13 c nmr ( 100 mhz , cdc 13 ) δ 153 . 16 , 149 . 76 , 149 . 72 , 143 . 86 , 143 . 80 , 139 . 45 , 139 . 42 , 139 . 39 , 139 . 35 , 135 . 63 , 135 . 56 , 135 . 48 , 132 . 47 , 129 . 74 , 129 . 72 , 128 . 99 , 128 . 59 , 128 . 43 , 128 . 41 , 128 . 37 , 127 . 87 , 127 . 86 , 127 . 77 , 126 . 34 , 126 . 36 , 122 . 17 , 122 . 14 , 114 . 39 , 114 . 36 , 112 . 31 , 109 . 42 , 11 . 21 , 61 . 12 , 55 . 91 , 55 . 90 ; 31p nmr ( 162 mhz , cdcl 3 ) − 7 . 82 , − 8 . 09 ; anal . calcd for c 45 h 44 o 11 p 2 : c , 65 . 69 ; h , 5 . 39 . found : c , 65 . 70 ; h , 5 . 56 . trimethylbromosilane ( 0 . 6 ml , 4 . 5 mmol ) was added to a solution of bisphosphate 2b ( 0 . 9 g , 1 . 1 mmol ) in dcm ( 10 ml ). after stirring 30 minutes under argon , the reaction was completed by the addition of methanol ( 20 ml ). following removal ( in vacuo ) of solvent the resulting oil ( 2c ) was dissolved in water ( 10 ml ) and washed with hexane ( 15 ml ). water was removed in vacuo and the phosphoric acid residue was dissolved in ethanol ( 10 ml ). sodium methoxide ( 0 . 25 g , 1 . 1 mmol ) was added and the mixture stirred for 30 minutes . the solvent was removed in vacuo and the colorless solid was recrystallized from water - acetone to afford bis - sodium phosphate 10a ( 1 . 6 g ) as a colorless solid . antimicrobial susceptibility testing . compounds were screened against the bacteria stenotrophomonas maltophilia , micrococcus luteus , staphylococcus aureus , escherichia coli , enterobacter cloacae , enterococcus faecalis , streptococcus pneumoniae , neisseria gonorrhoeae , and the fungi candida albicans and cryptococcus neoformans , according to established disk susceptibility testing protocols ( national committee for clinical laboratory standards 1997 . performance standards for antimicrobial disk susceptibility tests - sixth edition : approved standard m2 - a6 , nccls , wayne , pa .) the original synthesis of combretastatin a - 3 ( pettit and singh , 1987 , canadian journal of chemistry , 65 , 2390 ) was initially improved by reversing the reactive functional groups in the wittig olefin synthesis . subsequently , we were able to make further refinements by selectively silylating methyl gallate with tert - butylchlorodimethylsilane followed by methylation with methyl iodide in n , n - dimethylformamide to yield dimethyl ether 3 . benzoate 3 was next reduced ( 3 → 4 ) using lithium aluminum hydride in tetrahydrofuran and the product oxidized to aldehyde 5 with pyridinium chlorochromate in dichloromethane . the b ring unit was synthesized by first protecting isovanillin using tert - butylchlorodiphenyl - silane . the resulting silylether - protected isovanillin ( 6 ) was reduced using sodium borohydride in ethanol to benzyl alcohol 7 . treatment of alcohol 7 with phosphorous tribromide , followed by triphenylphosphine led to phosphonium salt 8 . the wittig reaction employing aldehyde 5 and the yield resulting from reaction of phosphonium salt 8 and n - butyl lithium in tetrahydrofuran at − 78 ° c . afforded stilbene 9 . deprotection using tetrabutylammonium fluoride provided combretastatin a - 3 in good overall yield ( 8 . 4 %). the choice of two different silylether protecting groups for rings a and b arose from the need to employ a ring b protecting group that was found to better survive the wittig reaction step and provide a future advantage in allowing selective removal of the ring a silylether group . phosphorylation ( silverberg et al ., 1996 , tetrahedron letters , 37 , 771 ; pettit and rhodes , 1998 , anti - cancer drug design , 13 , 981 ) of combretastatin a - 3 with dibenzyl phosphite provided phosphate 2b . debenzylation of phosphate ester 2b was readily achieved using bromotrimethylsilane ( lazar and guillaumet , 1992 ; pettit et al ., 2000 ). use of the silyl bromide in place of the iodide ( pettit and rhodes , 1998 ) was found ( pettit et al ., 2000 ) to decrease conversion to the ( e ) isomer . reaction of the resulting phosphoric acid with the respective base led to phosphate salts 10a - l . most of the prodrug candidates ( 10a - l ) retained potent tumor cell growth - inhibitory activity ( table ii ), but candidates 10a - d showed substantially better aqueous solubility than did 10e - j ( table iii ). contemporaneous , comparative testing of the parent combretastatin a - 3 ( 2a ) with its disodium phosphate prodrug ( 10a ) in the nci 60 - cell screen ( boyd , 1997 ,) yielded mean - panel gi50values ( x10 - 8mise ) of 6 . 57 1 . 84 and 10 . 3 1 . 8 , respectively . compare correlation analyses ( boyd and paull , 1995 ) confirmed that the mean - graph profiles of 2a and 10a were essentially indistinguishable . the combretastatins are moderately antimicrobial ( pettit et al ., 1995 ; pettit et al ., 1998 ; pettit et al ., 2000 ; pettit and lippert , 2000 ). indeed , the majority of the natural combretastatins and their derivatives are antibacterial ; however , ( e )- combretastatin a - 1 has antibacterial and antifungal activities ( pettit et al ., 2000 ). in disk diffusion assays , combretastatin a - 3 ( 2a ) was selective for the pathogenic fungus cryptococcus neoformans ( mic = 50 - 100 μg / disk ). the sodium phosphate prodrug ( 10a ) of combretastatin a - 3 ( 2a ) was not active in these assays . the dosage administered will be dependent upon the identity of the neoplastic disease ; the type of host involved , including its age , health and weight ; the kind of concurrent treatment , if any ; the frequency of treatment and therapeutic ratio . illustratively , dosage levels of the administered active ingredients are : intravenous , 0 . 1 to about 200 mg / kg ; intramuscular , 1 to about 500 mg / kg ; orally , 5 to about 1000 mg / kg ; intranasal instillation , 5 to about 1000 mg / kg ; and aerosol , 5 to about 1000 mg / k of host body weight . expressed in terms of concentration , an active ingredient can be present in the compositions of the present invention for localized use about the cutis , intranasally , pharyngolaryngeally , bronchially , intravaginally , rectally , or ocularly in concentration of from about 0 . 01 to about 50 % w / w of the composition ; preferably about 1 to about 20 % w / w of the composition ; and for parenteral use in a concentration of from about 0 . 05 to about 50 % w / v of the composition and preferably from about 5 to about 20 % w / v . the compositions of the present invention are preferably presented for administration to humans and animals in unit dosage forms , such as tablets , capsules , pills , powders , granules , suppositories , sterile parenteral solutions or suspensions , sterile non - parenteral solutions of suspensions , and oral solutions or suspensions and the like , containing suitable quantities of an active ingredient . for oral administration either solid or fluid unit dosage forms can be prepared . powders are prepared quite simply by comminuting the active ingredient to a suitably fine size and mixing with a similarly comminuted diluent . the diluent can be an edible carbohydrate material such as lactose or starch . advantageously , a sweetening agent or sugar is present as well as a flavoring oil . capsules are produced by preparing a powder mixture as hereinbefore described and filling into formed gelatin sheaths . advantageously , as an adjuvant to the filling operation , a lubricant such as talc , magnesium stearate ., calcium stearate and the like is added to the powder mixture before the filling operation . soft gelatin capsules are prepared by machine encapsulation of a slurry of active ingredients with an acceptable vegetable oil , light liquid petrolatum or other inert oil or triglyceride . tablets are made by preparing a powder mixture , granulating or slugging , adding a lubricant and pressing into tablets . the powder mixture is prepared by mixing an active ingredient , suitably comminuted , with a diluent or base such as starch , lactose , kaolin , dicalcium phosphate and the like . the powder mixture can be granulated by wetting with a binder such as corn syrup , gelatin solution , methylcellulose solution or acacia mucilage and forcing through a screen . as an alternative to granulating , the powder mixture can be slugged , i . e ., run through the tablet machine and the resulting imperfectly formed tablets broken into pieces ( slugs ). the slugs can be lubricated to prevent sticking to the tablet - forming dies by means of the addition of stearic acid , a stearic salt , talc or mineral oil . the lubricated mixture is then compressed into tablets . advantageously , the tablet can be provided with a protective coating consisting of a sealing coat or enteric coat of shellac , a coating of sugar and methylcellulose and polish coating of carnauba wax . fluid unit dosage forms for oral administration such as in syrups , elixirs and suspensions can be prepared wherein each teaspoonful of composition contains a predetermined amount of an active ingredient for administration . the water - soluble forms can be dissolved in an aqueous vehicle together with sugar , flavoring agents and preservatives to form a syrup . an elixir is prepared by using a hydroalcoholic vehicle with suitable sweeteners together with a flavoring agent . suspensions can be prepared of the insoluble forms with a suitable vehicle with the aid of a suspending agent such as acacia , tragacanth , methylcellulose and the like . for parenteral administration , fluid unit dosage forms are prepared utilizing an active ingredient and a sterile vehicle , water being preferred . the active ingredient , depending on the form and concentration used , can be either suspended or dissolved in the vehicle . in preparing solutions the water - soluble active ingredient can be dissolved in water for injection . and filter sterilized before filling into a suitable vial or ampule and sealing . advantageously , adjuvants such as a local anesthetic , preservative and buffering agents can be dissolved in the vehicle . parenteral suspensions are prepared in substantially the same manner except that an active ingredient is suspended in the vehicle instead of being dissolved and sterilization cannot be accomplished by filtration . the active ingredient can be sterilized by exposure to ethylene oxide before suspending in the sterile vehicle . advantageously , a surfactant or wetting agent is included in the composition to facilitate uniform distribution of the active ingredient . in addition to oral and parenteral administration , the rectal and vaginal routes can be utilized . an active ingredient can be administered by means of a suppository . a vehicle which has a melting point at about body temperature or one that is readily soluble can be utilized . for example , cocoa butter and various polyethylene glycols ( carbowaxes ) can serve as the vehicle . for intranasal instillation , a fluid unit dosage form is prepared utilizing an active ingredient and a suitable pharmaceutical vehicle , preferably p . f . water ; a dry powder can be formulated when insufflation is the administration of choice . for use as aerosols , the active ingredients can be packaged in a pressurized aerosol container together with a gaseous or liquefied propellant , for example , dichlorodifluoromethane , carbon dioxide , nitrogen , propane , and the like , with the usual adjuvants such as cosolvents and wetting agents , as may be necessary or desirable . the term “ unit dosage form ” as used in the specification and claims refers to physically discrete units suitable as unitary dosages for human and animal subjects , each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical diluent , carrier or vehicle . the specifications for the novel unit dosage forms of this invention are dictated by and are directly dependent on ( a ) the unique characteristics of the active material and the particular therapeutic effect to be achieved , and ( b ) the limitation inherent in the art of compounding such an active material for therapeutic use in humans , as disclosed in this specification , these being features of the present invention . examples of suitable unit dosage forms in accord with this invention are tablets , capsules , troches , suppositories , powder packets , wafers , cachets , teaspoonfuls , tablespoonfuls , dropperfuls , ampules , vials , segregated multiples of any of the foregoing , and other forms as herein described . the active ingredients to be employed as antineoplastic agents can be easily prepared in such unit dosage form with the employment of pharmaceutical materials which themselves are available in the art and can be prepared by established procedures . the following preparations are illustrative of the preparation of the unit dosage forms of the present invention , and not as a limitation thereof . several dosage forms were prepared embodying the present invention . they are shown in the following examples in which the notation “ active ingredient ” signifies either phenstatin 3b and / or phenstatin prodrug 3d , and / or benzophenones 4a - f or any other compound described herein . one thousand two - piece hard gelatin capsules for oral use , each capsule containing 200 mg of an active ingredient are prepared from the following types and amounts of ingredients : the active ingredient , finely divided by means of an air micronizer , is added to the other finely powdered ingredients , mixed thoroughly and then encapsulated in the usual manner . the foregoing capsules are useful for treating a neoplastic disease by the oral administration of one or two capsules one to four times a day . using the procedure above , capsules are similarly prepared containing an active ingredient - in 50 , 250 and 500 mg amounts by substituting 50 g , 250 g and 500 g of an active ingredient for the 200 g used above . one - piece soft gelatin capsules for oral use , each containing 200 mg of an active ingredient , finely divided by means of an air micronizer , are prepared by first suspending the compound in 0 . 5 ml of corn oil to render the material capsulatable and then encapsulating in the above manner . the foregoing capsules are useful for treating a neoplastic disease by the oral administration of one or two capsules one to four times a day . one thousand tablets , each containing 200 mg of an active ingredient , are prepared from the following types and amounts of ingredients : the active ingredient , finely divided by means of an air micronizer , is added to the other ingredients and then thoroughly mixed and slugged . the slugs are broken down by forcing them through a number sixteen screen . the resulting granules are then compressed into tablets , each tablet containing 200 mg of the active ingredient . the foregoing tablets are useful for treating a neoplastic disease by the oral administration of one or two tablets one to four times a day . using the procedure above , tablets are similarly prepared containing an active ingredient in 250 mg and 100 mg amounts by substituting 250 g and 100 g of an active ingredient for the 200 g used above . one liter of an aqueous suspension for oral use , containing in each teaspoonful ( 5 ml ) dose , 50 mg of an active ingredient , is prepared from the following types and amounts of ingredients : the citric acid , benzoic acid , sucrose , tragacanth and lemon oil are dispersed in sufficient water to make 850 ml of suspension . the active ingredient , finely divided by means of an air micronizer , is stirred into the syrup unit uniformly distributed . sufficient water is added to make 1000 ml . the composition so prepared is useful for treating a neoplastic disease at a dose of 1 teaspoonful ( 15 ml ) three times a day . a sterile aqueous suspension for parenteral injection , containing 30 mg of an active ingredient in each milliliter for treating a neoplastic disease , is prepared from the following types and amounts of ingredients : all the ingredients , except the active ingredient , are dissolved in the water and the solution sterilized by filtration . to the sterile solution is added the sterilized active ingredient , finely divided by means of an air micronizer , and the final suspension is filled into sterile vials and the vials sealed . the composition so prepared is useful for treating a neoplastic . disease at a dose of 1 milliliter ( 1 ml ) three times a day . one thousand suppositories , each weighing 2 . 5 g and containing 200 mg of an active ingredient are prepared from the following types and amounts of ingredients : the active ingredient is finely divided by means of an air micronizer and added to the propylene glycol and the mixture passed through a colloid mill until uniformly dispersed . the polyethylene glycol is melted and the propylene glycol dispersion is added slowly with stirring . the suspension is poured into unchilled molds at 40 ° c . the composition is allowed to cool and solidify and then removed from the mold and each suppository foil wrapped . the foregoing suppositories are inserted rectally or vaginally for treating a neoplastic disease . one liter of a sterile aqueous suspension for intranasal instillation , containing 20 mg of an active ingredient in each milliliter , is prepared from the following types and amounts of ingredients : all the ingredients , except the active ingredient , are dissolved in the water and the solution sterilized by filtration . to the sterile solution is added the sterilized active ingredient , finely divided by means of an air micronizer , and the final suspension is aseptically filled into sterile containers . the composition so prepared is useful for treating a neoplastic disease , by intranasal instillation of 0 . 2 to 0 . 5 ml given one to four times per day . an active ingredient can also be present in the undiluted pure form for use locally about the cutis , intranasally , pharyngolaryngeally , bronchially , or orally . five grams of an active ingredient in bulk form is finely divided by means of an air micronizer . the micronized powder is placed in a shaker - type container . the foregoing composition is useful for treating a neoplastic disease , at localized sites by applying a powder one to four times per day . one hundred grams of an active ingredient in bulk form is finely divided by means of an air micronizer . the micronized powder is divided into individual doses of 200 mg and packaged . the foregoing powders are useful for treating a neoplastic disease , by the oral administration of one or two powders suspended in a glass of water , one to four times per day . one hundred grams of an active ingredient in bulk form is finely divided by means of an air micronizer . the foregoing composition is useful for treating a neoplastic disease , by the inhalation of 300 mg one to four times a day . from the foregoing , it becomes readily apparent that a new and useful antineoplastic factor and new and useful antinceoplastic preparations have been herein described and illustrated which fulfill all of the aforestated objectives in a remarkably unexpected fashion . it is of course understood that such modifications , alterations and adaptations as will readily occur to the artisan confronted with this disclosure are intended within the spirit of the present invention . | 2 |
referring to fig1 and 2 , the pressurized tank sprayer 10 includes a tank 14 , cap 22 , measuring cup 26 , and double action pump 30 . the tank 14 includes a container 34 and a base 38 . the container 34 and base 38 may be distinct elements or the tank 14 may be constructed in one integral unit . the container 34 forms the portion of the tank 14 that holds the solution to be sprayed . as illustrated in fig1 and 2 , the container 34 has a generally substantially cylindrical shape which may also take the form of a slightly ellipsoidal shape to prevent the container 34 from becoming bowed or distorted when subject to air pressure . the container 34 is formed from a durable material that can withstand air pressure stress ; including , polypropylene , polyethylene , and nylon . embodiments of the container 34 formed from a generally opaque material may have measuring indicia on the interior surface of the container 34 visible from the opening 36 in the top of the container 34 . embodiments of the container 34 formed from a generally translucent material may include measuring indicia on the exterior of the container 34 . the volume of the container 34 may vary depending on the embodiment and purpose of the sprayer . as shown in fig3 , the top portion of the container 34 includes a cylindrical rim 16 with an opening 36 . the cylindrical rim 16 may extend upward from the container 34 and included a threaded exterior surface , as illustrated in fig3 . alternatively , the cylindrical rim 16 may extend into the container 34 and include a threaded interior surface . the cylindrical rim 16 mates with an opposing threaded portion 24 of the cap 22 , illustrated in fig5 a . the opening 36 in the cylindrical rim 16 may have a diameter large enough for a user to insert his or her adult hand into the container 34 . with reference to fig2 , the container 34 includes a spray port 42 that accepts a spray wand outlet 46 . the spray wand outlet 46 may be secured to the spray port 42 with any suitable airtight and watertight sealing method , including a threaded engagement , epoxy , or an adhesive . as illustrated in fig3 the spray port 42 includes an opening in fluid communication with the container 34 . with continued reference to fig2 , the container 34 may contain an outlet 46 integral with the container 34 sidewalls . the outlet 46 includes a hose connection portion and a tube connection portion . the hose connection portion is on the exterior of the tank 14 and mates with the spray wand hose ( not illustrated ), of a typical spray wand as known in the art . the tube connection portion is on the interior of the tank 14 and mates with a pick - up tube within the container 34 that extends from the outlet 46 to the bottom of the container 34 . the container 34 also includes an air pressure relief port 98 that accepts an air pressure relief valve 102 , as illustrated in fig1 and 4 . the air pressure relief port 98 is typically positioned on the container 34 above the maximum solution level . the air pressure relief valve 102 may be secured to the air pressure relief port 98 with any suitable airtight and watertight sealing method , including a threaded engagement , epoxy , or an adhesive . the air pressure relief valve 102 expels air when the air pressure in the container 34 exceeds a predetermined threshold . when the air pressure in the container 34 returns to a level below the threshold level the air pressure relief valve 102 automatically closes . the base 38 portion of the tank 14 includes footholds 54 , 55 situated between footstands 50 , 51 as best illustrated in fig1 and 2 . the base 38 can be made from the same material as the container 34 ; including , polypropylene , polyethylene , and nylon . if the base 38 and the container 34 are made from different materials , the base 38 should be securely fastened to the bottom of the container 34 . ideally , a user should be able to apply a strong upward force to the pump 30 without separating the base 38 from the container 34 . the base 38 includes two footstands 50 , 51 that project laterally from opposite sides of the container 34 , and provide first and second lateral foot contact portions , as illustrated in fig1 - 4 . the footstands 50 , 51 have a convex periphery 57 . in one embodiment , the shape of the convex footstands 50 , 51 may approximately match the arch portion of a person &# 39 ; s foot . the upper surface of each footstand 50 , 51 is suitable for a user to stand upon while stroking the pump 30 . in one embodiment , the upper surface of the footstands 50 , 51 includes a notched or ridged surface to grip the user &# 39 ; s feet . the footstand 50 , 51 may include an inclined upper surface , with the highest portion of each foothold 50 , 51 proximate the container 34 and the lowest portion of each foothold 50 , 51 proximate the convex periphery 57 of each foothold 50 , 51 . in another embodiment , the diameter of the container 34 proximate the footholds 50 , 51 gradually decreases . the gradually decreasing container 34 diameter combined with the inclined upper surface of the foothold 50 , 51 , forms a concave region 52 that surrounds the inner portion of a user &# 39 ; s shoe ; thereby , enabling the user to stabilize the pressure sprayer while stroking the pump 30 . the side surfaces of the footstands 50 , 51 have a concave periphery 53 that smoothly transitions into the convex periphery 57 at a rounded corner 56 . finally , the bottom of each footstand 50 , 51 includes a surface that engages the ground to support the tank sprayer 10 . the two footholds 54 , 55 are positioned between the footstands 50 , 51 on the base 38 , as best illustrated in fig1 . the footholds 54 , 55 are provided as recessed areas in the bottom portion of the container 34 . specifically , distance a defines the length and distance b defines the width of the footholds 54 , 55 . in at least one embodiment , distance a is about three to twelve inches , and distance b is about one to six inches . preferably , distance a is about four to six inches , and distance b is about two to three inches . the height of the footholds 54 , 55 is defined by the height of the footstands 50 , 51 as represented by distance c in fig4 . in at least one embodiment , distance c is about one - half to four inches . preferably , distance c is about one to two inches . in the embodiment of fig1 to 4 , the footholds 54 , 55 are not configured to be stood upon ; instead , the footholds 54 , 55 are recesses bordered by a concave sidewall 53 . the concave sidewalls 53 of the footholds 54 , 55 are configured to engage the sides of user &# 39 ; s shoes , and provide rotational stability to the container 34 while the user rotates the cap 22 or the pump 30 . to provide a sufficient shoe contact surface , the footholds 54 , 55 include an area large enough to accept the inside forefoot portion of a man &# 39 ; s foot or shoe . the height of the sidewalls 53 of the footholds 54 , 55 may be greater than the height of the sole portion of a man &# 39 ; s shoe in order to provide a large area of engagement with the man &# 39 ; s shoe and prevent the footstands 50 , 51 from sliding under or over the user &# 39 ; s shoes while the user attempts to rotate the cap 22 or pump 30 . referring to fig1 and 2 the cap 22 is threadedly connected to the top portion of the container 34 to cover the opening 36 in the container . the cap 22 includes first and second handles 58 , 59 with a funnel 62 positioned between the handles 58 , 59 . the cap 22 is made from a rigid material , preferably plastic . the handles 58 , 59 and funnel 62 can be an integral unit , or each element can be individually formed and secured together . a sealing member 204 ensures that the cap 22 makes an airtight and watertight junction with the container 34 , even when the container 34 is subject to air pressure , as shown in fig5 . viable sealing members 204 include rubber or synthetic gaskets and o - rings . the exterior periphery of the cap 22 includes a spray wand holder 66 , nozzle openings 68 , and strap connections 72 . the spray wand holder 66 supports the spray wand when the wand is not in use . as illustrated in fig2 , 5 a , and 5 c , the spray wand holder 66 is a circular opening in a projection extending from the cap 22 . alternatively , the spray wand holder 66 can include a circular hole with a notch 70 slightly wider than the diameter of the rigid rod portion of the spray wand . the spray wand holder 66 can be formed at any portion along the periphery of the cap 22 , including in the handles 58 , 59 . with continued reference to fig2 , 5 a , and 5 c , the nozzle openings 68 provide a storage area for spray wand nozzles . as illustrated , the nozzle openings 68 extend through the periphery of the cap 22 ; however in another embodiment the nozzle openings 68 are depressions in the cap 22 having a bottom surface that prevents a nozzle from falling through the opening 68 . the nozzle openings 68 have a conical interior surface that becomes narrower toward the bottom of the opening 68 . the interior surface grips the exterior of the nozzle to prevent the nozzle from becoming inadvertently jarred from the opening 68 . furthermore , a portion of the nozzle remains above the surface of the cap 22 when the nozzle is inserted into the opening 68 . the portion of the nozzle remaining above the cap 22 can be grasped by the user when the user desires to remove the nozzle from the nozzle opening 68 . the strap connections 72 provide a coupling point for the attachment members of a carrying strap . as shown in fig2 , 5 a , and 5 c , the strap connections 72 are laterally displaced upon the cap 22 to provide the user with a balanced lifting point . each connection 72 includes an opening that extends therethrough . the opening is sized to couple with the attachment member of a carrying strap ( not illustrated ). the connections 72 are sufficiently rigid to permit a user to lift and carry the tank sprayer 10 without bending or deforming the connections 72 . also , on the exterior periphery of the cap 22 are the two laterally displaced handles 58 , 59 . a first handle 58 extends outwardly from a first side of the cap 22 , and a second handle 59 extends outwardly from a second side of the cap 22 opposite the first side . the left and right handles 58 , 59 assist the user in securing and removing the cap 22 from the container 34 . the handles 58 , 59 illustrated in fig1 and 2 include extension portions 116 and a horizontal connection portion 74 ; however , any handle 58 , 59 that permits a user to apply a rotational force to the cap 22 may be utilized . for example , in one embodiment , the handles 58 , 59 may include a curvature either toward or away from the base of the container 34 . depending on the shape of the container 34 the curvature may simplify grasping the handles 58 , 59 . in another embodiment , the handles 58 , 59 extend outward in a substantially lateral direction relative to the funnel 62 such that a user &# 39 ; s hands are positioned substantially to the sides of the funnel 62 when the tank 14 is in an upright position and the user &# 39 ; s hands grasp the handles 58 , 59 . in still another embodiment , the handles 58 , 59 may exhibit vertical connection portions 74 . handles 58 , 59 exhibiting a vertical connection portion 74 could have substantially the same shape as the illustrated handles 58 , 59 exhibiting a horizontal connection portion 74 ; however , each vertical connection portion 74 may include a single extension portion 116 . as illustrated in fig1 and 2 , the handles 58 , 59 include an irregular gripping surface 74 . the gripping surface 76 reduces the likelihood that the user &# 39 ; s gloves will slide along the surface of the handles 58 , 59 as the user attempts to rotate the cap 22 . as illustrated in fig1 , the gripping surface 76 may simply include a series of ridges in the upper and / or lower portions of the horizontal connection portions 74 grasped by the user . in another embodiment , the handles 58 , 59 may include a rubberized coating instead of the series of ridges . like the series of ridges , the rubberized coating surrounds the horizontal connection portions 74 . the central portion of the cap 22 includes a funnel 62 and a drain 60 leading to the container 34 , as best illustrated fig5 a to 5c . the funnel 62 can be formed integrally with the cap 22 , or the funnel 62 can be a distinct unit attached to the cap 22 . as shown in fig5 a and 5c , the drain 60 is provided as a threaded opening which provides a passage to the opening 36 in the container 34 . the drain 60 is too small for a user to insert his or her adult hand . the substantially conical surface of the funnel 22 gradually becomes larger as the funnel 62 extends away from the drain 60 . the top edge of the funnel 62 is terminated with a ridge 78 . the depth of the funnel 62 depends on the embodiment , but in general the funnel 62 extends from the drain 60 to the top of the cap 22 . in another embodiment , the top of the funnel 62 includes a cylindrical rim that extends above the cap 22 to provide the user with an even larger pouring surface . in the disclosed embodiment , the conical surface of the funnel 62 is generally smooth , without cavities or irregularities in which the funneled solution may become isolated . a measuring vessel 26 , provided in the form of a measuring cup 26 , is connected to the exterior periphery of the cap 22 , as shown in fig1 and 4 . the measuring cup 26 is made of a rigid and sturdy material such as plastic or metal , and is suitable to measure liquid , powdered , solid , or gelled solutions . in one embodiment , the measuring cup 26 includes multiple chambers 96 of a specified quantity . for instance , the measuring cup 26 may contain chambers 96 sized to hold a tablespoon , a liquid ounce , and twenty five milliliters . furthermore , each chamber 96 may include additional indicia that further divide the chambers 96 into smaller quantities . in another embodiment , the measuring cup 26 simply includes one large chamber 96 with indicia marked on the inner surface . in either embodiment , the measuring cup 26 can be made from a translucent material and the measuring indicia can be formed into the outer surface of the chamber 96 or chambers 96 . the indicia indicate measured quantities in both metric and united states customary units . the measuring cup 26 includes arms 82 with tabs 86 that secure the first and second side of the measuring cup 26 to a pair of brackets 90 , as best illustrated in fig1 and 2 . the brackets 90 can be attached to , or integral with , the cap 22 or the handles 58 , 59 . in general , the measuring cup 26 is pivotably attached to the brackets 90 ; however , the measuring cup 26 can be removed and reattached by bending the resilient arms 82 , thereby pulling the tabs 86 out of the brackets 90 . when attached to the cap 22 , the measuring cup 26 pivots about the tabs 86 from an upright “ fill ” position to a tilted “ pour ” position . the bottom portion of the measuring cup 26 includes a post 92 that rests against the periphery of the cap 22 or the container 34 to maintain the measuring cup 26 in a level orientation while the measuring cup 26 is in the fill position . when the measuring cup 26 is pivoted , the contents of each chamber 96 are directed out of the measuring cup 26 and onto the conical surface of the funnel 62 , which is in fluid communication with the container 34 via the drain 60 . the measuring cup 26 includes a spout 94 into which the chambers 96 divert their contents when the measuring cup 26 becomes pivoted to the pour position . the spout 94 ensures the contents of the measuring chambers 96 are accurately directed onto the conical surface of the funnel 62 . the upper periphery of the measuring cup 26 may include a ridge 80 , as most clearly illustrated in fig5 a . the ridge 80 extends from the body of the measuring cup 26 and can be used as a handle to pivot the measuring cup 26 . additionally , in some embodiments , the ridge 80 may include measuring indicia corresponding to the capacity of the chambers 96 . as previously mentioned , the spout 94 directs the contents of the chambers 96 on to the surface of the funnel 62 . additionally , the spout 94 serves as an interlock device , as best illustrated in fig4 . in particular , the pump housing 106 prevents the measuring cup 26 from pivoting to the pour position when the pump housing 106 is positioned in the drain 60 of the cap 22 . motion is prevented because the spout 94 abuts the housing 106 of the pump 30 when the pump 30 is connected to the drain 60 in the cap 22 . the housing 106 prevents the measuring cup 26 from pivoting , because in order to pivot the spout 94 must move toward the center of the drain 60 ; however , with the pump housing 106 in the path of movement , the spout 94 cannot move toward the drain 60 . of course , with the pump 30 removed from the drain 60 , the path of movement of the measuring cup 26 is unobstructed , permitting the measuring cup 26 to pivot to the tilted “ pour ” position . the double action pump 30 includes an outer housing 106 , a pump mechanism , and a handle 110 , as illustrated in fig6 . the housing 106 is made of a rigid material , usually plastic or metal . in one embodiment , the housing 106 has a cylindrical shape , with a diameter that abuts the spout 94 of the measuring cup 26 when the measuring cup 26 is in the fill position . in another embodiment , the housing 106 includes a spout receptor that engages the spout 94 once the housing 106 has been completely threaded into the drain 60 in the cap 22 . the spout receptor can be a spout 94 shaped indentation in the housing 106 that receives the spout 94 when the pump 30 is securely fastened to the cap 22 . in each embodiment , the housing 106 prevents the measuring cup 26 from pivoting when the pump 30 is attached to the cap 22 . referring now to fig6 to 8 , the housing 106 surrounds the pump mechanism and includes a threaded bottom portion 118 to secure the pump 30 to the threaded drain 60 in the cap 22 . an o - ring 114 prevents the pressure developed in the container 34 from escaping through the junction between the drain 60 and the outer housing 106 . the outer housing 106 , pump mechanism , and of course the handle 110 remain outside of the container 34 when the pump 30 is connected to the cap 22 . the length of the pump 30 combined with the height of the tank 14 enable a user to stroke the pump 30 without having to bend over excessively far on the downstroke , as compared to pressure sprayers that utilize a pump 30 submerged within the container 34 . the pump handle 110 is threadedly connected to the top of the pump cylinder 138 , as illustrated in fig7 . the handle 110 includes a horizontal contact bar 112 that a user may grasp while stroking the pump 30 . in one embodiment , the length of the contact bar 112 is slightly greater than the width of a man &# 39 ; s hand , to permit a user to grasp the handle 110 and stroke pump 30 with a single hand . however , in another embodiment , the length of the contact bar 112 permits a man wearing work gloves to place his two hands side - by - side upon the contact bar 112 while stroking the pump . additionally , the contact bar 112 includes a series of ridges that provide a gripping surface , and also make the handle 110 easier to hold , should the handle 110 become wet . with continued reference to fig7 , the handle 110 can be secured to the outer housing 106 enabling a user to carry the tank sprayer 10 by the pump handle 110 . the base of the handle 110 includes a tab 122 used to secure the handle 110 to the outer housing 106 . the tab 122 engages a slot 126 in the outer housing 106 when the handle 110 is fully depressed and rotated . in one embodiment , a pump cushioning spring 130 must also be depressed in order to slide the tab 122 into the slot 126 . the resistive force from the pump cushioning spring 130 presses the tab 122 against the top portion of the slot 126 ensuring the handle 110 remains in the locked position until the user desires to disengage the tab 122 from the slot 126 by rotating the handle 110 . the pump mechanism injects air into the container 34 for compression . the pump mechanism includes a central connecting rod 134 , a pump cylinder 138 , a primary piston 142 , a secondary piston 146 , first and second check valves 150 , 154 , and a plurality of sealing members and gaskets , as illustrated in fig6 . the interrelationship of each pump mechanism component is explained below . with reference to fig6 , the central connecting rod 134 is a hollow tube that includes a bottom end in fluid communication with the container 34 . the connecting rod 134 includes a top portion threadedly connected to the primary piston 142 , and a bottom portion threadedly connected to the outer housing 106 . o - ring 200 forms an air tight seal between the connecting rod 134 and the outer housing 106 . o - ring 194 forms an air tight seal between primary piston 142 and the connecting rod 134 . as explained within , the pump cylinder 138 forces air through the connecting rod 134 and into the container 34 for compression . the pump cylinder 138 is a hollow tube that surrounds the central connecting rod 134 . the pump cylinder 138 is made from a rigid material , usually plastic . as illustrated in fig7 , the pump cylinder 138 includes a top portion threadedly connected to the base of the handle 110 , and , as illustrated in fig8 a and 8b , a bottom portion threadedly connected to the secondary piston 146 . an o - ring 190 ensures that the pump cylinder 138 makes an air tight junction with the secondary piston 146 . the primary piston 142 and the second check valve 154 are threadedly engaged to the top of the connecting rod 134 , as illustrated in fig7 . the primary piston 134 has an outside diameter slightly smaller than the inside diameter of the pump cylinder 138 . the primary piston 134 includes a groove 182 , which houses a “ floating ” o - ring 186 . the diameter of a cross section of the o - ring 186 is slightly smaller than the height of the groove 182 , such that the o - ring 186 is vertically displaceable within the groove 182 . as the pump 30 is stroked , the o - ring 186 moves to the top of the groove 182 on the upstroke , as illustrated by fig1 b , and moves to the bottom of the groove 182 on the downstroke , as illustrated by fig1 a . with reference to fig8 , the secondary piston 146 is a circular ring threadedly engaged to the bottom of the pump cylinder 138 . as the handle 110 is stroked , the pump cylinder 138 and the secondary piston 146 slide along the outer surface of the connecting rod 134 . the secondary piston 146 includes a groove 174 which houses a “ floating ” o - ring 178 . the diameter of a cross section of the o - ring 178 is slightly smaller than the height of the groove 174 , such that the o - ring 178 is vertically displaceable within the groove 174 . the o - ring 178 inside diameter is equal to the outside diameter of connecting rod 134 . as the pump 30 is stroked , the o - ring 178 slides up and down the outer surface of the connecting rod 134 , moving to the top of the groove 174 on the downstroke , as illustrated by fig9 a , and moving to the bottom of the groove 174 on the upstroke , as illustrated by fig9 b . check valves 150 , 154 include bases 152 , 156 with openings 158 , 162 and elastomeric diaphragms 166 , 170 , as illustrated in fig7 . each check valves 150 , 154 selectively seals a cavity of varying size formed by the motion of the pump cylinder 138 . when the air pressure above the check valves 150 , 154 exceeds the air pressure below the check valve 150 , 154 the edges of the diaphragm 166 , 170 flex away from the base 152 , 156 permitting air to travel to the area of lower pressure through the openings 158 , 162 . when the air pressure below the check valves 150 , 154 exceeds the air pressure above the check valves 150 , 154 , the air pressure forces the edges of the diaphragm 166 , 170 against the base 152 , 156 thereby sealing the openings 158 , 162 . when a user initiates an upstroke , as illustrated in fig9 b and 10b , by forcing the handle 110 and the pump cylinder 138 upward , the second check valve 154 opens allowing outside air to flow along direction a into the cavity defined at the top by the second check valve 154 and at the bottom by the primary piston 142 . air continues to flow through the second check valve 154 into the aforementioned cavity throughout the entire upstroke motion . additionally , the upstroke draws o - ring 186 against the top side of the groove 182 in the primary piston 142 , and o - ring 178 against the bottom side of the groove 174 in the secondary piston 146 . as the upward motion of the pump cylinder 138 causes the cavity between the pump cylinder 138 and the connecting rod 134 to become smaller , the air within the cavity is forced into groove 182 along directions p and b . after passing through the groove 182 the air flows along direction c , into the openings 158 in the first check valve 150 . finally , the air flows into the connecting rod 134 , and ultimately into the container 34 for compression . alternatively , when a user initiates a downstroke , as illustrated in fig9 a and 10a , by forcing the handle 110 and the pump cylinder 138 downward , the air trapped above the primary piston 142 forces the second check valve 154 closed , and o - ring 186 to the bottom of the groove 182 in the primary piston 142 . as the downward motion of the pump cylinder 138 causes the cavity above the primary piston 142 to become smaller , the air within the cavity is forced into groove 182 along direction g . throughout the downstroke the air continues to flow , along direction h , through the openings 158 in the first check valve 150 , into the connecting rod 134 , and ultimately into the container 34 . also during the downstroke , the downward motion of the pump cylinder 138 forces o - ring 178 to the top of the groove 174 in the secondary piston 146 , permitting air to enter the cavity between the pump cylinder 138 and the connecting rod 134 , in the following manner . first , the downward motion develops a vacuum between the pump housing 106 and the pump cylinder 138 that draws in outside air along directions i and j . next , the air is drawn around the pump cushioning spring 130 along direction l . finally , the vacuum draws air between the secondary piston 146 and the connecting rod 134 , and through groove 174 , along direction m . in summary , the pump 30 includes two air chambers ; during each pump 30 stroke one of the chambers is filled with outside air , while the air in the other chamber is evacuated into container 34 . thereby , enabling the pump to deliver air to the container 34 during each pump 30 stroke . after a series of pump 30 strokes , the user will have pumped a substantial volume of air into the container 34 . the air pressure generated by the increased volume of air forces the diaphragm 166 of the first check valve 150 to seat against the base 152 , thereby indefinitely maintaining the volume of air within the container 34 . when the user activates the valve on the spray wand the increased air pressure propels the solution from the container 34 . to reduce the probability of the pump 30 becoming damaged due to vigorous downward stroking , the pump 30 includes a cushioning spring 130 . the bottom surface of the cushioning spring 130 contacts the bottom of the pump housing 106 , and the top of the spring 130 contacts the bottom portion of the secondary piston 146 . the spring 130 cushions the secondary piston 146 should the piston 146 become forcefully directed toward the bottom of the pump 30 . additionally , the cushioning spring 130 provides tension upon the handle 110 when the handle 110 is in the locked position . in operation , a user first obtains and utilizes appropriate safety attire , which may include safety glasses , gloves , apron , and face mask . next , the user places his or her shoes in the footholds 54 , 55 , grasps the pump handle 110 , and slowly rotates the handle 110 until the pump 30 can be removed from the cap 22 . then , with shoes remaining in the footholds 54 , 55 , the user grasps the cap handles 58 , 59 and rotates the cap 22 until it can be removed from the container 34 . alternatively , the user may stand upon the footstands 50 , 51 when removing the cap 22 from the container 34 . with the cap 22 removed , the user can clean the inside of the container 34 or fill the container 34 with an appropriate amount of water or other solvent . next , the user tightly secures the cap 22 to the container 34 , using the footholds 54 , 55 to stabilize the container 34 . if the user desires to add a solute to the solvent , the user can measure an appropriate quantity of solute in the measuring cup 26 . when the appropriate amount of solute has been measured , the user pivots the measuring cup 26 to the tilted “ pour ” position to direct the solute onto the surface of the funnel 62 through the drain 60 in the cap 22 and into the container 34 . next , the user attaches the pump 30 to the threaded drain 60 . finally , the user stands upon the footstands 50 , 51 and repeatedly strokes the pump 30 until a sufficient air pressure has been developed in the container 34 . likewise , the user may stabilize the tank 14 with the footholds 54 , 55 while stroking the pump 30 . finally , the user may the trigger the spray wand to distribute the product , following any and all directions provided by the manufacturer of the solvent or solute . those skilled in the art will recognize that numerous modifications can be made to the specific implementations described above . therefore , the following claims are not to be limited to the specific embodiments illustrated and described above . the claims , as originally presented and as they may be amended , encompass variations , alternatives , modifications , improvements , equivalents , and substantial equivalents of the embodiments and teachings disclosed herein , including those that are presently unforeseen or unappreciated , and that , for example , may arise from applicants , patentees , and others . | 1 |
this invention relates to mutations in the ikbkap gene , which the inventors of the instant application discovered are associated with familial dysautonomia . more specifically , the mutation associated with the major haplotype of fd is a t - c change located at bp 6 of intron 20 in the ikbkap gene as shown in fig1 . this mutation can result in skipping of exon 20 in the mrna from fd patients , although they continue to express varying levels of wild - type message in a tissue specific manner . the mutation associated with the minor haplotype is a single g - c change at bp 2397 ( bp 73 of exon 19 ) that causes an arginine to proline missense mutation ( r696p ) that is predicted to disrupt a potential phosphorylation site . these findings have direct implications for understanding the clinical manifestations of fd , for preventing it and potentially for treating it . the ikap protein produced from ikbkap gene was originally isolated as part of a large interleukin - 1 - inducible ikk complex and described as a regulator of kinases involved in pro - inflammatory cytokine signaling ( cohen et al . 1998 ). however , a recent report questioned this conclusion , by reporting that cellular ikk complexes do not contain ikap based on various protein - protein interaction and functional assays . rather , ikap appears to be a member of a novel complex containing additional unidentified proteins of 100 , 70 , 45 , and 39 kda ( krappmann et al . 2000 ). ikap is homologous to the elp1 protein of s . cerevisiae , which is encoded by the iki3 locus and is required for sensitivity to pgkl killer toxin . the human and yeast proteins exhibit 29 % identity and 46 % similarity over their entire lengths . yeast elp1 protein is part of the rna polymerase ii - associated elongator complex , which also contains elp2 , a wd - 40 repeat protein , and elp3 , a histone acetyltransferase ( otero et al . 1999 ). the human elp3 gene encodes a 60 kda histone acetyltransferase that shows more than 75 % identity with yeast elp3 protein , but no 60 kda protein has been found in the human ikap - containing protein complex . consequently , it is considered unlikely that ikap is a member of a functionally conserved mammalian elongator complex ( krappmann et al . 2000 ). instead , it has been reported that the protein may play a role in general gene activation mechanisms , as overexpression of ikap interferes with the activity of both nf - κb - dependent and independent reporter genes ( krappmann et al . 2000 ). therefore , the fd phenotype may be caused by aberrant expression of genes crucial to the development of the sensory and autonomic nervous systems , secondary to the loss of a functional ikap protein in specific tissues . fd is unique among ashkenazi jewish disorders in that one mutation accounts for & gt ; 99 . 5 % of the disease chromosomes . as in other autosomal recessive diseases with no phenotype in heterozygous carriers , one might have expected to find several different types of mutations producing complete inactivation of the dys gene in the aj population . the fact that the major fd mutation does not produce complete inactivation , but rather allows variable tissue - specific expression of ikap , may explain this lack of mutational diversity . mutations causing complete inactivation of ikap in all tissues might cause a more severe or even lethal phenotype . indeed , cg10535 , the apparent drosophila melanogaster homologue of ikbkap , maps coincident with a larval recessive lethal mutation ( 1 ( 3 ) 04629 ) supporting the essential nature of the protein ( flybase ). thus , the array of mutations that can produce the fd phenotype may be limited if they must also allow expression of functional or partially functional ikap in some tissues to permit survival . with the identification of ikbkap as dys , it will now be possible to test this inactivation hypothesis in a mammalian model system . despite the overwhelming predominance of a single mutation in fd patients , the disease phenotype is remarkably variable both within and between families . the nature of the major fd mutation makes it tempting to consider that this phenotypic variability might relate to the frequency of exon 20 skipping in specific tissues and at specific developmental stages , which may be governed by variations in many factors involved in rna splicing . even a small amount of normal ikap protein expressed in critical tissues might permit sufficient neuronal survival to alleviate the most severe phenotypes . this possibility is supported by the relatively mild phenotype associated with the presence of the r696p mutation , which is predicted to permit expression of an altered full - length ikap protein that may retain some functional capacity . to date , this minor fd mutation has only been seen in four patients heterozygous for the major mutation . consequently , it is uncertain whether homozygotes for the r696p mutation would display any phenotypic abnormality characteristic of fd . the single patient with minor haplotype 3 and mixed ancestry , whose mutation has yet to be found , is also a compound heterozygote with the major haplotype . the existence of minor haplotype 3 indicates that ikbkap mutations will be found outside the aj population , but like the r696p mutation , it is difficult to predict the severity of phenotype that would result from homozygosity . since fd affects the development and maintenance of the sensory and autonomic nervous systems , the identification of ikbkap as the dys gene allows for further investigation of the role of ikap and associated proteins in the sensory and autonomic nervous systems . of more immediate practical importance , however , the discovery of the single base mutation that characterizes & gt ; 99 . 5 % of fd chromosomes will permit efficient , inexpensive carrier testing in the aj population , to guide reproductive choices and reduce the incidence of fd . the nature of the major mutation also offers some hope for new approaches to treatment of fd . despite the presence of this mutation , lymphoblastoid cells from patients are capable of producing full - length wild - type mrna and normal ikap protein , while in neuronal tissue exon 20 is skipped , presumably leading to a truncated product . investigation of the mechanism that permits lymphoblasts to be relatively insensitive to the potential effect of the mutation on splicing may suggest strategies to prevent skipping of exon 20 in other cell types . an effective treatment to prevent the progressive neuronal loss of fd may be one aimed at facilitating the production of wild - type mrna from the mutant gene rather than exogenous administration of the missing ikap protein via gene therapy . with knowledge of the primary mutation and secondary mutation of the fd gene as disclosed herein , screening for presymptomatic homozygotes , including prenatal diagnosis , and screening for heterozygous carriers can be readily carried out . individuals carrying mutations in the fd gene may be detected at either the dna or rna level using a variety of techniques that are well known in the art . the genomic dna used for the diagnosis may be obtained from an individual &# 39 ; s cells , such as those present in peripheral blood , urine , saliva , bucca , surgical specimen , and autopsy specimens . the dna may be used directly or may be amplified enzymatically in vitro through use of pcr ( saiki et al . science 239 : 487 - 491 ( 1988 )) or other in vitro amplification methods such as the ligase chain reaction ( lcr ) ( wu and wallace genomics 4 : 560 - 569 ( 1989 )), strand displacement amplification ( sda ) ( walker et al . pnas usa 89 : 392 - 396 ( 1992 )), self - sustained sequence replication ( 3sr ) ( fahy et al . pcr methods appl . 1 : 25 - 33 ( 1992 )), prior to mutation analysis . in situ hybridization may also be used to detect the fd gene . the methodology for preparing nucleic acids in a form that is suitable for mutation detection is well known in the art . for example , suitable probes for detecting a given mutation include the nucleotide sequence at the mutation site and encompass a sufficient number of nucleotides to provide a means of differentiating a normal from a mutant allele . any probe or combination of probes capable of detecting any one of the fd mutations herein described are suitable for use in this invention . examples of suitable probes include those complementary to either the coding or noncoding strand of the dna . similarly , suitable pcr primers are complementary to sequences flanking the mutation site . production of these primers and probes can be carried out in accordance with any one of the many routine methods , e . g ., as disclosed in sambrook et al . sup . 45 , and those disclosed in wo 93 / 06244 for assays for goucher disease . probes for use with this invention should be long enough to specifically identify or amplify the relevant fd mutations with sufficient accuracy to be useful in evaluating the risk of an individual to be a carrier or having the fd disorder . in general , suitable probes and primers will comprise , preferably at a minimum , an oligomer of at least 16 nucleotides in length . since calculations for mammalian genomes indicate that for an oligonucleotide 16 nucleotides in length , there is only one chance in ten that a typical cdna library will fortuitously contain a sequence that exactly matches the sequence of the nucleotide . therefore , suitable probes and primers are preferably 18 nucleotides long , which is the next larger oligonucleotide fully encoding an amino acid sequence ( i . e ., 6 amino acids in length ). by use of nucleotide and polypeptide sequences provided by this invention , safe , effective and accurate testing procedures are also made available to identify carriers of mutant alleles of ikbkap , as well as pre - and postnatal diagnosis of fetuses and live born patients carrying either one or two mutant alleles . this affords potential parents the opportunity to make reproductive decisions prior to pregnancy , as well as afterwards , e . g ., if chorionic villi sampling or amniocentesis is performed early in pregnancy . thus , prospective parents who know that they are both carriers may wish to determine if their fetus will have the disease , and may wish to terminate such a pregnancy , or to provide the physician with the opportunity to begin treatment as soon as possible , including prenatally . in the case where such screening has not been performed , and therefore the carrier status of the patient is not known , and where fd disease is part of the differential diagnosis , the present invention also provides a method for making the diagnosis genetically . many versions of conventional genetic screening tests are known in the art . several are disclosed in detail in wo 91 / 02796 for cystic fibrosis , in u . s . pat . no . 5 , 217 , 865 for tay - sachs disease , in u . s . pat . no . 5 , 227 , 292 for neurofibromatosis and in wo 93 / 06244 for goucher disease . thus , in accordance with the state of the art regarding assays for such genetic disorders , several types of assays are conventionally prepared using the nucleotides , polypeptides and antibodies of the present invention . for example : the detection of mutations in specific dna sequences , such as the fd gene , can be accomplished by a variety of methods including , but not limited to , restriction - fragment - length - polymorphism detection based on allele - specific restriction - endonuclease cleavage ( kan and dozy lancet ii : 910 - 912 ( 1978 )), hybridization with allele - specific oligonucleotide probes ( wallace et al . nucl acids res 6 : 3543 - 3557 ( 1978 )), including immobilized oligonucleotides ( saiki et al . pnas usa 86 : 6230 - 6234 ( 1989 )) or oligonucleotide arrays ( maskos and southern nucl acids res 21 : 2269 - 2270 ( 1993 )), allele - specific pcr ( newton et al . nucl acids res 17 : 2503 - 25 16 ( 1989 )), mismatch - repair detection ( mrd ) ( faham and cox genome res 5 : 474 - 482 ( 1995 )), binding of muts protein ( wagner et al . nucl acids res 23 : 3944 - 3948 ( 1995 ), denaturing - gradient gel electrophoresis ( dgge ) ( fisher and lerman et al . pnas usa 80 : 1579 - 1583 ( 1983 )), single - strand - conformation - polymorphism detection ( orita et al . genomics 5 : 874 - 879 ( 1983 )), rnaase cleavage at mismatched base - pairs ( myers et al . science 230 : 1242 ( 1985 )), chemical ( cotton et al . pnas usa 85 : 4397 - 4401 ( 1988 )) or enzymatic ( youil et al . pnas usa 92 : 87 - 91 ( 1995 )) cleavage of heteroduplex dna , methods based on allele specific primer extension ( syvanen et al . genomics 8 : 684 - 692 ( 1990 )), genetic bit analysis ( gba ) ( nikiforov et al . nuci acids res 22 : 4167 - 4175 ( 1994 )), the oligonucleotide - ligation assay ( ola ) ( landegren et al . science 241 : 1077 ( 1988 )), the allele - specific ligation chain reaction ( lcr ) ( barrany pnas usa 88 : 189 - 193 ( 1991 )), gap - lcr ( abravaya et al . nucl acids res 23 : 675 - 682 ( 1995 )), and radioactive and / or fluorescent dna sequencing using standard procedures well known in the art . as will be appreciated , the mutation analysis may also be performed on samples of rna by reverse transcription into cdna therefrom . furthermore , mutations may also be detected at the protein level using , for example , antibodies specific for the mutant and normal fd protein , respectively . it may also be possible to base an fd mutation assay on altered cellular or subcellular localization of the mutant form of the fd protein . antibodies can also be used for the screening of the presence of the fd gene , the mutant fd gene , and the protein products therefrom . in addition , antibodies are useful in a variety of other contexts in accordance with this invention . as will be appreciated , antibodies can be raised against various epitopes of the fd protein . such antibodies can be utilized for the diagnosis of fd and , in certain applications , targeting of affected tissues . for example , antibodies can be used to detect truncated fd protein in neuronal cells , the detection of which indicates that an individual possesses a mutation in the ikbkap gene . thus , in accordance with another aspect of the present invention a kit is provided that is suitable for use in screening and assaying for the presence of the fd gene by an immunoassay through use of an antibody which specifically binds to a gene product of the fd gene in combination with a reagent for detecting the binding of the antibody to the gene product . antibodies raised in accordance with the invention can also be utilized to provide extensive information on the characteristics of the protein and of the disease process and other valuable information which includes but is not limited to : 1 . antibodies can be used for the immunostaining of cells and tissues to determine the precise localization of the fd protein . immunofluorescence and immuno - electron microscopy techniques which are well known in the art can be used for this purpose . defects in the fd gene or in other genes which cause an altered localization of the fd protein are expected to be localizable by this method . 2 . antibodies to distinct isoforms of the fd protein ( i . e ., wild - type or mutant - specific antibodies ) can be raised and used to detect the presence or absence of the wild - type or mutant gene products by immunoblotting ( western blotting ) or other immunostaining methods . such antibodies can also be utilized for therapeutic applications where , for example , binding to a mutant form of the fd protein reduces the consequences of the mutation . 3 . antibodies can also be used as tools for affinity purification of fd protein . methods such as immunoprecipitation or column chromatography using immobilized antibodies are well known in the art and are further described in section ( ii )( b )( 3 ), entitled “ protein purification ” herein . 4 . immunoprecipitation with specific antibodies is useful in characterizing the biochemical properties of the fd protein . modifications of the fd protein ( i . e ., phosphorylation , glycosylation , ubiquitization , and the like ) can be detected through use of this method . immunoprecipitation and western blotting are also useful for the identification of associating molecules that may be involved in the mammalian elongation complex . 5 . antibodies can also be utilized in connection with the isolation and characterization of tissues and cells which express fd protein . for example , fd protein expressing cells can be isolated from peripheral blood , bone marrow , liver , and other tissues , or from cultured cells by fluorescence activated cell sorting ( facs ) harlow et al ., eds ., antibodies : a laboratory manual , pp . 394 - 395 , cold spring harbor press , n . y . ( 1988 ). cells can be mixed with antibodies ( primary antibodies ) with or without conjugated dyes . if nonconjugated antibodies are used , a second dye - conjugated antibody ( secondary antibody ) which binds to the primary antibody can be added . this process allows the specific staining of cells or tissues which express the fd protein . antibodies against the fd protein are prepared by several methods which include , but are not limited to : 1 . the potentially immunogenic domains of the protein are predicted from hydropathy and surface probability profiles . then oligopeptides which span the predicted immunogenic sites are chemically synthesized . these oligopeptides can also be designed to contain the specific mutant amino acids to allow the detection of and discrimination between the mutant versus wild - type gene products . rabbits or other animals are immunized with the synthesized oligopeptides coupled to a carrier such as klh to produce anti - fd protein polyclonal antibodies . alternatively , monoclonal antibodies can be produced against the synthesized oligopeptides using conventional techniques that are well known in the art harlow et al ., eds ., antibodies : a laboratory manual , pp . 151 - 154 , cold spring harbor press , n . y . ( 1988 ). both in vivo and in vitro immunization techniques can be used . for therapeutic applications , “ humanized ” monoclonal antibodies having human constant and variable regions are often preferred so as to minimize the immune response of a patient against the antibody . such antibodies can be generated by immunizing transgenic animals which contain human immunoglobulin genes . see jakobovits et al . ann ny acad sci 764 : 525 - 535 ( 1995 ). 2 . antibodies can also be raised against expressed fd protein products from cells . such expression products can include the full length expression product or parts or fragments thereof . expression can be accomplished using conventional expression systems , such as bacterial , baculovirus , yeast , mammalian , and other overexpression systems using conventional recombinant dna techniques . the proteins can be expressed as fusion proteins with a histidine tag , glutathione - s - transferase , or other moieties , or as nonfused proteins . expressed proteins can be purified using conventional protein purification methods or affinity purification methods that are well known in the art . purified proteins are used as immunogens to generate polyclonal or monoclonal antibodies using methods similar to those described above for the generation of antipeptide antibodies . in each of the techniques described above , once hybridoma cell lines are prepared , monoclonal antibodies can be made through conventional techniques of , for example , priming mice with pristane and interperitoneally injecting such mice with the hybrid cells to enable harvesting of the monoclonal antibodies from ascites fluid . in connection with synthetic and semi - synthetic antibodies , such terms are intended to cover antibody fragments , isotype switched antibodies , humanized antibodies ( mouse - human , human - mouse , and the like ), hybrids , antibodies having plural specificities , fully synthetic antibody - like molecules , and the like . expression systems for the fd gene product allow for the study of the function of the fd gene product , in either normal or wild - type form and / or mutated form . such analyses are useful in providing insight into the disease causing process that is derived from mutations in the gene . “ expression systems ” refer to dna sequences containing a desired coding sequence and control sequences in operable linkage , so that hosts transformed with these sequences are capable of producing the encoded proteins . in order to effect transformation , the expression system may be included on a vector ; however , the relevant dna may then also be integrated into the host chromosome . in general terms , the production of a recombinant form of fd gene product typically involves the following : first a dna encoding the mature ( used here to include all normal and mutant forms of the proteins ) protein , the preprotein , or a fusion of the fd protein to an additional sequence cleavable under controlled conditions such as treatment with peptidase to give an active protein , is obtained . if the sequence is uninterrupted by introns it is suitable for expression in any host . if there are introns , expression is obtainable in mammalian or other eukaryotic systems capable of processing them . this sequence should be in excisable and recoverable form . the excised or recovered coding sequence is then placed in operable linkage with suitable control sequences in an expression vector . the construct is used to transform a suitable host , and the transformed host is cultured under selective conditions to effect the production of the recombinant fd protein . optionally the fd protein is isolated from the medium or from the cells and purified as described in section entitled “ protein purification ”. each of the foregoing steps can be done in a variety of ways . for example , the desired coding sequences can be obtained by preparing suitable cdna from cellular mrna and manipulating the cdna to obtain the complete sequence . alternatively , genomic fragments may be obtained and used directly in appropriate hosts . the construction of expression vectors operable in a variety of hosts are made using appropriate replicons and control sequences , as set forth below . suitable restriction sites can , if not normally available , be added to the ends of the coding sequence so as to provide an excisable gene to insert into these vectors . the control sequences , expression vectors , and transformation methods are dependent on the type of host cell used to express the gene . generally , prokaryotic , yeast , insect , or mammalian cells are presently useful as hosts . prokaryotic hosts are in general the most efficient and convenient for the production of recombinant proteins . however , eukaryotic cells , and , in particular , yeast and mammalian cells , are often preferable because of their processing capacity and post - translational processing of human proteins . prokaryotes most frequently are represented by various strains of e . coli . however , other microbial strains may also be used , such as bacillus subtilis and various species of pseudomonas or other bacterial strains . in such prokaryotic systems , plasmid or bacteriophage vectors which contain origins of replication and control sequences compatible with the host are used . a wide variety of vectors for many prokaryotes are known ( maniatis et al . molecular cloning : a laboratory manual pp . 1 . 3 - 1 . 11 , 2 . 3 - 2 . 125 , 3 . 2 - 3 . 48 , 2 - 4 . 64 ( cold spring harbor laboratory , cold spring harbor , n . y . ( 1982 )); sambrook et al . molecular cloning : a laboratory manual pp . 1 - 54 ( cold spring harbor laboratory , cold spring harbor , n . y . ( 1989 )); meth . enzymology 68 : 357 - 375 ( 1979 ); 101 : 307 - 325 ( 1983 ); 152 : 673 - 864 ( 1987 ) ( academic press , orlando , fla . pouwells et al . cloning vectors : a laboratory manual ( elsevier , amsterdam ( 1987 ))). commonly used prokaryotic control sequences which are defined herein to include promoters for transcription initiation , optionally with an operator , along with ribosome binding site sequences , include such commonly used promoters as the beta - lactamase ( penicillinase ) and lactose ( lac ) promoter systems , the tryptophan ( trp ) promoter system and the lambda derived pl promoter and n - gene ribosome binding , site , which has become useful as a portable control cassette ( u . s . pat . no . 4 , 711 , 845 ). however , any available promoter system compatible with prokaryotes can be used ( sambrook et al . supra . ( 1989 ); meth . enzymology supra . ( 1979 , 1983 , 1987 ); john et al . gene 61 : 207 - 215 ( 1987 ). in addition to bacteria , eukaryotic microbes , such as yeast , may also be used as hosts . laboratory strain saccharomyces cerevisiae or baker &# 39 ; s yeast , is most often used although other strains are commonly available . vectors employing the 2 micron origin of replication and other plasmid vectors suitable for yeast expression are known ( sambrook et al . supra . ( 1989 ); meth . enzymology supra . ( 1979 , 1983 , 1987 ); john et al . supra . ( 1987 ). control sequences for yeast vectors include promoters for the synthesis of glycolytic enzymes . additional promoters known in the art include the promoters for 3 - phosphoglycerate kinase , and those for other glycolytic enzymes , such as glyceraldehyde - 3 - phosphate dehydrogenase , hexokinase , pyruvate decarboxylase , phosphofructokinase , glucose - 6 - phosphate isomerase , 3 - phosphoglycerate mutase , pyruvate kinase , triosephosphate isomerase , phosphoglucose isomerase , and glucokinase . other promoters , which have the additional advantage of transcription controlled by growth conditions , are the promoter regions for alcohol dehydrogenase 2 , isocytochrome c , acid phosphatase , degradative enzymes associated with nitrogen metabolism , and enzymes responsible for maltose and galactose utilization . see sambrook et al . supra . ( 1989 ); meth . enzymology supra . john et al . supra . ( 1987 ). it is also believed that terminator sequences at the 3 ′ end of the coding sequences are desirable . such terminators are found in the 3 ′ untranslated region following the coding sequences in yeast - derived genes . many of the useful vectors contain control sequences derived from the enolase gene containing plasmid peno46 or the leu2 gene obtained from yep13 , however , any vector containing a yeast compatible promoter , origin of replication , and other control sequences is suitable ( sambrook et al . supra . ( 1989 ); meth . enzymology supra . ( 1979 , 1983 , 1987 ); john et al . supra . it is also , of course , possible to express genes encoding polypeptides in eukaryotic host cell cultures derived from multicellular organisms ( kruse and patterson tissue culture pp . 475 - 500 ( academic press , orlando ( 1973 )); meth . enzymology 68 : 357 - 375 ( 1979 ); freshney culture of animal cells ; a manual of basic techniques pp . 329 - 334 ( 2d ed ., alan r . liss , n . y . ( 1987 ))). useful host cell lines include murine myelomas n51 , vero and het cells , sf9 or other insect cell lines , and chinese hamster ovary ( cho ) cells . expression vectors for such cells ordinarily include promoters and control sequences compatible with mammalian cells such as , for example , the commonly used early and later promoters from simian virus 40 ( sv 40 ), or other viral promoters such as those from polyoma , adenovirus 2 , bovine papilloma virus , or avian sarcoma viruses , herpes virus family ( such as cytomegalovirus , herpes simplex virus , or epstein - barr virus ), or immunoglobulin promoters and heat shock promoters ( sambrook et al . supra . pp . 16 . 3 - 16 . 74 ( 1989 ); meth . enzymology 152 : 684 - 704 ( 1987 ); john et al . supra . in addition , regulated promoters , such as metallothionine ( i . e ., mt - 1 and mt - 2 ), glucocorticoid , or antibiotic gene “ switches ” can be used . general aspects of mammalian cell host system transformations have been described by axel ( u . s . pat . no . 4 , 399 , 216 ). plant cells are also now available as hosts , and control sequences compatible with plant cells such as the nopaline synthase promoter and polyadenylation signal sequences are available ( pouwells et al . supra . ( 1987 ); meth enzymology 118 : 627 - 639 ( academic press , orlando ( 1986 ); gelvin et al . j . bact . 172 : 1600 - 1608 . depending on the host cell used , transformation is done using standard techniques appropriate to such cells ( sambrook et al . supra . pp . 16 . 30 - 16 . 5 ( 1989 ); meth . enzymology supra 68 : 357 - 375 ( 1979 ); 101 : 307 - 325 ( 1983 ); 152 : 673 - 864 ( 1987 ). u . s . pat . no . 4 , 399 , 216 ; meth enzymology supra 118 : 627 - 639 ( 1986 ); gelvin et al . j . bact . 172 : 1600 - 1608 ( 1990 ). such techniques include , without limitation , calcium treatment employing calcium chloride for prokaryotes or other cells which contain substantial cell wall barriers ; infection with agrobacterium tumefaciens for certain plant cells ; calcium phosphate precipitation , deae , lipid transfection systems ( such as lipofectin . tm . and lipoffectamine . tm . ), and electroporation methods for mammalian cells without cell walls , and , microprojectile bombardment for many cells including , plant cells . in addition , dna may be delivered by viral delivery systems such as retroviruses or the herpes family , adenoviruses , baculoviruses , or semliki forest virus , as appropriate for the species of cell line chosen . identification of the fd gene and its gene product also has therapeutic implications . indeed , one of the major aims of this invention is the development of therapies to circumvent or overcome the defect leading to fd disease . envisioned are pharmacological , protein replacement , antibody therapy , and gene therapy approaches . in addition the development of animal models useful for developing therapies and for understanding the molecular mechanisms of fd disease are envisioned . in the pharmacological approach , drugs which circumvent or overcome the defective fd gene function are sought . in this approach , modulation of fd gene function can be accomplished by agents or drugs which are designed to interact with different aspects of the fd protein structure or function . efficacy of a drug or agent , can be identified in a screening program in which modulation is monitored in vitro cell systems . indeed , the present invention provides for host cell systems which express various mutant fd proteins ( especially the t - c and g - c mutations noted in this application ) and are suited for use as primary screening systems . in vivo testing of fd disease - modifying compounds is also required as a confirmation of activity observed in the in vitro assays . animal models of fd disease are envisioned and discussed in the section entitled “ animal models ”, below , in the present application . drugs can be designed to modulate fd gene and fd protein activity from knowledge of the structure and function correlations of fd protein and from knowledge of the specific defect in various fd mutant proteins . for this , rational drug design by use of x - ray crystallography , computer - aided molecular modeling ( camm ), quantitative or qualitative structure - activity relationship ( qsar ), and similar technologies can further focus drug discovery efforts . rational design allows prediction of protein or synthetic structures which can interact with and modify the fd protein activity . such structures may be synthesized chemically or expressed in biological systems . this approach has been reviewed in capsey et al ., genetically engineered human therapeutic drugs , stockton press , new york ( 1988 ). further , combinatorial libraries can be designed , synthesized and used in screening programs . the present invention also envisions that the treatment of fd disease can take the form of modulation of another protein or step in the pathway in which the fd gene or its protein product participates in order to correct the physiological abnormality . in order to administer therapeutic agents based on , or derived from , the present invention , it will be appreciated that suitable carriers , excipients , and other agents may be incorporated into the formulations to provide improved transfer , delivery , tolerance , and the like . a multitude of appropriate formulations can be found in the formulary known to all pharmaceutical chemists : remington &# 39 ; s pharmaceutical sciences , ( 15th edition , mack publishing company , easton , pa . ( 1975 )), particularly chapter 87 , by blaug , seymour , therein . these formulations include for example , powders , pastes , ointments , jelly , waxes , oils , lipids , anhydrous absorption bases , oil - in - water or water - in - oil emulsions , emulsions carbowax ( polyethylene glycols of a variety of molecular weights ), semi - solid gels , and semi - solid mixtures containing carbowax . any of the foregoing formulations may be appropriate in treatments and therapies in accordance with the present invention , provided that the active agent in the formulation is not inactivated by the formulation and the formulation is physiologically compatible . the present invention also relates to the use of polypeptide or protein replacement therapy for those individuals determined to have a defective fd gene . treatment of fd disease could be performed by replacing the defective fd protein with normal protein or its functional equivalent in therapeutic amounts . fd polypeptide can be prepared for therapy by any of several conventional procedures . first , fd protein can be produced by cloning the fd cdna into an appropriate expression vector , expressing the fd gene product from this vector in an in vitro expression system ( cell - free or cell - based ) and isolating the fd protein from the medium or cells of the expression system . general expression vectors and systems are well known in the art . in addition , the invention envisions the potential need to express a stable form of the fd protein in order to obtain high yields and obtain a form readily amenable to intravenous administration . stable high yield expression of proteins have been achieved through systems utilizing lipid - linked forms of proteins as described in wettstein et al . j exp med 174 : 219 - 228 ( 1991 ) and lin et al . science 249 : 677 - 679 ( 1990 ). fd protein can be prepared synthetically . alternatively , the fd protein can be prepared from total protein samples by affinity chromatography . sources would include tissues expressing normal fd protein , in vitro systems ( outlined above ), or synthetic materials . the affinity matrix would consist of antibodies ( polyclonal or monoclonal ) coupled to an inert matrix . in addition , various ligands which specifically interact with the fd protein could be immobilized on an inert matrix . general methods for preparation and use of affinity matrices are well known in the art . protein replacement therapy requires that fd protein be administered in an appropriate formulation . the fd protein can be formulated in conventional ways standard to the art for the administration of protein substances . delivery may require packaging in lipid - containing vesicles ( such as lipofectin . tm . or other cationic or anionic lipid or certain surfactant proteins ) that facilitate incorporation into the cell membrane . the fd protein formulations can be delivered to affected tissues by different methods depending on the affected tissue . gene therapy utilizing recombinant dna technology to deliver the normal form , of the fd gene into patient cells or vectors which will supply the patient with gene product in vivo is also contemplated within the scope of the present invention . in gene therapy of fd disease , a normal version of the fd gene is delivered to affected tissue ( s ) in a form and amount such that the correct gene is expressed and will prepare sufficient quantities of fd protein to reverse the effects of the mutated fd gene . current approaches to gene therapy include viral vectors , cell - based delivery systems and delivery agents . further , ex vivo gene therapy could also be useful . in ex vivo gene therapy , cells ( either autologous or otherwise ) are transfected with the normal fd gene or a portion thereof and implanted or otherwise delivered into the patient . such cells thereafter express the normal fd gene product in vivo and would be expected to assist a patient with fd disease in avoiding iron overload normally associated with fd disease . ex vivo gene therapy is described in u . s . pat . no . 5 , 399 , 346 to anderson et al ., the disclosure of which is hereby incorporated by reference in its entirety . approaches to gene therapy are discussed below : retroviruses are often considered the preferred vector for somatic gene therapy . they provide high efficiency infection , stable integration and stable expression ( friedman , t . progress toward human gene therapy . science 244 : 1275 ( 1989 )). the full length fd gene cdna can be cloned into a retroviral vector driven by its endogenous promoter or from the retroviral ltr . delivery of the virus could be accomplished by direct implantation of virus directly into the affected tissue . other delivery systems which can be utilized include adenovirus , adeno - associated virus ( aav ), vaccinia virus , bovine papilloma virus or members of the herpes virus group such as epstein - barr virus . viruses can be , and preferably are , replication deficient . other methods of inserting the fd gene into the appropriate tissues may also be productive . many of these agents , however , are of lower efficiency than viral vectors and would potentially require infection in vitro , selection of transfectants , and reimplantation . this would include calcium phosphate , deae dextran , electroporation , and protoplast fusion . a particularly attractive idea is the use of liposomes ( i . e ., lipofectin . tm . ), which might be possible to carry out in vivo . synthetic cationic lipids and dna conjugates also appear to show some promise and may increase the efficiency and ease of carrying out this approach . the generation of a mouse or other animal model of fd disease is important for both an understanding the biology of the disease but also for testing of potential therapies . the present invention envisions the creation of an animal model of fd disease by introduction of the fd disease causing mutations in a number of species including mice , rats , pigs , and primates . techniques for specifically inactivating or mutating genes by homologous recombination in embryonic stem cells ( es cells ) have been described ( capecci science 244 : 1288 ( 1989 )). animals with the inactivated homologous fd gene can then be used to introduce the mutant or normal human fd gene or for introduction of the homologous gene to that species and containing the t - c , g - c or other fd disease - causing mutations . methods for these transgenic procedures are well known to those versed in the art and have been described by murphy and carter , curr . opin . cell biol . 4 : 273 - 279 ( 1992 ). the following examples are provided to illustrate certain aspects of the present invention and not intended as limiting the subject matter thereof . identification of the ikbkap gene and the mutations associated with fd were obtained as follows : blood samples were collected from two major sources , the dysautonomia diagnostic and treatment center at new york university medical center and the israeli center for familial dysautonomia at hadassah university hospital , with approval from the institutional review boards at these institutions , massachusetts general hospital and harvard medical school . either f . a . or c . m . diagnosed all patients using established criteria . epstein barr virus transformed lymphoblast lines using standard conditions . fibroblast cell lines were obtained from the coriell cell repositories , camden , n . j . rna isolated from post - mortem fd brain was obtained from the dysautonomia diagnostic and treatment center at nyu . genomic dna , total rna , and mrna were prepared using commercial kits ( invitrogen and molecular research center , inc .). cytoplasmic protein was extracted from lymphoblasts as previously described ( krappmann et al . 2000 ). exon trapping experiments of cosmids from a physical map of the candidate region yielded 5 exons that were used to screen a human frontal cortex cdna library . several cdna clones were isolated and assembled into a novel transcript encoding a 1332 aa protein that was later identified as ikbkap ( cohen et al . 1998 ). the complete 5 . 9 kb cdna sequence of ikbkap has been submitted to genbank under accession number af153419 . in order to screen for mutations in fd patients , total lymphoblast rna was reverse transcribed and overlapping sections of ikbkap were amplified by pcr and sequenced . evaluation of the splicing defect was performed using the following primers : 18f : gccagtgtttttgcctgag ; 19f : cggattgtcactgttgtgc ; 23r : gactgctctcatagcatcgc ( fig1 ). sequencing was performed using the amplicycle sequencing kit ( applied biosystems ) or on an abi 377 automated dna sequencer using the bigdye terminator cycle sequencing kit ( applied biosystems ). the control sequence of the candidate region was obtained by constructing subclone libraries from bacs and sequencing using vector specific primers . the fd sequence was generated by sequencing cosmids from a patient homozygous for the major fd haplotype using sequence specific primers . several human multiple tissue northern blots ( clontech ) were hybridized using the following radioactively labeled probes : ikbkap exon 2 , ikbkap exons 18 / 19 / 20 , ikbkap exon 23 , and a 400 bp fragment of the ikbkap 3 ′ utr immediately following the stop codon . poly ( a ) + rna was isolated from patient and control lymphoblast lines , northern blotted , and hybridized using a probe representing the full coding sequence of ikbkap . cytoplasmic protein extracted from lymphoblast cell lines was western blotted and detected using ecl ( amersham ) with an antibody raised against a peptide comprising the extreme carboxyl terminus ( aa 1313 - 1332 ) of human ikap , the protein encoded by ikbkap ( krappmann et al . 2000 ). to identify dys , exon trapping and cdna selection were used to clone and characterize all of the genes in the 471 kb candidate region : epb41l8 ( unpublished data ) or ehm2 ( shimizu et al . 2000 ), c90rf4 ( chadwick et al . 1999a ), c9orf5 ( chadwick et al . 2000 ), ctnnal1 ( zhang et al . 1998 ), a novel gene with homology to the glycine cleavage system h proteins ( cg - 8 ) ( unpublished data ), ikbkap ( cohen et al . 1998 ), and actl 7a and actl 7b ( chadwick et al . 1999b ). as fd is a recessive disorder , the a priori expectation for the mutation was inactivation of one of these genes . consequently , each of these were screened for mutations by rt - pcr of patient lymphoblast rna and direct sequencing of all coding regions . although many snps were identified , there was no evidence for a homozygous inactivating mutation . thus , it was concluded that the mutation would be found in non - coding sequence and the control genomic sequence of the entire 471 kb candidate region was generated using bacs from a physical map . direct sequence prediction using genscan and comprehensive searches of the public databases did not reveal any additional genes in the candidate region beyond those found by cloning methods . however , snps identified during sequence analysis enabled us to refine the haplotype analysis and narrow the candidate interval to 177 kb shared by the major haplotype and the previously described minor haplotype i ( blumenfeld et al . 1999 ). this reduced interval contains 5 genes , ctnnal1 , cg - 8 , ikbkap , actl7a and actl7b , all previously screened by rt - pcr without yielding a coding sequence mutation . a cosmid library was constructed from a patient homozygous for the major haplotype , assembled the minimal coverage contig for the now reduced candidate interval , and generated the sequence of the mutant chromosome . comparison of the fd and control sequences revealed 152 differences ( excluding simple sequence repeat markers ), which include 26 variations in the length of dt n tracts , 1 vntr , and 125 base pair changes . each of the 125 base pair changes was tested in a panel of 50 individuals known to carry two non - fd chromosomes by segregation in fd families . of the 125 changes tested , only 1 was unique to patients carrying the major fd haplotype . this t - c change is located at bp 6 of intron 20 in the ikbkap gene depicted in fig1 , and is demonstrated in fig2 a . ikap was originally identified as an iκb kinase ( ikk ) complex - associated protein that can bind both nf - κb inducing kinase ( nik ) and ikks through separate domains and assemble them into an active kinase complex ( cohen et al . 1998 ). recent work , however , has shown that ikap is not associated with ikks and plays no specific role in cytokine - induced nf - κb signaling ( krappmann et al . 2000 ). rather , ikap was shown to be part of a novel multi - protein complex hypothesized to play a role in general transcriptional regulation . the ikbkap gene contains 37 exons and encodes a 1332 amino acid protein . the full - length 5 . 9 kb cdna ( genbank accession number af153419 ) covers 68 kb of genomic sequence , with the start methionine encoded in exon 2 . ikbkap was previously assigned to chromosome 9q34 ( genbank accession number ap044195 ), but it clearly maps within the fd candidate region of 9q31 . northern analysis of ikbkap revealed two mrnas of 4 . 8 and 5 . 9 kb ( fig3 a and b ). the wild - type 4 . 8 kb mrna has been reported previously ( cohen et al . 1998 ), while the second 5 . 9 kb message differs only in the length of the 3 ′ utr and is predicted to encode an identical 150 kda protein . as seen in fig3 b , the putative fd mutation does not eliminate expression of the ikbkap mrna in patient lymphoblasts . a base pair change at position 6 of the splice donor site might be expected to result in skipping of exon 20 ( 74 bp ), causing a frameshift and therefore producing a truncated protein . however , initial inspection of our rt - pcr experiments in patient lymphoblast rna using primers located in exons 18 and 23 ( fig1 ) showed a normal length 500 bp fragment that contained exon 20 ( fig4 a ), indicating that patient lymphoblasts express normal ikbkap message . the western blot shown in fig4 b demonstrates that full - length ikap protein is expressed in these patient lymphoblasts . however , as the antibody used was directed against the carboxyl - terminus of ikap it would not be expected to detect any truncated protein should it be present . the presence of apparently normal ikap in patient cells is at odds with the expectation of an inactivating mutation in this recessive disease . in the absence of any evidence for a functional consequence of the intron 20 sequence change , the only alteration unique to fd chromosomes , additional genetic evidence was sought to support the view that it represents the fd mutation . the 658 fd chromosomes that carry the major haplotype all show the t - c change . in toto , 887 chromosomes have been tested that are definitively non - fd due to their failure to cause the disorder when present in individuals heterozygous for the major fd haplotype . none of these non - fd chromosomes exhibits the t - c mutation , strongly indicating that it is not a rare polymorphism . the frequency of the mutation in random aj chromosomes was 14 / 1012 ( gene frequency 1 / 72 ; carrier frequency 1 / 36 ), close to the expected carrier frequency of 1 / 32 ( maayan et al . 1987 ). in view of the strong genetic evidence that this mutation must be pathogenic , it was postulated that its effect might be tissue - specific . rna extracted from the brain stem and temporal lobe of a post - mortem fd brain sample was therefore examined . in contrast to fd lymphoblasts , rt - pcr of the fd brain tissue rna using primers in exons 19 and 23 ( expected to produce a normal product of 393 bp ) revealed a 319 bp mutant product , indicating virtually complete absence of exon 20 from the ikbkap mrna ( fig5 , lanes 10 - 11 ). as additional fd autopsy material could not be obtained , intensive analyses of additional lymphoblast and fibroblast cell lines were performed to determine whether exon - skipping could be detected . fibroblast lines from homozygous fd patients yielded variable results . some primary fibroblast lines displayed approximately equal expression of the mutant and wild - type mrnas while others displayed primarily wild - type mrna . in addition , extensive examination of additional patient lymphoblast lines indicated that the mutant message could sometimes be detected at low levels . an example of the variability seen in fd fibroblasts and the presence of the mutant message in some fd lymphoblasts is shown in fig5 . in fact , close re - examination of fig4 a shows a trace of the mutant band in 2 ( lanes 1 and 2 ) of the 3 fd samples . the absence of exon 20 in the fd brain rna and the preponderance of wild - type mrna in fibroblasts and lymphoblasts indicate that the major fd mutation acts by altering splicing of ikbkap in a tissue - specific manner . to identify the mutations associated with minor haplotypes 2 and 3 , ( blumenfeld et al . 1999 ) we amplified each ikbkap exon , including adjacent intron sequence , from genomic dna . a single g - c change at bp 2397 ( bp 73 of exon 19 ) that causes an arginine to proline missense mutation ( r696p ) was identified in all 4 patients with minor haplotype 2 ( fig2 b ). this was subsequently confirmed by rt - pcr in lymphoblast rna as shown in fig2 c for a region that crosses the exon 19 - 20 border . the pcr product , generated from an fd patient who is a compound heterozygote with minor haplotype 2 and the major haplotype , clearly shows that rna is being expressed equally from both alleles based on heterozygosity of the g - c point mutation in exon 19 . however , the rna from the major haplotype allele shows no evidence for skipping of exon 20 which would be expected to produce a mixture of exon 20 and 21 sequence beginning at the end of exon 19 . this confirms our previous observation that lymphoblasts with the major fd mutation produce a predominance of normal ikbkap transcript . the r696p mutation is absent from 500 non - fd chromosomes , and it has been seen only once in 706 random aj chromosomes in an individual who also carries the minor haplotype . this mutation is predicted to disrupt a potential threonine phosphorylation site at residue 699 identified by netphos 2 . 0 ( blom et al . 1999 ), suggesting that it may affect regulation of ikap . interestingly , the presence of this minor mutation is associated with a relatively mild disease phenotype , suggesting that a partially functional ikap protein may be expressed from this allele . no mutation has been identified for minor haplotype 3 , which represents the only non - aj putative fd chromosome . as discussed above , the allele - specific oligonucleotide ( aso ) hybridization assay is highly effective for detecting single nucleotide changes in dna and rna , such as the t - c or g - c mutations or sequence variations , especially when used in conjunction with allele - specific pcr amplification . thus , in accordance with the present invention , there is provided an assay kit to detect mutations in the fd gene through use of a pcr / aso hybridization assay . genomic dna samples are placed into a reaction vessel ( s ) with appropriate primers , nucleotides , buffers , and salts and subjected to pcr amplification . suitable genomic dna - containing samples from patients can be readily obtained and the dna extracted therefrom using conventional techniques . for example , dna can be isolated and prepared in accordance with the method described in dracopoli , n . et al . eds . current protocols in human genetics pp . 7 . 1 . 1 - 7 . 1 . 7 ( j . wiley & amp ; sons , new york ( 1994 )), the disclosure of which is hereby incorporated by reference in its entirety . most typically , a blood sample , a buccal swab , a hair follicle preparation , or a nasal aspirate is used as a source of cells to provide the dna . alternatively , rna from an individual ( i . e ., freshly transcribed or messenger rna ) can be easily utilized in accordance with the present invention for the detection of the fd2 mutation . total rna from an individual can be isolated according to the procedure outlined in sambrook , j . et al . molecular cloning — a laboratory manual pp . 7 . 3 - 7 . 76 ( 2nd ed ., cold spring harbor laboratory press , new york ( 1989 )) the disclosure of which is hereby incorporated by reference . in a preferred embodiment , the dna - containing sample is a blood sample from a patient being screened for fd . in amplification , a solution containing the dna sample ( obtained either directly or through reverse transcription of rna ) is mixed with an aliquot of each of datp , dctp , dgtp and dttp ( i . e ., pharmacia lkb biotechnology , n . j . ), an aliquot of each of the dna specific pcr primers , an aliquot of taq polymerase ( i . e ., promega , wis . ), and an aliquot of pcr buffer , including mgcl . sub . 2 ( i . e ., promega ) to a final volume . followed by pre - denaturation ( i . e ., at 95 . degree . c . for 7 minutes ), pcr is carried out in a dna thermal cycler ( i . e ., perkin - elmer cetus , conn .) with repetitive cycles of annealing , extension , and denaturation . as will be appreciated , such steps can be modified to optimize the pcr amplification for any particular reaction , however , exemplary conditions utilized include denaturation at 95 . degree . c . for 1 minute , annealing at 55 . degree . c . for 1 minute , and extension at 72 . degree . c . for 4 minutes , respectively , for 30 cycles . further details of the pcr technique can be found in erlich , “ pcr technology ,” stockton press ( 1989 ) and u . s . pat . no . 4 , 683 , 202 , the disclosure of which is incorporated herein by reference . in a preferred embodiment , the amplification primers used for detecting the t - c mutation and the g - c mutation in the fd gene are 5 ′- gccagtgtttttgcctgag - 3 ′/ 5 ′- gactgctctcatagcatccc - 3 ′ and 5 ′- cggattgtcactgttgtgc - 3 ′/ 5 ′- gactgctctcatagcatcgc - 3 , respectively . following pcr amplification , the pcr products are subjected to a hybridization assay using allele - specific oligonucleotides . in a preferred embodiment , the allele - specific oligonucleotides used to detect the mutatons in the fd gene are as follows : in the aso assay , when carried out in microtiter plates , for example , one well is used for the determination of the presence of the normal allele and a second well is used for the determination of the presence of the mutated allele . thus , the results for an individual who is heterozygous for the t - c mutation ( i . e . a carrier of fd ) will show a signal in each of the wells , an individual who is homozygous for the t - c allele ( i . e ., affected with fd ) will show a signal in only the c well , and an individual who does not have the fd mutation will show only one signal in the t well . in another embodiment , a kit for detecting the fd mutation by aso assay is provided . in the kit , amplification primers for dna or rna ( or generally primers for amplifying a sequence of genomic dna , reverse transcription products , complementary products ) including the t - c mutated and normal alleles are provided . allele - specific oligonucleotides are also preferably provided . the kit further includes separate reaction wells and reagents for detecting the presence of homozygosity or heterozygosity for the t - c mutation . within the same kit , or in separate kits , oligonucleotides for amplification and detection of other differences ( such as the g - c mutation ) can also be provided . if in the same kit as that used for detection of the t - c mutation , separate wells and reagents are provided , and homozygosity and heterozygosity can similarly be determined . as will be appreciated , a variety of other nucleotide based detection techniques are available for the detection of mutations in samples of rna or dna from patients . see , for example , the section , above , entitled “ nucleic acid based screening .” any one or any combination of such techniques can be used in accordance with the invention for the design of a diagnostic device and method for the screening of samples of dna or rna for fd gene mutations in accordance with the invention , such as the mutations and sequence variants identified herein . further , other techniques , currently available , or developed in the future , which allow for the specific detection of mutations and sequence variants in the fd gene are contemplated in accordance with the invention . through use of any such techniques , it will be appreciated that devices and methods can be readily developed by those of ordinary skill in art to rapidly and accurately screen for mutations and sequence variants in the fd gene in accordance with the invention . thus , in accordance with the invention , there is provided a nucleic acid based test for fd gene mutations and sequence variants which comprises providing a sample of a patient &# 39 ; s dna or rna and assessing the dna or rna for the presence of one or more fd gene mutations or sequence variants . samples of patient dna or rna ( or genomic , transcribed , reverse transcribed , and / or complementary sequences to the fd gene ) can be readily obtained as described in example 2 . through the identification and characterization of the fd gene as taught and disclosed in the present invention , one of ordinary skill in the art can readily identify the genomic , transcribed , reverse transcribed , and / or complementary sequences to the fd gene sequence in a sample and readily detect differences therein . such differences in accordance with the present invention can be the t - c or g - c mutations or sequence variations identified and characterized in accordance herewith . alternatively , other differences might similarly be detectable . kits for conducting and / or substantially automating the process of identification and detection of selected changes , as well as reagents utilized in connection therewith , are therefore envisioned in accordance with the invention of the present invention . as discussed above , through knowledge of the gene - associated mutations responsible for fd disease , it is now possible to prepare transgenic animals as models of the fd disease . such animals are useful in both understanding the mechanisms of fd disease as well as use in drug discovery efforts . the animals can be used in combination with cell - based or cell - free assays for drug screening programs . the first step in creating an animal model of fd is the identification and cloning of homologs of the ikbkap gene in other species . the human ikbkap sequence ( genbank accession no . af153419 ) was used to search the mouse expressed sequence tag database ( dbest ) using the blast program ( www . ncbi . nlm . nih . gov / blast ). a single 5 ′ est from a mouse brain library ( genbank association no . au079160 ) was identified that showed marked similarity to the 5 ′ end of ikbkap . the corresponding cdna clone , mncb - 3931 , was obtained from the japanese collection of the research bioresource / national institute of infectious disease . in addition , eight est &# 39 ; s that were similar to the 3 ′ end of the orf were found to belong to unigene cluster mn . 46573 ( www . ncbi . nlm . nih . gov / unigene ). examination of this cluster yielded several poly ( a +)- containing clones , and we obtained the clone ui - m - cg0p - bhb - g - 07 - 0 - u1 ( genbank accession no . be994893 ) from research genetics . rna ( 1 ug / ml from balb / c mouse brain was obtained commercially ( clontech ). oligo - dt 15 and random hexamer primers were annealed to the template at 65 ° c . for 10 min in the presence of 1 × first - strand buffer , 2 mm dntp mix , and 4 mm dtt . the reaction mixture was incubated at 42 ° c . for 90 min after addition of suuperscript ™ ii rt ( 200 u / ul ) and rnase inhibitor ( 80 u / ul ) ( gibco ). dna sequencing was performed using the amplicycle sequencing kit ( applied biosystems ) for the 33 [ p ]- labeled dideoxynucleotide chain termination reaction , using the following conditions : 30 sec at 94 ° c ., 30 sec at 60 ° c ., and 30 sec at 72 ° c . for 30 cycles . the radioactively labeled sequence reaction product was denatured at 95 c for 10 min and run on a denaturing 6 % polyacrylamide gel for autoradiography . basic sequencing manipulations and aligments were carried out using a program from genetics computer group ( gcc ; madison , wis .). the cdna sequence generated throughout the experiments were aligned and assembled into a 4799 - bp cdna named ikbkap . to obtain the full - length cdna sequence , pcr was performed on the mouse cdna template using primers designed from the sequence of the 5 ′- and 3 ′- cdna clones . the pcr conditions were as follows : 15 sec at 95 ° c ., 30 sec at 54 ° c . to 60 ° c ., and 3 min at 68 ° c . for 9 cycles ; then 15 sec at 95 ° c ., 30 sec at 54 to 60 ° c ., and 3 min with increment of 5 sec for each succeeding cycle at 68 c for 19 cycles , followed by 7 min at 72 ° c . the pcr products were electrophoresed on a 1 % agarose gel stained with ethidium bromide and were cleaner using a qiaquick pcr cleaning kit ( qiagen ) in the preparation for cycle sequencing . successive primers were designed in order to obtain the full - length ikbkap sequence , which was deposited in genbank under accession no . af367244 . expression of ikbkap was examined using both mouse embryo and adult mouse multiple tissue northern blots ( clontech ). the blots were probed with a 1045 - bp pcr fragment that contains exons 2 through 11 , which was generated using primer 1 ( 5 ′ gcgtcgtagaaattgc - 3 ′) and primer 2 ( 5 ′- gtggtgctgaaggggcaggc - 3 ′). the probe was radiolabeled ( sambrook et al ., 1989 ) and was hybridized according to the manufacturer &# 39 ; s instructions . several of the mouse ikbkap ests belogned to the unigene cluster mn . 46573 , which has been mapped to chromosome 4 ( unists entry : 253051 ) between d4mit287 and d4mit197 . to assess synteny between mouse chromosome 4 and human chromosome 9 , we used several resources available at ncbi ( www . nbci . nlm . nih . gov / homology ). the 37 human ikbkap exons were searched against the celera database to obtain homologous mouse sequences . approximately 130 mouse genomic fragements ( 500 - 700 bp ) were obtained using the celera discovery system and celera &# 39 ; s associated database , and these fragements were assembled into seven contigs . in order to assemble the coomplete genomic sequence , we obtaiined six mouse bacterial artificial chromosomes ( bacs ) from researcg genetics after they screened an rpci - 23 mouse library using 4300 bp human probe that contained exon 2 . to verify that these bac clones contained the entire ikbkap gene , we amplified fragments from the 5 ′ and 3 ′ ends of the gene , as well as a fragment from the 3 ′ flanking gene act17b ( slaugenhaupt et al ., 2001 ) we designed primers at the ends of each of the seven contigs constructed from the celera data and generated pcr products from the bacs . subsequently , we sequenced and closed five of the gaps , with the resulting two contigs assembled and deposited to celera ( accession no . csn009 ). after cloning and sequencing the mouse homolog of the human ikbkap gene , a targeting vector can then be constructed from the mouse genomic dna . the targeting vector would consist of two approximately 3 kb genomic fragments from the mouse fd gene as 5 ′ and 3 ′ homologous arms . these arms would be chosen to flank a region critical to the function of the fd gene product ( for example , exon 20 ). in place of exon 20 , negative and positive selectable markers can be placed , for example , to abolish the activity of the fd gene . as a positive selectable marker a neo gene under control of phosphoglycerate kinase ( pgk - 1 ) promoter may be used and as a negative selectable marker the 5 ′ arm of the vector can be flanked by a pgk - 1 promoted herpes simplex thymidine kinase ( hsv - tk ) gene can be used . the vector is then transfected into r1 es cells and the transfectants are subjected to positive and negative selection ( i . e ., g418 and gancyclovir , respectively , where neo and hsv - tk are used ). pcr is then used to screen for surviving colonies for the desired homologous recombination events . these are confirmed by southern blot analysis . subsequently , several mutant clones are picked and injected into c57bl / 6 blastocytes to produce high - percentage chimeric animals . the animals are then mated to c57bl / 6 females . heterozygous offspring are then mated to produce homozygous mutants . such mutant offspring can then be tested for the fd gene mutation by southern blot analysis . in addition , these animals are tested by rt - pcr to assess whether the targeted homologous recombination results in the ablation of the fd gene mrna . these results are confirmed by northern blot analysis and rnase protection assays . once established , the fd gene -/- mice can be studied for the development of fd - like disease and can also be utilized to examine which cells and tissue - types are involved in the fd disease process . the animals can also be used to introduce the mutant or normal fd gene or for the introduction of the homologous gene to that species ( i . e ., mouse ) and containing the t - c or g - c mutations , or other disease causing mutations . methods for the above - described transgenic procedures are well known to those versed in the art and are described in detail by murphy and carter supra ( 1993 ). the techniques described above , can also be used to introduce the t - c or g - c mutations , or other homologous mutations in the animal , into the homologous animal gene . as will be appreciated , similar techniques to those described above , can be utilized for the creation of many transgenic animal lines . to the extent that any reference ( including books , articles , papers , patents , and patent applications ) cited herein is not already incorporated by reference , they are hereby expressly incorporated by reference in their entirety . while the invention has been described in connection with specific embodiments thereof , it will be understood that it is capable of further modification , and this application is intended to cover any variations , uses , or adaptations of the invention following , in general , the principles of the invention and including such departures from the present disclosure as come within known or customary practice in the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth , and as fall within the scope of the invention and the limits of the appended claims . | 2 |
throughout all the figures , same or corresponding elements are generally indicated by same reference numerals . insoles are provided for all common shoe sizes and configured for snug fit in the shoe . the insoles accommodate the sole of the foot in a form fit , and intended for cushioning and supporting the foot structures that are exposed to stress . the invention provides for a range of insoles as listed below ( using shoe - size 40 as an example ): modular insole for diverse degenerative symptoms in the foot structures , the shape of the insole varying to suit the specific symptom ; 40b : fallen plantar arch ( early stage ) as a result of the old age ; 40c : fallen plantar arch ( medium stage ) as a result of old age ; 40d : fallen plantar arch ( advanced stage ) as a result of old age ; 40e : modular insole with stirrup - type stabilization and control of the ankle joint ( also in combination with shin - bone protector ); all insole types are provided in different degrees of hardness and with zones that differ in hardness , and all may include a metatarsal truss pad , such as a metatarsal truss pad 12 , shown , by way of example , in fig2 a . turning now to the drawing , and in particular to fig1 there is shown a top view of an insole 1 according to the invention . the insole 1 has a container 6 extending from a heel region 2 through a region of the lateral longitudinal arch 3 to a region of the fifth metatarsal head 4 and from there to a region of the first metatarsal head 5 . the container 6 is filled with a gaseous ( e . g . air ) or liquid fluid , preferably a water - based liquid , and is preferably made of a soft material which is impermeable to liquids and gases , adapts to the shape of the foot and has comfortable support properties . examples as material for the container 6 include , e . g ., a gel or a foamed plastic , such as foamed ethylene . of course , a person skilled in the art is aware of a wide range of gels or foamed plastics and will utilize the type of material which is best adapted to the particular application in which the invention is to be used . as shown in fig1 b , which is a sectional view of the insole , taken along the line i — i of fig1 a valve 7 is provided at a side of the insole 1 for controlling , i . e . increasing or reducing , the amount of fluid in the container 6 . this can be done , for example , by means of a syringe , which is insertable into the valve 7 , for injection of fluid into the container 6 or withdrawal of fluid from the container 6 . to enable a user to readjust the amount of fluid in the container 6 , it is useful to provide a graduation 8 , which comprises , for example , graduation marks running transversely to the longitudinal direction of the insole 1 . in this way , the user is able to select a suitable insole for a shoe size and for foot prophylaxis , and then to adapt it individually to own personal needs . as an alternative , the container 6 may also be located only in the heel region or in the region of the lateral longitudinal arch , or from the region of the fifth metatarsal head to the first metatarsal head , or in any combination of these regions . turning now to fig2 a , there is shown a top and front perspective illustration of a variation of the insole 1 according to the present invention . parts corresponding with those in fig1 a are denoted by identical reference numerals and not explained again . in this embodiment , provision is made for a stirrup - shaped device 10 for immobilizing the talocalcaneonavicular joint and for controlling and / or stabilizing the ankle joint of a human being . the stirrup - shaped device 10 is thus secured to a rear portion of the insole 1 and projects upwards . suitably , a shinbone protector 11 is integrated in the stirrup - shaped device 10 . in a forward area thereof , the insole 1 includes a metatarsal truss pad 12 for providing an elevation in the metatarsal area whereas in the heel region , the insole 1 is raised by an insertion wedge 13 which is flattened towards the forward part . as an alternative , the area between forefoot and distal tarsus may also be designed flatter . fig2 b shows a rear view of the insole 1 . of course , the provision of the shin - bone protector 11 , metatarsal truss pad 12 and insertion wedge 13 are optional and any combination should be considered within the scope of the present invention . turning now to fig3 a and 3 b , there is shown a side and rear illustration of an athletic sock generally indicated by 14 . the insole 1 shown here extends into the stirrup - type device 15 with two vertical legs configured as entirely unitary piece . the device 15 has a medial leg 18 and a lateral leg 19 . fig3 a - b and 4 a - b also show the stirrup - type device 15 secured with a band 16 extending substantially in horizontal direction around the leg of the user . when the stirrup - type device 15 is an integral part of the insole 1 , it is formed from the same flexible plastic material as the insole . the front portion of the stirrup - type device 15 is configured as a closed front . however , the front portion may also be configured as a two piece front portion so that two pieces may meet prior to securement with the band 16 . the band 16 can extend in a substantially horizontal direction . alternatively , the band 16 can also be configured as a crossed band . rearwardly , the stirrup - type device 15 remains open . generally , the stirrup - type device 15 is from soft plastic . preferably , the stirrup - type device 15 is constructed in layers , which can be arranged in a sandwich type manner , wherein the inner - and outer layers exhibit varying grades of hardness , respectively softness . for example , the device 15 can be constructed so the layer ( s ) close to the body of the user can be made from softer material , which can be covered by a relatively stiffer plastic body 20 as seen in fig4 a - b . the stiffer plastic body 20 can also be set into the stirrup - type device 15 so as to take up no dimension in addition to that of the stirrup - type device 15 . the plastic body optionally has a lateral opening 21 for ease of wear by the user . since the container 6 may also be located only in the heel region or in the region of the lateral longitudinal arch , or from the region of the fifth metatarsal head to the first metatarsal head , or in any combination of these regions , the container 6 of the insole 1 , also with the stirrup type device 15 for the athletic sock is adjustable to these foot regions . alternatively , the insole 1 can be configured in various sizes so that it covers the heel only , or the insole 1 can be sized extending from the heel to the midfoot , or from the heel to the toes . optionally , the insole 1 of the athletic sock 14 can be configured so it can be filled with a fluid material as described above . as compared to the insole 1 , the combination of insole 1 and the stirrup - type device 15 stabilizes the foot in medial - lateral direction ( supination trauma motion ) exerting pressure onto the mechano - receptors of the body and thereby activating these . this is known as “ proprioception ” which leads to autostabilization of the body . thus , with the combination of the insole 1 and device 15 according to the invention on the one hand , a prophylaxis against supination trauma is realized and on the other hand , the proprioception is raised , which is further enhanced by means of the frictional band 16 disposed in substantial horizontal position . the stirrup - type device 15 can be removably secured to the athletic sock , for example by means of a velcro ®- type fastener 17 or other type of hook and loop fastener . in an alternate manner , the stirrup - type device 15 is secured to the athletic sock in a non - removable manner , for example by being sown to the sock . in another manner , the athletic sock 14 is manufactured so that the plastic insole 1 with the stirrup - type device 15 is sprayed directly onto the sock material to which it bonds . the outer plastic layer 20 can be an integral part of the insole 1 with the stirrup - type device 15 or it can be attached to by other means . optionally , a shinbone protector 11 can also be integrated with the stirrup - type device 15 ; for example the shinbone protector can be attached to the lower end at the front of the stirrup - type device . while the invention has been illustrated and described as embodied in an insole , it is not intended to be limited to the details shown since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . | 0 |
as to the figures , like reference characters indicate corresponding or like parts throughout the several figures . fig1 to 3 show a therapeutic apparatus in the form of a garment 100 . the garment 100 includes a torso section 200 connected to a pelvic section 300 having leg portions 315 a and 315 b adjacent a crotch region and configured to receive the patient &# 39 ; s left and right legs respectively . the torso section 200 includes a plurality of elongated expandable bladders 210 , which , when the garment 100 is worn by a patient , longitudinally extend vertically or parallel to the anteroposterior axis of the patient . in the system of fig1 , the garment 100 includes four expandable bladders 210 a , 210 b , 210 c , 210 d , with a first pair 210 a , 210 b configured to underlie the patient &# 39 ; s left scapula and a second pair 210 c , 210 d configured to underlie the patient &# 39 ; s right scapula . it should be understood , however , that any suitable number of bladders 210 , including a single bladder 210 , may be provided under each of the left scapula and the right scapula . a control unit 400 includes a pump mechanism 420 controlled by a processor 410 to selectably expand the bladders 210 a , 210 b , 210 c , 210 d . the pump mechanism 420 may be , for example , the same as or like the pump described in the &# 39 ; 219 patent , which is described in greater detail above and which is incorporated by reference in its entirety by reference thereto . the control unit 400 is configured to control the expansion of each bladder 210 a , 210 b , 210 c , 210 d independently to provide a highly controllable level of localized force at the location of each bladder 210 a , 210 b , 210 c , 210 d . the processor 410 is programmed to expand bladders 210 a and 210 b while the bladders 210 c and 210 d are in a relatively deflated or non - expanded state , thus providing a rolling force that lifts the patient &# 39 ; s back , in the area of the left scapula , to rotate the patient &# 39 ; s torso rightward . subsequently , the bladders 210 a and 210 b are deflated and the bladders 210 c and 210 d are expanded , so as to rotate the patient &# 39 ; s torso leftward in an analogous manner . this process is repeated for any desired number of iterations or “ rolls ,” which may be predetermined and / or provided to the control unit 400 by an operator and / or the patient . further , the rate of rolling and any amount of time between commencements of rolling treatment sessions ( for example , every 10 to 20 minutes ) may be predetermined and / or adjusted , for example , by the operator and / or patient . fig1 shows that the garment 100 is integrated with components as described in the &# 39 ; 219 patent , which is discussed in greater detail above and which is incorporated herein in its entirety by reference thereto . for example , the garment 100 includes channels 335 and pressure relievers 346 , as described in the &# 39 ; 219 patent . these elements may be controlled , along with the bladders 400 and / or any other controllable components described herein , by the control unit 400 and / or a separate controller . fig1 also shows that the garment 100 includes a soilage sensor 350 that is disposed in the groin region of the garment and that is configured to detect urinary and / or fecal soilage to alert , e . g ., nurses , to the occurrence of urinary and / or fecal soilage . this signals the nurse to perform a garment change . the sensor may also allow the nurse to spend less time checking a patient for urinary and for fecal soilage . although a single sensor 350 is shown , any number of sensors may be provided , as appropriate . the illustrated sensor is integrated into the garment and is associated with an alarm 450 disposed within the control unit 400 . the alarm may be provided at any suitable location , and it may be configured to receive signals using wired and / or wireless communication . referring to fig3 , since the patient &# 39 ; s back is generally angled with respect to the surface ( e . g ., the bed ), supporting the patient &# 39 ; s back during the respective right and left rolling movements , the outer bladders 210 a and 210 d hold a larger volume of pressurization fluid , or at least have a geometry that allows the bladders 210 a and 210 d to extend a greater distance between the patient &# 39 ; s back and the surface on which the patient is lying . the control unit 400 may be integrated into the garment or provided as a separate unit , such as , for example , a hand - held device . further , the processor 410 and the pump mechanism 420 may be provided in the same housing or separate housings and may communicate with each other through wired and / or wireless communication channels . the pump mechanism includes one or more pumps that are controllable to selectably pressurize and expand the bladders 210 a , 210 b , 210 c , 210 d via a pressurization fluid ( e . g ., a gas or liquid ) that extends through pressure control lines and into the interior chambers of the bladders 210 a , 210 b , 210 c , 210 d . in fig3 , each of the bladders 210 a , 210 b , 210 c , 210 d includes a respective vibrating and / or percussive device 220 a , 220 b , 220 c , 220 d disposed on the side of the respective bladder 210 a , 210 b , 210 c , 210 d adjacent the patient &# 39 ; s back so as to improve pulmonary hygiene . the devices 220 a , 220 b , 220 c , 220 d create a vibratory and / or percussive effect to help mobilize sequestered secretions within the lungs of , e . g ., debilitated and / or bed - ridden patients . such vibratory and / or percussive treatments are intended to break up inspissated fluids within the lungs , reducing surface tension , so as to allow secretions to be mobilized and expectorated . this is intended to reduce the need for a nurse and for a pulmonary therapist to provide percussive treatment . also , because the treatment mechanism is integrated into the garment , percussive therapy may be increased in frequency since it may be controlled in an automated manner . the vibrating and / or percussive devices 220 a , 220 b , 220 c , 220 d may be controlled , such as , for example , independently of each other , by the control unit 400 and / or a separate controller . although the vibrating and percussive devices 220 a , 220 b , 220 c , 220 d are integrated into the bladders 210 a , 210 b , 210 c , 210 d , the vibrating and / or percussive devices 220 a , 220 b , 220 c , 220 d may be provided separate from the bladders 210 . further , multiple vibrating and / or percussive devices may be provided for each bladder 210 a , 210 b , 210 c , and / or 210 d . the vibrating and / or percussive devices 220 a , 220 b , 220 c , 220 d may apply mechanical percussion ( for example , a cupping mechanism or paddle paddles that rotate back - and - forth ) and / or ultrasonic vibration , which is intended to increase the effect of pulmonary surfactants . the vibrating and / or percussive devices 220 a , 220 b , 220 c , 220 d may be controlled ( for example , by the controller 400 ) to provide vibration and / or percussion to the patients lungs simultaneously with the side - to - side “ rolling ” provided by the actuation of the bladders 210 a , 210 b , 210 c , 210 d . although “ rolling ” and vibration / percussion may be advantageous when applied alone or separately , it is believed that the simultaneously operable combination of a vibration / percussion mechanism and a “ rolling ” mechanism enhances the pulmonary benefits to the patient as compared to the application of these treatments applied alone or separately . referring to fig4 , a vascular compression garment 500 is configured to be worn to surround around a patient &# 39 ; s hip and upper thigh region in a manner similar to compression shorts . the garment 500 includes leg portions 515 a and 515 b configured to receive a patient &# 39 ; s left and right legs , respectively . an expandable vascular compression bladder 510 is provided in the region of a vascular access and is controllable ( for example , with controller 400 or a separate controller ) in a manner like that of the control and pressurization of the bladders 210 , as described above . although the bladder 510 is a single oval - shaped bladder , any number of bladders may be provided , and they may be separately controllable for applying pressure to the femoral artery . the garment 500 is configured to provide only enough pressure to minimize or at least reduce bleeding in connection with an invasive procedure , such as , for example , cardiac catheterization . the pressure bladder conforms to the patient &# 39 ; s body and includes an integrated bleeding sensor 550 that triggers an alarm to alert nurses if bleeding occurs . the alarm mechanism may function in connection with a control unit ( e . g ., control unit 400 ), in a manner like that of the soilage sensor 350 , as described above . in response to the triggering of the alarm by the bleeding sensor 550 , a nurse may conduct manual intervention ( including , for example , a visual inspection for bleeding ) and / or the device may be controlled ( for example , automatically ) to increase the pressure applied to the vascular access region with the bladder 510 . the garment 500 may be integrated with the therapeutic garment 100 described above or provided as a separate and stand - alone apparatus . furthermore , the garment 500 may be integrated into a larger garment that limits shifting so that pressure is only placed where it is anatomically needed . this larger garment may be , e . g ., the therapeutic garment 100 , as described above . further , although the garment 500 is configured to apply pressure to the femoral artery ( for example , after an angiography procedure ), the garment 500 may be configured to apply pressure to any appropriate access location in connection with any suitable procedure . fig5 shows a system that includes a semi - permeable material 812 in the region of an expandable bladder 815 that is in approximation with a patient 900 supported on a bed 950 . a pump 820 ( which may be the same as pump 420 shown in fig1 ) is controlled to supply air ( or any other suitable gas ), via supply line 822 , to the interior space 815 of the bladder 815 . the pressurization of the interior space 815 with respect to the ambient atmosphere creates a pressure differential across the semi - permeable material 812 . this pressure differential causes the air or other gas to pass ( relatively slowly ) across the semi - permeable material 812 and into contact with the patient &# 39 ; s skin or a material adjacent the patient &# 39 ; s skin . the air or gas provided to the patient 900 across the semi - permeable material is intended to control the temperature and humidity at the patient &# 39 ; s skin and to help reduce and evaporate perspiration or other moisture . a controller ( for example , controller 400 shown in fig1 ) may monitor the pressure the in the bladder 810 and provide additional gas to the bladder 810 to account for the gas passing through the semi - permeable material 812 . the control system may use a suitable pressure detection mechanism ( for example , a pressure sensor ) to maintain a desired pressure . in addition to controlling gas pressure in the bladder 812 , the temperature and / or humidity of the gas provided to the bladders 210 a , 210 b , 210 c , 210 d may be controlled . for example , the gas ( e . g ., air ) may be cooled and dehumidified with respect to ambient air such that the gas passing though the semi - permeable material and into contact with the patient may be better suited to reduce moisture and perspiration and increase patient comfort . it is believed that the system of fig5 further resists development of pressure sores and increases patient comfort . the humidity and temperature of the air provided to the bladder 810 may be monitored ( for example , by temperature and humidity sensors ) and controlled accordingly . this monitoring may be performed , for example , at a gas supply source ( for example , the pump 820 ) and / or within the bladder 810 . however , the gas may be cooled and / or dehumidified without sensing the temperature and humidity of the gas ( for example , to simply the system and control thereof ). as explained above , the system of fig5 may be used with any expandable bladder system described herein , including , for example , the expandable bladders 210 a , 210 b , 210 c , 210 d , the components as described in the &# 39 ; 219 patent , ( such as channels 335 and pressure relievers 346 shown in fig1 ), and / or the vascular compression bladder 510 . although the present invention has been described with reference to particular examples and exemplary embodiments , the foregoing description is not limiting . moreover , the apparatus , method , and system described herein may be used in any appropriate combination . | 0 |
referring now to the drawings , there is disclosed a toy object 50 in the form of a submarine comprised of a first member 51 and a second member 52 frictionally joined together to form the submarine body 70 . the toy 50 is provided with a simulated conning tower 55 having periscopes 56 extending upwardly therefrom . diving planes 57 and 58 extend outwardly from each of the members 51 and 52 respectively and are angularly disposed with respect to the horizontal such that forward movement of the submarine 50 through the water causes the submarine to nose down and dive . propulsion of the toy submarine 50 through the water is provided by rotation of a propeller 60 connected to motor mechanism 61 housed within the submarine and particularly the body 70 formed by the members 51 and 52 . normally , the toy submarine 50 floats in the water with only the conning tower 55 extending out of the water , but when the propeller 60 rotates , the toy submarine dives or submerges and is propelled forwardly totally underneath the water until such time as the propeller 60 ceases to rotate , whereupon the toy submarine rises through the water until once again it resumes its static position wherein the conning tower 55 extends out of the water . this action is provided in part by the coaction of a ballast chamber 63 formed by the two members 51 and 52 and a buoyant air chamber 64 also formed by the coaction of the members 51 and 52 , as will hereinafter be set forth . the members 51 and 52 snap fit together to form a body or hull 70 which includes the conning tower 55 and all other portions hereinbefore set forth . referring now to fig3 there is the &# 34 ; inside &# 34 ; of the member 51 having a bow area 71 and a stern area 73 with the bow area being provided with spaced apart apertures 72 and the stern area being provided with outwardly extending fins 74 which in use are vertically oriented and an outwardly extending fin 75 which in use is horizontally oriented . the rear of the member 51 is formed into a bearing 76 having a half collar 77 outwardly thereof , the bearing and collar forming an enlarged and smooth arcuate surface for a purpose hereinafter set forth . spaced apart apertures 78 are provided in the stern area of the member 51 , and one aperture 89 is formed in each fin 74 . the member 51 is provided with a conning tower area 82 including the upstanding walls 84 and a plurality of apertures 83 positioned near the base of the conning tower area , that is near the juncture of the conning tower and the body or hull 70 . the member 51 contributes a portion of the buoyant air chamber 64 which is defined by an air chamber outer wall 85 being formed of two arcuate end portions 86 interconnected by straight upstanding body portions 87 . as best seen in fig5 the wall 85 extends outwardly beyond the rim of the body member 51 and particularly outwardly beyond the conning tower portion 82 thereof . a plurality of alignment members 90 are positioned on the inner surface of the member 51 and extend outwardly therefrom beyond the peripheral edge of the member . a post 92 having a forwardly extending bevel centering guide 93 connected thereto is attached to the body member 51 as at 94 , the post 92 , the guide 93 and the body member 51 preferably being an integral one - piece molded unit . this is also true with respect to the entire member 51 described including the conning tower area 82 and the air chamber outer wall 85 , all of which is a single integral one - piece , molded in one shot , synthetic organic resin . referring now to fig4 the member 52 is illustrated and includes a bow area 101 and a stern area 103 , the bow area being provided with a plurality of apertures 102 and the stern area being provided with upstanding vertical fins 104 and complimentary in size and shape to the fins 74 and a single horizontally extending fin 105 complimentary in size and shape and location to the fin 75 . a bearing seat 106 is provided at the rear most end of the member 52 and serves with the bearings 76 and the half collar 77 to provide a smooth bearing surface for the motor mechanism 61 , as will be explained . a plurality of apertures 108 are provided in the stern area 103 corresponding in number and location substantially to those apertures 78 in the member 51 . a conning toward area 112 is provided in the member 52 located in registry with the conning tower area 82 of the member 51 . it is herein noted that the two members 51 and 52 snap fit together , and therefore , the peripheral dimensions of the two members 51 and 52 must be complimentary such that when fitted together a smooth body or hull 70 is provided . apertures 113 are provided in the conning tower area in registry with the apertures 83 . an air chamber inner wall 115 extends outwardly from the inner surface of the member 52 and extends beyond the peripheral edge of the body member 52 ( see fig5 ) and is formed of two spaced apart arcuate end portions 116 interconnected by straight wall portions 117 . the air chamber inner wall 115 is dimensioned to fit snugly within the air chamber outer wall 85 and frictionally to engage the inner surface of the outer wall 85 thereby to provide a water tight buoyant air chamber 64 . apertures 120 in the edge of the body member 52 cooperate with like apertures in the edge of the body member 51 to provide a plurality of spaced circular apertures 122 along the juncture of the members 51 and 52 . two posts 121 extend outwardly from the inner surface of the fins 104 , which posts are dimensioned to fit securely within the apertures 89 in the fins 74 thereby to ensure frictional engagement of the members 51 and 52 . near the forward end or bow area of the member 52 , there is a sheath 125 dimensioned to receive therein the post 92 , the sheath having a second band centering guide 126 extending forwardly thereof and attached to the member 52 as at 128 . it is preferred that the sheath , the guide 126 and the attachment means 128 be integrally molded with the member 52 . the motor mechanism 61 includes an elongated shaft 130 having an eye 131 with an opening 132 formed at one end thereof and a knurled portion 133 at the other end thereof . a propeller collar 135 at the juncture of the propeller 60 and the shaft 130 provides strength and acts as a positioner for the propeller . a flange 136 spaced inwardly from the propeller 60 serves to prevent the shaft 130 from being pulled too far out of the assembled hull or body 70 , and hence , is also a positioner in the same fashion as the collar 135 . a rubberband or other elastic member 140 interconnects the post 92 and sheath 125 with the shaft 130 and particularly the eye 131 , the rubberband serving as energy storing device . the members 51 and 52 as well as the shaft 130 and propeller 60 are integrally molded in one - piece and are interconnected by a series of links ( not shown ). when the members 51 and 52 are severed from the connecting links , the rubberband 140 which is provided separately is positioned as shown in fig3 between the band centering guides 93 and 126 to be in contact with the post 92 and the distal end of the sheath 125 . thereafter , the members 51 and 52 are aligned in registry and snap fitted together with the post 92 and sheath 125 as well as the posts 121 serving to maintain the two members together to form the hull or body 70 and to maintain the shaft 130 in the completed bearing formed by the members 76 and 106 . during the snap fit of the members 51 and 52 , air is trapped within the chamber 64 formed by the frictional engagement of the inner wall 115 and the outer wall 85 , thereby to provide the buoyant air chamber 64 . the ballast chamber 63 is formed by the members 51 and 52 and when the toy 50 is introduced into the water , water immediately fills the ballast chamber 63 through the various apertures therein with the apertures on the top of the toy 50 allowing air to escape easily thereby facilitating the rapid filling of the ballast chamber . in a static condition , the toy 50 floats in the water with principally only the conning tower 55 extending outwardly . potential energy is stored in the elastic member or rubberband 140 by rotating the knurled end 133 of the shaft 130 . after sufficient energy has been stored in the member 140 , the shaft 130 is released and the conversion of the potential energy stored in the rubberband to kinetic energy results in rotation of the propeller 60 causing the toy object 50 to move forwardly in the water . due to the angle of the diving planes 57 and 58 , forward movement of the toy object or submarine 50 causes the bow portion thereof to nose downwardly and continued forward movement causes the submarine to dive or submerge . after the energy in the rubberband 140 has been exhausted , and the propeller 60 ceases to rotate , the submarine 50 once again rises to the surface of the water to resume its static or at rest condition . the knurled end 133 of the shaft 130 provides easy operation of the motor mechanism 61 and the smooth bearing surfaces formed by the bearing 76 and the bearing seat 106 combine to provide smooth operation of the shaft 130 . the static condition or level of the submarine 50 in the water is determined by the weight of the material in the submarine 50 as well as the size of the buoyant air chamber 64 . it is imperative to the operation of the toy 50 that the air of buoyant air chamber 64 remain water tight no matter how rough the toy is handled . accordingly , the outer and inner walls 85 and 115 respectively , overlap to a considerable extent and in each case the walls extend beyond the associated member 51 and 52 respectively . it is this overlapping configuration in combination with the friction fitting of the members 51 and 52 that ensures the watertight nature of the chamber 64 . another feature of the present invention is the fact that each member 51 and 52 coacts to form both the ballast chamber 63 and the buoyant air chamber 64 . further , each of the members 51 and 52 coact to form an improved bearing surface for the shaft 130 , thereby providing improved rotation of the propeller 60 and hence , improved operation of the entire toy 50 . a still further feature of the present invention is the knurled end 133 of the shaft 130 which extend beyond the propeller 60 outside of the hull or body 70 enabling potential energy to be stored in the motor mechanism 61 relatively easily , and provides a great improvement over the prior art device . a still further feature of the present invention is the improved connection for the energy storage or rubberband 140 at the forward end of the submarine comprised of the post and sheath 92 and 125 which ensures that the motor mechanism 61 is centrally retained during operation of the submarine 50 preventing canting of the propeller 60 during operation . another important feature of the present invention , particularly with respect to its use as a premium toy , is the fact that the entire construction with the exception of the rubberband 140 is made from the same synthetic organic resin as one - piece in a single shot , which resin is preferably high impact polystyrene . it is not necessary that the resin be limited to polystyrene or that the entire construction be made in a single shot , however , the preferred resin and method greatly reduces the production costs and enables the entire construction to be used as a premium . while there has been illustrated what at present is considered to be the preferred embodiment of the present invention , and particularly the embodiment wherein the object is a simulated submarine , it is obvious that various modifications and alterations may be made therein without departing from the true spirit and scope of the present invention and it is intended to cover in the appended claims all such variations and modifications thereof . | 0 |
the essence of the present invention is the provision of a series of gas - separation membrane modules which are tailored and arranged so as to remove different components of a feed gas stream , in an efficient manner , and in a continuous fashion . in particular , each membrane module in the series is chosen according to the specific composition of the feed gas for that module , and what is expected to comprise the product gas of that module . in the present invention , no single membrane module is used to do every task . instead , the gas - separation process is broken into smaller steps , each performed by a different membrane module which is best suited to the immediate sub - task . fig1 illustrates a first embodiment of the present invention . a feed gas enters at conduit 10 , and is conveyed into dehydration module 1 . the dehydration module comprises a membrane for removing water vapor , but has little or no effectiveness in removing the component gases or contaminants . the dehydration module comprises hollow polymeric fibers , preferably polymers prepared by poly - condensation polymerization such as polycarbonate , polyester , polyether , polyimide , or polyamide , or , most preferably , polyether fibers such as polysulfone . the product of module 1 is then directed into module 2 , which comprises a membrane which removes some of the carbon dioxide , or carbon dioxide and water vapor , from the stream . the membrane in module 2 is chosen such that it will remove some , but not all , of the carbon dioxide in the stream . removal of too much carbon dioxide , at this stage , would be disadvantageous , because it would increase the concentration of heavier hydrocarbons to the point that such hydrocarbons would condense and degrade the membrane . such condensation would reduce the efficiency and / or durability of the membrane . the material used for the membrane in module 2 may include polymeric hollow fibers , preferably polymers prepared by poly - condensation polymerization such as polycarbonate , polyester , polyether , polyimide , or polyamide , most preferably polyether fibers such as polycarbonate , even more preferably polycarbonate fiber prepared from tetrabromobisphenol a polycarbonate ( tbba ). these membranes have a high permselectivity for carbon dioxide and water vapor over hydrocarbons , but a relatively low tolerance for condensing hydrocarbons . the stream then passes into module 3 , which will provide for the additional removal of carbon dioxide from light hydrocarbons ( c1 - c4 ) while tolerating and removing condensable hydrocarbons such as pentane , hexane , heptanes , octane , nonane , and decane , as well as c11 - c20 hydrocarbons as they concentrate up in the feed gas to the point of saturation . this module can be called a c5 + module . it will remove the condensable higher hydrocarbons while concentrating the c1 - c4 hydrocarbons through the continued removal of carbon dioxide . the c5 + module comprises polymeric hollow fibers , with the fiber being chosen from cellulosic polymers , the most preferable fiber comprising cellulose triacetate fibers ( cta ). while this type of membrane does not have as high a permselectivity for carbon dioxide over hydrocarbons as the previous module , it can tolerate and drain off condensed hydrocarbons from the feed stream . the product of module 3 is directed through conduit 20 . in the example wherein the feed gas is natural gas from a well , this product gas comprises mainly methane , and the product gas is relatively free of water vapor , carbon dioxide , and heavy hydrocarbons . each module can be fed from either the bore side or the shell side . each module can be placed in a sequential position such that it will provide the greatest efficiency for the process . water vapor may be more desirably removed first , while the condensable hydrocarbons may be removed next , and the gas separation process would be the last operation . in summary , the present invention is based on the fact that a single membrane will have advantages and disadvantages with respect to each of the different gases passing through it . for example , a membrane which is very good at selecting for carbon dioxide is also likely to be degraded by condensation of heavy hydrocarbons . thus , the invention comprises breaking the gas - separation process into “ bite sized ” pieces , and to require each module to do only that to which it is best suited . thus , in the example described herein , the first stage removes mainly water vapor , but not carbon dioxide or heavier hydrocarbons . the second stage has good selectivity for carbon dioxide ( sometimes called the “ fast ” gas ), so its job is to remove some ( but not all ) carbon dioxide while allowing other hydrocarbons to pass through . the third stage removes most of the remaining carbon dioxide , using a membrane which does not degrade when some of the heavier hydrocarbons liquefy . but the selectivity of the third stage for carbon dioxide is not as good as that of the second stage membrane . but by the time the gas stream has reached the third stage , much of the carbon dioxide has already been removed . in an alternative embodiment , the same process can be practiced with a single unit which effectively combines the functions of the three modules of fig1 in one housing . fig2 shows this alternative arrangement . in fig2 , each type of polymeric fiber is woven into a mat , and the mats of fibers are arranged around a core tube in the most preferential order . in effect , each mat comprises the fibers of a different membrane module , and the three modules are arranged concentrically . thus , the modules each have a generally annular cross - section . in the preferred embodiment , the feed gas can enter from the shell side , and the product can be extracted from the core tube . however , the same arrangement could be configured to operate with a bore - side feed . fig2 represents the case of shell - side feed . in fig2 , the various types of fiber are illustrated symbolically , through the use of different cross - hatchings . in reality , the fibers are tiny , and not readily illustrated . in the embodiment of fig2 , the feed gas is directed through port 21 , into dehydration fiber 22 , which is arranged concentrically around core tube 23 . the feed gas is at a relatively high pressure , and it therefore quickly becomes distributed along the entire length of the fiber . water vapor preferentially passes into the bore of the fiber , and escapes at either end of the fiber as permeate . the remaining components of the feed gas , such as carbon dioxide and other hydrocarbons , comprise the retentate stream , which is held within the outer casing 24 by o - rings 25 . next , the retentate gas ( the product stream of the dehydration module ) passes to the second stage , which comprises permselective fiber 26 , which is immediately adjacent to the dehydration fiber , and closer to the core tube 23 . the permselective fiber is the fiber having high selectivity for carbon dioxide ( the fast gas ) and light hydrocarbons . the carbon dioxide preferentially permeates the fiber , and is removed as waste . the product stream of the second stage is the retentate gas . the retentate gas of the second stage then passes into the third stage , which is hydrocarbon fiber 27 , located closest to the central core . fiber 27 is the fiber which is tolerant of condensable hydrocarbons having molecular weight of c5 and above . for this third stage , the permeate includes some carbon dioxide and some hydrocarbons . the retentate will include some liquid in the gas stream , but , as explained above , this liquid will not degrade the membrane of this stage . the retentate is withdrawn as the final product stream . in fig2 , the ports labeled “ permeate ” are connected to all of the modules , so that the permeate gases from each stage are ducted into the same channel . it is the retentate gas , which has not permeated any of the fibers of any of the modules , that is extracted as the final product gas . although the invention has been described with respect to a specific composition of feed gas , it should be understood that the invention can be applied to other feed gases having different compositions . in general , the choice of materials for the membranes may be different for different compositions of feed gas . the essence of the present invention is that it provides separate modules , tailored for specific feed and product gases , wherein each module is thereby optimized for its specific sub - task . the invention can therefore be modified in ways that will be apparent to those skilled in the art . such modifications should be deemed within the spirit and scope of the following claims . | 1 |
the embodiments disclosed below are not intended to be exhaustive or to limit the invention to the precise forms disclosed in the following detailed description . rather , the embodiments are chosen and described so that others skilled in the art may utilize their teachings . for example , while the following description refers primarily to uvs , certain features described herein may be applied to other applications such as atvs , snowmobiles , motorcycles , mopeds , etc . with reference first to fig1 - 6 , the vehicle of the present disclosure will be described . the vehicle is shown generally at 10 and is commonly referred to as an all terrain vehicle ( atv ), a side - by - side vehicle ( s × s ) or a utility vehicle . as shown , vehicle 10 generally comprises a frame 12 ( fig2 ) supported by ground engaging members 14 and 16 . as shown in this disclosure , ground engaging members 14 and 16 are comprised of wheels 18 and tires 20 ; and wheels 22 and tires 24 . vehicle 10 further comprises a drivetrain 30 ( fig2 ) operatively connected to frame 12 and drivingly connected to one or more of the ground engaging members 14 , 16 . in the present disclosure , the drivetrain 30 is comprised of a fuel - burning engine and transmission combination , together with a driveshaft extending between the drivetrain and the front ground engaging members 14 . in one embodiment , the transmission includes a continuously variable transmission . one or more of the ground engaging members 14 , 16 are operably coupled to the fuel - burning engine through the continuously variable transmission . however , any drivetrain could be contemplated such as hybrid , fuel cell or electric . the drivetrain 30 , the front and rear suspension assemblies , and steering assemblies are more thoroughly described in our pending applications ser . nos . 11 / 494 , 891 filed jul . 28 , 2006 and 11 / 494 , 890 filed jul . 28 , 2006 , the subject matter of which is incorporated herein by reference . as shown in fig1 and 2 , vehicle 10 further includes a body portion or chassis shown generally at 40 to include a hood 42 , front fender 44 , dash 46 , sideboard 48 , front floorboard 50 , rear sideboard 52 , rear floorboard 54 and rear cargo area 56 . as also shown , vehicle 10 is comprised of two seating areas , namely a front seating area 60 and a rear seating area 62 where front seating area 60 is comprised of side - by - side seats , shown as bucket seats 64 ; and rear seating area 62 is comprised of side - by - side seats , shown as bucket seats 66 . as shown best in fig3 , front seats include a seat bottom 64 a and a seat back 64 b , while rear seat 66 includes a seat bottom 66 a and a seat back 66 b . vehicle 10 also includes a roll cage 70 comprised of a front section 72 , a center section 74 , and a rear section 76 , where the front 72 , center 74 and rear 76 sections are attached to each other and to frame 12 as more fully described herein . with respect now to fig7 - 12 , frame 12 will be described in greater detail . frame 12 is generally comprised of a main frame section 80 and a front frame section 82 , where the two sections are interconnected by way of couplers 84 . with reference first to fig9 and 10 , the main frame section 80 is generally comprised of two longitudinal frame rails 90 interconnected by a plurality of struts such as 92 , 94 , 96 attaching frame rails 90 together in a predefined spaced - apart relation . main frame section 80 also comprises a drivetrain mounting section 102 extending at a rear portion of main frame 80 . with respect now to fig1 , frame 80 also defines front seat support platform 110 and rear seat support platform 112 . front seat support platform 110 includes a transversely extending tube 114 having legs 116 attached to outer frame rail 118 and inner legs 120 directly attached to frame tubes 90 . frame tube 114 spans the distance across frame rails 118 and the frame tubes 90 . with reference still to fig1 , frame tubes 114 include a latch hook 122 as described further herein . front seat support platform 110 further includes a transverse frame member 124 which as best shown in fig9 is attached to roll cage center section 74 as further described herein . frame tube 124 includes latching pins 126 for inter - engagement with seats 64 . with reference still to fig1 , rear seat support platform 112 is comprised of frame tubes 130 which provide an elevated platform for transverse frame tubes 132 and 134 . frame tubes 132 have latch hooks 136 ( similar in nature to latch hooks 122 ) and frame tube 134 has latching pins 138 ( similar to latching pins 126 ). with respect still to fig1 , main frame member 80 further includes roll cage mounting sections 150 and 152 . as shown , mounting section 150 includes a plate 154 on each side spanning tube 90 and frame rail 118 . mounting section 152 is provided by a plate 156 provided on frame tube 158 which spans uprights 160 of frame rail 118 . with respect now to fig1 , front frame member 82 will be described in greater detail . front frame member 82 includes frame tubes 170 which complement frame tubes 90 , and are held in a fixed relation by tubes 172 , 174 . frame rails 178 are fixed in relation to frame tubes 170 by way of a strut 180 . front frame 82 further comprises front roll cage mounting sections 182 comprising plates 184 positioned between cross tubes 186 , 188 , and elevated by way of uprights 192 , 194 . as described , frame 80 is comprised of main frame member 90 and front frame member 82 . splitting the frame into two separate modular subassemblies allows for easier processing of the entire vehicle 10 . due to the load on the frame tubes 90 , 170 , the connection provided by coupler 84 takes place at a longitudinal position from either end of the frame 80 , within a distance from the end , of approximately 30 % of the length of frame 80 . the coupler 84 could also be placed at the rear of frame tubes 90 . with reference now to fig1 , frame tube coupler 84 is shown poised for receipt within frame tubes 90 , 170 . as shown , coupler 84 is comprised of individual coupler members 200 . the coupler members 200 are identical , and each comprises a tube connecting section 202 and an alignment or interengaging section 204 . the interengaging sections 204 include interengaging elements , shown here as projections 206 and recesses 208 . projections 206 are shown as frusto - conical in shape , and recesses have a complementary frusto - conical recessed configuration . the interengaging sections 204 further comprise apertures 216 which self align with apertures 216 in the opposite interengaging section 204 when complementary projections 206 and recesses 208 align . as also shown in fig1 , tube connecting sections 202 include legs 210 and stand - offs 212 . finally , a connecting bracket 220 is provided for connecting frame rails 118 and 178 . to connect main frame member 80 and front frame member 82 , the individual coupler members 200 are each inserted into respective ends of the frame tubes 90 , 170 until such time as stand - offs 212 abut an end edge of the frame tubes 90 , 170 . stand - off 212 leaves a weld gap for welding the individual couplers 200 to the frame tubes 90 , 170 . the individual couplers 200 are shown welded in place to respective frame tubes 90 , 170 in fig1 and 11 . coupler 84 allows alignment of frame tubes 90 and 170 as individual couplers 200 are each aligned with respective frame tubes 90 , 170 and individual couplers 200 are alignable to each other . couplers 84 also allow alignment of frame tubes 90 , 170 when the main frame 80 and front frame 82 are not themselves perfectly aligned . that is , once individual coupler members are close to alignment , fasteners ( not shown ) are positioned into and through complementary apertures 216 , whereby the fasteners may be drawn tight until the projections and recesses are in engagement with each other . this aligns the tubes 90 , 170 . at the same time , any shear forces on the coupler 84 is taken up through the projections and recesses , not through the fasteners . with respect now to fig1 , roll cage 70 is shown comprised of front 72 , center 74 and rear 76 roll cage sections ; and are shown connected at connection joints 230 and 232 . such joints are known in the industry . front roll cage section 72 is comprised of uprights 234 , transverse sections 236 , and longitudinally extending sections 238 . mounts 240 are provided at the front and extend from uprights 234 . it should be appreciated that mounts 240 cooperate with mounting sections 182 ( fig1 ) by way of fasteners ( not shown ). center roll cage section 74 is comprised of uprights 246 , transverse section 248 and longitudinally extending sections 250 . mounts 252 are provided at the lower end of upright 246 and is comprised of stand - offs 254 and mounting brackets 256 . it should be appreciated that mounting brackets 256 cooperate with mounting section 150 ( fig1 ) by way of fasteners ( not shown ). rear roll cage section 76 is comprised of uprights 260 , transverse section 262 , and longitudinally extending section 264 . mounts 268 are provided at the lower end of uprights 260 which cooperate with mounting sections 152 ( fig1 ). roll cage assembly 70 comprises ergonomic features for the driver and passengers . first , supports 276 are provided on uprights 246 extending forwardly . these supports are positioned adjacent to seats 64 , as shown in fig1 and 2 , and enclose the driver and front passenger . second , supports 280 are provided between uprights 246 and 260 , and include an upper portion 282 , lower portion 284 and transition portion 286 . as shown in fig1 , support 280 is shown in position where lower portion extends across the entry spaced above floorboard 54 . transition section 286 and upper portion 282 extend across the seat 66 and enclose the rear passengers . finally , rear passenger hand bar 290 extends between uprights 246 , and as best shown in fig1 , extends behind front seats 64 , as described below . as shown in fig1 , rear seat bottoms 66 a are shown elevated relative to front seat bottoms 64 a . thus the rear passenger hand bar 290 , which extends behind front seat backs 64 b is positioned at shoulder height relative to the persons in front seats 64 . as shown best in fig1 , seat belt retractor 300 is positioned on hand bar 290 , and is attached to bracket 302 which is connected between hand bar 290 and upright 246 . this places the seat belt retractor 300 in a convenient location for those in front seats 64 , yet keeps the retractor away from the rear passengers . vehicle 10 is also ergonomically designed for the rear passenger &# 39 ; s riding experience . for example , and with respect still to fig1 , uprights 246 are shown flaring outwardly . for example , uprights at the frame are spaced apart by a dimension of d 1 but extend upwardly to a dimension of d 2 which is larger than d 1 . this provides a spacing at 310 between uprights and seat backs 64 b providing extra room for the passenger &# 39 ; s knees . the vehicle design also provides easy ingress and egress . as shown best in fig1 , the driver and front passenger may easily enter vehicle 10 without contacting longitudinally extending sections 238 . this is due to the fact that the distance ( d 6 ) between sections 238 is less than the extreme position adjacent the top of uprights 234 ( d 5 ) and is less than the distance between the extreme position adjacent the top of uprights 246 ( d 4 ). this insetting of longitudinally extending sections 238 provides easy ingress . in a like manner relating to the rear passengers , and as best shown in fig4 , 6 and 14 , longitudinally extending section 264 are inset from extreme positions of both uprights 246 and 260 , that is d 6 is less than both d 2 and d 7 ( fig4 and 6 ). this provides easy ingress for rear passengers . the design also provides an enhanced ride for the rear passenger . due to the elevated rear seats 66 , the rear passengers can view over the top of the front seats 64 . as shown best in fig7 , the elevation of the seats is such that the hip pivot axis ( h - point ) of the rear passenger ( h 2 ) is higher than the h - point of the driver ( h 1 ). also , for ride purposes , the h - point of the rear passenger ( h 2 ) is positioned either over , or forward of , the centerline of the rear axle . as shown best in fig7 , h 2 and the axle centerline are spaced apart by a distance d 8 . also , in order to enhance the ride of the rear passenger , as well as keep the center of gravity low , a seating position 310 of the rear passenger is positioned lower than a top 320 of the engine 322 . the seating position is the location on the seat having the highest distribution of load from the passenger while idle . this area is normally substantially adjacent to an intersecting line through the torso of the passenger and the seat bottom 66 a . in the illustrated embodiment of fig7 , this distance is shown as d 9 . finally , seating position 310 is also forward of , a forward most point 330 of engine 322 , and as shown best in fig7 , this distance is depicted as d 10 . it should be appreciated that the seating positions could also be lower than the highest point 320 of engine 322 and behind the forward most point 330 , if the seats laterally straddled the engine 322 . with respect now to fig1 , the vehicle 10 provides enhanced serviceability and functionality . as shown , each seat 64 , 66 may be removed . the seat 64 is shown having a lower base 350 having locking feet 352 receivable under latch hook 122 and a latch 354 which is receivable over latching pin 126 . latch release 356 releases latch 354 from the latch - locked condition . latch 354 is substantially similar to the latch shown in pending u . s . application ser . no . 12 / 246 , 948 filed oct . 7 , 2008 ( this is the x2 seat ). this provides access to a battery ( not shown ) in battery box 360 . also as transverse tube 124 is bolted to stand - offs 254 ( fig9 ), removal of tube 124 allows the molded covering 360 to be easily removed . it should be appreciated that one or more of the rear seats 66 may be removed in an identical manner to that described with respect to front seats 64 . removing one or more of the rear seats may be desired if extra storage space is required and the space is not required for a rider . also , accessory mounts could be provided ( having a similar construction and footprint to that of seat base 350 ) and snapped in place in one or both seat positions . for example , such accessories could include coolers , tool boxes , trunks , water tanks , fuel containers , camping / fishing gear , a dog crate / kennel , and the like . this enhances the functionality of vehicle 10 . while this invention has been described as having an exemplary design , the present invention may be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the invention using its general principles . further , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains . | 8 |
fig7 and 8 show an intraocular lens comprising the lens proper ( the “ optic ”) 50 and a pair of haptics 52 . the optic is a lamina , i . e . roughly plate - shaped , so that its diameter ( assuming a circular profile ) is much greater than its thickness , especially at the edges . extending from each haptic at a point part - way along its length is a lug 54 . the lugs are configured in this example as shown in , e . g ., fig9 ( a ) and have a neck 56 and a head 58 and are of one piece with the respective haptics . the lugs extend in a direction substantially perpendicular to the plane 53 of the lamina . in one example of its use , the lens is inserted into the capsule of the eye through a capsulotomy previous made in the eye and is secured to the capsule by inserting each lug through a void made in the capsule by suitable means . in this respect convenient use can be made of the modern femtosecond pulsed laser technique , which enables voids of very accurate size and location to be made in the capsule by laser - pulse photoablation along a predetermined boundary . this means that the lens can be produced as a standard item with the lugs 54 disposed at a standard distance apart from each other and from the optical centre of the optic , leaving it up to the surgeon to form voids of the correct location and size in the capsule to suit this standard distance . the head 58 of the lugs is preferably , but not necessarily , mushroom - shaped ( see fig9 ( a )), which facilitates the insertion of the lug into the void made in the capsule . by contrast the surface 60 of the head behind the mushroom surface is desirably linear , to discourage the lug from coming out of the void of its own accord . thus , the void will normally be a through - hole of a diameter approximately equal to that of the neck of the lug . in addition , the neck of the lug will normally be of a length approximately the same as , but preferably somewhat greater than the anticipated thickness of the capsule wall ( which is approximately 20 micrometers ). a typical range of values for the length of the neck is 30 to 50 micrometers and for the diameter of the neck is 100 to 500 micrometers . the profile of the lugs may be other than mushroom - shaped , provided it allows relatively easy insertion of the lugs into the voids in the capsule wall . thus , the lug may have a “ t ”- shaped cross - section , as shown in fig9 ( b ). a preferred variant of this “ t ” profile is fig9 ( c ), in which the outer edge is chamfered , making it easier to insert . also , while the inclusion of a head is to be preferred , for the reason given in the preceding paragraph , it is not absolutely essential . thus , the invention also envisages the use of a lug as shown in fig9 ( d ) or fig9 ( e ). in fig9 ( d ) the lug consists of just the neck , which has a square top . a variant of this , similar to that shown in fig9 ( c ), is a rounded - top version illustrated in fig9 ( e ). where the lug is headless , it may be expedient to ensure a fairly tight fit between the lug and the capsule void , in order to discourage migration of the implant away from the capsule . as regards the profile of the lugs in plan view ( view orthogonal to the sectional view of fig9 ), this is preferably circular , though other profiles may also be suitable . a second embodiment of the implant in accordance with the invention is illustrated in fig1 and 11 . here the implant has no haptics , but consists of the optic 70 plus a peripheral section 72 , which is a simple extension of the edge of the optic 70 . the radial width of the extension will be at least sufficient to accommodate the lugs and to ensure that the voids made in the capsule are reasonably remote from the lip of the capsulotomy . four lugs 74 protrude from , and are of one piece with , the peripheral section , being substantially equidistantly spaced around the peripheral section . the lugs 74 are configured as in the first embodiment ( see fig9 ). this implant is smaller than that of the first embodiment , since no haptics are present . this means that the incision to be made in the eye , in order to introduce the implant into the eye , can be made smaller , with a smaller wound and leading to a faster recovery of the patient and less induced astigmatism . when the implant is located adjacent to the inside of a capsulotomy made in the anterior part of the capsule ( an “ anterior capsulotomy ”)— this location is called the “ bag fixated ” location — the lugs will face toward the front of the eye . this situation applies to the first embodiment , since it assumes the use of haptics , and also to the second embodiment . in addition the lugs can be placed on the posterior side of the device and be fixated in the bag using posterior facing lugs and voids in the posterior capsule . there may or may not be a posterior capsulotomy separate from the voids to receive the lugs . in addition , where the implant of the second embodiment is located adjacent to the outside of the anterior capsulotomy ( the “ sulcus fixated ” location ), the lugs will be facing toward the back of the eye . the reverse will apply where the implant is located adjacent the inside or outside of a posterior capsulotomy . examples of the above - described first and second embodiments are shown in fig1 - 19 . fig1 shows a side view of a lens without haptics located within a capsular bag . the lugs 80 are anterior - facing , i . e . facing toward the front of the eye , and are engaged with holes 82 created in the anterior wall of the bag 84 . an anterior capsulotomy 86 can also be seen . fig1 shows a front view of this arrangement , though with a somewhat wider capsulotomy 86 than that shown in fig1 . a similar configuration , but involving a lens with haptics , is shown in fig1 and 15 . the lens itself is shown in fig1 , while the lens in the bag is shown in fig1 . this time the lugs 90 are situated further away from the centre of the lens 92 and therefore engage with holes 94 located further away from the anterior capsulotomy 96 . fig1 depicts a side view of a lens 100 with haptics 102 and posterior - facing lugs 104 , which engage with holes 106 made in the posterior wall 108 of the bag . also shown is an anterior capsulotomy 110 . fig1 and 18 are top and front views , respectively , of a lens 120 located in the capsular bag 122 , in which the lens has haptics 124 and posterior - facing lugs 126 inserted into posterior capsular voids . this time a capsulotomy 128 , 130 has been made in both the anterior and posterior walls of the capsule . incidentally , fig1 shows , for clarity , a copy of fig1 , but with reduced dimensions to align with the diameter of the capsular bag shown in fig1 . finally , an example of a hapticless lens 140 having posterior - facing lugs 142 engaging posterior voids is shown in fig1 . the capsular bag has an anterior capsulotomy 144 . the use of the lugs in these two embodiments has the following advantages : the implant can be reliably and repeatedly placed at a desired position in the x - y plane vis - à - vis the capsule ; the implant can be very securely attached to the capsule ; the implant can be fixed at a desired rotational orientation , which is required where the lens has an asymmetrical optic ( e . g . where there is variable optical power in the lens or where there is a toric optic ); since the implant can be held firmly against the capsule by the lugs ( via the mushroom head ), the implant can be made to have a well defined placement in the z - direction ( see fig8 ), which enables a reliable definition of the optical power of the implant to be obtained . instead of using only one lens as an implant , it may be necessary to employ a multi - lens design . examples of such a design are illustrated and discussed in us 2003 / 0130732 mentioned earlier , the contents of which are incorporated by reference . the multiple lens form a unit and are secured to the capsule via either anterior - facing or posterior - facing lugs . alternatively , both anterior and posterior facing lugs may be provided on respective front and back lenses , these lugs engaging with voids made in the anterior and posterior walls of the lens capsule . in another example embodiment of the invention , the implant is not a lens , but a plug , blank or bung . such an implant is not required to have any refractive power , but serves merely to close a fenestration or other aperture in the capsule . an example of this is shown in fig2 . indeed , fig2 shows two examples of different diameter , depending on the size of the fenestration to be closed . it can be seen that this implant is flat and therefore has no optical power . furthermore , the lugs in this situation are not required to accurately establish the rotational position of the implant ( which would be the case with an asymmetrical lens ), but merely to secure the plug to the capsule . the plug may or may not be opaque , depending on the location of the aperture being closed . a specific example of a plug in use with a capsule is not shown in the drawings . however , a typical scenario is as shown in fig1 , in which the lens was replaced by a plug such as shown in fig2 . the lugs engage with holes in one wall of the bag and block off an opening or fenestration , which might be larger than or smaller than the capsulotomy shown as item 86 in fig1 . fenestrations that might be closed off using the plug are , for example , fenestrations introduced into the capsule in order to facilitate the entry of an instrument for evacuating the lens material . in this respect , femtosecond lasers are often used to cut the lens into very small cubes or slices , so that they can be evacuated through a small - bore instrument or cannula . the cannula can be introduced into the capsule through such a fenestration . in addition , the plug can be used to provide tectonic support , in order to keep compartments in the eye physically separate . it is also useful as a means of preventing silicone oil from moving forward into the anterior segment of the eye . the plug may also be used to close or block a capsulotomy to inhibit vitreous prolapse . although a total of two lugs are shown in some embodiments and four in others , there may be as many lugs as there are haptics in the embodiment having haptics ( there may also be fewer lugs than haptics ), and fewer than , or more than , four lugs in the second . a criterion for selecting the number of lugs is to ensure a secure fixing of the implant to the capsule . also , it should be appreciated that the haptics shown in the example embodiment are representative only , and may take many other shapes . the lugs , though shown as being unitary with the haptics or the lens extension , may instead be separate items , which are attached by suitable means to the haptics or extension in order to allow the lens optic to move or flex for accommodating lens designs . for flexible extensions a common material is silicone . the lugs may be constructed from silicone or acrylic material , as is common with current intraocular lens implants as well as other materials . similarly , while the implant , apart from the haptics , has been shown in the drawings as being essentially circular in shape , it may take any shape corresponding to the capsule opening against which it is to be located . thus , where the implant is a lens , it may be oval or elliptical in shape , for example , instead of circular . although the use of the implant of the present invention has been described in connection with cataract surgery , alternative uses are envisaged . thus , the implant can be also be employed in surgical procedures for treating myopia , hyperopia , astigmatism or presbyopia ( refractive lens exchange surgery ) or used in procedures where the natural lens is left in place and an implant lens is also inserted . the foregoing description has been given by way of example only and it will be appreciated by a person skilled in the art that modifications can be made without departing from the scope of the present invention . | 0 |
referring to fig1 and 2 , there is shown an accelerator pedal device according to the present invention . in the drawings , designated by numeral 1 is a pedal lever ( viz ., accelerator pedal proper ) which has a pad 2 mounted to a lower part thereof . as is well seen from fig2 the pedal lever 1 has at its middle part a pivot shaft 3 fixed thereto . the pivot shaft 3 is pivotally held by a support bracket 4 which is securely mounted to a pedal mount bracket 6 ( see fig1 ) secured to a dash panel 5 of an associated motor vehicle . although not shown in the drawings , bolts and nuts are used for securing the support bracket 4 to the pedal mount bracket 6 . as is seen from fig2 between the pedal lever 1 and the support bracket 4 , there is arranged a pedal return spring 7 which has a multi - turned portion spacedly received on the pivot shaft 3 . with this return spring 7 , the pedal lever 1 is biased in a counterclockwise direction in fig1 about the axis of the pivot shaft 3 , that is , in a direction to return a throttle valve ( not shown ) of an associated engine to a closed position . as is seen from fig1 to the dash panel 5 above the pedal mount bracket 6 , there is secured a stopper bracket 9 which has a lower bent wall 8 serving as a stopper . the lower bent wall 8 is equipped at its rear face with a thin shock absorbing pad 8a . the dash panel 5 and the stopper bracket 9 have aligned bores ( no numerals ) through which an accelerator cable 10 passes . the accelerator cable 10 extends to the throttle valve of the engine . designated by numeral 11 is a first auxiliary lever which has a lower end pivotally disposed about pivot shaft 3 of the pedal lever 1 . the first auxiliary lever 11 has an upper bent end 12 which is contactable with the shock absorbing pad 8a on the stopper wall 8 defined by the stopper bracket 9 . as is understood from fig2 the bent end 12 is normal to the major portion of the first auxiliary lever 11 . the bent end 12 is equipped at its rear upper face with a thin shock absorbing pad 12a . the first auxiliary lever 11 is formed at its upper rear portion with a switch actuating lug 13 which is bent normal relative to the major portion of the lever 11 , as is seen from fig2 . designated by numeral 14 is a second auxiliary lever which , similar to the first auxiliary lever 11 , has a lower end pivotally disposed about the pivot shaft 3 . the second auxiliary lever 14 has an upper bent end 15 which is contactable with the shock absorbing pad 12a of the bent end 12 of the first auxiliary lever 11 , as is understood from fig1 . the upper bent end 15 is normal to the major portion of the lever 14 . the upper bent end 15 is equipped at its rear face with a shock absorbing pad 15a . as is seen from fig1 the upper bent end 15 of the second auxiliary lever 14 has the accelerator cable 10 connected thereto through a damping bush 16 . as is seen from fig1 under a rest condition of the pedal lever 1 , an upper portion of the same is pressed against the shock absorbing pad 15a of the upper bent end 15 of the second auxiliary lever 14 . more specifically , under the rest condition of the pedal lever 1 , the upper bent end 12 of the first auxiliary lever 11 is pressed against the stopper wall 8 of the stopper bracket 9 , the upper bent end 15 of the second auxiliary lever 14 is pressed against the upper bent end 12 of the first auxiliary lever 11 and at the same time the upper portion of the pedal lever 1 is pressed against the upper bent end 15 of the second auxiliary lever 14 . these pressed conditions are induced by the work of the pedal return spring 7 . a coil spring 19 extends between the first auxiliary lever 11 and the support bracket 4 to bias the lever 11 in a counterclockwise direction in fig1 that is , in a direction to press the upper bent end 12 of the first auxiliary lever 11 against the stopper wall 8 of the stopper bracket 9 . a clutch control switch 17 is secured through bolts to the second auxiliary lever 14 in a manner to face forward toward an upper rear face of the pedal lever 1 , and a pedal depression degree sensing switch 18 is secured through bolts to the second auxiliary lever 14 in a manner to face rearward toward the switch actuating lug 13 of the first auxiliary lever 11 . retractable antenna pins of these switches 17 and 18 are denoted by numerals 17a and 18a respectively . these pins 17a and 18a are spring - biased to project outward . accordingly , when the pedal lever 1 is depressed against the biasing force of the return spring 7 , the clutch control switch 17 is actuated by the upper rear face of the pedal lever 1 and the pedal depression degree sensing switch 18 is actuated by the switch actuating lug 13 of the first auxiliary lever 11 in such a manner as will be described in detail hereinafter . it is to be noted that the engagement of the pedal lever 1 with the clutch control switch 17 , due to the depression of the pedal lever 1 , induces a clockwise pivoting of the second auxiliary lever 14 about the pivot shaft 3 in fig1 and the engagement of the switch actuating lug 13 with the pedal depression degree sensing switch 18 induces a clockwise pivoting of the first auxiliary lever 11 about the pivot shaft 3 in fig1 . the clutch control switch 17 and the pedal depression degree sensing switch 18 are each housed in a robust plastic casing . as is seen from fig1 in the rest condition of the pedal lever 1 , a small given clearance &# 34 ; a &# 34 ; is defined between the upper rear face of the pedal lever 1 and the face of the clutch control switch 17 on which the antenna pin 17a is located , and at the same time , another small given clearance &# 34 ; b &# 34 ; is defined between the face of the pedal depression degree sensing switch 18 on which the antenna pin 18a is located and the front face of the switch actuating lug 13 . it is to be noted that the clearance &# 34 ; b &# 34 ; is somewhat greater than the clearance &# 34 ; a &# 34 ;. when , in operation , the pad 2 of the pedal lever 1 is applied with an external force , the pedal lever 1 is pivoted about the axis of the pivot shaft 3 in a clockwise direction in fig1 against the biasing force of the return spring 7 . at an initial stage of this pivoting , only the pedal lever 1 is pivoted due to existence of the clearance &# 34 ; a &# 34 ;. thus , at this stage , the accelerator cable 10 fixed to the second auxiliary lever is not moved and thus opening operation of the throttle valve of the engine does not take place . when the pedal lever 1 comes to a position where the upper rear face of the pedal lever 1 pushes the antenna pin 17a of the clutch control switch 17 , the switch 17 is turned on . with this , an initial depression stroke of the pedal lever 1 is sensed and thus a corresponding signal is applied to an associated electromagnetic clutch ( not shown ) to control the same . it is to be noted that the application of such signal to the clutch takes place prior to the opening operation of the throttle valve which will be described in the following . then when the pedal lever 1 is brought into contact with the face of the clutch control switch 17 keeping the switch 17 on , the second auxiliary lever 14 is urged to pivot about the pivot shaft 3 in a clockwise direction in fig1 together with the pedal lever 1 . this clockwise pivoting of the second auxiliary lever 14 pulls the accelerator cable 10 thereby effecting the opening operation of the throttle valve of the engine . when then the second auxiliary lever 14 comes to a position where the antenna pin 18a of the pedal depression degree sensing switch 18 is pushed by the switch actuating lug 13 of the first auxiliary lever 11 , the switch 18 is turned on and thus a corresponding control signal is applied to an associated automatic transmission to control the same . then , when , due to continuous pivoting of the pedal lever 1 , the face of the pedal depression degree sensing switch 18 is brought into contact with the switch actuating lug 13 keeping the switch 18 on , the first auxiliary lever 11 is urged to pivot about the pivot shaft 13 in a clockwise direction in fig1 together with the second auxiliary lever 14 . it is to be noted that this pivoting of the first auxiliary lever 11 is carried out against the biasing force of the coil spring 19 . that is , under this condition , the pedal lever 1 , the second auxiliary lever 14 and the first auxiliary lever 11 are forced to pivot like a single unit . when now the external force is removed from the pad 2 of the pedal lever 1 , the first auxiliary lever 11 is returned due to the force of the coil spring 19 to its rest position wherein the upper bent end 12 of the lever 11 is pressed against the stopper wall 8 of the stopper bracket 9 , and at the same time , the pedal lever 1 is returned due to the force of the return spring 7 to its rest position together with the second auxiliary lever 14 . that is , during the returning movement of the pedal lever 1 , the upper front face of the lever 1 is brought into contact with the upper bent end 15 of the second auxiliary lever 14 thereby pivoting the lever 14 to its rest position . in other words , when the external force is removed from the pedal lever 1 , the pedal lever 1 , the second auxiliary lever 14 and the first auxiliary lever 11 are urged to pivot like a single unit to their rest positions as shown in fig1 due to the biasing forces of the return springs 7 and 19 . thus , during this return pivoting , the clutch control switch 17 and the pedal depression degree sensing switch 18 are turned off and the accelerator cable 10 is moved in a reversed direction thereby closing the throttle valve of the engine . as is understood from the foregoing description , in the rest condition of the accelerator pedal device of the invention , the respective upper bent ends 12 and 15 of the first and second auxiliary levers 11 and 15 are both pressed against the stopper wall 8 of the stopper bracket 9 by the upper end of the pedal lever 1 . this means that , under such rest condition , the small given clearance &# 34 ; a &# 34 ; between the pedal lever 1 and the clutch control switch 17 and the other small given clearance &# 34 ; b &# 34 ; between the pedal depression degree sensing switch 18 and the switch actuating lug 13 are kept assured or unchanged . accordingly , even when a remarkable tensile force is produced in the accelerator cable 10 , the relative positioning between the first and second auxiliary levers 11 and 14 is assuredly maintained , and thus , well - timed operations of the two switches 17 and 18 with respect to the pivoting movement of the pedal lever 1 are obtained . although , in the above , it is described that both the clutch control switch 17 and the pedal depression degree sensing switch 18 are secured to the second auxiliary lever 14 , it is possible to secure such switches 17 and 18 to counter - levers ( viz ., the pedal lever 1 and the first auxiliary lever 11 ) of the second auxiliary lever 14 . | 5 |
referring to the drawings in detail , fig1 shows pictorially the major , geographically dispersed elements that comprise the illustrative embodiment of a fully implemented system . these are , customer premises , 101 , which could number in the hundreds of thousands for a typical utility ; power plants , 102 , which could number ten or so for each utility in the pool ; each utility &# 39 ; s central computer , 103 ; each utility &# 39 ; s power pool or grid tap , 104 ; power pool central computer , 105 ; out - of - doors temperature monitors , 106 , which could number thirty or more per utility , and shared broadcast radio transmitters , 107 , which could number ten or so per utility . each customer &# 39 ; s premises contains one or more calendar - time , watt hour meters , 108 , which keep a running record of energy consumption , typically by the hour , that is correlated with calendar - time . these meters are interrogated on a monthly basis by meter reading devices , 109 , which temporarily store the running records of many meters and insert the time and date of each reading . batches of these records are periodically transferred to computer 103 through anyone of numerous telephone data terminals , 110 . a similar running record of mean hourly power supplied to the utility &# 39 ; s customers by each generator in the utility &# 39 ; s system , is retained by recording meter , 112 . the stored record of each of these meters is periodically transferred to computer 103 via telephone data terminals , 111 , along with the time and date of the readout . power pool , or grid , directional tap , 113 , feeds a sample of imported energy to calendar - time energy meter , 114 , and a sample of exported energy to meter 115 . the stored record of meter , 114 , is periodically transferred to computer 103 via telephone data terminal , 116 , where it is multiplied by a post facto price and then appropriately factored into the utility &# 39 ; s hourly energy price . the stored record of meter , 115 , is periodically transferred to grid central computer 105 via phone terminal 116a where it is processed along with estimated upcoming demand - related prices determined in computer 103 . computer 103 also determines the post facto hourly prices for energy supplied to utility customers and the hourly charges billed to each customer . each bill is a sum of the products of hourly prices and customer &# 39 ; s calendar - time kwh consumption . to this is added any bonus / surcharge distribution , which computer 103 also determines . computer 103 also prints out matrix - bill , 117 , which contains a post facto record of the customer &# 39 ; s energy consumption pattern . matrix - bill , 117 , is mailed to each customer . it serves as both a bill and an instructional guide in how and when to best use electricity to realize its lowest cost . computer 105 receives estimates of upcoming hourly prices from each utility in a power pool along with estimates of how much energy each utility has available for export in the upcoming hour . it collates and then distributes this information to each pool member where buy and sell decisions are made . computer 105 later helps settle inter - utility accounts by splitting differences between the estimated price and the post - facto computed price . index processer , 118 , receives hourly demand - related price estimates and temperature data from computer , 103 , from which it creates , via a look - up - table , two single digit index numbers , each preferably ranging between 0 and 9 , each characterizing the price and bonus / surcharge protocol that is estimated to be in effect during the hour . the numerical indices are fed to broadcast transmitter - interupt - switch , 107 , where they are stored prior to being fed in during a momentary preemption of transmitter , 107a , coinciding with a program quiet moment . these indices are received by receiver / display device , 119 , on the consumer &# 39 ; s premises , where they are stored for an hour for the purpose of creating a continuous - appearing display . receiver / display device 119 is illustrated here as being integrated into a household clock . the fully implemented system described above can also function in various partial implementations . for example , customers can be batched by their service classification with only one or two classifications connected up to the &# 34 ; free market system &# 34 ;. also a single utility can implement the system without a link to a power pool . it is also not essential to include the bonus / surcharge distribution or the matrix bill or the broadcast real time display . all of these can be gradually incorporated over time to eventually realize a fully implemented system . the post facto demand - related hourly base price charged by each utility for the energy it supplies is determined in computer 103 from software that is developed from the tep algorithm . this algorithm consists of a tefc factor in which cost and market factors are blended , a k gr multiplier which keeps monthly gross revenues fixed , a composite hourly fuel cost / kwh or fc , and a profit / kwh or p , tep = tefc ( k gr )+ fc + p tefc n is a demand modified , fixed cost price factor when n generators are on - line , simultaneously . wc n is the weighted composite cost of the n th generator p n is the mean power output of the nth generator averaged over a month where ## equ1 ## and p n is the mean power supplied by the nth generator averaged over one hour or capacity of nth generator c n is the fixed per diem cost associated with the nth generator t o is an empirically determined , fixed duration period whose least value is 24 δt n is time interval in hours when n generators are simultaneously online during t o period p 1 is the baseline generator that is online 24 hours per day an optional enhancer - multiplier can be generated to make tefc even more responsive to demand . this multiplier can take the form of p h ( t )/ p d where p h ( t ) is the mean hourly power demand of the entire system during the course of a day , and p d is the mean demand averaged over a 24 hour day . the gross revenue factor , k gr , would be generated once per extended interval of time that it is active . a sub - routine algorithm describes this factor . the algorithm is described by the following expression that is total fixed cost divided by estimated gross revenues from tefcs for the month : ## equ2 ## 30 ( c 1 + . . . + c n ) is the monthly fixed costs by generaters 1 through n ( e 1 + e 2 + . . . + e n ) is the total energy provided in time slot n the fuel cost per kwh in the entire system is a weighted composite of all individual fuel costs used during a 24 hour period which is expressed by the following algorithm : ## equ3 ## where fc n is the fuel cost per kwh used by generater n , and e n is the energy generated by generater n . pricing export power requires estimating the exporter &# 39 ; s tep for each upcoming hour . this estimate could be based on market considerations alone since this price does not have to be regulated . the export price estimate could also be based on a tep taken from a similar day and hour from a previous month of the exporter &# 39 ; s post facto demand related price ( tep ) record , modified by a demand / price multiplier . this multiplier activates a price surge that must occur if demand approaches generating capacity . the importer &# 39 ; s price , p im , could then be expressed as : ## equ4 ## where tep exr is the exporter &# 39 ; s tep during a given hour each utility &# 39 ; s composite tep ,( or demand - related price ), is the weighted composite price of locally generated power and imported power , which can be expressed as follows : ## equ5 ## where tep c is the local , base composite price for customers e l is total locally generated energy , for the hour e im is the amount of energy imported , for the hour the actual price charged to a specific customer would be tep c multiplied by a service classification constant which is predetermined for each type of customer . the bonus / surcharge algorithm is comprised of three stages , 1 ) indentifying a specific time interval as being eligible for b / s distributions , 2 ) determining which customer is eligible for either a bonus or surcharge in any particular time increment , and 3 ) determining the amount of the bonus or surcharge attributed to each customer during any eligible time interval . stage 1 requires a criterion for establishing a particular time slot as representing an above normal demand . this is done by out - of doors temperature indications and apriori calender knowledge , like day of week and season . specific customer eligibility is determined by whether , during the apriori b / s period , that , customer uses more or less energy than a baseline amount established for that customer on a typical day . the amount of the surcharge rate per kwh would be determined by the following expression : ## equ6 ## where s s is the summer surcharge rate and s w the winter rate ; t is the actual representative out - of - doors temperature ; 80 ° and 30 ° are the threshold high demand summer and winter temperatures ; and &# 34 ; a &# 34 ; is a variable selected by each utility based on actual experience . the bonus rate per kwh is determined from the following expressions : ## equ7 ## where b s is the summer bonus rate per kwh ; r s is a quantity taken from a look up table , lut , which is illustrated by table i ; r b is the bonus version of r s as defined by the lut ; σe b is a running sum of energy - time increments that are bonus eligible and σe s is the running sum for surcharge eligible energy - increments . table i______________________________________sample lut for . sup .- r . sub . b and . sup .- r . sub . sδe / et -. 2 -. 1 0 +. 1 +. 2 t______________________________________80 °+ 1 . +. 6 +. 05 -. 6 - 1 . 30 ° 85 °+ 1 . 1 +. 7 +. 07 -. 7 - 1 . 1 20 ° 90 °+ 1 . 2 +. 8 +. 1 -. 8 - 1 . 2 10 ° 95 °+ 1 . 3 +. 9 +. 15 -. 9 - 1 . 3 0 °. sup .- r . sub . b . sup .- r . sub . s______________________________________ δe is the difference in energy consumption , during an eligible b / s time interval , between the actual energy consumed and the energy determined during a more typical day which establishes a baseline energy consumption for each customer during each time unit of that typical day . for this sample table , if the out - of - doors temperature is 90 ° f . and the energy consumption for a particular hour is 20 % above the baseline level , then r is - 1 . 2 , and elibible for a surcharge . the implementation of the tep and b / s algorithms is shown in fig2 where it is illustrated as a flow diagram indicating computer system processes . block 201 is comprised of modems , buffer memories , a data organizer , and rams , or random access memories . the input data consists of temperatures , customer energy consumption per unit time and customer id and rate categories , generator energy output per unit time and generater id , imported energy from grid per unit calender time , and the price for the imported energy per unit of calender time . the data organizer organizes the data so it fits in with common calender - time . each generator energy column includes a secondary column of 0 &# 39 ; s and 1 &# 39 ; s , where the 0 indicates zero online power during the time unit , and 1 indicates energy being supplied during that time unit . the temperature data and each customer &# 39 ; s energy consumption data is fed into block 202 where the b / s process takes place . generator energy , import energy , and grid - import price are fed into block 203 where the tep algorithm process take place . block 204 is a sequencer that steps the data through the process and determines which time interval is a b / s interval from the temperature data , clock - calender 206 information and from eprom 205 which stores holiday information for the year . block 207 receives customer - rate category and identification information from which it adds a price correction based on the customer category , i . e . residential , industrial . this information is fed along with customer id , to block 208 where the matrix - billing information is developed . this data flow into block 209 where printing occurs and then into block 210 where mail processing takes place . block 208 also receives information from the b / s and tep blocks . fig2 a illustrates how the b / s algorithm is executed through block diagram steps , as follows : the hourly temperature readings are fed into block 211 where the differences are taken from the b / s threshold temperatures stored in the block . winter and summer threshold differences are fed into block 212 along with the adjustable constant &# 34 ; a &# 34 ; from prom 213 . from this information block 212 determines the surcharge rate for each unit of time and stores that information . concurrently , the customer energy consumption is transferred to ram 214 , where that ram &# 39 ; s information is compared with the data stored in prom 215 which contains baseline energy consumption per unit time for every customer . a comparison is performed in register 216 where δe / e is computed and cross referenced with temperature in lock - up - table 217 where r is determined and fed into multiplier register 218 along with energy data from block 214 . the e · r products are fed into block 219 where q is determined . the q factor can be determined statistically or by estimating it and then making correction later , or by grinding through the sum of all bonus eligible energy units and dividing that sum by the sum of all surcharge eligible energy units . the q and s from block 212 are fed into register 220 where these factors are multiplied resulting in the bonus rate for each time unit . one output from block 220 is fed out for subsequent use in generating the matrix - bill , in this case for determining the maximum bonus any customer might be eligible for with a preferred demand pattern . blocks 212 , 218 , and 220 , feed into register 221 where the sign , + or -, associated with r determines whether the product e · r is multiplied by the bonus rate generated in block 220 or the surcharge rate determined in block 212 . the output from 221 is then fed to b / s ram 222 where it is kept until needed by billing , 209 . this output is also fed to running adder 223 whose output provides a measure of the balance that is maintained between bonuses and surcharges being accumulated by the customers . fig3 illustrates how the tep algorithm is realized as a series of steps in a computational process performed in central computer 103 . the energy supplied by each generater per unit time , e p , is fed into block 301 where tefc is computed for each time unit . the details of the tefc algorithm process is described in fig3 a . prom 302 contains the per diem fixed costs and expenses allocated to each generator slot and feeds that information , as called for , into tefc block 301 and k gr block 303 . tefc block 301 also generates e t , the total energy generated during each unit time interval by all on - line generators . this information is used by tep l block 304 and tep c block 307 . the tefc output from block 301 is fed into k gr block 303 and tep l block 304 . block 304 also receives a composite fuel cost per kwh , developed from the algorithm previously described and computed in block 305 along with a profit factor per kwh stored in block 306 . the computational process that takes place in 304 is the product of tefc and k gr summed with the fuel cost and profit factors . this sum total for every time unit is fed into tep c block 307 along with the imported energy and power grid price for that energy . the composite tep computed in this block is the energy - weighted price described earlier . the algorithm used in block 303 , where k gr is run , is σc n / σe tn · tefc m times a monthly factor 30 . fig3 a describes a shortcut method for determining tefc . e p is fed into ram 310 through processer 311 and is fed directly into ram 312 , where each column represents a generator slot and each row a unit time slot . processer 311 substitutes a 1 if any energy is generated in that generater time slot and a 0 if no energy is generated in that slot . row 313 contains the sum total of all energy generated by each generator during all the time slots that comprise a tep interval , i . e . 24 hours or 7 days . column 314 contains the sum total of the energy produced by all the on - line generaters in each time unit . divide - register 315 divides the totals stored in row 313 by the duration of the unit time interval , 314a , thereby converting that energy quantity into a mean power quantity . that quantity is again divided in register 316 by the per diem fixed cost factor c n that represents each generator slot coinciding with each column in ram 312 . this quantity is multiplied in register 317 by the 0 or 1 that is stored in each unit time line of 311 . summing register 318 adds together each of the quantities generated in a unit time row resulting in a tefc for each time unit . fig4 describes the processes that occur in billing computer 208 . the information produced here is needed to print the matrix - bill that is customer energy per unit time by a number that adjusts that quantity for its category rate factor , k cr , to reflect the relative differential that different customer categories receive , i . e . residential , industrial . the customer id include a category id which , selects the appropriate k cr quantity stored in prom 400 and multiplies each energy time unit in register 401 by that constant . the resulting products are fed to multiplication registers 402 , 403 , and 404 where the numbers are multiplied by ; qs , which develops a quantity that approximates the maximum bonus that each customer could be eligible for ; by the b / s rate to develop the actual bonus or surcharge that each customer is eligible for in any time unit ; and by tep c to develop the actual amount charged each customer for energy that has been consumed during each unit time slot . the unit time customer &# 39 ; s energy is fed directly to triple summing register 405 where daily , weekly , and monthly energy consumption for each customer is tabulated . the outputs from registers 402 , 403 , and 404 feed triple summing registers 406 , 407 , and 408 which develop the daily , weekly and monthly b max . b / s amounts being debited or credited to the bill , and the actual tep bill , respectively . the daily sums from registers 405 and 408 are fed into divide register 409 to develop a mean daily price per kwh . the monthly sum from triple summing register 408 is fed to gated summing registers 410a , 410b , & amp ; 410c . the gates are controlled by the customer category gleaned from the customer &# 39 ; s id , in which 410a might be opened for residential customers , 410b might be for industrial customers , etc . the output from each of these registers is a total monthly tep gross revenue by customer category , figures that would be useful for regulators . temperature data is fed into processer 412 where the minimum or maximum temperature for each day is determined . customer id is used to retrieve past - due information and address information using files 413 & amp ; 414 for the printer . ( appropriate c sequencing and buffer memories are implicit to this diagram .) although the matrix - bill , as described in fig7 and 7a , closes a post facto feedback loop with the customer , it would be preferable to also close a real - time loop . such a loop is described by fig5 & amp ; 6 . this loop provides economic indications directly to the consumer as described by fig5 . this figure shows ordinary clock , 500 , with two lcd numerals added to the clock face as shown . inside the clock is a small radio antenna and receiver , 501 and 502 ; a memory element , 503 ; lcd display circuitry 504 , and the lcd numerals , 505a & amp ; 505b . once each hour a digital word representing 0 through 9 , for each numeral , is broadcast for less than one second . one numeral represents the tep for that hour , with 1 indicating the lowest possible tep and 9 the highest possible tep level . the second numeral represents the level of b / s activity , with 0 representing no activity and 9 indicating maximum activity , meaning the largest possible bonuses or surcharges are being distributed . at the end of the display period , the old numerals are erased and replaced with current indicators . fig6 shows a preferred embodiment for the real time economic feedback . processer 600 receives real time information about the power each generator in the utility is supplying to the system , and about the out - of - doors temperature difference from threshold used in b / s computations . from all this information processor 600 determines two single digit numerals , one characterizing the current price and the other the b / s distribution . each level range of temperature difference corresponds to a discrete numeric characterization determined from a look up table . the real time price characterization uses a similar lookup table but needs an intermediary computation to estimate the actual real time price . the two characterizing numerals are preferably readout once each hour from processer 600 and stored in buffer memory 601 . each broadcast transmitter linked to the system is periodically dialed by dialer 602a and fed this information via modem 602 and telephone lines , to modems 603 . the two numerics are enterred into buffer memory 604 and stored until clock 605 activates switch 606 , which momentarily preempts transmitter , 607 , during quiet station times . antenna 608 broadcasts the numeric information , along with an enabling code , to all suitably equipped consumers within radio signal reception range . fig7 and 7a illustrate a version of the post facto bill . matrix 700 indicates the bonus or surcharge being credited or debited for each day in the month , along with the maximum bonus that might have been attributed to that customer if demand were restrained for that day . see box 700a . each of the boxes in fig7 , described in detail by box 701a , shows mean daily price , total daily energy consumption , and highest ( or lowest in winter ) daily temperature . each week &# 39 ; s sum and the total monthly charge is presented broken down into tep and bonus or surcharge components and totaled . | 8 |
reference will now be made in detail to a preferred embodiment of the present invention , an example of which is illustrated in the accompanying drawings . fig4 and fig1 illustrate a schematic view of the valve side of dual cam shaft arrangement and dedicated brake cam rocker for a compression release - type engine brake assembly 10 according to the present invention . the compression release engine brake components and the valve actuation components are located in rocker arms 100 , 200 , and 300 . the rocker arms 100 200 , and 300 are spaced along a common rocker shaft 11 having at least one passage . the common rocker shaft 11 has a passage 12 through which a supply of engine oil flows therethrough , as shown in fig5 . the common rocker shaft 11 also has a supply passage 13 which supplies hydraulic fluid to an exhaust rocker arm 100 and an intake rocker arm 200 . a valve 30 is located on the common rocker shaft 11 , as shown in fig5 . the valve 30 is preferably a normally open solenoid valve , as shown in fig6 . it , however , is contemplated by the inventors of the present invention that other suitable valves may be substituted and are considered to be within the scope of the present invention . the valve 30 includes a connector assembly 31 for electrically connecting the valve 30 to a vehicle voltage source , not shown . the valve 30 when in an open position permits the flow of hydraulic fluid from passage 12 to supply passage 13 . the rocker arms 100 , 200 and 300 correspond to a cam shaft 20 having three spaced cam lobes 21 , 22 , and 23 . exhaust cam lobe 21 corresponds to an exhaust rocker arm 100 . intake cam lobe 22 corresponds to an intake rocker arm 200 . brake cam lobe 23 corresponds to a brake rocker arm 300 . the exhaust cam lobe 21 and the intake cam lobe 22 are oriented and timed to effect normal valve operation , as in a typical four - stroke internal combustion engine , of the type known in the prior art . the brake cam lobe 23 includes a first compression release lobe . in a preferred embodiment , the profile of the lobe starts at about 35 °. the first compression release lobe is timed to start about 40 ° before compression top dead center ( tdc ), then reach maximum opening around compression top dead center . then start closing after compression top dead center staying partially open for a period and then closing around bottom dead center , and finish just after compression tdc . a second lobe is timed to start about 1000 after compression tdc and finish by 200 ° after compression tdc . means for effecting exhaust valve operation will now be described in connection with fig5 - 9 . the means includes an exhaust rocker arm 100 that is rotatably mounted on the common rocker shaft 11 . a first end of the exhaust rocker arm 100 includes an exhaust cam lobe follower 110 . the exhaust cam lobe follower 110 preferably includes a roller follower 111 that is in contact with the exhaust can lobe 21 . a second end of the exhaust rocker arm 100 has a lash adjuster 120 . the lash adjuster 120 is adjacent to a crosshead 130 . the lash adjuster 120 is described in detail below . the crosshead 130 is preferably a bridge device that is capable of opening two exhaust valves simultaneously . the exhaust rocker arm 100 also includes a control valve 140 that includes a spring ball assembly 141 . the control valve 140 is in communication with a fluid passageway 150 that extends through the exhaust rocker arm 100 to the lash adjuster 120 . the control valve 140 is also in communication with a fluid passageway 160 that extends between the control valve 140 and supply passage 13 of the common rocker shaft 11 . the passage 12 is connected to passage 14 which supplies hydraulic fluid to provide lubrication between the exhaust rocker arm 100 and the common rocker shaft 11 . the passage 14 also supplies lubricant through passage 15 to the exhaust cam lobe follower 110 such that the roller follower 111 smoothly follows cam 21 . means for effecting intake valve operation will now be described in connection with fig1 - 12 . the means includes an intake rocker arm 200 that is rotatably mounted on the common rocker shaft 11 . a first end of the intake rocker arm 200 may include an intake cam lobe follower , as described above in connection with exhaust rocker arm 100 . the intake cam lobe follower 210 is in contact with the intake cam lobe 22 . however , it is contemplated that other cam followers , such as , for example , a roller follower are considered to be within the scope of the present invention . a second end of the intake rocker arm 200 has a lash adjuster 220 . the lash adjuster 220 has the same design as the lash adjuster 120 described above in connection with the exhauster rocker arm 100 . the lash adjuster 220 is adjacent to a crosshead 230 . the lash adjuster 220 is described in detail below . the crosshead 230 is also preferably a bridge device that is capable of opening two intake valves simultaneously . the intake rocker arm 200 also includes a control valve 240 . the control valve 240 is in communication with a fluid passageway 250 that extends through the exhaust rocker arm 200 to the lash adjuster 220 . the control valve 240 has the same construction as the control valve 140 described above in connection with the exhaust rocker arm 100 . the control valve 240 is also in communication with a fluid passageway 260 that extends between the control valve 240 and supply passage 13 of the common rocker shaft 11 . the passage 12 is connected to passage 15 which supplies hydraulic fluid to provide lubrication between the exhaust rocker arm 200 and the common rocker shaft 11 . the passage 14 also supplies lubricant through passage 17 to the exhaust cam lobe follower 210 such that the roller follower 211 smoothly follows cam 22 . alternatively , the common rocker shaft 11 may be provided with a third passage 18 , as shown in fig1 . the third passage 18 supplies lubricant to the cam following 110 , 210 and 310 . means for effecting two cycle engine braking will now be described in connection with fig1 - 15 . the means includes a brake rocker arm 300 that is rotatably mounted on the common rocker shaft 11 . a first end of the brake rocker arm 300 includes a brake cam lobe follower 310 . the brake cam lobe follower 310 preferably includes a roller follower 311 that is in contact with the brake cam lobe 31 . a second end of the brake rocker arm 300 has an actuator piston 320 . the actuator piston 320 is spaced from the crosshead 130 of the exhaust rocker arm 100 . when activated , the brake rocker arm 300 and the actuator piston 320 contact the crosshead pin 133 of the crosshead 130 to open the at least one exhaust valve . the brake rocker arm 300 also includes a combination control valve / solenoid valve 340 . the valve 340 is in communication with a fluid passageway 350 that extends through the brake rocker arm 300 to the actuator piston 320 . the valve 340 is also in communication with a fluid passageway 360 that extends between the valve 340 and passage 12 of the common rocker shaft 11 . the valve 340 is preferably includes an electronically operated solenoid valve . the valve 340 includes a connector assembly 341 for electrically connecting the control valve to a vehicle -- which supplies voltage at the proper time . the above - described brake rocker arm 300 includes a valve 340 including a solenoid valve mounted on the rocker arm 300 . it is contemplated and preferred by the inventors of the present invention that the valve 340 may be relocated to the common rocker shaft 11 . as shown in fig1 , solenoid valve 344 is located on the common rocker shaft 11 . with this arrangement , any difficulties with electrically connecting the valve to the vehicle are avoided because the solenoid valve would not rotate with the rocker arm . the rocker arm 300 would include a control valve 342 therein similar to control valves 140 and 240 , described above . hydraulic fluid would then be fed to the rocker arm 300 through the solenoid valve 344 on the common rocker shaft 11 to the control valve on the rocker arm to operate the actuator portion 320 . as shown in fig1 , hydraulic fluid is supplied to the system 10 by a pumping assembly 7000 or other suitable assembly for supplying pressurized fluid . the pumping assembly 7000 is preferably connected to a hydraulic fluid source 8000 , such as , for example , an engine oil pan . the brake rocker arm 300 preferably interacts with a spring assembly attached to the common rocker shaft 11 . the spring assembly engages the brake rocker arm 300 to return the rocker arm 300 to a rest position when the rocker arm 300 is not in use ( i . e ., during positive power ). the lash adjuster 120 will now be described in connection with fig9 . the lash adjuster 120 is mounted in the second end of the exhaust rocker arm 100 , as shown in fig9 . the lash adjuster 120 includes an inner plunger 121 and an outer plunger 122 . the outer plunger 122 includes a ring 1221 that is positioned within groove 170 within the exhaust rocker arm 100 , as shown in fig9 . the inner plunger 121 is slidably received within the outer plunger 122 . in operation , hydraulic fluid flows into a cavity 1211 in the inner plunger 121 . as the cavity 1211 fills with fluid , the check ball valve 1213 is biased downwardly to open aperture 1210 in the inner plunger 121 . hydraulic fluid then flows into cavity 1222 in the outer plunger . as the cavity 1222 is filled with fluid , the outer piston 121 moves downward to an extended position to engage crosshead pin 130 . the downward movement of the outer piston 121 is limited by the ring 1221 engaging the lower surface of groove 170 . the lash adjuster 220 has a similar construction to the lash adjuster 120 , described above . the lash adjuster 220 includes an additional assembly to limit the upward travel of the outer plunger 222 . this expands the lash between the rocker arm 200 and the crosshead 230 . this permits the delayed opening of the intake valves when the lash adjuster 220 is in a retracted position . it , however , is contemplated by the inventors of the present invention that other suitable lash adjusters including , but not limited to , electronically operated lash adjusters and mechanically operated adjusters may be substituted for the above described hydraulic lash adjuster . these variations and modifications are considered to be within the scope of the present invention . fig3 depicts the exhaust valve opening and remaining open for optimum engine braking . fig3 begins at the tdc of the first compression stroke . additionally , the extended plateaus shown during which the exhaust valve remains open but with a reduced valve opening , permits drawing exhaust gas from the exhaust manifold into the cylinder as the piston travels away from the cylinder head . the exhaust valve closes and the entrapped exhaust gas is compressed and then released providing a second engine braking cycle . subsequently , the intake valve opens , air is drawn into the cylinder and compressed and then released providing a first engine braking cycle . subsequently , the intake valve opens , air is drawn into the cylinder and compressed repeating the two - cycle braking . the intake valve &# 39 ; s opening is modified ( from its positive power timing ) to occur after tdc of the second braking cycle to insure the compressed exhaust gas is not vented into the intake manifold . the operation of the exhaust rocker arm 100 will now be described during positive power operation . during positive power , the control valve 30 is opened . the control valve 30 is preferably a normally open three way solenoid valve . the solenoid valve 30 permits the flow of hydraulic fluid from passage 12 to supply passage 13 . fluid then flows through passageway 160 to control valve 140 . the spring ball assembly 141 of the control valve 140 is unseated to allow hydraulic fluid to flow through passageway 150 to lash adjuster 120 . the lash adjuster 120 is extended to a fully extended normal operating position such that the lash adjuster 120 is in contact with the crosshead 130 . when pressure within the control valve 140 , specifically the spring ball assembly 141 equalizes a hydraulic lock forms which allows the lash adjuster 120 to remain in an extended position . accordingly , the exhaust rocker arm 100 will activate exhaust valve openings in response to exhaust cam lobe 21 . the operation of the intake rocker arm 200 during positive power operation will now be described . as described above in connection with the exhaust rocker arm 100 , the solenoid valve 30 is in an open position . the spring ball assembly 241 of solenoid valve 30 permits the flow of hydraulic fluid from passage 12 to supply passage 13 . fluid then flows through passageway 260 to control valve 240 . the control valve 240 is unseated to allow hydraulic fluid to flow through passageway 250 to lash adjuster 220 . the lash adjuster 220 is extended to a fully extended normal operating position such that the lash adjuster 220 is in contact with the crosshead 230 . the control valve 240 operates in a similar manner to control valve 140 , described above , to form a hydraulic lock that allows the lash adjuster 220 to remain in an extended position . accordingly , the intake rocker arm 200 will actuate intake valve openings in response to intake cam lobe 22 . the operation of the brake rocker arm 300 during positive power operation will now be described . the solenoid valve 340 is closed . during positive power the solenoid valve 340 remains closed . accordingly , the actuator piston 320 remains in a seated position , as shown in fig1 and 15 . the brake rocker arm 300 will remain in a disabled position during positive power . the operation of the exhaust rocker arm 100 will now be described during an engine braking operation . during engine braking , the solenoid valve 30 is operated to stop the flow of hydraulic fluid through passage 13 . the control valve 140 is opened . this permits the hydraulic fluid trapped within passageway 150 , as described above in connection with the positive power operation to be vented . the spring ball assembly 141 prevents the additional supply of hydraulic fluid to passageway 150 . this causes the lash adjuster 120 to retract . as a result , exhaust valve openings cease during the engine braking operation . a spring , not shown , may be provided to prevent vibration and chatter of the exhaust rocker arm 100 when in the above described disabled position . the operation of the intake rocker arm 200 will now be described during an engine braking operation . during engine braking , the solenoid valve 30 is operated to stop the flow of hydraulic fluid through passage 12 , as described above . a control valve 240 is operated to vent the hydraulic fluid in a similar manner as described above in connection with the exhaust rocker arm 100 . the preset stop of the lash adjuster 220 prevents the lash adjuster 220 from fully retracting . accordingly , the intake rocker arm 200 is not fully disabled during the engine braking operation . the total cam lift of the intake cam lobe 22 is not transferred into valve lift . this has the effect of delaying the time event to occur after exhaust top dead center . the opening of the intake valve is delayed due to the partially retracted position of lash adjuster 220 . the opening is delayed until the cylinder is vented through the open exhaust valve immediately following the second compression braking cycle , as shown in fig3 . the operation of the brake rocker arm 300 during an engine braking operation will now be described . during engine braking , the solenoid valve 340 is operated . hydraulic fluid is permitted to flow from passage 12 through passageway 360 to passageway 350 . the actuator piston 320 then extends to a fully extended position such that it contacts pin 133 on crosshead 130 . when the passageway 350 is filled with hydraulic fluid and the pressure is equalized within valve 340 , a hydraulic lock is formed thus holding the actuator piston 320 in an extended position . the operation of the exhaust valve is now controlled by the brake rocker arm 300 in response to actuation by the brake cam lobe 23 . the operation of the exhaust valves will occur in response to the profile of the brake cam lobe 23 . the brake cam lobe 23 also preferably has an exhaust gas recirculation lobe that occurs after the first braking event . this exhaust gas recirculation lobe on cam profile is disposed so that exhaust gas recirculation occurs after the first braking event , as shown in fig3 . preferably , this allows the valves to remain open , which in turn allows exhaust gases to flow into the cylinder on the power stroke , charging the cylinder prior to the second braking event . the brake cam lobe 23 once again lifts the rocker arm just before exhaust top dead center , permitting a second braking event as shown in fig3 . effective two - cycle engine braking may be achieved in accordance with the present invention . the operating sequence of events will now be described . a first compression release cycle or braking event 1 is initiated just prior to compression top dead center , as shown in fig3 . the exhaust valve is then reset by partially closing the exhaust valve . the partial closing of the exhaust valve permits the recharging of the cylinder through an exhaust gas recirculation event 2 , as shown in fig3 . the exhaust valve is then completely closed at the completion of the exhaust gas recirculation event . during this engine operating sequence , the normal operation of the exhaust valve by the exhaust rocker 100 is disabled . the operation of the at least one exhaust valve is controlled by the brake rocker arm 300 . the profile of the brake cam lobe 23 initiates the first braking event 1 and causes the at least one exhaust valve to remain partially open during the exhaust gas recirculation event 2 . a second compression release cycle or braking event 3 is initiated just prior to exhaust top dead center , as shown in fig3 . the profile of the brake cam lobe 23 initiates the opening and closing of the at least one exhaust valve during the second braking event 3 . the opening event 4 of the at least one intake valve is delayed past the exhaust top dead center , as shown in fig3 . the delayed intake valve opening prevents the valve to open when high cylinder pressure is present . continuing with the embodiments in the accompanying figures , fig1 is an alternative embodiment for the means for effecting exhaust valve operation . the exhaust rocker arm 1000 is rotatably mounted on the common rocker shaft 11 . a first end of the exhaust rocker arm 1000 includes an exhaust cam lobe follower 110 . a second end of the exhaust rocker arm 1000 has a lash adjuster 120 . the lash adjuster 120 is connected adjacent to a crosshead 130 . the crosshead 130 is preferably a bridge device that is capable of opening two valves simultaneously . the exhaust rocker arm 1000 also includes a solenoid valve 1400 . the solenoid control valve 1400 is in communication with a fluid passageway 150 that extends through the exhaust rocker arm 100 to the lash adjuster 120 . the solenoid control valve 1400 is also in communication with a fluid passageway 160 that extends between the solenoid valve 140 and supply passage 13 of the common rocker shaft 11 . the solenoid valve 1400 combines the valve 30 and the solenoid valve 140 into a single assembly . fig1 is an alternative embodiment for the means for effecting intake valve operation . the intake rocker arm 2000 is rotatably mounted on the common rocker shaft 11 . a second end of the intake rocker arm 2000 has a lash adjuster 220 . the intake rocker arm 2000 also includes a solenoid valve 2400 . the solenoid valve 2400 is in communication with a fluid passageway 250 that extends through the exhaust rocker arm 2000 to the lash adjuster 220 . the solenoid valve 2400 has the same construction as the solenoid valve 1400 described above in connection with the exhaust rocker arm 1000 . the intake rocker arm 2000 and the exhaust rocker arm 1000 operate in substantially the same manner as the intake rocker arm 200 and the exhaust rocker arm 100 . in this embodiment , the solenoid valve 30 is eliminated . it will be apparent to those skilled in the arts that various modifications and variations can be made in the construction and configuration of the present invention , without departing from the scope or spirit of the invention . several variations have been discussed in the preceding text . furthermore , it is contemplated that the present invention may be used with a common rail camless type engine whereby the above described rocker arms may be electronically operated . others will be apparent to persons of ordinary skills in the art . it is intended that the present invention cover the modifications and variations of the invention , provided they come within the scope of the appended claims and their equivalence . | 5 |
the sol - gel precursor solution of the present invention includes a mixture of a monomeric organoalkoxysilane , a metal alkoxide m ( or ) n ( wherein m is a suitable transition metal ); r is ch 3 , c 2 h 5 or c 3 h 7 ; and n is 3 or 4 ), alcohol ( such as methanol , ethanol or propanol ), water , and a chlorine containing acid ( such as hcl ). suitably , m may be ti , zr , ge or al . preferably , the ph of the solution is adjusted to about 7 . 5 ( for reasons of handling safety ) by the addition of naoh . among the monomeric organoalkoxysilanes which can be used with the present invention are those listed in table 1 . in a preferred embodiment , the monomeric organoalkoxysilane contains an imidazole group , for example , n [ 3 -( triethoxysilyl ) propyl ]- 4 , 5 imidazole ( tspi ) and n [ 3 - triethoxysilyl ) propyl ]- 4 , 5 - dihydroimidazole ( tspdi ). table 1______________________________________ organosilane / chemical formula______________________________________3 - glycidoxypropyltrimethoxysilane ( gps ) ## str1 ## 3 - aminopropyltrimethoxysilane ( aps ) h . sub . 2 n ( ch . sub . 2 ). sub . 3si ( och . sub . 3 ). sub . 3n -[ 3 -( triethoxysilyl ) propyl ] imidazole ( tspi ) ## str2 ## n -[ 3 -( triethoxysilyl ) propyl ]- 4 , 5 - dihydroimidazole ( tspdi ) ## str3 ## ______________________________________ the film - forming precursor solution can be prepared by incorporating an organoalkoxysilane / metal alkoxide ( m ( or ) n wherein m is a suitable transition metal such as ti , zr , ge or al ; r is ch 3 , c 2 h 5 or c 3 h 7 ; and n is 3 or 4 ) into an alcohol / water mixing medium containing an appropriate amount of an acid containing chlorine . suitably , the alcohol may be methanol , ethanol or propanol preferably , the acid is hcl . the acid acts as a hydrolysis accelerator and produces a clear precursor solution . the addition of the acid aids in the formation of a uniform coating film on the metal substrate . when the precursor solution is used as a coating material for a metal substrate , the ph of the solution is preferably adjusted to approximately 7 . 5 by the addition of an appropriate amount of a suitable base such as , for example , koh or naoh . prior to addition of the base , the solution will be very acidic ( i . e ., it will have a ph of from about 1 . 0 to about 3 . 5 ). the base makes the solution safer to handle . the aluminum substrate used in the following examples was 2024 - t3 clad aluminum sheet containing the following chemical constituents : 92 wt . % al , 0 . 5 wt . % si , 0 . 5 wt . % fe , 4 . 5 wt . % cu , 0 . 5 wt . % mn , 1 . 5 wt . % mg , 0 . 1 wt . % cr , 0 . 25 wt . % zn and 0 . 15 wt . % other elements . the oxide etching of the aluminum was carried out in accordance with a well known commercial sequence called the forest products laboratory ( fpl ) process . as the first step in the preparation , the surfaces were cleansed with acetone to remove any organic contamination . they were then immersed in chromic - sulfuric acid ( na 2 cr 2 o 7 · 2h 2 o : h 2 so 4 : water = 4 : 23 : 73 by weight ) for 10 min at 80 ° c . after etching , the fresh oxide surfaces were washed with deionized water at 30 ° c . for 5 min , and subsequently dried for 15 min at 50 ° c . the substrate can be coated by immersing it in the above mentioned solution at ambient temperature . the substrate is then withdrawn from the solution . next , the coated substrate is heated for a time sufficient and at a temperature sufficient to yield a solid coating . the coated substrate is then heated for a time sufficient , and at a temperature sufficient , to produce a polymetallic - siloxane coating . a thinner polymetallicsiloxane coating may be obtained by diluting the sol - gel precursor solution with water . coating of the aluminum surfaces using the sol - gel system was performed in accordance with the following sequence . first , the fpl - etched aluminum substrate was immersed in the precursor solution at ambient temperature . the substrate was then withdrawn slowly from the soaking bath , after which the substrate was heated for 20 hrs . at a temperature of 100 ° c . to yield a solid coating . the samples were subsequently heated for 20 min . at temperatures ranging from 200 ° to 500 ° c . the mix compositions for the gps / ti ( oc 2 h 5 ) 4 based precursor solution systems are given in table 2 . for each formulation , the gps to ti ( oc 2 h 5 ) 4 ratio was varied so that the concentration of hcl needed to produce a clear precursor solution was dependent mainly on the gps / ti ( oc 2 h 5 ) 4 ratio . as the proportion of ti ( oc 2 h 5 ) 4 increased , the required amount of hcl was increased to form ti compounds which were susceptible to hydrolysis . the hcl - catalyzed hydrolysis of ti ( oc 2 h 5 ) 4 is as follows : ## str4 ## table 2__________________________________________________________________________compositions of clear precursor solutionsused for various gps / ti ( oc . sub . 2 h . sub . 5 ). sub . 4 ratiosgps / ti ( oc . sub . 2 h . sub . 5 ). sub . 4 gps ti ( oc . sub . 2 h . sub . 5 ). sub . 4 ch . sub . 3 oh water hcl ( wt . %)/( wt . ratio ) ( wt . %) ( wt . %) ( wt . %) ( wt . %) [ gps + ti ( oc . sub . 2 h . sub . 5 ). sub . 4__________________________________________________________________________100 / 0 50 0 30 20 1080 / 20 40 10 30 20 1060 / 40 30 20 30 20 2040 / 60 20 30 30 20 30__________________________________________________________________________ the hydroxylated titania derived from the hydrolysis of ti ( oc 2 h 5 ) 4 appears to react preferentially with the c - cl groups , rather than the silanol groups ( si - oh ). the silanol groups are formed by hydrolysis of the methoxysilane groups in gps . a possible condensation reaction occurring between the c - cl in the polymeric organosilanes and the hydroxy groups in the hydrated ti compounds is shown below : ## str5 ## upon heating to 300 ° c ., a large number of carbon containing groups such as ch 2 o and ch 3 cho are eliminated from the ti incorporated organopolysilane networks . this can be seen in the following equation : ## str6 ## the conversion of the ti incorporated organopolysilane networks into the polymetallicsiloxane network structure occurs at about 300 ° c . at temperatures of about 300 ° and above , pyrolytic changes in conformation appear to occur . the pyrolytic changes result in the elimination of numerous organic groups from the ti - incorporated organopolysilane network structures . once the transition is completed , the ti elements located in the networks act as a crosslinking agent which connect directly between the polysiloxane chains . the extent of ti crosslinking depends mainly on the gps / ti ( oc 2 h 5 ) 4 ratio . samples for ir analysis were prepared by incorporating the powdered samples into kbr pellets . the presence of si -- o -- ti linkages in the pts is indicated by an ir absorption peak at approximately 930 cm - 1 . the absorption intensity around 930 cm - 1 becomes weaker as the proportion of ti ( oc 2 h 5 ) 4 is increased . this is illustrated in fig1 . the presence of the bonds at 930 cm - 1 illustrates the formation of a polytitanosiloxane film at a low temperature ( i . e ., less than 1000 ° c ). when the heat treatment temperature was increased to 400 ° c ., the peak in the 2900 cm - 1 region of the ir spectra for all of the gps samples disappeared . this is shown in fig2 and suggests that all the residual organic compounds were nearly removed from the pts networks . the spectral features for the 400 ° c .- treated samples were similar to those for the 300 ° c .- treated ones with the exception of the disappearance of the 2900 cm - 1 scale from 400 ° c . treated sample . comparing the results at 500 ° c . ( see fig3 ), with those at 400 ° c . ( fig2 ), no specific changes or shifts in the absorption bands for any samples can be seen . when the film treatment temperature was raised to 300 ° c ., samples containing a gps / ti ( oc 2 h 5 ) 4 ratio of 100 / 0 experienced severe damage . this is shown in fig4 a . the failure appears to be due to pyrolytic changes in conformation of the polymericorganosilane . these pyrolytic changes result from the elimination of organic species from the network structure and result in excessive shrinkage of the film . the sem ( scanning electron microscope ) microstructure view of the 60 / 40 ratio film ( fig4 b ) disclosed a much lower magnitude in shrinkage and / or stress cracks . this strongly suggests that the cross - linking ability of the ti compounds , which connect directly between the polysilane chains , acts significantly to suppress the development of stress cracks . it is theorized that the network structure of the pts polymers , formed by pyrolytically induced conformational changes in ti compound modified organosilane polymers , contributes to the maintenance of film shape at high temperatures . the amount of cracking can be reduced by diluting the sol gel precursor solution with water . the dilution of the sol gel precursor solution results in the formation of a thinner polymetallicsiloxane coating . corrosion protection data for the above - coated substrates were obtained from the polarization curves for pms coated fpl etched aluminum samples upon exposure to an aerated 0 . 5m sodium chloride solution at 25 ° c . the typical cathodic - anodic polarization curves of log current density vs . potential for the coated samples were similar to those reported by several investigators for other materials ( g . a . dibari and h . j . read , corrosion , 27 ( 1971 ) 483 ; z . a . foroulis and m . j . thubriker , electrochim . acta , 21 ( 1976 ) 225 ; and a . v . pocius , in k . l . mittal ( ed . ), adhesion aspects of polymeric coatings , plenum press , new york , 1983 , pp . 173 - 192 ). the corrosion protective performance of the coatings was evaluated by an electrochemical procedure involving measurement of the corrosion current , i corr , by extrapolation of the cathodic tafel slope . the variation in the i corr value was plotted as a function of the treatment temperature . these results are depicted in fig5 . as seen in fig5 the protective ability of the coatings depends primarily on the gps / ti ( oc 2 h 5 ) 4 ratio and the treatment temperature . a low i corr value indicates good corrosion protection . the i corr - temperature relations for the 80 / 20 and 60 / 40 ratio coatings indicate that although microcracks form on the film surface at temperatures ≧ 300 ° c ., the i corr values after treatment at 400 ° c . are almost equal to those for the coatings pretreated at 100 ° c . this suggests that pts coating films at 100 ° c . formed from in - situ conformation changes at 400 ° c . provided corrosion protection for aluminum . coating of the aluminum surfaces using the sol - gel system was performed in accordance with the following sequence . first , the fpl - etched aluminum substrate was immersed in the precursor solution at ambient temperature . the substrate was then withdrawn slowly and heated for 20 hr at a temperature of 100 ° c . to yield a solid coating . the samples were subsequently heated for 20 min at temperatures ranging from 200 ° to 500 ° c . a film - forming precursor solution composed of 30 wt % of the particular organosilane , 20 wt % ti ( oc 2 h 5 ) 4 , 30 wt % ch 3 oh and 20 wt % water was employed to produce the pts polymers . the required concentrations of the hcl hydrolysis promoter needed to prepare clear precursor solutions were dependent upon the species of organosilane , and for the tspdi system was 30 % by weight of total mass of organosilanes and ti ( oc 2 h 5 ) 4 . the presence of si -- o -- ti linkages in the pts can be readily identified from the ir absorption peak at approximately 930 cm - 1 . the extent of the densification of the si -- o -- ti linkages was estimated by comparing the absorbencies at approximately 930 cm - 1 for the pts samples derived from the various organosilane - ti ( oc 2 h 5 ) 4 systems . as previously discussed , samples for the ir analysis were prepared by incorporating the powdered samples into kbr pellets . fig6 summarizes the resulting variations in absorbance plotted as a function of treatment temperature . the data indicates that the extent of densification of si -- o -- ti bonds is dependent upon the reactive organic functional groups attached to the terminal carbon of the methylene chains within the monomeric organosilane structures . an absorption peak at approximately 930 cm - 1 was not detected for the 200 ° c .- treated gps - and tspdi - ti ( oc 2 h 5 ) 4 systems . this indicates that a pts containing a highly densified si -- o -- ti bond was not formed at this temperature . a prominent ir peak at approximately 930 cm - 1 was observed for the gps and tspdi - ti ( oc 2 h 5 ) 4 systems when the samples were heated at 300 ° c . for 20 min . an absorption peak at approximately 930 cm - 1 was observed for the 200 ° c . treated aps - ti ( oc 2 h 5 ) 4 system . this indicates that pts , containing a highly densified si -- o -- ti bond , was formed at these temperatures . this illustrates the formation of a polymetallicsiloxane coating at a low temperature ( i . e ., less than 1000 ° c .). beyond this temperature , the absorbance value increased slowly , suggesting that the in - situ conversion of the ti compound - incorporated organosilane polymers into pts progressively occurs at temperatures ranging from about 200 ° to about 300 ° c . fig7 illustrates the sem images obtained for coating film surfaces preheated at 200 ° c . except for the development of few microcracks , the aps and tspdi coatings [ fig7 ( a ) and ( b )] exhibit excellent surfaces . the sem micrographs of these coating systems after being exposed to air for 20 min at 300 ° c . are shown in fig8 . the aps and tspdi coatings ( fig8 ( a ) and ( b )) showed no film damage with the exception of the appearance of a clear crack line . heat damage and distortion of the aluminum substrate was apparent , but after heating for 20 min at 500 ° c ., the tspdi coating was not damaged [ see fig9 ( a )]. accordingly , pts coating films derived from the ti ( oc 2 h 5 ) 4 - tspdi system appear to have the most stable si -- o -- ti bonds in the pts network structure . this may be due to moderate densification of the si -- o -- ti bonds in the pts network structure . the corrosion protective performance of pts coatings derived from various organosilane - ti ( oc 2 h 5 ) 4 systems was determined by comparing the corrosion current , ( i corr ) values determined from the cathodic tafel slopes of the various organosilane - ti ( oc 2 h 5 ) 4 systems . the corrosion tests in this study were performed on pts coatings formed on the fpl - etched aluminum at 300 °, 400 °, and 500 ° c . the resultant changes in i corr , for these coating specimens are summarized in table 3 . table 3______________________________________ i . sub . corr value ( μa ) obtained after pretreatment atcoating system 300 ° c . 400 ° c . 500 ° c . ______________________________________gps - ti ( oc . sub . 2 h . sub . 5 ). sub . 4 3 . 5 × 10 . sup .- 1 6 . 0 × 10 . sup .- 1 0 . 5aps - ti ( oc . sub . 2 h . sub . 5 ). sub . 4 8 . 5 × 10 . sup .- 2 5 . 8 × 10 . sup .- 1 1 . 2tspdi - ti ( oc . sub . 2 h . sub . 5 ). sub . 4 2 . 0 × 10 . sup .- 2 4 . 6 × 10 . sup .- 1 9 . 8 × 10 . sup .- 1tspi - ti ( oc . sub . 3 h . sub . 5 ). sub . 4 2 . 5 × 10 . sup .- 2 4 . 9 × 10 . sup .- 1 9 . 9 × 10 . sup .- 1______________________________________ after treatment at 300 ° c ., the lowest i corr value of 2 . 0 × 10 - 2 μa was measured on the pts coatings derived from the tspdi system . the aps system produced the next lowest i corr value . these values were approximately two orders of magnitude less than that for the ts system . the data indicates that the i corr values for all of the pts coatings formed at ≧ 300 ° c . increased as the film treatment temperature was raised . this is probably due to the increased size and number of cracks in the films . pts coatings derived from the tspdi system imparted the best corrosion protection , and at 500 ° c ., the i corr value was still on the order of 10 - 1 μa . ti ( oc 3 h 7 ) 4 , zn ( oc 3 h 7 ) 4 and al ( oc 3 h 7 ) 3 - modified organosilanes the mix compositions for the ti ( oc 3 h 7 ) 4 , zn ( oc 3 h 7 ) 4 and al ( oc 3 h 7 ) 3 sol - gel precursor solutions are listed in table 4 . in order to produce a clear precursor solution it was very important to add a chlorine containing acid such as hcl . the chlorine containing acid acted as a hydrolysis accelerator and aided in the formation of a uniform coating film on the metal substrate . table 4__________________________________________________________________________compositions of clear precursor solutions used in various m ( oc . sub . 3h . sub . 7 ). sub . n * - modified tspi systems . hcl , tspi / m ( oc . sub . 3 h . sub . 7 ). sub . n * tspdi zr ( oc . sub . 3 h . sub . 7 ). sub . 4 , ti ( oc . sub . 3 h . sub . 7 ). sub . 4 , al ( oc . sub . 3 h . sub . 7 ). sub . 3 , ch . sub . 3 oh , water wt %/ tspi + wt ratio wt % wt % wt % wt % wt % wt % m ( oc . sub . 3 h . sub . 7 ). sub . 4 or__________________________________________________________________________ 3100 / 0 50 -- -- -- 30 20 1270 / 30 35 15 -- -- 30 20 2050 / 50 25 25 -- -- 30 20 3070 / 30 35 -- 15 -- 30 20 1550 / 50 25 -- 25 -- 30 20 2570 / 30 35 -- -- 15 30 20 4050 / 50 25 -- -- 25 30 20 50__________________________________________________________________________ m : zr , ti and al n : 3 or 4 the substrates were coated by immersing an fpl - etched aluminum substrate into the precursor solution at ambient temperature . the substrate was then withdrawn from the precursor solution . next , the substrate was heat treated at 150 ° c . for 20 hrs . the 150 ° c . heat treatment results in the removal of water and methanol from the precursor solution coating and produces a sintered coating . the substrates coated with the ti ( oc 3 h 7 ) 4 and zn ( oc 3 h 7 ) 4 sol - gel precursor solutions were heated for 30 minutes at 350 ° c . to form polyzirconicsiloxane and polytitanosiloxane coatings . the substrates coated with the al ( oc 3 h 7 ) 3 sol - gel precursor solutions were heated for 30 minutes at 200 ° c . to form a polyaluminosiloxane coating . the hcl catalyzed hydrolysis - polycondensation reaction occurred in the following manner : ## str7 ## it is believed that the hydroxyl groups derived from the hcl - catalyzed hydrolysis of zr ( oc 3 h 7 ) 4 and ti ( oc 3 h 7 ) 4 , react preferentially with the cl in cl - substituted end groups in the silane compound , rather than the silanol groups which are formed by hydrolysis of the ethoxysilyl groups in the tspdi . the proposed reaction mechanism for this is shown below : ## str8 ## it is believed that the reaction of the halide with the oh in the hydroxylated metals favors the elimination of hydrogen chloride . the formation of cl - terminated end groups plays an important role in creating the m - o - c linkages . the reaction process for the al ( oc 3 h 7 ) 3 / tspdi system is different than those of the ti ( oc 3 h 7 ) 4 / tspdi and ti ( oc 3 h 7 ) 4 / tspdi systems . a polymeric organoaluminosilane network is formed when the al ( oc 3 h 7 ) 3 / tspdi system is heated to 150 ° c . and is believed to have the following structure : ## str9 ## ir studies were performed on the ti ( oc 3 h 7 ) 4 / tspdi and zr ( oc 3 h 7 ) 4 / tspdi samples after they had been heated for 30 minutes in air at 350 ° c . the samples had previously been heated at 150 ° c . for 20 hours . the ir analyses were conducted using the kbr method which incorporates the powder samples of 2 to 3 mg into kbr pellets of approximately 200 mg . fig1 illustrates the ir spectra for a ) 100 % tspdi , b ) tspdi / zr ( oc 3 h 7 ) 4 ( in a 50 : 50 ratio ) and c ) tspdi / ti ( oc 3 h 7 ) 4 ( in a 50 : 50 ratio ) samples heat treated at 150 ° c . for 20 hours and 350 ° c . for 30 minutes . the presence of a polymetallicsiloxane is indicated by an ir peak within the area of about 910 cm - 1 to about 960cm - 1 . the tspdi / zr ( oc 3 h 7 ) 4 system ( fig1 ( b )) had an ir peak at 950 cm - 1 . the tspdi / ti ( oc 3 h 7 ) 4 system ( fig1 ( c )) had an ir peak at 930 cm - 1 . these peaks signify the formation of polymetallicsiloxane , at a low temperature ( i . e ., less than 1000 ° c . ), by the process shown below : ## str10 ## the 350 ° c . heating results in the elimination of numerous organic groups permitting the zr and ti metal oxides to act as crosslinking agents which connect the polysiloxane chains to form polyzirconicsiloxane and polytitanosiloxane . characteristics of pms ( coating films derived from tspdi / ti ( oc 3 h 7 ) 4 , tspdi / zr ( oc 3 h 7 ) 4 and tspdi / al ( oc 3 h 7 ) 3 precursor systems thin coating films were obtained by diluting 20 g of the precursor solutions listed in table 4 with 80 g of deionized water . the fpl - etched aluminum substrate was immersed into the diluted precursor solution . the substrate was withdrawn from the solution and heated for 20 hours at 150 ° c . the sintered samples were then heated at 350 ° c . for 30 minutes to form the pyrolysis induced pms coating films . the thickness of the pms film deposited on the substrate was determined using a surface profile measuring system . the average thickness of the films derived from the precursor solution consisting of 100 / 0 , 70 / 30 , and 50 / 50 tspdi / m ( oc 3 h 7 ) 3 or 4 ratios , ranged from approximately 0 . 2 to approximately 0 . 4 μm . fig1 illustrates the polyzirconicsiloxane ( pzs ) film derived from the 70 / 30 tspdi / zr ( oc 3 h 7 ) 4 . this pzs film had relatively few microcracks . the amount of cracking can be reduced by diluting the sol gel precursor solution with water . the dilution of the sol gel precursor solution results in the formation of a thinner polymetallicsiloxane coating . ideally , a pms coating surface will have a uniform film free of cracks and pits . these characteristics were observed in the 50 / 50 tspdi / ti ( oc 3 h 7 ) 4 ratio derived polytitanosiloxane ( pts ) film illustrated in fig1 a . fig1 b illustrates the 70 / 30 tspdi / ti ( oc 3 h 7 ) 4 ratio derived pts film . the 70 / 30 ratio film has a few microcracks . a thinner polymetallicsiloxane coating may be produced by diluting the sol gel precursor solution with water . corrosion protection data for the polytitanosiloxane and polyzirconicsiloxane coated substrates were obtained from the polarization curves for pms coated fpl etched aluminum samples upon exposure to an aerated 0 . 5m sodium chloride solution at 25 ° c . to evaluate the protective performance of the coatings , the corrosion potential ( e corr ) and corrosion current ( i corr ) were determined for the polarization curves . e corr is defined as the potential at the transition point from cathodic to anodic polarization curves . i corr values were measured by extrapolation of the cathodic tafel slope . these results are summarized in table 5 . table 5______________________________________corrosion potential , e . sub . corr and corrosion current , i . sub . corr , valuesforpms - coated and uncoated aluminum specimens . coating systems , i . sub . corr ,( tspi / m ( oc . sub . 3 h . sub . 7 ). sub . 4 or 3 ) e . sub . corr * μa______________________________________uncoated ( blank ) - 0 . 725 2 . 5ps ( 100 / 0 ) - 0 . 695 1 . 8pzs ( 70 / 30 ) - 0 . 625 7 . 8 × 10 . sup .- 1pzs ( 50 / 50 ) - 0 . 710 1 . 5pts ( 70 / 30 ) - 0 . 589 1 . 8 × 10 . sup .- 1pts ( 50 / 50 ) - 0 . 596 1 . 6 × 10 . sup .- 1______________________________________ as seen , the major effect of these pms coatings on the corrosion protection of aluminum is to move the e corr value to less negative potentials and to reduce the cathodic current ( i corr ). the samples coated with pts produced significantly higher e corr values , and significantly lower i corr values , than the uncoated samples . this strongly suggests that the pts coating films will serve to provide good corrosion resistance from a sodium chloride solution and will minimize the corrosion rate of the aluminum . thus , while there have been described what are the presently contemplated preferred embodiments of the present invention , those skilled in the art will realize that changes and modifications may be made thereto without departing from the scope of the invention , and it is intended to claim all such changes and modifications as fall within the true scope of the invention . | 2 |
the above - described objects and other objects and characteristics and advantages of the present invention will now be described in detail with reference to the accompanied drawings . typically , the direction condenser microphone includes an acoustic delay device . embodiments of the present invention will be described by dividing into two examples , an example wherein the acoustic delay device is mounted at a front sound hole of a case for passing through a front sound and an example wherein the acoustic delay device is mounted at a rear sound hole of a pcb for passing through a rear sound . fig3 is a lateral cross - sectional view illustrating a directional silicon condenser microphone having an additional back chamber in accordance with a first embodiment of the present invention , wherein an acoustic delay device 170 is installed at a front sound hole 130 a of the case for passing through the front sound . referring to fig3 , the directional silicon condenser microphone 100 having an additional back chamber 152 in accordance with the first embodiment has a structure wherein a chamber case 150 for forming the additional back chamber 152 and an asic chip 120 for driving an electrical signal of a mems chip 110 are disposed on a pcb substrate 140 having a conductive pattern 141 and connection terminals 142 and 144 , a mems chip 110 is disposed on the chamber case 150 , and a case 130 having the front sound hole 130 a for passing through the front sound is attached to the pcb substrate 140 . the acoustic delay device 170 is attached at the front sound hole 130 a inside the case , and the conductive pattern 141 and the ground connection terminal 144 are connected via a through - hole 146 . the chamber case 150 increases a space of the back chamber of the mems chip 110 to improve a sensitivity and improve a noise problem such as thd ( total harmonic distortion ), wherein a through - hole 150 a for connecting a back chamber 15 formed by the mems chip 110 with the additional back chamber 152 is disposed on an upper surface of the chamber case 150 , and the mems chip 110 has a structure wherein the backplate 13 is formed on the silicon wafer 14 using the mems technology and the vibrating plate 11 is formed to have the spacer 12 therebetween as shown in fig1 . the chamber case 150 may have a shape of a square pillar or a cylinder , and may be manufactured using a metal or a mold resin . in addition , although not shown , electrical wiring is disposed on the chamber case 150 so as to transmit the electrical signal of the mems chip 110 to the asic chip 120 . the chamber case 150 having the through - hole 150 a on an upper surface thereof for forming the additional back chamber , the mems chip 110 attached on the through - hole 150 a of the chamber case 150 to expand the back chamber , and the asic chip 120 are disposed on the pcb substrate 140 . the conductive pattern 141 is disposed on a portion of the pcb substrate 140 that is in contact with the case 130 . in addition , a rear sound hole 140 a for passing through the rear sound is disposed at a portion of the pcb substrate 140 where the chamber case 150 is mounted . a sealing pad 148 for carrying out a hole sealing of the sound hole 140 a for preventing a distortion of a sound wave by soldering may be further disposed around the rear sound hole 140 a of the pcb substrate 140 . a reference numeral 148 a denotes a sound hole formed by the sealing pad 148 . the case 130 is a metal case having one surface open wherein the case 130 has the shape of the cylinder or the square pillar . the case 130 has an end portion in contact with the conductive pattern 141 of the pcb substrate 140 and has the front sound hole 130 a for passing through the external front sound at a bottom surface thereof as well . the case 130 is attached to the pcb substrate 140 by aligning the metal case 130 on the conductive pattern 141 formed on the pcb substrate 140 and then spot - welding at least two points by a laser welding or a spot welding and then sealing a contacting portion of the case 130 and the pcb substrate 140 with an adhesive 164 such as an epoxy . a reference numeral 162 denotes a welding point . in accordance with a method for manufacturing the directional silicon condenser microphone 100 of the first embodiment , after the chamber case 150 is attached such that the rear sound hole 140 a of the pcb substrate 140 is positioned inside the additional back chamber 152 while mounting the asic chip 120 , the mems chip 110 is attached to the chamber case 150 such that the through - hole 150 a of the chamber case 150 is positioned inside the back chamber 15 of the mems chip 110 . thereafter , the acoustic delay device 170 is attached to the front sound hole 130 a of the case 130 having the shape of the cylinder or the square pillar , and the case 130 having the shape of the cylinder or the square pillar is fixed to the conductive pattern 141 of the pcb substrate 140 by the laser welding . the case 130 is bonded to the pcb substrate 140 by the adhesive 164 . the adhesive 164 may be a conductive epoxy , a non - conductive epoxy , a silver paste , a silicon , a urethane , an acryl and / or a cream solder . referring to fig3 , the mems chip 110 having the additional back chamber 152 formed by the chamber case 150 and the asic chip 120 are disposed on the pcb substrate 140 , and the square or circular conductive pattern 141 is disposed at a portion that is in contact with the case 130 having the shape of the cylinder or the square pillar . since a size of the pcb substrate 140 is larger than that of the case 130 having the shape of the cylinder or the square pillar , a connection pad or the connection terminal for connecting to an external device may be freely disposed on the large pcb substrate , and the conductive pattern 141 may be manufactured by disposing a copper film via a conventional pcb manufacturing process and then plating a nickel or a gold . a ceramic substrate , a flexible pcb ( fpcb ) substrate or a metal pcb may be used instead of the pcb substrate 140 . the case 130 having the shape of the cylinder or the square pillar has a contacting surface with the pcb substrate 140 open such that chip components may be housed inside , wherein the front sound hole 130 a for passing through the front sound is disposed thereon . the case 130 may be manufactured using a brass , a copper , a stainless steel , an aluminum or a nickel alloy and may be plated with gold or silver . after aligning the case 130 to the conductive pattern 141 of the pcb substrate 140 , a welding point 162 which is a portion of the contacting portion is welded with the laser using a laser welder ( not shown ) to fix the case 130 to the pcb substrate 140 . thereafter , an assembly of the microphone is complete by applying the adhesive 164 to the entire contacting portion . the welding refers to spot - welding one or more points ( preferably two or four points ) in order to fix the case 130 to the pcb substrate 140 rather than welding an entire contacting surface of the case 130 and the pcb substrate 140 . a bonding point formed between the case 130 and the pcb substrate 140 through such welding is referred to as the welding point 162 . the case 130 is fixed to the pcb substrate 140 by the welding point 162 such that the case 130 is not moved during a bonding using the adhesive 164 or a curing process for bonding at a proper position . in addition , the conductive pattern 141 is connected to the ground connection terminal 144 through the through - hole 146 , and when the case 130 is bonded , external noise is blocked to remove the noise . at least two and up to eight connection terminals 142 and 144 for connecting to the external device may be formed at a bottom surface of the pcb substrate 140 , and each of the connection terminals 142 and 144 is electrically connected to a chip component side through the through - hole . particularly , in accordance with the embodiments of the present invention , when the connection terminals 142 and 144 extends about the pcb substrate 140 , the rework may be facilitated by using an electric solder through an exposed surface . in accordance with the embodiments of the present invention , while the laser welding is exemplified as a method for fixing the case 130 to the pcb substrate 140 , a soldering or a punching may be used for fixing the case 130 to the pcb substrate 140 , and the conductive epoxy , the non - conductive epoxy , the silver paste , the silicon , the urethane , the acryl or the cream solder may be used as the adhesive 164 . fig4 is a lateral cross - sectional view illustrating a directional silicon condenser microphone 100 ′ having an additional back chamber in accordance with a second embodiment of the present invention . as described above , the silicon condenser microphone 100 of the first embodiment differs from the silicon condenser microphone 100 ′ of the second embodiment in a position of the acoustic delay device 170 , wherein the acoustic delay device 170 is attached to the front sound hole 130 a of the case 130 for passing through the front sound in the first embodiment , and is attached to the rear sound hole 140 a of the pcb for passing through the rear sound in the second embodiment . therefore , while the front sound from an external acoustic source that passed through the front sound hole 130 a of the case is subjected to a phase delay by the acoustic delay device 170 to reach the mems chip 110 in the first embodiment , the rear sound from the external acoustic source that passed through the rear sound hole 140 a of the pcb substrate 140 is subjected to the phase delay by the acoustic delay device 170 to reach the mems chip 110 in the second embodiment . in accordance with the silicon condenser microphone of the second embodiment , since a constitution thereof is identical to that of the silicon condenser microphone of the first embodiment except the position of the acoustic delay device 170 , an additional detailed description is omitted . fig5 is a diagram exemplifying an additional back chamber in a form of a square pillar in accordance with the present invention , and fig6 is a diagram exemplifying an additional back chamber in a form of a cylinder in accordance with the present invention . as shown in fig5 and 6 , the chamber case 150 for forming the additional back chamber 152 may have the shape of the square pillar 150 ′ and the cylinder 150 ″ and the through - hole 150 a is disposed on an upper portion of the square pillar 150 ′ or the cylinder 150 ″ to form a path with the back chamber 15 of the mems chip 110 . the silicon condenser microphone 100 having various shapes may be manufactured by attaching the case 130 having various shapes on the pcb substrate 140 . the asic chip 120 and the mems chip 110 are mounted on the pcb substrate 140 . the mems chip 110 includes the additional back chamber 152 by the chamber case 150 . for instance , the case may have the shape of the cylinder , the square pillar , a cylinder having a wing at an end thereof , or a square pillar having a wing at an end thereof . as shown in fig7 , in accordance with the directional silicon condenser microphone mounted on the main pcb 310 , the connection pad 320 of the main pcb 310 is coupled to the connection terminals 142 and 144 by a soldering as well as the case 130 extruding at a center of the pcb substrate 140 is inserted the inserting hole 310 a of the main pcb 310 . therefore , in accordance with a mounting method of the present invention , since the case 130 extruding over the pcb substrate of the microphone is inserted in the inserting hole 310 a of the main pcb 310 , an overall height after the mounting is smaller than the conventional microphone wherein the connection terminals are formed on an opposite side of the component side to be mounted the main pcb , resulting in an efficient use of a space required for mounting the product . the present invention includes a chamber case for forming an additional back chamber under a mems chip in order to increase a back chamber space of the mems chip , thereby improving sensitivity and noise problems such as a thd ( total harmonic distortion ). | 7 |
fig2 schematically depicts a first embodiment of an installation for sputtering used according to the invention . above a sputter source 10 with the target material to be sputtered off , such as , for example , a magnetron source , a plasma 13 is maintained . ions of a supplied working gas ag , such as , for example , ar , by pulse transmission knock largely neutral target material particles n out of the target , which become deposited onto a workpiece 15 . as shown schematically at the feed unit 17 , the plasma above the sputter source can be operated with dc or by means of a pulsed dc voltage pl or , in principle , by means of superimposed dc and ac or with ac , in particular rf power . due to the precipitation of interest in the present case , of dielectric layers on customarily non - conducting workpiece substrates 15 , the feasibility is in particular pointed out of operating the plasma by means of a dc voltage , however , to connect low - ohmically the plasma - generating electrodes , as shown schematically in fig2 at 19 a and 19 b and as indicated thereon in dashed lines , at given time intervals , preferably periodically . with respect to the plasma - enhanced coating of non - conducting substrates with dielectric layers and using dc plasmas or of substrate bias , reference can be made to : ep 508 359 or u . s . pat . no . 5 , 423 , 970 ; and ep 564 789 or u . s . pat . nos . 5 , 948 , 224 and 6 , 149 , 783 . the layers of the color filter layer systems are each generated either nonreactively , thus exclusively using the working gas ag and / or by a reactive sputtering process and use of a reactive gas rg , such as of o 2 , for example depending on which layer materials are used . therein , according to the invention , temperatures of the coated workpieces 15 , provided with the lift - off lacquer 11 , of maximally 150 ° c ., preferably maximally 100 ° c ., are maintained . due to the high ion bombardment density , dense layers are realized which hardly change their spectral properties at varying ambient temperature and humidity . without further directing measures , such as providing collimators , the sputter coating according to the invention is suitable for application in which disturbed regions 3 according to fig1 having an extension of approximately 5 * d can be accepted . stated in terms of the maximum disturbed region thickness d 5 , each disturbed region 3 has a width of at most 10 * d 5 since , as will be explained later , the necessary lift - off lacquer layers of thickness d can be substantially thinner than twofold the color filter layer systems deposited thereon . in fig3 , in a representation analogous to fig1 , a second process used according to the invention is shown schematically , namely plasma - enhanced or ion - enhanced vapor deposition . herein , for example by means of an electron beam 23 and / or a heating unit 25 , a material is vaporized from a crucible 27 . again , a dense plasma 24 is maintained above the crucible 27 with a feed source 28 which , with respect to the output signals , can be structured analogous to the source 17 explained in conjunction with fig2 . the workpieces are here preferably disposed on a rotationally driven carrier 26 shaped like a calotte whose sphere center is the center z of the vaporization source 27 . again , temperatures are maintained not exceeding 150 ° c ., in particular not exceeding 100 ° c . this directed process makes it possible to coat lift - off lacquer structures 11 with filter layer systems , which require disturbed regions 3 according to fig1 whose extension is approximately 1 * d and less . in plasma - enhanced or ion - enhanced vapor deposition , according to fig3 , depending on the layer to be built up of the color filter layer system , work also proceeds nonreactively with the exclusive use of working gas ag or reactively using a reactive gas rg . in fig4 is shown on an enlarged scale the lift - off lacquer structure 32 on the substrate 30 . above it is shown schematically the plasma 34 of the plasma - enhanced precipitation process . if the first layer 31 of the color filter layer system , shown in dashed lines in fig4 , is to be deposited by a reactive process , such as in particular using ionized oxygen , the lift - off lacquer structure , as shown schematically at 35 , in particular in the edge regions is attacked by excited reactive gas , as stated , in particular o 2 or by h 2 o activated in the plasma and / or split from the residual gas . a first feasibility of preventing this comprises depositing the first layer of the color filter layer system nonreactively , thus in view of fig2 or fig3 with the exclusive use of the working gas ar . for this purpose the layer material is used either directly as target or vaporization source material . a second and preferred feasibility comprises according to fig5 applying before application of the first layer 31 of the color filter layer system , an optically broadband and largely transmitting free of loss , i . e . optically neutral , well - adhering intermediate layer onto the lift - off lacquer structure , which as a protective layer withstands the subsequent process . the intermediate layer 45 shown in fig5 having a thickness of 5 to 10 nm , comprises preferably sio or sio 2 , which is chemically not attacked by excited ionized reactive gas , in particular o 2 or h 2 o from the residual gas . in fig5 the layer 31 drawn in dashed lines denotes the subsequently applied first optically active layer of the color filter layer system which can now be deposited through a reactive process . subsequently , the intermediate layer 45 can also comprise sio 2 which is precipitated nonreactively or only weakly reactively . in this case , an sio 2 intermediate layer forms the first , low - refractive layer of the filter layer system with following higher - refractive layers . in the following , coating processes used by example with the resulting color filter structures will be introduced . substrate : glass filter structure : strips 160 μm wide 20 mm long , 100 μm spacing lacquer layer thickness : 3 . 2 μm lacquer : shipley 1045 , diluted 6 : 1 optical filter layer system : 1 . 5 μm ( d 5 of fig1 ) layer system : sio 2 / tio 2 coating process sio 2 : reactive sputtering , installation bas 767 source : si target sputter power : 6 . 4 kw working gas : ar reactive gas : o 2 working gas flow : 40 sccm reactive gas flow : 50 sccm rate : 0 . 3 nm / sec coating process tio 2 : reactive sputtering source : ti target sputter power : 10 kw working gas : ar reactive gas : o 2 working gas flow : 40 sccm reactive gas flow : 36 sccm rate : 0 . 16 nm / sec coating temperature : t ≦ 80 ° c . size of the disturbed zone next to the lacquer mask ( 1 of fig1 ): ≦ 10 μm stability of the edges of the filter : & lt ; 1 nm edge shift from 20 ° c . to 80 ° c . in this example the intermediate layer has been omitted . the plasma is switched on before the coating proper is started . therefore the lacquer mask comes into contact with o 2 / ar plasma . the edges of the lacquer are thereby rounded . this makes the lift - off step difficult or necessitates a relatively thick lacquer mask . through the process according to the invention it becomes possible to produce pixel structures , such as in particular for lcd light valve projectors and ccd sensors , cost - effectively and with low part rejects rate which , in addition , are spectrally extremely stable against environmental changes , in particular temperature and humidity changes . in particular , when using said intermediate layer , moreover , extremely good adhesion of the color filter system on the substrate is attained . the necessary lift - off lacquer layers can be substantially thinner than the twofold of the color filter layer systems deposited thereon . providing overhanging side walls of the lacquer regions , as is customary in aluminization in the semiconductor production , is superfluous . since the application of the color filter layer systems takes place at low temperatures and consequently the subjacent lift - off lacquer structures are exposed to correspondingly low temperature stresses — thus need only have low temperature resistance — an extremely simplified lift - off technique results without hot and extremely aggressive solvents or ultrasound needing to be employed for the lift - off . the preferred use of said intermediate layer avoids negatively influencing the reactive precipitations of the first filter layer on the lift - off lacquer , in particular the edge damage of the lacquer structures through reactive ar — o 2 — h 2 o plasmas . | 6 |
before explaining the present invention , in detail , it is to be understood that the invention is not limited in its application to the details of construction and arrangement of parts illustrated in the accompanied drawings , since the invention is capable of other embodiment and being practiced or carried out in a variety of ways . also , it is to be understood that the phraseology or terminology employed herein is for the purpose for description and not of limitation . referring now to fig1 the game of this invention is generally designated by the numeral 10 and includes an upright portion 12 , an inclined ramp 14 and a putting surface 16 . side boards 18 and 20 are located on each side of the ramp 14 . at the end of the ramp are a plurality of receptacles 22 , the details of which will be hereafter described . the receptacles connect with an outlet 24 which may include means for directing the golf balls 25 back to the player generally designated by the numeral 26 , who uses a putter 27 as is well known . suitable electrical connection 30 is provided for actuation of the scoring means as hereafter described . a plurality of counterballs 32 are provided in the machine and are adapted to be received , during the play , for each player in a scoring receptacle 34 . the player with the greater number being declared the winner . fig2 represents the players view of the components of the game shown and displayed on framework 12 . at the terminus of ramp 14 are a plurality of receptacles 22 which are designated by the indicia &# 34 ; 1 &# 34 ; through &# 34 ; 9 &# 34 ;. each of the receptacles are color coded red and blue , designated &# 34 ; r &# 34 ; and &# 34 ; b &# 34 ; respectively . for each numeral there is a corresponding red and blue ( r and b ) receptacle . the vertical board itself includes an opening 31 in the top thereof to receive a plurality of counterballs 32 . the mechanism of the game comprises a plurality of angularly oriented and intersecting channels 40 , 42 , 44 , 50 , 52 and 54 . at the intersection of each channel is a wing valve , for example , at the intersection of channels 40 and 50 is a wing valve 60 . at the intersection of channels 42 and 50 is a wing valve 62 , at the intersection of channels 44 and 50 is wing valve 64 . at the respective intersections with channel 52 are respective wing valves 66 , 68 and 70 . at the intersections with channel 54 are respective wing valves 72 , 74 and 76 . the game board includes a cover 80 which is translucent opposite the various channels and may be opaque for the remainder of the board . the portions designated &# 34 ; red &# 34 ; and &# 34 ; blue &# 34 ; may be colored accordingly as shown . fig3 is another view with cover 80 removed to describe the game board of the invention and the various channels as previously described . a scoring channel 82 - red intersects with the wing valves 72 , 74 and 76 while scoring channel 84 - blue intersects with wing valves 64 , 70 , and 76 . ramps 86 and 88 are provided so that the counterballs may roll to the respective receptacle openings 90 and 92 . the view of fig4 provides description of wing valve 76 which is representative of all of the wing valves and which include a pivot shaft 100 extending through appropriate bushings through framework 12 . a solenoid 102 which is one of a pair for each wing valve is attached to the framework 12 . the solenoid plunger 104 is connected to the shaft 100 by a flexible cord member 106 which extends around the shaft 100 through an opening 108 therethrough and knotted at the end . a cord 110 is similarly attached to the shaft on the other side and being connected to the second solenoid , not shown in this view . below each receptacle 22 is an activator switch 120 having an arm 122 which golf ball 25 will hit supplying electrical energy by way of wires 124 and 126 to the solenoid 102 . each wing valve is maintained in its normal intersection blocking position by a resilient band 130 which connects around peg 132 affixed to the framework 12 and peg 134 affixed wing valve 76 . referring now to fig5 - 7 , the sequence of operation is shown when the players &# 39 ; golf ball has entered receptacle 22 - b which , upon activation of the switch 120 will send electrical current to operate solenoid 102 . as the solenoid 102 actuates , its plunger 104 will move vertically upward carrying with it cord 106 . because of pre - designated slack in 106 , half travel of the plunger 104 will take up the slack with the remaining half movement acting to pivot shaft 100 90 ° as shown in fig7 . sufficient slack is provided in cord 110 relative to the shaft 100 such that the rotation of the shaft nearly takes up the slack therein , again , as shown in fig7 . fig8 is a frontal view of wing valve 68 which operates relative to channels 42 and 52 and further describes the pivoting action of the valve . in its normal position the valve 68 includes an opening formed by surface 140 and 142 which will entrap a counterball 32 therein . in the view shown the wing valve has been pivoted to the right allowing the counter ball 32 , showing dotted , to drop by gravity into channel 52 , where the counter ball will be stopped by the next wing valve 70 ( see fig3 ). the object of the game is for each player to accumulate as many of the counterballs 32 to his or her respective scoring channels 82 or 84 as the case may be . to begin the game , one player is designated for the color red and the other player designated for the color blue . accordingly , the red player will attempt to putt the golf ball into the red channels , i . e . one red , two red , three red , etc . which in turn will cause the respective wing valves to pivot in a counter - clockwise direction , thus directing the counter balls 32 toward the red side scoring channel . likewise , the blue player will attempt to putt his golf ball into the blue receptacles 22 causing the respective wing valve to pivot in a clockwise direction toward the blue scoring channel . the winner , of course , being that player that has accumulated the majority of counterballs 32 . | 8 |
various embodiments of the invention will hereunder be described with reference to the accompanying drawings . fig1 to 3 are central cross - sectional views showing an arrangement of a lens mount according to a first embodiment of the invention . further , fig5 to 8 are exploded perspective views showing a detailed arrangement of the lens mount . in this connection , fig1 shows a state of an initial position ( on the side of an infinity ) of a focus group upon a wide angle end . fig2 shows a state of a feeding position ( on the close side ) of the focus group upon the wide angle end , while fig3 shows a state of the initial position ( on the side of the infinity ) of the focus group upon the wide angle end . as shown in fig1 to 3 , the lens mount is arranged such that a first group of lenses 141 , a second group of lenses 142 , a third group of lenses 143 and a fourth group of lenses 144 are respectively arranged from the front to the rear ( i . e . from left to right ). fig4 is a view schematically showing movement of each of the groups of lenses upon zoom operation . however , as shown in fig4 the first group of lenses 141 to the third group of lenses 143 of the groups of lenses are adapted to integrally move within the lens mount during reaching the telephoto end from the wide angle end . respective portions will hereunder be described in detail with reference to fig1 to 3 and fig5 to 8 . in this connection , each of fig5 to 8 shows that various elements are exploded in an optical - axis direction . as shown in fig1 and 5 , a fixed frame 52 of the lens mount is fixedly mounted on a camera body ( not shown ) at a rearward end thereof , and is formed with linear key grooves 52a into which linear keys 53b of three ( 3 ) locations arranged at a rearward end of a frame of a first group of lenses 53 ( refer to fig6 ) are fitted respectively , and a linear key groove 52d into which an fpc guide 78 ( refer to fig8 ) is fitted . further , a rotary frame 51 is fitted about an outer periphery of the fixed frame 52 for angular movement . moreover , a groove 52c is formed along a circumferential direction in an outer periphery of the fixed frame 52 at a forward end thereof . a c - ring 64 for engaging with the rotary frame 51 in the optical - axis direction is mounted in the groove 52c . meanwhile , the fixed frame 52 has an inner periphery thereof which is formed with a cam groove 52b which is fitted on cam followers 59a of an intermediate frame 59 ( refer to fig8 ) ( fig1 is an developed view of the fixed frame 52 ). furthermore , a light shielding element 145 made of flocked cloth or the like for preventing unnecessary or un - required light from entering the lens frame from a gap between the fixed frame 52 and the first lens group frame 53 is fixedly mounted on an inner periphery of a forward end of the fixed frame 52 . the rotary frame 51 has an inner peripheral surface thereof which is fitted radially in an outer periphery of the fixed frame 52 , as described above . movement of the rotary frame 51 in the optical - axis direction is engaged by the c - ring 64 which is mounted on a forward end of the fixed frame 52 . thus , the rotary frame 51 is movable in an angular - movement direction with respect to the fixed frame 52 , but movement thereof in the optical - axis direction is regulated ( i . e . prevented ). moreover , the rotary frame 51 has an inner periphery thereof which is formed therein with a cam groove 51b having a bottom thereof for moving the first lens group frame 53 in the optical - axis direction , and a cam groove 51c having a bottom thereof for moving the fpc guide 78 in the optical - axis direction ( fig2 is a developed view thereof ). the rotary frame 51 has an outer periphery thereof on which the gear 51a is formed . thus , the arrangement is such that a zoom gear 227 that is an output gear of a zoom drive unit is in mesh therewith to perform rotary driving . further , a pattern sheet 76 of a zoom encoder for a zoom photo reflector 139 which detects a zooming position of a zoom lens is - fixedly mounted on the outer periphery of the rotary frame 51 . as shown in fig6 the first lens group frame 53 that is a lens frame of the first group of lenses 141 has , at a rearward end thereof , an outer periphery thereof formed with the linear keys 53b which are fitted respectively in the linear key grooves 52a in the fixed frame 52 at equal intervals . thus , the first lens group frame 53 is capable of being moved in the optical - axis direction with respect to the fixed frame 52 . moreover , the linear keys 53b have upper surfaces thereof which are formed respectively with cam followers 53a which are fitted in the cam groove 51b in the rotary frame 51 . furthermore , a shutter bottom plate 81 ( refer to fig7 ) is fastened by screws 65 to the inner periphery of the first lens group frame 53 under a state in which the shutter bottom plate 81 is regulated in position in the radial direction and the rotational direction and a shutter lid or closure 82 ( refer to fig7 ) is put between the shutter bottom plate 81 and a front frame 60 . further , the front frame 60 ( refer to fig7 ) and the middle frame 59 ( refer to fig8 ) are fitted in the inner periphery of the lens first group frame 53 for angular movement in a peripheral direction . rollers 77 which are mounted on the fourth lens group frame 57 ( refer to fig8 ) enter the inner periphery of the first lens group frame 53 . linear key grooves 53e ( refer to fig1 ) for regulating a fourth lens group frame 57 in the rotational direction are formed at three ( 3 ) locations in the inner periphery of the first lens group frame 53 . moreover , through - bores 53c for pressingly fitting , respectively , pins 75 for regulating the middle frame 59 into the optical - axis direction are formed through the inner periphery of the first group of lenses 53 . furthermore , a barrier drive ring 69 for opening and closing a barrier is fitted in a forward end of the first lens group frame 53 in the optical - axis direction for angular movement in the radial direction . the forward end off the first lens group frame 53 is connected to a barrier drive gear 100b ( refer to fig7 ) which projects from a bore in the forward end of the first lens group frame 53 . as shown in fig8 the fourth lens group frame 57 is fastened by a screw such that a fourth lens group retaining frame 56 which retains the fourth group of lenses 144 becomes integral therewith . the fourth lens group frame 57 has an outer periphery thereof on which three pins 57a are provided in planting . the rollers 77 are fitted respectively upon the pins for rotation . the rollers 77 are fitted respectively in the linear key grooves 53e ( refer to fig1 ) which are provided in the inner periphery of the first lens group frame 53 . thus , the fourth lens group frame 57 is movable only in the optical - axis direction with respect to the first lens group frame 53 , but is not moved in the angular movement direction . furthermore , a fourth lens group spring 62 is arranged between the fourth lens group frame 57 ( refer to fig8 ) and the shutter bottom plate 81 ( refer to fig7 ) through a spring retainer 63 therebetween . the rollers 77 are biased so as to be abutted always against respective end - face cams 59b of the middle frame 59 . the middle frame 59 has an outer periphery thereof which is fitted , in the radial direction , in an inner periphery of the first lens group frame 53 ( refer to fig6 ). forward ends of respective pins 75 which are press - fitted from the outer periphery of the first lens group frame 53 are fitted respectively in grooves which are formed in the outer periphery of the middle frame 59 , whereby the middle frame 59 is integrally retracted in the optical - axis direction with respect to the first lens group frame 53 , and rotation thereof is freely retained . moreover , the cam followers 59a which are fitted in the cam groove 52b in the fixed frame 52 are formed in the outer periphery of the middle frame 59 . furthermore , an interlocking plate 66 is fixedly mounted on the outer periphery of the middle frame 59 ( see fig9 a ). further , the end - face cams 59b are formed on one end of the middle frame 59 . as shown in fig7 the front frame 60 has an outer periphery thereof which is rotatably fitted in diameter in an inner periphery of the first lens group frame 53 , and an inner periphery which is formed with a plurality of linear key grooves 60b ( refer to fig1 ) into which a plurality of linear keys 54a of the second lens group frame 54 are fitted respectively . a second lens group spring 61 that is a compression spring is arranged between the front frame 60 and the second lens group frame 54 . further , the outer periphery of the front frame 60 is formed with a projection 60a which is put into a gap 66a in the forward end off the interlocking plate 66 . the projection 60a is so connected as to be integrally rotated together with rotation of the middle frame 59 ( refer to figs ., 9a anti 10 ). thus , since the front frame 60 is fitted , in the radial direction , in the inner periphery of the first lens group frame 53 , eccentricity with respect to the rotation of the second lens group frame 54 is minimized as far as possible as compared with the fact that the second lens group frame 54 is directly rotated by the interlocking plate 66 . thus , it is possible to maintain high optical performance . moreover , a barrier drive changing - over lever 101 for connecting a focal drive gear train 146 and a barrier drive gear train 147 to each other is arranged on the inner peripheral surface of the front frame 60 . the inner peripheral surface of the front frame 60 is provided with a barrier drive changing - over lever - position regulating cam portion which regulates a position of the barrier drive changing - over lever 101 such that the connection is not performed under a state other than a collapsible mount state , and which regulates the position of the barrier drive changing - over lever 101 such that the interlocking plate 66 does not obstruct or disturb connection of the barrier drive changing - over lever 101 upon collapsible mount . the second lens group frame 54 retains the second group of lenses 142 and is formed with a plurality of linear keys 54a which are fitted respectively in the plurality of linear key grooves 60b in the front frame 60 . the second lens group frame 54 has a rearward end thereof which is formed with a cam follower 54b which is abutted against an end - face cam 55c which is formed on an inner peripheral surface of the third lens group frame 55 . furthermore , the second lens group spring 61 is positioned between a front end of the second lens group frame 54 and a rearward end of the front frame 60 . further , the linear keys of the second lens group frame 54 are fitted respectively in the key grooves 60b in the front frame 60 . thus , the second lens group frame 54 and the front frame 60 are integrally rotated in the rotational direction , but are freely retractable in the optical - axis direction with respect to each other . in this connection , a biasing force of the second lens group spring 61 so acts as to abut the cam follower 54b against the end - face cam 55c which is formed on the third lens group frame 55 . the third lens group frame 55 holds or retains the third group of lenses 143 , and has an inner peripheral portion thereof which is formed with an end - face cam 55c on an end surface thereof in the optical - axis direction , which is displaced along a circumferential direction . the third lens group frame 55 is formed with a cam follower 55d which is abutted against a cam portion 58a of a focus cam ring 58 . fig1 is a partially - sectionalized , side elevational view showing the second lens group frame 54 , the third lens group frame 55 and the focus cam ring 58 , and showing the positional relationship between the cam followers 54b , the end - face cam 55c , the cam followers 55d and the cam portions 58a . the cam followers 54b of the second lens group frame 54 are biased against the end - face cam 55c of the third lens group frame 55 by the biasing force of the second lens group spring 61 . further , the cam followers 55d of the third lens group frame 55 are abutted respectively against the cam portions 58a of the focus cam ring 58 . moreover , as shown in fig7 the outer peripheral surface of the third lens group frame 55 is formed with a projection in which the bore 55a is formed in projection in the optical - axis direction . furthermore , the outer peripheral surface of the third lens group frame 55 is formed with a linear key 55b at a position substantially opposed against the projection with respect to the optical axis . a rod 89 which is retained between the shutter bottom plate 81 and the shutter closure 82 of the shutter unit is fitted in the bore 55a , and the linear key 55b is fitted in a groove ( not shown ) which is formed in the shutter bottom plate 81 . thus , the third group of lenses 55 is not rotatable , but is movable only in the optical - axis direction with respect to the shutter bottom plate 81 . as shown in fig9 the interlocking plate 66 is fixedly mounted on the outer peripheral portion of the middle frame 59 , and the outer - peripheral projection 60a of the front frame 60 is put into the gap 66a in the forward end of the interlocking plate 66 , whereby the middle frame 59 and the front frame 60 are connected to each other so as to be integrally moved angularly . further , the interlocking plate 66 is adapted to make the barrier drive changing - over lever 101 which connects the focal drive gear train 146 and the barrier drive gear train 147 to each other at the end face 66b of the interlocking plate 66 upon movement from a short focal end to a collapsible mount state , to a connecting state . as shown in fig6 the barrier drive ring 69 is fitted for angular movement in a forward end 53f of the first lens group frame 53 , at an inner diameter portion 69e . further , as shown in fig1 and 17 , the barrier drive ring 69 is connected to a barrier drive gear 100b by an internal gear 69a . the circumference or periphery of the connecting portion becomes a substantially or schematically closed state in the form of a bag . planar barrier springs 70 having an illustrated contour or shape are arranged two ( 2 ) at positions diametrically opposed against each other at the internal gear 69a and the opposite surface ( the side of the front surface of the camera ), to bias vanes or blades 71 , and to perform opening and closing of the barrier blades 71 and barrier blades 73 ( refer to fig1 and 17 ). each of the barrier springs 70 is a plate - like spring on which a bending or folding portion is formed midway thereof , and is arranged on a circumference of the barrier drive ring 69 as shown in fig1 and 17 . each of the barrier springs 70 has both ends thereof which are abutted against projections 69b of the barrier drive ring 69 . further , projections 69d are fitted in and are inserted respectively into guide grooves 69c which are provided in opening in the folding portion . the barrier springs 70 are arranged on the barrier drive ring 69 under a state in which movement in the optical - axis direction and in the rotational direction are regulated . as shown in fig6 the barrier blades 71 are arms which are angularly movable respectively around bosses 53g which are provided in projection on a forward end of the first lens group frame 53 . two ( 2 ) blades which are the same in contour as each other are arranged on the first lens group frame 53 . as shown in fig1 , each barrier blade 71 is formed with projections 71c biased respectively by the barrier springs 70 , projections 71a which drive respectively the barrier blades 73 under a closed state , and recesses 71b for biasing projections 73b of the barrier blade 73 upon an open state . the barrier blades 73 are arms which are angularly movable respectively around the bosses 53g at the forward end of the first lens group frame 53 , similar to the barrier blades 71 . two ( 2 ) blades the same in contour as each other are arranged on the first lens group frame 53 . as shown in fig1 , the barrier blades 73 are biased by the projections 71a of the barrier blades 71 toward a closed state , while the projections 73b are biased by the barrier blades 71 toward an open state , to thereby respectively perform opening and closing operations . a cover ring 74 is so arranged as to be mounted on the forward end of the first lens group frame 53 to regulate ( i . e . retain ) positions of the barrier drive ring 69 , the barrier blades 71 and the barrier blades 73 in the optical - axis direction . further , as shown in fig2 a - 21c and 22 , the fpc guide ( flexible printed circuit board guide ) 78 is formed with engagements 78b which are fitted in the linear key groove 52d in the fixed frame 52 , a cam follower 78c which is engaged with the cam groove 51c in the rotor frame 51 , and an arm 78a which urges a lens frame flexible circuit board 302 which is arranged within the lens frame . the lens frame flexible printed circuit board 302 is assembled by the arm 78a so as to become a u - shape . the lens frame flexible printed circuit board 302 is driven in the optical - axis direction through an amount of movement approximately half the amount of feeding of the first lens group frame 53 , by a cam of the rotary frame 51 . moreover , the fpc guide 78 is so arranged as to regulate the operating guide of the lens frame flexible printed circuit board 302 and expansion or spreading into the optical - axis direction by the arm 78a . furthermore , in a case where there is no fpc guide 78 , the flexible printed circuit board 302 spreads as shown in fig2 a - 26c . fig2 is a block diagram showing an arrangement of a principal portion of a drive circuit in the lens mount according to the first embodiment . further , fig2 is a conceptional view showing the flexible printed circuit board in which connection is made to the principal portion of the drive circuit . a shutter unit 3 is arranged within the lens mount . moreover , a focus motor 108 , a shutter plunger 111 , a shutter trigger photo reflector 110 , a focus photo interrupter 109 and the like are arranged within the shutter unit 3 . an actuator , a sensor or the like , a zoom motor 201 , a display device 307 , a release switch 318 and a control circuit 12 packed on a main circuit board 301 within the camera body are connected to each other by a lens frame flexible printed circuit board 302 . in this connection , the actuator , sensor and the like will subsequently be described in detail . returning to fig1 two ( 2 ) shutter blades 92a and 92b are arranged rearwardly of the shutter bottom plate 81 . the shutter blades 92a and 92b are normally closed so as to shield a flux of light or a luminous flux which is passed through the groups of lenses . by release operation , the shutter blades 92a and 92b open in a predetermined period of time and , subsequently , are closed . further , the shutter blades 92a and 92b are movably punted between blade retainers 93 and 94 which are fixedly mounted on the shutter bottom plate 81 . the blade retainers 93 and 94 are adapted to perform a guide function upon opening and closing operation of the shutter blades 92a and 92b . the focus motor 108 is fixedly mounted on the shutter bottom plate 81 . a pinion gear 105 is fixedly mounted on an output shaft of the focus motor 108 . the arrangement is such that angular movement output of the focus motor 108 is transmitted by the focal drive gear train 146 ( refer to fig7 ) to angularly move the focus cam ring 58 , to thereby perform a focusing operation . a sealing element 68 which is arranged at a forward end of the fixed frame 52 is an element for preventing water drops from entering the interior of the camera , and is made of elastic , material . the side rearward of the camera is fixedly mounted on the fixed frame 52 , while the outer peripheral side is fixedly mounted on the front side cover 21 . an inner diameter side thereof is urged against the first lens group frame 53 . linear feeding operation of the first lens group frame is possible , and a lip portion 68a in linear contact in the form of a ring with the first lens group frame 53 at forward and rearward two locations so that water drops do not enter the interior of the camera . subsequently , zoom operation of the lens mount according to the first embodiment will be described . first , zoom operation from a state of a lens frame short focal end illustrated in fig1 to the long focal side illustrated in fig3 will be described . when a drive electric power source is supplied to a zoom motor 201 ( refer to fig2 ) which is arranged at a predetermined location of the camera body , a gear 227 ( refer to fig5 ) is driven so that the rotary frame 51 is angularly moved . when the rotary frame 51 is rotated in the clockwise direction as viewed from the subject side , the cain followers 53a of the first lens group frame 53 are engaged with the cam groove 51b in the rotary frame 51 . since movement in the rotational direction is regulated ( i . e . prevented ) by the linear key groove 52a in the fixed frame 52 , the first lens group frame 53 moves linearly j n the optical - axis left - hand direction ( in the direction of the subject ) in the figure . at this time , the middle frame 59 is also moved in the optical - axis left - hand direction integrally with the first lens group frame 53 and , simultaneously , the middle frame 59 is rotated also in the clockwise direction by the cam on the inner periphery of the fixed frame 52 . by rotation of the middle frame 59 , the positions of the cams 59b of the middle frame 59 which is abutted against the roller 77 of the fourth lens group frame 57 are changed whereby the relative position of the fourth lens group frame 57 with respect to the first lens group frame 53 is changed . the interlocking plate 66 which is fixedly mounted on the outer periphery of the middle frame 59 is angularly moved integrally with the middle frame 59 . in keeping therewith , the front frame 60 and the second lens group frame 54 engaged with the front frame 60 by the linear key are also rotated through an rotational angle the same as that of the middle frame 59 . by this rotation , a contact position of the cam follower 54b of the second lens group frame 54 with respect to the end - face cam 55c of the third lens group frame 55 is changed . as a result , the relative spacing between the second group of lenses 142 and the third group of lenses 143 is changed . by angular movement of the rotary frame 51 , the fpc guide 78 i s also moved in the optical - axis left - hand direction only through the amount approximately half that of the first lens group frame 53 so that the lens frame flexible circuit board 302 mounted on the shutter bottom plate 81 restrains extension or expansion in the optical - axis central direction within the lens frame . the above description describes driving from the short focal side to the long focal side in the lens mount according to the embodiment . however , reverse driving from the long focal side to the short focal side can be realized by the fact that the rotary frame 51 is rotated in the counterclockwise direction . a focus drive mechanism in the lens mount according to the embodiment will subsequently be described . fig1 and 13 are exploded perspective views showing an arrangement of the focus drive mechanism according to the embodiment . as shown in fig1 and 13 , a focus motor 108 is fixedly mounted on the shutter bottom plate 81 . the focus motor 108 has an output shaft 108a thereof on which a pinion gear 105 is fixedly mounted . an idle gear 106 which is supported on a pivot on the shutter bottom plate 81 for angular movement is in mesh with the pinion gear 105 . further , an idle gear 107 which is supported on a pivot on the shutter bottom plate 81 for angular movement is in mesh with the pinion gear 105 . moreover , gears 83 , 84 , 85 and 86 are two - step gears for deceleration or reduction in speed and are supported on respective pivots on the shutter bottom plate 81 for axial movement . furthermore , a gear 87 is an idle gear , and is in mesh with a small diameter gear portion 86b of the gear 86 , a focus cam 58a and a gear portion 58b . in case where focusing is performed , a drive power source is supplied to the focus motor 108 from the side of the camera body . thus , the focus cam ring 58 is moved angularly . the third lens group frame 55 is regulated in angular movement thereof by a rod 89 and the linear key 55a , and is linearly moved in the optical - axis left - hand direction . at this time , since the second lens group frame 54 is also engaged with the linear key groove in the front frame 60 , the second lens group frame 54 is moved linearly in the optical - axis left - hand direction through the amount of movement the same as that of the third lens group frame 55 without being angularly moved . thus , the second lens group frame 54 and the third lens group frame 55 are moved in unison with each other in the optical - axis direction only through focal adjustment , which is determined by the zoom operation , without the spacing therebetween being changed , and is changed from the state illustrated in fig1 to a state illustrated in fig3 . a gear 88 is supported on a pivot on the shutter bottom plate 81 for angular movement , and is provided with a slit blade portion 88b . the slit blade portion 88b is counted by the focus photo interrupter 109 , whereby the number of revolutions of the motor is detected . specifically , pulses of the focus photo interrupter 109 are counted whereby it is possible to know the rotational angle of the focus cam ring 58 , that is , the feeding amounts of the respective second and third lens group frames 54 and 55 . gear 98 and two - step gear 99 are both supported in pivot on the barrier drive changing - over lever 101 for angular movement . further , the barrier drive gear 100 is supported on a pivot on the shutter bottom plate 81 for angular movement . a gear portion 100a at one end of the barrier drive gear 100 is in mesh with a large - diameter gear portion 99b of the two - step gear 99 . the barrier drive gear portion 100b at the other end of the barrier drive gear 100 is in mesh with the internal gear 69a of the barrier drive ring 69 . a barrier drive changing - over lever 101 is supported in pivot on the shutter bottom plate 81 for angular movement . one end 101a of the drive changing - over lever 101 is urged against the interlocking plate 66 . the barrier drive changing - over lever 101 is movable between a position where the gear 98 is in mesh with the gear portion 58b of the focus cam ring 58 and a position where a pin 101b is urged against the cam portion 60b of the front frame 60 so that a gear 98 is not in mesh with the gear portion 58b of the focus cam ring 58 . operation of the above - described focus drive mechanism will next be described . fig2 is a flow chart showing operation of the focus drive mechanism in the lens mount according to the present embodiment . operation of the mechanism will hereunder be described with reference to the flow chart , and fig1 and 13 . first , when the release sw 318 ( refer to fig2 ) is turned on ( step s0 ), distance measurement is performed by an auto focus sensor ( not shown ) ( step s1 ). at this time , the feeding amounts of the second group of lenses 142 and the third group of lenses 143 upon the focusing operation are found by operation or computation . the target number of feeding pulses naf is found from the computed feeding amounts . subsequently , the focus motor 108 is reversely rotated to perform lens resetting operation ( step s2 ). specifically , when the focus motor 108 is reversely rotated , the focus cam ring 58 is rotated in the direction indicated by a in fig1 . thus , the stopper 58c of the focus cam ring 58 is abutted against the stopper 81d of the shutter bottom plate 81 and stops . simultaneously with the reverse rotation of the focus motor 108 , the first timer starts ( step s3 ), and the first timer is reset every time that the pulse input signal is received from the photo interrupter ( pi ) 109 ( step s4 ). by end or termination of count of the first timer ( step s5 ), it is judged as being an end of resetting operation , and the focus motor 108 stops ( step s6 ). subsequently , the focus motor 108 is normally rotated , i . e . rotated in the normal direction ( step s7 ) and , simultaneously therewith , the second timer starts ( step s8 ). thus , the focus cam ring 58 is rotated in a direction indicated by an arrow b in fig1 . at this time , pulse signals from the photo interrupter 109 are monitored . the focus motor 108 is reduced in speed or is decelerated from the point of time the number of pulses reaches the feeding target pulse number naf -- 50 ( step s9 , step s10 ). at the time the number of pulses from the photo interrupter 109 reaches the target pulse number naf , the focus motor 108 stops ( step s11 , step s12 ). as a result , the second group of lenses 142 and the third group of lenses 143 are fed in accordance with the distance from the subject , and the focusing operation ends . subsequently , the shutter operates so that exposure is performed ( step s18 ). meanwhile , as described above , when the focus motor 108 is normally rotated , the second timer which has a time longer than the focusing operation starts ( step s8 ). in case where count of the second timer ends prior to the fact that count of the target pulse number naf ends ( step s14 , step s16 ), it is judged that the camera is out of order so that display of fault is performed on the display device 307 of the camera ( step s15 , step s17 ). the lens barrier drive changing - over mechanism in the lens mount according to the present embodiment will next be described with reference to fig1 to fig1 . fig1 is an explanatory view showing a transmitting state to the barrier drive system of the lens barrier drive changing - over mechanism . moreover , fig1 is an explanatory view showing a non - transmitting state to the barrier drive system of the lens barrier drive changing - over mechanism . the barrier drive changing - over lever 101 is supported by a pivot on the shutter bottom plate 81 for angular or swinging movement . furthermore , the gear 98 and the two - step gear 99 are supported by pivots on shafts , respectively , for angular movement , which are fixedly mounted in planting , on the barrier drive changing - over lever 101 . meanwhile , the barrier drive gear 100 is supported by a pivot on the shutter bottom plate 81 for angular movement . the gear 100a which is formed on one end of the barrier drive gear 100 and the gear 99b of the two - step gear 99 are in mesh with each other . further , the gear 99a of the two - step gear 99 is in mesh with the gear 98 . the barrier drive changing - over lever 101 has one end 101a thereof which is swingable between a position where the one end 101a is urged against the end face of the interlocking plate 66 ( refer to fig1 ) upon lens collapsible mount so that the gear 98 is in mesh with the gear portion 58b of the focus cam ring 58 ( refer to fig1 ), and a position where the pin portion 101b is urged against the cam portion 60c of the front frame 60 so that the gear 98 is not in mesh with the gear 58b ( refer to fig1 ). moreover , in fig1 , 17 and 18 , the barrier drive ring 69 is fitted on the forward end 53f of the first lens group frame 53 for angular movement . the barrier drive ring 69 has an inner diameter portion thereof which is provided with the internal gear 69a which is in mesh with the gear portion 100b which is formed on the other end of the barrier drive gear 100 . moreover , the barrier spring 70 is fixedly mounted on the barrier drive ring 69 . thus , the barrier blade 71 is adapted to be urged . the barrier blade 71 is mounted on the first lens group frame 53 for swinging movement around a swinging - movement center that is the boss 53d which is arranged at the forward end of the first lens group frame 53 . tire barrier blade 71 is formed with projections 71c which are biased by the barrier spring 70 , the projection 71a for driving the barrier blade 73 toward the closed state , and a recess 71b for biasing the projection 73b of the barrier blade 73 toward the open state . the barrier blade 73 is mounted on the first lens group frame 53 for angular movement around a swinging center that is the boss 53d at the forward end of the first lens group frame 53 , similarly to the barrier blade 71 . upon the barrier closed state , the barrier blade 73 is biased by the projection 71a of the barrier blade 71 , and upon the open state , the projection 73b is driven by the barrier blade 71 , to perform opening and closing operation . further , a cover ring 74 is mounted on the forward end of the first lens group frame 53 , to regulate the positions of the barrier drive ring 69 , the barrier blade 71 and the barrier blade 73 in the optical - axis direction . operation of the lens barrier drive mechanism will next be described . first , when the power sw is turned off , a power source is supplied to a zoom drive unit ( not shown ) so that the zoom motor 201 ( fig2 ) is rotated . thus , the rotary frame 51 is rotated in the counter - clockwise direction . moreover , the first lens group frame 53 is moved to the collapsible mount position . at this time , the middle frame 59 is also moved to the collapsible mount position by the movement of the first lens group frame 53 . furthermore , by the interlocking plate 66 which is rotated integrally with the middle frame 59 , one end 101a of the barrier drive changing - over lever 101 is urged . the barrier drive changing - over lever 101 is swung ( in the direction indicated by the arrow c in fig1 ) so that the gear 98 and the gear 58b are in mesh with each other ( refer to fig1 ). specifically , power of the focus motor 108 is transmitted to the barrier drive gear 100 . the power source is next supplied to the focus motor 108 . by the fact that the focus motor 108 is rotated in the counterclockwise direction , the power is transmitted to the barrier drive gear 100 through a gear train so that the barrier drive gear 100 is rotated in the counterclockwise direction . thus , by the fact that the gear 100b arranged on the one end of the barrier drive gear 100 and the internal gear 69a are in mesh with each other , the barrier drive ring 69 is rotated in the counterclockwise direction . at this time , the barrier blade 71 is urged by the barrier spring 70 so that the barrier blade 71 is swung in a barrier closed direction . meanwhile , the barrier blade 73 is urged against the projection 71a on the barrier blade 71 , and is likewise swung in the barrier closed direction . at this time , the pulse signals from the photo interrupter 109 are counted , and the motor stops at the time it is detected that the focus motor 108 is rotated through the predetermined pulse number required for barrier closing . when the power sw is turned on , the power source is first supplied to the focus motor 108 to rotate the focus motor 108 in the clockwise direction . thus , the power of the focus motor 108 is transmitted so that the barrier drive ring 69 is rotated in the clockwise direction . further , the projection 71b of the barrier blade 71 is urged against the barrier spring 70 so that the barrier blade 71 is moved in the open direction . meanwhile , the projection 73b is urged against the barrier blade 71 so that the barrier blade 73 is likewise moved in the open direction . at this time , similarly to the time of the above - described closure , the pulse signals from the photo interrupter 109 are counted . the motor stops at the time it is detected that the focus motor 108 is rotated only through a predetermined number of pulses . the power source is next supplied to the zoom drive unit ( not shown ) so that the zoom motor 201 is rotated . thus , the rotary frame 51 is rotated in the clockwise direction . as a result , the first lens group frame 53 is moved to a photographable position . furthermore , the middle frame 59 is rotated in keeping with the movement of the first lens group frame 53 . specifically , the front frame 60 is rotated through the interlocking plate 66 . at this time , since the cam portion 60c of the front frame 60 urges the pin 101b of the barrier drive changing - over lever 101 , the barrier drive changing - over lever 101 is swung to a position where the gear 98 and the gear 58b are not in mesh with each other ( refer to fig1 ). as a result , transmission between the barrier drive gear 100 and the focus motor 108 is cut off . thus , normal photographing is made possible . according to the above - described first embodiment , it is possible to provide the lens mount of the structure in which , in the optical system for the zoom lens which has a plurality of groups of lenses which change spacing therebetween upon the zoom operation , and which are fed integrally upon the focusing operation , the positions of the groups of lenses which are fed upon the focusing operation are maintained at high accuracy , and the size in the radial direction is restrained to be extremely low . specifically , the change of the group spacing due to the zooming of the focusing optical system is realized by the arrangement in which the end face cam is provided on any one of the lens frame which is angularly moved upon the zoom operation and the lens frame which is retained so as to be capable of moving linearly in the optical - axis direction , and the cam follower is provided on the other , whereby it is possible to realize a lens mount which is compact as a whole in which an increase of a size in the radial direction is restrained , the lens mount can be packed in the extremely reduced space because the drive force upon zoom operation is transmitted to the focusing group by the thin - plate like connecting element and , as a result , the other elements or the like can effectively be arranged in a blank space . moreover , due to the fact that the cam frame which transmits the zooming drive force to the plurality of lens mounts uses an extremely small amount of simple elements , the lens mounts can be retained easily and highly accurately . thus , it is possible to provide a lens mount of a small size at a low cost . furthermore , according to the aforementioned first embodiment , since the connecting portion between the internal gear and the barrier drive gear becomes schematically a closed state , it is possible to prevent powder dust or dirt or the like from entering this portion . thus , it is possible to prevent operational malfunction or failure or the like which is generated by the fact that dust or dirt and sand are adhered to the gear surfaces of the gears or the like and are put between the gears . further , angular movement and fitting of the barrier drive ring is performed by inner - diameter portions , whereby a space can be provided between the lower surface of the camera , of the outer peripheral portion on which the dust or dirt or the like is liable to be accumulated and the angular moving element . thus , even if the dust or dirt or the like is accumulated on this portion , no influence is exerted upon operation of the angular moving element . it is possible to prevent operational failure or malfunction . further , since a forward end surface adjacent to the angular movement fitting portion between the barrier drive ring and the lens mount are substantially in the same surface or are coplanar to each other , the dust or dirt or the like is difficult to be accumulated on the mouth of the angular movement fitting portion . thus , it is possible to prevent operational failure or malfunction due to the fact that the dust or dirt enters the fitting portion . moreover , according to the above - described embodiment , it is possible to prevent the light ray from shading by the fact that the flexible printed circuit board arranged within the lens mount extrudes into the effective light flux , by less number of parts , and it is possible to prevent operational failure or malfunction due to the fact that the flexible printed circuit board interferes with the movable element , and is put into the gap or the like between the lens frames . furthermore , according to the aforesaid embodiment , the lenses of the forward group of the zoom lenses are fixed whereby sealing treatment or processing for making the lens frame drip proof is sufficient to be performed only to the telescoped or expanded portions upon zoom . thus , the waterproof structure of the lens frame can be simplified . further , since no abundant or excessive load due to the sealing treatment is applied to the focus drive system , it is possible to compact the focus drive system . thus , control at high accuracy is made possible . moreover , if a comparison is made with a case where a cover glass is provided in front of the lens mount , it is not required or unnecessary to secure the moving space for the focus lens in the optical - axis direction . accordingly , it is possible to realize a lens mount which is shorter in overall length . thus , it is possible to provide the zoom lens mount which is of drip proof structure and which is small in size . a lens mount according to a second embodiment of the invention will next be described . the second embodiment is different from the first embodiment only in the drive mechanism for the fpc guide , and the other arrangements and functions are similar to those of the first embodiment . accordingly , only different points will be described here . fig2 and 28 are perspective views of a principal portion showing a drive mechanism for an fpc guide and a first lens group frame in the lens mount according to the second embodiment . as shown in fig2 , the second embodiment is arranged such that a first lens group frame 53 &# 39 ; and an fpc guide 78 &# 39 ; are driven by the use of lead screws 351 and 352 which are reverse in phase and which are the same in lead ( i . e . pitch ) as each other . the reduction gear ratio of gears 353 and 354 becomes about 2 : 1 , to thereby realize a feeding mechanism . furthermore , fig2 shows a modification of the second embodiment . in the modification , the reduction gear ratio of gears 357 and 358 is made to 1 : 1 , and lead of lead screws 355 and 356 of a reverse phase is made to about 2 : 1 , whereby the feeding mechanism can be realized . also in the second embodiment arranged as described above , advantages similar to those of the first embodiment can be expected . a lens mount according to a third embodiment of the invention will next be described . the third embodiment is different from the first embodiment only in the lens barrier drive changing - over mechanism . the other arrangement and function are similar to those of the first embodiment . accordingly , only differences will be described here . fig2 is a view showing a lens barrier drive changing - over mechanism in the lens mount according to the third embodiment . in the first embodiment , the barrier drive changing - over lever 101 is urged by the interlocking plate 66 into the direction in which the gear 98 and the gear 58b are in mesh with each other . in the third embodiment , however , as shown in fig2 , a pin 101c of a barrier drive changing - over lever 101 is urged by a rib 60a which is formed in protrusion by a cam portion 60c of a front frame 60 . also in the third embodiment arranged as described above , advantages similar to those of the first embodiment can be expected . as described above , according to the various embodiments , it is possible to provide the lens mount which is reduced in the size or dimension the radial direction . moreover , it is possible to provide a lens mount which prevents operational failure or malfunction which occurs due to dust or dirt and sand or the like which enter from the outside . furthermore , it is possible to provide the lens mount which has the mechanism which is secured to guide the flexible printed circuit board by lesser number of parts . in this invention , it is apparent that working modes different in a wide range can be formed on the basis of this invention without departing from the spirit and scope of the invention . this invention is not restricted by any specific embodiment except as many be limited by the appended claims . | 6 |
generally , the present invention provides a method and system for sizing ecds , the system and method that accounting for local and global process variations , and environmental variations . in addition , the present invention provides a method and system for choosing and pruning design points in process variables space and environmental variables space and a method and system for pruning a space of possible circuit sizings . the present invention provides tools that overcome the limitations of previous tools . first is a tool and flow that allows the analog designer to efficiently choose device sizes for circuits of small , medium , and larger size at the cell level , taking into account local process variation , global process variation , and environmental conditions to aim for 100 % yielding circuits . it overcomes the issues of the state - of - the - art approach by providing a means to handle larger numbers of design variables and / or larger numbers of performance metrics , i . e . handle larger circuits . it does this via data - mining and related techniques which prune the design space , and which choose & amp ; prune the corners . like the state - of - the - art , it supports varying degrees of automation . the flow is as follows : 1 . corners ={ typical global process corner & amp ; typical environmental corner } 2 . ( optional ) prune and / or provide bias to regions of design space , using one of the techniques describe later 3 . change device sizes to meet specifications at corners , using spice for feedback 4 . do monte carlo ( or similar ) sampling on new design 5 . if stopping conditions are met ( e . g . target yield is hit ), stop 6 . do pruned process - corner discovery using one of the techniques described later 7 . go to step 2 a variant of the above flow is to enter into it at step 4 with an initially sized design , then proceed as usual . another variant is to have a different set of corners in step 1 ( e . g . typical global process corner and many environmental corners ). in addition , the invention is a second tool and flow that provides a means to choose and prune the process & amp ; environmental corners which can then subsequently be used as inputs to other cad tools . its payoff is : better quality designs because the corners chosen are more representative of the actual variation ; faster time to design closure because generating representative corners is efficient . it will multiply the payoff of other tools that use it because they can use corners with these characteristics . fig2 shows an exemplary embodiment of an ecd sizing system 20 of the present invention . the system 20 includes an ecd database 20 that is in communication with a processor module 23 , which includes a sampler module 24 , a design point selection module ( dpsm ) 28 and a sizing module 30 . the processor module 23 is connected to a simulation module 26 , a display module 32 , and a user input module 34 . the ecd database 22 can include the ecd &# 39 ; s topology specifications represented as a netlist or as a schematic , performance metrics , design variables , process variables , environmental variables of the ecd , and any other suitable ecd - related information . the ecd database 22 can also define the steps to be followed to measure performance metrics of the ecd as a function of the ecd &# 39 ; s several variables ( e . g ., how to measure the power consumption of the ecd ). the ecd database can further include an initial setting of the sizes ( and of any other design variables ) associated to devices of the ecd . the ecd database 22 can be of any suitable type . that is , the ecd database 22 need not be a full - fledged relational database supporting advanced queries ; it could merely be , for example , a collection of files residing in a set of directories possibly across several machines . the performance metrics of the ecd can be a function of the variables specified in the ecd database 22 . the design variables can include , e . g ., widths and lengths of devices of the ecd , i . e ., adjustable dimensions of device features . the process variables can be related to random variations in the ecd manufacturing . the environmental variables can include , e . g ., temperature , load conditions and power supply . the ecd database 22 can also include , amongst others , further information about design variables , such as minimum and maximum values that features of the ecd &# 39 ; s topology can take . the ecd database 22 can also include constraints for each performance metric ( e . g ., power consumption & lt ; 1 mw ), device models ( e . g ., mos model files ), and a random joint probability density function ( jpdf ), or any other suitable density function , of process parameters to model manufacturing variation or , at least a way to draw random points from the jpdf , even if the jpdf itself is not directly accessible . as will be understood by the skilled worker , the procedure to be followed to measure the performance metrics of the ecd can be in the form of circuit test benches ( test harnesses ) that are combined with the netlist to form an ultimate netlist . the ultimate netlist can be simulated by the simulation module 26 , which is in communication with the ecd database 22 . the simulation module 26 can include , for example , one or more circuit simulators such as , for example , spice simulators . results from simulations performed by the simulation module 26 can be stored in the ecd database 22 . in the context of the present invention , the sampler module 24 selects , in accordance with data stored in the ecd database , process points and / or environmental points , and a set of simulations . the simulations are invoked through the simulation module 26 , in order to gather more information about a design point ( circuit sizing ) of the ecd in question . for example , information that can be obtained from the simulation results includes a yield estimate , and / or any other suitable information that can stored in the ecd database 22 , and / or be presented to a user of the system 20 through the display module 32 . a common form of sampling that can be performed by the sampler module 24 is monte carlo sampling ( mcs ) in which , e . g ., n process points are drawn from the ecd database 22 in accordance with a pre - determined probability distribution that models manufacturing variations . for each process point , each user - specified ( or pre - determined ) circuit analysis ( e . g ., ac , dc , transient ), and each environmental point for that analysis , a circuit simulation is performed , from which a performance metric of the ecd can be extracted ( e . g ., power consumption , gain ). one method of calculating yield is to merely count the number of feasible process points , that is , the number of process points that have met all performance constraints across all environmental points , and divide by n , the total number of process points . the simulations performed by the simulation module 26 can be readily displayed to the user through the display module 32 in any suitable format . for example , a waveform of voltage or current for a given pair of variables ( process point , environmental point ) can be displayed . as another example , multiple waveforms can also be displayed simultaneously to the user . further examples include displaying simulation results as performance metric measurements scatter plots in one , two , or three dimensions . furthermore , worst - case performance measurements , as measured across environmental points , can be displayed to the user . as yet another example , histograms , and box plots can be displayed to show a distribution of a given performance metric measurement . as will be understood by a person skilled in the art , the sampler module 24 can perform any suitable type of sampling such as mcs or latin hypercube sampling ( lhs ). lhs is similar to mcs except that in lhs , there is intrinsically at least one process point in every pre - specified sub - region of process variables space ( or environmental variables space ). this can enhance consistency of sampling and typically allows for convergence to tighter confidence intervals ( e . g ., in calculating the yield estimate of an ecd ) more quickly than mcs . lhs samples can be displayed through the display module 32 , just as mcs samples , and yield estimated in the same way . another example of sampling that can be performed by the sampler module 24 is importance sampling , in which there is a bias in drawing samples in process variables space , the bias being towards the boundary between infeasible and feasible design points of the ecd . this approach can make the confidence interval in the yield estimate tighten more rapidly than mcs or lhs . the simulation module 26 can perform specified analyses on a given design ( circuit topology and sizing ), at specified process point ( s ) and environmental point ( s ), using any number of specified test harnesses . a circuit topology is composed of circuit devices ( e . g . resistors , mos transistors , or even larger building blocks with set behavior such as op amp models ), and of the interconnections ( wires , conductors ) between the devices . sometimes the topology can include extra components from parasitic extraction of a layout . a test harness is merely a representation of more devices , and interconnections , plus energy sources ( e . g . oscillating voltage ), and means of measurement ( e . g ., probes on given nodes and / or mathematical formulae that ultimately output scalar values of performance ) to be connected to the ecd . the simulation module 26 typically solves one or more sets of differential equations as part of its analysis . in the context of circuit design software , “ spice ” refers to a particular class of simulation modules that are very popular . the dpsm 28 takes as input design points ( also referred to as design corners , or simply “ corners ”) sampled by the sampler module 24 in accordance with the ecd particulars defined in the ecd database 22 . the dpsm 28 can also take as input any other suitable design points ( e . g ., design points determined in accordance with historical data for similar ecds ). the input taken from the sampler module 24 can be mcs data , lhs data , importance sampling data , or any other suitable sampling data . the selected design points can be obtained from the ecd database 22 or can be passed on to the dpsm 28 directly from the sampler module 24 . the selected design points can be displayed to the designer through the display module 32 , used by the designer , and / or output for use by other tools ( e . g ., cad tools ). further , as will described later , other inputs to the dpsm 28 can include , for example , a previous round of corners to be pruned , and user specifications such as the maximum number of corners allowed , maximum number of simulations , maximum runtime , target yield , and any other suitable strategy parameters . a general aim of corner discovery approaches ( i . e ., of design point selection ) is to have a set of corners that are representative enough of the yield - improvement problem such that if all constraints are met on all the corners , then the yield can approach , or hit , 100 %, and even improve the margin of performances ( e . g ., improve process capability “ cpk ”). a secondary aim of corner discovery ( design point selection ) is that the corners should not be impossible , near - impossible , or impractical to meet . for example , if target gain is & gt ; 60 db then there is no need to have a corner that tends to return gains of 130 db . an additional aim of corner discovery is that the number of corners should be minimal , or at least the total time to simulate on all corners should be minimal . further , another aim of corner discovery would be to have the user / designer understand how the corners were selected / generated , and have a means to understand why each specific corner is chosen . there are numerous approaches that can be used by the dpsm 28 to select design points / corners . exemplary approaches are summarized in table i . in a first approach , the dpsm 28 selects design points that capture the bounds of each performance metric of the ecd . in order to do so , each performance metric of each design point sampled by the sampler module 24 is calculated by the simulation module 26 , and can be stored in the ecd database 22 . the dpsm 28 accesses the ecd database 22 and selects , for each performance metric , a design point having a maximum performance metric value , and a design point having a minimum performance metric value . fig3 shows an example of this type of design point selection for an ecd having two performance metrics . as seen in the scatter plot of fig3 , the selected design points , denoted by open squares , are attributable to a maximum and a minimum value for each performance metric . another approach that can be used by the dpsm 28 to select design points / corners is by performing inverse non - dominated filtering on the performance metrics of the design points sampled by the sampler . non - dominated filtering finds a set of non - dominated points , where each point is nondominated only if it its performance metrics vector is not dominated by any other points &# 39 ; performance metric vectors . a performance metrics vector p1 dominates another vector p2 if p1 &# 39 ; s performance metric values are at least as good as each of p2 &# 39 ; s metric values , and better than at least one of p2 &# 39 ; s metric values . inverse nondominated filtering is like nondominated filtering , except for each performance metric , the direction of “ good ” vs “ bad ” is reversed . for example , in nondominated filtering the direction of a “ good ” power consumption is to minimize , and “ bad ” is to maximize ; whereas in inverse nondominated filtering the direction of “ good ” power consumption is to maximize , and “ bad ” is to minimize . fig4 shows an example of this type of design point selection for the same ecd having the same two performance metrics analyzed at fig3 . as seen in the scatter plot of fig4 , the selected design points , denoted by open squares , are disposed somewhat along a low performance contour . yet another approach that can be used by the dpsm 28 is to cluster design points selected by inverse non - dominated filtering based on a distance measurement in metric space . fig5 shows how the six selected design points of fig4 have been clustered into three design points , denoted by open squares . a further approach that can be used by the dpsm 28 to select design points / corners is to select corners that capture worst - case performance metric values . the worst - case performance metric value is a maximum metric value when , by definition , the metric value should be minimized in the ecd . the worst - case performance metric value is also a maximum metric value when , by definition , the metric value should be greater than , or equal to a threshold value . conversely , the worst - case performance metric value is a minimum metric value when , by definition , the metric value should be maximized by the ecd and , the worst - case performance metric value is also a minimum metric value when , by definition , the metric value should be less than , or equal to a threshold value . an additional approach that can be used by the dpsm 28 is to cluster design points selected by capturing worst - case performance metric values . in this case , the clustering can be performed in process variables space and / or environmental variables space . that is , design points that have worst - case performance metric values , and that are near each other in process variables space and / or environmental variables space can be clustered . another approach that can be used by the dpsm 28 to select design points / corners is to select corners that capture worst - case performance metric values as described above and then , from these selected corners , choose corners that have infeasible values , an infeasible value being a value that is outside pre - determined boundaries . a design point having infeasible values can be a design point that fails with respect to each performance metric of the ecd . further , the chosen corners can be clustered in process variables space and / or environmental variables space . that is , design points that have worst - case performance metric values , and that are near each other in process variables space and / or environmental variables space can be clustered . a further approach that can be used by the dpsm 28 to select design points / corners is to select a single corner that is the most detrimental to the ecd &# 39 ; s yield . this corner can be selected by simulating the sample points obtained by the sampler module 24 with a plurality of test harnesses and , for each of the plurality of simulations , to calculate , for each sample point , a yield of the ecd . the corner / design point having the worst yield is the one selected . another approach that can be used by the dpsm 28 to select design points / corners is to simulate the sample points obtained by the sampler module 24 with a plurality of test harnesses and , for each of the plurality of simulations , to calculate , for each sample point , a yield of the ecd . the corner / design points selected correspond to those with the worst yield for each test harness . yet another approach that can be used by the dpsm 28 to select design points / corners is to model each performance metric as a function of at least one of process variables and environmental variables , and to optimize each model to obtain , for each performance metric , a design point having a maximum value , and a design point having a minimum value . alternatively , the optimization can be performed to obtain the design point having a minimum value only . as described above , some of the approaches used by the dpsm 28 to select design points / corners apply inverse non - dominated filtering on the performance metric values , such that the corners that give the tradeoff of worst - case performances are selected . also , several approaches apply clustering in performance space , or in process / environmental space in order to reduce the number of corners . any suitable clustering algorithm can be used , such as , for example , k - means clustering , hierarchical agglomerative clustering , or fuzzy c - means clustering . especially interesting for the clustering algorithms is that they can respond to user - input specification of maximum number of corners , which can be input through the user input module 34 . another technique that the dpsm 28 can use to select design points / corners is to define a corner as a 3 - tuple of ( process point , analysis , environmental point ) instead of just a process point , or a ( process point , environmental point ). if just a process point was specified , then the designer would still have to simulate all analyses and environmental points at the given process point ; and similarly for ignoring the analysis , whereas with an exact specification then it makes the simulation required to be fully specified . another technique that the dpsm 28 can use to select design points / corners is to consider only corners that cause unfeasibility . a further technique to select design points / corners to only consider corners that cause the highest constraint violation ( difference between target specification and measured value ). in order to fairly compare violations of different performance metrics , the violation measures need to be scaled to have substantially the same range . a simple way to do this for a given metric is to merely measure the maximum and minimum value found across all samples , and divide the violation by ( maximum − minimum ). approach ix of table i embodies this well : by choosing a corner for each analysis , it will return a value for each performance metric . by choosing the meanest corner at a given analysis , i . e ., the corner that causes the highest constraint violation , it ensures that solving the meanest corner will likely solve other corners simultaneously ( and is therefore efficient ). approaches such as the exemplary approaches listed in table i can also be used in various combinations as well . from a user perspective , he may have an option of choosing which approach to apply to the sample data to select a set of corners , or he may just request the most representative corners and perhaps specify a maximum number of corners . the designer can also apply different filtering approaches sequentially . for example , the designer can use approach i in a first round of design point selection , and then , e . g ., use approach vi in a subsequent round of design point selection . fig6 shows an exemplary user interface 40 that can be displayed to the user / designer by the display module 32 during a sizing run of an ecd using the system 20 . the interface 40 includes a statistical corners pane 42 , a design candidate pane 44 , and a corner performances pane 46 . a pointing device such as , for example , a computer mouse , can be part of the user input module and used to select elements on the interface 40 . the interface 40 is for an exemplary ecd having power , bandwidth , and phase margin as performance metrics . further , the ecd in question has four variables sizes : m1_l , m1_w , m2_l and m2_w . as shown in the exemplary statistical corners pane 42 , the corners ( design points ) selected by the dpsm 28 are those that have the worst - case power , the best - case power , the worst - case bandwidth and the best - case bandwidth . to discover such design points , the user clicks ( or selects through any suitable means ) the discover corners button 43 . in the present example , four discovered design points ( or design candidates ) are presented to the user in the design candidate pane 44 as candidates 1 through 4 . even though four design candidates are shown in the present example , the present invention is applicable to any suitable number of design candidates . each design candidate can have its size changed by the designer through the user input module 34 . further , the user can add one or more candidate manually by selecting the add candidate button 45 , which invokes the sizing module 30 . to simulate the design candidates the user can select the simulate button 47 in the corner performance pane 46 . alternatively , the simulation can be done automatically . the corner performance pane 46 shows power and bandwidth for each of the candidate designs 1 through 4 for a series of simulations for each candidate design . the line 48 indicates a pre - determined maximum value for power and the line 50 indicates a pre - determined minimum value for bandwidth . the circles represent simulations meeting the pre - determined criteria of power and bandwidth . the squares represent simulations failing these pre - determined criteria . as will be understood by the skilled worker , the statistical corners pane 42 provides the user with different choices of how to discover candidate designs . alternatively , the user interface 40 can include a pane ( not shown ) where an interactive two - dimensional plot of design points , such as , e . g ., those presented at fig3 to 5 , that allows the user to select / unselect corners himself , e . g ., by clicking on corners . further , the user interface 40 can have a pane ( not shown ) listing corners that can be selected by the user . with the various embodiments of the user interface , the user / designer can select corners , design with them , simulate at them , save them to the ecd database 22 , export them , etc . he may also load or import previously set corners from the ecd database 22 . once the corner performance pane 46 shows successful simulations only , the user can have confidence that the design candidates of the design candidate pane 44 are properly sized . the sizing module 30 of the system 20 can support a fully manual design flow , a fully automatic flow , or a mix of manual and automatic flows . in the manual flow of the sizing module 30 , the user changes design variables ( sizings ) through the user interface 40 and then invokes simulations across sample points to get feedback about performance metrics of the ecd , visualizes results , then repeats until convergence ( e . g ., all constraints on performance metrics are met on all design points ). it is possible that a single button click can be used to invoke all the simulations and have all the results displayed to the user automatically through the display module 32 . as will be understood by the skilled worker , the results can be displayed along with computations on top of raw results to aid intuition . with modern fast simulators and / or parallel processing , this turnaround time can be as quick as a few seconds . therefore the flow for the user to manually size a circuit to be feasible on all the corners can be very rapid — it is possible for the user to design a 100 % yield circuit in minutes , with full control . as seen at fig6 , the exemplary user interface 40 allows the user to select performance metrics criteria that are used as a basis for discovering corners . a click of the discover corners button 43 can cause the design candidates to be displayed automatically in the design candidates pane 44 , and can cause simulation of these corners to be performed , and the results to be displayed automatically in the corner performance pane 46 , and vice - versa . the corner performance pane 46 shows representations used to compare the results of each design candidate across the full statistical corners . there is a data point shown for each measurement that is output by spice simulation ( or by any other suitable simulation ). each individual plot &# 39 ; s x - axis includes a discrete value for each design candidate ( 1 through 4 in this example ). for each design candidate , the set of corner values is represented as circles for corners where the specifications are being met , and as squares for corners where the specification is not being met . by placing the results for the design candidates next to one another , the designer can easily compare the results and pick the most promising design candidate . the sizing module 30 can also support a fully automatic flow , in which any suitable embodied optimizing algorithm ( i . e ., an optimizer ) can do substantially the same loop as manual sizing but in an automatic way . that is , the optimizer tries different sizings in accordance with pre - determined instructions , invokes simulations , gets feedback , and tries new sizings based on the feedback , until convergence . there could be a mix of manual and automation as well . for example , the user can supply a starting point from which the optimizer does a local optimization . or , as another example , during the course of the optimization the user tracks progress via visual feedback through the display module , and , based on the progress , the user guides the optimizer , e . g ., suggests new designs , changes the allowed design variable search space , changes the biases towards different objectives and constraints and corners , adds or removes corners , or stops the optimization run . fig7 shows another embodiment of the present invention . the system 21 of fig7 differs from the system 20 described above in that the processor module 23 also includes a pruning module 50 . as is described below , the pruning module 50 can drastically simplify the problem of sizing an ecd by pruning down the number of design variables to size . the pruning module 50 takes as input , for a given ecd , the design points sampled by the sampler 24 and simulated by the simulation module 26 . based on this data , the simulation module 26 calculates a value of each performance metric of the ecd . the pruning module 50 then calculates an impact of each process variable ( and / or environmental variables ) on the performance metrics . subsequently , the pruning module 50 , based on the impact of each process variable on the performance metrics , calculates an impact of each device of the ecd on the performance metrics . the pruning module 50 then identifies the device ( or devices ) having the biggest impact on the performance metrics . once the highest impact device ( or devices ) are identified , the pruning module identifies the design variables ( sizes ) of the ecd that are not present in the highest impact device ( s ) and sets to a constant value the identified variables . effectively , the pruning module 50 can greatly simplify the sizing of an ecd by identifying the design variables that have no relevance to the highest impact devices of the ecd , and , by assigning constant values to those identified variables . this allows the user to size the highest impact design variables ( sizes ) first without having to worry about the lesser important design variables . alternatively , instead of setting the less important design variables to constant values , the pruning module 50 can communicate these variables , and their importance with respect to the highest impact devices , to the user through , e . g ., the display module 32 . the user can then assess the importance of the design variables and , in accordance with his assessment , select which ones to vary . this assessment in fact biases the user &# 39 ; s choice in which design variables ( sizes ) to vary . once the importance of the design variables has been assessed and / or the lowest importance variables set to constant values , the procedure for sizing the circuit is substantially the same as that described in relation to the interface 40 of fig6 . in other words , the pruning module 50 takes the “ sample data ” as an input along with the overall design space , and outputs a reduced design space and / or biases . it prunes / biases the design space using the following steps : ( 1 ) from “ sample data ”, extract relative importance of process variables ( 2 ) sum up relative importance of process variables across devices to get relative importance of devices ( because each process variable is associated with a device ) ( 3 ) freeze design variables that are not associated with the most important devices , and return the corresponding design space ; or alternatively ( 3 ) return relative impacts of design variables and let those be treated by the user as biases of which variables to change . the designer can then use the dpsm 28 in that reduced space . in the case where the space was pruned too much and he cannot hit the target design , the designer can expand the design space again . however , in most cases , the pruned design space contains designs that will meet the target performances at the corners . the impact of the process variables on the performance metrics can be calculated in any suitable way . for example , one way is to compute correlations between process variables and feasibility , where the higher the absolute correlation between a process variable and feasibility means a higher impact . a related way is to use an analysis of variance , such as anova , or related statistical inferences . another possible way to calculate the impact of the process variables on the performance metrics is to build a two - class classifier mapping process variables to classes of { feasible , infeasible } sets of performance metrics , using the “ sample data ”, obtained from the sampler module 24 , to construct the input / output training data , then extract the relative importance of each variable in the mapping from the classifier . the building of the classifier can be automatic . a feasible set of performance metrics is one where all performance metric values satisfy pre - determined ecd criteria . an infeasible set of performance metrics can be one where one or more performance metric values fails to satisfy pre - determined ecd criteria . another way to obtain an impact of each process variable on the performance metrics of the ecd is to build one regression model for each performance metric to map the process variables to worst - case performance values ( worst - case across environmental points ), then , for each regression model extract the relative importance for each variable on the performance metric . this is followed by summing the relative importances ( with or without weights on the sum ). some classifiers and regressors provide direct means to extract relative importance of variables , but some do not ; a general way to extract relative importance from classifiers , or regressors , can be accomplished using a method that can be written as steps a through i below : a ) error_per_variable = { } b ) for each variable v c ) error = 0 d ) repeat num_scrambles times e ) x_scr = x but randomly permute v &# 39 ; s row f ) y_scr = simulate regressor on x_scr g ) error = error + rmse ( y , y_scr ) h ) error_per_variable { v } = error i ) impacts = normalize error_per_variable the general idea of the algorithm is : the more error that occurs when a variable &# 39 ; s inputs are “ scrambled ”, then the more impact the variable has . step a initializes the data structure error_per_variable , which is a map that will hold a scalar entry of “ error ” for each of the model &# 39 ; s input variables . step b starts the loop that iterates across each variable , to find that variable &# 39 ; s error . the error is set to zero at step c . the loop will find the error by doing a random permutation of (“ scrambling ”) the training inputs for that variable ( step e ), simulating the regressor with the modified training input data ( step f ) to get output values y_scr , and in step g computing the root - mean - squared - error ( rmse ) of y_scr compared to the known true values , y . step g also updates the error for that variable v . it repeats steps d - g num_scrambles times for variable v , e . g ., 50 - 500 times . finally , step 1 normalizes the error_per_variable by merely dividing each error value by the sum of all error values . alternatively the pruning module 50 can be used to invoke ecd simulations , such as , e . g ., spice simulations , simulating at different design points , i . e ., for different sizes of the design variables , in order to gather data to extract design variable impacts directly instead of linking design variable impacts to random variable impacts via devices . there are many possible implementations of this approach . one embodiment does ( 1 ) a space - filling sampling in design variable space ( e . g ., lhs in a uniform distribution bounded by design variable bounds ), ( 2 ) at each design point , simulate at all the corners , and ( 3 ) extract design variable impacts from the simulation data , e . g ., with correlation or one of the model - building approaches described above . another embodiment would use a “ growing ” approach : ( 1 ) start with an initial design point ( e . g . supplied by user ) and an initial small hypercube about the design point ; ( 2 ) set all design variables ×{ increase , decrease } as possible expansion directions ; ( 3 ) do space - filling sampling in the design space defined by the hypercube ; ( 4 ) simulate the new design points at corners ; ( 5 ) prune away expansion directions that significantly hurt performance ; and ( 6 ) stop if no directions left , else go to ( 3 ). these are two possible examples for “ design space pruning ” with spice simulation ; however , any other suitable type of design space pruning can be used . fig8 shows another embodiment of a system of the present invention . the system 60 of fig8 differs from the system 20 described above in that the processor module 23 does not include a sizing module . the processor module 23 of the system 60 , instead of determining sizes of an ecd , outputs design candidates ( design points / corners ) to a cad module 62 , which uses its own methods to size the ecd . a database 64 , containing data relevant to the cad module can be in communication with the cad module 62 . the cad module can be any cad tool that naturally uses corners , such as , e . g ., a timing analyzer , or an automated circuit sizer . fig9 shows a flow chart of an exemplary method of sizing an ecd of the present invention . the ecd has an initial first set of sizes attributable to dimensions of ecd &# 39 ; s devices . at step 70 , at least one of process variables space and the environmental variables space are sampled to obtain a first set of sample points . subsequently , at step 72 , the ecd is simulated in accordance with the first set of sizes , at the first set of sample points to obtain first simulation data . at step 74 , a value for each performance metric of the ecd is calculated in accordance with the first simulation data to obtain a first set of performance data . at step 76 , it is determined if a portion of the first set of performance data is outside pre - determined boundaries . if the answer to the determination of step 76 is no , then the method end at step 78 . however , if a portion of the first set of performance data is outside the pre - determined boundaries , then , at step 80 a selection , from the first set of samples points is made , in accordance with the first set of performance data and in accordance with pre - determined rules , samples points to obtain a set of selected sample points . this is followed , at step 82 , with a step of varying at least one size of the first set of sizes to obtain a second set of sizes . subsequently , steps 72 to 80 are repeated until the performance metrics are all within their respective pre - determined ranges . that is , the step of simulating the ecd , in accordance with the second set of sizes , at the set of selected sample points to obtain second simulation data , is performed . this is followed by calculating a value for each performance metric in accordance with the second simulation data to obtain a second set of performance data . then , a step of determining if the second set of performance data is outside pre - determined boundaries is performed . the pre - determined rules of step 80 can be in accordance with any of the approaches described above in relation to table i . for example , the pre - determined rules can include selecting , for each performance metric , a sample point having a maximum performance value and a sample point having a minimum performance value . further , the pre - determined rules can include selecting one or more sample points through inverse non - dominated filtering of the first set of sample points . additionally , the inverse non - dominated filtering of the first set of sample points can be followed by a clustering of the sample points , the clustering being in accordance with a pre - determined performance scaling criteria . any suitable clustering algorithm can be used such as , for example , k - means clustering , hierarchical agglomerative clustering , or fuzzy c - means clustering . further , the pre - determined rules can include selecting , for each performance metric , a sample point having a worst - case performance value , the worst - case performance value being one of : ( a ) a maximum performance value for a performance metric to be minimized in the ecd ; ( b ) a maximum performance value for a performance metric that is to set equal or greater than a pre - determined threshold in the ecd ; ( c ) a minimum performance value for a performance metric to be maximized in the ecd ; and ( d ) a minimum performance value for a performance metric that is to set equal or smaller than a pre - determined threshold in the ecd . this can be followed by a clustering of the sample points in accordance with at least one of a pre - determined process variables space scaling criteria and a pre - determined environmental variables space scaling criteria . alternatively , the minimum performance value criteria can be such that the minimum performance value is outside a pre - determined feasibility range . additionally , selecting can be followed by a step of clustering a clustering of the sample points in accordance with at least one of a pre - determined process variables space scaling criteria and a pre - determined environmental variables space scaling criteria . the step of automatically simulating the ecd can include simulating the ecd at the first set of sample points ( corners ), with a plurality of test harnesses , and the first simulation data can include simulation data for each test harness , the performance data including performance data for each test harness ; and , the pre - determined rules include calculating , for each test harness , in accordance with its respective performance data , a yield of the ecd for each sample point ; and selecting a sample point associated with a lowest yield of the ecd . the step of automatically simulating the ecd can include simulating the ecd at the first set of sample points , with a plurality of test harnesses , the first simulation data including simulation data for each test harness , the performance data including performance data for each test harness ; and , the pre - determined rules include calculating , for each test harness , in accordance with its respective performance data , a yield of the ecd for each sample point ; and selecting , for each test harness , a sample point associated with a lowest yield of the ecd . the step of selecting , for each performance metric , the sample point having a maximum performance value and the sample point having a minimum performance value , can include modeling each performance metric as a function of the at least one of the process variables space and the environmental variables space , to obtain a model of each performance metric ; and , optimizing the model of each performance metric to obtain the sample point having a maximum performance value and the sample point having a minimum performance value . the step of selecting , for each performance metric , the sample point having a worst - case performance value , can include : modeling each performance metric as a function of the at least one of the process variables space and the environmental variables space , to obtain a model of each performance metric ; and optimizing the model of each performance metric to obtain the sample point having the worst - case performance value . the step of selecting , for each performance metric , the sample point having a worst - case performance value can include : modeling each performance metric as a function of the at least one of the process variables space and the environmental variables space , to obtain a model of each performance metric . for each performance metric to be maximized in the ecd , the model of each performance metric is optimized to obtain a sample point having a respective minimum performance value . for each performance metric to be minimized in the ecd , the model of each performance metric is optimized to obtain the sample point having a respective maximum performance value . the performance metrics can include at least one of an area of the ecd , power consumption , gain and bandwidth . simulating the ecd can include simulating the ecd in accordance with an analog electronic circuit simulator . sampling can include monte carlo sampling from a distribution describing manufacturing variations of the process variables . sampling can include latin hypercube sampling from a distribution describing manufacturing variations of the process variables . fig1 shows a flowchart of a flow chart of another exemplary method of sizing an ecd of the present invention . the exemplary method represented at fig1 first reduces the number of variables to size before actually sizing these variables . this is accomplished by sampling the process variables , and , optionally , the environmental variables , at step 90 . at step 92 , the ecd is simulated in accordance with the sampled points . values of the performance metrics of the ecd are calculated at step 94 , in accordance with the sampled points obtained at step 92 . at step 96 , the impact of each process ( and / or environmental ) variables on each performance metric is calculated . subsequently , at step 98 , in accordance with the results obtained up to step 96 , the impact of each device on each performance metric is calculated . following this , at step 100 , the ecds device having the lowest impact on the performance metrics is identified and , at step 102 , the design variables related to the lowest impact device are identified . at step 104 , the design variables that are not related to the highest impact device are frozen . finally , at step 106 , the ecd is sized by varying only the variables related to the highest impact device . any suitable method of sizing the ecd can be used at step 106 , including any embodiment of the method shown at fig9 and described above . the exemplary method shown at fig1 is to size an ecd that has associated thereto design variables , process variables , and environmental variables , the design variables , process variables and environmental variables respectively define a design variables space , a process variables space and an environmental variables space , the ecd has devices . the devices have associated thereto variable dimensions ( sizes ), the variable dimensions are part of the design variables . the variables dimensions have associated thereto a first set of sizes , the ecd further has associated thereto performance metrics . the method comprises steps of : sampling the process variables space to obtain a first set of sample points ; automatically simulating the ecd at the first set of sample points , in accordance with the first set of sizes , to obtain first simulation data ; calculating , in accordance with the first simulation data , for each of the sample points , a value of each of the at least one performance metrics to obtain a first set of performance data ; calculating , in accordance with the first set of performance data , an impact of each process variable on the at least one of the performance metrics ; calculating , in accordance with the impact of each process variable on the at least one of the performance metrics , an impact of each device on the at least one of the performance metrics ; identifying , in accordance with the impact of each device on the at least one of the performance metrics , one or more devices each having an impact on the at least one of the performance metrics that is less that a pre - determined minimum impact , to obtain a lowest impact device ; identifying design variables upon which the lowest impact device set depends , to obtain identified design variables , the identified design variables including at least one size of the first set of sizes ; fixing each of the identified design variables to a constant value , to have the first set of sizes include fixed sizes and variables sizes ; varying at least one variable size of the first set of sizes to obtain a second set of sizes ; selecting , from the first set of sample points , in accordance with the first set of performance data , and in accordance with pre - determined rules , a second set of sample points ; automatically simulating the ecd , at the second set of sample points , for the second set of sizes , to obtain second simulation data ; calculating , in accordance with the second simulation data , a value of each of the performance metrics to obtain a second set of performance data ; determining if the second set of performance data is outside pre - determined boundaries ; if the second set of performance data is outside the pre - determined boundaries , varying at least one size of the second set of sizes to obtain a third set of sizes ; automatically simulating the ecd , at the second set of sample points , for the third set of sizes , to obtain third simulation data ; calculating , in accordance with the third simulation data , a value of the performance metric to obtain a third set of performance data ; determining if the third set of performance data is outside the pre - determined boundaries ; and , if the third set of performance data is inside the pre - determined boundaries , storing the third set of sizes in a computer - readable medium . once the sizes of the features of the device on the ecd have been determined , they can be used in the actual fabrication of the ecd . the pre - determined rules can be base on any suitable approach , including the approaches listed at table i , and described above . alternatively , as shown as fig1 , the process variables space can be sampled at step 150 to obtain corners ( design points ), and the design variables ( sizes ) can be sampled at step 150 to obtain candidate designs . subsequently , at step 154 , the ecd can be simulated for each candidate design , at each corner . following this , at step 156 , values of the ecd &# 39 ; s performance metrics are determined for each combination of design variable sample and corner . at step 158 , the impact of each design variable on the performance metrics is determined . at step 160 , the design variables having the lowest impact on the performance metrics are identified , and , at step 162 , the identified design variables are set to constant values ( i . e ., they are frozen ). finally , at step 164 , the ecd is sized by varying design variables other that the frozen variables . the design flow as outlined in the summary , including all its variants including manual sizing including fully automated loop including automated sizing including mix of automated and manual sizing including when the design space is pruned including when the design space is not pruned each of the methods to prune and / or bias the design space , including : data - mining to get impacts from sampling variable - sweep in design variable space on corners =& gt ; impact extraction variable - sweep in design variable space on corners =& gt ; choose design hypercube space - filling sampling in { design , random , environmental } space =& gt ; data - mining =& gt ; impact extraction space - filling sampling in design space on corners + data - mining to get impact adaptive sampling to find bounds of feasible region ( across corners ) adaptive sampling to find mappings from design variables =& gt ; worst - case performances across corners more combinations of the above each of the methods to choose & amp ; prune the corners , as ( random ) or ( random , environmental ) corners any of the methods to prune and / or bias the design space , where the results are used as inputs to other cad tools any of the methods used to choose & amp ; prune corners , where the resulting corners are used as inputs to other cad tools in the preceding description , for purposes of explanation , numerous details are set forth in order to provide a thorough understanding of the embodiments of the invention . however , it will be apparent to one skilled in the art that these specific details are not required in order to practice the invention . in other instances , well - known electrical structures and circuits are shown in block diagram form in order not to obscure the invention . for example , specific details are not provided as to whether the embodiments of the invention described herein are implemented as a software routine , hardware circuit , firmware , or a combination thereof . embodiments of the invention can be represented as a software product stored in a machine - readable medium ( also referred to as a computer - readable medium , a processor - readable medium , or a computer usable medium having a computer - readable program code embodied therein ). the machine - readable medium can be any suitable tangible medium , including magnetic , optical , or electrical storage medium including a diskette , compact disk read only memory ( cd - rom ), memory device ( volatile or non - volatile ), or similar storage mechanism . the machine - readable medium can contain various sets of instructions , code sequences , configuration information , or other data , which , when executed , cause a processor to perform steps in a method according to an embodiment of the invention . those of ordinary skill in the art will appreciate that other instructions and operations necessary to implement the described invention can also be stored on the machine - readable medium . software running from the machine - readable medium can interface with circuitry to perform the described tasks . the above - described embodiments of the present invention are intended to be examples only . alterations , modifications and variations may be effected to the particular embodiments by those of skill in the art without departing from the scope of the invention , which is defined solely by the claims appended hereto . | 6 |
the present invention relates to an improved radioassay for vitamin b 12 which is characterized in employing as the intrinsic factor preparation a saline extract of mouse or rat stomachs . such mouse or rat derived intrinsic factor , unlike the intrinsic factor preparations derived from higher mannals , such as hog , is essentially free of r - protein . thus the use of the mouse or rat derived intrinsic factor in radioassay for vitamin b 12 will not mask cobalamin deficiency in the assay subject , since these intrinsic factor preparations are specific for true cobalamin . additionally , the use of mouse or rat derived intrinsic factor avoids the necessity of having to undertake the inefficient , time - consuming , and expensive purification procedures , such as affinity chromatography , required for intrinsic factor preparations obtained from other mammalian sources contaminated with r - protein . in a further aspect of the invention , it has been found that maximum efficiency in the assay procedure is obtained by carrying out extraction of the serum sample with cyanide buffer at ph 4 . 5 and carrying out the radioassay at a ph of 7 . 2 . mouse and rat intrinsic factor preparations exhibit the properties of pure intrinsic factor without the necessity of undertaking the purification procedures . thus , the intrinsic factor preparations used in the present invention will be greater than 98 % inhibited in the binding of bioactive cobalamin when preincubated with antibody to intrinsic factor . addition of 10 , 000 pg of cobinamide to an assay sample using the rat or mouse intrinsic factors does not result in any observable inhibition to the binding of true cobalamin . finally , gel chromatography of the mouse or rat derived intrinsic factor preparation tagged with radiolabeled b 12 produces a single sharp peak corresponding to an apparent molecular weight of about 55 , 000 . this peak is almost completely inhibited by preincubation with antibody to intrinsic factor . the mouse and rat intrinsic factor preparations can be obtained from mouse or rat stomachs by procedures known per se . thus , the mouse or rat stomachs can be homogenized in cold saline and the supernatant separated from the residual tissue mass by centrifugation or filtration . it is desirable that the resulting saline extract be adjusted to ph 10 with aqueous dilute base , such as an alkali hydroxide , preferably sodium hydroxide , to inactivate any pepsin which is present in the stomach and carried into the extract . pepsin can cause degradation of the intrinsic factor unless inactivated by denaturation in base . a representative preparation of mouse intrinsic factor is set forth below : 1 part ( 150 g ) of clean minced mouse stomachs homogenized with 4 parts of phosphate buffered saline ( ph 7 . 2 ) for 5 minutes at 4 ° c . in a sorvall homogenizer . the homogenate is centrifuged for 30 minutes at 30 , 000 g and 4 ° c . the supernatent is decanted and adjusted to ph 10 with 1 n naoh . after stirring for 20 minutes the ph is adjusted with 1 n hcl to 5 . 0 . centrifugation again at 30 , 000 g for 30 minutes to remove precipitate and the supernatant adjusted to ph 7 . 2 with 1 n naoh . the mouse or rat derived intrinsic factors can be utilized in any of the standard radioassay procedures for b 12 known in the art . a particularly preferred procedure is set forth below : 1 . pipet 0 . 5 ml of serum into a 12 ml &# 34 ; red - top &# 34 ; vacutainer tube . 3 . cap the tube with the original stopper and pierce the stopper with a # 22 blood - drawing needle , leaving the needle through the cap for venting purposes . 5 . cool the tube by placing it in an ice - water bath . 6 . mix the contents rapidly in a vortex mixer . complete mixing is important . 7 . remove the needle and centrifuge the tube at 1500 × g for 20 minutes . 8 . the appropriate control sera are extracted by a similar method . 1 . pipet 0 . 5 ml of serum into a 12 ml &# 34 ; red - top &# 34 ; vacutainer tube . 5 . pour the supernatant fluid from the extraction recovery into an appropriately labeled vacutainer tube . it is important to have the precipitate and the supernatant fluid in identical tubes . keep both tubes , one containing the precipitate and the other the supernatant . 6 . a recovery control is also needed for each of the control sera . 1 . prepare standard tubes in duplicate by mixing working standard and buffer as follows : ______________________________________standard standard buffer working standard______________________________________0 1100 μl 0 μl5 1100 510 1100 1025 1075 2550 1050 5075 1025 75100 1000 100150 950 150nsb 1100 0total 1100 0______________________________________ 2 . pipet 1 . 0 ml of the clear supernatant from the serum extraction into each of two 12 × 75 mm polystyrene tubes . 3 . to each extract , add 100 μl of phosphate hydroxide solution . 6 . to all the tubes except &# 34 ; non - specific binding &# 34 ; ( nsb ) and &# 34 ; total &# 34 ; add 200 μl of mouse if ( 1 : 1000 in 0 . 5 m phosphate buffer ph 7 . 2 ). to the blank and total , add 200 and 400 μl respectively of 0 . 5 m phosphate buffer ph 7 . 2 . 8 . let the tubes stand for 30 minutes at room temperature . 9 . to all the tubes , except &# 34 ; total &# 34 ;, add 200 μl of albumin - coated charcoal . the charcoal must be constantly mixed while it is being pipetted . 12 . decant the supernatants into appropriately labeled tubes and place them in a gamma counter . add 1 ml of 0 . 4 % kcn ( 40 mg / 10 cc h 2 o ). ______________________________________a . na . sub . 2 hpo . sub . 4 35 . 5 gm / 500 ccb . na . sub . 2 hpo . sub . 4 . h . sub . 2 o 34 . 5 gm / 500 cc______________________________________ phosphate / hydroxide buffer : dissolve 3 . 8 gm naoh / 100 cc of ph 7 . 2 buffer . titrate 10 ml of acetate - cn - extraction buffer with 1 . 0 ml po 4 / oh to ph 7 . 0 - 7 . 2 and adjust extraction buffer with naoh or phosphate buffer if necessary . radioactive b 12 : amersham searle ( 10 μco / ml ). dilute 75 μl / 10 cc with phosphate buffer , 0 . 5 m , ph 7 . 2 . standard vitamin b 12 : stock vitamin b 12 obtained from parke - davis ( betalin ) ( 100 μg cyanocobalamin per ml ). dilute 1 : 1000 to a concentration of 0 . 1 μg / ml in 0 . 5 m phosphate buffer , ph 7 . 2 . prepare working standard ( 1 ng / ml ) by diluting the above solution 1 : 1000 in 0 . 5 m phosphate buffer , ph 7 . 2 . albumin buffer : dilute 2 ml of 22 % bovine albumin to 15 ml with 0 . 5 m phosphate buffer , ph 7 . 2 . mouse intrinsic factor : dilute the mouse stomach extract 1 : 1000 with 0 . 5 m phosphate - albumin buffer ph 7 . 2 . 2 . plot percent bound versus pg b 12 per tube on linear graph paper , read unknowns verses standard curve , and multiply × 10 = pg / ml serum . while the above procedure specifically employed mouse derived intrinsic factor , an analogous procedure can be employed for rat derived intrinsic factor or for that matter for intrinsic factor derived from any other mammalian species ; stomach which is free of endogenous r - protein . similarly while the radioligand described in the assay procedure was 57 co , it is possible to employ any other suitably radiolabeled cyanocobalamin , such as , for example , 125 i labeled cyanocobalamin , in a manner known per se . the affinity of the mouse intrinsic factor for cobalamin was determined by placing 200 μl of the primary dilution of mouse stomach extract in the final reaction tube , and it was found that was able to bind 50 % of a trace amount of radiolabeled ligand . this amount of mouse stomach extract ( mse ) was used for all subsequent experiments . incubation of varying amounts of 57 co - cobalamin with a constant amount of intrinsic factor allowed determination of the affinity constant ( k ) at ph 7 . 2 is 1 . 21 × 10 &# 34 ; liters per mole . the titration data were confirmed by reacting a constant amount of intrinsic factor , 200 μl of the primary dilution with different concentrations of 57 co - cyanocobalamin for the purpose of determining the optimal amount of radioligand to be used in the assay . one hundred microliters of the working solution containing 45 picograms of radioactive cyanocobalamin was determined to be optimal . with the materials employed in the specific procedure above , this amount of 57 co - cyanocabalamin results in about 14 , 000 cpm in the &# 34 ; total &# 34 ; tube . standard curves for the inhibition assay useful in determining b 12 levels in clinical samples can be derived from the assay procedure described above . the concentrations of standards used in generating such standard curves should correspond with the amount of vitamin b 12 usually found in clinical samples . the final reaction conditions are : intrinsic factor , 200 μl of the primary dilution ; radioactive ligand , 100 l of the working dilution ; time 30 minutes ; ph , 7 . 2 ; and non - radioactive standards , 5 to 150 picograms per tube , or the equivalent of 50 to 1 , 500 picograms of vitamin b 12 per ml of serum . that intrinsic factor , free of &# 34 ; r &# 34 ; proteins , can be obtained from extracts of mouse stomach is supported by several experimental observations . when radiolabeled cobalamin is incubated with mse under the conditions described above , and the mixture separated in a column packed with sephadex g - 150 , the radioactive complex elutes as a single peak with an apparent molecular weight of 54 , 900 . in the same column , the complex radiocobalamin - r - protein ( human saliva or hog stomach extract concentrate ) elutes with an apparent molecular weight of 101 , 000 . the formation of the radiocobalamin , mouse derived , intrinsic factor complex is completely inhibited by preincubation of the mse with human anti - intrinsic factor antibody . the data are shown in table 1 : table 1______________________________________inhibition of the mouse intrinsic factor . sup . 57 co - cobalaminreaction by human anti - intrinsic factor antibody intrinsic factor preparation human saliva______________________________________total cobalamin in thereaction mixture ( ng ) 15 15 ( a ) ( b ) ( a ) ( b ) cobalamin bound by thebinder alone ( ng ) 8 . 1 8 . 0 5 . 2 5 . 3cobalamin boundafter pre - incubation 0 . 6 0 . 8 5 . 8 6 . 0with antibody ( ng ) 0 . 5 0 . 7 6 . 2 6 . 2cobalamin bound by theantiserum alone ( ng ) 0 . 8 0 . 6 0 . 6 0 . 6inhibition by antiserum ( a ) = 97 . 5 % 98 . 8 % antiserum ( b ) 98 . 8 % 97 . 5 % ______________________________________ when 15 nanograms of radiocobalamin are incubated with the appropriate amount of mse , 8 . 1 nanograms of ligand are bound . preincubation with two different preparations of antibody results in essentially complete inhibition of binding . by contrast , preincubation of human saliva with anti - intrinsic factor antibody shows that formation of the &# 34 ; r &# 34 ; protein 57 co - cobalamin complex is not inhibited by antibody . when the antibody preincubated intrinsic factor - radiocabalamin mixture is passed through the sephadex g - 150 column as above , the peak at an apparent molecular weight of 54 , 900 is almost completely gone . cobinamide is useful as a model for the biologically inactive vitamin b 12 analogs . the ability of the analogs to inhibit the binding of true b 12 to the mouse intrinsic factor preparation can be conveniently studies by adding different concentrations of cobinamide to the reaction tubes containing mse or human saliva and 57 co - cabalamin . the reaction conditions were as described above . the data demonstrated that 643 , 738 picograms of cobinamide are required to produce the same degree of inhibition ( 50 %) as 60 picograms of cobalamin , thus indicating a calculated crossreactivity of less than 0 . 1 % at ph 7 . 2 . when the experiments are performed at ph 4 . 5 , the figures are cobalamin , 49 . 1 pg / ml and cobinamide , 7 . 355 pg / ml for a calculated crossreactivity of 0 . 66 %. when human saliva is utilized in the same experiment in place of mse , the results are in marked contrast . in such experiment 112 picograms of cobinamide produce the same degree of inhibition ( 50 %) as 58 . 9 picograms of vitamin b 12 or a calculated crossreactivity of 52 . 6 %. that the inhibition is competitive can be inferred from the similar and nearly parallel slopes of the inhibition curves , particularly in the saliva experiment . additional data on the inability of cobinamide to inhibit the mouse derived intrinsic factor - cobalamin reaction can be seen in table 2 where the results of adding 10 , 000 pg of cobinamide to a control tube carried through the entire procedure are shown . table 2______________________________________crossreactivity of cobinamidewith cobalamine in the ligand mif assay recovery of 10 , 000 pg of cobinamide as cobalamineday b / bo % pg / ml______________________________________1 98 92 99 54 101 07 98 108 99 59 97 2410 104 011 101 015 95 24______________________________________ average recovery 8 . 5 pg / ml crossreactivity 0 . 085 % the improved assay procedure of the present invention is of sufficient sensitivity so that 5 picograms of cabalamin in the reaction tube can be distinguished from zero with statistical significance , or a limit of sensitivity for the clinical assay of 50 pg / ml . sensitivity data obtained from the subject assay is summarized below in table 3 . table 3______________________________________the sensitivity of the mouse intrinsic factorligand assay for serum cobalaminbound counts per minute 0 50 picograms per ml______________________________________ 6514 5657 6130 5715 6274 5791 6252 5827mean 6307 5761______________________________________ t = 6 . 128 p & lt ; . 01 the subject assay was run repetatively to determine the &# 34 ; within run &# 34 ; reproducibility . results of these experiments are summarized below in table 4 . table 4______________________________________the &# 34 ; within run &# 34 ; reproducibility of the mouseintrinsic factor ligand assay by serum cobalamin______________________________________ cobalamin , cobalamin , specimen # picograms / ml specimen # picograms / ml______________________________________1 252 . 4 11 249 . 72 263 . 1 12 243 . 33 255 . 2 13 266 . 64 241 . 0 14 246 . 65 263 . 5 15 263 . 96 289 . 3 16 241 . 07 263 . 4 17 241 . 68 272 . 3 18 256 . 09 271 . 8 19 247 . 710 242 . 9 20 248 . 0mean 254 . 26standard deviation 10 . 68coefficient of variation 4 . 2 % ______________________________________ day - to - day variation and thus the precision of the test is indicated by the data collected in table 5 . table 5______________________________________day - to - day reproduction of the mifligand method for serum cobalamin * sample 1 sample 2extraction results extraction resultsday recovery % in pg / ml recovery % in pg / ml______________________________________1 86 420 86 7092 86 505 86 6963 86 435 86 6774 87 428 88 64886 . 2 444 ± 34 86 . 4 686 ± 24 ( avg . ( avg . results ) ( avg . ( avg . results ) recovery recoverysample ) sample ) coefficient of variation sample 1 = 7 . 7 % - sample 2 = 3 . 5 % ______________________________________ * all extractions at ph 4 . 6 and all assays at ph 7 . 2 the recovery of cobalamin added to normal serum and carried through the entire procedure is indicative of the accuracy achieved by the assay procedure . results of such experiments are shown in table 6 . table 6______________________________________mif cobalamin assayph 7 . 2the recovery of cobalaminadded to normal human serumadded theoretical found recovery ( percentage ) ______________________________________endogenous cobalamin 252 pg / ml100 352 345 93200 452 458 103400 652 632 95______________________________________ average recovery 97 ph 4 . 5 endogenous cobalamin 382 pg / ml100 482 492 110200 582 569 94400 782 759 94______________________________________ average recovery 99 . 33 a test kit which can be utilized in the practice of the improved radioassay method of the present invention comprises individual vials containing sufficient amounts of each reagent for multiple assays , such kit comprising : 1 . one vial of radiolabeled cyanocabalamin solution , preferably 57 co - cyanocobalamin ; 2 . one vial of mouse or rat derived intrinsic factor in buffered solution ; 3 . one vial each of cobalamin standards at between 0 and 150 pg , preferably one vial each of 0 . 5 pg , 10 pg , 25 pg , 50 pg , 75 pg , 100 pg and 150 pg standards . such kit may optionally also contain one or more of the following reagent vials : | 6 |
the first step of the process is the preparation of the aluminum sulfate ( alum ) silica sol component . in this step of the process about 0 . 4 to 0 . 46 kilograms of alum is dissolved in 1 . 7 to 1 . 8 kilograms of water in a suitable reactor . a quantity , about 0 . 28 to 0 . 29 kilograms of concentrated sulfuric acid is added to the solution , the solution is allowed to cool to room temperature and a quantity of sodium silicate , containing about 12 . 4 weight percent silicone dioxide is added with constant stirring . the silicate addition is adjusted to achieve a ph of about 2 . 8 to 3 . 05 in the resulting slurry . the clay slurry is prepared in the second step of the process . a sufficient quantity of kaolin clay is added to a quantity of water to prepare a slurry containing about 70 % solids . the clay is dispersed by adding a dispersant such as tetrasodium pyrophosphate in admixture with sodium polyacrylate . the zeolite slurry is prepared in the third step of the process . a sufficient quantity of faujasite is added to a quantity of water to prepare a slurry containing about 30 percent solids . the ph of the slurry is adjusted to about 4 . 5 to 4 . 8 with a 20 percent solution of sulfuric acid . any faujasite having a silica to alumina ratio of about 5 can be used . the faujasite sold under the trade name pq valfor cp 300 - 63 gives satisfactory results . an alumina slurry is then prepared by adding dry alumina powder to a sufficient quantity of water to prepare a slurry containing about 20 to 25 weight percent solids . the alumina slurry is added to the outer ingredients already in the mixing tank to prepare the final spray dryer slurry . the essence of the invention resides in the addition of the surfactant to any one of the component slurries . the addition is preferably made in this step , but the surfactant can be added to any one or more of the component slurries individually or after all components have been combined . the surfactant is preferably pre - diluted and added as 1 percent by weight solution . the final step in the preparation is the spray drying step . spray drying is a well known and well established drying technique for drying slurries . in this step the slurry prepared in steps described above is fed to a conventional spray dryer . feeding the slurry to a spray dryer employing a spinning wheel atomizer operated at an atomizer wheel speed of 10 , 000 rpm is preferred . the spray dryer is preferably operated at an inlet temperature of about 500 degrees fahrenheit and an outlet temperature of about 250 degrees fahrenheit . following spray drying and before any physicohemical tests can be conducted on the catalyst , the sodium associated with the zeolite and the occluded salts resulting from the addition of the binder must be removed . one technique to effect this removal is pre - exchange of the zeolite . in another technique low sodium content binders such as silica sol , silica -- alumina sol or alumina sol are used to avoid washing and / or exhcanging with ammonium salts or rare earth salt solutions . however , in the typical commercial operation washing , exchanging and often intermediate calcination at 1000 to 1100 degrees f . are required to adequately reduce the sodium to levels that do not impair the function of a given catalyst formulation . the following general technique was used in the examples i through iv set out below : 1 . a quantity of the spray dried material ( 260 - 270 ) grams were slurried in 800 to 1000 ml . of water heated to 140 to 160 degrees f . 3 . a solution of ammonium sulfate was prepared by dissolving about 140 to 160 grams of ammonium sulfate in 1300 to 1600 grams of water . the filter cake was rinsed with about 1600 gms . of this solution that had been heated to 140 to 160 degrees f . 4 . the filter cake was then rinsed with 100 to 1400 ml . of water that been heated to 140 to 160 degrees f . 5 . the filter cake was reslurried and the ph of the resulting slurry was recorded . 6 . a rare earth exchange was completed by adding a solution of rare earth chloride hexahydrate containing 2 grams of the hexahydrate per 100 grams of finished catalyst . the finished catalyst contained 1 per cent rare earth oxide . the ph was adjusted to a ph of 4 . 7 to 5 . 0 and was maintained at that value for about 10 minutes . 7 . the slurry was dewatered in a buchner and rinsed with about 1200 ml . of water heated to 140 to 160 degrees f . 8 . the filter cake was dried at 450 degrees f . followed by calcination of the dry powder at 1000 degrees f . for one hour . after drying , the finished catalyst was properly prepared for subsequent testing . 9 . steps 1 through 4 were repeated . the product was washed with 1800 ml of water heated to 140 to 160 degrees . f . 10 . the filter cake was dried for 4 hours at a temperature of 450 degrees f . and the catalyst product recovered . the process described above is used to prepare a faujasite containing rare earth containing catalyst . the novel process can also be used to prepare amorphous gel based catalysts . if a catalyst devoid of rare earth is to be prepared the rare earth exchange step is eliminated . the calcination temperature in step 8 can be carried out at temperature between 1000 and 1500 degrees f depending on the type of hydrogen y catalyst being prepared . the invention is illustrated by the following specific but non - limiting examples . this example illustrates the preparation of the catalyst without the addition of acid stable surfactant . an acid / alum solution was prepared by mixing the following components in the ratios shown to the volume needed . a quantity ( 0 . 454 kg ) of aluminum sulfate was mixed well with 1 . 79 kg of water . the mixture was agitated well until all the aluminum sulfate has been dissolved . after the sulfate had been dissolved 0 . 029 kg of 95 - 98 % sulfuric acid was added . this solution is then cooled to at least 86 degrees f before it was used . the acidified alum solution was pumped into a high shear mix pump and simultaneously a stream of sodium silicate , containing 12 . 4 wt % silica , was also pumped into the mix pump . the silicate flow rate is adjusted to achieve a ph in the mixing pump discharge in the range of 2 . 80 - 3 . 05 . a 3 : 1 flow of silicate to acidified alum was typically required to achieve the desired ph range . a slurry of kaolin clay was made up to a 70 % solids slurry , measured by o &# 39 ; haus moisture balance , using as dispersing agents tspp and sodium polyacrylate ( napa ) slurry make - up water in the following proportions , 0 . 24 % tspp predissolved in hot water to a 10 % solution , and 0 . 25 % napa , based on the weight of as is air float clay . the dispersant is first added to the make - up water followed by the dry clay which is added under high shear agitation 1 . the binder solution was prepared consisting of acid / alum and sodium silicate as described above . 2 . the required amount of the binder was transferred to a mix tank under a high shear mixer . the temperature and ph of the mix was recorded . 3 . the required amount of clay slurry , prepared as described above was added to the high shear mix tank . the temperature and ph of the mix was recorded . 4 . a zeolite slurry was prepared by slurring dry zeolite powder in water to 30 % solids and the ph of the slurry was adjusted to 4 . 5 - 4 . 8 using 20 % sulfuric acid . this slurry was then added to the high shear mix tank . the temperature and ph was recorded . we have found pq valfor cp 300 - 63 dry zeolite powder to be suitable . 5 . an alumina slurry was prepared by slurring dry alumina powder in water . this may conveniently be in the amunt of water required to adjust the drier feed slurry to its desired water and solids content . normally a calculated 22 wt % solids was employed . this alumina slurry was added to the other catalyst ingredients already in the mix tank under high shear agitation to produce the final spray drier feed slurry . the temperature and ph were recorded . any suitable alumina powder may be used . for the purpose of this invention alcoa alumina powder cp - 2 was used . 6 . the spray drier feed was pumped to a anhydro model type iii - a no . 4 spray drier employing a spinning wheel atomizer . operating conditions were , 500 degrees f inlet temperature , 250 degrees f . outlet temperature , atomizer wheel speed 10 , 000 rpm . table i indicates typical results obtained when catalysts were prepared by the prior art procedure . catalyst hardness as expressed by the cai index were in excess of 6 wt %/ hr and the attrition in excess of 1 . 3 wt %/ hr on a rate basis . the procedure of example i was followed except that the desired amount of additive in the form of a 1 gm / 100 ml prediluted solution was added to the weighed amount of the desired component slurry . table ii and iv present the data obtained using the procedure of our invention wherein the acid stable dispersant was dupont zonyl tbs . catalysts were prepared with a range of zeolite contents from 10 to 25 % at 18 % binder expressed as silica . the attrition indexes are considerably lower ( table ii ) than those of the prior catalysts of example i . all catalysts of our invention had a cai value of less than 5 . 00 and an attrition rate of less than 1 . 00 . table v indicates the effect of varying the zonyl from 1 to 4 grams per 2442 gm of as is clay . the data again indicates substantial improvement over the prior art catalysts of example i . no further improvement appears to be observed when the surfactant level is raised to 2 gms to 4 grams per 2442 gm of as is clay . catalysts were prepared by the procedure of example ii using an acid stable surfactant described as potassium perfluoroalkyl sulfonates produced by 3m designated fc - 95 . the attrition data on these catalysts is presented in table iii . when compared to a catalyst prepared by the prior art procedure catalysts prepared with the acid stable surfactant all had a substantially improved attrition over a range of surfactant from 1 to 4 gm per 2442 gm of as is clay . test were performed to determine the effects of adding acid stable surfactant to the other components of the catalyst slurry . table vi and table vii demonstrates theat the surfactant is effective when added to any of the catalyst components individually ( runs 181 , 182 and 183 ) to the spray dryer feed ( run 184 ) or all components ( runs 178 and 179 .). again the improvement is substantial when compared to catalysts prepared by the processes of the prior art . preparation of spray dried air float koalin employing 3m fc - 95 potassium perfluoralkyl sulfonates surfactant in this example the procedures for preparing the clay slurry described in example i were followed except that the clay component was first spray dried either with or without the addition of the 3m fc - 95 potassium perfluoroalkyl sulfonates acid stable surfactant prior to spray drying . each of the slurries was prepared to contain 0 . 25 % tspp and 0 . 25 % sodium polyacrylate . after the spray dried kaolin sample was prepared aliquot amounts were mixed with water to prepare slurries containing 65 - 70 % solids . the slurry was subsequently incorporated into the spray drier feed tank containing the other catalyst components . the attrition data for the catalysts prepared by this procedure along with the simulated aging data are compared with the data for the catalysts prepared without the surfactant in table viii . the simulated aging data was collected by aging comparable samples of treated and untreated spray dried kaolin for 5 days at a temperature of 180 degrees fahrenheit . at the end of this time the aged spray samples were reslurried and used in preparation of catalysts . it is apparent from the data presented in table viii that the catalysts prepared from the treated spray dried kaolin showed a marked improvement over the non - treated versions . the treated samples showed good stability under the accelerated aging test when compared to the non treated samples . this is apparent from a comparison of runs 120 and 132 with runs 119 and 131 . table i______________________________________run no 167 185______________________________________nay 2636 ( 25 ) 2636 ( 25 ) alumina 526 ( 10 ) 526 ( 10 ) silica sol 11500 ( 23 ) 11500 ( 23 ) clay 3545 ( 42 ) 3545 ( 42 ) sol ph 2 . 93 2 . 97sol temp ./ c . 33 31feed ph 3 . 27 3 . 29cai 9 . 83 9 . 03att ./ rate 1 . 97 1 . 80______________________________________ notes no additives were used in these runs . component inputs are shown as weight in grams and the number in () is the percent material on a silica / alumina basis . table ii______________________________________addition of surfactant to other catalystcomponent slurriesrun no . 181 182 183 184______________________________________na y 2636 ( 25 ) 2636 ( 25 ) 2636 ( 25 ) 2636 ( 25 ) alumina 526 ( 10 ) 526 ( 10 ) 526 ( 10 ) 526 ( 10 ) silica sol 11500 ( 23 ) 11500 ( 23 ) 11500 ( 23 ) 11500 ( 23 ) clay 3636 ( 42 ) 3636 ( 42 ) 3636 ( 42 ) 3636 ( 42 ) sol ph 3 . 00 3 . 01 3 . 00 3 . 00sol temp . c . 32 31 33 34feed ph 3 . 29 3 . 27 3 . 20 3 . 27cai 0 . 79 1 . 90 1 . 85 2 . 29att . rate 0 . 16 0 . 38 0 . 37 0 . 46surf .,/ g 1 . 00 1 . 00 1 . 00 1 . 00add . point silica zeolite alumina sd feed______________________________________ notes dupont zonyl registered trademark covering fluorocarbon surfactant diluted / 1 gram / 100 ml of water surfactant was added and mixed into the individual component prior to addition of the component to the high shear mix tank . components inputs are shown by weight in grams and the number in () is th percent material on a silica / alumina basis . table iii______________________________________surfactant 3m fc 95 potassium perfluoroalkyl sulfonate . run no . 93 94 96______________________________________nay 1888 ( 25 ) 1888 ( 25 ) 1888 ( 25 ) alumina 526 ( 10 ) 526 ( 10 ) 526 ( 10 ) silica sol 11500 ( 23 ) 11500 ( 23 ) 11500 ( 23 ) clay 3545 ( 42 ) 3545 ( 42 ) 3545 ( 42 ) sol ph 3 . 02 2 . 97 3 . 10sol . temp . c . 18 12 12feed ph 3 . 19 3 . 12 3 . 33feed . temp . c 9 11 10cai 3 . 88 3 . 19 3 . 40att . rate 0 . 78 0 . 64 0 . 70surfactant , g . 1 . 00 2 . 00 4 . 00______________________________________ notes surfactant added as a dry powder to the clay slurry on the basis of 1 gra per 2442 grams of as is clay . clay slurry made up using 0 . 5 % tspp the zeolite source had a lower moisture content therefore the weight used in each prep is less . component inputs are shown by weight in grams of as is component and the number in () is the percent material on a silica / alumina basis . table iv______________________________________preparation using 18 % binderrun no . 150 163 164 165______________________________________nay 2636 ( 25 ) 2136 ( 20 ) 1591 ( 15 ) 1045 ( 10 ) silica sol 9000 ( 18 ) 9000 ( 18 ) 9000 ( 18 ) 9000 ( 18 ) alumina 526 ( 10 ) 526 ( 10 ) 526 ( 10 ) 526 ( 10 ) clay 3955 ( 47 ) 4364 ( 52 ) 4818 ( 57 ) 5227 ( 62 ) sol ph 2 . 95 2 . 96 3 . 00 2 . 95sol temp . c . 36 36 35 36feed ph 3 . 33 3 . 20 3 . 31 3 . 20cai 4 . 04 1 . 70 2 . 42 1 . 37att . rate 0 . 81 0 . 34 0 . 49 0 . 27surf ., gm 1 . 12 1 . 24 1 . 36 1 . 48______________________________________ notes dupont zonyl a registered trademark covering fluorocarbon tbs surfactant diluted on the basis of 1 gram / 100 ml water and added to the clay slurry . surfactant loading is normalized to equal 1 gram per 2442 grams of as is clay . component inputs are shown by weight in grams and the number in () is the percent material on a silica / alumina basis . table v______________________________________preparation using 23 % binderrun no . 170 171 180______________________________________nay 2636 ( 25 ) 2636 ( 25 ) 2636 ( 25 ) silica sol 11500 ( 23 ) 11500 ( 23 ) 11500 ( 23 ) alumina 526 ( 10 ) 526 ( 10 ) 526 ( 10 ) clay 3545 ( 42 ) 3545 ( 42 ) 3545 ( 42 ) sol ph 3 . 01 2 . 97 3 . 00sol temp . c . 34 33 31feed ph 3 . 26 3 . 31 3 . 23cai 2 . 44 1 . 32 1 . 30att . rate 0 . 49 0 . 26 0 . 26surfactant , gm . 1 . 00 2 . 00 4 . 00______________________________________ notes dupont zonyl a registered trademark covering fluorocarbon tbs surfactant diluted on the basis of 1 gram / 100 ml water and added to the clay slurry . surfactant loading is normalized to equal 1 gram per 2442 grams of as is clay . component inputs are shown by weight in grams and the number in () is the percent material on a silica / alumina basis . table vi______________________________________addition of surfactant to catalyst slurriesrun no . 181 182 183______________________________________nay 2636 ( 25 ) 2636 ( 25 ) 2636 ( 25 ) silica sol 11500 ( 23 ) 11500 ( 23 ) 11500 ( 23 ) alumina 526 ( 10 ) 526 ( 10 ) 526 ( 10 ) clay 3636 ( 42 ) 3636 ( 42 ) 3636 ( 42 ) sol ph 3 . 00 3 . 01 3 . 00sol temp . c . 32 31 33feed ph 3 . 29 3 . 27 3 . 20feed temp . c . 22 22 25cai 0 . 79 1 . 90 1 . 85att rate 0 . 16 0 . 38 0 . 37surfactant , gm . 1 . 00 1 . 00 1 . 00add . point silica zeolite alumina______________________________________ notes dupont zonyl a registered trademark covering fluorocarbon tbs surfactant diluted on the basis of 1 gram / 100 ml of water . surfactant was added to and mixed into the individual components prior to adding the component to the high shear mix tank . component inputs on an as is basis are shown , but as weight in grams and the number in () is the percent material on a silica / alumina basis . table vii______________________________________addition of surfactant to catalyst slurriesrun no . 184 178 179______________________________________nay 2636 ( 25 ) 2636 ( 25 ) 2636 ( 25 ) silica 11500 ( 23 ) 11500 ( 23 ) 11500 ( 23 ) alumina 526 ( 10 ) 526 ( 10 ) 526 ( 10 ) clay 3636 ( 42 ) 3636 ( 42 ) 3636 ( 42 ) sol ph 3 . 00 2 . 97 2 . 95sol temp . c . 34 32 32feed ph 3 . 27 3 . 23 3 . 26feed temp . c . 26 24 21cai 2 . 29 1 . 90 0 . 74att rate 0 . 46 0 . 38 0 . 15surfactant , gm . 1 . 00 0 . 50 1 . 00add . point s . d . feed in all components______________________________________ notes dupont zonyl a registered trademark covering fluorocarbon surfactant diluted on the basis of 1 gram / 100 ml of water . surfactant was added to and mixed into individual components prior to adding the component to the high shear mix tank . component inputs are shown by weight in grams on an as is basis and the number in () is the percent material on a silica / alumina basis . table viii______________________________________attrition and aging data for catalystprepared from kaolin treated with 3m fc - 95potassium perfluoroalkyl surfactantsbefore spray dryingrun no . type age cai rate______________________________________119 * af - std - p 0 8 . 32 1 . 08120 ** af - std - p , fc - 95 0 3 . 16 0 . 63 potassium perfluoroalkyl surfactants131 * af - std - p 5 days *** 9 . 70 1 . 93132 ** af - std - p , fc - 95 5 days *** 3 . 84 0 . 77 potassium perfluoroalkyl surfactants______________________________________ af - std - p standard catalyst preparation ( see table i , runs 167 and 185 using air float clay ( af ) * fc95 potassium perfluoroalkyl surfactants added 1 gram per 2442 grams o air float clay ( af ) ** aging at 180 degrees f . obviously many modifications and variations of the invention may be made without departing from the essence and scope thereof . only such limitations should be applied as are indicated in the appended claims . | 1 |
the bio - fertilizer composition of the present invention comprises a symbiotic organism , which is selected from the group consisting of rhizoctonia sp . ( bcrc930076 ) and rhizoctonia sp . ( bcrc930077 ); a growth substance ; and a medium , which is used to mix and evenly disperse the symbiotic organisms and the growth substance . the symbiotic organisms are rhizoctonia spp . purified and isolated from the wild grown orchid roots . one colony of rhizoctonia sp ., which has been deposited in firdi ( food industry research and development institute taiwan , 331 shih - pin road , hsinchu , taiwan 300 ) with a deposit number of bcrc0930076 , are pale yellow with cotton fibers in the front sides , and the colors of hyphae are also pale yellow . the widths of hyphae are between 3 . 5 - 4 . 5 mm , in average of 3 . 9 mm . the lengths of bead - like cells are between 17 - 30 mm , in average of 23 . 5 mm , and the widths are between 10 - 12 mm , in average of 11 . 1 mm . the rate of hyphal elongation is 10 - 11 mm per day . there are two nuclei in one cell . another colony of rhizoctonia sp ., which has been deposited in firdi with a deposit number of bcrc0930077 , are white yellow with cotton fibers in the front sides , and the colors of hyphae are also white yellow . the widths of hyphae are between 4 - 5 mm , in average of 4 . 34 mm . the lengths of bead - like cells are between 14 - 25 mm , in average of 19 . 4 mm , and the widths are between 9 . 6 - 14 mm , in average of 11 . 9 mm . the rate of hyphal elongation is 10 - 11 mm per day . there are two nuclei in one cell . the above - identified colonies were deposited on dec . 15 , 2004 . any known plant growth substance ( pgs ) which promotes orchid growth and does not interfere with the existence of orchid symbiotic organism can be applied in the present invention and is not limited . the plant growth substances include natural plant hormones and artificially synthesized plant growth regulators . the natural plant hormones include auxins , gibberellins , cytokines , abscisic acid , ethylene , brassinosteroids , jasmonate and salicylates and so on , not restricted to the list here . the plant growth regulators are synthesized by chemical methods which are organics similar to the molecular structures or physiological activities of natural plant hormones . examples are choline chloride , inositol , lysine # 3 root inducer and aminosong solution , and are not limited to this list . on the other hand , as a medium mentioned above , any medium used to thoroughly mix and evenly disperse the symbiotic organisms and the growth substances can be applied in the present invention to bring into functions , no particular restriction is applied in the invention . examples include peat moss , sphagnum mosses , coconut fiber and rotting logs , and are not limited to the list here . the mixing ratio of symbiotic organisms and plant growth substances of the bio - fertilizer composition in the invention can be adjusted according to the spreading ways , amount , and different growth stages of orchid species . there is no particular restriction . people skilled in the art of the present invention also understand from this explanation that the bio - fertilizer composition can be produced in either solid forms or in liquid forms . on the other hand , people skilled in the art also comprehend that the symbiotic organism of the bio - fertilizer composition can be applied directly into the culture media of orchid seed in test tubes during seed germination without plant growth substance but with simple medium ( e . g . oat meal agar medium ) to promote the germination . besides , the bio - fertilizer composition can further comprises a nutrient solution to provide a better growth promotion effect . any nutrient solution provides nutrients for orchid plants and enhances the growth can be applied in the present invention without particular restriction . fruit and vegetable juices ( for instance , v8 juice ), gy nutrient solution ( liquid glucose - yeast extract media ), cm nutrient solution ( glucose - yeast extract - malt extract ) and food grade beverage ( for instance , milk ) are examples but not limited . the present invention is further explained in the following examples . the present invention disclosed above is not limited by these examples . the present invention may be altered or modified and all such variations are within the scope and spirit of the present invention . orchids are observed after slicing of each orchid plant under microscope , and the roots suspected to be infected with orchid symbiotic organisms are sampled to isolate the microbes from the infected roots . first of all , the roots are washed , sonicated with 1 % sodium hypochlorite for 15 to 20 min for disinfection , then washed with sterile distilled water three times . the roots are cut into pieces , placed in separation culture media , and incubated in the dark at 25 ° c . for 3 to 4 days till mycelia appear . single hypha picked from mycelium is subcultured into potato dextrose agar ( pda ) plate ( 39 g / l of difco potato dextrose agar ) for colony purification . purification of hypha is determined according to the growth condition of hypha , and the non - purified hypha is picked with a needle , incubated in a fresh pda plate till colonies are purified . purified colonies are placed into test tubes respectively and stored at 4 ° c . the purified symbiotic organisms are identified , termed rhizoctonia sp . ma and rhizoctonia sp . mb by firdi ( taiwan , roc ), and deposited there on dec . 15 , 2004 . the deposit number is assigned to be bcrc930076 and bcrc930077 , respectively . both rhizoctonia sp . ma and rhizoctonia sp . mb are analyzed for their pathogenicities to affirm their danger to plants . sterilized peat mosses or soil - free media are used as the growing media for testing plants . first of all , the surfaces of seeds are disinfected with sodium hypochlorite , these seeds includ crop blocks such as mung beans ( bean family ), cucumbers ( calabash family ), radishes ( crucifer family ) or rice and so on . these disinfected seeds are sowed directly , or germinated in advance , and placed into the media containing purified orchids symbiotic organisms , in the ratio of 0 . 5 - 1 g microbes to one plant in a plastic vessel respectively . the water level is adjusted to be the same as in the field . the container and the plant are wrapped with a large transparent plastic bag to prevent the spreading of harmful microbes , and the plant was kept away from the side of bag to avoid the abnormal growth . these bags are placed in a green house with normal illumination for 7 - 14 days . the growth of each plant is observed to confirm whether it has symptoms . finally , no symptom is observed . therefore these symbiotic organisms obtained in this experiment show no pathogenicity . culture media containing 39 g of difco pda ( potato dextrose agar ) in one liter of water are autoclaved at 121 ° c . for 20 minutes to cultivate the purified orchid symbiotic organisms obtained from example 1 , which are stored as the seed stocks . the orchid symbiotic organisms can be cultivated and produced in liquid form or solid form . gy culture solution ( 2 % of glucose and 1 % of yeast extract ), cm culture solution ( 5 g each of glucose , yeast extract and malt extract are added to one liter media ), and mp culture media ( 2 . 5 % of milk powder ) are applied for liquid form cultivation . these culture solutions are autoclaved for 20 min to be sterile . after the media are cooled , the abovementioned orchid symbiotic microbial seed stocks are inoculated to cultivate either stay quiet at 25 ° c . or shake at low speed ( 80 - 100 rpm ). five days later , the solution of culture media ias ground with a disinfected juice grinder to disperse the mycelium and stored in a sprinkling can . when orchid symbiotic organisms is cultivated in solid form , media for cultivation of mushroom or mushroom spawn or orchid such as peat moss , sphagnum mosses , coconut fiber or rotting logs are mixed thoroughly in a ratio with the abovementioned liquid culture solution and autoclaved for 60 min . after the media are cooled , the abovementioned orchid symbiotic microbial seed stocks are inoculated in the surface of this medium . cultivation can be carried out in the dark in sterile compact packs or in shallow dishes less than 1 . 5 cm thick ). after several days , when the mycelium grows all over the surface of media , the mycelium can be mixed evenly and used for inoculation , or be dried with media in the shade in a sterile environment , then put into sealing bags and store at 4 ° c . refrigerator , the mycelium can be stored for more than 6 months . the proper cultivating temperature for orchid symbiotic organisms is around 25 - 28 ° c ., usually without illumination . the bio - fertilizer composition of the invention is prepared after the orchid symbiotic organisms are mixed with plant growth substances and suitable media . rhizoctonza sp . ma and rhizoctonia sp . mb isolated from example 1 are spread into different culture media , such as pda culture media , peat , vermiculite , perlite and sphagnum mosses . the seeds of haemaria are inoculated into the abovemetioned culture media to observe the germination . fig1 shows the results of germination rates with different treatments . haemaria seeds do not germinate no matter what kind of culture media is used without the addition of orchid symbiotic mibrobe ( control group ). and germination rates are significant higher than those of control groups when the orchid symbiotic organisms are added . among them , the germination rate of the pda culture media group is the highest , which reached 25 - 30 %. enhancement of haemaria seedling growth with different fertilizers during tissue culture the seedlings of haemaria ( about 1 cm in height ) are planted in oat culture media ( 2 . 5 g of ground oat bran and 11 . 5 g of agar , add water to one liter ) and divided into four groups ; no fertilizer group ( nm , control group ); hyponex no . 3 ( commercial chemical fertilizer ) added group ; bio - fertilizer composition ma added group ( ma ) as described in example 3 containing rhizoctonia sp . ma ( bcrc930076 ); and bio - fertilizer composition mb added group ( mb ) as described in example 3 containing rhizoctonia sp . mb ( bcrc930077 ). the growth of seedlings of haemaria in different groups is compared after 4 months . each treatment contains 15 duplicates , and the data is analyzed with duncan &# 39 ; s multiple range test ( dmrt ) using p - value of 0 . 05 . as shown in table 1 , the addition of fertilizers significantly enhances the growth conditions of plants in comparison with the plants of the control group . among the three former groups , hyponex no . 3 added group shows the significantly enhancing effects in plant heights only , while the bio - fertilizer composition added groups show significant effects in plant heights , leave lengths and fresh weights when compared to the control group . other values such as leave widths and root numbers are also higher than those of the control group though not significantly . in summary , the bio - fertilizer composition in the present invention indeed effectively improves the growth of the seedlings of haemaria , and is better than the effects of chemical fertilizer . the seedlings of haemaria ( 6 - 9 cm in height ) are divided into 2 groups by heights ( 6 - 7 cm in height vs 8 - 9 cm in height ) and planted in oat culture media . each group is further divided into 3 groups : no fertilizer group ( nm control group ); bio - fertilizer composition ma ( bcrc930076 ) added group from example 3 ; and bio - fertilizer composition mb ( bcrc930077 ) added group from example 3 . the growth of seedlings of haemaria in different groups is compared after 4 months . each treatment contains 20 duplicates , and the data is analyzed with duncan &# 39 ; s multiple range test ( dmrt ) using p - value of 0 . 05 . as shown in table 2 , the addition of fertilizers ( treatment groups ) shows significant effects on both of the seedlings of haemaria in plant heights , leave numbers and fresh weights in comparison with those of the plants from the control group , and showed better growth conditions . the seedlings of dendrobium candidum are planted in oat culture media after deflasking from tissue culture , and divided into 3 groups : no fertilizer group ( nm control group ); bio - fertilizer composition ma ( bcrc930076 ) added group from example 3 ; and bio - fertilizer composition mb ( bcrc930077 ) added group from example 3 . the growth of seedlings of dendrobium candidum in different groups is compared after 4 months . each treatment contains 20 duplicates , and the data is analyzed with duncan &# 39 ; s multiple range test ( dmrt ) using p - value of 0 . 05 . as shown in table 3 , the addition of fertilizers ( treatment groups ) improved the growth of dendrobium candidum in comparison with the control group , and the survival rates of treatment groups are 20 % better than that of the control group . the seedlings of phalaenopsis are planted during tissue culture , and divided into 3 groups ; no fertilizer group ( control group ); bio - fertilizer composition ma ( bcrc930076 ) added group from example 3 ; and bio - fertilizer composition mb ( bcrc930077 ) added group from example 3 . the growth of seedlings of phalaenopsis in different groups is compared after 4 months . each treatment contains 5 duplicates , and the data is analyzed with duncan &# 39 ; s multiple range test ( dmrt ) using p - value of 0 . 05 . the effect of addition of fertilizers ( treatment groups ) in the growth of phalaenopsis in comparison with the control group is shown in fig2 . the root numbers and fresh weights of treatment groups are significantly higher than those of the control group . enhancement of phalaenopsis seedling growth with bio - fertilizer after deflasking from tissue culture the seedlings of phalaenopsis are planted after deflasking from tissue culture , and divided into 3 groups ; no fertilizer group ( nm control group ); bio - fertilizer composition ma ( bcrc930076 ) added group from example 3 ; and bio - fertilizer composition mb ( bcrc930077 ) added group from example 3 . after 4 months , the growth of seedlings of phalaenopsis after deflasking in different groups is compared . each treatment contained 5 duplicates , and the data is analyzed with duncan &# 39 ; s multiple range test ( dmrt ) using p - value of 0 . 05 . the effects of fertilizers ( treatment groups ) in the growth of phalaenopsis in comparison with the control group are shown in fig3 . the contents of chlorophyll of treatment groups are significantly higher than those of the control group . phalaenopsis amabili and doritaenopsis casablanca joy × phalaenopsis taida pinlong are treated with either bio - fertilizer composition mb or plant growth regulators gibberellic acid ( ga 3 ), or both . the flowering rates are observed after incubation . as shown in table 4 , the addition of bio - fertilizer mb and ga 3 ( treatment groups ) improved the growth of both phalaenopsis to a large extent : 92 % and 88 % respectively , in comparison with 42 % of the control group ( nm ), which is 50 % better than that of the control group . anoectochilus formosanus is treated with either bio - fertilizer composition mb ( mb ) or nothing ( nm ). the changes on effective components are analyzed after incubation . the treatment contains 4 duplicates , and the data is analyzed with duncan &# 39 ; s multiple range test ( dmrt ) using p - value of 0 . 05 . table 5 shows the comparison analysis of bioactive components with health benefits such as superoxide dismutase ( sod ), polysaccharids , polyphenols , phosphorus ions and vitamin c with or without the addition of bio - fertilizer mb . the bio - fertilizer composition mb ( treatment group ) significantly increased the effective components of anoectochilus formosanus to a large extent . | 0 |
the following examples further define , describe , and compare methods of preparing the toner materials of the present invention and of utilizing them to develop electrostatic latent images . these examples , other than the control examples , are intended to illustrate the various preferred embodiments of the present invention . parts and percentages are by weight unless otherwise indicated . about 1 . 8 parts of polystyrene ( d - 125 , available from pennsylvania industrial chemicals company ) and about 0 . 2 parts of carbon black were well mixed and then introduced under pressure into an intensive mixer at a hydraulic pressure of about 7 kg / cm 2 and a compressor pressure of about 5 . 0 kg / cm 2 . the mixture was kneaded for about 10 minutes while maintaining the temperature inside of the mixer at about 80 ° c . the kneaded mixture was taken out of the mixer , cooled , and suitably broken . the broken mixture was coarsely pulverized by a free mill to a size of several hundred microns , and then finely pulverized by a jet - mixer at a pneumatic pressure of about 6 . 3 kg / cm 2 while feeding the coarsely pulverized particles at a rate of about 1 . 6 kg / hour thereby to form a fine toner powder having an average particle size of about 12 microns . a copy of a standard test pattern was prepared in a 2200 xerox copying machine using the resulting toner powder . examination of the resulting copy by a line densitometer showed that when a fine line of grey with a density of about 0 . 7 is reproduced in a density of about 0 . 9 , the density of the background is about 0 . 01 , and when it is reproduced in a density of about 1 . 2 , the background density is about 0 . 04 . the copy exhibited a soiled appearance . the copying was repeated about 5 , 000 times and the background density became about 0 . 04 when the same pattern as above was reproduced in a density of about 0 . 9 , and more than about 0 . 05 when it was reproduced in a density of about 1 . 2 . the copies obtained were very soiled . about 1 . 5 parts of polystyrene ( d - 125 , available from pennsylvania industrial chemicals company ) and about 0 . 3 parts of an epoxy resin ( e - 1001 , a product of shell chemical co . ), and 0 . 2 parts of carbon black were well mixed , kneaded , and pulverized in the same way as in example i to form a toner powder . the same test as in example i was performed using a 2200 xerox copying machine . it was found that the background density was about 0 . 01 when the pattern was reproduced in a density of about 0 . 9 ; about 0 . 005 when it was reproduced in a density of about 1 . 2 ; and about 0 . 005 when it was reproduced in a density of about 1 . 6 . the copy was clear . when the same test was performed for about 20 , 000 copying cycles , the background density was about 0 . 01 when the pattern was reproduced in a density of about 0 . 9 ; about 0 . 01 when it was reproduced in a density of about 1 . 2 ; and about 0 . 005 when it was reproduced in a density of about 1 . 6 . thus , no substantialy change in background density was evident with this toner composition . about 1 . 1 parts of polystyrene ( st - 120 , a product of sanyo kasei ), about 0 . 9 parts of an epoxy resin ( e - 1002 , a product of shell chemical co .) and about 0 . 2 parts of carbon black were well mixed , kneaded , and pulverized in the same way as in example i to form a toner powder . the same test as in example i was performed using a 2200 xerox copying machine . it was found that when the pattern was reproduced in a density of about 0 . 9 , the background density became about 0 . 01 ; it was about 0 . 01 when the pattern was reproduced in a density of about 1 . 2 ; and it became about 0 . 005 when the pattern was reproduced in a density of about 1 . 6 . after about 20 , 000 copying cycles , there was substantially no quality change since the background density was about 0 . 01 for the reproduced density of about 0 . 9 ; about 0 . 01 for the reproduced density of about 1 . 2 ; and about 0 . 01 for the reproduced density of about 1 . 6 . about 0 . 3 parts of polystyrene ( st - 75 , a product of sanyo kasei ), about 1 . 2 parts of polystyrene ( st - 120 , a product of sanyo kasei ), about 0 . 3 parts of an epoxy resin ( e - 1002 , a product of shell chemical co . ), and about 0 . 2 parts of carbon black were well mixed , kneaded , and pulverized in the same way as in example i to form a toner powder . the same test as in example i was performed using a 2200 xerox copying machine . it was found that the background density became about 0 . 005 for the reproduced density and about 0 . 9 ; about 0 . 005 for the reproduced density of about 1 . 2 ; and about 0 . 01 for the reproduced density of about 1 . 6 . after about 20 , 000 copying cycles , there was substantially no quality change since the background density was about 0 . 01 for the reproduced density of about 0 . 9 ; about 0 . 005 for the reproduced density of about 1 . 2 ; and about 0 . 01 for the reproduced density of about 1 . 6 . about 1 . 6 parts of polystyrene ( st - 120 , a product of sanyo kasei ), about 0 . 2 parts of an epoxy resin ( e - 1002 , a product of shell chemical co .) and about 0 . 2 parts of carbon black were well mixed , kneaded , and pulverized in the same way as in example i to form a toner powder . the same test was performed as in example i using a 2200 xerox copying machine . the background density became about 0 . 01 for the reproduced density of about 0 . 9 , and about 0 . 005 for the reproduced density of about 1 . 6 . after about 20 , 000 copying cycles , the background density became about 0 . 01 for the reproduced density of about 0 . 9 ; and about 0 . 01 for the reproduced density of about 1 . 6 . there was no substantial change observed in copy quality . about 1 . 2 parts of a copolymer composed of about 25 parts by weight of a chlorostyrene unit and about 75 parts by weight of a styrene unit , about 0 . 6 parts of an epoxy resin ( e - 1004 , a product of shell chemical co . ), and about 0 . 2 parts of carbon black were well mixed , kneaded , and pulverized in the same way as in example i to form a toner powder . the same test as in example i was performed using a 2200 xerox copying machine . it was found that the background density was about 0 . 005 for the reproduced density of about 0 . 9 ; and about 0 . 005 for the reproduced density of about 1 . 6 . after about 20 , 000 copying cycles , the background density was found to be about 0 . 005 for the reproduced density of about 0 . 9 and about 0 . 01 for the reproduced density of about 1 . 6 . there was no substantial change observed in copy quality . about 1 . 3 parts of polystyrene ( st - 120 , a product of sanyo kasei ), about 0 . 5 parts of an epoxy resin ( e - 1001 , a product of shell chemical co . ), about 0 . 2 parts of poly ( n - butyl methacrylate ) ( elvacite 2044 , a product of dupont ), and about 0 . 2 parts of carbon black were well mixed , kneaded , and pulverized in the same way as in example i . the same test as in example i was performed using a 2200 xerox copying machine . it was found that the background density was about 0 . 01 for the reproduced densities of about 0 . 9 , 1 . 2 , and 1 . 6 . after about 20 , 000 copying cycles , there was substantially no change in background density , it being about 0 . 01 for the reproduced densities of about 0 . 9 , 1 . 2 , and 1 . 6 . about 1 . 2 parts of a copolymer composed of about 85 parts by weight of a styrene unit and about 15 parts by weight of an isobutyl methacrylate unit , about 0 . 6 parts of an epoxy resin ( e - 1002 , a product of shell chemical co . ), and about 0 . 2 parts of carbon black were well mixed , kneaded , and pulverized in the same way as in example i to form a toner powder . the same test as in example i was performed using a 2200 xerox copying machine . it was found that the background density was about 0 . 005 for the reproduced density of about 0 . 9 ; about 0 . 005 for the reproduced density of about 1 . 2 ; and about 0 . 01 for the reproduced density of about 1 . 6 . after about 20 , 000 copying cycles , no substantial change was observed in background density since it was about 0 . 005 for the reproduced density of about 0 . 9 ; about 0 . 01 for the reproduced density of about 1 . 2 ; and about 0 . 01 for the reproduced density of about 1 . 6 . the expression &# 34 ; developer mixture &# 34 ; as employed herein is intended to include electroscopic toner material or combinations of toner material and carrier material . although specific materials and conditions are set forth in the foregoing examples , these are merely intended as illustrations of the present invention . various other suitable additives , colorants , and other components , such as those listed above , may be substituted for those in the examples with similar results . other materials may also be added to the toner to sensitize , synergize , or otherwise improve the fusing properties or other desirable properties of the system . other modifications of the present invention will occur to those skilled in the art upon a reading of the present disclosure . these are intended to be included within the scope of this invention . | 6 |
while this invention is susceptible of embodiment in many different forms , there are shown in the drawings , and will herein be described in detail , preferred embodiments of the invention with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the broad aspect of the invention to the embodiments illustrated . fig1 shows a spout 10 in fluid communication with a flexible container 12 of the present invention . the spout 10 comprises a base 14 , a passageway 18 , and an evacuation structure 26 . the base 14 is connected to one of a plurality of walls 16 of the flexible container 12 . the spout 10 is generally centrally disposed on the base 14 , the spout 10 extending in a perpendicular direction from the base 14 . the passageway 18 within the spout 10 allows for fluid communication with the inside of the flexible container 20 . the passageway 18 has a top end 22 and a bottom end 24 . the passageway 18 is substantially perpendicular to the base 14 . the evacuation structure 26 is connected to the bottom end 24 of the passageway 18 by a pivotal or flexible connection 30 . the evacuation structure 26 as shown in fig2 is substantially parallel to the base 14 of the spout 10 . initially , the flexible container 12 is filled with fluid through the spout 10 . the pivotal connection 30 of the evacuation structure 26 allows it to flex away from the spout 10 when the flexible container 12 is filled with fluid . this is shown by the direction of arrow a in fig3 . thus , the pivoting of the evacuation structure 26 ensures the evacuation structure 26 will not obstruct the flow of the fluid , inhibiting the filling of the flexible container 12 . in addition , because the evacuation structure 26 is flexibly movable , it will not break off under the force of the fluid during filling . during evacuation of the fluid , the evacuation structure 26 will pivot back towards the spout 10 , ensuring that the walls 16 of the flexible container 12 will not inhibit the fluid from evacuating . the flow of the evacuating fluid will cause the evacuation structure 26 to return to its original position or close enough to the spout 10 so the evacuation structure 26 will prohibit the walls 16 of the flexible container 12 from blocking the spout 10 during evacuation . alternatively , in another embodiment of the present invention , the pivotal connection 30 will have memory . after filling and before evacuation of the flexible container 12 , the memory of the pivotal connection 30 will cause the evacuation structure 26 to pivot back towards the spout 10 . the evacuation structure 26 will prohibit the walls 16 of the flexible container 12 from entering the passageway 18 when the flexible container 12 is evacuated . the evacuation structure 26 ensures that the fluid is not blocked from entering the spout 10 during evacuation by the walls 16 of the flexible container 12 . as shown in fig2 and 3 , in one embodiment of the present invention , the evacuation structure 26 comprises at least one crosshair 28 . at least one end of one crosshair 28 is pivotally connected 30 to the bottom end 24 of the passageway 18 . in another embodiment of the present invention , the evacuation structure 26 comprises at least two crosshairs 28 . the crosshairs 28 overlapping one another so that both can be pivoted away from the spout 10 . the crosshairs 28 could have a circular cross - sectional area , a rectangular cross - sectional area , or a variety of other shapes . the crosshairs 28 extend across the bottom of the passageway 24 so that each end of the crosshairs 28 is proximate the spout 10 . as shown in fig2 and 3 , in one preferred embodiment of the present invention , the evacuation structure 26 comprises two members 28 which are substantially perpendicular to each other and are connected at the point where they overlap . one end of one member 28 is pivotally connected 30 to the bottom end 24 of the passageway 18 of the spout 10 . as shown in fig4 , in another embodiment of the present invention , the evacuation structure 26 comprises at least two members 28 . the members 28 are substantially parallel to one another . the parallel members 28 can have substantially the same length as one another , or the members 28 can have varying lengths . as shown in fig5 , in another embodiment of the present invention , the evacuation structure 26 is a substantially flat permeable plate 32 . the permeable plate 32 has a periphery 34 , and at least one point on the periphery 34 is pivotally connected 30 to the bottom end 24 of the passageway 18 of the spout 10 . it should be understood that the permeable plate 32 could have a concave or convex shape to it . it should be appreciated that a number of other embodiments of the present invention would perform the same functions of the present invention . the present invention provides an evacuation structure 26 that will prohibit the walls 16 of the flexible container 12 from entering the passageway 18 during evacuation , thereby inhibiting the fluid evacuation . the present invention also provides an evacuation structure 26 which will not impede the filling of the flexible containers 12 . while the specific embodiments have been illustrated and described , numerous modifications come to mind without significantly departing from the spirit of the invention and the scope of protection is only limited by the scope of the accompanying claims . | 1 |
the present invention will now be described in detail with reference to the drawings , which are provided as illustrative examples of the invention so as to enable those skilled in the art to practice the invention . notably , the figures and examples below are not meant to limit the scope of the present invention to a single embodiment , but other embodiments are possible by way of interchange of some or all of the described or illustrated elements . moreover , where certain elements of the present invention can be partially or fully implemented using known components , only those portions of such known components that are necessary for an understanding of the present invention will be described , and detailed descriptions of other portions of such known components will be omitted so as not to obscure the invention . embodiments described as being implemented in software should not be limited thereto , but can include embodiments implemented in hardware , or combinations of software and hardware , and vice - versa , as will be apparent to those skilled in the art , unless otherwise specified herein . in the present specification , an embodiment showing a singular component should not be considered limiting ; rather , the invention is intended to encompass other embodiments including a plurality of the same component , and vice - versa , unless explicitly stated otherwise herein . moreover , applicants do not intend for any term in the specification or claims to be ascribed an uncommon or special meaning unless explicitly set forth as such . further , the present invention encompasses present and future known equivalents to the known components referred to herein by way of illustration . notably , the terminology used in the present specification is driven by preferred embodiments based on the g . fast ( g . 9701 ) standard . however , the present invention is not limited to such embodiments , and the concepts of the invention are applicable to any time division duplexed multicarrier based vectoring system other than g . fast . the present inventors recognize that discontinuous operation ( do ) defined by the g . fast standard requires the vectoring system to maintain an additional set of coefficient memory for both down - stream do and upstream do sub - matrices . according to certain aspects , therefore , embodiments of a vectoring system according to the invention uses this additional coefficient memory for the coefficient update staging area as outlined in more detail below . an example g . fast system implementing do according to embodiments of the invention is shown in fig1 . as shown , the system includes a distribution point unit ( dpu ) 100 having a full ro vectoring group of n lines 102 - 1 to 102 - n respectively coupled to cpes 104 - 1 to 104 - n . of this full set of n lines , a subset of m lines ( 102 - 1 of m to 102 - m ) is designated by the dpu as belonging to a do group . as is known , during each tdd frame of the g . fast system ( e . g . comprising 36 symbols ), all n lines in the system participate in ro for a certain number of symbols ( e . g . 4 downstream ( ds ) symbols of 32 ds symbols per tdd frame ), while only the m lines in the system ( m & lt ; n ) participate in do ( e . g . 28 ds symbols per tdd frame ), during which symbol periods the remaining n - m lines transmit only quiet symbols to save power . as such , the dpu 100 needs to maintain different sets of fext coefficients for the ro group ( e . g . n × n matrix of fext coefficients 110 ) and for the do group ( e . g . m × m matrix of fext coefficients 112 ). it should be noted that although only one set of coefficients is shown for each group , there typically needs to be different sets of coefficients for upstream and downstream communications . moreover , it is possible that there can several different do groups at the same time , or at different times . during operation , before each symbol period , the dpu 100 engages the appropriate ro matrix 110 or do matrix 112 to perform vectoring for all of the lines that are active during the subsequent symbol period . as set forth above , an aspect of the invention is allowing the matrices 110 and 112 to be managed and updated without the use of a separate memory used as a staging area . in general , by disabling the power - efficient , discontinuous operation , a g . fast system according to embodiments of the invention first frees up the do coefficient memory 112 . next , the system uses this memory as the staging area to manage joining / leaving events . finally the system reverts back to the power - efficient discontinuous operation and re - populates the do coefficient memory . embodiments of the invention will now be described in more detail primarily in connection with the downstream operation where the equipment in the distribution point unit ( dpu ) is all centrally located and the transceivers may be controlled by a central processor in the dpu . the customer premises transceivers are all distributed to different ( disparate ) locations . since upstream crosstalk cancellation is done with post cancellation processing in the dpu , discontinuous operation on each line may be rendered autonomous . however , the invention is not limited to downstream operations , and the principles described herein for the downstream may also be applied to the upstream channel using coordinated upstream flow control , for example . a block diagram illustrating an example dpu 100 for implementing aspects of the present invention is shown in fig2 . as shown , dpu 100 includes a fiber optic transceiver ( gpon onu ) 202 , a switch 204 , a central controller 206 , a vector control entity ( vce ) 208 which maintains a ro channel matrix 110 and a do channel matrix 112 , a vector precoder 214 and n g . fast transceivers 220 - 1 to 220 - n . as is known , during downstream tdd frames , transceivers 220 - j ( where j = 1 , 2 , . . . , n ) map user data received from gpon onu 202 and switch 204 to frequency domain symbols using mapper 222 ( for each line supported by the dpu ). to perform vectoring , vector precoder 214 adjusts the symbols before they are converted to time domain by ifft 224 and then to analog signals by afe 226 . when do is enabled , vector precoder 214 uses either ro channel matrix 110 or do channel matrix 112 , as controlled by vce208 . according to aspects of do , the key elements of fig1 to consider are the g . fast transceivers 120 and the vector precoder 112 . the power dissipation of these blocks will be reduced by the do being enabled . it should be noted that fig2 illustrates components for downstream transmissions for ease of illustrating aspects of the invention . however , dpu 100 typically also includes components for facilitating upstream communications , as should be apparent to those skilled in the art . similarly , transceivers 220 are illustrated as including downstream path components such as mapper 222 , ifft 224 and afe 226 for ease in illustrating certain aspects of the invention as set forth in more detail below . however , it should be understood that transceivers 220 can include additional components not shown in fig2 , including components for facilitating both upstream and downstream communications . central controller 206 , vce 208 , vector precoder 214 can be implemented by processors , chipsets , firmware , software , etc . such as nodescale vectoring products provided by ikanos communications , inc . those skilled in the art will be able to understand how to adapt these and other similar commercially available products after being taught by the present examples . meanwhile , g . fast transceivers 220 include conventional processors , chipsets , firmware , software , etc . that implement communication services such as those defined by the g . fast recommendation , as adapted for use in the present invention . those skilled in the art will be able to understand how to adapt such conventional g . fast products after being taught by the present examples . it should be noted that , although shown separately for ease of illustration , some or all of components 206 , 208 and 220 may be incorporated into the same chips or chipsets . it should be further noted that , although not illustrated here , transceivers 220 communicate with cpe transceivers also including conventional processors , chipsets , firmware , software , etc . that implement communication services such as those defined by the g . fast standard , as adapted for use in the present invention . those skilled in the art will be able to understand how to adapt such g . fast products after being taught by the present examples . fig3 shows an example of do being performed when vectoring is enabled in a dpu supporting four lines ( i . e . n = 4 ). as shown in this example , to enable vectoring , the tdd frame boundaries 302 are all aligned on all the lines in the vector group . fig3 shows two time regions : t no 304 for ro where all of the lines in the vector group are transmitting data symbols 312 in each of the time slots ; the other region t do 306 for do , which has a mixture of lines transmitting data 312 and quiet symbols 310 . it should be noted that , as mentioned previously , descriptions herein focus on transmission in the downstream direction . the crosstalk cancellation in the upstream direction is done with post cancellation processing in the upstream receiver . however , the principles described here for the downstream may also be applied to the upstream channel using coordinated upstream flow control , and so the invention includes such upstream embodiments as well . it should be further noted that the “ transmission ” of quiet symbols does not actually involve the formation of any symbols by transceiver 220 nor any transmission of energy on the line . rather , the transceiver is merely biased in such a manner as to maintain the same termination impedance it has on the line when it is transmitting data . transmission of a quiet symbol effectively turns off the process of the transceiver for the symbol period resulting in power savings relative to the case where the transceiver is sending a data symbol . in the example of fig3 , to enable vectoring , during ro 304 , the vce 208 causes precoder 214 to perform full 4 × 4 pre - coding for downstream crosstalk cancellation using matrix 110 . thus , the system is operating with full throughput maximum performance , while also dissipating the maximum power dissipation . for the do region 306 , the central controller 206 optimally configures the time slots for proper balance between system performance and power dissipation savings . accordingly , in this example , during symbol periods in the do region 306 , the central controller 206 causes the vce 208 to engage the do channel matrix 112 so that the downstream pre - coder 214 uses a 2 × 2 configuration for cancelling the crosstalk between lines 3 and 4 , while configuring the transceivers 220 for lines 1 and 2 to transmit only quiet symbols . for the 2 × 2 pre - coder configuration , it can be assumed that some power saving is achieved in the precoder 214 as compared with the full 4 × 4 configuration for the corresponding period of time since fewer operations were executed . it should be noted that the configuration of the channel matrix and pre - coder 214 , as well as the number of time slots in the do region 306 can be dependent on the amount of data required for transmission during the tdd frame . the central controller 206 monitors the activity on the transmit buffers in transceivers 220 to help determine the configuration of time slots and the pre - coder . the algorithms used by controller 206 to determine the optimal balance between performance and power dissipation savings can be implementation dependent , and those skilled in the art will be able to implement various such algorithms after being taught by the present examples . fig4 is a diagram for illustrating aspects of managing joining events according to embodiments of the invention . fig4 illustrates operation of a g . fast vectored system such as that shown in fig3 . as in that example , to enable vectoring of the four active lines 1 - 4 , during ro 404 , while all lines are transmitting data symbols 412 , the vce 208 causes precoder 214 to perform full 4 × 4 pre - coding for downstream crosstalk cancellation using matrix 110 . for the do region 406 , the central controller 206 causes the vce 208 to engage the do channel matrix 112 so that the downstream pre - coder 214 uses a 2 × 2 configuration for cancelling the crosstalk between lines 3 and 4 which continue to transmit data symbols 412 , while configuring the transceivers 220 for lines 1 and 2 to transmit only quiet symbols 410 . fig4 further illustrates managing a joining / leaving event in the system that affects either the number of n lines in the ro group or m lines in the do group according to embodiments of the invention . in this example , an additional line 5 signals to join the system in a symbol 420 during do region 406 . as shown in fig4 , controller 206 suspends the power - efficient do operation and begins power - inefficient do operation in period 424 in the symbol period subsequent to the joining notification 420 . in contrast to power - efficient do operation , the vce 208 engages the full ro coefficient matrix 110 , with the lines 1 and 2 that are not in the do group transmitting pre - coded idle symbols 414 while do group lines 3 and 4 continue to transmit data symbols 412 . this frees up the memory used for the do coefficient matrix 112 . in period 424 , the vce 208 uses the memory previously used for the do coefficient matrix 112 as the staging memory to encode the updated full n + 1 × n + 1 coefficient matrix . it should be appreciated that the encoding process can extend over many tdd frames . in the do period 406 in each of these tdd frames , the lines 1 and 2 that are not in the do group continue to transmit idle symbols instead of quiet symbols . after the new full ro matrix has been encoded , pointers to the memories associated with ro coefficient matrix 110 and do coefficient matrix 112 are switched such that the updated ro coefficient matrix 110 can be engaged by the vce 208 before the beginning of the next tdd frame when line 5 is allowed to actually join the ro group . during period 426 , the coefficients in the do matrix 112 are re - computed . it should be appreciated that this can take several tdd frames . also during period 426 , to enable vectoring of all lines 1 - 5 , the updated ro coefficient 110 is engaged by the vce 208 . as further shown in fig4 , during all do periods in period 426 , lines 1 and 2 , which are not in the do group , continue to transmit idle symbols 414 , while the new line 5 has been designated as not belonging in the do group in this example , and so it also begins to transmit idle symbols 414 . finally , in the first symbol of the first do period of a tdd frame after the new do coefficient matrix is computed , vce 108 engages the updated do matrix 112 and the system resumes power - efficient do operation 406 , with quiet symbols 410 being transmitted by lines not in the do group ( lines 1 , 2 and 5 in this example ). it should be noted that the above example describes updating the downstream coefficient matrices during an event where a line requests joining the system during a downstream do operation . those skilled in the art will appreciate that the upstream coefficient matrices can be updated for the new line during subsequent transmissions using similar processing as described for the downstream coefficient matrices , and will further understand how to manage a line drop event after being taught by these examples . fig5 is a flowchart illustrating aspects of managing joining / leaving events according to embodiments of the invention in alternative detail . as in the previous example , this flowchart illustrates an example method of managing a new line requesting to join an existing n × n system during downstream discontinuous operation having a do group of m lines such as that shown in fig1 . in a first step s 502 , the system suspends the power - efficient do operation and begins power - inefficient do operation . more particularly , as described above , during power - efficient do operation , the vce 208 engages the smaller sub - matrix 112 with n - m lines that are not in the do group transmitting quiet symbols ( i . e . no power ). during power - inefficient do operation according to the invention , however , the vce 208 engages the full matrix 110 , with the n - m lines that are not in the do group transmitting pre - coded , idle symbols . this frees up the memory used for the do coefficient matrix 112 . in embodiments , the idle symbol is constructed using the ( 0 , 0 ) point of the direct channel constellation . no user data is transmitted on the line during time slots corresponding to idle symbols but sending such an idle symbol effectively causes the transceiver 220 to send crosstalk cancellation signal energy from other lines in the vector group to provide downstream crosstalk cancellation . it should be noted that idle symbols therefore differ from quiet symbols in that the idle symbols are actually adjusted by vector precoder 214 and converted to time domain signals by ifft 224 for transmission on the associated lines , whereas quiet symbols do not result in any signals actually being transmitted . in a next step s 504 , the system uses the memory previously used for the do coefficient matrix 112 as the staging memory to encode the updated full coefficient matrix for the new full ro group of n + 1 lines . this process can take several tdd frames . as is known , g . fast describes mechanisms to estimate the full ro matrix using sync symbols and errors associated with the sync symbols communicated by downstream cpe &# 39 ; s , and embodiments of the invention can use these mechanisms . further details thereof will be omitted here for sake of clarity of the invention . in a next step s 506 , after the new full ro matrix has been encoded , pointers to the memories associated with ro matrix 110 and do matrix 112 are switched such that the updated n + l × n + 1 ro coefficient matrix 110 can be engaged by the vce 208 before the next tdd frame when the new line actually joins the ro group . in a next step s 508 , the coefficients in the do matrix 112 are re - computed . in embodiments , this is done by deriving the coefficients from the ro matrix 110 using conventional approaches such as those described in connection with co - pending application ser . no . ______ ( 14ik08 ). finally , preferably in the do portion of next tdd frame after the new do coefficient matrix is computed , in step s 510 , the vce 208 engages the updated do matrix 112 and the system resumes power - efficient do operation . although the present invention has been particularly described with reference to the preferred embodiments thereof , it should be readily apparent to those of ordinary skill in the art that changes and modifications in the form and details may be made without departing from the spirit and scope of the invention . it is intended that the appended claims encompass such changes and modifications . | 7 |
to create one electrolyte solution we add to water cobalt cation at around 1 mm , such as by adding coso 4 , cocl 2 , co ( no 3 ) 2 or the like . we also add a fluoride anion at a concentration of about 0 . 1 m . we preferred providing the fluoride anion in the form of a ph buffered mixture of kf and hf . in our experiments with varied phs the ph was adjusted by the addition of khf 2 or naoh as needed . in other electrolyte solutions we added to water cobalt cation at around 1 mm , such as by adding coso 4 , cocl 2 , co ( no 3 ) 2 or the like . we also added our selected buffering electrolyte , typically at a concentration of about 0 . 1 m or 1 m . all potentials are given relative to the nhe reference electrode . in the fig2 - fig6 experiments we causes electrolytic film deposition of our catalyst by operating the fig1 device using the aforesaid electrolytic solution at about 1 . 48 volts ( e . g . 1 . 33 volts to 1 . 58 volts ). once the anode has been coated with our catalyst , it is no longer critical that the electrolyte solution contain both the cobalt or fluoride . it could continue to be operated with fluoride . fig2 depicts the results of cyclic voltammetry scans of an indium tin oxide substrate anode in 0 . 1 m kf electrolyte with and without 1 mm coso 4 at ph 5 . the vertical axis is the log current density . the horizontal axis is voltage . in the presence of cobalt ions ( 11 ) there was an abrupt production of catalytic current . as the voltage is scanned back , there was a broad cathodic peak centered at e p , c = 1 . 07 v . subsequent to electrodeposition we ran the fig3 experiments . continued controlled - potential ( cpe ) electrolysis at 600 s 1 . 48 v , in 0 . 1 m fluoride at ph 5 with 1 mm coso 4 , and following a subsequent 600 s . cpe at 1 . 48 v in cobalt - containing buffer led to deposition of a film of material that showed increased catalytic current on subsequent cyclic voltammetric scans . these ( 13 ) experiments showed an anodic wave at ˜ 1 . 2 v that blended into the catalytic current . a subsequent cyclic voltammetric scan following rinsing of the electrode and electrolysis in fresh ph 5 fluoride buffer for 10 min at 1 . 48 v confirmed that even without cobalt in the electrolyte solution the coated anode retained essentially the same activity ( 14 ). note that in our experiments the catalytic effect was noted unless the electrode is held at potentials more reducing than the cathodic wave at ˜ 1 v , below which dissolution of the catalyst is observed . as depicted in fig4 , we then compared the effect of different phs using a graphite anode . we found that even at phs around neutral the catalytic effects are quite efficient . we then sought to compare the efficiency of our catalyst with catalytic results using another anion besides fluoride , with cobalt . these experiments are depicted on fig5 . the fig5 experiments confirm the superiority of the fluoride anion ( 23 )/ 1 m or ( 24 )/ 0 . 1 m versus phosphate ( 25 ) or ( 26 ) at those molarities . we compared the log of the current density versus overpotential . we then ran an experiment involving constant - potential electrolyses of fluoride - buffered cobalt solutions in a stirred , undivided cell ( without the diaphragm 8 ). these experiments were not focused on the collection of the gases . fig6 experiments were run at an initial ph of 5 , and showed the pattern of current increase reflecting deposition as graphed . with the increase in current there was formation of increased visible deposit on the electrode and bubbling . fluoride results ( 20 ) were superior to phosphate ( 21 ), and vastly superior to sulfate . in prolonged electrolyses in cobalt - free buffer at lower ph , we noted that there was a decrease in current over time . we attribute this to slight dissolution of the visible coating on the anode . this suggests that the pka of hf is close to that of the solid . however , steady state is achieved at approximately 0 . 1 mm co ++ . alternatively , increasing the fluoride concentration in the electrolyte solution after anode coating formation was found to lead to a more stable deposit . in the fig7 experiment we used 0 . 1 m fluorophosphate presented as sodium monofluorophosphate adjusted with sulfuric acid or sodium hydroxide to a ph of 4 . 8 . catalyst was deposited at about 1 . 3 v and the resulting cell then worked efficiently at about 1 . 6 v . in the fig8 experiment we used 0 . 1 m of trifluoromethyl sulfonamide adjusted with sodium hydroxide to a ph of about 6 . 3 . catalyst was deposited on the anode at 1 . 05 v and the resulting cell then worked efficiently at about 1 . 55 v . in the fig9 experiment we used 1 m sulfate presented at a 50 / 50 mix of sodium sulfate and sodium bisulfate adjusted with sulfuric acid and sodium hydroxide to a ph of 2 . 2 . catalyst was not deposited on the anode . our preliminary experiments with chromate indicate similar utility . thus , as yet another alternative we are proposing 1 m chromate presented as a mix of sodium chromate and chromium trioxide adjusted with sodium hydroxide to a ph of about 6 . 5 . as a further alternative we are proposing 1 m trifluoromethyl phosphonate or other perfluoroalkyl phosphonate presented as the perfluoroalkyl phosphonic acid adjusted with sodium hydroxide to a ph of about 6 . 5 . as yet another alternative we are proposing 1 m perfluoro - tert - butoxide or other perfluorinated tertiary alkoxides , deprotonated hexafluoroacetone hydrate or other anions of perfluorinated dialkyl ketone hydrates presented as the perfluorinated alcohol or ketone adjusted with sodium hydroxide to a ph of about 4 . 5 . the cathode ( 6 ) can be any cathode suitable for use in water electrolysis under the conditions we are exposing the cathode to . particularly preferred cathodes are platinum or platinized graphite cathodes . the anode ( 4 ) begins with a substrate ( 5 ), which again can be any anode suitable for use in water electrolysis under the conditions we are exposing the anode to . particularly preferred substrates for the anode are materials such as tin oxides , particularly indium tin oxide or fluorine tin oxide . once the anode has been coated with our catalyst , it is no longer critical that the electrolyte solution contain both the cobalt and the anion . it could continue to be operated without the cobalt , using the anion . one can generate oxygen gas using our improved anode ( along with hydrogen at the cathode ). an electrode prepared by the constant - potential deposition can be placed in 0 . 1 m - 1 m anion , in a closed , divided cell like that of fig1 , and linked to a pressure transducer . the presence of gas generation at both the anode and cathode can be confirmed . further , we note that we ran some studies of the nature of the catalysts . in one experiment we determined that the catalyst contained cobalt , oxygen , and fluorine , in about the ratio of one fluorine , to 4 . 24 cobalt , to about 8 . 9 oxygen . we believe that the fluorine is present as fluoride in the material . sem images of the deposit show a layer of fused spherical nodules . the catalyst appears yellow - brown . we believe that with this catalyst f acts as a proton acceptor during oxidation of cluster sites bearing either a co ( h 2 o ) or cooh moiety en route to o — o bond formation , with either subsequent proton transfer to or exchange of the formed hf with f in solution . the inability of catalytically competent deposits to form anywhere near as well in sulfate electrolyte solutions at low cobalt concentration suggests that so 4 2 − is too weak of a base . our experiments with fluoride suggest that the fluoride is acting in some more complicated role than phosphate does . we believe that it is not just acting as a base . fluoride can act as a ligand on cobalt , and fluoride is also a strong hydrogen - bond acceptor that may play a role in activating water molecules towards reaction with the catalytic center . as cobalt oxyfluoride compounds are readily produced , we favor the explanation that a cobalt oxide cluster containing at least one fluoride ligand is formed to create the claimed catalyst , and that this undergoes exchange with water to form an aqua - complex which engages in electron - coupled proton transfer to outer - sphere fluoride to yield clusters containing a co ( o ) species which produces the observed water oxidation . while a number of embodiments of the present invention have been described above , the present invention is not limited to just these disclosed examples . there are other modifications that are meant to be within the scope of the invention and claims . thus , the claims should be looked to in order to judge the full scope of the invention . the present invention provides catalytic materials for use in water electrolysis and other reduction reactions , where the catalyzed reaction can be conducted at mildly acidic conditions . it also provides anodes useful in these methods , methods of forming these anodes , and methods of generating a fuel and oxygen gas using them , thereby providing a more practical way of storing renewable energy . | 8 |
fig1 a and 2b show a nickel electrocast shell se obtained in accordance with the present invention . the electrocast shell se has a predetermined shape ( see fig4 and 7 ) and it has a surface formed with a grain pattern p , for example , simulating leather with stitched portions s . the electrocast shell se is formed with a multitude of fine vent holes h distributed therethroughout to form a microporous body . the vent holes h are arranged respectively at pitches of 0 . 4 to 0 . 7 mm longitudinally and transversely , and have openings o1 at the front surface thereof of a diameter of 0 . 08 to 0 . 1 mm . since the openings o1 of the vent holes h are very small in diameter , the grain pattern p is not affected by imprinting of the openings . the manufacture of the electrocast shell se will now be described with reference to fig3 a to 3e . a precision model m having the grain pattern p is fabricated from gypsum . the surface of the model m having the grain pattern p is subjected to a silver mirror treatment to form a thin conductive layer co of silver on the surface , and the grain pattern p is present over the entire surface of the conductive layer co . the periphery of the model m is surrounded by an insulating cylindrical body t . a multitude of elutable polystyrene particles b having a diameter of 0 . 2 mm are stacked in approximately four sub - layers on the entire surface of the conductive layer co to form a band or layer l of the polystyrene particles . an anti - floating body w comprising glass particles in a nylon net is placed on the layer l so that the polystyrene particles b in the lowermost sub - layer are pressed into close contact with the surface of the conductive layer co . thereby , each of the polystyrene particles b in the lowermost sub - layer comes into close point contact with the surface of the conductive layer co . the model m is put into a nickel plating solution so in an electrocasting tank ta . the conductive layer co is connected to the (+) terminal of a power source es and an electrode e , opposite the anti - floating body w , is connected to the (-) terminal of the source es whereby the model m is subjected to an electrocasting treatment . during this electrocasting treatment , the deposited nickel n fills the spaces between the conductive layer co and the polystyrene particles b , except for the contact points between the conductive layer co and the polystyrene particles b , and the deposited nickel n fills the spaces between the adjoining polystyrene particles b except for the contact points therebetween thereby to obtain the electrocast shell se having the grain pattern p on the surface thereof . the thickness of the electrocast shell se is set to be thinner than the layer l so that the surfaces of the polystyrene particles b in the uppermost sub - layer are slightly exposed from the electrocast shell se . after the electrocast shell se has been separated from the conductive layer co , the shell is immersed into a solvent , such as toluene , methylene chloride , or the like to elute the polystyrene particles b from the electrocast shell se . in this case , since a part of the particles and the upper surface of layer l are exposed and since the particles at the surface with the grain pattern p are exposed at their contact points , the polystyrene particles b are dissolved at said exposed portions and contact points to form openings o2 and o1 respectively . the electrocast shell se is internally formed with holes h1 after the polystyrene particles have been eluted which communicate through openings h2 at the contact points between the adjoining polystyrene particles b . in this manner there is obtained electrocast shell se in the form of a microporous body having a multitude of vent holes h with extremely small - diameter openings o1 , o2 at respective surfaces thereof as shown in fig1 a and 2b . the particles that may be eluted include paraffin particles , aluminum particles and the like in addition to the aforementioned polystyrene particles b . in the case of paraffin particles , they are eluted from the electrocast shell by heating . in the case of aluminum particles , they are eluted from the electrocast shell by heating or by chemical etching . fig4 shows an apparatus for obtaining a laminated body having grain pattern p , using the electrocast shell se obtained in accordance with the present invention . the apparatus comprises a vertically movable first movable portion 1 1 and a vertically movable second movable portion 1 2 located therebelow . a downwardly oriented opening 4 of a box 3 having a top wall 2 is closed by the electrocast shell se with the grain pattern p facing downwardly . the outer peripheral edge of the shell se is fixedly secured to a flange 7 of the box 3 through a pad 6 by means of a plurality of bolts 8 and nuts 9 . a support plate 10 is suspended from the top wall 2 of the box 3 , and intermediate portions of a plurality of angle members 11 are welded to the lower edge of the support plate 10 in a predetermined spaced relation in a plane perpendicular to fig4 . both ends of each of the angle members 11 are welded to the inner surface of the box 3 . the electrocast shell se is supported by the angle members 11 by means of a plurality of bolts 13 screwed into threaded sleeves 12 welded to the rear surface of the electrocast shell se . at the inner peripheral edge of the flange 7 , a vacuum seal 14 is interposed between the edge and the shell se . within the box 3 , a porous back - up body 17 having continuous air holes is integrally joined to the rear surface of the electrocast shell se so as to reinforce the shell se . the back - up body 17 comprises a first layer 17 1 disposed on the electrocast shell se and comprising a multitude of adjoining steel balls 18 of excellent anti - corrosion property , such as stainless steel . the steel balls are mutually joined together by a thermosetting plastic such as an epoxy resin . a second layer 17 2 of the back - up body is laminated on the first layer 17 1 and comprises a multitude of adjoining glass particles 19 mutually joined together by a thermosetting plastic , similar to the one joining the steel balls . when the first layer 17 1 is formed , a predetermined quantity of steel balls 18 of a diameter of 70 to 150μ with a resin layer r 1 formed of said thin thermosetting plastic on the surface thereof ( as shown in fig5 ) are introduced into the box 3 at the rear surface of the electrocast shell se , after which the steel balls 18 with the resin layers r 1 are heated to 70 ° to 80 ° c . to join the contacting resin layers of the adjoining steel balls 18 to form gaps v 1 surrounded by the contact points . continuous air holes are formed in the first layer 17 1 by the gaps v 1 . when the steel balls 18 are mutually joined together , the first layer 17 1 and the electrocast shell se are also joined together by the resin layers r 1 . when the second layer 17 2 is formed , members ( not shown ) having the same shape as recess 17a are suspended within box 3 to form said recesses 17a in order to reduce the weight of the apparatus . a predetermined amount of glass particles 19 of a diameter between 400 to 600μ having thin resin layers r 2 on the surfaces thereof ( as shown in fig6 ) are introduced into the box 3 onto the first layer 17 1 , after which the glass particles 19 with the resin layers r 2 are heated to 70 ° to 80 ° c . to join the particles 19 at their contact points with the adjoining glass particles to form gaps v 2 surrounded by the contact points . continuous air holes are formed in the second layer 17 2 by the gaps v 2 . when the glass particles 19 are mutually joined together , contact points between the first layer 17 1 and the second layer 17 2 are also joined by the resin r 2 . the support plate 10 is formed with a plurality of through - holes 20 through which the glass particles 19 can pass so as not to be interrupted by the support plate 10 . cooling pipes 21 are embedded in the first layer 17 1 in a zigzag fashion so that the electrocast shell se may be uniformly cooled over its entire extent . in this case , the first layer 17 1 principally comprises the steel balls 18 and therefore has excellent heat conductivity . accordingly , the electrocast shell se may be cooled efficiently . the zigzag embedment of the cooling pipes 21 reinforces the first layer 17 1 . the interior of the box 3 is connected through a changeover valve 22 to a vacuum pump 23 1 and a blower 24 . the second movable portion 1 2 is constructed as follows . a press mold 28 having a shape for registration with the electrocast shell se is fixedly secured at an upwardly oriented opening 27 of a box 26 having a bottom wall 25 . the press mold 28 is formed at its upper surface with a recess 29 into which a core c can be fitted . the press mold 28 is also formed with a plurality of vacuum holes 30 extending therethrough and the holes 30 are approximately uniformly distributed over the entire mold . the interior of the box 26 is connected to a vacuum pump 23 2 . a laminated body to be molded comprises a plastic sheet s and a core c . the plastic sheet s comprises a single layer of polyvinyl chloride or the like , or a laminated sheet which includes said single layer as a skin to which is secured a foam polypropylene cushion layer . the core c is formed with a plurality of small - diameter vacuum attraction holes 31 in a plate of abs resin or the like and the plate is registered with recess 29 in the press mold 28 such that the holes 30 in the mold are aligned with the holes 31 in the core c . the surface of the core c is coated with a hot melt adhesive , as an adhesive agent , and the adhesive is heated and softened . in the state as shown in fig4 the first movable portion 1 1 has been moved upwards while the second movable portion 1 2 has been moved downwards to open the electrocast shell se and the press mold 28 . the core c is fitted into the recess 29 of the press mold 28 with the adhesive - coated surface thereof facing outwards , and the vacuum attraction holes 31 are brought into registration with the vacuum attraction holes 30 of the press mold 28 . the plastic sheet s formed from skin layer a and cushion layer b is heated to a softening temperature of approximately 180 ° c ., and the plastic sheet s is disposed between the first and second movable portions 1 1 and 1 2 ` with the skin layer a on top . as shown in fig7 the first movable portion 1 1 is moved downwards while the second movable portion 1 2 is moved upwards to clamp the plastic sheet s between the electrocast shell se and the press mold 28 . since the plastic sheet s is pressed against the surface of the electrocast shell se by the press mold 28 , the sheet s will have good conformance to that surface . the interior of the box 3 of the first movable portion 1 1 is connected to the vacuum pump 23 1 . the electrocast shell se with the multitude of fine vent holes h over the entire extent thereof applies suction force to the plastic sheet s to insure that it conforms to the surface of the shell se by the press mold 28 . therefore , the sheet s comes into tight and close contact with the whole surface of the shell se whereby the grain pattern p will be accurately and clearly transferred or embossed onto the surface of the sheet s and at the same time the sheet s is formed into the shape of the electrocast shell se . since the electrocast shell se is being cooled by the cooling pipes 21 , the sheet s is immediately cooled to prevent the grain pattern p and the shape of the sheet s from changing . the vacuum pump 23 2 on the second movable portion 1 2 is actuated to suction the molded sheet s against the press mold 28 and the surface of the core c and blowing pressure is applied to the molded sheet by switching the interior of the box 3 of the first movable portion 1 1 to the blower 24 through the changeover valve 22 . thereby the molded sheet or body is released from the electrocast shell se and comes into close contact with the core c to be joined therewith . since the molded sheet is in firm and close contact with the electrocast shell se , combined use of the suction force and blowing pressure constitutes an extremely effective means for promoting the release of the molded body . the blower 24 is then halted , and the interior of the box 26 of the second movable portion 1 2 is switched to atmospheric pressure , after which the first movable portion 1 1 is moved upwards while the second movable portion 1 2 is moved downwards to permit removal of the laminated body l from the press mold 28 . the grain pattern p applied to the surface of the laminated body l is clear and distinct . in addition , the joining strength between the molded body formed from the plastic sheet s and the core c is great , and its durability is excellent . although the invention has been described in relation to a specific embodiment thereto , it will become apparent to those skilled in the art that numerous modifications and variations can be made within the scope and spirit of the invention as defined in the attached claims . | 2 |
‘ big bird ’ has not been observed under all possible environmental , cultural and light conditions . the following observations and descriptions are of plants grown in fulshear , tex ., in april 2005 , under polypropylene shadecloth providing a 30 percent light reduction , and under conditions which closely approximate commercial production . plants described were approximately one year old . in this description , color references are to the royal horticultural society colour chart ( 4th edition ) and terminology used in the color descriptions herein refers to plate numbers in this color chart . phenotypic expression may vary with light intensity , cultural and environmental conditions . botanical .— hibiscus rosa - sinensis ‘ big bird ’. parentage . — female or seed parent : hibiscus rosa - sinensis ‘ spring break ’. male or pollen parent : an unnamed plant from the cross of hibiscus rosa - sinensis stormy moon × purple passion . propagation . — by cuttings . time to initiate rooting . — approximately 14 to 21 days at 21 - 24 ° c . time to develop roots . — approximately 42 to 56 days at 21 - 24 ° c . root description . — fine to medium ; fibrous ; freely branching . size . — height : approximately 40 - 50 cm in a # 2 pot ( from soil level to top of flowers ). diameter / spread : approximately 40 - 45 cm in a # 2 pot . form and growth habit . — perennial , evergreen shrub ; mostly upright and somewhat spreading . branching . — freely branching , about 4 to 8 lateral branches develop after pinching . lateral branches : approximately 11 cm long and 4 mm in diameter . coloration : young — 147b . mature — 199b . internode length : approximately 3 cm . shape . — cordate . apex : rounded . base : cordate . leaf size . — approximately 9 cm long and 8 cm wide . arrangement . — alternate , single , symmetrical . margin . — crenate . aspect . — undulate . texture . — glabrous . coloration . — young foliage upper side : near yellow - green group 146b . under side : near yellow - green group 146c . mature foliage upper side : near yellow - green group 147a . under side : near yellow - green group 147b . petioles . — size : approximately 3 cm in length ; approximately 2 . 5 mm in diameter . coloration : near yellow - green group 147b . texture : smooth . bloom period . — typically year - round under subtropical and tropical conditions . flower arrangement . — arranged singly at terminal leaf axils ; free flowering with 3 to 4 flower buds and / or open flowers per terminal apex ; flowers face upright and slightly outward . flower appearance . — ruffled yellow flower with a dark maroon center ; flowers are open for about two days before closing ; flowers persistent . flower diameter . — approximately 14 cm . flower depth . — when placed on a horizontal plane , the flower extends 6 cm above the surface , with the ruffles extending 2 cm . buds ( just prior to showing color ).— rate of opening : approximately 1 or 2 days , depending on temperature . shape : elliptic . length : approximately 3 cm . diameter : approximately 1 . 4 cm . color : near yellow - green group 146b . fragrance . — none noted . petals . — number / arrangement : corolla consists of 5 overlapping petals . shape : spatulate with rounded apex . size : approximately 8 . 5 cm long and 8 . 7 cm wide . margin : entire , but ruffled . texture : smooth . base descriptor : oblique . color upper surface : yellow , near between 15a and 15b , with the eye or throat near greyed - purple 187a . lower surface : majority of the lower surface is near 15c , fading to near 15d at the base of the petal . sepals . — number / arrangement : 5 sepals fused into a star - shaped calyx . shape : linear with acuminate apices . margin : entire . color : near yellow - green group 146b . peduncles . — length : approximately 4 cm . diameter : approximately 2 mm . angle : upright to about 45 degrees . strength : strong , flexible . color : near yellow - green group 147b . androecium . — stamens : numerous ; approximately 50 . stamen length : approximately 5 mm . filament color : near white group 155b . anther size : approximately 1 mm long × 1 mm wide . pollen amount : abundant . pollen color : near yellow group 15c . gynoecium . — pistil length : approximately 6 cm . stigma appearance : five , rounded . stigma diameter : approximately 2 mm . stigma color : near yellow group 5a . style color : base is near 187a , lightening to near 185b ; the upper half is near 15c . seed production : has not been observed . pests / diseases : resistance to known hibiscus diseases had not been observed on plants grown under conditions approximating commercial practices . | 0 |
fig1 shows how the inventive sealing element 1 is inserted into a specially provided recess 3 of the injector body 2 . the recess 3 has a section 4 at the bottom end that tapers conically towards the engine . an elastomer grommet 5 is formed on the sealing element 1 , said elastomer grommet embodied as a counterpart to section 4 . by means of the elastomer grommet 5 , the sealing element 1 can be plugged onto the head plate of the piezo actuator . the sealing element 1 is inserted from the bottom so deep into the recess 3 that the elastomer grommet 5 forms a tight fit against the section 4 of the recess 3 . the sealing element 1 is completely made of elastomer . at the top end of the sealing element 1 , two encircling sealing beads 6 are formed that are compressed when they are inserted into the sealing element in the recess 3 and therefore seal the recess 3 from the outside . as a result , the inside part of the injector body 2 is sealed hermetically from the environment . in this way , the mounting area for the piezo actuator is protected against environmental influences and particularly against a very wide diversity of liquids and this guarantees a reliable functioning of the piezo drive for the entire service life of the vehicle . the sealing element 1 has two breakthroughs running in a longitudinal direction . these breakthroughs serve to accommodate the contact pins 7 that are connected to the electrical leads of the piezo actuator . a control voltage is applied to the piezo actuator via the contact pins 7 . at the top end of the sealing element 1 , flexible sealing lips 8 are formed around each breakthrough that completely seal the pushed - in contact pins 7 . in this way , it is ensured that there can be no ingress of liquid from the outside into the piezo actuator . in the case of the sealing element 1 according to the invention , the sealing function brought about by the encircling sealing beads 6 is completely separate from the sealing function brought about by the flexible sealing lips 8 . as a result , a deformation in the area of the encircling sealing beads 6 that occurs because of the compression , does not affect the sealing efficiency of the flexible sealing lips 8 . on the other hand , a forced position of the contact pins 7 can be compensated for by the flexibility of the sealing lips 8 without this adversely affecting the efficiency of the sealing beads 6 . the elastomer material can compensate and dampen relative movements that result because of thermal expansions and vibrations . in order to ensure that the sealing functions are separate from one another and do not adversely affect one another , there must be sufficient elastomer material between the different seals to serve as a buffer function . therefore , in the embodiment shown , the different sealing functions implemented by the sealing element 1 are decupled from one another in such a way that the sealing beads 6 and the sealing lips 8 are arranged at different levels transverse to the longitudinal direction of the sealing element 1 . fig2 shows a cross - section through the sealing element 1 on the basis of which the different sealing effects implemented by means of the sealing element 1 can be identified . the encircling elastomer beads 6 seal the sealing element 1 from the associated recess of the injector body . the breakthroughs 9 that pass in a longitudinal direction through the sealing element 1 serve to accommodate the two contact pins 7 . the sealing lips 8 seal the contact pins 7 from the piezo actuator . the leads of the piezo actuator can be welded to the flat parts 10 or be connected electrically in another way . the elastomer grommet 5 is formed on the bottom end of sealing element 1 by means of which the sealing element 1 consisting of the said elastomer grommet is plugged onto the head plate of the piezo actuator . fig3 is a view of the overall structure of the piezo actuator . the piezo stack 11 can be deformed in a longitudinal direction by applying a voltage signal to the leads 12 . the piezo stack 11 is located inside the bourdon tube 13 that is welded to the base plate 14 . the bourdon tube 13 is connected to the head plate 15 in such a way that it is under a certain initial stress that acts as a resetting force for the piezo stack 11 . in order to fit the piezo actuator , the contact pins 16 pass through the breakthroughs of the sealing element 17 and through the side slots 18 of the head plate 15 . the flat parts 19 are connected to the leads 12 in an electrically conductive way , for example , by welding . in this case , particularly laser beam , arc or resistance welding processes are considered . subsequently , the sealing element 17 is also moved towards the head plate 15 ; as a result , the contact pins 16 are pulled out of the sealing element 17 . the sealing element 17 is put onto the formed spigot 20 . this aligns the piezo stack 11 , the head plate 15 and the sealing element 17 relative to one another . the contact pins 16 can now be shortened to the desired length . subsequently , the assembled piezo actuator is inserted into the corresponding recess in the injector body and fixed in the desired position . this can , for example , be done by the piezo actuator being sealed off from the injector body by means of calking elements . in this case the thread 21 is used for fixing the calking elements . | 7 |
fig1 illustrates a block diagram of the front end of a typical wireless terminal 10 employed in cellular communications system that incorporates a power amplifier 36 in accordance with one embodiment of the present invention , although the invention is not limited in scope in that respect . for example , fig5 illustrates a communications system comprising a base terminal 8 and a plurality of wireless terminals 10 , which advantageously employ a power amplifier 36 in accordance with one embodiment of the invention . with reference to fig1 and 5 , antenna 12 is configured to receive signals from a base station 8 , and to transmit signals from the wireless terminal back to the base station . the output terminal of antenna 12 is coupled to an input terminal of a duplexer 14 . duplexer 14 is designed to route incoming signals from the base station to the upper signal path of wireless terminal 10 , and to route signals from the lower path of the wireless terminal to antenna 12 . signals received by antenna 12 are routed through duplexer 14 to an input terminal of a bandpass filter 16 , which is tuned to a desired frequency band intended for the wireless terminal . the output signal of bandpass filter 16 is amplified by low noise amplifier 18 , which has an input terminal coupled to the output terminal of the bandpass filter . a mixer 20 receives the output signal of low noise amplifier 18 and a constant frequency signal from voltage - controlled oscillator 26 . mixer 20 down - converts the frequency of the signal received from low noise amplifier 18 , and provides the down - converted signal to a bandpass filter 22 . the output signal of bandpass filter 22 is then applied to an automatic gain control amplifier 24 . the output signal of automatic gain control amplifier 24 is then provided to a signal processing circuit ( not shown ) for converting the received signal into speech and / or data . the lower signal path of wireless terminal 10 performs substantially the reverse functions of components described above . thus , amplifier 28 receives and amplifies the signal intended to be transmitted to a base station . the output signal of amplifier 28 is then applied to a mixer 30 , which also receives a constant frequency signal from voltage - controlled oscillator 26 . mixer 30 up - converts the signals received from amplifier 28 to a radio frequency rf signal . the output signal of mixer 30 is coupled to an input terminal of a bandpass filter 32 . the output signal of bandpass 32 , in turn , is provided to a driver 34 , which generates a radio frequency rf signal having a given power signal level . the output signal of driver 34 is coupled to an input terminal of a dynamic power amplifier such as amplifier 36 in accordance with one embodiment of the present invention . finally , the output signal of dynamic power amplifier 36 is coupled to antenna 32 via duplexer 14 . as mentioned before , the input power signal level coupled to amplifier 36 depends on the distance of the wireless terminal from the base station . as the distance from the wireless terminal to the base station increases , the required input power signal coupled to amplifier 36 increases also . conversely , as the distance from the wireless terminal to the base station decreases , the required input power signal coupled to amplifier 36 decreases also . however , with prior an power amplifiers , as the input power signal decreases the efficiency of the amplifier would substantially decrease also . as it will be explained in more detail hereinafter , in accordance with one aspect of the present invention , dynamic power amplifier 36 adjusts its biasing signals so that the amplifier operates at a substantially high efficiency region for a substantially wide range of input power signal levels . fig2 illustrates a block diagram of a dynamic power amplifier , such as 36 , in accordance with one embodiment of the present invention , although the invention is not limited in scope in that respect . the input terminal of dynamic power amplifier 36 receives a voltage signal from the output terminal of driver 34 ( fig1 ). this voltage signal is coupled to an input terminal of a power amplifier 38 . advantageously , as it will be explained in more detail with reference to fig3 a and 3b , power amplifier 38 comprise a bipolar junction transistor ( bjt ), or a field effect transistor ( fet ), although the invention is not limited in scope in that respect . the output voltage signal of power amplifier 38 is coupled to an input terminal of a power sensing device such as coupler 40 . one example of coupler 40 may be a directional coupler such as the one manufactured by mini - circuits ™, brooklyn , n . y . the basic function of a directional coupler is to receive an input signal and to provide two output signals that correspond to the input signal . the output signals are not equal in amplitude . the large power output signal is at the main - line output port 48 , and , the smaller power indication signal is at the coupled port 50 . typically , there is high isolation between the coupled port and the output port . thus , with the use of directional coupler 40 , it is possible to monitor and sense the power signal level at the output terminal of power amplifier 38 independent of load conditions at the output of dynamic power amplifier 36 . the power indication signal at coupled port 50 is applied to an input terminal of an envelope detector 44 . typically , envelope detector 44 is a capacitor - diode network that measures approximately the average value of the power indication signal provided by coupler 40 . the output signal of envelope detector 44 is substantially a direct current ( dc ) average voltage signal , which corresponds to the output power level of power amplifier 38 . the operation of envelope detector 44 is well - known and described in micro - electronics , digital and analog circuits and systems , by jacob millman ( mcgraw - hill 1979 ). the output terminal of the envelope detector is coupled to an input terminal of a direct current ( dc ) offset converter 46 . dc offset converter 46 generates a substantially direct current ( dc ) biasing voltage signal that corresponds to the magnitude of the average output voltage signal provided by envelope detector 44 . the direct current ( dc ) biasing voltage signal of converter 46 is coupled to an input terminal 52 of power amplifier 38 , as it will be explained in more detail hereinafter , with reference to fig3 a and 3b . fig3 a illustrates a block diagram of a power amplifier 38 in accordance with one embodiment of the present invention , although the invention is not limited in scope in that respect . voltage signal coupled to terminal 54 is in turn applied to an input terminal of an input matching network 60 . typically , input matching network 60 comprises a resistance , a capacitance and an inductance and provides impedance matching between the output stage of driver 34 ( fig1 ), and the input stage of amplifier 38 . the output terminal of input matching network 60 is coupled to the base terminal of a transistor 64 . transistor 64 is preferably a power bjt transistor that is configured to operate at high frequencies . the base terminal of transistor 64 is also configured to receive a direct current voltage signal from a base bias network 62 . base bias network 62 receives a substantially direct current ( dc ) biasing voltage signal from converter 46 via terminal 52 . base bias network 62 is preferably a low pass filter that is configured to prevent high frequency signals from traveling to or from transistor 64 via the base bias network . the emitter terminal of transistor 64 is coupled to the ground signal level . the collector terminal of transistor 64 is coupled to a collector bias network 66 . collector bias network 66 receives a substantially constant direct current ( dc ) voltage signal from a constant dc voltage source , such as a battery , via terminal 57 , and provides a biasing current to transistor 64 . preferably , the collector bias network may be configured as a low pass filter to prevent high frequency signals from traveling to or from transistor 64 via the collector bias network . the collector terminal of transistor 64 is also coupled to an input terminal of an output matching network 68 , which is configured to provide impedance - matching between the output stage of power amplifier 38 and input stage of duplexer 14 ( fig1 ). fig3 b illustrates a block diagram of power amplifier 38 employing a field effect transistor ( fet ) 74 , instead of a bipolar junction transistor bjt 64 of fig3 a . it will be appreciated by those skilled in the art that the operation of power amplifier 38 , in conjunction with transistor 74 , is based on the same principles discussed in reference to fig3 a . thus , the operation of dynamic power amplifier 36 is applicable to both embodiments illustrated in fig3 a and 3b , although the invention is not limited in scope in that respect . during operation , dynamic power amplifier 36 adjusts the biasing voltage signals of power amplifier 38 based on the power signal level at the output terminal of power amplifier 38 . coupler 40 monitors the power signal level and provides a corresponding power indication voltage signal at terminal 50 . since power amplifier 38 amplifies high frequency signals , envelope detector 44 is preferably employed to provide an average voltage signal which corresponds to the average power signal level at the output of power amplifier 38 . based on this average power signal level , converter 46 provides a corresponding biasing signal to terminal 52 of base bias network 62 . the change in biasing signal changes the operating point of transistor 64 such that the transistor maintains a substantially linear characteristics . preferably , the converter provides a biasing voltage signal that allows transistor 64 to operate at a substantially high efficiency for a wide range of power signal levels . the efficiency of transistor 64 depends , among other things , on the input power signal level provided at its input terminal . for a transistor that is biased at a fixed biasing point , the efficiency of the transistor decreases as the input power signal level decreases . the efficiency of the transistor may be represented by ## equ1 ## where η is known as power - added efficiency , p output is the output power signal level , p input is the input power signal level , v ce is collector voltage signal and i c is the collector current . for a transistor with a fixed biasing point , the collector voltage signal and the collector current remain constant regardless of variations in the input and output power signal levels . thus , power added efficiency decreases as the power levels of input and output signals decrease . however , in accordance with the present invention , the collector voltage signal and the collector current signal vary as the output power signal detected by envelope detector 44 varies . thus , when the output power signal level decreases , offset dc converter 46 applies a lower voltage signal to base bias network 62 . in response , the collector current of transistor 64 also decreases and the power added efficiency of the transistor remains substantially constant . typically , it is desirable to operate power transistors 64 or 74 at a predetermined power gain such that the power added efficiency is at a substantially high value , while the transistor remains at a substantial linear region of its operation . advantageously , such a power gain is defined as 1 - db gain compression point , g 1db , which is defined as the power gain where the nonlinearities of the transistor reduces the power gain by 1 db over the small - signal liner power gain . that is , where g o ( db ) is the small - signal linear power gain in decibels . a typical plot 110 of p output versus p input , which illustrates the 1 - db gain compression point 112 , is shown in fig4 . plot 110 illustrates a power response characteristic for a typical transistor at 4 . 7 ghz , at a predetermined base current signal , i b = g 1 . the power response characteristic of the transistor may be different depending on the value of base current signal , i b . for example , plot 116 illustrates the power response characteristics of the transistor for a different base current signal i b = g 2 . the power added efficiency of the transistor , at base current signal i b = g 1 , is illustrated by plot 114 . again , the power added efficiency of the transistor may be different depending on the value of base current signal , i b . for example , the power added efficiency of the transistor , at base current signal i b = g 2 is illustrated by plot 120 . fig4 illustrates that for the same value of base current signal , the power added efficiency decreases as output power and input power signal levels decrease . however , it is possible to maintain the same power added efficiency by varying the value of the base signal current i b . in accordance with one aspect of the invention , converter 46 may be configured such that for a given output power signal , it applies a direct current voltage signal to base bias network 62 in accordance with power response characteristics illustrated in fig4 . to this end , it may be possible to maintain the power gain of the transistor at 1 - db gain compression point for a wide range of power output signals generated by amplifier 38 . it will be appreciated that the same principle of operation discussed above in connection with transistor 64 is equally applicable to a power amplifier that employs a field effect transistor ( fet ) 74 . however , instead of varying the base current of transistor 64 , it is desirable to vary the gate voltage for transistor 74 . furthermore , in accordance with another embodiment of the invention , dynamic power amplifier 36 may be configured such that coupler 40 monitors the input power signal level instead of the output power signal level illustrated in fig2 . as such , the detected input power signal level may be coupled to an input terminal of envelop detector 44 , which in turn causes converter 46 to vary the biasing signals of the transistor employed in power amplifier 38 . thus , the present invention allows high frequency power amplifiers such as those employed in battery driven wireless terminals or other battery driven devices , to operate linearly at substantially high power added efficiency for a wide range of input and output power signal levels . advantageously , this results in an extended battery life and more reliable device . the foregoing merely illustrates the principles of the inventions . it will thus be appreciated that those skilled in the art will be able to devise various arrangements which , although not explicitly described or shown herein , embody the principles of the invention and are thus within its spirit and scope . | 7 |
[ 0019 ] fig1 shows a schematic view of a control system for a vehicle according to a first embodiment according to the invention . the vehicle is provided with two front steered wheels 1 a , 1 b and two rear wheels 2 a , 2 b , wherein each wheel is provided with a braking unit , e . g . a disc brake . each wheel is also provided with a sensor 3 a , 3 b ; 4 a , 4 b for detecting wheel rotation . these rotation sensors are part of the anti - locking brake system ( abs ) or stability control system of the vehicle . the type of sensor used is not relevant to the invention . the signals generated by the sensors are used to determine if the vehicle is moving and , if so , at which velocity . a further sensor 5 is arranged in connection with the steering actuating means , which in this case is a steering wheel 6 . in a first embodiment this sensor 5 is used as a position sensor , measuring the position of the steering wheel 6 in order to determine the steering angle α of the steering wheel . this first steering angle α is proportional to a second steering angle β of the steered wheels 1 a , 1 b . in the preferred embodiment the steering wheel 6 is connected to the steered wheels 1 a , 1 b via a mechanical linkage 7 , possibly via hydraulic components such as a power steering system . in an alternative embodiment , the position sensor 5 may be placed adjacent a suitable part of the steering linkage 7 , such as the pivot point of a steered wheel , in order to measure the actual steering angle β of the wheels directly . similarly , for electrically actuated steering systems a sensor could be placed near one of the steered wheels to measure the actual steering angle β . it is also possible to used a desired steering angle input from the driver , who may use a steering wheel , a joystick or some other signal generating actuator connected to a central steering control unit . alternatively a steering angle signal transmitted from a steering control unit to a steering actuator for the steerable wheels may be used . the signals from the rotation sensors 3 a , 3 b ; 4 a , 4 b and the signal generated by the sensor 5 are transmitted to an electronic control unit ( ecu ) 10 . the ecu 10 can be a separate unit or be integrated into a single unit for combined control of the vehicle abs and / or stability system . in the preferred embodiment an integrated unit is used , which unit would also send and receive signals to and from the vehicle engine 11 and driveline ( not shown ). the engine and driveline parameter signals can also be used for determining the vehicle velocity , using e . g . engine revolutions and gear selector position . this may be used as an alternative to , or as a back - up for , the wheel rotation sensors 3 a , 3 b ; 4 a , 4 b . in operation , the position signals transmitted to the ecu 10 from the sensor 5 are used to detect if the steering wheel is turned to a maximum limit position and in which direction the steering wheel has been turned . if the former condition is true , then ecu will use rotation the sensors 3 a , 3 b ; 4 a , 4 b to determine whether the vehicle is stationary or moving . if the vehicle moves at a velocity less than a predetermined limit v max , for example 7 km / h , the ecu 10 will transmit a signal to the brake actuator of the steered wheel on the side of the vehicle toward the inside of the turn . the braking force applied to said inside wheel is preferably less than or equal to the force that can be applied without activating the anti - locking function of the abs . both the steering wheel angle and the velocity are monitored during the procedure , which is ended as soon as the steering wheel is moved away from its maximum limit position or if the vehicle velocity v exceeds the predetermined limit v max . although the preferred embodiment uses a triggering condition where the steering wheel angle α is at its maximum limit , it is also possible to use predetermined steering wheel angles smaller than the maximum value α max . in this way the position sensor 5 may trigger the system when the steering wheel angle α is 5 - 10 ° less than the maximum value α max . according to a further embodiment it is also possible to trigger the braking action gradually , as the steering wheel angle approaches its maximum angle α max . this will give a softer transition as the brake is applied on the inside wheel and may allow braking action to start at higher velocities , e . g . 10 km / h . full braking action will , however , not take place until the velocity drops below the pre - set maximum value , i . e . when v & lt ; v max . [ 0027 ] fig2 shows a flowchart in which the sequential steps of the system are described . according to a preferred embodiment , the system is triggered when the steering wheel angle or reached its maximum value α max . as soon as the system is started , a sampled set of data from the rotation sensors 3 a , 3 b ; 4 a , 4 b and position sensor 5 are received by the ecu 10 ( see fig1 ). the steering wheel angle α — its direction and the vehicle velocity v , calculated from the rotation signal values , is inputted to the system at 100 . in the next step 110 , the system compares the actual steering wheel angle α with the maximum angle α max , to confirm that the steering wheel is still at its limit position . if this is true , the system , at step 120 , compares the actual vehicle velocity v with a predetermined maximum value v max for the velocity , e . g . v ≦ 7 km / h . when both conditions are fulfilled , the ecu transmits a signal to the brake actuator of the inside steered wheel , step 130 . if one or both conditions are false , the step for applying brakes is bypassed . the system then performs a loop back to the start , whereby a new set of data is sampled . the loop can be interrupted if the steering wheel angle α drops below a predetermined limit α lim , and / or if a set number of loops have been performed without the brakes being actuated . variations of this flow chart are possible depending on the selected limit conditions set for the angle a and the velocity v , as well as the conditions for starting the system . examples of such conditions are initiation at an angle less than α max , or a gradual initiation of the brakes as the angle ox and / or speed v reaches pre - set threshold values . a further condition that can be detected by the sensor 5 is the rate of turning of the steering means or actuator . if the sensor 5 detects a sudden turning of the steering actuator , the inside wheel is braked briefly . as this condition can occur at almost any wheel angle α and at speeds higher than the velocities stated above , i . e . at v max & gt ; 10 km / h , it is important that the brakes are only actuated for a short time and / or that this function can be overridden by a vehicle stability system , or a similar system . the duration of brake actuation can be limited by a predetermined time interval or by ending brake actuation as soon as the rate of turn of the steering actuator drops below a predetermined value . both these predetermined values are selected depending on factors such as the size or weight of the vehicle , or the absence or presence of an anti - locking brake or stability system . if a vehicle stability system is present it must be able to override the brake actuation if it detects that an impending or an actual brake actuation may have , or is causing , a negative effect on the roadholding of the vehicle . [ 0031 ] fig3 shows how the turning radius is decreased by the steering control device . with the steerable wheels 1 a , 1 b deflected to their maximum steering angle β , a line 1 is drawn perpendicular to the rolling direction of the inside wheel 1 a . this line l 1 intersects a further line w , passing through the rear axle carrying the rear wheels 2 a , 2 b , at a point q 1 . the distance between the point q 1 and the center of gravity g of the vehicle equals the minimum turning radius r 1 of a standard vehicle . when a braking force is applied to the inside steerable wheel , the vehicle will be made to “ over steer ”. this condition causes the vehicle to make a slightly sharper turn , as the maximum steering angle β has been increased by a small amount δβ . this is illustrated by the line l 2 which is perpendicular to the new rolling direction of the inside wheel 1 a . the line l 2 intersects the line w through the rear axle at a second point q 2 , inside the first point q 1 the distance between the second point q 2 and the center of gravity g is the new turning radius r 2 . in the case of a large saloon car , the turning radius may be reduced by approximately 1 meter using this application . [ 0033 ] fig4 illustrates how the vehicle would travel along a curve a 1 with the steering control device actuated , as compared to the curve a 2 without said system . in addition fig4 clarifies what is meant by the term “ over steer ” and how it affects the movement of the vehicle . the scale of the different curves a 1 and a 2 in the figure is exaggerated for clarity . it may be noted that as the vehicle travels at low speed when the steering control device is actuated , it can be assumed that there will be no shift in the position of the center of gravity g caused by the inertia of the vehicle . it is therefore assumed that the center of gravity will remain in the same position on a longitudinal center line a through the vehicle . although the preferred embodiment comprises driven front wheels , either as a 2 - or a 4 - wheel drive , the invention will also work for rear - wheel driven vehicles . | 1 |
reference will now be made in detail to the present embodiments of the invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . in one aspect , the present invention is directed to an improvement in path detection probability and path false alarm probability . in a novel finger management strategy , the present invention sorts assigned path delays / monitoring delays and the newly searched path delays by parameters that are related to the path detection probability performance and path false alarm performance , such as path strength , path appearance elapsed time and path level crossing rate . prioritized monitoring delays and newly searched path delays are compared to determine near new delays to one of the monitoring delays . a monitoring delay is assigned a near delay of a newly searched path delay when the difference between the newly searched path delay and the monitoring delay is less than a predetermined threshold . in the event that there is more than one near delays for a monitoring delay , the one with a higher priority is assigned to the monitoring delay . in another aspect of the present invention , a method of path selection determines possible path candidates by judging the path statuses of the monitoring or searching paths . the path statuses depend on the parameters that are related to the path detection probability performance and path false alarm performance , such as path strength , path appearance elapsed time and path level crossing rate . another aspect of the present invention is directed to the setting of a threshold value for path candidate selection . a plurality of thresholds are set for parameters that are related to the path detection probability performance and path false alarm performance , such as path strength , path appearance elapsed time and path level crossing rate . a path compared with the plural thresholds is granted a particular weighting according to the region in which the path is located . the granted weighting is used to update the path status . furthermore , a fuzzy region , or region of uncertainty , surrounds each threshold to address any instantaneous fluctuations in the threshold . furthermore , the thresholds are set to be different from each other by a preserved hysteresis region to prevent two thresholds from being too close in values . additionally , the present invention is directed to a method of managing a cell list whereby bad quality cells are removed from the cell list . once removed , the receiver would not waste computational powers to measure and demodulate bad quality cells . the method of the present invention takes into consideration the cell appearance frequency to determine the quality of cells . an example of the cell appearance frequency is the elapsed time that a receiver cannot detect any path from the monitoring cell . if the elapsed time is over a pre - determined threshold , the cell at issue is deemed a bad quality cell and is removed from the cell list . in one aspect , the cell list is ranked by the cell appearance frequency . the cell list management of the present invention also takes into consideration cell quality estimation , such as signal strength and cell appearance frequency . an example of cell appearance frequency calculated from the elapsed time from the last time a cell can be found at least one path in the receiver . the cell quality estimation is then compared with plural thresholds . for different thresholds , the monitoring cell is granted different weight depending on the region in which the cell is located . a cell quality parameter for the monitoring cell is updated according to the granted weighting . the cell list is then updated according to the measure of cell quality of the monitoring cells . fig1 is a top - level block diagram of one embodiment of the present invention . referring to fig1 , a general flow diagram of finger management and cell list management are depicted . the system and method of the present invention includes a multi - path searcher 101 for conducting coarse multi - path searches . multi - path searcher 101 receives an input ( not labeled ) and an updated cell list from cell list update unit 109 . a candidate select unit 102 is coupled to receive input from multi - path searcher 101 . candidate select units 102 and 106 determine possible path candidates according to a particular path selection method . a path tracking loop / verification unit 105 received inputs from a finger assignment unit 104 and an updated cell list from cell list update 109 . path tracking loop / verification unit 105 functions to monitor paths and conduct fine path delay tracking . two threshold setting units 103 and 107 set the thresholds for candidate selection in accordance with a particular threshold setting method . finger assignment unit 104 receives possible path candidates from candidate select units 102 and 106 , and combines the newly searched path delays from multi - path searcher 101 and other path information to generate a path list for the next path monitoring to path tracking / verification unit 105 . finger assignment unit 104 also provides finger assignment information to a cell quality measurement unit 108 . together with the information from candidate selection units 102 and 106 , cell quality measurement unit 108 provides a cell quality measurement . cell list update unit 109 then updates and renews the information in the cell list according to the information from cell quality measurement unit 108 . fig2 is an embodiment of finger assignment method consistent with one embodiment of the present invention . referring to fig2 , the method begins at step 201 . at step 202 , m newly searched path delays from multi - path searcher , such as multi - path searcher 101 in fig1 , and n monitoring path delays in path tracking / verification unit , such as path tracking / verification unit 105 in fig1 , are provided . there is a corresponding path status for each path delay . the path status is related to path detection probability and path false alarm probability performance parameters , such as path strength , path level crossing rate , and path appearance elapsed time . the path level crossing rate is the rate that the path strength passes through a predetermined threshold . the path appearance elapsed time is the elapsed time from the last time that the same path is detected . the path status could be taken as a confidence evaluation parameter of a possible path candidate . the m newly searched path delays and the n monitoring path delays are first sorted according to path statuses . referring to step 203 , the expected p output path delays and the next monitoring path list are reset . the corresponding path statuses are reset as “ invalid ” paths . to keep the monitoring path delays , the n monitoring path delays are first copied to p output path delays at step 204 . the p output path statuses also inherit the n path statuses . from steps 205 to 212 , the m newly found path delays are compared with the n monitoring path delays to determine the near paths for each of the n monitoring paths . two paths are determined as near paths if the distance between the two paths is less than a predetermined threshold . if there is any near path for one of the n monitoring paths , the monitoring path delay is replaced by the near path delay , which is newly found in the multi - path searcher . if there is more than one near path delays for a monitoring path delay , the higher - order near path delay is picked to replace the monitoring path delay . the path replacement is performed on the p output path delays , which are copies of the n monitoring path delays . the output path statuses remain the same , which means they are not replaced by the path statuses of the newly searched path delays . the aforementioned steps may be implemented in any known controller coupled to a delay searcher and delay trackers . after the path replacement is complete , steps 213 to 218 fill the “ invalid ” output path delays with the remaining , non - replaced , path delays in the m newly searched paths . the remaining path delays are picked by order , and the path statuses of the picked survival path delays are also copied to the output path statuses . to ensure the output path delays differ from each other by at least greater than a predetermined threshold , the paths with lower priorities are eliminated , or kicked out at step 219 . the path statuses of the eliminated paths are set as “ invalid ”. with the prioritized finger assignment as set forth in an exemplary method shown in conjunction with fig2 , the path detection probability and the path false alarm probability performance are improved . fig3 is a flow diagram of an embodiment of path selection . referring to fig3 , the method begins at step 301 by inputting path information at step 302 . the path information includes path delays , corresponding path statuses , and corresponding path parameters for comparison purposes . the path parameters are related to the path detection probability and the path false alarm probability performance . the path parameters may include path strengths , path level crossing rates and path appearance elapsed time . at steps 303 and 304 , the parameters are compared with plural thresholds , and the paths are granted different weightings depending on the threshold levels . according to the granted weighting , the corresponding path status is updated at step 305 , and the candidate paths are selected according to the path statuses at step 306 . fig4 is a flow diagram of one embodiment for threshold comparison steps 303 and 304 in fig3 . referring to fig4 , the parameter for comparison depicted herein is path strength . if the path strength is not greater than a predetermined threshold tl at step 402 , the method goes to step 408 to check if the path status is in the lowest level or weighting . the terms level and weighting are interchangeable as appropriate under the circumstances of this embodiment . in this example , the path status is classified into several levels or weightings . if the path status is in the lowest level , the path status is set to “ invalid ” as in step 407 . if the path status is not in the lowest level , the path status level or weighting is lowered at step 409 . however , if the path strength is greater than threshold tl , the path strength is then compared with another threshold th at step 403 . if the path strength is not greater than threshold th , the path status remains the same at step 410 . if the path strength is greater that threshold th , the path status is verified whether it is at the highest level as in step 404 . if the path status is not at the highest level or weighting , the path status is increased or raised at step 411 . if the path status is at the highest level or weighting , the path status remains the highest level at step 405 . fig5 is a flow diagram of another embodiment for threshold comparison steps 303 and 304 in fig3 . referring to fig5 , the parameter for comparison herein is path appearance elapsed time . if the elapsed time is not shorter than a predetermined threshold th at step 502 , the method determines if the path status is in the lowest weighting or level at step 508 . the terms level and weighting are interchangeable as appropriate under the circumstances of this embodiment . in this example , the path status is classified into several levels . if the path status is at the lowest level , the path status is set to “ invalid ” at step 507 . if the path status is not at the lowest level , the path status level or weighting is lowered at step 509 . however , if the elapsed time is shorter than threshold th , the elapsed time is compared with another threshold tl at step 503 . if the elapsed time is not shorter than threshold tl , the path status remains the same as before at step 510 . if the elapsed time is shorter that threshold tl , the path status is checked to determine if it is at the highest level at step 504 . if the path status is not at the highest level , the path status is raised or increased at step 511 . if the path status is at the highest level , the path status remains the highest level at step 505 . fig6 is an example for setting a threshold value . referring to fig6 , the thresholds for comparing the received power delay profile or channel impulse response are shown . the thresholds may be derived from the power delay profile or other information , such as path strength , noise level , or interference level . a path compared with the plural thresholds is granted weighting according to the region in which the path is located . the granted weighting is used to update the path status . furthermore , a fuzzy region , or region of uncertainty , surrounds each threshold to address any instantaneous fluctuations in the threshold . furthermore , the thresholds are set to be different from each other for a preserved hysteresis region to prevent two thresholds from being too close in values . fig7 is another example for setting a threshold value . referring to fig7 , the thresholds are for comparing the path appearance elapsed time . similar to fig6 , there is a fuzzy region around each threshold as the shadow areas in the figure . between thresholds , there is a hysteresis region to prevent thresholds from getting too close in values . each region again is assigned its corresponding weighting . fig8 is a plot showing an exemplary cell appearance frequency for a high snr cell . referring to fig8 , an indication “ novalidpathindication ” indicates that there is no path passing over the predetermined threshold , and the “ pathsensitivelevel ” indicates the predetermined threshold . if the elapsed time of “ novalidpathindication ” is longer than a predetermined threshold , the cell being measured is deemed a bad quality cell . this cell is then removed from the cell list . here , the elapsed time has not expired and therefore the cell being measured is not a bad cell . fig9 is a plot showing an exemplary cell appearance frequency for a low snr cell . referring to fig9 , because the elapsed time is longer than the expiring time , the cell being measured is deemed a bad quality cell , and is therefore removed from the cell list . fig1 is a flow diagram of an embodiment for cell list management consistent with one embodiment of the present invention . referring to fig1 , a level crossing rate counter or elapsed time counter , as appropriate , is reset at step 1001 . a path appearance indicated is provided at step 1002 . a cell quality measured using cell appearance frequency is calculated at step 1003 . in this embodiment , the cell appearance frequency is expressed as the signal strength level crossing rate and / or the elapsed time since the last time the monitoring cell could be detected at least one cell at the receiver . the cell quality measurement is compared with a predetermined threshold at step 1004 to decide whether the monitoring cell is a bad quality cell . a bad quality cell is one whose level crossing rate is smaller than the predetermined threshold or if the elapsed time is greater than the predetermined threshold . if it is a bad quality cell , this cell is removed from the cell list at step 1005 . fig1 is another embodiment of cell list management consistent with the present invention . in this embodiment , cell quality estimation is calculated at step 1102 . the cell quality estimation could be , for example , the signal strength of the monitoring cell . the cell quality estimation is compared with a predetermined threshold at steps 1103 and 1104 to calculate a level crossing rate and / or an elapsed time as a cell quality measurement . the level crossing rate is the rate that the cell quality estimation passes through a predetermined threshold . the elapsed time may be , for example , the consecutive time that the cell quality estimation is under a predetermined e threshold . the cell list is then updated according to the cell quality measurement at step 1105 . fig1 is a flow diagram of another embodiment of cell list management . referring to fig1 , cell quality estimation is calculated at step 1202 . the cell quality estimation may be , for example , the signal strength of the monitoring cell . the cell quality estimation is then compared with plural predetermined thresholds at step 1203 . the monitoring cell is granted different weightings according to the compared results at step 1204 . a cell quality measurement parameter is then updated based on the granted weighting at step 1205 . the cell list is updated according to the cell quality measurement of the cells at step 1206 . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims . it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof . it is understood , therefore , that this invention is not limited to the particular embodiments disclosed , but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims . | 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.