Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
with initial reference directed now to fig1 and 2 of the appended drawings , a motorized , climbing device , constructed generally in accordance with the best mode of the invention , has been generally designated by the reference numeral 10 . preferably device 10 is in the form of a hunter &# 39 ; s tree - climbing stand . however , the device may be used to climb any elongate , vertical column or pole that is generally cylindrical and which has a smooth lower circumference . the tree stand embodiment is preferred . the stand 10 is illustrated in a lowered position in fig1 , providing access for a hunter or other passenger or user to be seated within a carriage 12 that engages a track 14 . preferably the hunting stand 10 is used by sportsmen or outdoorsmen that desire an elevated observation position for hunting , as is common practice with deer hunters . of course the stand 10 presents numerous advantages and features that are useful to others besides hunters such as those that service telephone or power lines . it is preferred that the elongated , sectioned track 14 be secured to the external surface of the vertically upright tree ( or column or pole ). preferably the hunting stand is deployed upon a pine tree whose smooth lower regions are free of branches 9 or other obstructions or protrusions that would interfere with vertical travel during normal operation . although rigid and robust , the various components are relatively lightweight and they may be easily transported into the woods . once unloaded from the vehicle ( i . e ., an atv or pickup truck ) at the hunting or job site , they may be securely installed and assembled as hereinafter described . once the stand 10 is installed , a seated hunter can simply operate toggle switch 252 ( fig1 ) to elevate himself upon carriage 12 several feet above ground 15 to have a commanding view of the desired hunting area proximate tree or column 16 . when the alternative carriage of fig1 is deployed , the device 10 functions as an elevator and may be used to service vertically elevated objects such as power lines , telephone lines and the like . the elongated track 14 preferably comprises several similar , interfitting sections that are axially coupled together at the hunting site . the track is attached to the tree ( or column ) 16 along an exposed , smooth portion of the tree trunk that is free of obstructions or significant surface irregularities . alternate , aligned track sections 17 , 18 , and 19 ( i . e ., fig2 , 3 ) for example , are axially fitted together as explained hereinafter and then affixed to the tree trunk by encircling band clamps 21 of conventional construction . each band clamp comprises an encircling loop 22 ( i . e ., fig4 ) whose ends are provided with suitable hooks 23 and turnbuckles that engage rigid l - brackets 24 that are affixed at regular spaced - apart intervals to the rear of each track section ( i . e ., fig3 ). a variety of conventional , encircling clams or cables known in the art may be used . the assembled track 14 ( i . e ., fig1 ) is surmounted by a vertically displaceable shuttle 26 ( fig5 ) through which the track extends . the shuttle 26 supports and is interconnected with a coupling assembly described later ( i . e ., fig6 , 9 - 11 ). a preferably electric drive motor 103 and a rotatable drive gear 108 described later ( i . e ., fig6 , 11 - 12 ) engages the track 30 . carriage 12 is removably fitted to and supported by the coupling hardware ( i . e ., fig1 ), so it travels vertically upwardly or downwardly relative to the track 30 with the shuttle 26 in response to motor operation . shuttle 26 is prevented from being accidentally driven off of top track 19 by stops 20 ( fig2 ) on track section 19 . with joint reference directed now to fig3 and 4 , the track 14 comprises a plurality of similar track sections 17 - 19 that are to be fitted together axially and then secured to the tree 16 substantially perpendicular to the ground 15 . each track section comprises an elongated , rigid flange 28 that is generally rectangular . the front or outer side of each flange 28 supports a section of toothed rack 30 whose rigid teeth 31 are ultimately engaged by the motor - driven gear described later . the rack 30 is secured at the middle of the flange 28 by welding , and it extends along the entire length of the flange in parallel relation thereto . the rear or inner side of each flange supports a rigid , elongated sleeve 33 ( fig4 , 6 ) that is welded at the center of the flange rear . the rigid , tubular sleeve 33 is substantially coextensive with the flange 28 of each track section 17 - 19 and is parallel with the flange . the upper end of each sleeve 33 ( i . e ., fig4 ) coaxially supports a smaller diameter coupling tube 36 that projects approximately six inches away from it . the reduced diameter of coupling tubes 36 enables it to fit within the interior diameter of the sleeve 33 . in assembly each coupling tube 36 is coaxially fitted to a bottom sleeve end 38 of an adjacent track section to unite the track assembly . when properly assembled , aligned segments of the rack 30 abut gently and present a continuous rack with uniformly spaced apart teeth 31 . each section of track 17 - 19 has a pair of alignment rods 40 proximate the upper end of its sleeve 33 that project outwardly , spaced - apart from and parallel with coupling tube 36 . rods 40 are welded at the sides of the sleeve 33 , at the region where the sleeve borders the flange 28 . as appreciated from fig4 and 6 , for example , when two track sections are fitted together , rods 40 project forwardly to the next track section , aligning them proximate the lower sleeve end 38 in sliding contact with the flange 28 of the adjacent track section . rods 40 thus prevent twisting as contact with the adjacent flange minimizes torsional displacements . the bottom of the bottom track section 71 has a pair of similar rods 41 that are non - parallel , and which anchor themselves within the ground . as best seen in fig4 , the preferably two - piece brackets 24 have a preferably l - shaped cross section . each bracket 44 comprises a flat base 42 welded to sleeve 33 that is parallel with and spaced - apart from flange 28 . a perpendicular bracket section 44 is welded to base 42 and projects vertically away from the base . perpendicular section 44 has a pair of slots 46 ( fig4 ) enabling it to mate with a similarly slotted plate 81 whose projecting , pointed sides on either aside of central notch 80 engage the tree . plate 81 is adjustably , slidably secured to bracket section 44 . bolts 82 extend through the aligned slots 46 and wing nuts 83 are tightened to secure the plate 81 in a desired position . slots 48 are defined in the base sections 42 of brackets 24 to receive ends of the encircling loops described earlier . as seen in fig4 , the end of loop 22 has a hook 23 that engages a slot 48 to mount the stand . the opposite end of the loop 22 may comprise an over - center clamp , or a turnbuckle , coupled to a similar hook engaging another bracket slot 48 . during installation , adjustments to plate 81 enable the l - brackets 24 to adapt for minor irregularities in the outer surface of tree 16 . referring now to fig5 and 6 , the elongated shuttle 26 is of generally c - shaped cross section . the front panel 48 provides a mounting surface for the coupling hardware described hereinafter . an elongated access orifice 49 clears the drive gear described later , which engages the rack 30 positioned below it in assembly . panel 48 is integral with a pair of parallel , spaced - apart sides 51 and 52 which are positioned , in assembly opposite the edges of the rack flanges 28 ( fig6 ). there are a plurality of pairs of spaced apart guide rollers 54 projecting inwardly of the shuttle from each side 51 , 52 , secured by fasteners 53 . as seen in fig6 , for example , the track flanges 28 are positioned between and constrained by rollers 54 in use . a plurality of spaced - apart pairs of similar guide rollers 56 project inwardly from shuttle panel 48 and slidably adjoin opposite sides of the track 30 , as best seen in fig6 . the preferred carriage 12 is detailed in fig7 - 10 . a rigid , generally cubicle frame 60 ( fig8 ) comprises parallel vertical legs 62 ( i . e ., fig9 ) and 63 ( fig8 ) at the carriage rear and a pair of lateral supports 64 and 65 extending horizontally between them . supports 64 and 65 comprise numerous spaced apart orifices 61 , 66 respectively that are engaged when the carriage is user - fitted to the shuttle coupling means as described hereinafter . spaced apart side rails 67 and 68 extend horizontally at the bottom of the carriage between the front and rear ; upper frame rails 69 and 70 are spaced above lower support rails 68 and 67 respectively . vertical supports 72 and 73 extend between the upper and lower frame rails for strength . in the best mode a seat 75 is preferably disposed atop the carriage frame . hand rails 76 and 77 are mounted on each side of the seat 75 adjacent a comfortable cushion 78 . rails 79 support a back - supporting cushion 80 . a generally rectangular footrest 82 has a pair of side rails 84 pivoted to the carriage frame by hinges 85 . the footrest 82 is maintained in a substantially horizontal position during use by suitable cables 86 extending between clevis &# 39 ; s 87 ( fig8 ) and 88 ( fig7 ). with joint reference directed now to fig9 - 12 , the coupling assembly 90 ( fig1 - 12 ) interconnects the carriage 12 with the shuttle 26 and track 14 . the shuttle 26 is fitted with upper and lower , spaced apart wings 94 and 95 respectively that have upwardly projecting pins 96 , 97 respectively . the carriage 12 is disposed upon the shuttle wings 94 , 95 . it is user - fitted to the shuttle by fitting pins 96 emanating from wing 94 ( fig1 ) into orifices 66 in cross piece 65 ( fig8 ). similarly , pins 97 in wing 95 penetrate orifices 61 in carriage frame cross piece 64 . the other coupling hardware seen in fig1 , for example , will be positioned beneath the seat 75 between the previously described frame members 62 , 53 , 65 etc . housing 92 is attached to sides 51 and 52 of carriage 26 by screws 87 shown in ( fig1 ). cover 113 may be removed by removing similar screws . a support bracket 100 is fitted within housing 92 . bracket 100 has a horizontal support plate 102 ( fig1 ) upon which a drive motor 103 ( fig1 ) is secured . similarly , bracket 100 has a vertically oriented support plate 105 that secures the drive gear assembly 106 . a toothed drive gear 108 driven by preferably dc motor 103 is positioned so that it penetrates shuttle slot 49 ( i . e ., fig5 ) and engages the rack 30 to propel the carriage . in assembly the motor 103 , the gear drive assembly and related components are protected within housing 92 . a preferably twenty - four volt battery 86 ( fig1 ) is disposed within battery holder 116 which is mounted to surface 111 of housing 92 . a safety lock is provided . referencing fig1 , the front panel 110 of the housing 92 has a port through which an elongated lock actuator 115 extends . the lock handle 112 and actuator 115 must be deflected to operate the stand . a follower 119 coaxially engages a spring 120 and it secures a ratchet 122 attached by a nut 123 . ratchet 122 is yieldably biased towards the rack 30 ( i . e ., teeth 31 ) to lock the carriage in place when a desired elevation is attained , independently of the motor or driving system . referring to fig1 , the shuttle 26 supports a manual cranking system 130 that can be used when and if the motor fails . a hand crank 133 drives motor shaft 85 which extends through drive gear assembly 106 within enclosure 134 and out to hand crank 133 . the alternate embodiment of a carriage 200 can be used by lineman to service power and telephone lines and is shown and described in ( fig1 ). like carriage 12 , carriage 200 uses spaced apart orifices 61 and 66 respectively that are engaged when the carriage is user - fitted to the shuttle 26 in the same manner as shown an described for carriage 12 . carriage 200 has a generally cube shaped frame with a foot platform 201 comprising several spaced apart , parallel angle bars 202 welded to perpendicular angle bars 203 and 204 . square bars 205 and 206 and 217 are welded to vertical supports 207 , 208 , 209 , and 210 . hand rails 211 and 212 are mounted on each side of carriage . square bar 213 is welded to bars 207 and 210 for rigid support . vertical supports 215 extend between the upper cross bars 216 and lower bars 203 and 204 . a safety bar 214 swings open when access or egress to the platform is desired . gussets 218 are welded at the four bottom corners of the frame for support . fig1 illustrates the generalized electrical wiring scheme . a terminal block circuit 251 interconnects with a 24 - volt dc battery pack . power delivered across couplings 255 , 256 delivers current to a high current relay switch 252 that includes a reversing function for changing current polarity . current outputted from the relay stage 252 passes through circuits 253 and 254 tot energize the motor through coupling 250 . from the foregoing , it will be seen that this invention is one well adapted to obtain all the ends and objects herein set forth , together with other advantages which are inherent to the structure . it will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . as many possible embodiments may be made of the invention without departing from the scope thereof , it is to be understood that all matter herein set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense .	0
the present invention provides an improved telecommunication system , improved components of such a system , and improved transmission bandwidth for video , audio , and data content exchange . in contrast to known systems , the present invention expands the usefulness of existing and more economically desirable communication links , such as twisted pair links . moreover , the present invention provides methods that expand the usefulness of such links . while the preferred embodiment is explained in the context of twisted pair links , one of ordinary skill would appreciate that the invention may utilize alternative links such as shielded twisted pair , screened shielded twisted pair , and screened unshielded twisted pair ( and any other variant of a twisted pair ). the improved telecommunication system is discussed in detail below including dynamic allocation of spectrum , command and control systems , and specific embodiments of such improvements . as noted above , an object of the present invention is to provide an improved system for regenerating degraded signals and dynamically allocating new frequency bands for specific categories of communication signals to enable high bandwidth transmissions over twisted pair links . as such , corrective circuitry 130 and fmm 300 are deployed in one embodiment of the present invention . in general , corrective circuitry 130 and fmm 300 are operably coupled within a single device , referred to hereinafter as the central premise equipment 100 . reference is made below to cpe 100 . cpe 100 may be deployed as an electronic set top box positioned within a home , office building , central office , or other remote facility accessible to system users or administrators . cpe 100 employs corrective circuitry 130 in order to reconstruct degraded signals received over twisted pair links . cpe 100 also employs fmm 300 in order to make use of available transmission bandwidth on twisted pair links by dynamically allocating frequency bands for use by specific categories of communication signals , preferably , ranging from 0 to 20 megahertz . in one embodiment , fmm 300 dynamically allocates frequency bands of at least 4 . 5 megahertz . cpe 100 comprises an analog section and a digital section . the analog section includes input and output ports for twisted pair links , corrective circuitry 130 , and one or more buffers 140 . the digital section includes of one or more converters 150 , wan 230 and / or lan 240 , microprocessors 160 adopted to provide fmm 300 functionality , and serial ports 170 . reference to the analog and digital sections and its components is made below . as illustrated in fig1 , the analog section of cpe 100 includes a physical interface for connecting cpe 100 to the local telephone network &# 39 ; s twisted pair infrastructure . the physical interface may be an rj11 port or other link suitable for terminating cpe 100 and twisted pair telephone infrastructure , including rj14 , rj25 , rj61 , and others . preferably , the physical interface provides coupling of more than one twisted pair link . each twisted pair link provides a channel for transmitting electric signals . each twisted pair link comprises a receiver 110 and transmitter 120 . receiver 110 is interconnected , respectively , with wires 111 . similarly , transmitter 120 is interconnected , respectively , with wires 121 . by way of example , preferably a plurality of wires 111 and 112 may be bundled together in channels 200 . receiver 110 and transmitter 120 may be optionally coupled as a single transceiver , such transceiver preferably receives two wire twisted pair , one wire used for transmission , and one wire used for reception . analog signals are received by cpe 100 on the receiver 100 and transmitted out from cpe 100 on transmitter 120 . upon receiving a signal over the physical interface , cpe 100 reconstructs the original information in the signal . cpe 100 employs correcting circuitry 130 in order to reconstruct degraded signals received over twisted pair links . corrective circuitry 130 is described in the next section . preferred embodiments of the improved telecommunication system employ corrective circuitry 130 to compensate for degradation of analog signal in twisted pair links to enable high bandwidth transmissions over great spans of such links . in general , corrective circuitry 130 operably couples with twisted pair links which presently form the backbone of telephone systems in the united states and many other countries . corrective circuitry 130 enables transmission of frequencies ranging from 0 to 20 megahertz over distances of 6 , 000 feet over unshielded twisted pair links without repeaters . corrective circuitry 130 of the preferred embodiment enables simultaneous and bidirectional transmission of signals over twisted pair links . the circuitry also supports both high bandwidth analog and digital signal transmission and reception , including full motion color video with voice and / or data content . corrective circuitry 130 also accommodates full duplex video channels and additional voice grade channels over the twisted pair link . corrective circuitry 130 provides an effective alternative for the transmission of high bandwidth analog signals wherever twisted pair links exist , without the need for installation of new communication link infrastructure and expensive line condition equipment . operation of corrective circuitry 130 reconstructs degraded signals received over a twisted pair link . signal degradation is the loss of quality of an electronic signal , caused by several factors in the time domain and in the physical domain of an electronic signal , including drift , crosstalk , and aging effect . corrective circuitry 130 of the present invention employs means to achieve desired circuit characteristics , such as matched transmission levels , matched impedances , and equalization for changing the frequency envelope of a sound . corrective circuitry 130 may also employ means to improve data transmission , such as equalization of the insertion - loss - vs .- frequency characteristic . when twisted pair links do not employ the aforementioned corrective circuitry 130 means , electrical signals deteriorate as they pass over distances of the twisted pair link and information carried by such signals is not reliably reconstructed . examples of corrective circuitry 130 are described in u . s . pat . nos . 5 , 528 , 286 , 5 , 283 , 637 , and 6 , 064 , 422 , which are hereby incorporated by reference in their entirety . examples of corrective circuitry 130 are described in the &# 39 ; 286 and &# 39 ; 637 patents in columns 11 - 18 and is further described in the &# 39 ; 422 patent in columns 8 - 10 . an example of corrective circuitry 130 employed in one embodiment of the present invention compensates for the impedance of a twisted pair link . such corrective circuitry amplifies and impedance matches analog signal on a twisted pair wire . portions of the corrective circuit 130 provide an offsetting impedance to the received analog signal . such offsetting or compensating impedance is preferably proportional and in vectoral opposition to the impedance of the twisted pair link to negate the effects of the impedance on the signal . preferably , corrective circuitry 130 dynamically matches such impedance , without the need for operator intervention . the output signal from corrective circuitry 130 is a reconstructed analog signal . another example of corrective circuitry 130 employed by the invention measures the attenuation of lower frequency components of the signal to compute the length of the twisted pair link over which the received signal was traveled . the corrective circuitry 130 also compares the low frequency components of the received attenuated signal with the known signal level to compute a compensation factor . corrective circuitry 130 applies greater signal amplification in higher frequency portions than in the lower frequency portions due to greater loss occurring in higher frequency portions of the twisted pair . the signal is thereupon reconstructed . the aforementioned circuitry provides a non - exhaustive list of exemplary corrective circuitry 130 that operably couples to the twisted pair for reconstructing a received degraded analog signal , as shown in fig1 . corrective circuitry 130 optionally couples with a switching network 210 , which is discussed in the next section . in one embodiment , a switching network 210 terminates receiver 110 and transceiver 120 with corrective circuitry 130 . as shown in fig2 , one embodiment of switching network 210 connects as many 16 channels 200 of receivers 110 and transmitters 120 . switching network 210 enables cpe 100 to send and / or receive signals at any given time . switching network 210 enables cpe 100 to employ different mediums of networking , including optical , laser , ethernet , fiber , atm , and 802 . 11 . by way of example , switching network 210 may receive / transmit information signals on twisted pair links and transmit / receive such information signals over alternative mediums of networks . in addition , switching network 210 may be coupled with microprocessor 160 so that a received signal can be treated by fmm 300 , which is shown within microprocessor 160 . by way of example , switching network 210 may provide commands to fmm 300 that define frequency allocation . switching network 210 also receives analog signals from the digital section &# 39 ; s converter 150 upon remodulation of spectrum over the physical interface . as illustrated in fig2 , switching network 210 is operably coupled to corrective circuitry 130 ( described above ), to enable transmission of frequencies of desired bandwidths over twisted pair links connected with switching network 210 . as shown in fig2 , buffer or isolation means 140 interconnects corrective circuitry 130 with converter 150 and microprocessor 160 which includes fmm 300 . buffer 140 is described in the following section . buffer 140 is an electrical component , such as a circuit , that isolates corrective circuitry 130 from converter 150 . buffer 140 is located between corrective circuitry 130 and converter 150 and is used to interconnect the two components . buffer 140 is optionally a flow control means for delaying the transit time of a signal in order to allow operations in converter 150 to occur . electronic temporary storage means in buffer 140 store the signal for a period of time as it passes from corrective circuitry 130 to converter 150 , ( alternatively through multiplexer 220 ) as such components may have different speeds for handling and / or processing signals . buffer 140 retransmits a stored signal at approximately the rate converter 150 demodulates the signal . buffer 140 is optionally coupled with multiplexer 220 , which is discussed below . as shown in fig2 , multiplexer 220 is adopted to receive signals from any of buffers 140 and / or converter 150 and select among available twisted pair link transmitters 120 for transmission of analog signals . multiplexer 220 , shown operably coupled to microprocessor 160 , selects among available twisted pair transmitters 120 and receivers 110 of channels 200 when transmitting and receiving analog signals . multiplexer 220 selects among such channels 200 based upon input from microprocessor 160 . for example , upon receiving a signal from buffer 140 over selected first receiver 100 of channels 200 , multiplexer 220 transmits the signal to converter 150 . converter 150 thereupon transmits the signal to microprocessor 160 , which processes the signal with fmm 300 ( further discussed below ). microprocessor 160 then selects a second transmitter 120 from one of the available transmitters 120 in channels 200 and configures multiplexer 220 to transmit the analog signal over the second transmitter 120 . microprocessor 160 transmits the signal back to converter 150 , which thereupon transmits the signal back to multiplexer 220 . now configured , multiplexer 220 transmits the signal over the selected second transmitter 120 . multiplexer 220 operably couples the with the converter 150 , which is part of cpe &# 39 ; s 100 digital section . reference to the digital section and its components are made in the following sections . the typical components and architecture of the digital section are discussed herebelow including : converter 150 , wan 230 and lan 240 , microprocessor 160 , and fmm 300 . similar to a traditional modem , converter 150 interconnects analog twisted pair links with digital data processing devices . as such , converter 150 handles both incoming and outgoing transmissions . converter 150 also sends and receives digital signals to and from microprocessor 160 . when transmitting digital signals , converter 150 employs techniques to encode the digital bits into analog signals based upon specified protocols . the protocols are either preset , automatically , or manually specified . the protocols define the methods of encoding and the data transfer speed . the converter 150 supports a plurality of protocols , such as tcp / ip . cpes 100 establish connections with one another based upon common protocols . cpes 100 also employ proprietary protocols so that only cpes 100 supporting the same proprietary protocol can establish connections . when an analog signal is received at converter 150 on a twisted pair link , converter 150 demodulates the signal into digital signals for further treatment by microprocessor 160 and fmm 300 . converter 150 also receives digital signals over wan 230 and lan 240 . upon receiving digital signals from the connected wan 230 and lan 240 networks , converter 150 also forwards the signals to microprocessor 160 . wan 230 and lan 240 networks support ethernet connections . in another embodiment , converter 150 is adopted to receive an optical signal over a fiber optical cable ( not shown ). upon receiving such a signal , converter 150 thereupon converts such signal into a digital format for treatment by microprocessor 160 . one example of a means for converting optical signal to a digital signal format is a transponder ( not shown ). transponders are adopted to receive an optical signal and convert such signal into an analog format and , following such conversion , convert the analog signal into a digital format . as shown in fig1 , converter 150 receives digital signals over wan 230 and lan 240 . lan 240 and wan 230 support the ieee 802 . 3 standard ( e . g . the ethernet protocol ). wan 230 and lan 240 connect cpe 100 through a uniform serial bus (“ usb ”), twisted pair , coaxial cable , serial , parallel or other suitable physical interface . accordingly , cpe 100 supports carrier sense multiple access with collision detection (“ csma / cd ”) media access control (“ mac ”), so that cpe 100 can interoperate with interconnected nodes of wan 230 or lan 240 . depending upon the information in the signal , such as the target recipient &# 39 ; s address , microprocessor 160 causes a signal from lan 240 or wan 230 to transmit or retransmit over the twisted pair links of the telephone infrastructure . microprocessor 160 is discussed below . microprocessor 160 receives digital signals from converter 150 . microprocessor 160 is a programmable digital electronic component that functions as a central processing unit (“ cpu ”) for cpe 100 . upon receiving a signal , microprocessor 160 performs fmm 300 functionality . in one embodiment , microprocessor 160 selects transmitters 120 and receivers 110 from one of the available transmission 120 and receivers 110 in channels 200 and configures multiplexer 220 to transmit and receive signals based upon such selection . as illustrated in fig3 , fmm 300 consists of three logical blocks : frequency spectrum assignment (“ fsa ”) 310 , protocol allocation (“ pa ”) 320 , and graphical configuration interface (“ cgi ”) 330 . in general , fmm 300 is software preferably residing on the application layer of an operating system . fmm 300 is preferably interoperable with a variety of operating systems , such as linux and windows ce . in addition , fmm 300 assigns frequency according to configuration instructions provided to cpe 100 . users and network administrators dynamically control cpe 100 and supply configuration information to manage spectrum usage in a way that optimizes available bandwidth over twisted pair links depending upon the range a signal will travel over twisted pair , the physical properties of twisted pair , and service demands of each user . as illustrated in fig3 , fsa 310 is a sub - module of fmm 300 . an object of this sub - module is to allocate discrete frequency bands , such as those in fig4 . another object of the spectrum assignment block is to provide compensation factors to corrective circuitry 130 . a further object of fsa 310 is to control the range of frequencies allocated in the spectrum to various video 450 , audio 430 , and data 460 signals , among others . accordingly , based upon cpe &# 39 ; s 100 spectrum assignment settings of 0 to 20 megahertz , as shown in fig4 , fsa 310 assigns service categories into discrete frequency bands . control signals are employed to initially configure frequency allocation assignments for service categories . control signals define routing table information so that the signals reach the targeted recipient . in an example embodiment , control signals are transmitted over a channel in reserved band 410 . an example control signal specifies video signal for broadcast in video band 410 ranging from 0 to 4 . 5 megahertz . once assigned , fsa 310 directs converter 150 to modulate ntsc signals over the twisted pair link in the specified frequency range . in instances when multiple cpes 100 exist remotely from one another , at least one of such remote cpes 100 receives the newly allocated spectrum and demodulates such spectrum at the specified frequencies to resolve ntsc frequency information . in another example embodiment , channels reserved for specific protocol are assigned frequencies in reserved band 410 . fig4 illustrates reserved band 410 ranging from approximately 7 . 5 megahertz to 9 megahertz . fig4 also illustrates guardband 420 between reserved band 410 and audio band 430 , and between audio band 430 and data band 460 , and between data band 460 and video band 450 . guardbands 420 are provided to eliminate undesired capacitive , inductive , or conductive coupling from channels within the allocated frequency bands , to another ( e . g ., cross talk ). in yet another example embodiment , cpe 100 devices are preset with frequency assignment information . however , upon configuration , frequency assignment information is updated . for example , if a cpe 100 is preconfigured to receive control signals at 15 megahertz in special application band 440 , when a cpe 100 first connects to the system ( not shown ), cpe 100 receives frequency control information at 15 megahertz in special application band 440 . fsa 310 receives demodulated 15 megahertz frequency signal to extract new frequency assignment information . cpe 100 settings are thereupon updated with frequency assignment information . by automatic or manual configuration , cpe 100 thereby adopts itself to receive and resolve signals with other cpes 100 in the system . frequency assignment information is stored in log file at cpe 100 and accessed when allocating new spectrum . an entry in this file , for example , would be the allocation shown in fig4 : video band 0 - 4 . 5 megahertz ; guardband 4 . 5 - 5 megahertz ; data band 5 . 0 - 6 . 0 megahertz ; guardband 6 . 0 - 6 . 5 megahertz ; audio band 6 . 5 to 7 . 0 megahertz ; guardband 7 . 0 - 7 . 5 megahertz ; reserved band 7 . 5 to 9 ; and special application band 9 . 0 to 20 megahertz . in another example embodiment , an emergency information channel is preferably assigned in reserved band 410 . breaking news , weather , and national security alerts are examples of information available on an emergency information channel . depending upon the information being transmitted the assigned bandwidth of the emergency channel may be expanded beyond reserved band 410 by fsa 310 . in yet another example embodiment , reserved band 410 also preferably includes channels designated for communication of particular protocols . protocol specific signals include tcp / ip and a variety of other proprietary and standardized protocols . depending upon the information transmitted , the assigned bandwidth of the protocol channels may be expanded beyond reserved band 410 by fsa 310 . in addition , fsa 310 preferably configures new frequency allocation assignments based on several factors including the physical properties of the twisted pair links . for example , signal transmissions requiring high qos are allocated lower , more reliable , frequencies if the quality of the twisted pair link is low . subscriber demands for a particular service optionally effect making frequency assignments . for example , highly viewed sporting events may necessitate wider frequency band allocation for video band 450 . fsa 310 may also analyze spectrum transmissions and determine if particular frequency is in greater demand . finally , protocol specific requirements also play a factor in frequency assignments . for example , ntsc signal may require between 0 and 4 . 5 megahertz . fsa 310 interoperates with pa 320 to incorporate protocol specific requirements in frequency assignments . pa 320 is discussed in the following section . fsa 310 communicates with pa 320 to assign the industry standard or custom protocols . pa 320 stores signaling rules used to convey information between cpes 100 . signaling rules include , for example , format and relative timing of signal exchange between cpes 100 . pa 320 also includes a protocol converter means for translating the protocols of a received signal to a new protocol for transmission in the dynamically allocated frequency spectrum . this allows cpes 100 to transmit and receive spectrum using newly or dynamically selected protocols . the protocol allocation block also enables cpe 100 to transmit and receive properly formatted digital signals between cpe 100 and peer entities of lan 240 or wan 230 . a preferred type of protocol supported by this submodule is traditional internet protocol . other types of protocols , including proprietary protocols , are employed as well . pa 320 computes an efficient arrangement of protocol channels . by multiplexer 220 , as shown in fig2 , one or more signals are combined into a single channel with different frequency transmission band settings . for example , ntsc , ip data , and pots may be arranged and multiplexed on a common twisted pair wire each having different spectrum allocation settings and protocol sequencing . pa 320 includes signaling rules established by control signals , preconfigured settings , or cgi 330 . cgi 330 is discussed in the following section . gci 330 is displayed on a video monitor of a digital processing machine and is adopted to receive input from a user and / or administrator . gci 330 is a submodule of fmm 300 . gci 330 provides means for a user and / or an administrator to assign and set the various protocols and frequency assignments . gci 330 also enables users and administrator to input protocol requirements and available or unused spectrum information . gci 330 also enables users to populate fsa 310 with qos requirements for signal transmission . fsa 310 updates qos requirements automatically or selectively so as to provide strategic allocation of frequency bands to satisfy a particular qos . some examples of selectively applied qos requirements are based upon known standards , such as those provided for tcp / ip including variable bit rates and constant bit rates . another example of known standards are those provided by ieee 802 . 11 ( e . g ., wi - fi ), developed by working group 11 of the ieee lan / man standards committee ( ieee 802 ). once populated , fsa 310 selectively employs the specified qos requirements when allocating frequency spectrum . users may also selectively populate qos requirements based upon system objectives . for example , assume an object of the system is to provide less than a two percent rate of signal loss for a particular service category . further assume that such service is allocated a channel from 5 megahertz to 7 megahertz . assuming further that lower frequencies translate to improved signal strength , when fsa 310 observes degradation in the signal resulting in greater than two percent data loss , then fsa 310 reallocates the service in a frequency ranging from 5 megahertz to 6 megahertz . alternatively , if a specific harmonic causes crosstalk in a channel , fsa 310 reallocates the channel in a higher frequency . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one will readily appreciate from the disclosure , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	7
once an animal becomes trapped in a vehicle in dangerous conditions , the window of opportunity which exists during which the animal may be successfully rescued without harm is frequently quite short . many jurisdictions allow for public resources , such as the 911 emergency call center , to be utilized to report incidents of animals trapped in vehicles . however , the response time in such situations is often insufficient to avoid harm to the animal or death . in particular , allocation of resources may force emergency authorities to assign a lower level of priority to such calls , resulting in a longer response time than is the case with human emergencies . this places even more of a premium on the ability of the emergency responders to quickly locate an animal in distress . unfortunately , in a typical animal rescue response , precious time may be wasted in locating the vehicle in which an animal is trapped . this may occur , for example , because a member of the public reporting the incident may have provided insufficient or inaccurate information about the vehicle in which the animal is trapped and its location . this may be the result of the person being unaccustomed to making such reports , or being distracted by the stress of the situation . the foregoing problems are not limited to animal rescue . according to a report published by kidsandcars . org , on average , 38 children die in hot cars each year from heat - related deaths after being trapped inside motor vehicles . more generally speaking , the same issues are frequently encountered whenever members of the general public or a group of particular individuals are suddenly tasked with reporting information on an incident or a developing situation . recent examples include terrorism events such as the boston marathon bombing and the san bernardino shootings , the flooding of new orleans as a result of hurricane katrina , and the various cases of alleged police brutality which have been recently reported in the media . in each of these instances , members of the general public found themselves in situations where they possessed information vital to the rapid and effective response to the event by authorities . however , due to faulty , insufficient or delayed reporting of the incident by such persons , the ability of authorities to respond effectively was compromised , sometimes with tragic consequences . in many cases , faulty reporting of the incident is due to the fact that the person reporting an incident may be unsure or unaware of which details of the incident can or should be included in the report , or may be too distracted to properly tend to such details . for example , such a person may fail to note critical details concerning the time and location at which the event occurred . the lack of such details may hamper the ability of a responding party to respond effectively to the event . it has now been found that some or all of the foregoing issues may be addressed with the systems and methodologies disclosed herein . in a preferred embodiment , these systems and methodologies utilize a mobile application , possibly in conjunction with an associated web service , to report animals in distress and to facilitate their rescue . the application , which is preferably installed on a mobile communications device or mobile technology platform associated with a user , may leverage technologies that have been developed in the art to create events and to associate media with the created events . these include , for example , the systems , methodologies and software disclosed in u . s . 2013 / 0275505 ( gauglitz et al . ), entitled “ systems and methods for event networking and media sharing ”, which is incorporated herein by reference in its entirety . the systems , methodologies and software disclosed herein may be further understood with reference to the particular , non - limiting embodiment depicted in fig1 - 15 . however , while this particular embodiment is specifically concerned with a system for facilitating animal rescue , it will be appreciated that the systems , methodologies and software disclosed herein are more broadly applicable to a wide variety of situations in which it is desirable to aggregate information and media related to one or more events , and to make the aggregated information and media available to an interested party ( such as , for example , a party responsible for responding to the event ). fig1 - 15 are screenshots illustrating a first particular , non - limiting embodiment of a software application which may be utilized to implement or facilitate the systems , methodologies and software disclosed herein for facilitating animal rescue . the application is preferably a mobile application which may be downloaded to the mobile communications devices or mobile technology platforms of a community of users . such downloads may occur , for example , by way of one or more suitable online sites such as , for example , the itunes store ™, google play ™, or other such application stores or sites . each user within the community of users register with and / or logs into the application ( or web service ) associated with the application using one of the alternative windows depicted in fig1 - 2 . the application may be accessible from within another application . thus , as shown in fig3 , the application ( entitled “ hotdawg ” in this embodiment ) may be bundled with other applications on a common launch screen . the informational screen on the right may be accessed through a settings icon from within the application that may be visible on the screen ( usually in the top toolbar ), by using a suitable menu or button ( such as , for example , the android “ menu ” button that is standard on android phones ) or by selecting the “ donate ” icon next to the tail - wagging dog . as seen in fig4 , in the particular embodiment depicted , a splash screen is displayed while the application is loading , preferably for a period of up to 3 seconds . upon launch , the application checks if the location awareness features of the host device are activated and , if so , preferably refreshes these features . preferably , the location awareness features will include suitable features of the host device that allow it to determine its location . this location may be specified , for example , in terms of a set of gps coordinates or through other suitable means . also upon launch , the application checks if the image tagging features of the host device are activated and , if so , preferably refreshes these features . preferably , the image tagging features will include suitable features of the host device that allow it to tag captured images with metadata or other identifying information . such identifying information may include the time and date on which the media was captured , the location of the host device ( preferably in terms of gps coordinates ) at the time of media capture , local temperature and weather information ( this may be gathered from a sensor integrated into the host device , or by referencing the location , date and time information relating to an incident with a third - party service which tracks and collects this information ), and possibly information which identifies the host device itself . fig5 depicts the main information gathering screen of the application . as seen therein , this screen contains a series of input categories which a user may select to provide information relating to an animal in distress . thus , in the particular embodiment depicted , the user may select the categories “ puppy ”, “ plates ” or “ parked ”. selection of one of the aforementioned categories will launch image capture software ( depicted by the middle frame of fig5 ) so that the user may capture images which will be assigned to that category . thus , for example , the user may select the “ puppy ” category to capture images of a trapped animal . the user may select the “ plates ” category to capture images of the license plates of a vehicle an animal is trapped in . the user may also select the “ parked ” category to capture images of the location at which the vehicle may be found . the number of images a user may capture for each category , and the size of these images , is not particularly limited . however , in some embodiments , maximum values may be specified to conserve storage or computational resources . after the user is finished capturing images for one of the categories , the user may utilize suitable navigational icons ( e . g ., “ back ” arrows ) in the software to return to the main information gathering screen of the application . it will be appreciated that each of the categories may be populated with images using this approach . as seen in fig7 , upon capturing at least one image in a category , the icon representing that category is preferably replaced by a thumbnail version of an image assigned to that category . the image utilized for this purpose may be designated by the user , or may be selected by default ( e . g ., the software may be configured to use the first image in that category or the most recent image , or may randomly select an image from the category ). in the particular embodiment depicted , the software also includes a “ place ” category . as seen in fig6 , selection of this category launches a zoomable map which depicts the current location of the user thereon by way of a suitable icon or marker . preferably , this icon or marker is centered on the map by default , and the map itself is movable by the user ( e . g ., through selection of suitable navigational icons such as arrows , or by finger - swiping or pinching the map in a desired direction ). the user is alerted that they can move the map underneath the fixed icon or marker so as to give as precise an indication of the intended , depicted location as possible . however , in some embodiments , either instead of or as an alternative to the foregoing , the icon or marker which will be made to correspond to the depicted location may itself be movable on the map . preferably , if the user does not select the place category , the program will ask the user to verify the depicted location to ensure accuracy . in some embodiments , if the user does not actively update the location awareness features of the mobile communications device or mobile technology platform , the mobile application may prompt the user to do so ( in some cases , this may simply involve requesting the device or platform to refresh the determined location ). the mobile application may also prompt the user to update the location awareness features at the time of media capture or periodically over the course of time . this may help to ensure that any location information associated with captured media is accurate . each instance of media captured by the user will be tagged with relevant identifying data using the media tagging information described above . the information the captured media is tagged with is preferably in addition to any metadata that is otherwise associated with the captured media by the host device . the information may be sent embedded within the media itself , or separately where the metadata is associated with specific content . when a user has completed capturing all requested or desired media , the user may then submit the media to a suitable authority such as , for example , a local law enforcement agency or an animal rescue organization . preferably , this is accomplished through suitable messaging ( which may include , for example , texts , mms , sms , email , instant messaging or twitter ) with the captured media as attachments thereto , as the targets of an embedded link , or by other suitable means . more preferably , the message may be shared with the authority as an event from within an instance of the same application which the user has used to capture the information . in the particular embodiment depicted , this is accomplished automatically by selection of the icon labeled “ 911 ”. as part of the process , selection of this icon launches the rightmost screen depicted in fig7 in which the user is notified that the user &# 39 ; s contact information will be shared only with local law enforcement agencies and organizations to effect rescue of the animal . this notification preferably reminds the user that law enforcement authorities may utilize the captured images to issue citations , to prosecute the responsible parties , or for other such purposes , and provides the user with the opportunity to accept or decline these terms . once the user accepts these terms ( e . g ., by selecting the “ agree ” button in the embodiment depicted ), the tagged images are sent to ( or authorized for viewing by ) the appropriate authorities . after submission , the software initiates a timer , and the elapsed time is displayed as shown in fig8 . the timer continues to run until the “ outcome ” tab is selected by the user . upon selection of this button , a menu is launched from which the user may select “ police arrived ”, “ accused left ” or “ couldn &# 39 ; t stay ”. during this time , the user may be subjected to various targeted advertising . in some embodiments , the user &# 39 ; s participation in the service may be encouraged by offering the user discounts and special offers in place of , or as part of , the targeted advertising . as seen in fig9 , if the “ police arrived ” tab is selected , a window is launched from which the user can capture a “ trophy ” image of the scene . a “ submit ” button is provided , the election of which allows the user to publish this image to a network or to otherwise share it with parties of interest . such sharing may occur via commonly used social - media sites such as facebook , twitter , snapchat and instagram or , for example , through a media sharing network of the type described in u . s . 2013 / 0275505 ( gauglitz et al . ), entitled “ systems and methods for event networking and media sharing ”, which is incorporated herein by reference in its entirety . fig1 shows some examples of the information which may be made available to law enforcement authorities and other such parties using the systems and methodologies described herein . as seen therein , the software provides a running list to such parties of trapped animal incidents . each item in the list includes ( if available ) the location of the vehicle in which the animal is trapped , the time the incident was first reported , the license plate of the vehicle in which the animal is trapped , a map of the vehicle &# 39 ; s location , images of the trapped animal , and other information which may be useful or required in locating the vehicle . in the particular embodiment depicted , each item on the list is scrollable sideways to display additional images or information concerning the incident . as seen in fig1 , the mobile application ( or an associated web application or web service ) may employ suitable icons , color coding or other means to indicate the criticality associated with each incident , so that treatment of the incidents may be effectively prioritized . in the particular embodiment depicted , this is accomplished , for example , by providing a map on which a suitable marker associated with each reported incident appears . the markers are preferably color - coded to indicate the amount of time that has elapsed since each incident was reported . thus , for example , the markers may have a first color within the first x minutes , a second color within the range of x to x + y minutes , and a third color when more than x + y minutes have elapsed . by way of example but not limitation , x in this example may be 8 minutes , and y may be 7 minutes , although it will be appreciated that values for these or other parameters may be dictated by intended use , current conditions and other such considerations . as seen in fig1 , an address in the listing may be selected by the user . doing so launches a suitable program , subroutine or procedure that provides directions from the user &# 39 ; s current location to the location of the incident . such a program , subroutine or procedure may invoke an external mapping or navigational service such as , for example , googlemaps ™, amazonmaps ™ or applemaps ™. it will be appreciated that the foregoing feature may be used by local law enforcement or other parties involved in animal rescue to arrive at the location of the incident as promptly as possible . as seen in fig1 - 15 , the software may be equipped with various reporting features to provide reports on the users of the program . such reports may specify , for example , the number of cities where the user has used the application over the last 7 days , the number of animal rescues the user has facilitated over the lifetime of their use of the application , and the number of abuse reports generated over the last 30 days as a result of the user &# 39 ; s actions . while it is preferred that media is captured and assigned to categories during use of the mobile application in the manner described above , it will be appreciated that embodiments are also possible in which media capture may occur outside of use of the mobile application , and that media may be assigned to categories after capture of the media has occurred . it will further be appreciated that , while the systems and methodologies disclosed herein are preferably implemented with a mobile application , these systems and methodologies may be implemented in other manners as well . thus , for example , these systems and methodologies may be implemented over a website , as a web application , with a web - based service , through the use of software in forms other than mobile applications , or through combinations or sub - combinations of the foregoing . it will also be appreciated that these systems and methodologies may be implemented as a distributed application in which some of the functionality of the software is performed on the client device , while other functionalities of the software may be performed on one or more remote servers or other remote computational devices . it will be appreciated that various embodiments of the systems and methodologies disclosed herein may be adapted to allow the user to enter various identification features of , for example , a vehicle of interest ( e . g ., a vehicle in which an animal is trapped ). thus , for example , in addition to entering license plate information , in some embodiments , the user may be able to enter a vehicle identification number ( vin ) ( also sometimes referred to as a chassis number ). the vin is a unique code ( including a serial number ) which is used by the automotive industry to identify individual motor vehicles . it will also be appreciated that , in some embodiments of the software , systems and methodologies disclosed herein , various other information may be captured and / or transmitted to authorities or appropriate third parties . such other information may include , for example , the date , time , local weather , and surroundings . by way of example , images , video or audio files of the area surrounding or adjacent to the event being reported may be captured by the user and transmitted to authorities . thus , for example , in an animal rescue situation , the user may be prompted to capture images or video of nearby street intersections , shopfronts or other identifiable features to facilitate rapid location of the animal . this information , or details associated with it , may be embedded ( e . g ., through the use of suitable metadata ) in the captured media or may be otherwise associated with it . in some embodiments of the systems and methodologies disclosed herein , the software utilized in these systems and methodologies may be equipped with voice recognition capabilities . in such embodiments , keyword triggers may be utilized to rapidly access a particular window or functionality within the software . for example , by uttering a phrase such as “ picpocket police ”, the user may access the particular window or functionality within the software that allows the user to report an event to the police . the software may similarly be equipped with the ability to allow the user to input keywords , by way of a keypad or other suitable input device , to similar effect . it will be appreciated that the software may have the ability to allow the user to report a variety of events to a wide spectrum of parties responsible for responding to events of a particular type . hence , this feature may allow the user to rapid access the appropriate portions of the software required to report an event of a specific type without having to wade through unnecessary windows or menus . it will be appreciated that the systems , methodologies and software described herein may be deployed across a wide variety of mobile communications devices and mobile technology platforms . these include , without limitation , mobile or cellular phones , personal digital assistants , laptop computers , notebooks , smartwatches , smart glasses , handheld communications devices , wearables equipped with computational or communications abilities ( including contact lenses ), and the like . for purposes of this disclosure , the modifier “ mobile ”, as used in “ mobile technology platform ” and mobile communications device ”, denotes a device that weighs less than 10 lbs , and typically weighs no more than 6 . 5 lbs . the systems , methodologies and software disclosed herein may use various features of the systems , methodologies and software disclosed in u . s . 2013 / 0275505 ( gauglitz et al . ), entitled “ systems and methods for event networking and media sharing ”, which is incorporated herein by reference in its entirety ; in u . s . 20130117146 ( gauglitz et al . ), entitled “ system and methods for event networking , media sharing , and product creation ”, which is incorporated herein by reference in its entirety ; in wo2016040680 ( gauglitz ), entitled “ systems and methodologies for validating the correspondence between an image and an asset ”, which is incorporated herein by reference in its entirety ; in pct / us2015 / 066257 ( gauglitz ), entitled “ drone based systems and methodologies for capturing images ”, which is incorporated herein by reference in its entirety ; and in u . s . ser . no . 14 / 988 , 564 ( gauglitz ), entitled “ use of a roaming geofence to control media sharing and aggregation associated with a mobile target ”, which is incorporated herein by reference in its entirety . for example , the geofences described herein may be roaming geofences of the type described , for example , in u . s . ser . no . 14 / 988 , 564 ( gauglitz ). similarly , the captured media described herein may be captured with a drone - based system as described , for example , in pct / us2015 / 066257 ( gauglitz ). various embodiments of the systems described herein may be moderated or unmoderated . in moderated systems , the moderator may be charged , for example , with approving or monitoring requests for event creation , approving or monitoring authorized users of the system , or approving or monitoring media or information shared over the system . in some embodiments , use of the system or software may be restricted to a set of trusted users , or visibility of , or notifications related to , an event may be restricted to a particular set of users . for example , in some embodiments , use of the system or software may be restricted to a particular entity or entities , or to personnel associated with , vetted by , registered with , or otherwise trusted by such entities . for example , in some embodiments , use of the system or software may be restricted to law enforcement personnel or emergency responders . in some embodiments , use of the system may be split between two or more groups , with each group possibly having its own distinct set of access or use privileges . for example , in some embodiments , only law enforcement personnel may have the ability to create an event , but members of the general public may have the ability to monitor events or to contribute media to an event or vice - versa . it will be appreciated that the systems , methodologies and software disclosed herein may interface with , link to , or utilize various other products , social media platforms , or technologies . for example , the systems , methodologies and software disclosed herein may generate alerts or notices which are sent out across social media platforms such as facebook or twitter . in some embodiments , such alerts or notices may be sent to users of such social media platforms which subscribe to or follow a particular feed , user or homepage . thus , for example , users ( such as , for example , members of the media or general public ) who follow the austin police department may be notified when events , or certain subsets or categories of events , are created which the austin police department is tasked with responding to , or when captured media is associated with such events . such alerts or notices may also be sent to various parties of interest through various messaging forums or types . thus , for example , such alerts may be broadcast across communication or social media platforms such as twitter or facebook , and may be sent in sms , mms , email , or text formats . it will also be appreciated that , in some embodiments of the systems and methodologies disclosed herein , alerts or notices related to an event may be directed to parties with potential interest in the event . for example , a user of the system may be given notices of events which have been created , or which are ongoing , and which are proximal to the user &# 39 ; s current location ( as determined , for example , by location awareness functionalities resident on a mobile communications device or mobile technology platform associated with the user ). similarly , a user of the system may be given notices of events of a type which the user has expressed interest in ( as , for example through appropriate software menu selections or entries made by the user , or based on events which the user has previously created or contributed media or information to ). it will further be appreciated that , in some embodiments of the systems , methodologies and software disclosed herein , the responding party may be a passive party with respect to the creation of events and the aggregation of media . for example , the systems , methodologies and software may be implemented over a social media platform in which the users or a third party control the creation of events and the aggregation of media , and in which the responding party merely subscribes to the system or software ( or an appropriate feed produced thereby ) so that the responding authority can take appropriate action when they deem it necessary . by way of example , while animal rescue may be an appropriate function of the responding party , it may be of secondary importance to the responding party . hence , the responding party may monitor the system or software ( or a feed produced thereby ) only when it has sufficient bandwidth to respond to events of that type . the systems , methodologies and software disclosed herein may be directed to reporting events of a specific type ( such as , for example , the animal rescue software described herein ), or may be styled as a more generalized platform over which a variety of different event types may be reported . each event type may have one or more predefined templates associated with it which governs information or media which is preferred or required to be input or captured by the user . for example , in one embodiment , the system may be a web - based system in which the user is presented with one or more web pages equipped with fields which show the information or media already input by the user , and any missing information or media which is preferred or required in order for the responding party to effectively respond to the event . examples of such web pages are depicted in fig1 - 12 , it being understood that this approach may be utilized with a wide variety of events , and not just animal rescue . the systems , methodologies and software disclosed herein may also utilize templates which are created or modified in real time by the responding party . thus , for example , the responding party may create or modify a template to allow the responding party to better respond to an event which may be developing or fluid in nature . by way of example , if police are especially interested in images or video of a getaway vehicle used in an armed robbery , the template for reporting the event may be modified to include a special field for photos or video entitled “ getaway vehicle ”, and the responding entity may prioritize consideration of reports in which that particular field is populated . this approach may be utilized , for example , to allow the responding entity to sort through a potentially large number of reports in a short amount of time to identify those reports most likely to be of current interest . similarly , the template may be updated with photos of the suspected perpetrators to aid members of the public in determining the suspects &# 39 ; whereabouts . the systems , methodologies and software disclosed herein may be used in conjunction with a wide variety of responding parties . the responding party may be a municipality , utility , or a local , state , federal or international agency , organization or service . for example , the responding party may be a law enforcement agency ( such as , for example , the local or state police , the fbi , interpol , or the like ) or law enforcement personnel , an emergency response team ( such as , for example , fema , red cross , a paramedic squad , a fire department , or a ski patrol ), an animal rescue organization , a utility ( which may use the system or software to , for example , allow members of the general public to report gas leaks , downed power lines , broken water mains , or service disruptions ), or the like . it will be appreciated that the definition of an event ( and in particular , the definition of a geofence associated with an event ) in the systems , methodologies and software disclosed herein may change over time . for example , it may be determined that two ostensibly distinct events are actually part of the same event . upon such a determination ( which may be made , for example , by a moderator or by the system or software itself ), the two events may be merged into a single event or they may be linked . similarly , an event may be split into two or more distinct events or subevents . by way of example , a first user may report the robbery of a nearby convenience store , and a second user may report a car accident several blocks away . it may be determined ( by license plate images or other information ) that the same vehicle was involved in both incidents , in which case the events may be merged or otherwise linked so that information or media associated with one of the events will also be associated with the other event . similarly , a shoplifting incident in the convenience store which occurred prior to the armed robbery ( and which was originally associated with the armed robbery based on location ) may later be determined to be a wholly unrelated event , and may be disassociated from the armed robbery event ( e . g ., by specifying a temporal window for the shoplifting incident which does not overlap with the armed robbery incident ). it will also be appreciated that the perimeter of a geofence may evolve over time . for example , as noted above , two or more geofences may be determined to belong to the same event , in which case the geofences will , in the aggregate , form the geofence for the event . these geofences may overlap , or may be discrete . alternately , if it is determined that two or more different locations belong to the same event , the geofence for the event may be redrawn to cover the multiple locations ( as , for example , by using a least squares approach to drawing a circle that encompasses all of the locations ). as still another possibility , the addition of new locations to an event may result in the formation of a complex or irregularly shaped geofence for the event . in some embodiments of the systems , methodologies and software described herein , flags may be utilized to designate sets of users to whom an event , or the information or media associated with an event , will be visible . by way of an example , both members of the general public and members of a local police force may be provided with instances of the same software . when events are created which are of a type which local police are tasked with responding to , those events may be appropriately flagged so that those events ( and preferably , only those events ) are visible to a member of the local police who is utilizing the software . in this manner , local law enforcement may utilize the same version of the application utilized by members of the general public . however , the flags serve a filtering function so that only events appropriate for local law enforcement will be visible to members of the local police ( thus , for example , social events created by users will preferably not be visible to members of the local police ). conversely , flags may be utilized to ensure that some events are visible only to members of a set of trusted users . for example , if a member of a local police force creates an event relating to a drug bust , it will typically be desirable for that event to not be visible to members of the general public . this result may again be achieved through the suitable use of appropriate flags . it will be appreciated that the foregoing use of flags is very desirable . in particular , it obviates the need to produce different versions of the software to accommodate different groups of users who use the software in different ways . instead , the appropriate use of flags allows the same software to be utilized in different ways by different sets of users . the use of flags , or other suitable means to control the visibility of events , may be implemented or governed by suitable software settings , some or all of which may be set by the user or by appropriate authorized parties . the above description of the present invention is illustrative , and is not intended to be limiting . it will thus be appreciated that various additions , substitutions and modifications may be made to the above described embodiments without departing from the scope of the present invention . accordingly , the scope of the present invention should be construed in reference to the appended claims .	6
in general overview , the present invention recognizes that the architecture for a ce product can be designed using a library of hardware objects connected together using a common interface structure . as understood herein , this hardware modularity maximizes product feature flexibility and permits commoditization at the module level rather than at the product level . object - oriented hardware architecture implicates three issues addressed below : objects , interfaces , and data routing . referring initially to fig1 , a first non - limiting object - oriented hardware system is shown , generally designated 10 , in which various hardware - implemented modules ( also referred to herein as “ objects ”) follow desired functions . that is , any function performed in a system is a candidate as a hardware module . this breakdown permits easy use and substitution of function as needed . by “ hardware module ” or “ hardware object ” is meant more than a single electronic component such as a single resistor , capacitor , or transistor and less than an entire separately - vended ce component such as an entire tv , disk player , pvr , etc . among the hardware objects that are contemplated herein are ntsc tuners , atsc tuners , analog input modules for composite , s - video , and component input , an ip network communication module , a hdmi ( or dvi ) input module , a vga input module , a decoder ( mpeg , avc , dv , etc .) module , a scaler module , an image enhancement module ( e . g ., a de - interlace module ), a graphics generator module for generating user interfaces , and a display driver module . accordingly , it may be appreciated that an object oriented hardware approach establishes a library of modules that can be pipelined together or switched in / out of the data path to achieve the desired functionality . fig1 shows a first example system 10 using present object - oriented hardware principles that may be employed as a video processing system for a tv . each of the elements shown in fig1 may be implemented by a respective hardware module , and all the hardware modules may be located on the same substrate if desired . the modules communicate by means of three switches 12 , 14 , 16 to effect data exchange . the switches 12 , 14 , 16 may be cross point switches that permit any input to be routed to any output , as more fully disclosed below . among the modules shown in the non - limiting example of fig1 are a demodulator module 18 that receives information from , e . g ., an audio - video source . a filter module 20 may be provided to filter the signal and a decryption module 22 may likewise be provided to decrypt an encrypted data stream . likewise , an encryption module 24 may be provided to encrypt data that is output by the system 10 . transcoding of video can be undertaken by a transcode module 26 . multiplexing of outgoing data and demultiplexing of incoming data can be provided by a multiplexer module 28 and a demultiplexer module 30 , respectively . video scaling may be provided by a scaler module 32 , and data input and / or output handled by a first in first out ( fifo ) buffer module 34 . a control module 36 that may be implemented by a field programmable gate array ( fpga ) may control / coordinate various activities of the above signal processing modules . in addition to the above signal processing modules each of which in general is configured to execute one and only one function , fig1 shows that the system 10 may also include various input / output modules for communicating with components external to the system 10 . by way of non - limiting example , the system 10 may include a p_o_d_ (“ pod ”) module 38 , a removable memory medium 40 such as a sony memory stick ( which is a trademark of sony corp . ), a video delivery module 42 , an ilink interface module 44 , a personal computer interface ( pci ) interface module 46 , and an integrated drive electronics ( ide ) interface 48 . fig2 shows another example object - oriented hardware module system 50 that can be used to drive a tv display . as shown , the system 10 can receive video information from first through third source interface modules 52 , 54 , 56 , each of which can send video stream protected by digital rights management to a respective high definition media interface ( hdmi ) receiver module 58 , 60 , 62 . the streams from the hdmi receiver modules can be switched through a universal pipeline switch 64 to appropriate signal processing modules such as an image compositer module 66 ( for , e . g ., rendering a composite image from the three data streams ) and an image mirror module 68 . outputs of the signal processing modules can be sent through the switch 64 as shown to a display driver 70 for presenting video images on a tv display 72 . a more detailed example of a module used in a digital tv can be seen in fig3 , which illustrates a scaler module . the illustrated scaler module receives frames of video at an input fifo 74 , demultiplexes it at a demultiplexer 76 , and then processes it through an input canvas 78 , clipper 80 , and scaler processor 82 to resize the video to meet needs of subsequent modules . the resized video is sent through an output canvas 84 and output to subsequent modules through an output fifo buffer 86 . control parameters can describe the input format and the desired output format . microcode can be loaded or selected if there are options for the scaler algorithm . as understood by the present invention , the above - described hardware modularity is most versatile when a common interface is used to interconnect modules . while specialized modules interface to outside components , internal interconnections are interchangeable because of the shared interface . an important interface carries the pipelined data from module to module . serial multi - gigabit technologies such as those used for pci express and gigabit ethernet can be used . these communication methods transfer data over a simple pair of wires traversing tens of centimeters , easily accommodating distribution within , e . g ., a tv chassis . data rates for each module in a pipeline can be common to the system or be programmed to match the fixed or dynamic needs of each point - to - point connection . digital rights management support may also be included to protect data . other components of a common interface can include a means to exchange control and status information . this could be serviced by i2c or similar low bit rate bus to avoid royalty issues . a common reference clock source can be distributed to all modules . an internal phase - locked loop ( pll ) or similar clock multiplier could use , e . g ., 25 mhz to generate the required internal clocks . a low speed metronome - like strobe ( i . e ., a frame clock ) can be used for system synchronization . turning now to data routing , dedicated simple connections can exist between modules that always feed each other , but as mentioned above greater flexibility can be achieved by using switches . these can also facilitate clustering modules in different areas on the chassis . switches can range from low tech selectors to much more versatile cross points . a cross point switch permits any input to be routed to any output ( even more than one output simultaneously ). dynamic configuration can be used to change modules in and out of the logical pipeline . even the sequence order can be changed . fifos can be implemented at the junction points to smooth out data and match clock rates . in addition to the above description , as contemplated herein the object - oriented hardware modules of the present invention can be unit tested then verified as an addition to a known working system . new modules can be phased into active production lines . the most versatile form of integration is to connect each module to a single cross point . or , modules may be combined into sub - systems that appear as a single module with a superset of capability . an example might be for an analog input interface that could be used across multiple products . common packaging for modules that frequently are used in the same product can result in cost savings . other modules can be configured as physical plug - ins that encourage field upgrades . for system setup and control a simple microprocessor or a state machine may be used , as mentioned above in relation to fig1 . control can include object initialization and data routing specification . operation of a module pipeline can start with selection of an operational mode . this will cause any necessary microcode to be loaded ( via the pipeline bus ) and switches to be set matching the desired topology . specifics can be described in a table to make mode changes easy . with the above disclosure in mind , it may now be appreciated that object oriented hardware is an advantageous systems approach to design and build digital consumer electronics . it splits the product into separate functional tasks that can be perfected in isolation and be swapped in and out to meet the needs of the customer . it is very agile and permits rapid response to changes and demands in the marketplace . data can be transmitted serially with a sync line asserted when the first bit of a serial burst or buffer is sent . the sync signal may be removed immediately after the first data bit or any time before the gap time between bursts . receiving modules may use the asserting edge of the sync signal to indicate the start of a new buffer . the format of a buffer can be anything agreed to by both the sending and receiving modules . a typical format might be that of a serial mpeg2 transport stream . “ push ” mode may be implemented by having the sending module drive the clock line . “ pull ” mode can be implemented by having the receive module drive the clock line . an optional ready line can be driven by the side not driving the clock for flow control . a fifth line can be used to flag buffers with errors but generally transmission and content errors can be handled with “ in band ” bits or by using the control / notification busses . push / pull mode can be a configuration register option for all serial data stream connections . each serial port connection can be configurable as to direction and stream type . four or five pins may be used for each port . the primary four signals may be used for serial transport streams and the fifth provides a mechanism for the external device to provide a stream address . serial data ( input / output ) data clock ( input / output ) data sync ( input / output — same as data ) valid / ready ( not valid asserted by source , not ready asserted by receiver ) address ( input indicates stream being transferred ) the cross point switch mentioned above can have addressable ports when the clock is supplied externally . this means an additional input line that provides the cross point with an asynchronous address value to further specify the port address . the port subaddress may be supplied by first asserting a start bit and then a four bit address value and check bit for a total of six bits . bit transitions can be synchronized by the system generic clock value . the sub address may remain in effect until explicitly replaced by another sub address . this feature is useful when connecting to devices that have time multiplexed streams such as 1394 , usb , ethernet , etc . the interface used to pass data between modules may be standardized to facilitate easy interconnection . in addition to a connection to the control bus , modules can have input data streams , output data streams , a connection to the notification bus , and even a connection to an outside bus or device . communication between the modules can use three common mechanisms — control , notification , and data . all three can be serial implementations to minimize the number of connections . several characteristics may be common to all modules . a system clock is supplied to all modules to be used for timing purposes . ( this clock may be used for serial data bus clocking , but it is not required .) a control register can be used to reset a module to the same state as power - up . another register can be used to put the module into power save mode . when in power save mode , the module uses the least amount of power possible by only being receptive to a command to leave power save mode . control can be performed via an i2c bus . this provides access to configuration registers , command delivery and status retrieval . one of the buses above may be a notification bus that can be used for special completion or contingency type messages typically implemented in an interrupt structure . each module that can produce a notification can have a configuration register for each possible use . notifications may be queued for processing by the control module ( s ). any type of module can send a notification , but only a control module is expected to process it . each notification may be 32 bits long and in a format defined by the control module . ( recall that the control module is responsible for initializing the configuration registers in each module .) a value of zero is assumed to be inactive and is the power up or reset condition . bits within the notification may be assigned to indicate the id of the servicing control module , the notification priority and the notification description . notifications may either be self regenerative or require re - arming to be resent . self regenerating notifications may be sent automatically every time an event happens to trigger the notification . this would usually apply to aperiodic and unexpected events . state sensitive notifications such as buffer starvation may be sent only on the state change and not repeatedly sent with each system clock . re - armed notifications may require a command to acknowledge the notification before can be resent . the notification bus may be a single line with open collector drivers and the system clock used for edge synchronization . any module can drive the bus low at any time . before sending a notification , a module listens to the notification bus for sixteen clock periods ( notification length ) to assure that the bus is quiescent . each notification can be initiated by asserting a start bit followed by the data bits msb first . as a module is asserting logical one bits of its notification , it checks to see if another module is asserting a logical zero at the same time . if such a collision is detected , the module asserting a logical one suspends its assertion and waits for the bus to be quiescent again . this collision management scheme causes the lowest value notification to have the highest priority and introduces no delay to the higher priority notification . a special circuit may be used to receive the notifications . it can act as a prioritizing pre filter for the servicing cpu or other control device . notifications can be queued in fifo like list in priority order . a level type interrupt can be asserted whenever any notifications are queued . reads of the device ( it looks like a location of memory ) can produce the highest priority ( lowest numeric value ) pending notification . reading an empty notification can produce a value of “ all ones ” indicating a null notification . a special notification can be self generated by the device if the queue overflows . ( high order bits a zero , n low order bits indicating the number of discards .) the fifo modules can be memory elements used to buffer data on a first in / first out basis . they can also be used as a store and forward element , a delay line , rescan buffer mode , or even flow control based upon time stamps . as a fifo , data can be pushed in ( or pulled in when data is available ) from the upstream element and pulled out by the downstream element . data bits are normally stored individually but a run length encoding scheme could be used for compressible data . for stream types with long data blocks , sync bits from the input stream may be preserved within the fifo by counter registers organized as a subfifo within the main fifo . a counter register can be incremented as data bits are clocked in . when a sync bit is encountered , the register can be pushed onto the subfifo and a new counter started . as data bits are pulled out of the fifo , the oldest counter is decremented with each bit until the counter reaches zero . at this point the output sync signal is asserted and the next counter pulled from the subfifo . for short data block stream types , the sync bits can be stored as a parallel bit stream to the main data stream . store and forward feature may be used to move status information from the end of a data buffer to the beginning . data may be pushed into the fifo in the normal manner but output availability is held off until the entire buffer has been received . a programmable counter may be used to specify the length of the buffer . the final trailing bits received may be preserved as buffer status and the output side of the fifo is enabled . the status bits can be transmitted ( stream location tbd ) first before the main data . this feature permits a source module ( without its own storage ) to build a buffer on the fly and flag a flaw after the fact . the destination module ( also without its own storage ) learns of the flaw up front . the fifo can be used as a delay line by programming a minimum buffer depth . data is pushed in as with a normal fifo but output availability is not asserted unless the required amount of data is queued . this eases the job of synchronizing multiple streams ( i . e . audio lip sync ). rescan buffer mode permits the same data to be pulled from the buffer repeatedly until replaced by a fresh push . this can be used for insertion packets that are injected periodically into a stream but are updated only occasionally . random writes are permitted . flow control fifos can be implemented by prepending a time stamp to the beginning of each buffer . this time stamp may have been done by an upstream process or as part of the fifo input hardware . data out of the fifo can be held up until the internal time reference reaches the time stamp value attached to the buffer on the head of the queue or the next buffer is discarded if its time stamp is “ stale ”. the input ready line can be programmed to range in meaning from actually full to a water mark , and the same is true for the output ready line . read and write pointers can be under program control . pci support requires one of the more complicated modules . module features may include pci interface configuration registers , memory mapped access to the i2c control / status bus , and dma like support for multiple stream transfers . eight simultaneous serial data stream transfers can be active at one time . each stream has a double ranked set of address / counter registers and several operating modes . the counter specifies the number of bytes to transfer and the address points to the transfer location on the pci memory bus . a stream specific control register specifies the transfer direction , if double stacking is active , if the same buffer is to be used as a continuous loop , how to report transfer complete , if the transfer is push / pull , etc . additionally , a system may include any number of cpu modules . if cpu support is provided outside the module , there not need be any internal cpu . at the other end of the spectrum can be systems with multiple cpu modules . one cpu might handle security issues such as key handling and generation . another cpu might turn front end modules that tune , fec , and demodulate a signal into a self standing tuner subsystem . the cross point switch referred to above can be used as a generic and flexible means to exchange data between modules any input can be routed to any output . inputs can be routed to more than one output simultaneously . cross point switches can be cascaded to form larger switches that can handle more streams . the cross point ports can be programmed to operate in either push or pull mode and could even include a small amount of buffering to eliminate the need for a full fifo . accordingly , modules in accordance with present principles may fall into five basic categories , namely , control , data exchange , internal processing , storage , and edge or external interface . control modules are responsible for conscious decision making and orchestrating the data flow between the processing modules . data exchange modules serve as an autonomous nervous system to keep the data flowing with a minimum of control intervention . a combination of physical and logical “ plumbing ” routes the data streams between modules . processing modules combine , split , and transform data to achieve their design function . one or more data streams may be input and one or more data streams may be output . programmed registers control the value added features . storage modules preserve data between processes and are usually implemented as fifos . edge pieces interface with the outside world . this might be an electrical transformation such as analog to digital . while the particular system and method for object oriented hardware is herein shown and described in detail , it is to be understood that the subject matter which is encompassed by the present invention is limited only by the claims .	7
embodiments of the present invention will be described below with reference to the accompanying drawings . fig1 shows a first embodiment of the present invention for obtaining a circuit resistor of fig3 . as in prior art , resistor group one ( 201 ) to resistor group four ( 204 ) are made of polycrystalline silicon 3 composed of a low concentration impurity region 4 and a high concentration impurity region 5 , which are formed in an insulating film 2 on a semiconductor substrate 1 , and the electric potentials of a terminal 101 to a terminal 105 are obtained out of a first metal portion 9 serving as a metal wiring via a contact hole 6 above the high concentration impurity region 5 . unlike the prior art where a metal for covering resistors is formed such that each resistor group is covered with one metal cover whose shape is arbitrary , the present invention uses the first metal portion as a wiring that connects resistor groups to one another , and second metal portions which have the same area and which cover their respective resistor groups . the area of each of the second metal portions whose areas are the same is determined to cover the resistor group that has the largest area . this is because , in order to reduce resistance shifts due to hydrogen diffusion into polycrystalline silicon during a semiconductor manufacturing process , a low concentration impurity region in every resistor group has to be completely covered with a metal portion while all the metal portions above the resistor groups have to have the same area . accordingly , it is appropriate to set the area of every metal portion to be the area of a metal portion that covers a resistor group requiring the largest area . in the case of building the resistor circuit of fig3 , for example , the second metal portion that covers resistor group one ( 201 ), which uses more unit resistors than any other resistor groups and therefore requires the largest area , has the largest area . accordingly , the area of each of second metal portions that cover other resistor groups ( resistor group two ( 202 ) to resistor group four ( 204 )) is set to have the area of the second metal portion above resistor group one . a space is created between resistor groups when a resistor group that requires a small area is covered with a metal portion having the same area as the one that covers the resistor group requiring the largest area . in such empty spaces below the second metal portions , polycrystalline silicon dummy patterns 8 which have the same shape as the polycrystalline silicon resistors are placed at regular intervals . maintaining the continuity in shape of the polycrystalline silicon resistors in this way avoids expected shape deviation in etching process caused by the existence of discontinuity in shape of the polycrystalline silicon resistors . giving the same area to all second metal portions above the resistor groups which are made of polycrystalline silicon resistors by the above - described method results in uniform reception of influences generated in the semiconductor manufacturing process , maintaining the uniformity of the resistor groups below the second metal portions and protecting , as in prior art , the polycrystalline silicon resistors from the exposure to hydrogen during the semiconductor manufacturing process . generally simultaneous formation of the first metal portions and the second metal portions is possible , yielding no additional manufacturing process . fig4 shows a comparison in the resistance ratio of the unit resistor in each resistor group of the resistor circuit of fig3 whose layout was made according to a conventional manner as shown in fig2 a and was manufactured through a certain manufacturing process . according to fig4 , all unit resistor should have the same resistance ration though the unit resistor in resistor group one ( 201 ), which is covered by a metal wiring having the largest area , has the highest resistance ratio and the unit resistor in resistor group three ( 203 ), which is covered with a metal wiring having the smallest area , has the lowest resistance ratio . in contrast , as shown in fig5 , unit resistors of a resistor circuit that employs the layout of fig1 according to the present invention have substantially the same resistance ratio in any resistor group . the effectiveness of the present invention is thus obvious . the second metal portions in this embodiment are not connected to anywhere and are electrically floating . fig6 shows a second embodiment of the present invention for obtaining the resistor circuit of fig3 . in the second embodiment , each of the second metal portions , which is electrically floating in the first embodiment , is connected to the semiconductor substrate through contact holes in a region outside of the resistor groups . this has an effect of releasing process charge and accumulated heat , both of which are generated during a semiconductor manufacturing process , to the semiconductor substrate having a large capacity . in this embodiment even if the external disturbance such as process charge or heat fluctuates , resistance fluctuation caused by the fluctuation of external disturbances can be reduced to the minimum by releasing the charge or heat instantly to the substrate . in short , by uniforming fluctuation due to the influence of external disturbances in a semiconductor manufacturing process while reducing the influence of the fluctuation of external disturbances themselves to the minimum , resistance fluctuation can be reduced and a resistor circuit composed of stable polycrystalline silicon resistors that have reduced resistance fluctuation can be provided . fig7 shows a third embodiment of the present invention for obtaining the resistor circuit of fig3 . in the third embodiment , each second metal portion , which is electrically floating in the first embodiment , is connected to one end of resistors belonging to a resistor group that is covered with the second metal portion . this structure makes it possible to close the difference between the electric potential of a resistor group that is generated when the resistor circuit starts operation and the electric potential of the second metal portion above the resistor group , and to reduce resistance fluctuation due to the depletion or accumulation effect of polycrystalline silicon resistors which is caused by the electric potential difference between the two . thus , fluctuation due to the influence in a semiconductor manufacturing process can be made uniform and resistance fluctuation due to the depletion or accumulation effect of resistor groups can be controlled . a resistor circuit composed of stable polycrystalline silicon resistors that have reduced resistance fluctuation can thus be provided . fig8 shows a fourth embodiment of the present invention of obtaining the resistor circuit of fig3 . in the fourth embodiment , each second metal portion , which is connected to one end of resistors belonging to a resistor group that is covered with the second metal portion in the third embodiment , is connected to a resistor end 11 , which is extended from one end of the resistors belonging to the resistor group that the second metal wiring covers . as in the third embodiment , this structure makes the electric potential of each second metal wiring equal to that of a resistor group below the second metal portion . the structure thus reduces resistance fluctuation due to the depletion or accumulation effect , which is caused by the electric potential difference generated between the two when the resistor circuit operates , in polycrystalline silicon resistors . this structure is also capable of easing process charge and accumulated heat both of which are generated during a semiconductor manufacturing process by releasing the process charge and heat to an extended portion of a resistor that has a certain volume . even if the external disturbance such as process charge or heat fluctuates , resistance fluctuation caused by the external disturbance can be reduced to the minimum through minimizing the effect by releasing the charge or heat instantly to the substrate . this embodiment can give an effect of uniforming fluctuation due to the influence of external disturbances in a semiconductor manufacturing process while reducing the influence of the fluctuation of external disturbances themselves to the minimum as well as controlling resistance fluctuation due to the depletion or accumulation effect in resistor groups . a resistor circuit having stable polycrystalline silicon resistors having reduced resistance fluctuation can thus be provided .	7
with reference now to the drawing , and particularly fig1 apparatus in accordance with the present invention comprises a frame defined by a pair of oppositely disposed lateral sides 1 and 2 . sides 1 and 2 are interconnected at their front edges by a transverse bar member 3 and are interconnected at their opposite or rear edges by a transverse member 4 . the frame is completed by a base member 5 . disposed within the frame between the lateral sides 1 and 2 , and movable with respect thereto , is a housing defined by a pair of oppositely disposed u - shaped channels 6 and 7 interconnected by a transversely extending plate 8 . in the manner to be described in more detail below , the movable housing comprising channels 6 and 7 and plate 8 receives a self - contained tape cartridge or cassette 17 ; the cassette being shown in phantom in fig1 . the channel defining members 6 and 7 are each provided with a pair of projections , indicated at 9 and 10 for channel 6 , which extend transversely to engage slots or grooves formed in the lateral sides 1 and 2 of the frame . each of the grooves or slots is of generally l - shaped configuration and is defined by connecting portions 11 and 12 . the portions 11 of the grooves in sides of the frame cooperate with the projections on the movable housing channel members to enable the housing to slide parallel to a plane defined by the frame base member 5 ; this first direction of movement being the direction of insertion of the tape cartridge 17 . when the limit of movement in the first direction is reached , the groove portions 12 cause the movable frame to be displaced in a direction perpendicular to the initial direction of motion . a blocking member 14 , which is in the form of a tongue , is pivotally mounted by means of hinges 13 on the upper part of rearwardly disposed member 4 of the frame . blocking member 14 extends the entire width of the space between the lateral side walls 1 and 2 and carries , at its oppositely disposed ends , forwardly extending projections or feet 15 . as may be seen from fig1 these projections 15 of blocking member 14 are adapted to engage projecting portions 8 1 of the transverse plate 8 of the movable frame . the projections on the blocking member 14 thus function as a stop to maintain the movable frame in the non - operative position of fig1 and 5 until a tape is fully inserted therein . the blocking member 14 is biased toward its lowered or blocking position , as depicted in fig1 and 2 , by a pair of springs 18 which extend between the frame member 4 and lugs 19 on the pivotal member 14 . it is to be noted that different approaches to the manner of mounting the springs 18 have been shown in fig1 and in fig2 - 4 . at its center the member 14 is provided with a forwardly extending projection 16 which is bent into respective downwardly and upwardly inclined portions 16 1 and 16 2 so as to define a camming surface for the purpose to be described below . the disclosed embodiment of the present invention , as may best be seen from fig4 also includes springs 23 , an actuating rod 26 and its associated push - button 27 and cam plates 28 with inclined edges 29 . the positioning and functioning of these additional elements will be described below in a discussion of the operation of the apparatus . with the device in the unloaded position of fig1 and 2 , a tape cartridge 17 will be introduced with its operative edge facing the projection 16 on blocking member 14 . the tape cartridge will slide in the channels 6 and 7 until the thickened portion 17 1 of its operative edge engages the portion 16 2 of projection 16 . upon engagement with the projection 16 , the tape cartridge will cause the member 14 to pivot upwardly thus releasing the movable housing for further movement . the blocking member 14 thus acts upon the movable housing to prevent displacement perpendicular to the direction of insertion of the tape cartridge prior to the full insertion of the tape cartridge . thus , the tape cartridge 17 and the movable housing are first displaced parallel to the plane of insertion of the tape while being guided by the projections 9 and 10 in the portions 11 of the grooves in the sides 1 and 2 of the frame . thereafter , when the tape cartridge has caused the blocking member 14 to be cammed upwardly , the movement in the first direction will be completed and the movable housing and tape cartridge will be guided in a second direction perpendicular to the first direction ; i . e ., the second motion will be in a plane transverse to the initial insertion plane . the second step of motion of the housing results from cooperation of the projections 9 and 10 on the housing with the portions 12 of the grooves in the frame lateral sides . the tape cartridge will thus be lowered onto and inserted into the driving and controlling elements ; i . e ., the capstan 20 and the shafts 21 and 22 of the spools or reels as shown in fig2 - 6 . the tape cartridge 17 and the movable housing are assisted in their descending movement by springs 23 which are anchored at first ends to the sides 1 and 2 and connected at their opposite ends to the projections 10 . it is to be noted that the projection 16 will be contacted by the thickened portion 17 1 of the operative edge of the tape cartridge only if the cartridge is properly oriented when introduced into the movable housing . thus , the tape cartridge itself cooperates with the blocking bar 14 to perform a security function which prevents the lowering of the tape cartridge onto the drive and control mechanisms 20 , 21 and 22 when the cartridge is improperly inserted . referring to fig4 the tape cartridge 17 and the movable housing may be released from the operative position and returned to the position of fig3 and subsequently to the position of fig2 with ejection of the tape cartridge , by means of a rod 26 actuated by a push - button 27 . the rod 26 carries a pair of camming plates or projections 28 which are provided with inclined edges 29 . movement of the rod 26 in the direction of a tape cassette insertion will thus cause the projections 9 and 10 to be forced upwardly to the top of the portions 12 of the grooves in the frame lateral sides by the inclined edges 29 of projections 28 . the movable housing 10 , of course , will move toward the front edge of the device only after it has been fully displaced perpendicularly . the final movement in the plane of insertion will take place under the action of the springs 23 . while a preferred embodiment has been shown and described , various modifications and substitutions may be made thereto without departing from the spirit and scope of the invention . accordingly , it is to be understood that the present invention has been described by way of illustration and not limitation .	6
preferred embodiments of the present invention will be described referring to the accompanying drawings . a method of image encoding according to the present invention is carried out by an image encoding apparatus ( a shape encoding apparatus ) shown as a first embodiment in fig8 . the shape encoding apparatus encodes shape data of a motion image received at a shape input terminal 1 and releases it from a code output terminal 10 . the encoding operation of the shape encoding apparatus is implemented on the basis of a macroblock by a hybrid encoding method ( for example , of the mpeg standard ) including dct and motion compensative prediction encoding . the shape data is encoded over not the entire of a frame but a rectangular area ( vop ) in which the object is defined . the shape data received at the shape input terminal 1 is transferred to a motion detector 2 and a shape encoder 4 . the motion detector 2 examines a motion of image between the shape data and a locally decoded data which has been locally decoded from a coded form produced by the shape encoder 4 and saved in a locally decoded image memory 5 . a resultant motion vector is released together with the mode of each macroblock . the modes of the macroblocks are identical to those described previously and will be explained in no more detail . the mode of each macroblock is supplied to a mode memory 6 and a mode encoder 7 as well as the shape encoder 4 . the motion vector from the motion detector 2 is transmitted to a motion compensator 3 and a motion vector encoder 8 . the motion vector encoder 8 encodes the motion vector and delivers its encoded form to a multiplexer 9 . the motion compensator 3 produces a predictive shape data from the locally decoded shape data saved in the locally decoded image memory 5 with reference to the motion vector and delivers it to the shape encoder 4 where it is used together with the mode of the macroblock for encoding the shape data . an encoded shape data is then supplied to the multiplexer 9 . also , the shape encoder 4 locally decodes the encoded shape data and delivers a locally decoded shape data to the locally decoded image memory 5 . the mode of the macroblock produced by the motion detector 2 is provided to the mode memory 6 and the mode encoder 7 . the mode memory 6 saves the mode of the macroblock as the mode of a reference macroblock in the reference frame . also , parameters x_org ( t ), y_org ( t ), w ( t ), and h ( t ) are supplied and saved in the mode memory 6 as the reference frame parameters . the parameters are indicative of the size of ( the rectangular area of ) vop . more specifically , the parameters x 13 ( t ) and y_org ( t ) are coordinate values at the upper left corner of the rectangular area of vop in a frame at the timing t . the parameter w ( t ) is a width of the rectangular area and h ( t ) presents a height of the rectangular area . those parameters are used for specifying the rectangular area of vop . the mode encoder 7 encodes the mode of the macroblock according to the mode of the reference macroblock in the ( reference ) frame cited . the mode encoder 7 also determines the reference macroblock from the coordinate values at the upper left corner of the vop of the reference frame and the coordinate values at the upper left corner of the macroblock to be encoded . the mode of the macroblock can thus be encoded according to the mode of the reference macroblock in the reference frame . more particularly in the mode encoder 7 , the mode of the macroblock of interest is encoded by e . g . vlc ( variable length coding ) examining the mode of the reference macroblock in the reference frame to select a desired vlc table which can allocate a short length code when the mode to be encoded is identical to that of the reference macroblock in the reference frame . if the mode is encoded by arithmetical encoding , a proper probability table is selected and used . the action of the mode encoder 7 will be explained later in more detail . the encoded mode of the macroblock of interest is then transferred to the multiplexer 9 . the multiplexer 9 receives the encoded shape data from the shape encoder 4 , the encoded motion vector of each macroblock from the motion vector encoder 8 , and the encoded mode of each macroblock from the mode encoder 7 which are multiplexed to a stream of coded bits and released out from a code output terminal 10 . the coded bit stream is added with error correction codes , subjected to particular modulations , and recorded by a recording apparatus not shown onto an image recording medium of the present invention such as cd - rom ( compact disk read only memory ), dvd ( digital versatile disk ), optical disk , magnetic disk , optomagnetic disk , ram , or the like , or further transmitted to a receiver at the other end of a transmission medium . in the encoding apparatus in fig8 in the embodiment of the present invention , the macroblock of the reference frame which is referenced when the mode of the macroblock is encoded is different from the one in the encoding apparatus in fig3 . in the following , the encoding of the mode encoder 7 is explained in detail . in the mode encoder 7 of the shape encoding apparatus of the first embodiment , the encoding of the mode of the macroblock is performed with reference to the mode of the corresponding macroblock in the reference frame which is most analogous to the macroblock to be encoded and its efficiency will thus be increased . the mode of the macroblock to be encoded and the coordinate values at the upper left corner of the same macroblock are supplied to the mode encoder 7 together with the coordinate values at the upper left corner of the vop in the reference frame . in response , the reference macroblock to be cited is determined from the coordinates values at the upper left corner of the vop in the reference frame and the coordinate values at the upper left corner of the macroblock to be encoded by a reference macroblock determining unit , described later , in the mode encoder 7 . the mode of the reference macroblock is then read from the mode memory 16 . according to the mode of the reference macroblock in the reference frame , the mode of the macroblock is encoded by the mode encoder 7 . an arrangement of the reference macroblock determining unit 14 in the mode encoder 7 is now explained referring to fig9 . fig9 illustrates the determination of an x coordinate value of the reference macroblock , in which ( x ( t ), y ( t )) are coordinate values at the upper left of the macroblock in the rectangular area ( of vop ) in the frame at the timing t and ( x_org ( t ), y_org ( t )) are coordinate values at the upper left of the rectangular area ( of vop ) in the frame at the timing t . it is assumed in fig9 that two consecutive frames are developed succeedingly at t = 1 and t = 2 . as shown in fig9 x ( 2 )- x_ ( 1 )+ 8 is calculated by an arithmetic unit 11 where x_org ( 1 ) is an x coordinate value at the upper left corner of the rectangular area of the frame at t = 1 , x ( 2 ) is an x coordinate value at the upper left corner of the macroblock , at the upper left , in the rectangular area of the frame at t = 2 , and 8 is equal to a half the number of pixels along the horizontal direction of the macroblock . a result a is transferred to another arithmetic unit 12 where the result a calculated by the unit 11 is divided by 16 , rounded down by eliminating its fraction , and multiplied by 16 . an output of the arithmetic unit 12 is added with x_org ( 1 ) by a further arithmetic unit 13 . a result represents the x coordinate x ( 1 ) at the upper left corner of the reference macroblock in the rectangular area of the frame at t = 1 . in the circuit shown in fig9 the x coordinate x ( 1 ) at the upper left corner of the reference macroblock located at the upper left corner of the rectangular area of the frame at t = 1 . although the circuit shown in fig9 calculates along the horizontal direction ( or the x axis ), it may also determine the y coordinate value along the vertical direction ( or the y axis ), at the upper left corner of the reference macroblock in the rectangular area of the frame at t = 1 , from y_org ( 1 ) and y ( 2 ). the above is expressed by the following equations ( 1 ) and ( 2 ). the calculation of (/ 16 × 16 ) in the arithmetic unit 12 can be implemented by replacing four of the least bits in a binary output of the arithmetic unit 11 with 0s . according to the reference macroblock determining method , the mode of the reference macroblock is most certainly given correct as shown in fig1 and the number of bits required for the encoding will be minimized . [ 0086 ] fig1 a , 10b , 10 c , and 10 d are similar to those shown in fig5 a , 5b , 5 c , and 5 d . [ 0087 ] fig1 illustrates three consecutive frames at t = 0 , t = 1 , and t = 2 where the object ( e . g . of a person ) and a rectangular area of vop which defines the object . the rectangular area consists of a number of macroblocks arranged in a grid array . as shown in fig1 a , the object of the person stands with its hands ( or arms ) extending horizontally at t = 0 . as the time runs from t = 1shown in fig1 b to t = 2 shown in fig1 c , the left hand ( or arm ) of the person , viewed from this side , is gradually lifted up . it is apparent from fig1 a , 10b . and 10 c that as the object of the person moves , the coordinate values at the upper left corner , the width , and the height of the rectangular area of vop are varied . the frames shown in fig1 c and 10d are identical in time . the frame shown in fig1 b is similar to that shown in fig4 a and the frames shown in fig1 c and 10d are similar to that shown in fig4 a . for encoding each macroblock in the rectangular area of the frame at t = 1shifted from at t = 0 , the mode of the macroblock in the rectangular area in the frame at t = 1has to determined according to whether the object is present or not and the motion ( a change ) of the object in the macroblock as compared with those in the reference macroblock in the preceding frame at t = 0 . when the object ( or a part of the object ) is not present in the macroblock in the rectangular area of the frame at t = 1 , the mode is selected m 0 as best shown in fig1 b ( where m0 is denoted by only 0 ). when the motion of the object is not changed from that of the preceding frame , the mode of the macroblock is mskip ( denoted by s in fig1 ). when the motion of the object is slightly changed from that of the preceding frame , the mode is selected minter ( denoted by i in fig1 ). when the motion of the object is greatly changed from that of the preceding frame , the mode is mintra ( denoted by c in fig1 ). as apparent , the coordinate values at the upper left corner , the width , and the height of the rectangular area are unchanged between fig1 a and 10b . for encoding the macroblock in the rectangular area of the frame at t = 2 , it is essential to acknowledge that the coordinate values , width , and height of the rectangular area are different between fig1 b and 10c . when the macroblocks in the rectangular area of the frame at t = 2 are encoded , their modes are preferably assigned as shown in fig1 c . using the reference macroblock determining method explained in conjunction with the arrangement of the first embodiment shown in fig8 , and 7 , an array of the modes of the reference macroblocks are developed , as shown in fig1 d , almost perfectly corresponding to the modes of the macroblocks in the rectangular area of the frame at t = 2 . it is apparent from the comparison between fig1 c and fig1 d that nearly all the reference macroblocks developed by the reference macroblock determining method operated with the first embodiment of the present invention are identical in the mode to those to be encoded . an arrangement and its operation for decoding the encoded bit steam produced by the encoding apparatus of the first embodiment shown in fig8 will be described referring to fig1 . the encoded bit stream which has been read from an image recording medium of the present invention or has been received from a proper transmission medium and subjected to given processes of modulation and error correction by an unshown receiver is introduced to a code input terminal 60 of a shape decoding apparatus in the arrangement of the first embodiment shown in fig1 . the coded data introduced at the code input terminal 60 is decoded by the shape decoding apparatus before released as a shape data from a shape output terminal 68 . the decoding in the shape decoding apparatus like the action of the encoding apparatus shown in fig8 is also carried out with reference to the modes of macroblocks . as shown in fig1 , the code data received at the code input terminal 60 is separated by a demultiplexer 61 to a shape data code , a motion vector code , and a macroblock mode code . the separated codes are transferred to a shape decoder 64 , a motion vector decoder 62 , and a mode decoder 67 respectively . the motion vector decoder 62 decodes the motion vector code and transmits its decoded data to a motion compensator 63 . the mode decoder 67 decodes the mode code according to the mode of a reference macroblock in a reference frame which has been decoded and saved in a mode memory 66 . the mode decoder 67 also receives the coordinates values at the upper left corner of the vop in the reference frame , the mode of the macroblock to be decoded , and the coordinate values at the upper left corner of the macroblock to be decoded . in the mode decoder 67 , the coordinates values at the upper left corner of the vop in the reference frame and the coordinate values at the upper left corner of the macroblock to be decoded are processed to determine a reference macroblock and the mode of the reference macroblock is read out from the mode memory 66 . the mode decoder 67 decodes the mode of the macroblock of interest according to the mode of the reference macroblock in the reference frame . the arrangement of determining the reference macroblock is identical to that shown in fig9 and will be explained in no more detail . the coordinate values at the upper left of the macroblock to be decoded may be provided either from the outside as an external signal or from any other component in the decoding apparatus . the decoded mode of the macroblock produced by the mode decoder 67 is transferred to both the shape decoder 64 and the mode memory 66 where it is saved as the mode of the reference macroblock in the reference frame . in the mode memory 66 , the coordinate values of x_org ( t ) and y_org ( t ) at the upper left corner of the rectangular area of vop are also saved . the motion compensator 63 produces a predictive shape data from a decoded shape data which has been reconstructed by the shape decoder 64 using the motion vector from the motion vector decoder 62 and saved in a decoded image memory 65 . the predictive shape data is then supplied to the shape decoder 64 . the shape decoder 64 receives the shape data code , the decoded mode of the macroblock from the mode decoder 67 , and the predictive shape data from the motion compensator 63 . the shape decoder 64 decodes the shape data code of each macroblock according to the decoded mode of the macroblock and the predictive shape data . a resultant decoded form of the shape data is transferred via a shape output terminal to the outside . the shape data is also fed to the decoded image memory 65 where it is saved for future use in the motion compensator 63 to produce a predictive shape data . a second embodiment of the present invention will be described , in which the reference to the modes of the macroblocks is different from that in the first embodiment . in the second embodiment , the correlation of the mode of a coded form of the ( locally decoded ) macroblock in the same frame is used for determining the mode of the reference macroblock . such an action will be described in more detail referring to fig1 . an image encoding apparatus ( a shape encoding apparatus ) shown in fig1 is provided for encoding a shape data of image received at a shape input terminal 21 and delivering its coded form from a code output terminal 3 0 . this encoding apparatus employs a hybrid encoding technique ( such as of the mpeg standard ) consisting of dct and motion compensative prediction encoding , in which data is processed in macroblocks . the shape in the image is not encoded throughout a frame size but in a rectangular area ( of vop ) which defines the shape of an object . in action , the shape data received by the shape input terminal 21 is supplied to a motion detector 22 and a shape encoder 24 . the motion detector 22 examines a motion in each macroblock between the supplied shape data and a locally decoded shape data which has been encoded by the shape encoder 24 , locally decoded , and saved in a locally decoded image memory 25 . a resultant motion vector representing the motion is then released together with a mode of the macroblock . the modes of the macroblocks are identical to those explained previously and their explanation will be omitted . the mode of the macroblock is transferred to a mode encoder 27 as well as the shape encoder 24 . the motion vector is supplied to a motion vector encoder 28 and a motion compensator 23 . the motion vector encoder 28 encodes the motion vector and delivers its encoded form to a multiplexer 29 . the motion compensator 23 produces a predictive shape data from the locally decoded shape data saved in the locally decoded image memory 25 on the basis of the motion vector and delivers it to the shape encoder 24 . in the shape decoder 24 , the shape data is encoded according to the predictive shape data and the mode of the macroblock and transferred to the multiplexer 29 . also , the shape encoder 24 decodes locally the encoded shape data and feeds its locally decoded form to the locally decoded image memory 25 . the mode encoder 27 encodes the mode of the macroblock supplied according to the following procedure . it is now assumed that the location of the macroblock , the x - th from the left end and the y - th from the upper end in a frame , is expressed by a coordinate point m ( x , y ). for encoding the macroblock of the coordinate point m ( x , y ), the mode encoder 27 uses reference to four macroblocks which are located adjacent to the macroblock to be encoded in the frame and have been encoded ; an ( upper left ) macroblock at the coordinate point m ( x − 1 , y − 1 ) on the upper left side of the macroblock at m ( x , y ) to be encoded , an ( upper ) macroblock at the coordinate point m ( x , y − 1 ) on the upper side , an ( upper right ) macroblock at m ( x + 1 , y − 1 ) on the upper right side , and a ( left ) macroblock at m ( x − 1 , y ) on the left side , as shown in fig1 . according to the modes of the reference macroblocks , in case of vlc encoding process , a desired vlc table is selected or in case of arithmetic encoding process , a desired probability table is selected for the encoding . since the mode of the macroblock to be encoded is correlated to the modes of the spatially adjacent macroblocks , its encoding will increase in the efficiency . the encoded mode of the macroblock is then transferred to the multiplexer 29 . the multiplexer 29 receives the encode shape data from the shape encoder 24 and the encoded motion vector from the motion vector encoder 28 as well as the encoded mode of each macroblock from the mode encoder 27 which are multiplexed and released from a code output terminal 30 as a steam of encoded bits . the encoded bit stream is then added with an error correction code and subjected to given modulations before stored in a storage medium of the present invention such as cd - rom , dvd , optical disk , magnetic disk , optomagnetic disk , ram , or the like , or transmitted via transmission lines to a receiver not shown . the second embodiment , unlike the first embodiment , is hence applicable not only to the interframe encoding but also to the intraframe encoding . a third embodiment of the present invention will be described using reference to pixel values in the mode encoding with the arrangement of the second embodiment . an arrangement of the third embodiment is modified in which a locally decoded shape data of the locally decoded image memory 25 is directly supplied to the mode encoder 27 as shown in fig1 . the shape encoding apparatus of the third embodiment permits the mode encoder 27 to encode the mode of each macroblock according to the following process . assuming that the location of the macroblock , the x - th from the left end and the y - th from the upper end in a frame , is expressed by a coordinate point m ( x , y ), the encoding of the mode of the macroblock at m ( x , y ) is based on the reference to the level of pixels g located in the macroblock at m ( x , y − 1 ) on the upper side and the macroblock at m ( x − 1 , y ) on the left side of the macroblock at m ( x , y ). more specifically , the pixels g allocated in the neighbor macroblocks at m ( x , y − 1 ) and m ( x − 1 , y ) in the frame which have been encoded are directly next to the macroblock to be encoded , as shown in fig1 . when the level of all the pixels g allocated in the macroblocks at m ( x , y − 1 ) and m ( x − 1 , y ) is denoted by a 0 ( indicating that they display a region outside the object in the frame ), the mode of the macroblock at m ( x , y ) to be encoded is of m 0 at a higher probability . when the level of all the pixels g allocated in the macroblocks at m ( x , y − 1 ) and m ( x − 1 , y ) represents a 1 ( indicating that they display a region inside the object in the frame ), the mode of the macroblock at m ( x , y ) to be encoded is very likely to be m 1 . when the level of the pixels g allocated in the macroblocks at m ( x , y − 1 ) and m ( x − 1 , y ) adjacent to the macroblock to be encoded includes both 0 and 1 , the modes of the macroblock at m ( x , y ) to be encoded are very likely m 0 and m 1 . as the modes of the macroblocks to be encoded are different in the probability of appearance , their encoding table , either a vlc table in the vlc encoding or a probability table in the arithmetic encoding , is selectively determined corresponding to the levels or values of the pixels g in the neighbor macroblocks at m ( x , y − 1 ) and m ( x − 1 , y ). accordingly , the third embodiment will also improve the efficiency of the encoding process . it is also clear that the third embodiment like the second embodiment is applicable to both the interframe encoding and the intraframe encoding . the use of the modes and the pixels of the encoded macroblocks for encoding in the second and third embodiments respectively is also favorable in the decoding process and will contribute to the accuracy of the decoding of high - efficiency coded data . an arrangement of a decoding apparatus and its operation for decoding the encoded bit stream produced by the encoding apparatus of the second or third embodiment shown in fig1 will be described referring to fig1 . the coded data introduced at a code input terminal 70 is decoded by the shape decoding apparatus before released as a shape data from a shape output terminal 78 . the decoding in the shape decoding apparatus like the action of the encoding apparatus shown in fig1 is also carried out with reference to the modes or pixels of the preceding macroblocks . as shown in fig1 , the code data received at the code input terminal 70 is separated by a demultiplexer 71 to a shape data code , a motion vector code , and a macroblock mode code . the separated codes are transferred to a shape decoder 74 , a motion vector decoder 72 , and a mode decoder 77 respectively . the motion vector decoder 72 decodes the motion vector code and transmits its decoded data to a motion compensator 73 . the decoded shape data is provided from a decoded image memory 75 to the mode decoder 77 . the mode decoder 77 decodes the encoded mode of the macroblock according to the modes of the neighbor macroblocks which have been decoded . more particularly , in case of the vlc decoding process , a desired vlc table is selected with reference to the modes of the neighbor macroblocks which have been decoded or in case of the arithmetic decoding process , a desired probability table is selected for the decoding the determining of the modes of the neighbor macroblocks which have been decoded is similar to that of the mode encoder 27 of the second embodiment and will be explained in no more detail . the decoded mode of the macroblock produced by the mode decoder 77 is transferred to both the shape decoder 74 . the motion compensator 73 produces a predictive shape data from a decoded shape data which has been reconstructed by the shape decoder 74 using the motion vector from the motion vector decoder 72 and saved in the decoded image memory 75 . the predictive shape data is then supplied to the shape decoder 74 . the shape decoder 74 receives the shape data code , the decoded mode of the macroblock from the mode decoder 77 , and the predictive shape data from the motion compensator 73 . the shape decoder 74 decodes the shape data code of each macroblock according to the decoded mode of the macroblock and the predictive shape data . a resultant decoded form of the shape data is transferred via a shape output terminal to the outside . the shape data is also fed to the decoded image memory 75 where it is saved for future use in the motion compensator 73 to produce a predictive shape data . the shape decoding apparatus of the third embodiment allows the decoded shape data to be transferred from the decoded image memory 75 to the mode decoder 77 as denoted by the dotted line in fig1 . the mode decoder 77 decodes the encoded mode of the macroblock according to the level of the pixels of the neighbor macroblocks which have been decoded . more particularly , in case of the vlc decoding process , a desired vlc table is selected with reference to the level of the pixels of the neighbor macroblocks which have been decoded or in case of the arithmetic decoding process , a desired probability table is selected for the decoding . the determining of the levels of the pixels of the neighbor macroblocks which have been decoded is similar to that of the mode encoder 27 of the third embodiment and will be explained in no more detail . the determining of the modes of the reference macroblocks and the level of the pixels of the neighbor macroblocks in the first to third embodiments may be used in any combination through adaptive switching actions . for example , the methods of determining reference data in the first and second embodiments can be used by selectively switching from one to the other . also , the methods of determining reference data in the first and third embodiments or the second and third embodiments may be used in a combination by selectively switching from one to the other . moreover , all the methods of the first to third embodiments may be used together by selecting a desired one at a time to carry out the encoding process at an optimum efficiency . as set forth above , the present invention allows encoding of the mode of each code data at higher efficiency and subsequently , decoding the coded mode at higher accuracy , thus contributing to the optimum reproduction of an original image . it would be understood that various changes and modifications are possible without departing from the scope of the present invention . it is also true that the present invention is not limited to the foregoing embodiments .	7
radio frequency identification ( rfid ) labels can be intelligent or just respond with a simple identification ( id ) to radio frequency ( rf ) interrogations . the rfid label can contain memory . this memory can be loaded with data either via an interrogator , or directly by some integrated data gathering element of the rfid label , for example , an environmental sensor . this data is retrieved some time later . as shown in fig1 , an exemplary active rfid label 10 includes an antenna 12 , a transceiver 14 , a microcontroller 16 , a temperature sensor 20 and a battery 22 . microcontroller 16 includes several elements including a memory 18 . memory 18 can include a power conservation process 100 , fully described below . temperature sensor 20 senses and transmits temperature data to memory 18 at intervals of time . when triggered by rf interrogation via transceiver 14 , microcontroller 16 fetches the data ( i . e ., time stamp and temperature ) and sends it out to an interrogator as multiplexed data packets from transceiver 14 . in this manner , a historical temperature log stored in memory 18 in the active rfid label 10 can be retrieved . temperature logging is limited by the size of memory 18 and / or life of battery 22 . in some examples , rfid label 10 stores a voltage of its battery 22 along with a time and a temperature at each time interval . as shown in fig2 , an exemplary rfid interrogator 50 includes an antenna 52 , transceiver 54 , memory 56 , central processing unit ( cpu ) 58 and optional user interface ( ui ) 60 . the rfid interrogator 50 performs time division multiplexing ( tdm ) with the transceiver 54 and antenna 52 . data ( e . g ., time , temperature and / or battery voltage ) downloaded from the rfid label 10 can be stored in memory 56 . the rfid interrogator 50 can be used to program the active rfid label 10 to record or log a temperature and / or battery voltage in memory 18 with a time interval starting at an initial time . at each time interval , e . g ., every hour , the active rfid label 10 records a time , temperature and / or battery voltage in memory 18 . the rfid interrogator 50 can download the time , temperature and / or battery voltage data from memory 18 to memory 56 . over a period of service , i . e ., the recording and storing of time / temperature / voltage , the life of the rfid label battery 22 in the active rfid label 10 can diminish and eventually fail . in one example , if the active rfid label 10 detects reduced voltage in the battery 22 , the active rfid label 10 can increase the time interval for temperature and / or voltage readings , thus conserving the remaining life of the battery 22 . for example , if the initial time interval in the active rfid label 10 is sixty minutes , the active rfid label 10 will log a time , temperature and / or voltage every sixty minutes . if the active rfid label 10 detects a voltage in the battery is less than 80 % capacity , for example , the active rfid label 10 will increase the time interval for readings to , for example , one hundred twenty minutes . at subsequent readings , the active rfid label 10 will increase the time interval for readings as the battery 22 continues to deteriorate , i . e ., as a voltage in the battery 22 decreases with each reading , and the active rfid label 10 can continue to increase the time interval for temperature and / or voltage readings , thus extending the remaining life of the battery 22 . in another example , stored data received from the rfid label 10 can be analyzed by the rfid interrogator 50 . more specifically , from stored voltage data , the rfid interrogator 50 can determine whether the most recent voltage of the battery 22 is too low , or has dropped below a selected value , or that the voltage of the battery 22 is decreasing at too rapid a rate . in any event , the rfid interrogator 50 can instruct the rfid label 10 to increase its time interval of temperature and / or voltage readings or the rfid interrogator 50 can adjust its frequency of interrogations of rfid label 10 . in another example , the rfid label 10 does not store any time , temperature and / or voltage data . instead , during each interrogation of rfid label 10 , the rfid interrogator 50 requests the rfid label 10 for a current battery voltage and / or temperature . the rfid interrogator 50 can store temperatures and / or voltages over time . in addition , the rfid interrogator 50 can determine to increase its time interval between interrogators based on the currently polled battery voltage . as shown in fig3 , the power conservation process 100 includes receiving ( 102 ) an initial time interval . process 100 determines ( 104 ) whether the time interval is reached . if the time interval is reached , process 100 detects ( 106 ) a time from its internal clock , a temperature from its temperature sensor and voltage of its power supply , e . g ., battery . process 100 determines ( 108 ) whether the detected voltage has reached a selected reduced level . if the detected voltage has not reached a selected reduced level , process 100 stores ( 110 ) the detected time and temperature . if the detected voltage reached the selected reduced level ( or less ), process 100 increases ( 112 ) the time interval and stores ( 110 ) the detected time and temperature . process 100 then determines ( 104 ) whether the increased time interval is reached . process 100 can be incorporated into the memories of other types of rfid labels . for example , process 100 can be used with beacon tags . in general , a beacon tag is an active rf tag that can be factory set to transmit a periodic rf signal used for location , process and presence detection and tracking . typically , these devices are placed into non - metallic enclosures and transmit an rf signal to an rfid reader located at a distance of 3 - 10 meters . as the power decreases , process 100 can increase the time at which the period rf signal is transmitted . in another embodiment , memory 56 contains a time interval process 200 . as shown on fig4 , the time interval process 200 includes sending ( 202 ) an interrogation signal to a rfid label . process 200 receives ( 204 ) a response signal from the rfid label containing the label &# 39 ; s log of times , temperatures and voltages . process 200 determines ( 206 ) whether the most recent measured voltage of the label battery is below a minimum voltage . if the most recent voltage of the label is below a minimum , process 200 sends ( 208 ) a signal to the rfid label lengthening its time interval . process 200 determines ( 210 ) whether the rate of voltage decrease of the label battery exceeds a specified rate . the rate of decrease in battery voltage is determined by the rfid interrogator from the received store of battery voltages received from the rfid label during the interrogation . if the rate of decrease of battery voltage exceeds the specified rate , process 200 sends ( 208 ) a signal to the rfid label lengthening its time interval . in another embodiment , memory 56 contains a polling interval process 300 . as shown in fig5 , the polling interval process 300 includes sending ( 302 ) an interrogation signal to a rfid label . process 300 receives ( 304 ) a response signal from the rfid label containing the current battery voltage in the rfid label . process 300 determines ( 306 ) whether the current battery voltage in the rfid label is below a specified minimum . if the current battery voltage is below the specified minimum , process 300 lengthens ( 308 ) a time to sending its next interrogation signal . embodiments of the invention can be implemented in digital electronic circuitry , or in computer hardware , firmware , software , or in combinations of them . embodiments of the invention can be implemented as a computer program product , i . e ., a computer program tangibly embodied in an information carrier , e . g ., in a machine readable storage device or in a propagated signal , for execution by , or to control the operation of , data processing apparatus , e . g ., a programmable processor , a computer , or multiple computers . a computer program can be written in any form of programming language , including compiled or interpreted languages , and it can be deployed in any form , including as a stand alone program or as a module , component , subroutine , or other unit suitable for use in a computing environment . a computer program can be deployed to be executed on one computer or on multiple computers at one site or distributed across multiple sites and interconnected by a communication network . method steps of embodiments of the invention can be performed by one or more programmable processors executing a computer program to perform functions of the invention by operating on input data and generating output . method steps can also be performed by , and apparatus of the invention can be implemented as , special purpose logic circuitry , e . g ., an fpga ( field programmable gate array ) or an asic ( application specific integrated circuit ). processors suitable for the execution of a computer program include , by way of example , both general and special purpose microprocessors , and any one or more processors of any kind of digital computer . generally , a processor will receive instructions and data from a read only memory or a random access memory or both . the essential elements of a computer are a processor for executing instructions and one or more memory devices for storing instructions and data . generally , a computer will also include , or be operatively coupled to receive data from or transfer data to , or both , one or more mass storage devices for storing data , e . g ., magnetic , magneto optical disks , or optical disks . information carriers suitable for embodying computer program instructions and data include all forms of non volatile memory , including by way of example semiconductor memory devices , e . g ., eprom , eeprom , and flash memory devices ; magnetic disks , e . g ., internal hard disks or removable disks ; magneto optical disks ; and cd rom and dvd - rom disks . the processor and the memory can be supplemented by , or incorporated in special purpose logic circuitry . it is to be understood that the foregoing description is intended to illustrate and not to limit the scope of the invention , which is defined by the scope of the appended claims . other embodiments are within the scope of the following claims .	6
the present invention refers to hypodermic needles 101 , 201 or 301 for the administration of solutions and suspensions of drugs , medicines and vaccines , that contain at their sharp - end a water - soluble obstruction 102 , 202 or 302 , as is represented in fig1 a - d , 2 a - b and 3 a - b . penetration of the hypodermic needles 101 , 201 or 301 in living tissue of a human or animal subject results in the almost instantaneous dissolution of the obstruction 102 , 202 or 203 , and permits the injection of the liquid containing the drug or vaccine . the incorporation of the obstruction 102 , 202 or 302 avoids the user from expelling part of the liquid contained within the injection device prior to the needle penetrating the tissues of the receiving animal or human subject . the hypodermic needles 101 , 201 or 301 have preferred internal diameters ranking from 0 . 1 mm y 1 mm , and the capacity of administering drugs and vaccines by injection to depths up and over 5 cm . however it is acknowledged that larger internal diameter needles may be applicable in other fields of animal and plant health . the obstruction 102 , 202 or 302 is preferably composed by materials which are rapidly soluble in aqueous media and that dissolve once the needle penetrates living tissues . examples of these include , with out limitation , carbohydrates , sugar alcohols , amino acids , proteins , polymers , salts and / or mixtures thereof . applicable carbohydrates and sugar alcohols include , with out limitation , maltodextrin , trehalose , raffinose , cellobiose , melezitose , glucose , fructose , maltulose , iso - maltulose , lactulose , maltose , gentobiose , lactose , galactose , isomaltose , manose , maltitol , lactitol , eritrol , palatinitol , inositol , xilitol , mannitol , sorbitol , dulcitol and / or ribitol and mixtures thereof . preferably the carbohydrates are chosen from those that are acceptable for injection , with great solubility , and solid at a temperature of at least 45 ° c ., like for example mannitol , trehalose , raffinose , sucrose and / or glucose . preferably the amino acids are chosen among those that are acceptable for injection , highly soluble and solid at a temperature up to 45 ° c . like for example proline , cysteine , arginine , glutamine and / or glycine , and mixtures thereof . applicable proteins include , with out limitation , collagen , hyaluronic acid , fibronectin , gelatine , and / or agaroses , and mixtures thereof . the applicable polymers , include with out limitation , polyvinyl alcohols , polyvinylpyrrolidone and / or polyethylene glycols , and mixtures thereof . compatible solutes such as , with out limitation , glycine - betaine , ectoin , hydroxyectoin , can also be incorporated . moreover , the obstruction 102 , 202 or 302 can incorporate materials that result in an effervescent reaction when in contact with an aqueous media . examples of this , with out limitation , include sodium carbonates . other acceptable salts which are rapidly soluble and have the additional benefit of being efflorescent include , sodium sulphate , acetate trihydrate , tetraborate decahydrate ( borax ), bromoiridite dodecahydrate , carbonate heptahydrate metaperiodate trihydrate , metaphosphate hexahydrate , hydrogen orthophosphate dodecahydrate , sulphite heptahydrate , thiosulphate pentahydrate , calcium lactate , magnesium salicylate tetrahydrate , magnesium sulphate heptahydrate , and ammonium sulphate . the incorporation of the obstruction 102 , 202 or 302 in the hypodermic needle can be done by means of the incorporation of solutions of the soluble material and subsequent solidification by evaporation . the obstruction can also be incorporated by heating of the solid obstruction materials at temperatures in which they become malleable or liquid . the incorporation of a predetermined volume and subsequent cooling results in the fabrication of the desired soluble obstruction . other methods that permit the incorporation of a soluble obstruction include the incorporation of soluble membranes or puncture with the needle of a solid matrix that becomes incorporated at the needle end . the present invention is applicable , among others , to preloaded devices such as those represented in fig2 a - b . the incorporation of the obstruction 202 ensures that administration of the drug or vaccine 2004 contained in the reservoir 203 is only possible once the hypodermic needle has been injected and the obstruction 202 has dissolved in the receiving living tissues . one preferred realisation of the present invention incorporates devices preloaded with solutions or suspensions of the drug or vaccine in non aqueous liquids , such as , and with out limitation , oils or fluorocarbons . preferably the material that composes the obstruction 202 is not soluble in these non - aqueous liquids and therefore does not dissolve until the needle has penetrated the receiving living tissue . in another realisation represented in fig3 a - b , the hypodermic needle 301 that incorporates at its sharp - end the obstruction 302 , also incorporates a cartridge 305 that contains the drug or vaccine 306 stabilised in a solid format . administration of the drug or vaccine involves the assembly with an injector device 303 containing saline or water for injection 304 . injection of the hypodermic needle into living tissues results in the dissolution of the obstruction 302 permitting the flow of the water for injection 304 through the cartridge , and carry over of the dissolved drug or vaccine 306 . the hypodermic needles describes in the present invention incorporate at their sharp - end a soluble obstruction 102 , 202 or 302 which makes them functional only once they encounter an aqueous media such as a living tissue , as is illustrated , with out limitation , in the following three examples . injection of tetanus vaccine formulated as suspension in oil by means of a preloaded device incorporating a hypodermic needle with a soluble obstruction at its sharp - end the device represented in fig2 a - b was made to incorporate a soluble obstruction 202 of trehalose at the sharp - end of a 0 . 6 mm internal diameter stainless steel bevelled hypodermic needle 201 . for this , the sharp - end of the needle was dipped in a trehalose melt at about 100 ° c . cooling of the tip resulted in the formation of an obstruction 202 of solid amorphous trehalose glass . the needle incorporating the obstruction was assembled to a flexible pvc ampoule as injector device 203 . as a model drug or vaccine 204 , the ampoule contained 1 ml of a suspension in sesame seed oil of 1 - 10 μm trehalose particles containing stabilised tetanus vaccine . pressure of the final user on the pre - filled ampoule did not result in the ejection of any amount of the contained suspension . intramuscular injection of the needle in a guinea pig resulted in the immediate dissolution of the obstruction 202 and permitted the administration of the complete dose of the vaccine suspension by gentle pressure by the user over the ampoule . injection of a hepatitis b vaccine stabilised in a solid format in a cartridge located at the syringe end of a hypodermic needle incorporating a soluble obstruction at its sharp - end the device represented in fig3 a - b was manufactured to incorporate a soluble obstruction 303 of mannitol at the sharp end of a 0 . 3 mm internal diameter stainless steel bevelled hypodermic needle 201 . for this the sharp - end tip of the hypodermic needle was introduced in a 60 % mannitol solution in water at about 70 ° c . removal of the needle and cooling of the tip resulted in the formation of a solid obstruction with a mannitol crystal at the sharp - end of the needle . the needle carried at the syringe end a cartridge 305 containing as a model drug or vaccine 306 a hepatitis b vaccine stabilised in an amorphous water - soluble trehalose glass . prior to injection a conventional syringe 303 containing 1 ml of water for injection , was assembled to the hypodermic needle 301 . once assembled , pressure over the syringe 303 did not result in the ejection of any amount of liquid trough the syringe . subcutaneous injection of the needle into a guinea pig and gentle pressure over the syringe resulted in the immediate dissolution of the obstruction 302 permitting the flow of water for injection 304 through the cartridge 305 and administration of a full dose of the drug 306 . a hypodermic bevelled stainless steel needle , as for example in 101 , with an internal diameter of 0 . 8 mm was used to evaluate suitability of different materials to create the sharp - end obstruction 102 . the needles containing approximately 1 - 3 mm 3 volume of the different obstruction materials were assembled on to a syringe containing 1 ml sesame seed oil and injected into a set 3 % gelatine block at 25 ° c . as a model of a living tissue 103 . dissolution time was estimated from the time of injection . rapidly dissolving materials generally categorised as suitable needle - end obstruction materials (++++) while slower dissolving materials generally resulted in delayed injection and were categorised as less suitable obstructing materials (+).	0
hereinafter , preferred embodiments of the present invention will be described in greater detail with reference to the accompanying drawings . in the following description , same drawing reference numerals are used for the same elements even in different drawings . the matters defined in the description such as a detailed construction and elements are nothing but the ones provided to assist in a comprehensive understanding of the invention . thus , it is apparent that the present invention can be carried out without those defined matters . also , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . fig2 is a perspective view illustrating an led lighting device according to the first embodiment of the present invention . fig3 is an opened - up view of the lighting device of fig2 seen from the upper side thereof , and fig4 is a sectional view taken along line i - i in fig2 . as illustrated in fig2 to 4 , an led lighting device according to the first embodiment of the present invention includes an led 110 , a first lens 130 , and a second lens 150 . light irradiated from the led 110 is incident from the bottom surface side of the first lens 130 to the first lens 130 . for this , the led 110 may be provided on the lower surface side of the first lens 130 . here , the lower surface side of the first lens 130 may means just below the bottom surface of the first lens 130 . however , in the case where an accommodation groove 138 for accommodating the led 110 is formed on the bottom surface of the first lens 130 ( see fig4 ), it may mean the side of the accommodation groove 138 formed on the bottom surface of the first lens . on the other hand , the light incident to the first lens 130 through the lower surface side of the first lens 130 may be diffused to an outside of the first lens 130 through the first lens 130 . for this , the first lens 130 may be formed in a convex form as illustrated in fig4 . that is , as illustrated in fig4 , the first lens 130 may be formed to project in a convex form toward a light traveling path ( e . g . upward direction in fig4 ). by such a form of the first lens , the light incident to the first lens 130 may be refracted from the outer interface of the first lens 130 to the outside and diffused as it passes through the first lend 130 , and thus the light transfer range can be widened even if the led 110 is used as a light source of the lighting device . also , the length l 1 of the first lens 130 in a height direction may be set to be longer than the length l 2 of the first lens in a width direction . by forming the first lens 130 as described above , the thickness of the first lens 130 through which the light irradiated from the led 110 passes differs depending on the traveling path of the irradiated light , and thus the light irradiated from the led 110 can be emitted to an outside with uniform illumination . with reference to fig5 , the above described feature will be described in more detail . fig5 is a sectional view illustrating a traveling path of light incident from the led to the first lens and the quantity of light according to the traveling path . in the case of the led 110 , the quantity of light traveling vertically upward ( see fig5 ) is largest , and as the angle of the light traveling path becomes larger , the corresponding quantity of light becomes smaller ( see fig1 ). however , if the length l 1 of the first lens 130 , which surrounds the led 110 , in a height direction is set to be longer than the length l 2 of the first lens 130 in a width direction , the strongest light passes through the thickest part of the first lens 130 while the weakest light passes through the relatively thin part of the first lens 130 , resulting in that the strength of light according to the light traveling path can be corrected . accordingly , by forming the first lens 130 in the convex form toward the light traveling path ( i . e . upward direction in fig4 ) and setting the length l 1 of the first lens in the height direction to be longer than the length l 2 of the first lens in the width direction , the led 110 is changed from a point light source to a surface light source , and the light irradiated from the led 110 is emitted to an outside of the first lens 130 with the uniform quantity of light . however , the length of the first lens in the height direction may be limited depending on the size of the lighting device and soon , and in this case , the light traveling vertically upward still has illumination higher than that of the light traveling through other paths . accordingly , there is a need for a means capable of adjusting the quantity of light without lengthening the length of the first lens in the height direction any more ( such a means will be described later ). on the other hand , as illustrated in fig4 , the first lens 130 may include the first lens bottom surface 132 , the first lens side surface 134 , and the first lens upper surface 136 . the first lens bottom surface 132 is a surface to which the light irradiated from the led 110 is incident , and corresponds to the lower surface of the first lens 130 . on the first lens bottom surface 132 , an accommodation groove for accommodating the led 110 may be formed . the first lens side surface 134 extends upward from the first lens bottom surface 132 , and is configured in a manner such that the horizontal distance w between the first lens side surface 134 and a line c , which starts from the center part of the first lens bottom surface 132 and is orthogonal to the first lens bottom surface 132 , is decreased as it goes upward . the first lens 130 having the first lens side surface 134 may have a shape similar to a truncated cone . that is , the first lens 130 may be in the form of a body of revolution , of which the radius from the line c , which starts from the center part of the first lens bottom surface 132 and is orthogonal to the first lens bottom surface 132 , to the first lens side surface 134 is gradually decreased . accordingly , in the cross - section of the first lens 130 , one side surface may be in the form of an arc having a gentle slope . however , the shape of the first lens side surface 134 is not limited to the body of revolution , but any shape which can diffuse the light incident from the led , i . e ., which is configured in a manner such that the horizontal distance w between the line c and the first lens side surface 134 is decreased as it goes upward ( i . e . upward in fig4 ), can be adopted as the first lens side surface 134 . on the other hand , by adjusting the slope of the first lens side surface 134 ( e . g . gentle slope or steep slope ), the shape of the first lens side surface 134 , i . e ., the shape of one side surface of the first lens 130 ( typically , in the form of an arc ) can properly distribute the light diffused to the outside of the first lens 130 . at least a part of the light diffused as described above may be diffusedly reflected through a rough surface 152 of the second lens 150 provided on the outside of the first lens 130 . the rough surface may be formed through a blast process or surface process . the blast process is a process of roughening the surface of a material by spraying a grinding material in the form of small particles onto the surface of the material at high pressure . the blast process may be classified into sand blast using sand as the grinding material , grid blast using grid made of copper as the grinding material , and shot blast using special steel as the grinding material . by performing a proper blast process in accordance with the material of the second lens 150 , the rough surface 152 is formed on the inner surface of the second lens 150 . however , the forming of the rough surface 152 is not limited thereto , and the rough surface 152 may also be formed through a surface process such as an acid process . that is , the rough surface can also be obtained by corroding the inner surface of the second lens 150 through acid digests of the inner surface of the second lens 150 . such s rough surface 152 may be formed over the whole inner surface of the second lens 150 , or may be partially formed on a specified region . whether to form the rough surface 152 on the whole or partially may be determined in accordance with the degree of reflection required for the light diffused from the first lens 130 . if the partially formed rough surface 152 is sufficient for the diffused reflection of the light diffused from the first lens 130 , in consideration of the shape of the first lens 130 ( and the corresponding degree of light diffusion ) or the light traveling direction , the rough surface 152 may be formed only on a specified region of the inner surface of the second lens 150 . in accordance with the rough surface forming method , the rough surface 152 may have diverse cross - sections , and a regular or irregular shape cross - section may be repeatedly formed . for example , the rough surface 152 may be formed in the form of a plurality of fine protrusions projecting inside the second lens 150 . the fine protrusion 154 , as illustrated in fig4 , may in a triangular cross - section . however , the shape of the fine protrusion 154 is not limited thereto . for example , the fine protrusion 154 may be in a convex form toward the inside of the second lens 150 . referring to fig4 , the role of the rough surface 152 will be described . at least a part of the light diffused through the first lens 130 may be reflected in irregular directions by the fine protrusions 154 formed on the rough surface 152 . such reflection of the light may occur repeatedly , and as the light reflection occurs repeatedly , the light irradiated from the led 110 may be stereoscopic . the stereoscopic light may be emitted to an outside of the second lens . in addition , since the light irradiated from the led 110 should pass through both the first lens 130 and the second lens 150 , the cornea of the user &# 39 ; s eye may not be damaged even if a user directly sees the light irradiated from the led . on the other hand , in order to prevent the occurrence of a light loss during the reflection process , the led lighting device according to the present invention may further include a reflection plate ( not illustrated ). such a reflection plate may be provided on the upper surface of a lens connection part 160 that connects the first lens bottom surface 152 and the second lens 150 . even if the light reflected through the rough surface 152 travels in a direction where the light emission is not preferable , such as the rear surface of the lighting device and so on , the traveling light can be reflected again to the front surface by the reflection plate to minimize the light loss . the position of the reflection plate is not limited to the upper surface of the lens connection part 160 , but may be provided in a direction where the light emission is not preferable in accordance with the shape of the lighting device or the installation position of the lighting device . also , the reflection plate may be provided on the whole upper surface or only on a part of the lens connection part 160 . however , in the case where the light emission through the whole range of the lighting device including the rear surface of the lighting device is required , the reflection plate may not be provided . on the other hand , a part 156 of the second lens 150 corresponding to the first lens upper surface 136 may be formed to be depressed toward the first lens 130 . that is , as illustrated in fig4 , the part 156 of the second lens 150 corresponding to the first lens upper surface 136 may be formed to have a u - shaped cross - section . in this case , the lower surface of the second lens part 156 having the u - shaped cross - section may be formed to be thicker than the side surface of the second lens part 156 . by forming the second lens 150 in this manner , the light illumination becomes uniform when the light traveling vertically upward , which still has illumination higher than that of the light traveling through other paths after it passes through the first lens 130 , is finally emitted to an outside of the second lens 150 . in order to add an interior effect to the led lighting device according to the present invention , as illustrated in fig6 and 7 , scattering assistants 172 and 174 may be included in a space between the first lens 130 and the second lens 150 . fig6 and 7 are sectional views illustrating an led lighting device provided with scattering assistants in the space between the first lens and the second lens . the scattering assistants 172 and 174 may be transparent cubic or glass beads having a stereoscopic shape . however , the scattering assistant is not limited thereto , but may be fluid that can assist in light scattering . accordingly , the light diffused through the first lens 130 and the light reflected through the rough surface 152 of the second lens 150 may be scattered by the scattering assistants 172 and 174 , and thus the light finally emitted to the outside of the second lens 150 can provide superior interior effects . fig8 is a perspective view illustrating an led lighting device according to the second embodiment of the present invention . fig9 is an opened - up view of the lighting device of fig8 seen from the upper side thereof , and fig1 is a sectional view taken along line ii - ii in fig8 . as illustrated in fig8 to 10 , an led lighting device according to the second embodiment of the present invention includes an led 210 , a first lens 230 , and a second lens 250 . in the following description , the same ( or equivalent ) reference numerals are given to the same ( or equivalent ) parts as described above , and the detailed description thereof will be omitted . in the led lighting device according to the second embodiment of the present invention , four leds 210 are provided in circle . the leds 210 are arranged at the same interval around the center part of the lower surface of the first lens 230 . in the second embodiment of the present invention , accommodation grooves 238 for accommodating the respective leds 210 are formed on the lower surface of the first lens 230 . in the second embodiment of the present invention , the shape and the function of the first lens 230 and the second lens 250 are similar to those of the first lens 130 and the second lens 150 in the first embodiment of the present invention . however , in the case of the first lens 230 according to the second embodiment of the present invention , unlike the first lens 130 according to the first embodiment of the present invention , a hollow portion 239 is formed in a height direction in the center part of the first lens 230 . the shape of the hollow portion 239 is similar to the whole shape of the first lens 230 , and the horizontal distance between the edge of the hollow portion 239 and a line , which starts from the center part of the lower surface of the first lens 230 and is orthogonal to the lower surface of the first lens 230 , is decreased as it goes upward . if the hollow portion 239 is formed in the inside of the first lens 230 , the first lens 230 can be manufactured more easily . typically , the first lens 230 is formed by injection molding , and if the whole size of the first lens 230 is enlarged due to the use of several leds 210 , it may not be easy to manufacture the first lens 230 through injection molding . however , if the hollow portion 239 is formed in a height direction in the center part of the first lens 230 , problems occurring in manufacturing the large - sized first lens 230 can be removed . fig1 is a perspective view illustrating an led lighting device according to the third embodiment of the present invention . fig1 is an opened - up view of the lighting device of fig1 seen from the upper side thereof , and fig1 is a sectional view taken along line iii - iii in fig1 . as illustrated in fig1 to 13 , an led lighting device according to the third embodiment of the present invention includes an led 310 , a first lens 330 , and a second lens 350 . in the following description , the same ( or equivalent ) reference numerals are given to the same ( or equivalent ) parts as described above , and the detailed description thereof will be omitted . in the led lighting device according to the third embodiment of the present invention , six leds 310 are provided in circle . the leds 310 are arranged at the same interval around the center part of the lower surface of the first lens 330 . in the third embodiment of the present invention , the shape and the function of the first lens 330 and the second lens 350 are similar to those of the first lens 130 and the second lens 150 in the first embodiment of the present invention . however , according to the third embodiment of the present invention , unlike the first lens 130 and the second lens 150 according to the first embodiment of the present invention , the length of the first lens 330 in a height direction is set to be shorter than the length of the first lens 330 in a width direction . in the case of the second lens 350 , the part 356 of the second lens corresponding to the upper surface of the first lens 330 is formed to project toward the first lens 330 . the lighting device always has limitations in size and design . due to such limitations , the sufficient height of the first lens 330 may not be secured . in this case , by forming the second lens part 356 corresponding to the upper surface of the first lens 330 to project toward the first lens 330 , the illumination of the light irradiated from the leds 310 can be uniformly corrected . that is , by forming the corresponding part 356 to project toward the first lens 330 so that the second lens part 356 corresponding to the upper surface of the first lens 330 becomes thicker , the light , having passed through the first lens 330 vertically upward , should pass again through the second lens part 356 having a thickness thicker than other parts , and thus the whole light illumination can be uniformly corrected . although preferred embodiments of the present invention have been described for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .	5
in fig1 a television receiver having stereo / audio capability includes a demodulator 11 , a source selection switch 12 and a control means 13 , such as a microprocessor , all of which are standard in stereo capability television receivers and all of which are known in the art . for example , the demodulator 11 can be a nec part # upc 1870 ca chip , the source selection switch 12 can be a rca solid state div part # cd4052 and the microprocessor 13 can be a motorola part # 68hc05 . the demodulator 11 includes an audio input terminal 14 which receives the audio signal . output terminals 16 and 17 provide the demodulated left ( l ) and right ( r ) stereo / audio signal components to the source selection switch 12 via audio input terminals 18 and 19 and lines 40 and 41 respectively . the source selection switch 12 also includes auxiliary ( aux ) input terminals 21 and 22 which are used to provide input signals from auxiliary equipment , such as vcr &# 39 ; s and games . the audio output of the source selection switch 12 is provided on audio output terminals 23 and 23a . the source selection switch 12 includes a mute input terminal 24 and two auxiliary input terminals 25 and 26 . the controlling microprocessor 13 includes a channel change output 27 , an auxiliary 1 ( aux1 ) output terminal 28 , and an auxiliary 2 ( aux2 ) output terminal 29 , which are respectively coupled to the input terminals 24 , 25 and 26 of the source selection switch 12 by lines 30 , 31 and 32 respectively . the stereo demodulator 11 includes a mute input terminal 33 . the output lines 30 , 31 and 32 of the controlling microprocessor 13 are coupled to the mute input terminal 33 by voltage responsive electron control means 34 , 35 and 36 , respectively , which are diodes in this embodiment . in operation , the output terminals 27 , 28 , and 29 of the microprocessor 13 are normally low and the diodes 34 , 35 and 36 are nonconductive . in this condition the stereo demodulator 11 receives a stereo / audio input signal and provides the audio signal to the source selection switch 12 . when a viewer changes to a different channel , the channel change output terminal 27 of the microprocessor 13 goes high causing the diode 34 to become conductive and cause the mute input terminal 33 of the demodulator 11 to also go high and mute the demodulator during the channel change . the high on the channel change output terminal 27 is also provided to the mute input terminal 24 of the source selection switch to mute any audio which may be available because one of the auxiliary 1 or auxiliary 2 inputs is providing an input signal to the source selection switch 12 . the muting of the audio is used to prevent any popping sound which could otherwise occur during channel selection . the commands to the microprocessor 13 which result in any change to the status of the output terminals 27 , 28 and 29 are provided by a keyboard on the receiver and are initiated by the viewer when the viewer selects a particular channel , or one of the auxiliary inputs aux1 or aux2 . when either aux1 or aux2 is selected , the associated output terminal 28 or 29 goes high to render one of the diodes 35 or 36 conductive and cause the mute input terminal 33 of the demodulator 11 to go high and mute the demodulator and temporarily prevent stereo / audio from being provided by the output terminals 16 and 17 . the muting of the demodulator 11 therefore prevents crosstalk from the lines 40 and 41 , and the terminals 16 to 19 and all subsequent circuitry . in fig2 the demodulator 11 , source selection switch 12 and controlling microprocessor 13 are identical to those of fig1 as indicated by the like reference numbers . however , the voltage responsive electron control means 34 , 35 and 36 of fig1 are replaced by logic means 37 , which preferably is an or gate . the input terminals of the or gate 37 are coupled to the lines 30 , 31 and 32 whereby a high on either of the lines 31 , 30 or 32 causes the mute input terminal 33 of the demodulator 11 to go high and mute the demodulator in the same manner as in fig1 . it is noteworthy that some types of microprocessors may include internal electron control devices which can be used to replace the diodes 34 , 35 and 36 , or the or gate 37 , when the devices are not needed for other microprocessor functions .	7
fig1 and 2 disclose a switching element 1 for a valve train of an internal combustion engine . the switching element 1 is configured in this case as a roller tappet for a tappet push rod drive and comprises an outer part 2 having a bore 3 in which an axially movable inner element 4 extends . the inner element 4 and the outer part 2 are forced apart from each other by a lost motion spring 5 , not requiring further explanation here . in the illustrated axially separated position of the outer part 2 relative to the inner element 4 , the receptacles 6 , 7 thereof are aligned to each other . the receptacle 6 of the outer part 2 is manufactured as a circumferential annular groove . the receptacle 7 in the inner element 4 , in contrast , is designed as a radially extending through - bore . arranged herein are two diametrically opposite coupling means 8 , embodied here as pistons . the coupling means 8 are forced radially outwards ( coupling direction ) through the force of a compression spring 10 . in the radially inward direction i . e ., in the uncoupling direction , the coupling means 8 can be displaced by means of hydraulic medium . for this purpose , the outer part 2 appropriately has two oil passages 11 situated diametrically opposite each other ( see fig1 ). these passages 11 are configured in the present case as bores and offset by 90 ° to the coupling means 8 in the circumferential direction . in useful fashion , the oil passages 11 communicate with two hydraulic medium ducts from surrounding structure , not explained further here . a person skilled in the art will further see in the figures that means 13 for preventing rotation are provided on the outer peripheral surface 12 of the outer part 2 . these means 13 are designed here as opposite flattened portions . this measure proves to be necessary , firstly , in order to connect the oil passages 11 to their respective ducts and , secondly , in order to properly align a roller 14 with respect to a cam , not shown . it can be seen further that the inner element 4 is likewise secured against rotation relative to the outer part 2 . for this purpose , an anti - rotation device 15 ( embodied here as a pin ) is fixed in the outer part 2 and projects radially into the bore 3 of the outer part 2 . the inner element 4 , in turn , has a longitudinal recess 16 facing the anti - rotation device 15 on the flanks of which the anti - rotation device 15 is guided . the outer part 2 has , in a region distant from the bore , an annular groove 17 with a stop 18 . two retaining rings 19 , 20 are snapped into the annular groove 17 . these rings form a second and a first upper stop 21 , 22 , respectively . as a whole , the retaining rings 19 , 20 bear against the stop 18 . the second , lower retaining ring 19 serves as an anti - loss device of a pressure piston 23 of a hydraulic lash adjuster 24 that is installed in the inner element 4 . an adjustment of the coupling lash of the coupling means 8 in the surrounding receptacle 6 is achieved by means of the first retaining ring 20 that is situated on the second retaining ring 19 and is stocked in different thicknesses during assembly . it is clear that , after installation of the second retaining ring 19 , the pressure piston 23 together with the inner element 4 can no longer be pushed out of the bore 3 of the outer part 2 by the force of a compression spring 25 of the lash adjuster 24 or by the force of the lost motion spring 5 . the pressure piston 23 thus bears against the second retaining ring 19 through its edge 26 . before the coupling lash of the coupling means 8 relative to their receptacle 6 can be adjusted , it is necessary to determine this lash . this is done with the coupling means 8 extended . in doing so , to put it simply , after loading of the inner element 4 and hence its displacement in the bore 3 until a lower surface 27 of the receptacle 6 is reached , the free travel of the coupling means 8 in the receptacle 6 is measured . for a person skilled in the art it is then relatively simple to calculate , on the basis of the measured free travel , the height at which a central position of the coupling means 8 in the receptacle 6 is reached . when this value has been established , a first retaining ring 20 of appropriate thickness is snapped into the annular groove 17 directly above the second retaining ring 19 . the lost motion spring 5 thus presses the inner element 4 with its edge 28 against the second retaining ring 19 . in this position ( coupling position ), the adjustment of the coupling lash is completed , advantageously in such a manner that the coupling means 8 has an equally short traveling path in both axial directions within the receptacle 6 . to sum up , the free travel that the inner element 4 traverses relative to the outer part 2 , with the coupling means 8 in the receptacles 6 , after successful coupling with the outer part 2 and upon commencement of cam loading , is kept uniformly small by means of a series of switching elements 1 in internal combustion engines of the same type . excessive and undesirable variation in valve timings is precluded .	5
specificity is defined as the number of actually negative samples divided by the sum of the numbers of the actually negative and false positive samples . a specificity of 100 % means that a test recognizes all healthy persons as being healthy , i . e ., no healthy subject is identified as being ill . this says nothing about how reliably the test recognizes sick patients . sensitivity is defined as the number of actually positive samples divided by the sum of the numbers of the actually positive and false negative samples . a sensitivity of 100 % means that the test recognizes all sick persons . this says nothing about how reliably the test recognizes healthy patients . by the markers according to the invention , it is possible to achieve a specificity of at least 60 %, preferably at least 70 %, more preferably at least 80 %, even more preferably at least 90 % and most preferably at least 95 % for the stated disease for which a diagnosis is desired . by the markers according to the invention , it is possible to achieve a sensitivity of at least 60 %, preferably at least 70 %, more preferably at least 80 %, even more preferably at least 90 % and most preferably at least 95 % for the stated disease for which a diagnosis is desired . the migration time is determined by capillary electrophoresis ( ce ), for example , as set forth in the example under item 2 . in this example , a glass capillary of 90 cm in length and with an inner diameter ( id ) of 50 μm and an outer diameter ( od ) of 360 μm is operated at an applied voltage of 30 kv . as the mobile solvent , 30 % methanol , 0 . 5 % formic acid in water may be used , for example . in principle , higher formic acid contents , for example , 0 . 25 %, 0 . 5 %, 0 . 75 % or 1 %, may also be employed . it is known that the ce migration times may vary . nevertheless , the order in which the polypeptide markers are eluted is typically the same under the stated conditions for each ce system employed . in order to balance any differences in the migration time that may nevertheless occur , the system can be normalized using standards for which the migration times are exactly known . these standards may be , for example , the polypeptides stated in the examples ( see the examples ). the characterization of the polypeptides shown in the tables was determined by means of capillary electrophoresis - mass spectrometry ( ce - ms ), a method which has been described in detail , for example , by neuhoff et al . ( rapid communications in mass spectrometry , 2004 , vol . 20 , pages 149 - 156 ). the variation of the molecular masses between individual measurements or between different mass spectrometers is relatively small when the calibration is exact , typically within a range of ± 0 . 01 % or ± 0 . 005 %. the polypeptide markers according to the invention are proteins or peptides or degradation products of proteins or peptides . they may be chemically modified , for example , by posttranslational modifications , such as glycosylation , phosphorylation , alkylation or disulfide bridges , or by other reactions , for example , within the scope of degradation . in addition , the polypeptide markers may also be chemically altered , for example , oxidized , in the course of the purification of the samples . proceeding from the parameters that determine the polypeptide markers ( molecular weight and migration time ), it is possible to identify the sequence of the corresponding polypeptides by methods known in the prior art . “ diagnosis ” means the process of knowledge gaining by assigning symptoms or phenomena to a disease or injury . in the present case , the presence or absence of particular polypeptide markers is also used for differential diagnosis . the presence or absence of a polypeptide marker can be measured by any method known in the prior art . methods which may be used are exemplified below . a polypeptide marker is considered present if its measured value is at least as high as its threshold value . if the measured value is lower , then the polypeptide marker is considered absent . the threshold value can be determined either by the sensitivity of the measuring method ( detection limit ) or defined from experience . in the context of the present invention , the threshold value is considered to be exceeded preferably if the measured value of the sample for a certain molecular mass is at least twice as high as that of a blank sample ( for example , only buffer or solvent ). the polypeptide marker or markers is / are used in such a way that its / their presence or absence is measured , wherein the presence or absence is indicative of adpkd . thus , there are polypeptide markers which are typically present in patients with adpkd , but do not or less frequently occur in subjects with no adpkd . further , there are polypeptide markers which are present in subjects with adpkd , but do not or less frequently occur in subjects with no adpkd . in addition or also alternatively to the frequency markers ( determination of presence or absence ), amplitude markers may also be used for diagnosis . amplitude markers are used in such a way that the presence or absence is not critical , but the height of the signal ( the amplitude ) is decisive if the signal is present in both groups . in the tables , the mean amplitudes of the corresponding signals ( characterized by mass and migration time ) averaged over all samples measured are stated . to achieve comparability between differently concentrated samples or different measuring methods , two normalization methods are possible . in the first approach , all peptide signals of a sample are normalized to a total amplitude of 1 million counts . therefore , the respective mean amplitudes of the individual markers are stated as parts per million ( ppm ). in addition , it is possible to define further amplitude markers by an alternative normalization method : in this case , all peptide signals of one sample are scaled with a common normalization factor , as set forth , for example , in theodorescu et al . electrophoresis , 26 : 2797 - 808 ( 2005 ). thus , a linear regression is formed between the peptide amplitudes of the individual samples and the reference values of all known polypeptides . the slope of the regression line just corresponds to the relative concentration and is used as a normalization factor for this sample . all the groups employed consist of at least 20 individual patient or control samples in order to obtain a reliable mean amplitude . the decision for a diagnosis is made as a function of how high the amplitude of the respective polypeptide markers in the patient sample is in comparison with the mean amplitudes in the control groups or the “ ill ” group . if the value is in the vicinity of the mean amplitude of the “ ill ” group , the existence of adpkd is to be considered , and if it rather corresponds to the mean amplitudes of the control group , the non - existence of adpkd is to be considered . the distance from the mean amplitude can be interpreted as a probability of the sample &# 39 ; s belonging to a certain group . alternatively , the distance between the measured value and the mean amplitude may be considered a probability of the sample &# 39 ; s belonging to a certain group . a frequency marker is a variant of an amplitude marker in which the amplitude is low in some samples . it is possible to convert such frequency markers to amplitude markers by including the corresponding samples in which the marker is not found into the calculation of the amplitude with a very small amplitude , on the order of the detection limit . the subject from which the sample in which the presence or absence of one or more polypeptide markers is determined is derived may be any subject which is capable of suffering from adpkd . preferably , the subject is a mammal , and most preferably , it is a human . in a preferred embodiment of the invention , not just three polypeptide markers , but a larger combination of markers are used to enable differential diagnosis . by comparing a plurality of polypeptide markers , a bias in the overall result due to a few individual deviations from the typical presence probability in the individual can be reduced or avoided . the sample in which the presence or absence of the peptide marker or markers according to the invention is measured may be any sample which is obtained from the body of the subject . the sample is a sample which has a polypeptide composition suitable for providing information about the state of the subject . for example , it may be blood , urine , a synovial fluid , a tissue fluid , a body secretion , sweat , cerebrospinal fluid , lymph , intestinal , gastric or pancreatic juice , bile , lacrimal fluid , a tissue sample , sperm , vaginal fluid or a feces sample . preferably , it is a liquid sample . urine samples can be taken as preferred in the prior art . preferably , a midstream urine sample is used in the context of the present invention . for example , the urine sample may be taken by means of a catheter or also by means of a urination apparatus as described in wo 01 / 74275 . the presence or absence of a polypeptide marker in the sample may be determined by any method known in the prior art that is suitable for measuring polypeptide markers . such methods are known to the skilled person . in principle , the presence or absence of a polypeptide marker can be determined by direct methods , such as mass spectrometry , or indirect methods , for example , by means of ligands . if required or desirable , the sample from the subject , for example , the urine sample , may be pretreated by any suitable means and , for example , purified or separated before the presence or absence of the polypeptide marker or markers is measured . the treatment may comprise , for example , purification , separation , dilution or concentration . the methods may be , for example , centrifugation , filtration , ultrafiltration , dialysis , precipitation or chromatographic methods , such as affinity separation or separation by means of ion - exchange chromatography , or electrophoretic separation . particular examples thereof are gel electrophoresis , two - dimensional polyacrylamide gel electrophoresis ( 2d - page ), capillary electrophoresis , metal affinity chromatography , immobilized metal affinity chromatography ( imac ), lectin - based affinity chromatography , liquid chromatography , high - performance liquid chromatography ( hplc ), normal and reverse - phase hplc , cation - exchange chromatography and selective binding to surfaces . all these methods are well known to the skilled person , and the skilled person will be able to select the method as a function of the sample employed and the method for determining the presence or absence of the polypeptide marker or markers . in one embodiment of the invention , the sample , before being measured is separated by capillary electrophoresis , purified by ultracentrifugation and / or divided by ultrafiltration into fractions which contain polypeptide markers of a particular molecular size . preferably , a mass - spectrometric method is used to determine the presence or absence of a polypeptide marker , wherein a purification or separation of the sample may be performed upstream from such method . as compared to the currently employed methods , mass - spectrometric analysis has the advantage that the concentration of many (& gt ; 100 ) polypeptides of a sample can be determined by a single analysis . any type of mass spectrometer may be employed . by means of mass spectrometry , it is possible to measure 10 fmol of a polypeptide marker , i . e ., 0 . 1 ng of a 10 kd protein , as a matter of routine with a measuring accuracy of about ± 0 . 01 % in a complex mixture . in mass spectrometers , an ion - forming unit is coupled with a suitable analytic device . for example , electrospray - ionization ( esi ) interfaces are mostly used to measure ions in liquid samples , whereas maldi ( matrix - assisted laser desorption / ionization ) technique is used for measuring ions from a sample crystallized in a matrix . to analyze the ions formed , quadrupoles , ion traps or time - of - flight ( tof ) analyzers may be used , for example . in electrospray ionization ( esi ), the molecules present in solution are atomized , inter alia , under the influence of high voltage ( e . g ., 1 - 8 kv ), which forms charged droplets that become smaller from the evaporation of the solvent . finally , so - called coulomb explosions result in the formation of free ions , which can then be analyzed and detected . in the analysis of the ions by means of tof , a particular acceleration voltage is applied which confers an equal amount of kinetic energy to the ions . thereafter , the time that the respective ions take to travel a particular drifting distance through the flying tube is measured very accurately . since with equal amounts of kinetic energy , the velocity of the ions depends on their mass , the latter can thus be determined . tof analyzers have a very high scanning speed and reach a very good resolution . preferred methods for the determination of the presence or absence of polypeptide markers include gas - phase ion spectrometry , such as laser desorption / ionization mass spectrometry , maldi - tof ms , seldi - tof ms ( surface - enhanced laser desorption / ionization ), lc ms ( liquid chromatography / mass spectrometry ), 2d - page / ms and capillary electrophoresis - mass spectrometry ( ce - ms ). all the methods mentioned are known to the skilled person . a particularly preferred method is ce - ms , in which capillary electrophoresis is coupled with mass spectrometry . this method has been described in some detail , for example , in the german patent application de 10021737 , in kaiser et al . ( j . chromatogr a , 2003 , vol . 1013 : 157 - 171 , and electrophoresis , 2004 , 25 : 2044 - 2055 ) and in wittke et al . ( j . chromatogr . a , 2003 , 1013 : 173 - 181 ). the ce - ms technology allows to determine the presence of some hundreds of polypeptide markers of a sample simultaneously within a short time and in a small volume with high sensitivity . after a sample has been measured , a pattern of the measured polypeptide markers is prepared , and this pattern can be compared with reference patterns of sick or healthy subjects . in most cases , it is sufficient to use a limited number of polypeptide markers for the diagnosis of uas . a ce - ms method which includes ce coupled on - line to an esi - tof ms is further preferred . for ce - ms , the use of volatile solvents is preferred , and it is best to work under essentially salt - free conditions . examples of suitable solvents include acetonitrile , methanol and the like . the solvents can be diluted with water or an acid ( e . g ., 0 . 1 % to 1 % formic acid ) in order to protonate the analyte , preferably the polypeptides . by means of capillary electrophoresis , it is possible to separate molecules by their charge and size . neutral particles will migrate at the speed of the electroosmotic flow upon application of a current , while cations are accelerated towards the cathode , and anions are delayed . the advantage of capillaries in electrophoresis resides in the favorable ratio of surface to volume , which enables a good dissipation of the joule heat generated during the current flow . this in turn allows high voltages ( usually up to 30 kv ) to be applied and thus a high separating performance and short times of analysis . in capillary electrophoresis , silica glass capillaries having inner diameters of typically from 50 to 75 μm are usually employed . the lengths employed are 30 - 100 cm . in addition , the capillaries are usually made of plastic - coated silica glass . the capillaries may be either untreated , i . e ., expose their hydrophilic groups on the interior surface , or coated on the interior surface . a hydrophobic coating may be used to improve the resolution . in addition to the voltage , a pressure may also be applied , which typically is within a range of from 0 to 1 psi . the pressure may also be applied only during the separation or altered meanwhile . in a preferred method for measuring polypeptide markers , the markers of the sample are separated by capillary electrophoresis , then directly ionized and transferred on - line into a coupled mass spectrometer for detection . in the method according to the invention , it is advantageous to use several polypeptide markers for the diagnosis . the use of at least 5 , 6 , 8 or 10 markers is preferred . in order to determine the probability of the existence of a disease when several markers are used , statistic methods known to the skilled person may be used . for example , the random forests method described by weissinger et al . ( kidney int ., 2004 , 65 : 2426 - 2434 ) may be used by using a computer program such as s - plus , or the support vector machines as described in the same publication . another possibility is the linear combination of individual signals as described , for example , in rossing et al ., 3 μm soc nephrol . ( 2008 ) 19 ( 7 ): 1283 - 90 . fig1 shows the summed - up data from urine samples from control patients and adpkd patients . fig2 shows the “ receiver operating characteristic ” curves for the training and the test set . for detecting the polypeptide markers for the diagnosis , urine was employed . urine was collected from healthy donors ( control group ), from patients suffering from a chronic kidney disease or a renal or bladder carcinoma (“ diseases control ”) as well as from patients suffering from adpkd . for the subsequent ce - ms measurement , the proteins which are also contained in the urine of patients in an elevated concentration , such as albumin and immunoglobulins , had to be separated off by ultrafiltration . thus , 700 μl of urine was collected and admixed with 700 μl of filtration buffer ( 2 m urea , 10 mm ammonia , 0 . 02 % sds ). this 1 . 4 ml of sample volume was ultrafiltrated ( 20 kda , sartorius , göttingen , germany ). the ultrafiltration was performed at 3000 rpm in a centrifuge until 1 . 1 ml of ultrafiltrate was obtained . the 1 . 1 ml of filtrate obtained was then applied to a pd 10 column ( amersham bioscience , uppsala , sweden ) and desalted against 2 . 5 ml of 0 . 01 % nh 4 oh , and lyophilized . for the ce - ms measurement , the polypeptides were then resuspended with 20 μl of water ( hplc grade , merck ). the ce - ms measurements were performed with a beckman coulter capillary electrophoresis system ( p / ace mdq system ; beckman coulter inc ., fullerton , calif ., usa ) and a bruker esi - tof mass spectrometer ( micro - tof ms , bruker daltonik , bremen , germany ). the ce capillaries were supplied by beckman coulter and had an id / od of 50 / 360 μm and a length of 90 cm . the mobile phase for the ce separation consisted of 20 % acetonitrile and 0 . 25 % formic acid in water . for the “ sheath flow ” on the ms , 30 % isopropanol with 0 . 5 % formic acid was used , here at a flow rate of 2 μl / min . the coupling of ce and ms was realized by a ce - esi - ms sprayer kit ( agilent technologies , waldbronn , germany ). for injecting the sample , a pressure of from 1 to a maximum of 6 psi was applied , and the duration of the injection was 99 seconds . with these parameters , about 150 nl of the sample was injected into the capillary , which corresponds to about 10 % of the capillary volume . a stacking technique was used to concentrate the sample in the capillary . thus , before the sample was injected , a 1 m nh 3 solution was injected for 7 seconds ( at 1 psi ), and after the sample was injected , a 2 m formic acid solution was injected for 5 seconds . when the separation voltage ( 30 kv ) was applied , the analytes were automatically concentrated between these solutions . the subsequent ce separation was performed with a pressure method : 40 minutes at 0 psi , then 0 . 1 psi for 2 min , 0 . 2 psi for 2 min , 0 . 3 psi for 2 min , 0 . 4 psi for 2 min , and finally 0 . 5 psi for 17 min . the total duration of a separation run was thus 65 minutes . in order to obtain as good a signal intensity as possible on the side of the ms , the nebulizer gas was turned to the lowest possible value . the voltage applied to the spray needle for generating the electrospray was 3700 - 4100 v . the remaining settings at the mass spectrometer were optimized for peptide detection according to the manufacturer &# 39 ; s instructions . the spectra were recorded over a mass range of m / z 400 to m / z 3000 and accumulated every 3 seconds . for checking and standardizing the ce measurement , the following proteins or polypeptides which are characterized by the stated ce migration times under the chosen conditions were employed : the proteins / polypeptides were employed at a concentration of 10 pmol / μl each in water . “ rev ”, “ elm , “ kincon ” and “ givly ” are synthetic peptides . in principle , it is known to the skilled person that slight variations of the migration times may occur in separations by capillary electrophoresis . however , under the conditions described , the order of migration will not change . for the skilled person who knows the stated masses and ce times , it is possible without difficulty to assign their own measurements to the polypeptide markers according to the invention . for example , they may proceed as follows : at first , they select one of the polypeptides found in their measurement ( peptide 1 ) and try to find one or more identical masses within a time slot of the stated ce time ( for example , ± 5 min ). if only one identical mass is found within this interval , the assignment is completed . if several matching masses are found , a decision about the assignment is still to be made . thus , another peptide ( peptide 2 ) from the measurement is selected , and it is tried to identify an appropriate polypeptide marker , again taking a corresponding time slot into account . again , if several markers can be found with a corresponding mass , the most probable assignment is that in which there is a substantially linear relationship between the shift for peptide 1 and that for peptide 2 . depending on the complexity of the assignment problem , it suggests itself to the skilled person to optionally use further proteins from their sample for assignment , for example , ten proteins . typically , the migration times are either extended or shortened by particular absolute values , or compressions or expansions of the whole course occur . however , comigrating peptides will also comigrate under such conditions . in addition , the skilled person can make use of the migration patterns described by zuerbig et al . in electrophoresis 27 ( 2006 ), pp . 2111 - 2125 . if they plot their measurement in the form of m / z versus migration time by means of a simple diagram ( e . g ., with ms excel ), the line patterns described also become visible . now , a simple assignment of the individual polypeptides is possible by counting the lines . other approaches of assignment are also possible . basically , the skilled person could also use the peptides mentioned above as internal standards for assigning their ce measurements . urine samples from 17 patients with adpkd were first compared with 86 samples from control patients rated to be healthy . the summed - up data are shown in fig1 . the identification of 383 biomarkers that show statistically significant differences between the groups was achieved . in a test model for evaluation , a discrimination could be achieved with 100 % sensitivity and 98 . 8 % specificity . to evaluate the markers , 150 further samples were examined and tested with the established model . the sensitivity was 87 . 5 %, and the specificity was 97 . 5 %. fig2 shows the roc curves for the training and test sets . in order to test the specificity of the biomarkers for adpkd , further controls were included . a specificity of 93 % was found with healthy controls , a 95 % specificity was found for patients with other chronic kidney diseases , 85 % specificity for bladder cancer , and 83 % specificity for kidney tumors . in addition , a group of healthy subjects of & gt ; 60 years of age was included . in this case , a specificity of only 69 % was found . for some of the 383 potential biomarkers , it was possible to establish sequence information . in an analysis that was based only on the 75 sequenced peptides , a sensitivity of 100 % and a specificity of 95 . 5 % were found in the training set . upon cross - validation , a sensitivity of 94 . 1 % and a specificity of 94 . 2 % were obtained . this model was again tested against a test set . the sensitivity was 66 . 7 %, and the specificity was 99 . 1 %. it is found that the additional biomarkers not yet sequenced further increase the performance of the diagnostic method . however , 75 biomarkers already showed an auc of 0 . 89 and are thus excellently suitable .	6
fig1 illustrates from the side a portion of a helical twisted stem internal finishing tool , indicated generally at 20 . rectangular sections of elongate abrasive strip 21 are stacked on top of each other and aligned with the longitudinal axis of cotter pin 22 with the ends of the strips positioned in the bight 23 of cotter pin 22 . transverse offset slits 24 are formed in the lateral edges of the abrasive strips to form rectangular fingers 25 . the cotter pin 22 is twisted about its longitudinal axis to form a helical seam 28 from which extend the offset abrasive rectangular fingers 25 in a continuous uniform helical pattern along the length of the abrasive strip 21 . the end portion 29 of cotter pin 22 serves as the tool stem which may , for example , be inserted directly into and gripped by the chuck or collet of a drilling or finishing machine for powered rotation of the tool about the axis of the stem . the number of times the cotter pin is twisted or rotated about its longitudinal axis determines the helix angle in which the abrasive fingers 25 are arranged and may vary the resultant abrasive and finishing characteristics of the tool . fig2 is a plan view of a section of abrasive strip , indicated generally at 35 , illustrating the generally rectangular shape of the strip when cut to the desired length . the width 36 of the strip is generally fixed as a function of the extrusion process by which the strip is manufactured , although strips could be slit to narrower widths . the length 37 of the section of strip may be selected to create tools of varying axial length . the strips may be made of nylon , aramids or polyester . a preferred embodiment is 6 / 12 nylon which has excellent resistant to oils and greases , superior performance against repeated impact abrasion and fatigue , a low coefficient of friction , high tensile strength , and toughness . useful mechanical properties of nylon include strength , stiffness and toughness . also , the composition of the nylon polymer chain may be adjusted to achieve the desired stiffness , tensile strength , and melting point . some of the desirable nylon variations include : ( a ) nylon 6 / 6 synthesized from hexamethyl enediamine ( hmd ) and adipic acid ; nylons used in the present invention have a young &# 39 ; s modulus greater than 0 . 05 , preferably greater than 0 . 1 , and preferably greater than 0 . 2 . physical properties of the preferred nylon 6 / 12 include a melting point of 212 degrees c ., a dry yield strength at 10 3 psi of 8 . 8 ( 7 . 4 at 50 % rh ), and a dry flexural modulus of 295 ( 180 at 50 % rh ). nylon has a tensile strength of greater than 8 , 000 psi , and exhibits 250 % breakage during elongation . another type of polyamide useful in the production of the strips in the present invention includes aramids , defined as a manufactured fiber in which at least 85 % of the amide (-- c ( o )-- n ( h )--) linkages are attached directly to two aromatic hydrocarbon rings . this is distinguished from nylon which has a less than 85 % of the amide linkages attached directly to aromatic rings . aramid fibers have high tensile strength and high modulus . two preferred forms of aramids useful in the present invention include fiber formed from the polymerization of p - phenylenediamine with terephthaloyl chloride . these forms of aramids possess improved stiffness characteristics , strong resistance to solvents , and tensile strengths at 250 degrees c . comparable to textile fibers at room temperature . some thermal set polymers are also useful in the present invention . these include polyesters of long chain synthetic polymers with at least 85 % of dihydric alcohol ester ( horoh ) and terephthalic acid ( p - hoocc 6 h 4 cooh ). polyesters are also resistant to solvent and demonstrate breaking elongation of 19 - 40 %. the abrasive material embedded in the strip substrate may vary widely in amount , type and granular or grit size . for example , the abrasive material may range from aluminum oxide and silicon carbide to the more exotic polycrystalline diamond or cubic boron nitride . the amount of abrasive material distributed homogeneously throughout each strip may range up to about 30 to 45 % by weight of the strip . fig3 is an end view of the same section of abrasive strip as shown in fig2 illustrating the thickness 38 of the strip relative to its width 36 and length 37 . a preferred width to thickness ratio is about 30 : 1 , or about 3 cm to 1 mm . thicker strips may be used to create stiff abrasive fingers for heavy duty applications . tape thicknesses can vary from about 0 . 010 inches ( 0 . 254 mm ) to about 0 . 060 inches ( 1 . 524 mm with incremental sizes in between . fig4 is a plan view of a section of abrasive strip in which transverse longitudinally offset slits 40 have been made in opposing lateral edges 41 and 42 . the slits 40 create a fixed series of evenly dimensioned abrasive fingers 43 , offset from the fingers on the opposite lateral edge of the strip by one - half the width of one finger , so that each slit is laterally opposite the midpoint between the opposite edge . the abrasive fingers 43 have a simple rectangular shape with selected widths ranging from , for example , about 0 . 050 inches ( 1 . 27 mm ) to about 0 . 090 inches ( 2 . 286 mm ). this slit pattern is suitable for general internal deburring , edge radiusing , brush honing , and surface texturing . wider slit patterns for larger heavy duty work may have widths ranging from about 0 . 090 ( 2 . 286 mm ) to about 0 . 250 inches ( 6 . 35 mm ). a central unslit longitudinal portion of the strip 44 provides an uninterrupted surface upon which a cotter pin may be clamped to securely hold the strip . it should be noted that the strip remains in one piece after the longitudinal transverse slits are made . each abrasive finger 43 is permanently attached to central potion 44 and the relative position of each finger on the strip is fixed . thus a large number of loose filaments are avoided . fig5 is a cross - section of the section of abrasive strip as shown in fig4 . dotted lines 45 indicate the depth to which the transverse slits extend into the cross section of the strip . portion 46 represents the length of the abrasive fingers extending from the longitudinal central unslit portion 44 of the strip . fig6 is an end view of an assemblage of four stacked sections of identical abrasive strip which create finishing face 50 formed by adjacent tips 51 of abrasive fingers 43 . cotter pin 53 is shown from the end opposite the bight , clamping the assemblage of abrasive strip sections about the central longitudinal unslit portion 44 . as can be seen from fig6 the unslit portion is about the same width as the pin and is normally obscured by the pin . the number of strips stacked may vary , with the thickness of each strip no greater than about 0 . 060 inches ( 1 . 524 mm ) with an overall stack height of about 0 . 500 inches ( 12 . 7 mm ), depending on the size of the tool being made . fig7 is a side elevation of a cotter pin 60 having a bight 61 and a separable end portion 62 . each leg of the pin has the half - round sections seen in fig6 . fig8 is a side elevation of the cotter pin as shown in fig7 with at least one transversely slit abrasive strip 65 aligned with the longitudinal axis of the cotter pin with an end 66 of the strip positioned in the bight 61 of the cotter pin . abrasive fingers 43 extend normal to the longitudinal axis of the cotter pin and are longitudinally offset . twisting of the stem will produce the tool of fig1 with the fingers arranged in a uniform helical pattern and firmly gripped . fig9 is a plan view of a section of abrasive strip having an alternating transverse slit pattern wherein two closely spaced slits 70 and 71 form a very narrow abrasive finger 72 having a width of , for example , 0 . 090 inches ( 0 . 2286 mm ). the pair of closely spaced slits 70 and 71 are then repeated but at an extended distance along the lateral edge of the strip thereby creating abrasive finger 73 of greater relative width to finger 72 , such as , for example , 0 . 250 inches ( 6 . 35 mm ). the alternating pattern of wide and narrow abrasive fingers produces a tool particularly suited for some applications . it will also be noted that the closely spaced pairs of slits in lateral edge 74 are offset from those in lateral edge 75 to achieve continuous uninterrupted abrasive action of fingers of alternating size against the work piece . the offset again achieves the uniform helical array . fig1 is a plan view of a section of abrasive strip having diagonal transverse offset slits 80 in lateral edges 81 and 82 . this embodiment of the strip portion of the tool is suited , for example , for self - threading the tool into , for instance , a threaded hole for the purpose of deburring such threads and cleaning the work piece . the angle of the slits may be selectively varied for application to threads of different size and pitch . again the opposite side offset provides a uniform helical array . fig1 is a plan view of a section of an abrasive strip having alternating diagonal slits 85 and 86 in lateral edges 87 and 88 . slits 85 and 86 are also offset so that diagonal slits 85 , which slant from left to right as seen in such figure do not align transversely with the left to fight slits in the opposite lateral edge of the strip . diagonal slits 86 slanted from right to left are similarly offset . this alternating diagonal pattern produces along the lateral edge of the strip a wide angle abrasive finger 89 immediately adjacent a narrowing abrasive finger 90 . this pattern provides abrasive fingers of increased flexibility and is suitable for heavy duty work and application to smaller holes or bores . although the invention has been shown and described with respect to several preferred embodiments , it is obvious that equivalent alterations and modifications , particularly to the slit patterns in the abrasive strip and the helix angle in the tool stem , will occur to those skilled in the art upon reading and understanding this specification . the present invention includes all such equivalent alterations and modifications , and is limited only by the scope of the claims .	1
in the figure reference numeral 1 denotes an aerial by which a television signal can be received . this signal is applied to a signal section 2 in which it is amplified and processed for application in known way of the relevant signals to a picture display tube and a loudspeaker ( not shown ), respectively . a video signal is applied to a synchronization separation stage 3 at the output of which a composite synchronizing signal is present . this signal includes line synchronizing pulses having the line repetition frequency , i . e . for example , 15 , 625 or 15 , 750 hz which are applied to an input terminal of an and gate 4 . the output signal of gate 4 is applied to a first phase discriminator 5 , implemented as a controllable switch , whose output terminal is connected via a resistor 6 to a smoothing network 7 forming with resistor 6 a first low - pass filter . the line synchronizing signal is also applied to an input terminal of an and gate 8 the output signal of which is applied to a second phase discriminator 9 , also implemented as a controllable switch , whose output terminal is connected via a resistor 10 to network 7 forming therewith a modified ( second ) low - pass filter . the voltage produced in operation at network 7 is supplied to a voltage controlled line oscillator 11 for adjusting the frequency and / or phase thereof . oscillator 11 generates in the nominal case a sawtooth shaped signal having a frequency which is twice the line frequency . the sawtooth signal is applied to a pulse generator 12 by means of which it is converted into a pulse shaped signal whose leading edge occurs simultaneously with the rising edge of the sawtooth while the instant of occurrence of the trailing edge of the pulse is dependent on a voltage applied to generator 12 and generated in a manner still to be explained . the signal of generator 12 is applied to a frequency divider circuit 13 in which its frequency is divided by two and whose output signals therefore have the line frequency . one of the output signals of divider circuit 13 is applied as a reference signal to both switches 5 and 9 while another output signal of divider circuit 13 is applied to a driver and line output stage 14 . stage 14 supplies a line frequency current to the deflection coil , not shown , for the horizontal deflection in the picture display tube . line flyback pulses present in output stage 14 , for example across a winding of a transformer thereof are applied to an input terminal of an and gate 15 another input terminal of which is connected to the output terminal of divider circuit 13 supplying the reference signal . the output terminal of gate 15 is connected to an input terminal of an or gate 16 whose output terminal is connected to an input terminal of gate 4 and to a controllable switch 17 . a pulse generator 18 converts the signal of oscillator 11 into a pulse shaped signal having the line frequency and whose leading edge occurs simultaneously with a corresponding leading edge of the oscillator signal while the trailing edge occurs at an instant depending on a voltage applied to generator 18 . the pulse signal produced by generator 18 is applied to another input terminal of gate 16 . switch 17 is a phase discriminator , it also being supplied with the reference signal from the relevant output terminal of divider circuit 13 and its output voltage is smoothed by a low - pass filter 19 which yields the voltage applied to pulse generator 12 and referred to above . the line synchronizing and deflection circuit arrangement described so far has been described in greater detail in our u . s . pat . no . 4 , 228 , 642 with , however , the exception of parts 8 , 9 and 10 . the circuit arrangement will be seen to include two control loops , with the result that the signal produced at the output terminal of gate 16 and applied to gate 4 includes a gate pulse for keying the line synchronizing pulses in such a way that phase discriminator 5 operates only during a small portion of the line period , the gate pulse being positioned in the steady state substantially symmetrically relative to an edge of the reference signal derived from the oscillator signal , while the adverse influence of phase variations occurring in output stage 14 and due to variations in the turn - off time of a switch comprised therein is substantially compensated for . to these ends the position of the leading edge of the gate pulse depends on this turn - off time whereas the position of the trailing edge depends on the voltage applied to generator 18 , which voltage may be adjusted , or alternatively derived from the control voltage applied to oscillator 11 . line flyback pulses originating from output stage 14 are also applied to an input terminal of a line coincidence detector 20 , another input terminal thereof being supplied with the line synchronizing pulses from stage 3 and the output terminal being connected to an input terminal of and gate 8 . the function and the operation of this part of the line synchronizing circuit arrangement have been described in a slightly different embodiment in our co - pending u . s . patent application 727 , 714 , now abandoned , u . s . pat . no . 4 , 214 , 260 and the corresponding published dutch patent application 751163 . when the synchronized condition of oscillator 11 has been attained only phase discriminator 5 is active . because resistor 6 has a relatively high value the sensitivity thereof is low and the time constant of the first low - pass filter is formed by resistor 6 and network 7 is long . the phase discriminator 5 supplies a relatively small current to the filter . it is furthermore keyed by the output pulse from and gate 4 . these two circumstances ensure good noise immunity but would bring about a poor pull - in performance . if , however , coincidence detector 20 detects a non - synchronized condition , the second phase discriminator 9 is activated by the output signal of and gate 8 . resistor 10 has a relatively low value so that phase discriminator 9 supplies a large current to the second low - pass filter formed by resistor 10 and network 7 and having a relatively short time constant . since and gate 8 does not receive gate pulses the operation of phase discriminator 9 is not keyed , that it is to say it operates during the whole line period . in these circumstances the loop again and hence the pull - in range is large and the control loop pulls in quickly , whereafter the limited range control by means of phase discriminator 5 only is brought into operation which is a keyed operation . the output signal from line oscillator 11 is also applied to a frequency divider circuit 21 in which its frequency is divided by a number equal to the number of lines per image , for example , 625 or 525 . when oscillator 11 has its nominal frequency after pulling - in in the frequency of the line synchronization circuit arrangement described above the frequency of the output signal of divider 21 is equal to the field frequency for the standard for which the television receiver is suitable , for example , 50 or 60 hz . it follows from the foregoing that this situation is reached quickly , i . e . after a time period generally shorter than one field period which is equal to 20 or 16 . 7 ms . the field synchronizing pulses contained in the composite synchronizing signal available at the output of the synchronization separation stage 3 are obtained in known manner by means of a field synchronization separation stage 22 . it has yet to be ensured that the field frequency pulses obtained by means of divider 21 have a correct phase relationship with respect to the separated field synchronizing pulses present at the output terminal of stage 22 . both divider pulses and field synchronizing pulses are to this end applied to a field coincidence stage 23 the output terminal of which is connected to a counter 24 . the output terminal of counter 24 is connected to an input terminal of an or gate 25 , another input terminal thereof being connected to the output terminal q of a mode selection circuit 26 . the field synchronizing pulses present at the output terminal of separation stage 22 are also applied to a field oscillator 27 , to an input terminal of an and gate 28 via a switch 32 controlled by the output signal from gate 25 and to an input terminal of circuit 26 . field oscillator 27 is a free - running oscillator with a natural frequency which is lower than the field frequency . it is continuously triggered by the received field synchronizing pulses , its signal having thus the frequency and the phase of these pulses . this signal is applied to one of the selector contacts of a controllable switch 29 , another selector contact thereof being connected to the output terminal of divider 21 while the master contact of switch 29 is connected to a field output stage 30 . stage 30 supplies a field frequency current to the deflection coil , not shown , for the vertical deflection in the picture display tube . it is apparent from the foregoing that either the divider pulses or the field oscillator pulses are applied as a control signal to field output stage 30 , depending on the position of switch 29 . the operation from the divider pulses is referred to above as the internal synchronization mode , whereas the operation from the field oscillator pulses is referred to as the external synchronization mode . the position of switch 29 is controlled therefore by the output signal from or gate 25 . the output signal from switch 29 is also applied to a pulse generator 31 having two output terminals one of which is connected to an input terminal of and gate 28 while the other is connected to an input terminal of circuit 26 . generator 31 can be triggered by the output signal from or gate 25 . the output terminal of and gate 28 is connected to the reset terminal r of divider 21 and to an input terminal of circuit 26 . finally , the output terminal of line coincidence detector 20 is connected to an input terminal of circuit 26 . the field synchronizing and deflection circuit arrangement including the parts denoted by the reference numerals from 21 to 32 is similar to the arrangement described in our patent specification ser . no . 1 , 445 , 456 with , however the exception of the above - mentioned connection between line coincidence detector 20 and mode selection circuit 26 which is not present in this published patent specification . the operation of the present arrangement without the above - mentioned connection is as follows : counter 24 counts the number of times that non - coincidence occurs between the pulses applied to coincidence stage 23 . if non - coincidence occurs for a predetermined number of times , for example 16 , after the in - phase condition has prevailed , counter 24 delivers a logic 1 to or gate 25 . mode selection circuit 26 which can assume two states corresponding to the two synchronization modes of operation is still in the state corresponding to the internal synchronization mode , its output being a logic 0 . in these circumstances , the output signal of or gate 25 is a logic 1 which sets switch 32 into conduction and switch 29 into the position by which the pulses produced by oscillator 27 are supplied to output stage 30 ( external synchronization ). pulse generator 31 generates two series of gating pulses both having a repetition rate equal to the field frequency divided by an integer , for example 16 , each pulse having a duration of approximately one field period . the output signal from or gate 25 is also applied to set generator 31 which therefore produces a first gating pulse and supplies it to and gate 28 . a synchronizing pulse occurs during the occurrence of the first gating pulse so that the output signal of and gate 28 becomes logic 1 and resets divider 21 while it sets mode selection circuit 26 into the state corresponding to the external synchronization mode of operation , the output signal thereof becoming logic 1 and hence that of or gate 25 remaining logic 1 . when the incoming television signal is a normal television transmission the in - phase condition remains unchanged within stage 23 during the subsequent field periods so that the output signal of counter 24 is logic 0 . after a given number of field periods , for example 16 , after the occurrence of the first gating pulse , a second gating pulse is produced by pulse generator 31 which pulse is applied to selection circuit 26 . coincidence of a divider pulse with a synchronizing pulse is established during the occurrence of the second gating pulse which sets mode selection circuit 26 into the state corresponding to the internal synchronization mode of operation , its output signal becoming logic 0 . the output signal of or gate 25 thus becomes logic 0 and drives switch 29 into the position by which the divider pulses originating from divider 21 are supplied to output stage 30 while switch 32 is opened so that the field synchronizing pulses are no longer applied to and gate 28 . neither these pulses nor the following first gating pulse from generator 31 applied to and gate 28 will thus have an influence on divider 21 . when the incoming television signal is not a normal television transmission signal a non - coincidence condition will be established by stage 23 and counter 24 during the occurrence of the second gating pulse . mode selection circuit 26 remains thus in the state corresponding to the external synchronization mode of operation and the state of gates 25 and 28 as well as that of switches 29 and 32 remains unchanged . during the occurrence of the following first gating pulse , however , the output signal of and gate 28 becomes logic 1 and resets divider 21 and a new cycle of 16 field periods begins after which it can be established whether the incoming signal is a normal signal or not . after switching the receiver on mode selection circuit 26 is in the state corresponding to the external synchronization mode of operation either immediately or after 16 field periods . its output signal and hence that of or gate 25 is a logic 1 . switch 32 conducts while the pulses produced by oscillator 27 are supplied via switch 29 to output stage 30 . generator 31 is triggered to produce a first gating pulse during the occurrence of which the output signal of and gate 28 is changed into logic 1 and resets divider 21 . a coincidence condition then occurs in stage 23 whereafter the arrangement is switched as above during the occurrence of the following second gating pulse into the internal synchronization mode of operation if the received television signal is a normal signal . if no field synchronizing pulses are available at the output terminal of separation stage 22 for some reason , for example , because of noise and / or interference , no coincidence will occur in stage 23 and a logic 1 will be applied to or gate 25 after a time delay determined by counter 24 with the result that the arrangement will be brought into the external synchronization mode of operation , divider 21 being reset during the occurrence of each first gating pulse . the arrangement is thus ready to operate normally in case the synchronizing pulses reappear , while field oscillator 27 oscillates freely at its natural frequency , causing the displayed image , if any , to &# 34 ; roll over &# 34 ; in the vertical direction as long as no synchronizing pulses are present . before the above - mentioned delay has been completed , however , the arrangement will stay in the state it assumed before the synchronizing pulses dropped out , i . e . the divider pulses will be applied to field output stage 30 if the arrangement operates in the internal synchronization mode . the same may happen as a consequence of a phase jump occurring in the field synchronization pulses , for example , after a channel change in the receiver or a camera switch over in the transmission studio , which will cause , as stated in the preamble , a horizontal black bar to be displayed on the screen of the picture tube until counter 24 delivers a logic 1 , which introduces the external synchronization mode of operation . the purpose of the connection between line coincidence detector 20 and mode selection circuit 26 is to shorten the delay referred to without adversely influencing the noise immunity properties offered thereby . during normal synchronized operation , line coincidence detector 20 does not apply a signal to and gate 8 or to mode selection circuit 26 . if , however , a phase jump occurs as stated above in the field synchronizing pulses sequence , it is clear that a similar jump will most probably also occur in the line synchronizing pulses . a non - coincidence condition is consequently detected by means of line coincidence detector 20 , which switches on the wide range phase discriminator 9 for readjusting the line synchronization circuit arrangement while a signal is applied to mode selection circuit 26 causing the output signal thereof to assume the value logic 1 irrespective of the phase difference existing in coincidence stage 23 . if at this time less than 16 consecutive noncoincidence conditions have been detected by means of field coincidence stage 23 and counter 24 the output signal of the counter 24 will be logic 0 . that of gate or 25 will nevertheless be logic 1 which causes the external synchronization mode of operation to be introduced and divider circuit 21 to be reset , while the gating pulses sequence is being started . after a relatively short time the line synchronization loop attains its synchronized condition in which line coincidence detector 20 detects coincidence which switched off the operation of the wide range control by means of phase discriminator 9 while no information is sent to mode selection circuit 26 which thus remains in its state corresponding to the external synchronization mode of operation . this situation remains unchanged until the occurrence of the following second gating pulse during which the decision will be taken as above whether the field synchronization circuit arrangement has to be switched to the internal mode of operation or not . it will be observed that after switching the receiver on i . e . in a situation in which neither synchronization circuit arrangement has yet attained the synchronized condition , mode selection circuit 26 has to be in the arrangement of the drawing in the state corresponding to the external synchronization mode of operation , i . e . its output signal is logic 1 . a command originating from line coincidence detector 20 as described above has therefore no influence on the field synchronization circuit arrangement . if during normal reception one or more field synchronizing pulses are lost , for example because they cannot be distinguished from noise , while the line synchronizing pulses are normally received and processed , then one or more non - coincidence conditions will be detected by stage 23 and counted by counter 24 without line coincidence detector 20 exerting an influence on this operation . it is apparent from the foregoing that the delay introduced by counter 24 which is necessary to obtain satisfactory noise immunity is maintained whereas it is substantially reduced whenever it would be detrimental . if the opposite situation occurs , i . e . if some line synchronizing pulses are missing while the reception of field synchronizing pulses are satisfactory , the frequency of line oscillator 11 and hence that of the divider pulses will change . the signal supplied to field output stage 30 will , however , have the proper field frequency because line coincidence detector 20 forces almost immediately the field synchronization circuit arrangement to operate in the external synchronization mode of operation . line coincidence detector 20 is not the only place in the line oscillator control circuit from which a command can be sent to mode selection circuit 26 with the purpose of reducing the delay introduced by counter 24 . when non - coincidence exists in coincidence detector 20 a large current is supplied to network 7 and causes a large ripple voltage to be present thereat . this voltage which is substantially reduced in the line in - phase condition can be used for the command referred to . the same can also be done in case the operation of the line oscillator control circuit is not keyed by gate pulses . one advantage of the connection to mode selection circuit 26 is that use is made of components in an existing integrated circuit , for example of the mullard type tda 2576 . it could be , however , be utilized in other arrangement , i . e . not comprising such a mode selection circuit . the connection from either line coincidence detector 20 or network 7 could , for example , be connected to switches 29 and 32 with a similar result . it will be evident that some of the features described in the foregoing are not essential for the invention . a line oscillator having the line frequency , for example , could be used for oscillator 11 , divider 21 the dividing by a number equal to 312 . 5 or 262 . 5 , respectively , or , alternatively , a multiplication by 2 being effected prior to the division by 625 or 525 , respectively . similarly , the free - running oscillator 27 could be included between switch 29 and field output stage 30 , this oscillator being then synchronized either by the received field synchronizing pulses or by the divider pulses through the switch 29 . such an arrangement is actually described in our patent specification ser . no . 1 , 445 , 456 referred to above in which , moreover , the divider is not immediately reset when the arrangement is switched to the external synchronization mode of operation , this being due to the fact that the pulse generator similar to generator 31 in the present application is not triggered by the output signal of the gate similar to the present or gate 25 . the drawing includes an embodiment of mode selection circuit 26 . an and gate 33 receives the second gating pulses generated by generator 31 , the separated field synchronizing pulses from stage 22 and the pulses originating from divider circuit 21 . the output terminal of gate 33 is connected to the reset terminal of a flipflop 34 whose q output terminal is connected to an input terminal of or gate 25 . the output signals of and gate 28 and line coincidence detector 20 are applied to respective input terminals of an or gate 35 whose output terminal is connected to the set terminal of flip - flop 34 . it will readily be recognized that circuit 26 realized in this way can fulfil the functions described , i . e ., it is reset ( q = 0 ) if the input signals of and gate 33 coincide and it is set ( q = 1 ) of either input signal of or gate 35 is present . line coincidence detector 20 is not described in detail since such devices are well known in the art . our patent specification ser . no . 1 , 512 , 045 shows a possible embodiment thereof .	7
as shown in fig1 a digital cross - connect system according to the present invention comprises three cross - connect devices 200 interconnected by a transmission path 30 for transmitting signals of high - level groups , and a network management system 100 for issuing a connection request signal which indicates input and output terminals and requests one - to - one and one - to - many branch connections , and a connection request signal which indicates rear - stage switch means and requests one - to - many branch connections . each of the cross - connect devices 200 comprises a multistage switch 220 for interconnecting desired input and output terminals and a switch control device 210 responsive to a one - to - many branch connection request signal for instructing front - stage switch means to effect one - to - one connections only and inhibit one - to - many branch connections and instructing indicated front - stage switch means to inhibit connections from input terminals other than an indicated one input terminal , with the result that the switch control device 210 can control connections in the multistage switch 220 under connection requests from the network management system 100 . in fig1 and 2 , the network management system 100 has means for outputting a branch connection request to branch and send an input signal to output terminals of one tertiary switch 223 of a three - stage switch 220 3 , and means for inhibiting other input signals from being sent to output terminals of the tertiary switch 223 . each of the switch control devices 210 comprises means for inhibiting a primary switch of the three - stage switch 220 3 from branching and sending input signals , means for controlling the three - stage switch 220 3 to branch and send input signals based on a branch connection request outputted from the network management system 100 , and means for returning error information in the event that the branch connection request is blocked and cannot be executed . operation of the digital cross - connect system will be described below with reference to fig3 which shows a specific embodiment . to interconnect one certain input terminal and one certain output terminal , three paths that are available in the illustrated arrangement are designated successively in the ascending order of the numbers of secondary switches . according to a conventional system , to interconnect an input terminal which is supplied with an input signal 300i 1 and an output terminal which outputs an output signal 300o 1 , a first secondary switch 222 1 is selected , a primary switch 221 1 sends an input signal 300i 1 inputted from its input terminal 1 through an output terminal 1 thereof to an input terminal 1 of the secondary switch 222 1 , which sends the supplied signal through its output terminal 1 to an input terminal 1 of a tertiary switch 223 1 . the tertiary switch 223 1 then outputs the signal as an output signal 300o 1 from its output terminal . to interconnect an input terminal which is supplied with an input signal 300i 2 and an output terminal which outputs an output signal 300o 2 , since the secondary switch 222 1 is being occupied , a second secondary switch 222 2 is selected and sends the signal in a similar manner . similarly , the secondary switch 222 1 is selected to interconnect an input terminal which is supplied with an input signal 300i 3 and an output terminal which outputs an output signal 300o 3 , and the secondary switch 222 2 is selected to interconnect an input terminal which is supplied with an input signal 300i 4 and an output terminal which outputs an output signal 300o 5 . if the connection between the input terminal which is supplied with the input signal 300i 3 and the output terminal which outputs the output signal 300o 3 through the secondary switch 222 1 is broken , and the input terminal which is supplied with the input signal 300i 3 and an output terminal which outputs an output signal 300o 6 are to be interconnected , a secondary switch 222 3 is selected . when the input terminal which is supplied with the input signal 300i 1 is to be connected to the output terminal which outputs the output signal 300o 2 as well as to the output terminal which outputs the output signal 300o 1 , such a branch connection is blocked because the secondary switch 222 1 and the tertiary switch 223 1 are in use . according to the digital cross - connect system of the present invention , output terminals to which branch connections are to be made are designated in advance . for example , the input terminal which is supplied with the input signal 300i 1 is branched and connected to the output terminals which output the output signals 300o 1 , 300o 2 , and the output terminal which outputs the output signal 300o 2 , being dedicated for a one - to - one connection , is not used . therefore , a circuit or a device which is connected to the input terminal which is supplied with the input signal 300i 2 is connected to an input terminal which is supplied with an input signal 300i 8 , and a device connected to the output terminal which outputs the output signal 300o 2 is connected to an output terminal which outputs an output signal 300o 8 . the input terminal which is supplied with the input signal 300i 1 is connected to the output terminal which outputs the output signal 300o 1 through the secondary switch 222 1 . the input terminal which is supplied with the input signal 300i 8 is connected to the output terminal which outputs the output signal 300o 8 through the secondary switch 222 1 . the input terminal which is supplied with the input signal 300i 3 is connected to the output terminal which outputs the output signal 300o 3 through the secondary switch 222 1 . the input terminal which is supplied with the input signal 300i 4 is connected to the output terminal which outputs the output signal 300o 5 through the secondary switch 222 2 . if the connection between the input terminal which is supplied with the input signal 300i 3 and the output terminal which outputs the output signal 300o 3 through the secondary switch 222 1 is broken , and the input terminal which is supplied with the input signal 300i 3 and the output terminal which outputs the output signal 300o 6 are to be interconnected , then they are connected through the secondary switch 222 3 . with such connections made , branch connections to be made next from the input terminal which is supplied with the input signal 300i 1 to the output terminals which output the output signals 300o 1 , 300o 2 will not be blocked . another embodiment in which a clos - type five - stage switch having a switch size 12 × 12 will be described below with reference to fig4 and 5 . in the five - stage switch , branch connections between primary and secondary switches are inhibited from being made . g &# 39 ;× g output terminals of a quintic switch connected to one quartic switch belong to a broadcast group , g output terminals of one quintic switch belong to a broadcast subgroup , and all c ( c is one of 2 through g ) output terminals bx ( x is one of 1 through c ) branched from a ( a is one of 1 through n ) input signals belong to one broadcast group . output terminals which do not belong to the output terminals bx are inhibited from being connected to the broadcast group to which the output terminals bx belong . in the arrangement shown in fig5 output terminals which output output signals 300o 1 ˜ 300o 12 are in six broadcast groups , with each range of the output terminals which output output signals 300o 1 ˜ 300o 4 , output signals 300o 5 ˜ 300o 8 , and output signals 300o 9 ˜ 300o 12 being in two broadcast subgroups . in the five - stage switch , nine paths are available for interconnecting one input terminal and one output terminal , and switch blocks and tertiary switches that are used to interconnect the terminals are selected which have the smallest possible numbers . for example , an input terminal which is supplied with an input signal 300i 1 is connected to an output terminal which outputs an output signal 300o 1 through a switch block 250 1 and a tertiary switch 223 1 . an input terminal which is supplied with an input signal 300i 2 is connected to an output terminal which outputs an output signal 300o 7 through a switch block 250 2 and the tertiary switch 223 1 . an input terminal which is supplied with an input signal 300i 3 is connected to an output terminal which outputs an output signal 300o 3 through the switch block 250 1 and a tertiary switch 223 2 . an input terminal which is supplied with an input signal 300i 4 is connected to an output terminal which outputs an output signal 300o 5 through the switch block 250 2 and the tertiary switch 223 2 . the connection between the input terminal which is supplied with the input signal 300i 2 and the output terminal which outputs the output signal 300o 7 through the switch block 250 2 and the tertiary switch 223 1 is broken , and the input terminal which is supplied with the input signal 300i 2 is connected to an output terminal which outputs an output signal 300o 6 through a switch block 250 3 and the tertiary switch 223 1 . in such a connection configuration , branch connections to be made next between the input terminal which is supplied with the input signal 300i 1 and an output terminal which outputs an output signal 300o 4 are blocked . in the embodiment shown in fig5 output terminals to which branch connections are to be made are designated in advance . for example , if the input terminal which is supplied with the input signal 300i 1 is branched and connected to the output terminals which output the output signals 300o 1 ˜ 300o 4 , then the input signal 300i 1 is sent to the output terminals which output the output signals 300o 1 , 300i 4 . the output terminal which outputs the output signal 300o 3 is not dedicated for a one - to - one connection because it belongs to a broadcast group . therefore , a device to be connected to the input terminal which is supplied with the input signal 300i 1 is connected to an input terminal which is supplied with an input signal 300i 8 , and a device to be connected to the output terminal which outputs the output signal 300o 3 is connected to an output terminal which outputs an output signal 300o 8 . in fig5 therefore , the input terminal which is supplied with the input signal 300i 1 is connected to the output terminal which outputs the output signal 300o 1 through the switch block 250 1 and the tertiary switch 223 1 . the input terminal which is supplied with the input signal 300i 2 is connected to the output terminal which outputs the output signal 300o 7 through the switch block 250 2 and the tertiary switch 223 1 . the input terminal which is supplied with the input signal 300i 8 is connected to the output terminal which outputs the output signal 300o 8 through the switch block 250 2 and the tertiary switch 223 2 . the input terminal which is supplied with the input signal 300i 4 is connected to the output terminal which outputs the output signal 300o 5 through the switch block 250 1 and the tertiary switch 223 2 . with such connections , when the connection between the input terminal which is supplied with the input signal 300i 2 and the output terminal which outputs the output signal 300o 7 through the switch block 250 2 and the tertiary switch 223 1 is broken , and the input terminal which is supplied with the input signal 300i 2 is connected to the output terminal which outputs the output signal 300o 6 through the switch block 250 3 and the tertiary switch 223 1 , the branch connections between input terminal which is supplied with the input signal 300i 1 and the output terminal which outputs the output signal 300o 4 are not broken . it is to be understood that variations and modifications of certain preferred embodiments disclosed herein will be evident to those skilled in the art . it is intended that all such modifications and variations be included within the scope of the appended claims .	7
referring now to the drawings , and more particularly to fig1 , shown therein is a schematic of one embodiment of the operation of the process in accordance with the present invention as described herein . a biological feedstock 101 and a citric acid solution 102 are fed into a contacting device 103 . the biological feedstock 101 is optionally pre - filtered before entering the contacting device 103 . the concentration of the citric acid solution 102 is from about 0 . 5 wt . % to about 20 wt . %, preferably from about 5 . 0 wt . % to about 15 wt . % ( mass citric acid per mass aqueous solution ). the volumetric ratio of biological feedstock to citric acid solution is from about 20 : 1 to about 2 : 1 , preferably from about 5 : 1 to about 15 : 1 . it should be understood by one of ordinary skill in the art that although a citric acid solution is disclosed as being utilized in the present process , any acid , such as phosphoric acid , sulfuric acid , hydrochloric acid , nitric acid , acetic acid or carbonic acid , may be used so long as the acid functions in accordance with the present invention as described herein . during pre - filtration and acid contacting , the temperature of the biological feedstock is maintained from about 140 ° f . to about 280 ° f . the contacting device 103 functions to contact the biological feedstock 101 with the citric acid solution 102 . it should be understood by one of ordinary skill in the art , that any device capable of producing intimate contacting between two immiscible phases may be used in the present invention . specific examples of contacting devices suitable for this application include mixing valve , static mixer , or roto - stator high shear mixer . stream 104 , the two phase effluent from the contacting device 103 , is fed to a liquid - liquid separator 105 . the geometry and size of the separator 105 allow for most of the small aqueous droplets formed in the contracting device 103 to coalesce and form larger droplets that separate from a washed biological feedstock stream 107 . the separator is sized to provide between about 5 to about 30 minutes hold up time for the fluid . preferred operating conditions for the separator are between about 140 ° f . and about 280 ° f . at pressures less than about 500 psig . an aqueous stream 106 from the separator 105 contains citric acid , metal cations , chloride anions , soluble citric acid metal complexes , and small amounts of insoluble complexes . the washed biological feedstock stream 107 contains very small water droplets and is fed into and processed through a coalescing filter 108 to achieve further separation of spent aqueous citric acid complexes . the coalescing filter operates at temperatures between about 140 ° f . and about 280 ° f . at pressures less than about 500 psig . the aqueous stream 109 is compositionally the same as stream 106 . although the filter 108 is utilized to further separate the spent aqueous citric acid complexes , it should be understood by one of ordinary skill in the art that the separation of the very small water droplets in the washed biological feedstock 107 may also be achieved by a centrifuge , an electrical grid or any other means known in the art used to separate liquids . spent aqueous streams 106 and 109 are optionally combined and sent to a citric acid reclamation unit ( not shown ) and / or partially recycled . the washed and water - separated biological feedstock stream 110 has a total metals and phosphorus content less than about 100 ppm , preferably less than about 50 ppm , and more preferably less than about 20 ppm . the metals include calcium , iron , potassium , magnesium , and sodium . the pretreated biological feedstock stream 110 is optionally transported to a surge drum ( not shown ) for pumping to a hydroconversion reactor system ( not shown ) which optionally includes a fixed - bed reactor for converting pretreated biological feedstock to hydrocarbons . although the pretreatment process as illustrated in fig1 is shown utilized for a single - stage continuous operation , it should be understood by one of ordinary skill in the art that the required mixing and liquid - liquid phase separation may also be conducted in batch cycles . one of ordinary skill in the art will further recognize that the continuous operation may employ a plurality of contactor - separator stages , with counter - current , cross - current , or co - current flow of the citric acid solution 102 . in order to further illustrate the present invention , the following examples are given . however , it is to be understood that the examples are for illustrative purposes only and are not to be construed as limiting the scope of the subject invention . upon ignition , the solubilized metals contained in biological feedstocks remain as ash . although ash may also contain other non - combustible inorganic matter , it is proportional to the level of metal contaminants in the biological feedstock . the process of measuring ash consists of ( 1 ) weighing about 100 g of homogenized biological feedstock by an analytical balance , ( 2 ) placing the biological feedstock in a tared crucible , ( 3 ) melting the contents of the crucible over a hot plate , ( 4 ) igniting the molten biological feedstock in the crucible in a hood using proper personal protection and associated safe practices , and ( 5 ) weighing the crucible . net weight of ash remaining in the crucible divided by weight of the biological feedstock placed therein gives the ash content . the ash analysis was conducted on biological feedstocks of various metals content . fig2 shows a graphical representation of the correlation between ash and total group i and group ii metals as analyzed by inductively coupled plasma ( icp ) atomic emission spectroscopy . four 100 cc tubular reactors were each loaded with 80 cc of a commercial nimo catalyst and 20 cc of 70 - 100 mesh glass beads . the nimo catalyst was sulfided with a dimethyl disulfide ( dmds ) solution under h 2 flow conditions . decomposition of dmds to hydrogen sulfide was confirmed by use for lead acetate before the reactor temperature was raised from the first hold temperature of about 400 ° f . to the final hold temperature of about 650 ° f . the total sulfiding cycle ( start to end of dmds solution flow ) was about 20 hrs . after a 48 hr catalyst break - in , a triglyceride feed with relatively high solublized metal contaminants , inedible tallow , was introduced to the reactor . the properties of the feedstock , including contaminant metals and ash ( non combustible inorganics ), are summarized in table 1 . the operating conditions for all four reactors were : 1 liquid hourly space velocity ( lhsv ), 10 , 000 scf / bbl gas - to - oil ratio ( gor ), 700 ° f ., and 1 , 200 psig . the waxy solid tallow feed was thus converted to a clear liquid . full conversion of tallow to hydrocarbons was confirmed with gas chromatography ( gc ). about twenty - four hours after start of the tallow feed , two of the four reactors experienced high pressure drop . this ultimately led to a drop in gas flow rate and conversion performance . the reactors of example 2 were reloaded with catalyst and sulfided using the same procedure as discussed in example 2 . one of the reactors contained the same grade of catalyst used in example 2 . after a catalyst break - in , a triglyceride feedstock with low contaminant content , partially hydrogenated soybean oil , was introduced to the reactor . as indicated by the ash values of table 1 , this feedstock had 97 . 5 % less contaminant than the triglyceride feedstock of example 2 . the hydrotreater reactors were operated under the same liquid and gas flow conditions as example 2 . complete conversion of feedstock to hydrocarbon product was confirmed by gc at all operating temperatures tested : 550 ° f ., 600 ° f ., 650 ° f ., 700 ° f ., and 750 ° f . the reactor system was operated for 50 days on the same feed without increase in pressure drop across any of the four reactors . a biological feedstock was prepared by blending waste fats and greases according to table 2 . table 3 contaminants present in the biological feedstock of examples 4 and 5 feedstock attribute /- concentration contaminant ( wppm ) ash 1 , 675 calcium 285 iron 67 . 3 potassium 117 magnesium 7 . 6 sodium 123 phosphorus 144 silicon 3 . 2 zinc 3 . 6 acid number ( mg koh / g ) 94 . 7 the fat / grease feed blend was filtered through a 10 mm bag filter . the ash value of the filtered product was measured as 1 , 715 wppm — essentially unchanged . the filtered feedstock was then washed with de - mineralized water in a continuous operation . the biological feedstock to water volumetric flow ratio was 10 : 1 . the two streams , fat / grease at 15 gal / min and water at 1 . 5 gal / min , were brought into contact in a mix tee . the washed fat / grease blend was measured for ash content , and the wash cycle was repeated under the same conditions . the results of each water wash cycle are summarized in table 4 . based on the ash analyses , even after two water wash cycles the inorganics / metals content remained mostly unchanged . after the second water wash cycle , the fat / grease blend as shown in table 3 was washed with 10 % citric acid solution . the same continuous washing operation described in example 4 was used , with a 10 : 1 ratio of fat / grease to aqueous citric acid solution . the properties of the filtered citric - washed product are summarized in table 5 . it is evident from the ash analyses that citric acid wash removed most of the inorganic / metal contaminants . from the above description , it is clear that the present invention is well adapted to carry out the objects and to attain the advantages mentioned herein as well as those inherent in the invention . while presently preferred embodiments of the invention have been described for purposes of this disclosure , it will be understood that numerous changes may be made which will readily suggest themselves to those skilled in the art and which are accomplished within the spirit of the invention disclosed and claimed .	8
although the specific structure of the various types of semiconductor lasers in which the concepts of particular embodiments of the present invention can be incorporated is taught in readily available technical literature relating to the design and fabrication of semiconductor lasers , the concepts of particular embodiments of the present invention may be conveniently illustrated with general reference to a three - section dbr - type semiconductor laser 10 illustrated schematically in fig1 . in fig1 , the dbr laser 10 is optically coupled to a light wavelength conversion device 20 . the light beam emitted by the semiconductor laser 10 can be either directly coupled into the waveguide of the wavelength conversion device 20 or can be coupled through collimating and focusing optics or some other type of suitable optical element or optical system . the wavelength conversion device 20 converts the incident light into higher harmonic waves and outputs the converted signal . this type of configuration is particularly useful in generating shorter wavelength laser beams from longer wavelength semiconductor lasers and can be used , for example , as a visible laser source for laser projection systems . the dbr laser 10 illustrated schematically in fig1 comprises a wavelength selective section 12 , a phase matching section 14 , and a gain section 16 . the wavelength selective section 12 , which can also be referred to as the dbr section of the laser 10 , typically comprises a first order or second order bragg grating positioned outside the active region of the laser cavity . this section provides wavelength selection , as the grating acts as a mirror whose reflection coefficient depends on the wavelength . the gain section 16 of the dbr laser 10 provides the major optical gain of the laser and the phase matching section 14 creates an adjustable optical phase shift between the gain material of the gain section 16 and the reflective material of the wavelength selective section 12 . the wavelength selective section 12 may be provided in a number of suitable alternative configurations that may or may not employ a bragg grating . respective control electrodes 2 , 4 , 6 are incorporated in the wavelength selective section 12 , the phase matching section 14 , the gain section 16 , or combinations thereof , and are merely illustrated schematically in fig1 . it is contemplated that the electrodes 2 , 4 , 6 may take a variety of forms . for example , the control electrodes 2 , 4 , 6 are illustrated in fig1 as respective electrode pairs but it is contemplated that single electrode elements 2 , 4 , 6 in one or more of the sections 12 , 14 , 16 will also be suitable for practicing particular embodiments of the present invention . the control electrodes 2 , 4 , 6 can be used to inject electrical current into the corresponding sections 12 , 14 , 16 of the laser 10 . for example , the injected current can be used to alter the operating properties of the laser by controlling the temperature of one or more of the laser sections , injecting electrical current into a conductively doped semiconductor region defined in the laser substrate , controlling the index of refraction of the wavelength selective and phase matching sections 12 , 14 of the laser 10 , controlling optical gain in the gain section 16 of the laser , etc . the wavelength conversion efficiency of the wavelength conversion device 20 illustrated in fig1 is dependent on the wavelength matching between the semiconductor laser 10 and the wavelength conversion device 20 . in cases where the wavelength conversion device 20 comprises an shg crystal , the output power of the higher harmonic light wave generated in the shg crystal 20 drops drastically when the output wavelength of the laser 10 deviates from the wavelength conversion bandwidth of the shg crystal . for example , when a semiconductor laser is modulated to produce data , the thermal load varies constantly . the resulting change in laser temperature and lasing wavelength can be referred to as the wavelength thermal patterning effect . this thermal patterning effect generates a variation of the efficiency of the shg crystal 20 . in the case of a 12 mm - long ppln shg device , a temperature change in the semiconductor laser 10 of about 2 ° c . will typically be enough to take the output wavelength of the laser 10 outside of the 0 . 16 nm full width half maximum ( fwhm ) wavelength conversion bandwidth of the shg crystal 20 . the present inventors have recognized challenges in stabilizing the emission wavelength of a semiconductor laser because they are commonly subject to wavelength drift and associated cavity mode hopping . for example , and not by way of limitation , fig3 illustrates the evolution of emission wavelength as a function of gain current in a dbr laser . when the gain current increases , the temperature of the gain section also increases . as a consequence , the cavity modes move towards higher wavelengths . the wavelength of the cavity modes move faster than the wavelength of the dbr section . so , the laser reaches a point where a cavity mode of lower wavelength is closer to the maximum of the dbr reflectivity curve . at that point , the mode of lower wavelength has lower loss than the mode that is established and , according to basic principles of laser physics , the laser then automatically jumps to the mode that has lower loss . this behavior is illustrated on the curve 100 of fig3 . as is illustrated in fig3 , the wavelength slowly increases and includes sudden mode hops whose amplitude is equal to one free spectral range of the laser cavity . referring further to fig3 , curve 101 illustrates significantly different emission behavior in a dbr laser . specifically , a laser having the same general manufacturing parameters as the laser illustrated with reference to curve 100 , may exhibit significantly different behavior in the sense that , instead of having mode hops with an amplitude of one laser free spectral range , the laser will exhibit mode hops having up to 6 or more free spectral range amplitudes . for many applications , this large sudden wavelength variation would not be acceptable . for example , in the case of a laser projection system , these large hops would cause sudden intensity jumps in the image from a nominal grey - scale value to a value close to zero . the present inventors have investigated this phenomena , as well as wavelength instability and hysteresis in lasers , and note that these laser emission defects can be attributed to one or more of a variety of factors , including spatial hole burning , spectral hole burning , asymmetric gain saturation , gain profile broadening , and self induced bragg gratings . it is contemplated that these factors may lock lasing on the particular cavity mode that has been established in the laser cavity or encourage larger mode hops . indeed , it appears that once a mode is established , the photons that are inside the cavity at a specific wavelength disturb the laser itself by depleting and modifying the carrier density at a specific energy level or by creating a self induced bragg grating in the cavity . regardless of the cause of multi - mode drift in semiconductor lasers , when this phenomenon occurs , the lasing wavelength usually shows abnormal wavelength jumps which are equal to a multiple of the cavity mode spacing . before a large mode hop occurs , the laser usually shows large continuous wavelength shift . the larger wavelength drift and the abnormal wavelength jump can cause unacceptable noise in a laser signal . for example , referring to fig2 , a laser projection system is illustrated comprising an image source ( s ) generating a single or multi - color image data stream , image projection software and associated electronics ( s / e ) for generating a laser drive signal for each primary image color , a laser driver ( d ) generating respective laser drive currents for individual lasers ( ld ) configured to generate each primary image color , and scanning and projection optics ( o ) that operate to generate a single or multi - color projected image ( i ) comprising an array of image pixels . if this above - described phenomenon happens systematically in a semiconductor / shg laser projection system of the type illustrated in fig2 , the noise in the projected image will be readily visible to the human eye . indeed , the present inventors have recognized that this is the case even for semiconductor lasers that only exhibit single mode hops and corresponding sudden wavelength changes merely equal to one free spectral range of the laser cavity . the present inventors have also recognized that semiconductor lasers commonly exhibit a temperature evolution signature that can create unfavorable wavelength shifts and sudden changes in the output of the semiconductor laser and the output of the wavelength conversion device coupled to the laser . this unfavorable patterning can create significant problems in the context of the laser projection systems described above . although the present invention is not limited to any particular manifestation of the wavelength variations and sudden mode hops described herein , in the context of a laser projection system , these wavelength fluctuations can create smooth intensity variations and the mode hops can create relatively abrupt intensity shifts in the image created by scanning the laser . the particular pattern created in the image by these defects can be a function of a number of factors including , but not limited to , laser temperature , laser free spectral range , the ppln crystal spectral band pass , the spectral alignment of the laser dbr with respect to the ppln crystal , etc . regardless of the nature of the defect pattern , the pattern itself can present a problem in the image because it presents a readily recognizable , systematic structure in the image . also , for quasi - static images , these defects typically repeat themselves from frame to frame , making it very easy to recognize the defects in the image . the present inventors have recognized beneficial schemes for minimizing these systematic intensity variations in the output of a second harmonic generation ( shg ) crystal or other wavelength conversion device by forcing wavelength chirping in the semiconductor laser to which the conversion device is coupled . the forced chirping effectively broadens the optical spectrum of the laser and reduces the variation of intensity of the second harmonic light under the presence of the thermal patterning effect . more specifically , fig4 is a plot of the optical spectrum of a relatively narrow bandwidth semiconductor laser lasing at a single cavity mode . as is illustrated in fig4 , the effective spectral bandwidth w of the laser , i . e ., the spread of the optical spectrum in the wavelength domain , is about 0 . 02 nm . when the gain drive current of this laser is changed to produce a desired power output , the peak wavelength , i . e ., the wavelength of maximum intensity in fig4 , experiences a gradual shift and sudden mode hops due to the aforementioned thermal patterning effect . this gradual shift and the sudden mode hops of the peak wavelength translate to gradual variation and sudden changes of the intensity output of the shg coupled to the laser . fig5 plots the time - averaged optical spectrum of the same laser , where the drive current i gain injected into the gain section of the semiconductor laser is rapidly modulated with a square wave at about 0 . 5 ghz . the gain drive current low level is close to zero for 1 ns and the high level is much high than threshold current for 1 ns . as is illustrated in fig5 , the time - averaged optical spectrum is broadened about threefold because , during modulation , the drive current i gain drops to a value that is low enough to change the carrier density in the gain region , creating carrier density oscillation as the drive current i gain modulates . as a result , a plurality of different emission modes are selected in the semiconductor laser as the drive current is modulated . for example , there are five cavity modes available in the time - averaged optical spectrum illustrated in fig5 , each of which may be selected for lasing during the 1 - ns time when the gain drive current is higher than threshold current . the lasing of these plurality of different cavity modes effectively broadens the optical spectrum averaged during a pixel duration t p . in other words , the wavelength chirping forces the laser to oscillate among many cavity modes during a pixel duration t p , overwhelming any slower effect , such as the mode hops induced by the thermal patterning effect . in cases where a dbr laser is coupled to an shg crystal , for example , users will see less reduction of the second - harmonic intensity of the shg crystal when a dbr laser is under rapid wavelength chirping . in addition , the wavelength chirping relaxes the tight requirement of precisely matching the dbr reflection peak to the shg center wavelength because the effective spectral width of the wavelength - chirped laser is much broader than the single - wavelength laser . similar benefits would also be enjoyed in applications where other types of semiconductor lasers are coupled to wavelength conversion devices that require alignment of a conversion bandwidth with the emission spectrum of the laser . preferably , although not critical , the low level gain current i low that is reached during modulation is below the threshold current i th and may be set as low as zero because it is contemplated that this will enhance carrier density excursion during oscillation . to help eliminate the aforementioned impact of mode hopping and wavelength drift , the frequency of the cavity mode oscillations should be larger than the rate at which the semiconductor laser would otherwise exhibit mode hops . as a result , the fast wavelength chirping produced by the cavity mode oscillations overwhelms the mode hops created by the thermal patterning effect . the high level gain current i high , low level gain current i low , and threshold current i th , are illustrated schematically in the plot of fig7 in the context of a pixel - based laser projection system . each pixel is typically characterized by a pixel duration t p , which may vary from pixel to pixel , and a color - specific luminance value , which can be proportional to the high level gain current i high or a target gain current value i data . in cases where the target gain current value i data is used as a reference for pixel luminance , the respective values for the high level gain current i high and the low level gain current i low are controlled such that a combination of the two currents is proportional to the target gain current value i data . for a special case where the low - level gain drive current is below threshold current , only the amplitude and duty cycle of the high - level gain drive current i high should be controlled to achieve the target gain drive current value i data . the pixel luminance will typically vary across the projected pixels , as is represented in the varying magnitudes of the target gain current value i data . typically , the high level gain current i high is higher than the lasing threshold i th of the semiconductor laser and may be on the order of about 100 times the lasing threshold i th of the semiconductor laser . the waveform of the gain current can be made of pulse waves as is illustrated in fig7 or other waveforms such as square waves or sine waves . as is noted above the modulation frequency may be on the order of about 0 . 5 ghz but it is contemplated that suitable results may also be achieved at lower modulation frequencies , e . g ., perhaps as low as about 0 . 1 ghz . alternatively , it may be helpful to refer to the respective durations of the data periods encoded in the laser drive current i gain and control the modulation such that the modulation period is significantly shorter than the duration of the data period . for example , in the case of a laser projection system where pixels are illuminated for a period on the order of about 40 nsec , the drive current i gain can be modulated at a period of less than about 10 nsec . as a further example , it is contemplated that the frequency of the drive current modulation can be controlled such that the drive current i gain cycles through at least about 4 periods for each display pixel . fig6 illustrates the manner in which a data signal portion 100 that is used to drive a semiconductor laser can be combined with a modulated wavelength - chirped signal portion 200 according to the present invention . specifically , as is illustrated in fig6 , it is contemplated that these respective signal portions of the gain injection current can be integrated into the drive current 300 ( i gain ) by taking a sum or product of the laser data signal 100 and a suitably configured modulated signal portion 200 . in the context of a laser projection system including , for example , a frequency doubled ppln green light source , without wavelength control according to embodiments of the present invention , the green power emitted by the light source over a single line of the image display will exhibit sudden variations in power due to multiple cavity mode hops . as a result , projected images will have abrupt drops in power with amplitude on the order of 50 % and more . however , employing laser control schemes according to particular embodiments of the present invention where the drive signal is modulated to generate the aforementioned wavelength chirping , it is contemplated that wavelength mode hopping will be completely eliminated , or at least substantially mitigated . it is also contemplated that laser control schemes of the present invention may improve the semiconductor laser &# 39 ; s resistance to external reflection and reduce speckle problems in laser projection systems since the coherent length of a semiconductor laser is usually reduced by wavelength chirping . referring to the laser projection system illustrated schematically in fig2 , it is noted that the drive current control schemes according to particular embodiments of the present invention may be executed in a variety of forms within the system . for example , and not by way of limitation , the modulated chirp portion of the gain current may be executed by integrating the modulated chirp portion into the video signal during rendering by the projection software and electronics . in this approach , pixels distributed throughout the image would be altered by the modulated chirp portion independent of the required intensity from the source image . alternatively , the modulated chirp portion of the gain current may be integrated into the laser drive electronics . in this approach , the laser drive signal , which is derived from the image stream , would be modified to incorporate the modulated chirp portion prior to current scaling . it is noted that reference herein to single mode lasers or lasers configured for single mode optical emission should not be taken to restrict the scope of the present invention to lasers that operate in a single mode exclusively . rather , the references herein to single mode lasers or lasers configured for single mode optical emission should merely be taken to imply that lasers contemplated according to particular embodiments of the present invention will be characterized by an output spectrum where a single mode of broad or narrow bandwidth is discernable therein or by an output spectrum that is amenable to discrimination of a single mode therefrom through suitable filtering or other means . those skilled in the art will recognize that the active pixel duration t p referred to above and illustrated in fig7 may vary modestly and periodically across the image as a result of scanning speed variations . accordingly , reference to a projecting system that is characterized by a “ pixel duration ” or “ encoded data period ” should not be taken to denote that each pixel in an image has the same pixel duration . rather , it is contemplated that individual pixels within the display may have different pixel durations that each fall under the general concept of a display characterized by an active pixel duration t p . a multi - tone image can be generated by the image projection system by configuring the image projection electronics and the corresponding laser drive currents to establish a pixel intensity that varies across the array of image pixels . in this case , the modulated wavelength chirp portion of the drive current is superimposed upon the signal that encodes the varying pixel intensity . further detail concerning the configuration of scanning laser image projection systems and the manner in which varying pixel intensities are generated across an image is beyond the scope of the present invention and may be gleaned from a variety of readily available teachings on the subject . although the present invention has been described with primary reference to pixel - based projection systems , it is contemplated that other projection systems , such as spatial light modulator based systems ( including digital light processing ( dlp ), transmissive lcd , and liquid crystal on silicon ( lcos )), incorporating laser - based light sources may benefit from the wavelength stabilization and dithering techniques described herein . in these other systems the relevant period exogenous to the laser is not the pixel period but the inverse of the screen refresh rate , or a fraction thereof . reference is made throughout the present application to various types of currents . for the purposes of describing and defining the present invention , it is noted that such currents refer to electrical currents . further , for the purposes of defining and describing the present invention , it is noted that reference herein to “ control ” of an electrical current does not necessarily imply that the current is actively controlled or controlled as a function of any reference value . rather , it is contemplated that an electrical current could be controlled by merely establishing the magnitude of the current . it is to be understood that the preceding detailed description of the invention is intended to provide an overview or framework for understanding the nature and character of the invention as it is claimed . it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit and scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . for the purposes of defining and describing the present invention , it is noted that reference herein to values that are “ on the order of ” a specified magnitude should be taken to encompass any value that does not vary from the specified magnitude by one or more orders of magnitude . it is noted that terms like “ preferably ,” “ commonly ,” and “ typically ,” when utilized herein , are not intended to limit the scope of the claimed invention or to imply that certain features are critical , essential , or even important to the structure or function of the claimed invention . rather , these terms are merely intended to highlight alternative or additional features that may or may not be utilized in a particular embodiment of the present invention . further , it is noted that reference to a value , parameter , or variable being a “ function of ” another value , parameter , or variable should not be taken to mean that the value , parameter , or variable is a function of one and only one value , parameter , or variable . for the purposes of describing and defining the present invention it is noted that the term “ substantially ” is utilized herein to represent the inherent degree of uncertainty that may be attributed to any quantitative comparison , value , measurement , or other representation . the term “ substantially ” is also utilized herein to represent the degree by which a quantitative representation . e . g ., “ substantially above zero ,” varies from a stated reference , e . g ., “ zero ,” and should be interpreted to require that the quantitative representation varies from the stated reference by a readily discernable amount .	7
fig1 a shows a simplified block diagram overview of the invention , including local participant 10 , video display 30 , pair of imaging devices 41 and 42 , means for generating composite image 100 , motion video portal 70 , video delivery system 80 and second participant 90 . means 100 for generating composite image 146 is communicatively coupled 114 and 112 with at least two imaging device collection members 41 and 42 , respectively . means 100 regularly receives an image 118 and 116 from each of the at least two imaging device collection members 41 and 42 , respectively , to provide a synchronized collection of images based upon observations of at least the local participant &# 39 ; s head 10 by the imaging devices . means 100 for generating composite image 146 is communicatively coupled 142 to motion video portal 70 , providing a succession of composite images 146 , each based upon at least synchronized image collection 116 and 118 to 72 video delivery system 80 . video delivery system 80 presents 82 second participant 90 motion video stream 72 generated by motion video portal 70 conveying eye contact based upon the succession of composite images 146 . note that the motion video stream is compatible with a digital motion format and / or an analog motion format . the digital motion format includes , for example , any of the following : mpeg1 format , mpeg2 format , mpeg4 format , h . 261 format and h . 263 format . the analog format includes , for example , any of the following : ntsc format , pal format , and secam format . a primary responsibility of video delivery system 80 is to initiate and maintain a video delivery session with at least one remote location . note that in various embodiments of the invention , the video delivery session may include , but is not limited to , any of the following : a video conference session involving at least local participant 10 and at least one second participant 80 , a video phone session involving local participant 10 and second participant 80 , a video kiosk supporting video communication between at least local participant 10 and at least one second participant 80 , video training between at least local participant 10 and at least one second participant 80 , and television broadcast conveying a documentary style interview . each of these video delivery sessions is based upon the motion video stream presented 72 to the video delivery system 80 from motion video portal 70 . video delivery system 80 connects 82 to second participant 90 . the connection 82 can include transport across at least one communications network . while not shown , there is typically another motion video stream from second participant 90 which is transported via 82 through video delivery system 80 and rendered for presentation on video display 30 . additionally , certain embodiments of the invention may offer an ability to view the composite image 146 obtained from means 100 on the local video display 30 . there may further be the ability to view digital versions of the images 118 and 116 obtained from the video imaging devices 41 and 42 . a number of existing technologies are suitable for use as video display 30 including , for example , cathode ray tube monitors , liquid crystal displays , and plasma screen televisions . the display is preferably compatible with the format of the video output signal provided by the video delivery system . note that in certain embodiments of the invention , means 100 may be at least part of an instruction - processing computer and / or a dedicated hardware accelerator . note that as used herein , an instruction - processing computer includes , but is not limited to , single instruction and multiple instruction processing mechanisms acting upon single datapaths and multiple datapaths , leading to the often used acronyms of sisd , simd , misd , and mimd computers . the instructions processed by instruction processing mechanisms include , but are not limited to , instructions which are directly executed to alter the state of the system they control , as well as instructions which alter by inference the state of the system they control . note that instruction execution may be hardwired into the instruction processor , or interpreted . inferential systems include , but are not limited to , artificial neural networks , logic programming systems , and content addressable memory driven control systems . as used herein , a dedicated hardware accelerator provides at least one means by which calculations upon picture entities , preferably at least pixel components , may be performed . a dedicated hardware accelerator may or may not include an instruction processing control mechanism . by way of example , a hardware accelerator may include a state machine controller operating at least one partition of its controls as a ones - hot state machine . it may be a collection of state machines , with at least one , some or all of these state machines not having an instruction register . examples of such state machines often include , but are not limited to , floating point calculators , fifos , and bit packing circuits such as huffman coders and decoders . local participant 10 of the video delivery session is observed by at least a pair of video imaging devices 41 and 42 . the imaging device collection members 41 and 42 are collectively disposed to reveal essential features , for example , the head of local participant 10 for observation by at least one of imaging device collection members 41 and 42 . note that each of the digital versions of images 118 and 116 is comprised of a two - dimensional array of pixels of approximately the same size and shape . for the sake of discussion , video imaging device 41 is the first imaging device and video imaging device 42 is the second imaging device . means 110 for obtaining a digital version of the image 118 and 116 from each of at least two imaging device collection members 41 and 42 , respectively , as the image member in the synchronized image collection . one embodiment of the invention comprises means 120 for calculating a dense correspondence to determine a displacement in at least a first dimension for each of the pixels in the first image digital version 116 to move each of the pixels to a most nearly corresponding pixel in the image digital versions of at least one other member of the imaging device collection 118 . means 130 for generating an interpolated image 136 and 138 , for each of the imaging device collection members 41 and 42 , respectively . the interpolated images 136 and 138 are comprised of a two dimensional array of pixels of approximately the same size and shape . means 140 for combining at least two of the interpolated images 136 and 138 employs a partitioned averaging scheme using at least a second dimension to create the composite image 146 . note that the definition of first dimension and second dimension as used herein is discussed with respect to fig1 b . the pixels may use , for example , any of the known encoding schemes for designating at least chrominance and luminance , including but not limited to , yuv , rgb , and the various cie derived pixel coding schemes such as described in the background of the invention . note that some but not all embodiments of the invention may require conversion between two or more encoding schemes . conversion between these coding schemes may be performed , for example , by any of the following mechanisms : table look up , numeric calculation and / or compiled logic structures further including but not limited to finite state machines , logic equations , and truth tables . note that a table look up of a 24 bit pixel value input generating a 24 bit pixel value output requires 48 megabytes of memory . fig1 b shows a simplified block diagram of an alternative embodiment of the invention to fig1 a , with motion video portal 70 including first computer 200 with a program system 1000 at least in part generating composite image 146 . program system 1000 is comprised of program steps residing in memory 210 accessibly coupled 212 to first computer 200 . note that the invention includes an apparatus receiving the image collection 136 and 138 that may be stored in a memory , such as memory 210 . the invention may further include various means for obtaining at least one of images 136 and 138 note that means 110 for obtaining the digital version from at least one of the imaging device collection members may include any of the following : a frame grabbing circuit 220 coupled 112 to imaging device collection member 42 for obtaining the image 116 from the imaging device as the image member in the synchronized image collection 118 and 116 . video interface 240 coupling 114 imaging device collection member 41 to motion video portal 70 for obtaining a digital version of image 118 from imaging device collection member 41 . obtaining a digital version of an image may also include the step of performing a rectifying transformation . note that it is preferred with today &# 39 ; s technology that a consistent interface be provided for at least pairs of video imaging devices . it is contemplated that one of the two alternatives discussed in fig1 b would be used for at least pairs of video imaging devices . the motion video portal 70 may further include any of the following : a first finite state machine 230 receiving digital version of image 118 from imaging device collection member 41 by operating 232 video interface 240 . a first computer 200 coupled ( not shown ) with video interface 240 and accessibly coupled 212 to a first memory 210 and controlled by first program system 1000 comprised of at least one program step residing in the first memory 210 . fig2 is a diagram showing the preferred positioning of imaging devices 41 and 42 relative to local participant 10 , as found in fig1 a and 1b . imaging devices 41 and 42 are positioned at a common radial displacement r from the point of intersection c of the video camera field of view centerlines . the angular separation of the imaging devices , 9 , is preferably the smallest allowable separation given the size of video display 30 ( not shown ) and the housing size of imaging devices 41 and 42 . imaging devices 41 and 42 , as well as intersection point c of the centerlines , lie approximately in a horizontal plane . local participant 10 is preferably positioned such that his facial features are approximately located at c . means 100 receives the video signals from imaging devices 41 and 42 , respectively , and from these video signals , creates an image of local participant 10 as viewed from a point p along the arc common arc a about the point c . to maximize compatibility with existing video delivery equipment , means 100 may receive video input from the imaging devices and provide video output to the video delivery system in any one of a variety of video formats via a variety of transmission protocols . these video formats include but are not limited to analog formats and digital formats . the digital formats may include but are not limited to any of bitmap , grayscale , rgb , dv , yuv , and hdtv . the analog formats may include , but are not limited to , any of rs170 , rs343 , ntsc , pal , secam , and hdtv . as used herein , the term digital refers to any communications protocol or format based upon ordered collections of digits . each digit is preferably a member of a single digit value collection containing finitely many digit values . in today &# 39 ; s technology , the preferred digital value collection has two members , usually denoted as ‘ 0 ’ and ‘ 1 ’. digital formats are particularly convenient because they allow for simple conversion of image data into a form easily manipulated by the image processing algorithm . if a digital format is selected , a transfer protocol , such as usb or ieee 1394 , may be employed . the particular format of the video output signal is typically selected to match the format of an existing video camera within the local participant &# 39 ; s video delivery setup , thereby ensuring compatibility with the existing video delivery system 20 . with the invention configured as described above , local participant 10 positions himself or herself relative to local display 30 and imaging devices 41 and 42 approximately as shown in fig2 . local participant 10 may check his positioning relative to imaging devices 41 and 42 by previewing a composite image on local display 30 . local participant 10 may then initiate a video delivery session or join an existing video delivery session as provided by video delivery system 80 . after the videoconference , local participant 10 closes the video delivery session as provided by video delivery system 80 . prior to beginning the image processing operation , a calibration operation is preferably performed to obtain information describing the positioning and optical properties of the two imaging devices . the calibration process may be performed upon assembly of the teleconferencing apparatus if the video camera setup is a permanent fixture , or may be performed each time a change is made to the physical geometry or optical settings of the imaging devices . fig3 a depicts a detail flowchart of first program system 1000 of fig1 b implementing a method of conveying eye contact of a local participant presented to at least one second participant in a video delivery session as a motion video stream based upon observations by an imaging device collection . arrow 1010 directs the flow of execution from starting operation 1000 to operation 1012 . operation 1012 performs obtaining a digital version of the image from each of the members of the imaging device collection as the image member in the synchronized image collection . arrow 1014 directs execution from operation 1012 to operation 1016 . operation 1016 terminates the operations of this flowchart . certain embodiments of the invention include the following operations without operation 1012 . arrow 1020 directs the flow of execution from starting operation 1000 to operation 1022 . operation 1022 performs calculating at least one dense correspondence to determine a displacement in at least a first dimension for each of the pixels in the first image digital version that would move each of the pixels to a most nearly corresponding pixel in the image digital version of at least one other member of the imaging device collection . arrow 1024 directs execution from operation 1022 to operation 1016 . operation 1016 terminates the operations of this flowchart . arrow 1030 directs the flow of execution from starting operation 1000 to operation 1032 . operation 1032 performs generating an interpolated image for at least two of the imaging device collection members from the at least one dense correspondence of the at least two images . arrow 1034 directs execution from operation 1032 to operation 1016 . operation 1016 terminates the operations of this flowchart . each of the interpolated images is comprised of a two - dimensional array of pixels of approximately the same size and shape . arrow 1040 directs the flow of execution from starting operation 1000 to operation 1042 . operation 1042 performs combining at least two of the interpolated images employing , for example , a partitioned or other averaging scheme in a second dimension to create the composite image presented to a motion video portal creating the motion video stream . arrow 1044 directs execution from operation 1042 to operation 1016 . operation 1016 terminates the operations of this flowchart . note that in various embodiments of the invention none , some or all of these steps may be found as program steps residing in first memory 210 accessibly coupled 212 to at least one computer 210 contained within motion video portal 70 . note that means 100 , 110 , 120 , 130 , and 140 of fig1 a may each include at least one finite state machine and / or at least one computer . each computer is accessibly coupled to a memory and controlled by a program system made up of program steps implementing the method of operation 1000 and individual program steps 1012 , 1022 , 1032 , and 1042 , respectively , as shown in fig3 a . note that multiple computers may access a shared memory accessibly coupled to each of them . fig3 b depicts a detail flowchart of operation 1022 of fig3 a for calculating the dense correspondence . arrow 1060 directs the flow of execution from starting operation 1022 to operation 1062 . operation 1062 performs calculating a dense correspondence to determine a displacement in at least a first dimension for each of the pixels in the first image digital version which would move each of the pixels to a most nearly corresponding pixel in the image digital versions of at least one other member of the imaging device collection . arrow 1064 directs execution from operation 1062 to operation 1066 . operation 1066 terminates the operations of this flowchart . fig4 a depicts a detail flowchart of operation 1032 of fig3 for generating the interpolated image , for each of the pixels of the interpolated image . arrow 1070 directs the flow of execution from starting operation 1032 to operation 1072 . operation 1072 sets the interpolated image pixel to the corresponding pixel of the image digital version where the interpolated image pixel displaced by a partial displacement in at least a first dimension for the image device collection member . arrow 1074 directs execution from operation 1072 to operation 1076 . operation 1076 terminates the operations of this flowchart . fig4 b depicts a detail flowchart of operation 1042 of fig3 for generating each of the pixels of the composite image by combining the interpolated images . arrow 1090 directs the flow of execution from starting operation 1042 to operation 1092 . operation 1092 performs combining corresponding pixels of each of the interpolated images employing the averaging scheme partitioned along a second dimension to create the pixel of the composite image . arrow 1094 directs execution from operation 1092 to operation 1096 . operation 1096 terminates the operations of this flowchart . note that the sum of the partial displacements of the image device collection members is approximately equal to the displacement . in certain embodiments of the invention , the partial displacements must belong to a limited collection of incremental values , often a range of integers . the partial displacements may then sum to an incremental value close to the displacement . suppose the displacement is ‘ 3 ’ pixels , with the first and second partial placements may each be ‘ 1 ’. their sum , as ‘ 2 ’, is approximately equal to ‘ 3 ’. various embodiments of the invention may alternatively include displacement fractions exactly summing to the displacement . this can be achieved , at least in part , by the use of partial displacements including more than just integers . it is preferred that each of the pixels of any of the images are partially ordered in the one dimension by membership in exactly one member of a partition collection . fig4 c depicts a detail flowchart of operation 1042 of fig3 for combining corresponding pixels . arrow 1110 directs the flow of execution from starting operation 1042 to operation 1112 . operation 1112 performs combining corresponding pixels of the interpolated images employing the partitioned averaging scheme based upon the pixel membership in a partition collection to create the pixel of the composite image . arrow 1114 directs execution from operation 1112 to operation 1116 . operation 1116 terminates the operations of this flowchart . the partition collection may be comprised of a first side collection of the pixels , a center collection of pixels , and a second side collection of pixels . the center collection is between the first side collection and the second side collection in the second dimension fig5 a depicts a detail flowchart of operation 1112 of fig4 c for combining corresponding pixels . arrow 1130 directs the flow of execution from starting operation 1112 to operation 1132 . operation 1132 performs predominantly combining the corresponding pixel of the first interpolated image whenever the composite image pixel is a member of the first side collection . arrow 1134 directs execution from operation 1132 to operation 1136 . operation 1136 terminates the operations of this flowchart . arrow 1140 directs the flow of execution from starting operation 1112 to operation 1142 . operation 1142 performs predominantly combining the corresponding pixel of the second interpolated image whenever the composite image pixel is a member of the second side collection . arrow 1144 directs execution from operation 1142 to operation 1136 . operation 1136 terminates the operations of this flowchart . arrow 1150 directs the flow of execution from starting operation 1112 to operation 1152 . operation 1152 performs mixedly combining the corresponding pixels of the at least two interpolated images whenever the composite image pixel is a member of the center collection . arrow 1154 directs execution from operation 1152 to operation 1136 . operation 1136 terminates the operations of this flowchart . fig5 b depicts a detail flowchart of operation 1132 of fig5 a for predominantly combining the corresponding pixel of the first interpolated image whenever the composite image pixel is a member of the first side collection . arrow 1170 directs the flow of execution from starting operation 1132 to operation 1172 . operation 1172 determines when the composite image pixel is a member of the first side collection . arrow 1174 directs execution from operation 1172 to operation 1176 when the determination is ‘ yes ’. arrow 1188 directs execution to 1180 when the determination is ‘ no ’. operation 1176 performs predominantly combining the corresponding pixel of the first interpolated image to create the composite image pixel . arrow 1178 directs execution from operation 1176 to operation 1180 . operation 1180 terminates the operations of this flowchart . fig6 a depicts a detail flowchart of operation 1142 of fig5 a for predominantly combining the corresponding pixel of the second interpolated image whenever the composite image pixel is a member of the second side collection . arrow 1190 directs the flow of execution from starting operation 1142 to operation 1192 . operation 1192 determines when the composite image pixel is a member of the second side collection . arrow 1194 directs execution from operation 1192 to operation 1196 when the determination is ‘ yes ’. arrow 1208 directs execution to 1200 when the determination is ‘ no ’. operation 1196 performs predominantly combining the corresponding pixel of the second interpolated image to create the composite image pixel . arrow 1198 directs execution from operation 1196 to operation 1200 . operation 1200 terminates the operations of this flowchart . fig6 b depicts a detail flowchart of operation 1152 of fig5 a for mixedly combining the corresponding pixels of the at least two interpolated images whenever the composite image pixel is a member of the center collection . arrow 1210 directs the flow of execution from starting operation 1152 to operation 1212 . operation 1212 determines when the composite image pixel is a member of the center collection . arrow 1214 directs execution from operation 1212 to operation 1216 when the determination is ‘ yes ’. arrow 1228 directs execution to 1220 when the determination is ‘ no ’. operation 1216 performs mixedly combining the corresponding pixels of the at least two interpolated images to create the composite image pixel . arrow 1218 directs execution from operation 1216 to operation 1220 . operation 1220 terminates the operations of this flowchart . fig7 depicts a detail flowchart of operation 1176 of fig5 b for predominantly combining the corresponding first interpolated image pixel . arrow 1250 directs the flow of execution from starting operation 1176 to operation 1252 . operation 1252 performs setting the composite image pixel to include , for example , at least ½ of the corresponding first interpolated image pixel . arrow 1254 directs execution from operation 1252 to operation 1256 . operation 1256 terminates the operations of this flowchart . arrow 1260 directs the flow of execution from starting operation 1176 to operation 1262 . operation 1262 performs setting the composite image pixel to include , for example , at least ⅞ of the corresponding first interpolated image pixel . arrow 1264 directs execution from operation 1262 to operation 1256 . operation 1256 terminates the operations of this flowchart . arrow 1270 directs the flow of execution from starting operation 1176 to operation 1272 . operation 1272 performs setting the composite image pixel to include , for example , at least 15 / 16 of the corresponding first interpolated image pixel . arrow 1274 directs execution from operation 1272 to operation 1256 . operation 1256 terminates the operations of this flowchart . arrow 1280 directs the flow of execution from starting operation 1176 to operation 1282 . operation 1282 performs setting the composite image pixel to the corresponding first interpolated image pixel . arrow 1284 directs execution from operation 1282 to operation 1256 . operation 1256 terminates the operations of this flowchart . fig8 depicts a detail flowchart of operation 1196 of fig6 a for predominantly combining the corresponding second interpolated image pixel . arrow 1330 directs the flow of execution from starting operation 1196 to operation 1332 . operation 1332 performs setting the composite image pixel to include , for example , at least ¾ of the corresponding second interpolated image pixel . arrow 1334 directs execution from operation 1332 to operation 1336 . operation 1336 terminates the operations of this flowchart . arrow 1340 directs the flow of execution from starting operation 1196 to operation 1342 . operation 1342 performs setting the composite image pixel to include , for example , at least ⅞ of the corresponding second interpolated image pixel . arrow 1344 directs execution from operation 1342 to operation 1336 . operation 1336 terminates the operations of this flowchart . arrow 1350 directs the flow of execution from starting operation 1196 to operation 1352 . operation 1352 performs setting the composite image pixel to include , for example , at least 15 / 16 of the corresponding second interpolated image pixel . arrow 1354 directs execution from operation 1352 to operation 1336 . operation 1336 terminates the operations of this flowchart . arrow 1360 directs the flow of execution from starting operation 1196 to operation 1362 . operation 1362 performs setting the composite image pixel to essentially the corresponding second interpolated image pixel . arrow 1364 directs execution from operation 1362 to operation 1336 . operation 1336 terminates the operations of this flowchart . fig9 a depicts a detail flowchart of operation 1216 of fig6 b for mixedly combining the corresponding pixel of the at least two interpolated images . arrow 1400 directs the flow of execution from starting operation 1216 to operation 1402 . operation 1402 performs calculating a fixed linear combination of the corresponding pixels of the at least two interpolated images to create the composite image pixel . arrow 1404 directs execution from operation 1402 to operation 1406 . operation 1406 terminates the operations of this flowchart . arrow 1410 directs the flow of execution from starting operation 1216 to operation 1412 . operation 1412 performs calculating a blending linear combination of the corresponding pixels of the at least two interpolated images to create the composite image pixel blending in the second dimension with the composite pixels created by the predominantly combining steps . arrow 1414 directs execution from operation 1412 to operation 1406 . operation 1406 terminates the operations of this flowchart . fig9 b depicts a detail flowchart of operation 1412 of fig9 a for calculating the blending linear combination . arrow 1450 directs the flow of execution from starting operation 1412 to operation 1452 . operation 1452 performs calculating a sliding scale linear combination of the corresponding pixels of the at least two interpolated images to create the composite image pixel blending in the second dimension with the composite pixels created by the predominantly combining steps . arrow 1454 directs execution from operation 1452 to operation 1456 . operation 1456 terminates the operations of this flowchart . arrow 1460 directs the flow of execution from starting operation 1412 to operation 1462 . operation 1462 performs calculating a bulging scale linear combination of the corresponding pixels of the at least two interpolated images to create the composite image pixel blending in the second dimension with the composite pixels created by the predominantly combining steps . arrow 1464 directs execution from operation 1462 to operation 1456 . operation 1456 terminates the operations of this flowchart . fig1 a depicts a detail flowchart that shows a central partitioning technique that may be used , interalia , operation 1216 of fig6 b for mixedly combining the corresponding pixel of the at least two interpolated images . arrow 1470 directs the flow of execution from starting operation to operation 1472 . operation 1472 performs mixedly combining the corresponding pixels varied about an occlusion center corresponding to a geometric centroid estimate of the local participant in the composite image to create the composite image pixelpixel . arrow 1474 directs execution from operation 1472 to operation 1476 . operation 1476 terminates the operations of this flowchart . arrow 1480 directs the flow of execution from starting operation 1216 to operation 1482 . operation 1482 performs mixedly combining the corresponding pixels varied in a linear manner in the second dimension to create the composite image pixelpixel . arrow 1484 directs execution from operation 1482 to operation 1476 . operation 1476 terminates the operations of this flowchart . arrow 1490 directs the flow of execution from starting operation 1216 to operation 1492 . operation 1492 performs mixedly combining the corresponding pixels varied in a piece - wise linear manner in the second dimension to create the composite image pixelpixel . arrow 1494 directs execution from operation 1492 to operation 1476 . operation 1476 terminates the operations of this flowchart . fig1 b depicts a detail flowchart of operation 1012 of fig3 a for obtaining the digital version of the image from imaging device collection member as the image member in the synchronized image collection , for each of the imaging device collection members . arrow 1510 directs the flow of execution from starting operation 1012 to operation 1512 . operation 1512 performs applying a rectifying transformation associated with the imaging device collection member to the image from the imaging device collection member to create the digital version of the image . arrow 1514 directs execution from operation 1512 to operation 1516 . operation 1516 terminates the operations of this flowchart . fig1 a depicts a detail flowchart of an optional step in connection with the method of operation and program system 1000 of fig1 b and 3a for generating the composite image , for at least two of the imaging device collection members . arrow 1530 directs the flow of execution from starting operation 1000 to operation 1532 . operation 1532 performs determining the rectifying transformation associated with the imaging device collection member , based upon a raw image from the imaging device collection member . arrow 1534 directs execution from operation 1532 to operation 1536 . operation 1536 terminates the operations of this flowchart . fig1 b depicts a detail flowchart of operation 1012 of fig1 b and 3a for obtaining the digital version of the image , for each of the at least two is imaging device collection members . arrow 1550 directs the flow of execution from starting operation 1012 to operation 1552 . operation 1552 performs warping the image digital version for the imaging device collection member by the partial displacement for the imaging device collection member to modify the digital version image for the imaging device collection member . arrow 1554 directs execution from operation 1552 to operation 1556 . operation 1556 terminates the operations of this flowchart . further , warping the digital versions of these images has been shown in simulation experiments by the inventor to minimize the computational overhead in the dense correspondence calculation step . this advantageously decreases the computational effort required to create the composite image . note that certain embodiments of the invention may actively incorporate the operations of fig1 a and 11b into a single image operation to achieve approximately the same results of successively performing these operations . fig1 c depicts a detail flowchart of operation 1552 of fig1 b for warping the image digital version . arrow 1570 directs the flow of execution from starting operation 1552 to operation 1572 . operation 1572 performs applying an attenuating factor to the partial displacement for the imaging device collection member to modify the partial displacement for the imaging device collection member . arrow 1574 directs execution from operation 1572 to operation 1576 . operation 1576 terminates the operations of this flowchart . fig1 a depicts a detail flowchart , for alternative embodiments of the invention for operation 1572 of fig1 c for attenuating the partial displacement for the imaging device collection member to modify the partial displacement . arrow 1590 directs the flow of execution from starting operation 1572 to operation 1592 . operation 1592 performs multiplying the partial displacement for the imaging device collection member by an attenuating factor and optionally rounding the multiplication to an integral result to modify the partial displacement . arrow 1594 directs execution from operation 1592 to operation 1596 . operation 1596 terminates the operations of this flowchart . arrow 1600 directs the flow of execution from starting operation 1572 to operation 1602 . operation 1602 performs replacing the partial displacement for the imaging device collection member by a replacement partial displacement whenever the partial displacement is within a displacement interval . arrow 1604 directs execution from operation 1602 to operation 1596 . operation 1596 terminates the operations of this flowchart . such operations as 1602 permit replacement of the partial displacement based upon its inclusion in a range or interval of displacements . if the partial displacement corresponds to a displacement fraction between 1 / 16 and 3 / 16 , it may be replaced by a partial displacement corresponding to a displacement fraction of ⅛ , for example . arrow 1610 directs the flow of execution from starting operation 1572 to operation 1612 . operation 1612 performs replacing the partial displacement for the imaging device collection member by a table entry referenced by the partial displacement . arrow 1614 directs execution from operation 1612 to operation 1596 . operation 1596 terminates the operations of this flowchart . note , the attenuating factor may be between 0 . 0 and 1 . 1 . in certain preferred embodiments of the invention , the attenuating factor is between 0 . 90 and 1 . 00 . fig1 b depicts a detail flowchart of operation 1592 of fig1 a for multiplying the partial displacement for the imaging device collection member . arrow 1730 directs the flow of execution from starting operation 1592 to operation 1732 . operation 1732 performs rounding upward the result of the partial displacement for the imaging device collection member multiplied by the attenuating factor to modify the partial displacement . arrow 1734 directs execution from operation 1732 to operation 1736 . operation 1736 terminates the operations of this flowchart . arrow 1740 directs the flow of execution from starting operation 1592 to operation 1742 . operation 1742 performs rounding downward the result of the partial displacement for the imaging device collection member multiplied by the attenuating factor to modify the partial displacement . arrow 1744 directs execution from operation 1742 to operation 1736 . operation 1736 terminates the operations of this flowchart . arrow 1750 directs the flow of execution from starting operation 1592 to operation 1752 . operation 1752 performs rounding toward zero the result of the partial displacement for the imaging device collection member multiplied by the attenuating factor to modify the partial displacement . arrow 1754 directs execution from operation 1752 to operation 1736 . operation 1736 terminates the operations of this flowchart . arrow 1760 directs the flow of execution from starting operation 1592 to operation 1762 . operation 1762 performs rounding to nearest the result of the partial displacement for the imaging device collection member multiplied by the attenuating factor to modify the partial displacement . arrow 1764 directs execution from operation 1762 to operation 1736 . operation 1736 terminates the operations of this flowchart . fig1 a depicts a detail flowchart of operational method and / or program system 1000 of fig1 a , 1 b , and 3 a for generating the composite image which receives specific displacement fractions from the second participant and replaces the displacement fractions in use with the specific displacement fractions arrow 1790 directs the flow of execution from starting operation 1000 to operation 1792 . operation 1792 performs receiving via the video delivery system from the second participant a specific displacement fraction for the imaging device collection member , for the at least two of the imaging device collection members . arrow 1794 directs execution from operation 1792 to operation 1796 . operation 1796 terminates the operations of this flowchart . arrow 1800 directs the flow of execution from starting operation 1000 to operation 1802 . operation 1802 performs replacing the displacement fraction with the specific displacement fraction for the imaging device collection member , for the at least two imaging device collection members . arrow 1804 directs execution from operation 1802 to operation 1796 . operation 1796 terminates the operations of this flowchart . fig1 b depicts various potential imaging device collection member placements in relationship with display 30 . note that at least two imaging device collection members may each include equipment containing a charge coupled device ( ccd ) array . the equipment may include more than one ccd array per imaging device collection member . at least one of the imaging device collection members may further preferably embody at least one video camera . at least two imaging device collection members , 41 and 42 , are preferably horizontally positioned with respect to the head of local participant 10 , as seen through inspection of fig1 a , 2 , and 13 b . at least two imaging device collection members , 43 and 44 , may be vertically positioned with respect to the head of local participant 10 , as seen through inspection of fig2 and 13b . at least two imaging device collection members , 45 and 46 , or alternatively 47 and 48 , may be diagonally positioned with respect to the head of local participant 10 , as seen through inspection of fig2 and 13b . at least two imaging device collection members may preferably be symmetrically positioned about a local display as seen by local participant 10 , as seen through inspection of fig2 and 13b . by way of example , any of the pairs 41 and 42 , 43 and 44 , 45 and 46 , or alternatively 47 and 48 display such symmetry . additionally , groupings of more than two imaging device is collection members may exhibit symmetry . by way of example , the quadruple 41 , 42 , 43 and 44 , as well as the quadruple 45 , 46 , 47 and 48 display such symmetry . note that as used herein , an imaging device collection may preferably include , but is not limited to , two , three and / or four members . as used herein the first dimension and the second dimension belong to a collection comprising an essentially vertical dimension 60 , an essentially horizontal dimension 62 , an essentially diagonal dimension 64 and 66 as well as an essentially angular dimension 68 . as used herein , these dimensions 60 - 66 are preferably aligned with two imaging device collection members . the essentially angular dimension 68 may preferably use the approximate center of the pixel array as the angular center . alternatively , the essentially angular dimension may use the occlusion center corresponding to a geometric centroid estimate of the local participant in the composite image . in certain embodiments of the invention , whenever there are exactly two imaging device collection members being used , the first dimension and second dimension may be the same . whenever there are an odd number of imaging device collection members in use , the second dimension may preferably be the essentially angular dimension . by way of example , consider an embodiment of the invention using three imaging devices , 43 , 45 and 47 . the first dimension , for a given correspondence , is typically aligned along a line connecting the two imaging devices for which the correspondence is calculated . only one such first dimension would be horizontal in a three camera arrangement as shown . one possibility , though , is that the first dimension is horizontal as defined by the epipolar lines of the rectiied images . note that rather than just one center collection , as many as three center collections as well as three side collections of pixels may be preferred . note further that while the composite image is comprised of essentially the array of pixels as discussed previously , there is also the potential of mapping individual pixels by an ordering implicit with the second dimension . fig1 a depicts a detail flowchart of operational method and program system 1000 of fig1 a , 1 b and 3 a for generating the composite image . arrow 1830 directs the flow of execution from starting operation 1000 to operation 1832 . operation 1832 performs the video delivery system presenting the local participant the motion video stream conveying eye contact based upon the composite image succession . arrow 1834 directs execution from operation 1832 to operation 1836 . operation 1836 terminates the operations of this flowchart . fig1 b depicts a detail flowchart of operational method and program system 1000 of fig1 a , 1 b and 3 for generating the composite image , for at least two of the imaging device collection members . arrow 1850 directs the flow of execution from starting operation 1000 to operation 1852 . operation 1852 performs providing to the motion video portal a succession of the images from the imaging device collection member for the video delivery system to present to the local participant . arrow 1854 directs execution from operation 1852 to operation 1856 . operation 1856 terminates the operations of this flowchart . fig1 c depicts a detail flowchart of operational method and program system 1000 of fig1 a , 1 b and 3 for generating the composite image . arrow 1870 directs the flow of execution from starting operation 1000 to operation 1872 . operation 1872 performs specifying a point p from which the at least two imaging device collection members are displaced . arrow 1874 directs execution from operation 1872 to operation 1876 . operation 1876 terminates the operations of this flowchart . fig1 a depicts a detail flowchart of operation 1872 of fig1 c for specifying the point p . arrow 1890 directs the flow of execution from starting operation 1872 to operation 1892 . operation 1892 performs operating a tactile interface controlled by the participant for specifying the point p . arrow 1894 directs execution from operation 1892 to operation 1896 . operation 1896 terminates the operations of this flowchart . arrow 1900 directs the flow of execution from starting operation 1872 to operation 1902 . operation 1902 performs specifying the point p based upon interactions with the participant . arrow 1904 directs execution from operation 1902 to operation 1896 . operation 1896 terminates the operations of this flowchart . arrow 1910 directs the flow of execution from starting operation 1000 to operation 1912 . operation 1912 performs specifying the point p based upon interactions with the second participant reported by the video delivery system . arrow 1914 directs execution from operation 1912 to operation 1916 . operation 1916 terminates the operations of this flowchart . arrow 1920 directs the flow of execution from starting operation 1000 to operation 1922 . operation 1922 performs specifying the location of the participant &# 39 ; s eyes within the composite image based upon information from the second participant reported by the video delivery system . arrow 1924 directs execution from operation 1922 to operation 1916 . operation 1916 terminates the operations of this flowchart . note that as used herein , a tactile interface refers to at least one of a knob , a slider , a touchpad , a mouse , a trackball , and / or a keyboard . fig1 b depicts a detail flowchart of operational method and program system 1000 of fig1 a , 1 b , and 3 a for generating the composite image . arrow 1930 directs the flow of execution from starting operation 1000 to operation 1932 . operation 1932 performs providing a video conference between at least the local participant and at least the second participant based upon the motion video stream . arrow 1934 directs execution from operation 1932 to operation 1936 . operation 1936 terminates the operations of this flowchart . note that the video conference may be only presented to participants , or may be presented to an audience including more than just the participants . note further that the motion video stream may include more than motion video stream versions for different participants , as well as non - participating audiences . these different versions may provide compatibility with more than one video stream format . by way of example , the non - participating audience may receive an analog video format such as ntsc or pal , while the participants receive a digital motion format such as mpeg1 or h . 261 . arrow 1940 directs the flow of execution from starting operation 1000 to operation 1942 . operation 1942 performs providing a video phone session between the local participant and the second participant based upon the motion video stream . arrow 1944 directs execution from operation 1942 to operation 1936 . operation 1936 terminates the operations of this flowchart . arrow 1950 directs the flow of execution from starting operation 1000 to operation 1952 . operation 1952 performs providing a video kiosk supporting video communication between at least the local participant and at least the second participant based upon the motion video stream . arrow 1954 directs execution from operation 1952 to operation 1936 . operation 1936 terminates the operations of this flowchart . arrow 1960 directs the flow of execution from starting operation 1000 to operation 1962 . operation 1962 performs providing a video training session between at least the local participant and at least the second participant based upon the motion video stream . arrow 1964 directs execution from operation 1962 to operation 1936 . operation 1936 terminates the operations of this flowchart . note that in certain preferred embodiments , at least one of these operations are supported . accordingly , although the invention has been described in detail with reference to particular preferred embodiments , persons possessing ordinary skill in the art to which this invention pertains will appreciate that various modifications and enhancements may be made without departing from the spirit and scope of the claims that follow .	7
the following is a detailed description of example embodiments of the invention depicted in the accompanying drawings . the example embodiments are presented in such detail as to clearly communicate the invention and are designed to make such embodiments obvious to a person of ordinary skill in the art . however , the amount of detail offered is not intended to limit the anticipated variations of embodiments ; on the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the present invention , as defined by the appended claims . according to fig1 , a module 10 comprises a control circuit , which is preferably formed out of electronic components . in the exemplary embodiment shown , module 10 comprises a pid - regulator that includes a non - oscillatable time - delay element of the second order serving as a controlling section . in signal contact with the module 10 is an operating terminal 11 of a high - performance baler which in this context is not described in more detail . the baler , for example , may be a square baler . the operating terminal 11 can be installed in a traction vehicle of the baler . likewise , in signal contact with the module 10 is a pressing pressure sensor 12 . pressure sensor 12 senses the piston pressure of a pressing piston of the square baler and directs it to the module 10 for evaluating its signals . the module also evaluates the sensor signals of a binding twine load sensor 13 , which is preferably embodied as force sensor . the signals of a straw measuring wheel 14 also are provided to the module 10 . module 10 , in addition to the control circuit , also comprises an evaluation unit and which , via its control circuit , controls the throughput of a valve 15 for the pressing pressure of the pressing piston . accordingly , at the start of the pressing operation , after the maximum tensile strength of the binding twine has been entered as maximum value in the operating terminal 11 by an operating person , the operating terminals 11 or the module 10 predetermines a so - called standard pressing pressure . the standard pressing pressure is always selected so that neither tearing of the binding twine nor damaging of mechanical press components are accompanied by this pressing operation . based on this preset pressing pressure , the module 10 , by means of the pressing pressure sensor signals and , based on the signals of the binding twine force sensor 13 . controls a valve 15 at a predetermined press meter monitored by the straw measuring wheel sensor 14 to a pressing pressure for the pressing piston of the square baler . this ensures an optimised utilisation of the baler and of the binding twine , without the binding twine and / or the baler being damaged . according to fig2 , a block diagram for a second embodiment of a pressing pressure regulation for a high - pressure baler is shown that differs from the fig1 embodiment only in that the straw wheel as sensor is omitted . in view of the fact that present pressing pressure regulation the input signal of the straw wheel is omitted , the standard pressing pressure that manifests itself based on the load input ( particularly the input of the maximum tensile strength in the operating terminal 11 on the module 10 ), is not controlled according to a predetermined number of press meters but instead , immediately after the start of the pressing operation , the pressing pressure is controlled through the control circuit provided in the module 10 for the pressing twine and the square baler with respect to their optimised utilisation . fig3 shows a large square baler 20 with a pressing channel 21 in which , by means of a pressing piston 22 linearly moved therein , the pressing operation of the straw - like crop 23 conveyed via a feeding channel ( not shown ), is compacted into a square bale 24 . after a certain number of charges of the straw - like crop 23 , a knotter operation is triggered on a knotter device 26 arranged on an upper wall 25 of the pressing channel 21 . for this purpose , the knotter device 26 is provided with a knotter beak 27 , on which a force sensor 28 is provided . the force sensor 28 serves for detecting forces which occur on a binding twine 29 sensed by the knotter beak 27 . the forces on the binding twine 29 detected by the force sensor 28 are passed on to a processing electronic device 30 for their further processing , which device in the present case is connected to an operating terminal 32 via lines 31 for the exchange of data . furthermore , the processing electronic device 30 is connected via a signal line ( not shown ) to a sensor for sensing the revolutions of a straw measuring wheel 33 ( which sensor is not shown in more detail . at the start of the pressing operation , an operating person sets the maximum load limit , particularly the maximum permissible tensile strength of the binding twine selected for an intended pressing operation on the operating terminal 32 . subsequently , the processing electronic device 30 outputs a so - called standard pressing pressure as preliminary reference variable to a control circuit ( not shown in more detail ) that is preferably integrated in the module 10 for controlling the pressing pressure . once a predetermined number of press metres has been signalled to the processing electronic device 30 by the straw measuring wheel 33 , the processing electronic device 30 releases the preset standard pressing pressure and controls the pressing pressure based on the force sensor signals of the binding twine force sensor and the sensor signals of the pressing piston force sensor for the further pressing operations . the pressing pressure , based on the force sensor signals of the force sensors , is then controlled to a quantity which ensures that neither the binding twine nor the square baler , particularly sensitive mechanical components of this baler , are damaged upon a permanent pressing of a straw - like crop . the following list of reference signs of various elements mentioned above is included ( as follows ), for ease of explanation : as will be evident to persons skilled in the art , the foregoing detailed description and figures are presented as examples of the invention , and that variations are contemplated that do not depart from the fair scope of the teachings and descriptions set forth in this disclosure . the foregoing is not intended to limit what has been invented , except to the extent that the following claims so limit that .	0
fig1 through 8 , wherein like parts are designated by like reference numerals throughout , illustrate example embodiments of an adaptable putter head 10 according to the present invention . although ) the present invention will be described with reference to the example embodiments illustrated in the figures , it should be understood that many alternative forms can embody the present invention . one of skill in the art will additionally appreciate different ways to after the parameters of the embodiments disclosed , such as the size , shape , or type of elements or materials , in a manner still in keeping with the spirit and scope of the present invention . referring to fig1 , a first exemplary embodiment of an adaptable putter head 10 according to the invention is shown . for succinctness , the adaptable putter head 10 will hereinafter be referred to as the putter head 10 . the putter head 10 comprises a center piece 20 and two wings 50 . the center piece 20 includes a sole 30 and a top 40 . the sole 30 rests adjacent the putting surface when the putter is in use . the top 40 is used to attach a putter shaft 60 ( not shown ) at the hosel 48 of the putter head 10 . the center piece 20 further includes a central face 22 for striking a golf ball . each wing 50 includes a planar wing face 52 . in fig1 , the putter head 10 is shown in a play mode , with the wings 50 in a forward , fully extended position . the wings 50 are rotatably attached to the center piece 20 via pin 23 . thus , the wings 50 may be rotated around the axis formed by the pin 23 to move the wings 50 into a retracted folded position , thereby placing the putter head 10 into a training mode . the center piece 20 and wings 50 can be formed of hard or rigid material , and material having a certain amount of resilience depending on the desired striking characteristics of the putter , including but not limited to plastic , rubber , composites , synthetic materials , natural materials , wood and the like . the putter head 10 may likewise be made from metal or composites , while still providing desired functionality to the golfer . the components of the putter head 10 may be machined or cast . one of skill in the art will appreciate that any number of different materials and manufacturing methods may be utilized , such that the present invention is by no means limited to those specifically listed herein . now referring to fig2 , a perspective view from the sole 30 of the adaptable putter head 10 is shown . the wings 50 are able to rotate from an extended position to a retracted folded position . the retracted folded position of the wings 50 is indicated by the wings 50 shown in dotted lines . as illustrated , the top 40 of the putter head 10 serves to hide the wings 50 when placed in a folded position . now referring to fig3 , a detailed exploded view of the adaptable putter head 10 is shown . the center piece 20 serves as an anchor piece for the wings 50 . the wings 50 are rotationally engaged with the center piece 20 by hinge pin 23 . the hinge pin 23 passes through a hole 34 in the sole 30 , a sleeve 54 of the wing 50 and a top hole 46 in the top 40 . each wing 50 includes a cylindrical distal receiver 58 into which cylindrical distal wing magnets 59 are affixed . when the putter head 10 is placed in a training mode with the wings 50 in a folded position , the wing magnets 59 come into contact and hold the wings 50 securely in the retracted folded position during use . each wing 50 further includes a proximal bolt hole 56 into which magnetic adjusting bolts 57 are threadably engaged . the sole 30 of the center piece 20 includes two cylindrical receptacles 36 into which cylindrical sole magnets 37 are affixed . the sole magnets 37 correspond with each magnetic bolt 57 of each wing 50 such that when the wings 50 are in a forward fully extended position , the wings 50 are secured in place by magnetic attraction between the sole magnets 37 and the magnetic adjusting bolts 57 of each wing 50 . in addition to providing magnetic attraction to maintain the wings 50 in an extended position , the magnetic adjusting bolts 57 are adjustable to ensure that the entire striking surface , i . e ., the entire face 12 of the putter , formed by the central face 22 and the wing faces 52 , is properly aligned to form a single planar surface from wing 50 to wing 50 . when the putter head 10 is in play mode with the wings 50 fully extended , the threadably engaged magnetic adjusting bolts 57 may be adjusted via rotation to eliminate any gaps at the interface between the central face 22 and the wing faces 52 and to ensure that the wing faces 52 are properly aligned with the central face 22 . this adjustment feature ensures that the putter head 10 does not strike erroneously when fully extended in a play position . in addition , the adjustment feature allows the putter head 10 to be tuned when first manufactured and throughout its playing life . for example , during repeated use , the sole magnets 37 or hinge pins 23 may wear , requiring adjustment of the magnetic adjusting bolts 57 to ensure the central face 22 and wing faces 52 are aligned . now referring to fig4 , a top plan view of the adaptable putter head 10 according to the invention is shown . the putter head 10 is shown in a play mode , with the wings 50 in an extended position . in play mode , both wing faces 52 are planar aligned with central face 22 of the putter head 10 forming an entire face 12 . pin 23 is shown inserted through top pin hole 46 . the top 40 includes a top surface 42 and a decorative opening 44 in the surface 42 of the top 40 . also shown in the top surface 42 is the hosel 48 through which a putter shaft 60 may be attached to the putter center piece 20 . the location of the hosel 48 is shown for exemplary purposes . the hosel 48 may be located elsewhere on the top surface 42 of the putter head 10 to provide variable performance and adapt to different types of putter shafts or player preferences for balance , among other performance parameters . now referring to fig5 , a rear elevation view of the adaptable putter head 10 according to the invention is shown . the putter head 10 is shown in a play mode , with the wings 50 in a fully extended position . magnetic adjusting bolts 57 are deployed within proximal receivers 56 . distal cylindrical magnets 59 are secured within cylindrical distal receivers 58 . now referring to fig6 , a top plan view of the adaptable putter head 10 in a folded state is shown . the putter head 10 is shown in a training mode , with the wings 50 in a retracted or folded position . the wing faces 52 align with the edges 43 of the top 40 of the putter head 10 . the remainder of each wing 50 is hidden by the top 40 . decorative opening 44 is also adaptable to receive a mating insert weight ( not shown ) which can be used to adjust the weight and moi of the putter to suit a player &# 39 ; s preference or to easily test various swing weights and moi . now referring to fig7 , a rear elevation view of the adaptable putter head 10 according to the invention is shown . the putter head 10 is shown in a training mode , with the wings 50 in a retracted position . the wing magnets 59 hold the wings 50 securely in the retracted folded position via magnetic attraction . now referring to fig8 , an illustration of the putter head 10 with wings 50 fully extended is shown . the putter head 10 is configured to receive a putter shaft 60 acceptable to the preferences of the golfer . a golf ball b is positioned adjacent the central face 22 . thus deployed , a golfer is now able to use the same putter for practice as for actual play . the present invention has been particularly shown and described with respect to certain preferred embodiments and features thereof . however , it should be readily apparent to those of ordinary skill in the art that various changes and modifications in form and detail may be made without departing from the spirit and scope of the inventions as set forth in the appended claims . the inventions illustratively disclosed herein may be practiced without any element which is not specifically disclosed herein .	0
in order to determine the immunoactivity of the lysozyme dimer , an assay in human peripheral blood lymphocytes with facs analysis has been employed . mitogenic stimulation in human peripheral lymphocytes is a well established method to test reactivity of the most important cells of the immune system . to test influences of therapeutical substances on the activation and proliferation of lymphocytes from healthy blood donors , the mitogen is added in a suboptimal dose and the lymphocyte response is finally measured quantitatively with immunorelevant parameters . the results are compared with the control value measured without medication . to stimulate lymphocytes , cona in a concentration of 20 μg / ml of medium was used . initial cell concentration was 10 6 cells / ml . the short - time cultures in a co 2 incubator was carried out during one ( il - 2 receptors on lymphocytes and hla - dr ) or two days ( all other tests ). the following parameters have been measured as criteria for cellular activation : the following observations regarding cell products were made in the culture supernatant : neopterin -- produced by t - lymphocytes during the immune response and in stimulated cultures -- in the present experiments was not markedly elevated by the lysozyme dimer above the control value in cona stimulated cells without the tested dimer . with increased concentration of the tested dimer , the neopterin values were slightly higher . similarly , β - 2 - microglobulin values in all concentrations of the lysozyme dimers fluctuated around the control value . il - 2 receptors -- being shed from the lymphocyte surface during culture and giving information about total il - 2 receptor turnover -- were on a comparable level with the il - 2 receptors on the lymphocyte surface ( reported below ) and showed a clear suppression at the highest concentration of the tested dimer . interleukin - 6 showed a clear tendency to dose - dependent higher values in higher concentrations . this molecule is very important in hematopoiesis , cell differentiation and immune reaction . in the test , the first three values had to be extrapolated , since the highest standard was only 2000 pg / ml . the results relating to the remaining molecules are shown in table 1 below . unlike the interleukin - 6 , the tnf - α was unexpectedly table 1______________________________________influence of lysozyme dimer on the human peripheral blood lymphocytes______________________________________ hla - dr / no sample cd3 il - 2 rec ki - 67 / cd8 ki - 67 / cd4______________________________________control 3 . 3 8 . 9 6 . 0 2 . 71 . 1 mg / ml 2 . 2 2 . 6 4 . 8 5 . 3 2 . 0 . 3 mg / ml 1 . 9 6 . 3 4 . 1 3 . 0 3 . 0 . 1 mg / ml 3 . 0 6 . 1 6 . 5 ( 6 . 9 ) 4 . 33 μg / ml 3 . 0 5 . 9 6 . 3 3 . 0 5 . 10 μg / ml 3 . 4 6 . 0 7 . 7 3 . 7 6 . 3 . 3 μg / ml 2 . 4 5 . 0 7 . 5 3 . 7 7 . 1 μg / ml 2 . 5 4 . 9 7 . 0 4 . 1 8 . 0 . 3 μg / ml 3 . 3 5 . 8 7 . 5 3 . 9 9 . 0 . 1 μg / ml 2 . 8 4 . 0 7 . 9 3 . 8 10 . 33 ng / ml 3 . 1 4 . 6 8 . 0 4 . 1______________________________________no sample tnf thym .- kinase ifn - α______________________________________ control 205 . 11 9242 4 . 971 . 1 mg / ml 38 . 07 923 8 . 81 2 . 0 . 3 mg / ml 17 . 19 10914 9 . 44 3 . 0 . 1 mg / ml 13 . 75 7254 17 . 96 4 . 33 μg / ml 36 . 11 9525 3 . 67 5 . 10 μg / ml 22 . 22 5492 7 . 54 6 . 3 . 3 μg / ml 54 . 91 5198 6 . 26 7 . 1 μg / ml 18 . 47 5840 33 . 91 8 . 0 . 3 μg / ml 14 . 47 6839 10 . 07 9 . 0 . 1 μg / ml 94 . 16 3672 4 . 97 10 . 33 ng / ml 172 . 46 7312 10 . 07______________________________________ present in culture supernatants in dramatically reduced concentrations , except the last two dilution steps , which proved to be ineffective in suppression of tnf concentration . thymidine kinase is measured in the lymphocyte cytoplasma after freezing and thawing of the cell pellet . the thymidine kinase is upregulated in dividing cells making it a good marker for cell proliferation . table 1 data show a depression by the highest tested lysozyme dimer concentrations ; in the other dilution steps , no clear tendency can be seen . interferon - α , in turn , under the same conditions shows values above the control value of cona alone at higher concentrations . a visible increase occurs from the second value to the third dilution . hla - dr / cd3 , being a histocompatibility marker , is expressed on activated t - lymphocytes during the immune reaction . the results obtained show a certain percentage of activated t - cells in the control culture ; with various concentrations of lysozyme dimer in the cultures , the values vary around the control value . il - 2 receptors on lymphocytes : interleukin - 2 is a cytokine produced by t - helper lymphocytes after activation through il - 1 . il - 2 is autocrine and paracrine . t - helper lymphocytes not only produce il - 2 but are also stimulated to proliferation by this molecule . the receptors for il - 2 at the surface of t - helper lymphocytes are upregulated upon activation . table 1 shows that at highest concentration of lysozyme dimer there is a marked suppression of the il - 2 receptors on lymphocytes , while the remaining values do not differ more than within the biological bandwidth . table 1 also contains data related to ki - 67 / cd8 and ki - 67 / cd4 . ki - 67 is a proliferation molecule appearing in cells undergoing mitosis . ki - 67 is an important parameter to assess stimulated cells and in tumor diagnosis . in the reported results , a slight inhibition of cell proliferation is seen in ki - 67 suppressor ( cd8 ) cells with the highest two doses of lysozyme dimer . in helper ( cd4 ) lymphocytes with the highest dose , there appears to be substantial increase in the percentage of positive cells . with lower doses , the percentage of cells expressing ki - 67 / cd4 is slightly higher than the control value . the immunological parameters listed above and chosen by their potential importance in the immune response were analyzed with the method based on measuring the influence of a tested substance on suboptimally concanavalin a ( cona ) stimulated human peripheral lymphocytes . the method being well established , sensitive and allowing to evaluate many different parameters . at some 20 concentrations of lysozyme dimers there are marked differences of the test results as compared to the values of lymphocytes stimulated with cona alone , while as regards for example tnf and ifn - a , the observed effects are generally within the range of all tested dilutions . laboratory tests have been performed to determine the effect of lysozyme dimer on the phagocytic activity of milk and blood cells in vitro . it was earlier determined that in the standard in - vitro test , lysozyme dimer does not inhibit proliferation of the microorganisms isolated from the infected mammary glands of cows . as the clinical use of intraudderly and simultaneously intravenously administered lysozyme dimer effectively eliminates the infection of the mammary glands in cows , it was clear that the main antibacterial mechanism in mammary glands of cows is phagocytosis . accordingly , blood and milk of both healthy and infected cows were used in in - vitro tests aiming to determine the effect of lysozyme dimer on phagocytosis . for comparison , the experiments were conducted with the same concentration of substance tested and the same incubation time using the cells isolated from healthy and infected cows or even from an infected and a healthy section of the mammary gland of the same cow , in order to eliminate individual response differences . in the tests performed , both the purified dimeric form and a mixture of dimer and small fractions of trimers and higher oligomers of lysozyme were added to the blood or milk of the healthy and infected cows in concentrations of 25 -- 0 . 25 pg / ml and the mixture was incubated at 37 ° c . for 0 . 5 - 24 hours . the percentage of phagocytizing cells ( phagocytosis index according to the method of wisniewski et al ., zycie wet . 1994 69 : 168 ) and the percentage of granulocytes nitroblue tetrazolium test - positive ( according to the method of park , b ., lancet , 1968 , 22 : 532 ) were determined for each sample . the lysozyme dimer enhances phagocytic activity of leukocytes in the in - vitro tests . the effects are dependent on the dose and on the incubation time . higher concentrations of lysozyme dimer are necessary to activate milk leukocytes than blood leukocytes . excessively high concentrations of the dimer slightly reduce phagocytic activity in - vitro . selected results -- mainly showing that as long as the post - polymerization reaction mixture does not contain any cytotoxic monomeric form of the dimer , comparable results are obtained for highly purified and less pure dimerized lysozyme -- are shown in the following tables 2 and 3 in which a term &# 34 ; lysozyme dimer +&# 34 ; is used to indicate a composition containing a small fraction of trimers and higher oligomers of lysozyme as mentioned earlier in the specification . table 2______________________________________effect of lysozyme dimer on phagocytic activity of milk leukocytes from healthy cows ( concentration of the dimer 20 μg / ml , incubation time 3 hours ) healthy cow milk leukocytesindicator preparation cow no . 477 cow no . 463______________________________________ % phagocytosis control 77 . 8 80 . 0 lysozyme dimer + 100 100 lysozyme dimer 92 . 6 100 phagocytosis control 2 . 7 4 . 1 index lysozyme dimer + 4 . 4 6 . 4 lysozyme dimer 4 . 8 8 . 4 % reduction control 3 . 4 2 . 5 nbt lysozyme dimer + 5 . 7 3 . 8 lysozyme dimer 3 . 4 6 . 8______________________________________ table 3______________________________________effect of lysozyme dimer on the phagocytic activity of milk leukocytes from infected cows ( concentration of the dimer 20 μg / ml , incubation time 30 min .) infected cow ( no . 490 ) milk leukocytes infected / indicator preparation section healthy section______________________________________ % phagocytosis control 98 58 lysozyme dimer + 98 90 lysozyme dimer 100 100 phagocytosis control 10 . 9 2 . 7 index lysozyme dimer + 8 . 7 14 . 9 lysozyme dimer 10 . 9 8 . 9 % reduction control 4 . 2 4 . 2 nbt lysozyme dimer + 5 . 9 8 . 4 lysozyme dimer 5 . 5 7 . 0______________________________________ / = on set of inflammation ; cow not treated it is clear that the degree of purification of lysozyme dimer has no marked effect on the observed phagocytic activity of milk leukocytes . it may appear further that the effector cells may be granulocytes . in the further examples , results of in - vivo studies are reported . for the clinical tests , the formulation of 2 mg of lysozyme dimer in 10 ml of pbs solution was used . this preparation is referred to as klp - 602 . when administered intravenously , klp - 602 was shown to stimulate phagocytic activity of blood granulocytes in healthy and sick calves and in healthy foals as well as in milk cows following intraudder application . the effect is manifested through an increased number of neutrophils and increased ability to absorb staphylococcus and to reduce nbt . this phenomenon occurs primarily during the first 12 - 24 hours following the injection of the preparation . the effect of klp - 602 upon phagocytic activity in the udder depended upon the dose and the form of the drug and the response of the individual animal . lysozyme dimer was used in the therapy of infectious diseases of cattle , pigs , horses and dogs . in different doses and at different time intervals , the preparation was administered intravenously , intramuscularly , subcutaneously , intraudderly and intrauterinely . the medication was administered to 346 cows , 274 calves , 110 sows and male pigs , 294 piglets , 709 sucking piglets , 35 foals and 107 dogs . alternative treatment was applied as a control . due to the nature of the test animals , none was left without therapeutical treatment for morality reasons . nevertheless , the conclusions could be drawn in comparison to the clinical picture of the treated diseases known from veterinary literature . klp - 602 was most effective in the treatment of diseases affecting pigs . 100 % or nearly 100 % of animals recovered from the following diseases : post - partum agalactia ( mma syndrome ), dysentery , pyometritis , influenza and colibacillosis . application of the medicament in cases of edema disease and bronchopneumonia gave slightly less prominent but still significantly better results than those obtained by alternative therapies . prompt recession of diarrhoea ( usually during the first 24 hours ) and fever as well as reappearance of milk secretion of particular importance in cases of post - partum udder and uterine inflammations ( saving the life of the piglets ) could be observed . the effectiveness of klp - 602 therapy in comparison to alternative treatments is shown in table 4 below . when treated with klp - 602 , 100 % of foals suffering from enteritis and 83 . 3 % of foals suffering from bronchopneumonia have recovered faster than the control group with known preparations . klp - 602 was tested in the treatment of some diseases in dogs , such as folliculitis ( 100 % effective ), infection of the upper and lower respiratory tracts and infection of gastrointestinal tracts manifesting itself through diarrhoea . prevalent in this group was parvovirosis , which is known to be practically an incurable disease . nevertheless , a recovery rate of about 75 % was observed in parvovirosis cases . in the tests performed with the animals affected with naturally occuring diseases , as described above , several important observations were made : 1 . the therapy proved to be effective and very simple in treatment of diseases which have a multi - factor etiology and pathogenesis ( such diseases are prevalent in animal populations and are hard to handle especially in the breeding farms where epidemic spreading of diseases is very easy ). such findings prove the modulating effect of the lysozyme dimer on the natural defensive mechanisms . table 4__________________________________________________________________________animals treated with klp - 602 animals treated with other prepartionsno . of duration recovered not recovered no . of preparation recoverycases ( days ) number % number % cases used duration % __________________________________________________________________________i . colibacillosis of piglets434 1 - 2 421 97 13 3 400 . sup . x antibiotics 3 - 5 75 - 80 . sup . x glucose , vit . bii . dysentery of pigs29 1 - 2 29 100 -- -- 219 antibiotics 5 - 9 75 stolmed , ridowetiii . post - partum agalactia30 1 - 2 30 100 -- -- 40 . sup . x antibiotics 3 - 5 80 . sup . x cortisone , sulfamideiv . influenza of piglets38 1 - 5 38 100 -- -- 200 . sup . x antibiotics 3 - 9 60 - 80 . sup . x ( latent formulations ) v . morbus oedematosus82 1 - 3 78 95 4 5 120 . sup . x antibiotics 3 - 6 60 . sup . x penicillin , tetra - cycline vit . b , fluids + glucose__________________________________________________________________________ . sup . x approximate data 2 . the therapy proved to be effective in diseases which involve in their natural course the presence of endotoxic shock or other disorders such as high and long - lasting fever , affecting the status of an animal for long period of time after recovery and thus extremly detrimental for the animals such as horses ( foals )-- bred for races and other sports , as well as those bred mainly for the food industry , in which case the production costs are the critical issue . quick recoveries will allow significant reduction of costs for the treatment of such diseases . 3 . results observed in vivo confirm suppressed levels of tnf in various naturally occuring infections treated with lysozyme dimers and thus support the invention as claimed . the effect of lysozyme dimer on the activity of antibiotics against various different microorganisms was studied in order to select the bacteria for further tests , to determine the doses of antibiotics most effective for the selected microorganisms and to find the range of the lysozyme dimer concentrations within which the expected effects will be observed . in the experiments , two lots of lyophilized purified lysozyme dimer were used , one produced in 1991 and another one produced in 1992 . in the experiments , antibiotics available on the polish market , as supplied by polfa , a polish manufacturer of the drugs , such as penicillin , neomycin , erythromycin , cephalosporine ( sefril ), were used . the antibiotics to be tested were suspended in a buffered nacl - solution ( pbs - biomed ) or in a bovine serum . a lysozyme dimer was then added to the suspension in such a manner that in the tested samples the concentration of the dimer was always 5 μg / ml . the concentrations of the antibiotics being tested were different in each test due to varying sensibility of the microorganisms used . the effect of the antibiotic alone or in combination with a lysozyme dimer was tested in a pbs or bovine serum suspension in vitro on escherichia coli , salmonella enteritidis , staphylococcus aureus and streptococcus uberis isolated from sick animals . laboratory strains of sarcina lutea 9341 atcc and staphylococcus aureus 209 p were also used in the experiments . due to the preliminary character of the tests , each antibiotic was tested against 1 , 2 or 3 different kinds of bacteria as follows : a 0 . 05 ml portion of an 18 hours broth culture of the bacteria strain to be tested was added to a 14 ml sample of enriched agar ( biomed ). the mixture was stirred and poured out on a plate of 10 mm diameter . after cooling and solidification of the agar , sterile cylinders were placed thereon , and the cylinders were filled with the antibiotic solutions to be tested . a 10 mg sample of the antibiotic to be tested was initially dissolved in pbs ; next , the required volume of this solution was added to the predetermined volume of pbs or bovine serum so as to obtain a concentration of the antibiotic as close as possible to mic ( minimal inhibitory concentration ); solutions of 3 different concentrations were always prepared . 10 mg of lyophilized lysozyme dimer was initially dissolved in 10 ml of pbs . further dilutions were prepared with either pbs or with bovine serum and added to the antibiotic solutions prepared earlier as described above . the following combinations were tested : the concentration of antibiotic was the same in each cylinder ; the concentration of the lysozyme dimer was 5 μg / ml . after the cylinders were filled with the solutions , the plates were kept at room temperature for 2 hours ; then , the cultures were incubated at 37 ° c . the plates were removed from the heater after 18 hours of incubation , and the diameter of the bacteria growth inhibition zone ( lack of colonies ) was measured around the cylinders . no difference was found in the size of bacteria growth inhibition zones around the cylinders filled with the antibiotic suspensions in pbs without and with addition of lysozyme dimer in a concentration of 5 μg / ml . the size of the inhibition zone , however , decreased around the cylinders filled with the antibiotic suspension in bovine serum , but increased -- around those filled with the antibiotic + lysozyme dimer suspensions in bovine serum . the zones were bigger than those seen around cylinders filled with pbs suspensions as well as bigger than those around cylinders filled with serum suspensions of antibiotics alone , free of lysozyme dimer . the phenomenon occured in the tests with penicillin used against sarcina lutea . ampicillin showed a synergism in combination with lysozyme dimer in inhibiting in vitro growth of escherichia coli , salmonella enteritidis and staphylococcus epidermidis . it was noted that there is an increase of activity of erythromycin in the presence of lysozyme dimer against staphylococcus aureus 209 p and streptococcus uberis as well as of sefril -- against staphylococcus aureus 209 p . escherichia coli and salmonella enteritidis were resistant to this antibiotic . the increase of antibacterial activity of the tested antibiotics was observed only when the bovine serum was used as the solvent . as a rule , the increase averaged 50 %, but in some instances , the presence of lysozyme dimer resulted in a 100 % increase in the activity of the antibiotics . lysozyme dimer ( without any conservant ) in concentrations of 5 μg / ml exhibits in vitro a synergism with some antibiotics used in mic ( minimal inhibitory concentration ) in the presence of bovine serum in inhibiting bacteria growth . the results obtained until now make it clear that further studies will be essential . ito et al have recently reported that tnf - α can antagonize the anti - hiv activity of azt ( ito , m . et al . : &# 34 ; tumor necrosis factor antagonizes inhibitory effect of azidothymidine on human immunodeficiency virus ( hiv ) replication in vitro ; biochem . biophys . res . commun . 1990 , 166 ; 1095 - 1101 ). aids patients in an advanced stage suffer from many occasional infections . some infective agents may induce elevation of tnf - α , il - 6 and other cytokines that may be either immunosuppressive or may promote hiv replication . accordingly , treatment with azt alone is not sufficiently effective . in order to increase the anti - hiv activity of azt , it is therefore proposed to combine the azt treatment with the administration of lysozyme dimer to inhibit the synthesis of tnf -- the factor antagonizing an anti - hiv activity of azt .	0
referring now to the accompanying drawings , a description will be given of an embodiment of the present invention . fig1 is a block diagram illustrating an embodiment in which the present invention is applied to a display apparatus such as is used for data imprinting in a camera . a known display unit 100 has the finite number of 30 digits . a display driving unit 101 is connected to the display unit 100 and is constituted by a decoder and a driver which are both known . a known cpu ( central processing unit ) 102 controls the overall operation . a rom ( read - only memory ) 103 is a memory in which the programmed operation of the display apparatus has been stored . a ram ( random access memory ) 104 stores imprinting character data and comment data and has a digit number counter 104a and the like . display items , each of which has a fixed number of digits and is provided with contents such as those shown in nos . ○ 1 to ○ 5 in fig6 are stored in the ram 104 in interlinking relationship with a photographing operation . the number of digits of each of these display items is predetermined , and the display items are of such nature that they would lose their meaning as information if any one of the characters is missing . in addition , another display item having an arbitrary number of digits , which has contents such as those shown in no . ○ 6 in fig6 and is supplied through a keyboard unit 109 , is also stored in the ram 104 . the display items nos . ○ 1 to ○ 5 each having a fixed number of digits are items of information which are output automatically from a known camera control unit 105 or from a known built - in clock circuit 106 with a calendar during the shooting of a photograph , and the number of digits in each item has been predetermined . the display item no . ○ 6 having an arbitrary number of digits is such individual information concerning which the photographer wishes to carry out recording , data imprinting or the like independently or simultaneously with display items nos . ○ 1 to ○ 5 each having a fixed number of digits , the number of digits of the display item no . ○ 6 being arbitrary in accordance with the intention of the photographer . in addition , it is also possible to change the number of information digits of the display item no . ○ 6 in conformity with the remaining number of digits in the display unit 100 , and the priority of display thereof is lower than those of the aforementioned display items each having a fixed number of digits . a display item selecting unit 107 is constituted by a slide switch or the like and is adapted to determine whether or not the respective display items stored in the ram 104 are to be displayed . a decoder 108 transmits to the cpu 102 the data input from the keys of the display item selecting unit 107 , while a decoder 110 transmits to the cpu 102 english characters , kana characters , or the like from a keyboard unit 109 . among display items nos . ○ 1 to ○ 6 stored in the ram 104 , with respect to the data and time ( hour , minute and second ) of the display items nos . ○ 1 and ○ 2 , the ram 104 fetches data from the clock circuit 106 . with respect to display item no . ○ 3 on the tv / av data as well as display item no . ○ 4 the lens data , the ram 104 fetches data from the camera control unit 105 . the data on the number of photographed frames in display item no . ○ 5 is fetched to an imprinting data storing area from a counter provided in the ram 104 and adapted to increment by one each time a release signal is received from the camera control unit 105 . in addition , as for data on the comment in display item no . ○ 6 , data stored in a predetermined storing area 104b of the ram 104 is fetched to the imprinting data storing area . the respective data are stored in an imprinting data storing area 104c located in the ram 104 by the operation of the cpu 102 in accordance with the state of the selecting unit 107 which selects the display or non - display of the respective display items , and the data stored in the area 104c is displayed by the display unit 100 via the display driving unit 101 . when display items nos . ○ 2 , ○ 3 , ○ 4 , and ○ 5 are to be displayed , as shown in fig7 ( a ), the last two digits of display item no . ○ 5 will exceed the number of digits of the display unit 100 , and , if this state continues , erroneous information will be displayed and imprinted as faulty data . accordingly , in the present invention , as shown in fig7 ( b ), the data of display item no . ○ 5 is not displayed and the display of incomplete information is inhibited . furthermore , when the number of digits of the display items each having a fixed number of digits does not fill the number of digits of the display unit 100 , the arrangement is such that the surplus space can be used effectively by filling the same with the display item having an arbitrary number of digits , as shown in fig7 ( c ). in addition , as shown in fig8 ( a ), in a state in which the display item having an arbitrary number of digits is already being displayed , when a display item having a fixed number of digits is selected , the overall display of the display items with a fixed number of digits can be displayed with priority to the display of the display item having an arbitrary number of digits . referring now to the flowchart of fig2 a more detailed description will be made of the operation of the cpu 102 . a description will be given on the assumption that it has been determined by the selecting unit 107 that the date data and the data on the number of photographed frames are not to be displayed , but the time data , tv / av data , lens data , and comment data are to be displayed . it is assumed that a case where the display is selected by the selecting unit 107 is on , and a case where the non - display is selected thereby is off . first , initialization is effected in steps 1 , 2 and 3 . in other words , the imprinting data storing area 104c located in the ram 104 is cleared , and the contents of the digit number counter and the comment counter are set to zero . ( in the state shown in fig3 ( a ), the data pointer designates a place to which an ensuing input is to be effected , and is always at a position of the digit number counter + 1 .) in step 4 , determination is then made as to whether or not the date data in display item no . ○ 1 is on . if on , steps 5 and 6 are executed , but since it is off in this case , as described above , the operation proceeds to the next step . in step 7 , determination is made as to whether or not the time data in display item no . ○ 2 is on . since it is on in the case , 9 is added to the digit number counter 104a in step 8 , and the time data is transferred to the imprinting data storing area 104c ( the state shown in fig3 ( b )). in step 10 , determination is made as to whether or not the tv / av data in display item no . ○ 3 is on . since it is on in this case , 10 is added to the digit number counter 104a in step 11 , and the tv / av data is transferred to the imprinting data storing area 104c . in step 13 , determination is made as to whether or not the lens data in display item no . ○ 4 is on . since it is on in this case , 6 is added to the digit number counter 104a in step 14 . when all the display items ○ 1 to ○ 6 are on , i . e ., when an instruction is given to display all the items ○ 1 to ○ 6 , the number of display digits has exceeded the number of digits of the display unit 100 , so that determination is made in step 15 as to whether or not the digit number counter 104a has exceeded the 30 digits , which is the number of digits of the display unit 100 . if it has exceeded that number , step 22 is executed , 6 is subtracted from the digit number counter by way of the number of digits of the lens data . in this case , however , the number of digits has not exceeded 25 ( 9 + 10 + 6 ), so that the lens data is transferred to the imprinting data storing area 104c ( the state shown in fig3 ( c )). in step 17 , determination is made as to whether or not the film number data in display item no . ○ 5 is on . if on , steps 18 to 21 are executed , but since it is off in this case , the operation proceeds to an ensuing step . in step 23 , determination is made as to whether or not the comment data in display item no . ○ 6 is on . since it is on in this case , the number of digits of the comment is first calculated . this calculation is executed in the form of consecutively returning to an immediately preceding area from a final area in the comment data storing area 104b provided in the ram 104 . a character which does not constitute a space is searched , and the number of digits of the comment is calculated from the number of digits until the character is found ( see fig3 ( e )). in step 25 , determination is made as to whether or not the content of the comment counter 104e is equivalent to the number of digits of the comment obtained in the aforementioned calculation . since the content of the comment counter 104e is zero in the state in which no comment data has been transferred to the imprinting data storing area 104c , the operation proceeds to step 26 . in step 26 , determination is made as to whether or not the digit number counter 104a has equaled 30 digits . in this case , since the number of digits is still 25 , as described above , the operation proceeds to step 27 . after , in step 27 , one character is transferred from the comment data storing area 104b to the imprinting data storing area 104c , both the digit number counter 104a and the comment counter 104e are incremented by one in steps 28 and 29 , respectively , and the operation then returns to step 25 . when all the characters of the comment data have been transferred or when the imprinting data storing area 104c has reached digits as a result of repeating the operation in steps 25 through 29 , this repeated routine is computed in step 25 or 26 . ( fig3 ( d )) shows a state in which three characters of the comment have been transferred ). in the above , a description has been given of a case where the date data in display item no . ○ 1 and the film number data in display item no . ○ 5 are off , while the time data in display item no . ○ 2 , the tv / av data in display item no . ○ 3 , the lens data in display item no . ○ 4 , and the comment data in display item no . ○ 6 set to on . as other examples , however , a description will be given of the following two examples : ( a ) the date data in display item no . ○ 1 and the comment data in display item no . ○ 6 are off , while the time data in display item no . ○ 2 , the tv / av data in display item no . ○ 3 , the lens data in display item no . ○ 4 , and the film number data in display item no . ○ 5 are on . ( b ) the comment in display item no . ○ 6 is on , while , as for the other display items , the time data in display item no . ○ 2 and the tv / av data in display item no . ○ 3 are sequentially turned on from the state of off . in example a , the operation is the same up to step 16 as the above - described example ( the state in which fig3 ( c )= fig4 ( a ).) in step 17 , determination is made as to whether or not the film number data in display item no . ○ 5 is on . in this case , since it is on , eight is added to the digit number counter 104a in step 18 ( the state shown in fig4 ( b )) where determination is made as to whether or not the digit number counter has exceeded 30 digits . in this case , because the digit counter number exceeds that figure since 25 + 8 = 33 & gt ; 30 , step 20 is not executed . then , in step 21 , eight is subtracted from the digit number counter 104a by way of the counted number of digits of the film number information counted in step 18 , i . e ., the content of the counter 104a is returned to its formed state , and the operation proceeds to an ensuing step . in step 23 , determination is made as to whether or not the comment data in display item no . ○ 6 is on . since it is off in this case , steps 24 to 29 are not executed , and the operation is completed ( the state shown in fig4 ( c )). in fig4 ( b ), the data pointer remains to designate 26 , but this is because eight is added to only the digit number counter 104a and the actual transmission of the film number data has not been effected , so that the data pointer does not move . in the above - described example b , since only the comment data in display item no . ○ 6 is on , after steps 1 , 2 and 3 are executed , the operation passes through &# 34 ; no &# 34 ; in each of the steps 4 , 7 , 10 , 13 , and 17 . in step 23 , determination is made as to whether or not the comment data in display item no . ○ 6 is on . since it is on in this case , in step 24 , the number of characters of the comment data is calculated , as described above . characters are sent one at a time in step 27 from the comment data storing area 104b in the ram 104 to the imprinting data storing area 104c in the ram 104 until , in step 25 , the content of the comment counter 104e becomes equal to the number of digits of the comment obtained in the above - described process . when the comment counter 104e in the ram 104 becomes equal to the number of digits of the comment , the operation moves from step 25 to another step ( the state shown in fig5 ( a )). next , with respect to a case where the time data in display item no . ○ 2 has been set to on , after steps 1 , 2 and 3 are executed . in step 4 , the operation proceeds along the flow of no . in step 7 , the operation proceeds along the flow of yes , steps 8 and 9 are then executed , and the operation proceeds to step 10 . since only the time data in display item no . ○ 2 has been set to on and other items are still off , the operation proceeds along the flow of no . since the result of the determination is yes in step 23 , steps 24 to 29 are executed , as described above . incidentally , since , in this example , only steps 8 and 9 are added to the above - described operation , a detailed description of the operation will be omitted ( the state shown in fig5 ( b )). furthermore , with respect to a case where the tv / av data in display item no . ○ 3 is set to on , after steps 1 , 2 and 3 are executed , the result of determination in step 4 is no , and the result of determination in step 7 is yes , so that steps 8 and 9 are executed , and the operation proceeds to step 10 . since the result of determination in step 10 is yes , steps 11 and 12 are executed , and , in steps 13 and 17 , the operation proceeds along the flow of no ( the state shown in fig5 ( c )). in step 23 , determination is then made as to whether or not the comment data in display item no . ○ 6 is on . since it is on in this case , the number of digits of the comment data is calculated in step 24 . ( see fig5 ( e ), the number of characters of the comment = 17 .) then , in step 25 , determination is made as to whether or not the comment counter 104e has become equal to the number of digits of the comment . in step 26 , determination is made as to whether or not the digit number counter 104a has become equivalent to 30 digits . since the number of digits is still 19 , the operation proceeds with a further step . in step 27 , one character is transferred from the comment data storing area 104b to the imprinting data storing area 104c . in steps 28 and 29 , both the digit number counter 104a and the comment counter 104e are incremented by one , and the operation returns to step 25 . in this case , after 11 digits are transferred from the comment data storing area 104b to the imprinting data storing area 104c , the digit number counter 104a assumes 30 characters . hence , before the operation proceeds along the flow of yes in step 25 , the operation proceeds the flow of yes in step 26 ( the state shown in fig5 ( d )). in the above - described embodiment , priorities of display are set on the display items having fixed numbers of digits in the order of display item no . 1 to display item no . ○ 5 , and yet these display items may be arranged and displayed in the order selected by the display item selecting unit 107 . as has been described above , in accordance with the present invention , in cases where items to be displayed simultaneously are numerous and there is the possibility of the display information being displayed with a part thereof omitted , the display of that display item is inhibited . accordingly , it is possible to obtain an advantage in that the display leading to erroneous information and wasteful display can be prevented .	6
referring now to the drawings and particularly to fig1 which illustrates a reset circuit for a computer system having a modem with a variety of additional modem functions . the reset circuit is located outside the modem 110 and includes a reset switch 100 provided on a front or side panel of a personal computer for allowing a user to reset operation of the personal computer , and an inverter 120 coupled to receive a reset signal reset generated from the personal computer in accordance with a program contained in the personal computer for generating an inverted response to a reset port of the modem 110 . the reset switch 100 also generates another reset signal upon a manual depression of the reset switch 100 . when the reset signal reset from the personal computer or another reset signal from the reset switch 100 is applied to the reset port of the modem 110 , the modem 110 stops an additional modem mode or a specific program being executed and switches back to a basic modem mode for the exchange of digital data . if the modem 110 is malfunctioned even during the normal operation of the personal computer , the modem 110 must be reset by the depression of the reset switch 100 on the personal computer . when the reset switch 100 is depressed , the modem 110 is initialized to be restored back in a basic modem mode for the exchange of digital data . however , to initialize the modem 110 , the computer must be previously initialized . however , the computer requires time to be normally operated and thereafter to enable the modem to be set in a basic modem mode . moreover , since the reset signal reset is not generated from the computer when the computer is malfunctioned , the modem 110 can not be restored in the basic modem mode . in this case , the modem 110 can be reset only by the reset switch 100 of the personal computer . in the reset circuit as shown in fig1 there arises a problem that any one of additional modem functions being performed in the modem can not be rapidly changed into a basic modem mode for the exchange of digital data , when the computer is malfunctioned . during the mal - operation of the computer , the computer must be re - started by warm or cold booting in order that the modem is reset to be set in a basic modem mode . during the normal operation of the computer , the user must operate the computer in accordance with a reversely setting sequence of an additional modem function in order that the modem is charged from any one of additional modem functions to a basic modem mode . as a result , the modem can not be rapidly restored from any additional modem mode into a basic modem mode . referring now to fig2 which illustrates an especially designed reset circuit for a computer system having a modem constructed according to the principles of the present invention . this novel reset circuit generates a reset signal in accordance with a specific key entry , which is provided from a modem - supported personal computer . the reset signal is applied to a reset port of the modem 70 which is located inside the personal computer . then the modem 70 permits a specific additional modem function being performed to be rapidly restored in a basic modem mode for the exchange of digital data . in addition , if there arises an error on an operation system program being performed in the computer , a specific program being performed for the modem is immediately stopped and then rapidly changed back into the basic modem mode . as shown in fig2 the novel reset circuit includes an address selector 10 , a first decoder 20 having input ports coupled to receive a plurality of address signals a0 ˜ a5 from the personal computer , a second decoder 30 having input ports pa0 ˜ pa2 coupled to receive a plurality of data signals da0 ˜ da3 from the personal computer , a delay 50 , and an or gate 60 for generating a modem reset signal to the reset port of the modem 70 for resetting operation of the modem 70 . the first decoder 20 serves to decode the address signals a0 ˜ a5 to generate a port signal port . an enable signal aen from the personal computer is applied through an inverter in1 to an enable terminal of the decoder 20 . the address signals a0 ˜ a5 are provided from the personal computer when a specific key entry is entered by the user , or when there arises an error in an operation system program in the personal computer . in case that the decoder 20 is enabled in response to logic level of the enable signal aen from the personal computer , the decoder 20 starts to decode the address signals through the input ports thereof . a specific address signal , for example , the address signal a2 , of the address signals a0 ˜ a5 is applied through another inverter in2 to the decoder 20 , or applied directly to the decoder 20 by means a jumper switch js . the jumper switch js is provided to prevent port conflict . for example , if there is no port conflict in the decoder 20 when the address signal a2 is applied through the inverter in2 to the decoder , the jumper switch js need not be used . if there is port conflict in the decoder 20 , a contact terminal c1 is electrically connected with a contact terminal c3 by means of the jumper switch jw , so that the address signal a2 is applied directly to the decoder 20 . the inverter in2 and the jumper switch js constitute an address selector 10 for generating an anti - conflicting port signal . this is because the signal a2 is provided directly to the first decoder 20 by means of the jumper switch js and is provided through the inverter in2 to the first decoder 20 . the port signal port generated from the first decoder 20 is applied to an enable terminal / e1 of a second decoder 30 . this decoder 30 then receives data signals da0 , da1 and da3 though input ports pa0 ˜ pa2 thereof and decodes the same so as to generate a signal data serving as a modem reset signal . in addition to the data signals da0 , da1 and da3 , data signals da2 and da4 are provided from the personal computer and used as information for selecting additional modem functions of the modem 70 . the decoder 30 decodes the data signals da0 , da1 and da3 , and generates several signals through output ports thereof . one of the several signals generated thus is the signal data serving as a modem reset signal , and other signals are used to select the additional modem functions of the modem 70 . the modem reset signal data is supplied to a delay circuit 50 to be delayed for a constant time . the delayed modem reset signal , as well as another reset signal rd , is provided to input terminals of the or gate 60 whose output is connected to the reset port of the modem 70 . the delay circuit 50 is provided to assure that the modem reset signal corresponds to a specific reset active time of the modem 70 . the reset signal rd is provided from a reset switch ( not shown ), or a personal computer in which a specific program is executed . as a result , if any one of the above reset signals is applied to the or gate 60 , the modem 70 in response thereto is reset . the additional modem mode being performed for the modem 70 is then stopped and rapidly restored into a basic modem mode for the exchange of digital data . also , when there is an occurrence of an error in the execution of an operation system program in a personal computer , a specific program being performed for the modem 70 is stopped immediately to be rapidly restored into the basic modem mode . fig3 illustrates another reset circuit for a computer system having a modem constructed according to the principles of the present invention . this reset circuit configuration has the same construction as that of fig2 except that the delay circuit is omitted from the reset circuit of fig2 and hence identical parts are denoted by the same reference numerals and the description thereof is omitted herein for the sake of convenience . in this second configuration , the second decoder 30 receives a port signal port from the first decoder 20 to be enabled . the second decoder 30 then receives data signals da0 , da1 and da3 though input ports pa0 ˜ pa2 thereof and decodes the same so as to generate a modem reset signal data to the modem 70 . the delayed modem reset signal , as well as a reset signal rd provided from a reset switch ( not shown ) of a personal computer in which a program is executing , is provided directly to input terminals of the or gate 60 whose output is connected to the reset port of the modem 70 . if any one of the above reset signals is applied to the or gate 60 , the modem 70 becomes reset for enabling the additional modem mode being performed for the modem 70 to be rapidly restored into a basic modem mode for the exchange of digital data . also , when there arises an error on an operation system program being performed in a personal computer , a specific program being performed for the modem 70 is stopped immediately to be rapidly restored into the basic modem mode for the exchange of digital data . while there have been illustrated and described what are considered to be preferred embodiments of the present invention , it will be understood by those skilled in the art that various changes and modifications may be made , and equivalents may be substituted for elements thereof without departing from the true scope of the present invention . in addition , many modifications may be made to adapt a particular situation to the teaching of the present invention without departing from the central scope thereof . therefore , it is intended that the present invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out the present invention , but that the present invention includes all embodiments falling within the scope of the appended claims .	7
while this invention is satisfied by embodiments in many different forms , there is shown in the drawings and will herein be described in detail a preferred embodiment of the invention , with the understanding that the present disclosure is to be considered as exemplary of the principles of the invention and is not intended to limit the invention to the embodiment illustrated . the scope of the invention will be measured by the appended claims and their equivalents . adverting to the drawings , and fig1 - 4 in particular , there is illustrated the preferred biological specimen collection device 10 . this device is useful for the collection of biological specimens such as urine , sputum , blood and the like . this collection device includes an elongated , preferably cylindrically shaped , specimen receptacle 12 . one end of receptacle 12 is a closed end 14 and is preferably conically shaped with inwardly tapering side walls 15 . at the other end of receptacle 12 , there is an opening 16 which commmunicates with the interior of the receptacle so that the specimen may be collected therein . around opening 16 is an external thread 18 which facilitates the closure of the threaded cap , as described hereinafter . a series of graduation marks 19 may be included on the peripheral surface of the receptacle to indicate volume ; other indicia may also be marked on the receptacle as may be desired . as can be seen in the drawings , the elongated nature of receptacle 12 makes it useful as a centrifuge tube so that the specimen , once collected , need not be transferred to a different container for centrifugation . to this end , receptacle 12 is constructed from material with sufficient structural properties so that it may be centrifuged at appropriate speeds in standard centrifuges . rigid polymeric materials such as polypropylene , polyethylene , polystyrene and the like are suitable materials for centrifuging purposes . other materials may also be employed depending upon the nature of the specimen to be collected and subsequent testing and analysis . a funnel 20 includes a relatively wide specimen receiving portion 21 into which the specimen is deposited when being collected from the patient . communicating with this wide receiving portion is a passage tube 22 which has a passage way 24 extending therethrough . tube 22 slidably , but preferably snugly , fits inside opening 16 at the top end of receptacle 12 . in this fashion , tube 22 and passageway 24 communicate with the inside of receptacle 12 so that the funnel can serve its function . the fit between tube 22 and the open end of the receptacle allows for ready removal of the funnel after the specimen has been collected . it is preferred that funnel 20 include a cover 25 to provide a sealing closure over receiving portion 21 of the funnel . in the preferred embodiment of this invention , cover 25 is connected to funnel 20 by virtue of a hinge 26 . funnel 20 and cover 25 may be fabricated of plastic , glass or other materials , but are preferably made of plastic , polypropylene , polyethylene , polystyrene or the like . when plastic is used for the funnel and cover , hinge 26 may be integrally formed between the funnel and the cover so as to provide the so - called living hinge . a finger tab 28 is provided on cover 25 to facilitate the lifting a closure of the cover with respect to the funnel . a base 30 is included in the present biological specimen collection device in order to receive closed bottom end 14 of the receptacle and to support the receptacle in a substantially vertical position , particularly when the specimen is being collected . as seen more clearly in fig3 and 4 , taken in conjunction with fig2 base 30 includes a bottom support surface 31 , a top surface 32 and side walls 34 interconnecting the top and bottom surfaces of the base . in the preferred embodiment of this base , it is cylindrically shaped so that side wall 34 is one continuous side wall around the periphery of the base . an opening 35 is formed through top surface 32 and is sized to receive the outside diameter of receptacle 12 so that the receptacle may be supported in the base . communicating with opening 35 is a bore 36 which is also sized to receive the outside diameter of receptacle 12 therein . bore 36 extends into the base from top surface 32 in a direction substantially perpendicular to bottom surface 31 of the base . thus , receptacle 12 may be supported in the base in a substantially vertical position as seen by briefly referring to fig1 and 5 . as illustrated particularly in fig3 and 4 , bore 36 includes a plurality of spaced inwardly extending locking ribs 38 . these locking ribs are formed against the inside surface defined by bore 36 of the base and are adapted to firmly hold the receptacle in position once the receptacle has been inserted in the base . it is preferred that bore 36 have a circular cross - section to be compatible with the preferred cylindrical shape of receptacle 12 . extending inwardly into base 30 from bottom support surface 31 is a recess 40 . this recess is defined by a bore or a cylindrical side wall 41 and a substantially horizontal wall 42 which , in the embodiment being described , separates recess 40 from bore 36 . whereas bore 36 is adapted to receive receptacle 12 , recess 40 , defined by bore 41 , is adapted to receive a cap 45 , as more clearly seen by referring briefly to fig5 . in order to facilitate the firm holding of cap 45 in position within recess 40 , a plurality of spaced inwardly extending locking ribs 44 is provided to engage the cap . locking ribs 44 are similar in nature to the previously described locking ribs 38 , and are formed against the inner surface of bore 41 of the base . while base 30 may be made of many materials , depending upon choice , design and use of the present device , the material of preference is rigid plastic . moreover , it is preferred that base 30 be molded as an integral , unitary structure , in order to render its fabrication easy and inexpensive . as an integral , one piece structure , locking ribs 38 and 44 are also formed together with the other structural elements of the base . referring now to fig5 which illustrates cap 45 protectively maintained within recess 40 , it can be seen that the entire bottom support surface of base 30 has been covered . in the specific embodiment being described , a peelable , flexible , protective cover 46 is sealed around the entire periphery of the bottom surface of the base . various adhesives , cement or appropriate fastening techniques may be employed to effectuate this seal . a finger tab 48 is provided so that the user may peal cover 46 from the bottom surface of the base when the cap should be exposed for capping the receptacle . it is one purpose of cover 46 , together with recess 40 , to enclose and maintain cap 45 in a substantially contamination - free environment prior to use of the biological specimen collection device of the present invention . to this end , and inasmuch as all of the elements of this collection device are preferably sterilized as a packaged unit , protective cover 46 may be fabricated of a suitable paper material which will allow cap 45 to be sterilized using typical and well - known sterilizing techniques for medical products . at the same time , this paper or other material for cover 46 should prevent the ingress of microorganisms into cavity 40 where they would contaminate cap 45 before use . while the present invention is herein described with protective cover 46 as a preferred feature , it is within the purview of the present invention to eliminate this protective cover . cap 45 is then protected , prior to use of the device , by its position within recess 40 . cap 45 is sized to fit on top of opening 16 of the specimen receptacle and preferably includes an internal thread 49 which mates with thread 18 around open end 16 of the specimen receptacle . cap 45 is preferably made of rigid plastic , such as polypropylene , polyethylene , polystyrene or the like . the assembled biological specimen collection device may be packaged in a removable , flexible outer protective package 50 to facilitate sanitary handling both prior to and during the specimen collection procedure . package 50 may be a transparent , flexible thermoplastic bag which may be appropriately sealed along seal lines 51 and 52 . when opening package 50 , it is preferred to cut the package at or near seal line 51 thereby leaving the remainder of package 50 substantially intact for further use during the specimen collection procedure as described below . in use , biological specimen collection device 10 is assembled as illustrated in fig5 . specimen receptacle 12 is slidably and firmly positioned with its closed bottom end 14 inserted into bore 36 of base 30 . locking ribs 38 contribute to firmly holding the specimen receptacle in a substantially vertical position , as illustrated . funnel 20 is removably positioned so that tube 22 is inserted inside opening 16 at the top end of receptacle 12 . at this time , prior to specimen collection , cap 45 is maintained in a substantially contamination - free enviroment within recess 40 inside base 30 . protective cover 46 is intact in sealed condition on the bottom support surface of base 30 . in order to collect the biological specimen , such as sputum , cover 25 is lifted by virtue of finger tab 28 whereupon the specimen is deposited in wide receiving portion 21 of the funnel . the specimen passes through passageway 24 of the funnel and opening 16 of the specimen receptacle whereupon the specimen is deposited into the interior of the receptacle . when the specimen has been collected , cover 25 is repositioned to provide a sealing closure over the receiving portion of the funnel . it is preferred , at this stage of the procedure , to replace flexible package 50 over the entire specimen collection device . while lifting the device by grasping around the outside of the flexible package , and maintaining receptacle 12 in a substantially vertical position , the laboratory technician then grasps finger tab 48 and peels protective cover 46 , if included on the device , from the bottom surface of the base , thereby exposing cap 45 . the receptacle is removed from the base and the funnel is removed from the receptacle . as seen in fig6 receptacle 12 with specimen 60 therein , and while maintained substantially vertically , is positioned under base 30 and more directly under cap 45 . locking ribs 44 hold the cap in a fixed position inside recess 40 . moving the receptacle upwardly into the cap will cause open end 16 to come in contact with the interior of the cap . a turning motion will cause thread 18 at the open end of the receptacle to become engaged with the thread 49 in the interior of the cap . once in position , cap 45 may be appropriately tightened at the top end of the receptacle with its contents therein . inasmuch as receptacle 12 may be centrifuged , at this time the specimen may be transported directly to the centrifuge without the need for transfer to a different container or tube . thus , the present invention provides a biological specimen collection device which is easy to use , inexpensive to manufacture and may be conveniently handled so as to minimize the spread of infection during and subsequent to the specimen collection procedure . furthermore , the present specimen collection device conveniently stores the receptacle cap in a protective environment until the cap is needed to seal the contents of the specimen receptacle .	8
a schematically shown terminal clamp 10 has a receptacle 20 in which a post 14 , surrounded in its lower area by an insulating element 18 , is situated so as to be electrically insulated from terminal clamp 10 . this post 14 contacts a measuring element 16 in an electrically conductive manner . below the underside of measuring element 16 , in the area of receptacle 20 there may be situated an insulation 19 , in order to ensure that at this location in particular there is no electrically conductive contact between measuring element 16 and terminal clamp 10 . this insulation 19 may also be a component of insulating element 18 . via post 14 , a battery cable 12 is connected electrically and mechanically to terminal clamp 10 . the exemplary embodiment shown in fig2 differs from that shown in fig1 only in that it has a different embodiment of insulating element 18 . this element is formed as an injection - molded part in such a way that both terminal clamp 10 and post 14 are molded to form a unit . here the underside of measuring element 16 is situated on the upper side of insulating element 18 . post 14 is used to fasten battery cable 12 . for this purpose , for example a threading ( not shown ) is provided . the cable shoe of battery cable 12 is placed around post 14 and is subsequently fastened by a nut . measuring element 16 , which is preferably formed so as to be flat , is also placed around this post 14 . post 14 is in turn mechanically connected to terminal clamp 10 via insulating element 18 , by a suitable connection 24 . in the exemplary embodiment shown in fig1 , for example , insulating element 18 is formed as a sheath - shaped element . for this purpose , insulating element 18 must have sufficient flexibility to allow post 14 and terminal clamp 10 to be joined . the flexibility of insulating element 18 also provides tolerance compensation . latch mechanisms may also be used to ensure that post 14 is securely positioned in terminal clamp 10 . the material of insulating element 18 is preferably a plastic or an elastomer ( for example silicone ). in the exemplary embodiment shown in fig2 , insulating element 18 is realized as an injection - molded part . for this purpose , post 14 and terminal clamp 10 ( positioned at a distance from one another ) are molded with an insulating plastic , resulting in insulating element 18 . preferably , the upper edge of insulating element 18 extends somewhat past the upper side of terminal clamp 10 , so that it is ensured that measuring element 16 is situated so as to be electrically insulated from terminal clamp 10 at the location of post 14 . in the exemplary embodiment shown in fig3 , post 14 is provided in its lower region with a coating 18 ″. in the region that is to be insulated , post 14 is provided with a lacquer or with some other suitable insulating surface . post 14 coated in this way is subsequently mounted in terminal clamp 10 , for example pressed in . fig4 shows receptacle 20 of terminal clamp 10 in more detail . an essentially star - shaped receptacle contour 14 can be seen that is formed in such a way that rotation of post 14 on the one hand , as well as movement of post 14 downward in the axial direction , is reliably prevented . the associated post 14 is shown in fig5 . correspondingly , the post 14 also has a fastening contour 40 that is star - shaped . above fastening contour 40 , a radially circumferential collar 38 is provided . the outer diameter of collar 38 is preferably larger than that of fastening contour 40 . the components shown in fig4 and 5 are shown in the assembled state in fig6 . insulating element 18 is formed in such a way that an electrical insulation is achieved between terminal clamp 10 and post 14 . in addition , the outer radius of the upper side of insulating element 18 is greater than the outer radius of collar 38 . this reliably achieves an insulation between terminal clamp 10 and post 14 . in order to prevent rotation , receptacle contour 42 may , for example , be made rectangular , prismatic , triangular , or roughly rectangular , having one or two rounded - off side surfaces . advantageously , receptacle contour 42 may have counter - surfaces in a plane perpendicular to the axial direction of post 14 , so that post 14 may be mounted in a defined axial position , or receptacle contour 48 may also absorb forces acting in the axial direction . in the exemplary embodiment according to fig7 , terminal clamp 10 is shown , which may be connected to a terminal ( not shown ) of a battery , for example a battery of a motor vehicle . for this purpose , the limbs ( not shown in more detail ) of terminal clamp 10 can be moved towards one another in such a way that they clasp the battery terminal . the system also includes measuring element 16 . measuring element 16 is immediately connected mechanically and electrically to terminal clamp 10 on the one side by a compression 34 using clinching . at the location of compression 34 , terminal clamp 10 has an opening having chamfering on its rear side . the terminal of measuring element 16 is pressed into this opening using clinching in such a way that an undercut of measuring element 16 is formed in the area of the chamfering . this creates a quasi - riveted connection of terminal clamp 10 to measuring element 16 . on the right side , receptacle 20 of terminal clamp 10 is shown , which is used to fasten post 14 . for this purpose , post 14 is , for example , made cylindrical , and extends upwardly perpendicular to the flat plane of measuring element 16 . insulating element 18 is situated between post 14 and terminal clamp 10 , radially surrounding post 14 . the depicted system ensures that the battery current between post 14 for connecting battery cable 12 and the clamp connected to the battery terminal actually flows via measuring element 16 and is not short - circuited . a corresponding opening in measuring element 16 is matched to the outer diameter of post 14 . measuring element 16 lies partly on radially expanding collar 38 on post 14 , and partly also on the upper side of insulating element 18 , which is formed as a sheath . the upward - protruding side of post 14 may be provided with a threading ( not shown ) in order to fasten a cable shoe of a battery cable 12 , preferably the ground cable , using screwed connections . in the region of post 14 , measuring element 16 is surrounded by a housing 30 only laterally , while the surface of measuring element 16 is exposed . measuring element 16 is guided in the direction of housing 30 , into its interior . the actual measuring element is situated there , for example an electrical resistor made of a particular material such as manganin . inside housing 30 there is also situated an electronics unit ( not shown ) that detects the voltage drop at measuring resistor 16 and further evaluates it . in addition , on the basis of further data such as battery voltage , temperature , or the like , battery state quantities such as state of charge ( soc ) or aging ( state of health : soh ) can be determined . these data can be forwarded to further control devices , such as an energy management control device , via a data line ( not shown ) connected via a plug 32 . the additional supply voltage can also be supplied via this plug 32 . measuring element 16 is led out from housing 30 at the side facing away from post 14 . the electrical contacting to terminal clamp 10 also takes place at this location , in a compression 34 preferably obtained by clinching . however , it is essential that the electrical contacting between measuring element 16 and terminal clamp 10 should first take place , relative to the actual measuring resistor , at the side facing away from post 14 . in this way , the current from the battery terminal is conducted via terminal clamp 10 , the connection at the left connecting point of measuring element 16 , and the measuring resistor situated inside housing 30 , to post 14 , to which battery cable 12 is then to be connected . fig9 shows a three - part battery sensor design . this is preferably made up of terminal clamp 10 , electronics unit 22 , and cable terminal 48 . as an example , terminal claim 10 and electronics unit 22 are fastened to one another by connection 24 and compression 34 as already explained . the structural and connection technology is optimized by partitioning the battery sensor into three parts , namely terminal clamp 10 , electronics unit 22 , and cable terminal 48 . in the production sequence , the joining of these three partitions does not take place until the end of the sequence . this is intended to increase flexibility insofar as adaptation to a wide range of installation spaces is made possible merely by exchanging terminal clamp 10 and / or cable terminal 48 . changes to electronics unit 22 are not necessary . all three units 10 , 22 , 48 may be manufactured separately from one another and connected to one another only at the end of the production process . the complete assembly may be integrated into motor vehicle batteries that are commercially standard in poland , or extends somewhat beyond these . the connection technology used between the three units 10 , 22 , 48 may be selected such that they may be detached from each other . this creates the possibility of removing or attaching individual units without having to dismount the overall sensor from the battery or to mount it thereon . a significant advantage is that it becomes possible to remove cable terminal 48 without terminal clamp disassembly . the device for fastening a post in a terminal clamp is suitable in particular for use in a battery sensor integrated in the terminal clamp , but is not limited thereto .	6
the general solution of an embodiment of the disclosure is described first , incorporating fig1 . as illustrated in fig1 , the embodiment includes the following . step 101 : the length of the root sequence is determined . step 102 : a set of zcz lengths is selected so that , for any cell radius , the maximum number of preambles determined from a zcz length which is selected from the selected set of zcz lengths , and is applicable to the cell and capable of determining a maximum number of preambles , is closest to the maximum number of preambles obtained from a zcz length which is selected from the set of all integers , and is applicable to the cell and capable of determining a maximum number of preambles , wherein the maximum number of preambles is determined from the length of the root sequence and a zcz length selected . in an embodiment of the disclosure , it should be ensured that the product of a zcz length and the symbol period of the sequence is greater than the sum of the round trip time and the delay spread of a cell , i . e ., t × t s & gt ; t r + t d , in which , t is the length of zcz , t s is the symbol period , t r is the round trip time , and t d is the delay spread . since the maximum round trip time t r in a cell is determined by the cell radius r , i . e ., t r = 2r / c , where c is the speed of light , t × t s & gt ; t r + t d may be rewritten as t × t s & gt ; 2r / c + t d . furthermore , since t = n cs − 1 , t × t s & gt ; 2r / c + t d may be rewritten as ( n cs − 1 )× t s & gt ; 2r / c + t d . therefore , n cs & gt ; 1 +( 2r / c + t d )/ t s . additionally , since n pre =└ n zc / n cs ┘, n pre & lt ;└ n zc /( 1 +( 2r / c + t d )/ t s )┘. thus , n pre may be a function of the cell radius r . of course , the cell radius may also be varying ; and the value of n pre decreases as the value of n cs increases . in an embodiment of the disclosure , a limited set of n cs values is constructed , i . e ., for a certain cell radius , the n pre corresponding to the minimum n cs value which is selected from the limited set and is applicable to the cell , is closest to the n pre corresponding to the minimum n cs value which is selected from the set of all integers and is applicable to the cell . furthermore , a maximum relative difference may be constructed from n pre . this maximum relative difference is between the n pre ( r ), which is determined from the minimum n cs value selected from the set of integers and is applicable to the cell , and the n pre ( r ), which is determined from the minimum n cs value selected from the limited set and is applicable to the cell . if the finally determined or selected limited set is such a set that the maximum relative difference between the n pre ( r ), which is determined from the minimum n cs value selected from the set of integers and is applicable to the cell , and the n pre ( r ), which is determined from the minimum n cs value selected from the limited set and is applicable to the cell , is minimized in a cell of any radius , this limited set is a required one . as illustrated in fig2 , curve a indicates that for any one cell radius , an integer from the set of all integers may be selected as n cs of the cell , wherein a maximum number of preamble sequences may be generated based on the integer selected , and the generated preamble sequences are applicable to the cell . curve b indicates a set of n cs including a limited number of n cs . when the limited number of n cs is applied in cells of all radii , within a certain interval of cell radii , a same n cs will be used for all cell radii . thus , the n cs should be determined according to the maximum cell radius in the interval of cell radii . compared with a , the preamble number generated according to b decreases . under these conditions , if the selected limited set ensures that the maximum relative difference between the n pre ( r ) determined from a n cs value selected from any integer and the n pre ( r ) determined from a n cs value selected from the limited set is minimized , and it is assumed that the n pre ( r ) determined from a n cs value selected from any integer is a ( r ) and the n pre ( r ) determined from a n cs value selected from the limited set is b ( r ), and then a ( r ) and b ( r ) are respectively illustrated in fig2 . as seen from fig2 , there is a small deviation between a ( r ) and b ( r ). for a certain cell radius r , the deviation of b ( r ) from a ( r ) for some cell radius r may increase the number of required root sequences for that cell radius r . the increase of the number of root sequences becomes very important for large cell radii where n pre is small . for example , if a ( r )= 3 and b ( r )= 2 , the number of root sequences increases significantly , from ┌ 64 / 3 ┐= 22 to ┌ 64 / 2 ┐= 32 . an appropriate measure of the deviation of b from a should therefore weigh the difference a − b with higher weight for small n pre , e . g . by considering the maximum relative difference between a ( r ) and b ( r ), i . e ., [ a ( r )− b ( r )]/ a ( r ). we will adopt the maximum relative difference between a ( r ) and b ( r ) over all cell radii as the measurement of the deviation of b ( r ) from a ( r ), and find a set of n cs values that minimizes this measurement . this set may consist of one n cs = 0 and k + 1 non - zero n cs values . the total number of n cs values in the set is k + 2 . for example , in a relatively small cell , it would be possible to generate 64 zcz preambles from a single root sequence if n cs =└ n zc / 64 ┘. this value is the smallest value in the set n cs ( k ). the maximum value , n cs ( k ), is the one that allows for having 2 zcz sequences from a set single root sequence , so it is └ n zc / 2 ┐. for the largest cells there is only one rap generated from each root sequence . therefore , n cs ( k + 1 )= 0 . the maximum relative difference between a ( r ) and b ( r ), i . e ., [ a ( r )− b ( r )]/ a ( r ), is non - increasing with radius r within the interval of [( r ( k − 1 ), r ( k )] and the interval being k , as illustrated in fig2 . in fig2 , r ( k ) denotes the kth cell radius arranged orderly from small ones to large ones . the reason is that b ( r ) is constant in the interval , whereas a is inversely proportional to the smallest possible n cs for given r . this value of n cs increases with the round trip time and hence with r . if it is assumed that the maximum number of preamble sequences of the set a ( r ) is n pre ( k − 1 )− 1 in the cell radius interval of [ r ( k − 1 ), r ( k )], the maximum number of preamble sequences of the set b ( r ) generated in this interval associate with the cell radius r ( k ), i . e ., the maximum number of preamble sequences is n pre ( k ). the maximum relative difference d k in the interval k may be obtained from the following equation : if d k and n pre ( k − 1 ) are given , n pre ( k ) may be obtained by rearranging the above equation , i . e . : the maximum relative difference d max for all cell radii may be given by d max = max { d k } k = 1 k . for n pre ( k ), we will first allow n pre ( k ) to be a real number , and then round the result to the nearest integer . additionally , n p ( 0 ) and n pre ( k ) are fixed . then d max is minimized if all d k are equal , i . e . d k = d , k = 1 , 2 , . . . , k , as will be proved in the following . a set of values { n pre ( 1 ) ( k )} k = 0 k is constructed with the constraint that n pre ( 1 ) ( k )= n pre ( k ) for k = 0 and k = k , so that d k ( 1 )= d , k = 1 , 2 , . . . , k . for this set , d max = d . next , another set of values { n pre ( 2 ) ( k )} k = 0 k is constructed with the constraint that n pre ( 2 ) ( k )= n pre ( k ) for k = 0 and k = k , so that d max & lt ; d , i . e ., d k ( 2 ) & lt ; d k ( 1 ) , k = 1 , 2 , . . . , k . when k = 1 , since d k ( 2 )& lt ; d k ( 1 ) and n pre ( 2 ) ( 0 )= n pre ( 1 ) ( 0 ), n pre ( 2 ) ( 1 )& lt ; n pre ( 1 ) ( 1 ) is obtained according to n pre ( k )=( 1 − d k )( n pre ( k − 1 )− 1 ). when k = 2 , since d 2 ( 2 )& lt ; d 2 ( 1 ) and n pre ( 2 ) ( 1 )& gt ; n pre ( 1 ) , n pre ( 2 )( 2 )& gt ; n pre ( 1 ) ( 2 ) is obtained according to n pre ( k )=( 1 − d k )( n pre ( k − 1 )− 1 ). similarly , for all k , since n pre ( 2 ) ( k )= n pre ( 1 ) ( k )= n pre ( k ), n pre ( 2 ) ( k )& gt ; n pre ( 1 ) ( k ) is impossible . thus , it is impossible to construct a set of values n pre ( k ) such that d max & lt ; d , which proves that d max is minimized if all d k are equal , i . e . d k = d , k = 1 , 2 , . . . , k . in this way , the set of values { n pre ( k )} k = 0 k which minimizes d max may be found . replacing d k by d in n pre ( k )=( 1 − d k )( n pre ( k − 1 )− 1 ) and rearranging the equation , a linear difference equation is obtained as follows : n pre ( k )− an pre ( k − 1 )=− a , wherein a =( 1 − d ). from the above equation and the boundary conditions n pre ( 0 ) and n pre ( k ), a may be determined numerically . for example , the maximum number of preambles generated from one root sequence is 64 , i . e ., n pre ( 0 )= 64 . the minimum number of preamble obtained by cyclic shift is 2 , for example , n pre ( 14 )= 2 . thus , a = 0 . 856 may be obtained from these two parameters , and all n pre ( k ), k = 1 , 2 , . . . may further be obtained . the maximum relative difference is minimized through an approximate minimization by a sub - optimal algorithm , i . e ., by minimizing the maximum relative difference for fictive real - valued maximum number of zcz raps , and the maximum number of the zcz raps is thereafter quantized . the method is specified below . n cs ( k )=└ n zc /[ n pre ( 0 )× a k + a /( 1 − a )×( a k − 1 )]┘ ( 4 ) where └ x ┘ denotes the maximum integer not greater than x , n zc is the length of the root sequence , n pre ( 0 ) denotes the maximum number of preambles generated from the root sequence . still taking the above example as an example , if n pre ( 0 )= 64 and n pre ( 14 )= 2 , a = 0 . 856 is obtained based on equation ( 3 ). next , when n zc = 839 , n cs ( k ), k = 0 , 1 , 2 , . . . , 14 obtained based on equation ( 4 ) is illustrated in table 1 : if only one preamble sequence is obtained for a very large cell , which is the sequence itself , then n cs = 0 . adding this value into the above table , table 2 is obtained : finally , the true integer value of n pre ( k ) is obtained from n pre ( k )==└ n zc / n cs ( k )┘ that for some values of kn zc / n cs ( k ) are greater than the rounded values n pre ( k ). as illustrated in fig3 , when k = 14 , the value of d k obtained from the real number value of n pre ( k ) is d = 0 . 144 . it can be seen from fig3 that the true integer values of n pre ( k ) will cause d k to deviate from d . but the deviation is still very small for all cells except the two largest cells . thus , the selected limited set of values of n cs is applicable . it should be noted that if the limited set of values of n cs is determined , the limited set of lengths of zcz may also be determined , for instance , according to t = n cs − 1 . correspondingly , the disclosure provides an embodiment of an apparatus of determining a set of zcz lengths . as illustrated in fig4 , the apparatus includes : a length determination unit 410 , configured to determine a length of a root sequence ; and a set selection unit 420 , configured to select such a set of zcz lengths that , for any cell radius , the maximum number of preambles determined from a zcz length which is selected from the selected set of zcz lengths , and is applicable to the cell and capable of determining a maximum number of preambles , is closest to the maximum number of preambles determined from a zcz length which is selected from the set of all integers , and is applicable to the cell and capable of determining a maximum number of preambles , wherein the maximum number of preambles is determined by the length of the root sequence and a zcz length selected . the set selection unit 420 may include : a module 421 adapted for the selection of a set of cyclic shift increments , wherein , the module 421 is configured to select such a set of cyclic shift increments that , for any cell radius , the maximum number of preambles determined from a cyclic shift increment which is selected from the selected set of cyclic shift increments , and is applicable to the cell , is closest to the maximum number of preambles determined from a cyclic shift increment which is selected from the set of all integers and is applicable to the cell , wherein the maximum number of preambles is determined by the root sequence length and a cyclic shift increment selected ; and a module 422 adapted to obtain a set of zcz lengths , wherein the module is configured to obtain the set of zcz lengths according to the selected set of cyclic shift increments . in the above apparatus embodiment , the cyclic shift increment selected from the selected set of cyclic shift increments is the minimum cyclic shift increment in the selected set of cyclic shift increments ; and the cyclic shift increment selected from the set of all integers is the minimum cyclic shift increment in the set of all integers . the disclosure provides an embodiment of a base station , as illustrated in fig4 , which includes : a length determination unit 410 , configured to determine a length of a root sequence ; and a set selection unit 420 , configured to select such a set of zcz lengths that , for any cell radius , the maximum number of preambles determined from a zcz length which is selected from the selected set of zcz lengths , and is applicable to the cell and capable of determining a maximum number of preambles , is closest to the maximum number of preambles determined from a zcz length which is selected from the set of all integers , and is applicable to the cell and capable of determining a maximum number of preambles , wherein the maximum number of preambles is determined from the length of the root sequence and a zcz length selected . the disclosure further provides an embodiment of a mobile communication system , as illustrated in fig5 . the system comprises a base station 400 and a mobile terminal 500 . the base station 400 is configured to interact with the mobile terminal 500 , and to specify a zcz length from a set of zcz lengths for the mobile terminal 500 . the mobile terminal 500 is configured to generate a preamble according to the zcz length specified by the base station 400 , and to transmit an uplink signal to the base station 400 using the preamble . the set of zcz lengths is such a set of zcz lengths that , for any cell radius , the maximum number of preambles determined from a zcz length which is selected from the selected set of zcz lengths , and is applicable to the cell and capable of determining a maximum number of preambles , is closest to the maximum number of preambles determined from a zcz length which is selected from the set of all integers , and is applicable to the cell and capable of determining a maximum number of preambles , wherein the maximum number of preambles is determined from the length of the root sequence and a zcz length selected . in the above embodiment of the mobile communication system , the cyclic shift increment selected from the selected set of cyclic shift increments is the minimum cyclic shift increment applicable to the cell in the selected set of cyclic shift increments , the cyclic shift increment selected from the set of all integers is the minimum cyclic shift increment applicable to the cell in the set of all integers . in general , in embodiments of the disclosure , the selected limited set of n cs values should be such a set that , in a plurality of intervals of cell radii , the maximum relative difference between the maximum number of the zcz raps determined from the minimum n cs value of the limited set , which is applicable to the plurality of cells , and the maximum number of the zcz raps determined from a plurality of n cs values of a set of integers which are applicable to the plurality of cells is minimized . furthermore , a limited set of zcz lengths may be selected . of course , in a plurality of intervals of cell radii , the maximum relative difference between the maximum number of the zcz raps determined from the minimum zcz length of the limited set of zcz lengths , which is applicable to the plurality of cells , and the maximum number of the zcz raps determined from a plurality of zcz lengths of the set of all integers which are applicable to the plurality of cells is minimized . what are described above are only preferred embodiments of the disclosure . it should be noted that , for a person skilled in the art , variations and improvements may be made without deviating from the principle of the disclosure . those variations and improvements are all regarded to be within the scope of the disclosure .	7
with reference to fig1 to 5 , the present invention comprises a stator 2 disposed on a axle 5 , the stator consisting of a plurality of permanent magnets 22 radially spaced apart , and a plurality of conductive elements , preferably carbon brushes 42 , axially fastened onto a securing element 51 of the axle 5 and which are parallel to the axle 5 ; the axle is preferably a solid axle so that the diameter thereof may be reduced to the greatest extent , but the rigidity thereof must be maintained . the device according to the present invention further comprises an annular printed - circuit board 43 fixed on the wheel frame and pivotally disposed on the axle 5 with the wheel frame . the printed - circuit board 43 has two groups of conductive sheets 46 and 47 radially disposed thereon ( see fig3 to 4 ). these conductive sheets 46 and 47 are severally disposed in an inner area and outer area of one side of the printed - circuit board 43 . each conductive sheet 46 in the inner area exposes on one side of a body 44 , wherein each conductive sheet 46 is connected to the corresponding conductive sheet 47 disposed in the outer area and concealed in the insulated body 44 . the conductive sheets 46 in the inner area contact the above - mentioned carbon brushes 42 . the present preferred embodiment further comprises a bearing pivotally disposed on the axle 5 for use as a hub for supporting a wheel frame 1 . the interior of the wheel frame has a plurality of radially distributed winding coils 4 which correspond to the permanent magnets 22 , thereby forming a rotor 3 corresponding to the stator 2 . each winding coil 4 is connected to one of the conductive sheets 47 in the outer area of the printed - circuit board 43 . the wheel frame is fixed with the printed - circuit board 43 and may rotate therewith on the axle 5 . during rotation , the air currents generated by the rotating wheel frame may help to dissipate the heat of the winding coils 4 rapidly . the clutch device according to the present invention further comprises a power supply element 41 , such as a cable , attached onto the securing element 51 of the axle 5 for transmitting power via carbon brushes 42 and the printed - circuit board 43 to the winding coils 4 in the interior of the wheel frame , so that the winding coils 4 may generate an electromagnetic field with the permanent magnets 22 on the stator 2 , causing the wheel frame 1 to rotate around the axle 5 . the above - described device is a basic and typical example of the present invention . it may smoothly transmit power from the vicinity of the axle 5 via the carbon brushes 42 and the annular printed - circuit board 43 to the winding coils 4 of the rotor 3 . additionally , the above - described device is easy to manufacture and assemble . besides , the above - mentioned wheel frame may be formed by an outer wheel frame and an inner wheel frame so that the device according to the present invention is more suited for wheel - chairs , bicycles , low - speed vehicles , etc . a reduction mechanism 6 is shown in fig1 . although it consists of a planetary gear set , those skilled in the art know that the so - called reduction mechanism referred to herein may be selected from gear type , pulley type , or other type of reduction mechanism . it should be understood that the reduction mechanism is not restricted to the preferred embodiment disclosed in fig1 and 2 . as is mentioned above , the wheel frame of the clutch device according to the present invention further comprises an outer wheel frame 12 on the axle 5 and an inner wheel frame 11 pivotally disposed on a bearing 72 . the inner wheel frame 11 has a plurality of winding coils 4 disposed therein , and the inner wheel frame 11 is secured to the printed - circuit board 43 to rotate therewith . the above - described outer wheel frame 12 is used as a hub for supporting the motor wheels . the above - mentioned reduction mechanism 6 is provided between a lateral side of the inner wheel frame 11 and the outer wheel frame 12 , the reduction mechanism 6 having a driving gear 61 pivotally provided on a bearing 73 , an idle gear 64 pivotally disposed on a link 63 and a driven gear 62 disposed on the outer wheel frame 12 . the driving gear 61 of the reduction mechanism 6 is driven by the inner wheel frame 11 ( by means of the clutch device , to be described hereinafter ). the outer wheel frame 12 is coupled to the driven gear 62 of the reduction mechanism 6 so that the power generated when the inner wheel frame 11 rotates may be reduced by the idle gear 64 of the reduction mechanism 6 to be transmitted to the outer wheel frame 12 . the present invention is characterized in that the inner wheel frame 11 is fixed on a clutch ring 8 pivotally disposed on the axle 5 . the clutch ring 8 is supported by a bearing 71 and may rotate around the axle 5 . the clutch device according to the present invention consists of a clutch element having two portions , wherein one portion is provided on the clutch ring 8 and the other portion is provided on the driving gear 61 of the reduction mechanism 6 so that the clutch ring 8 may unite with the driving gear 61 as an integral whole in power transmission , or the clutch ring 8 may be separated from the driving gear 61 to stop power transmission . the above - mentioned clutch element may be controlled by a driving element , such as a steel pull wire 67 and a spring 66 as shown in fig1 and 2 . nonetheless , the clutch element may also be constituted by a conventional electromagnetic clutch sheet . then the cooperating driving element will be a power switch . the clutch element shown in fig1 and 2 is a mechanical structure , wherein the clutch ring 8 is supported by needle bearing 71 so that it may not only rotate around the axle 5 but also reciprocate in a direction parallel to the axis of the axle 5 . a retainer 65 is disposed on the left side of the clutch ring 8 so that it may move axially with the clutch ring 8 . between the retainer 65 and the securing element 51 of the axle 5 is disposed a resilient element , such as a plurality of springs 66 , so that , by means of the resilience thereof , the spring 66 may press the retainer 65 to move back to the right after it has moved to the left . in the preferred embodiment shown in fig1 and 2 , one portion of the clutch element is constituted by a plurality of grooves 81 formed in a lateral side of the clutch ring 8 , and the other portion thereof is constituted by a plurality of pins 611 formed on a lateral side of the driving gear 61 ; the grooves 81 and the pins 611 are coupled together in the conventional manner . in this embodiment , the driving element may be the steel pull wire 67 which may be operated manually , hydraulically or in any other manners . in addition , the left side of the clutch ring 8 is provided with a plurality of flanges 82 for reducing friction between the clutch ring 8 and the retainer 65 . this is only a detail of the clutch device according to the present invention . the above - described preferred embodiment is only for use in electric wheels . in the second preferred embodiment , the clutch device according to the present invention is adapted for use in bicycles to be coupled to the rear wheel of the bicycle so that the cyclist may choose to pedal with foot or employ the driving method of utilizing induction electromagnetic fields . as shown by imaginary lines in fig1 and 2 , in one lateral side of the center of the outer wheel frame 12 is insertably provided an interfacial connector 7 . the interfacial connector 7 is a conventional element . it is pivotally fitted on the axle 5 of the wheel so that the lateral side of the outer wheel frame 12 fits on a chain wheel 74 on the outer rim of the interfacial connector 7 to drive the outer wheel frame 12 in a single direction by means of the interfacial connector 7 . in other words , the clutch device according to the present invention utilizes the batteries in the bicycle to supply power to the winding coils 4 in the outer wheel frame 12 to drive the bicycle . alternatively , power supply to the winding coils is interrupted so that the bicycle has to be pedalled with foot to cause the chain wheel 74 to rotate and , through the interfacial connector 7 which transmit power in a single direction , drive the outer wheel frame 12 . if batteries are used to drive the outer wheel frame 12 to rotate , electric currents flow through a wire 41 to carbon brushes 42 and then to the printed - circuit board 43 . subsequently , the conductive sheets 46 in the inner area of the printed - circuit board 43 transmit electric currents via the conductive sheets 47 in the outer area to the winding coils 4 in the inner wheel frame 11 . after receiving power supply , the winding coils 4 generate a magnetic line , generating an induction electromagnetic field with the plurality of permanent magnets 22 on the stator 2 . since the stator 2 is fixed on the securing element 51 and remains immobile , the inner wheel frame 11 is pushed to rotate by the electromagnetic repulsion . after rotation , the winding coils 4 are continuously receiving power in the manner discussed above . if desired , the inner wheel frame 11 may be used to drive the outer wheel frame 12 . as shown in fig1 by releasing the pull wire 67 so that the the clutch element 81 and 611 of the clutch ring 8 disposed inside the interior of the inner wheel frame 11 and rotating therewith engage with each other to drive the driving gear 61 . the power thus generated is transmitted via the idle gear 64 to the driven gear 62 in the interior of the outer wheel frame 12 , causing the outer wheel frame 12 to rotate . if it is desired that the outer wheel frame 12 stops rotation , referring to fig2 by pulling the pull wire 67 so that the clutch ring 8 and the inner wheel frame 11 moves to the left , the clutch elements 81 and 611 will become disengaged from each other so that transmission of power is prohibited . certainly , the inner wheel frame 11 may be stopped from rotation simply by cutting off power supply from the batteries . although the present invention has been illustrated and described with reference to the preferred embodiment thereof , it should be understood that it is in no way limited to the details of such embodiment but is capable of numerous modifications within the scope of the appended claims .	8
fig1 shows an overall block diagram of the invention . host 10 is connected to workstation controller ( wsc ) 20 which is connected to a group of devices 40 . although not shown , several workstation controllers can be connected to host 10 similar to wsc 20 . host 10 has a processor 11 which is connected to controller interface 12 , storage 13 and system timer 18 . storage 13 is made up of data base area 14 and i / o buffers 16 . processor 11 is a typical processor known to those in the art , suitably programmed to operate as discussed later in conjunction with fig2 - 5 . controller interface 12 communicates with wsc 20 via line 17 . line 17 can be a system bus , communications line , part of a local area network or other communications means . in the preferred embodiment , line 17 is a system bus . line 17 can also be connected to several other workstation controllers similar to wsc 20 . wsc 20 consists of processor 22 connected to host interface 21 , device interface 23 , storage 24 , and wsc timer 28 . storage 24 consists of i / o buffers 26 and counter save area 27 . host interface 21 communicates with host 10 over line 17 . device interface 23 communicates with devices 40 connected to wsc 20 over communications line 29 . processor 22 is a typical processor known to those in the art suitably programmed to operate as discussed later in conjunction with fig6 - 10 . fig2 - 5 show a flow chart of how host 10 , more specifically host processor 11 , is programmed to determine the performance of the attached workstation controllers . after initialization is performed in block 51 , the processor looks to see if there are any tasks to do in its processor task queue as shown in block 52 . an infinite loop is entered here until processor 11 determines that there is a task to do and control moves to block 53 . in block 53 the task is analyzed to see whether it is a request from the user to start performance measurements . if so , the start performance measures subroutine of fig3 is called , as shown in block 54 . if not , block 56 determines whether the task is system timer 18 specifying to retrieve performance measurements . if so , the retrieve performance measurement subroutine of fig4 is called as shown in block 57 . if not , block 58 asks if the task is system timer 18 specifying to stop performance measurements . if so , the stop performance measurements subroutine of fig5 is called in block 59 . if not , processor 11 looks in block 61 to see if another valid task has been specified . if another valid task has been specified , that task is processed as shown in block 62 . if the task is not valid , an error message is posted in block 63 . in either event , control is returned back to block 52 for it to see if there are any other tasks in the processor task queue to perform . the start performance measurements subroutine of fig3 will now be discussed . the user is first prompted for the length of time to collect data in block 71 . the user is then prompted for the sample rate in block 72 . the sample rate is sent to the wsc and used in taking performance measurements . in the preferred embodiment , if the user does not specify values for block 71 and 72 , default values will be assumed . the sample rate should be fast enough to get a good statistical sample but not too fast to become a burden on the processor and skew the processor utilization measurements . in block 73 , a message is sent to system timer 18 that requests to be notified when it is time to retrieve measurements . measurements are retrieved before the counters in wsc 20 overflow . in block 74 , a message is sent to system timer 18 requesting to be informed when it is time to stop measurements . this is based on the user specified length of time to collect data . any information contained in data base 14 is initialized to zero in block 76 . in block 77 , the start measurements command and sample rate ( if specified by the user ) are sent to the attached workstation controllers . the subroutine then returns to block 52 of fig2 . when system timer 18 specifies in block 56 of fig2 that it is time to retrieve performance measurements , the retrieve performance measurements subroutine of fig4 is called . in block 81 , the retrieve measurements command is sent to the attached workstation controllers . upon receipt of this command , as will be discussed later in conjunction with fig1 , the workstation controllers send performance measurements data to the host and in block 82 the data contained in data base 14 is incremented with this data from the controllers . the subroutine then returns to block 52 of fig2 . when system timer 18 specifies in block 58 of fig2 that it is time to stop performance measurements , the stop performance measurements subroutine of fig5 is called . the stop measurements command is sent to the attached workstation controllers in block 86 . the retrieve performance measurements subroutine as shown in fig4 as previously discussed , is then called in block 87 . after performance data in the data base is incremented in block 82 , processor 11 begins to process the performance data contained in the data base in block 91 . the workstation controller processor utilization is calculated in block 92 as will be discussed later . the workstation controller processor workload evenness is calculated in block 93 , as will be discussed later . likewise , the workstation controller communications line utilization and workload evenness are calculated in blocks 94 and 96 , as will also be discussed later . after these calculations are performed , results are analyzed and sent to the user in block 97 . the subroutine then returns to block 52 of fig2 . concurrent with the operation of host processor 11 as shown in fig2 - 5 , workstation controller processor 22 is operating as shown in fig6 - 10 . after initialization is performed in block 101 , workstation controller processor 22 checks its processor task queue to see if there is any tasks to do in block 102 . if there is not any tasks to do , an idle loop counter is incremented in block 103 and control returns immediately to block 102 . the count contained in the idle loop counter will be used to determine the workstation controller processor utilization , as will be discussed later . the amount of time it takes to check to see if there is any task to do in block 102 , increment idle loop counter 103 , and return to block 102 is called the idle loop time . the idle loop time of a wsc can be different than the idle loop time of other wscs . in the preferred embodiment , the idle loop counter is a four byte counter and the idle loop time is approximately 10 microseconds . the idle loop as shown in blocks 102 and 103 continues until a task is placed in the processor task queue at which time processor 22 looks at the task in block 104 to see if it is a start measurements command sent from the host in block 77 of fig3 . if the host did send a start measurements command to the workstation controller , block 104 of fig6 is answered affirmatively and the start workstation controller measurements subroutine of fig7 is called in block 106 . if the task was not a start measurements command from the host , processor 22 looks to see whether it was a timer interrupt from wsc timer 28 as shown in block 107 . if the task was a timer interrupt , the wsc timer interrupt subroutine of fig8 is called in block 108 . if the task was not a timer interrupt , processor 22 looks to see whether it was a retrieve measurements command from the host as shown in block 109 . if the host has sent the workstation controller a retrieve measurements command in block 81 of fig4 block 109 of fig6 is answered affirmatively and the retrieve workstation controller measurements subroutine of fig9 is called in block 111 . if the task in the processor task queue was not a retrieve measurements command from the host , processor 22 looks to see if it was a stop measurements command from the host as shown in block 112 . if the host has sent the workstation controller a stop measurements command in block 86 of fig5 block 112 is answered affirmatively and the stop workstation controller measurements subroutine of fig1 is called in block 113 . if not , processor 22 looks to see whether this is another valid task that it can perform in block 114 . if yes , the indicated task is processed in block 116 . if the task is not valid , an error message is posted in block 117 . in either event , control is returned to block 102 of fig6 to look to see if any other tasks need to be performed . the start workstation controller measurements subroutine of fig7 will now be discussed . if the user specified a sample rate in block 72 of fig3 block 131 of fig7 is answered affirmatively and an interrupt interval is set to the specified sample rate in block 132 . in the preferred embodiment , o timer 28 interrupts workstation controller processor 22 every 50 milliseconds and if , for example , the sample rate was specified by the user as 200 milliseconds , the interrupt interval would be set to be 4 , which would be 4 times the timer interrupt of 50 miliseconds . if the user did not specify the sample rate , a default interrupt interval is set in block 133 . in either event , control moves to block 134 where a &# 34 ; measurements being taken &# 34 ; flag is set . in order to determine the performance of the processor and communications line of workstation controller 20 , five counters are saved in counter save area 27 as shown in fig1 . the counters are initialized in block 136 of fig7 . counters used are a sample counter , an idle loop counter , a communications usage counter , a processor queue counter , and a communications queue counter . in the preferred embodiment , the communications usage counter and communications queue counter are used in calculating the performance of communications line 29 connecting wsc 20 with devices 40 in fig1 . the interrupt counter is set to the interrupt interval in block 137 . control returns back to block 102 in fig6 . when wsc timer 28 interrupts processor 22 , the wsc timer interrupt subroutine of fig8 is called . if controller 20 was working on anything before the timer interrupt was received , the work is saved in block 151 . if the &# 34 ; measurements being taken &# 34 ; flag is not set , block 152 is answered negatively and flow of control goes to block 156 , where other timer functions are processed . if the &# 34 ; measurements being taken &# 34 ; flag is set , block 152 of fig8 is answered affirmatively . block 153 looks to see whether the counters need to be updated on this timer interrupt ( interrupt counter = 1 ). if not , the interrupt counter is decremented in block 154 , other timer functions are processed in block 156 and any work that was outstanding prior to the timer interrupt is restored in block 157 . control then returns back to block 102 in fig6 to process any other tasks . if block 153 determines the measurement counters need to be updated on this timer interrupt , the interrupt counter is first set to the interrupt interval in block 161 in a manner similar to that of block 137 of fig7 for future use . block 162 looks at the processor task queue and counts the number of tasks waiting on the processor task queue . this count is added to the processor queue counter , which is stored in counter save area 27 of fig1 . this information will be used to determine the workload evenness of the workstation controller processor as will be discussed later . block 163 looks at the communications task queue and counts the number of tasks waiting on that queue to be performed . it adds this count to the communications queue counter which is stored in counter save area 27 of fig1 . this information will be used to determine the workload evenness of the workstation controller communications line , as will be discussed later . block 164 asks whether the number of tasks on the communications task queue was zero . if not , the communications usage counter stored in counter save area 27 of fig1 is incremented in block 166 . this information indicates that the communications task queue was not empty and will be used to determine communications line utilization , as will be discussed later . in either event , the sample counter stored in counter save area 27 is incremented in block 167 to indicate one sample has been taken of the processor task queue and communications task queue . other timer functions are processed in block 156 and any work that was outstanding prior to the timer interrupt is restored in block 157 . control returns to block 102 in fig6 . if controller 20 receives a retrieve measurements command from the host , the retrieve workstation controller measurements subroutine of fig9 is called . the counts contained in the counters of counter save area 27 ( sample count , idle loop count , communications usage count , processor queue count , and communications queue count ) are sent on to the host in block 183 where they are used to increment the data contained in data base 14 of host 10 as shown in fig4 . in addition , the idle loop time for this particular wsc is sent to the host for use in calculating processor performance measurements . control returns to block 102 of fig6 . if controller 20 receives a stop measurements command from the host , the stop workstation controller measurements subroutine as shown in fig1 is called . the &# 34 ; measurements being taken &# 34 ; flag is reset in block 192 . control returns to block 102 of fig6 . as can be seen from the above discussion , processor 11 of host 10 programmed as shown in fig2 - 5 works concurrently with processor 22 of controller 20 as programmed in fig6 - 10 to determine the performance of the workstation controller . the following discussion describes a logical flow of control that includes both processors . assume first that both processor 11 and processor 22 are idle and block 52 of fig2 and block 102 of fig6 are both answered negatively . host processor 11 is in an infinite idle loop waiting for some work to do . processor 22 is incrementing the idle loop counter as shown in block 103 while also waiting for some work to do . while both processors are idle , the user notifies the host computer that he wants to start performance measurements . this task is placed in the processor task queue of processor 11 . blocks 52 and 53 are then answered affirmatively and the start performance measurements subroutine of fig3 is called . the user is prompted for the length of time to collect data and the sample rate in blocks 71 and 72 . system timer 18 is set up in blocks 73 and 74 . the data base is initialized in block 76 and the start measurements command is sent to the workstation controller in block 77 . upon receipt of the start measurements command from the host , the workstation controller leaves the idle loop of blocks 102 lo and 103 as shown in fig6 answers block 104 affirmatively and calls the start workstation controller measurements subroutine of fig7 . the interrupt interval is set to the specified sample rate in block 132 . the &# 34 ; measurements being taken &# 34 ; flag is set in block 134 , the counters are zeroed in block 136 , and the interrupt counter is set to the interrupt interval in block 137 . control returns to block 102 in fig6 where processor 20 continues the idle loop of blocks 102 and 103 until the first timer interrupt from wsc timer 28 is received . when the timer interrupt is received , the timer interrupt subroutine of fig8 is called . if the user specified the sample rate such that a sample should be taken for every four timer interrupts , the interrupt counter is decremented from 4 down to 1 upon receipt of four timer interrupts . when the interrupt counter reaches 1 , block 153 is answered affirmatively , and the measurement counters are updated . the interrupt counter is set to the original interrupt interval of 4 for future use . the number of tasks on the processor task queue and the communications task queue are counted and added to the processor queue counter and communications queue counter , respectively . if the communications task queue was not empty , the communications usage counter is incremented in block 166 . the sample counter is incremented in block 167 and control returns back to block 102 of fig6 . subsequent timer interrupts are handled in the same manner . referring back to fig2 when system timer 18 specifies that it is time to retrieve the performance measurements , the retrieve performance measurements subroutine of fig4 is called . the retrieve measurements command is sent to the workstation controller in block 81 and is placed in the processor task queue of processor 22 . block 109 of fig6 is answered affirmatively upon receipt of the retrieve measurements command from the host and the retrieve workstation controller measurements subroutine of fig9 is called . the counts contained i the five counters of counter save area 27 are sent to the host and are used to increment the counts contained in data base 14 . both processors again reenter their idle loops . when system timer 18 specifies that it is time to stop performance measurements in block 58 of fig2 the host calls its stop performance measurements subroutine as shown in fig5 . the host then sends a stop measurements command to the workstation controller in block 86 . upon receipt of the stop measurements command in its processor task queue , processor 22 answers block 112 of fig6 affirmatively and calls the stop workstation controller measurements subroutine of fig1 . processor 22 resets the &# 34 ; measurements being taken &# 34 ; flag as shown in fig1 , returns back to block 102 and reenters its idle loop . meanwhile , processor 11 calls its retrieve performance measurements subroutine of fig4 which causes a retrieve measurements command to be sent from the host to the workstation controller . the counts contained in counter save area 27 are sent to the host to increment the values contained in data base 14 . the manner in which processor 11 uses the data contained in data base 14 to arrive at performance characteristics of the attached workstation controllers will now be discussed . the workstation controller processor utilization is calculated by the following equation in block 92 : ## equ1 ## note that determining processor utilization by using an idle loop counter is accurate , simple , and does not degrade the performance of the processor . the workstation controller processor workload evenness is calculated by the following equation in block 93 . ## equ2 ## the workstation controller communications line utilization is calculated by the following equation in block 94 : ## equ3 ## the workstation controller communications line workload evenness is calculated by the following equation in block 96 : ## equ4 ## in block 97 , the calculations performed in blocks 92 , 93 , 94 , and 96 are analyzed and the results of this analysis are sent to the user . specifically , the workstation controller processor utilization is analyzed to see whether it falls below a first threshold amount . in the preferred embodiment , the first threshold is 50 %. if the workstation controller processor utilization is below 50 %, the user is informed that the workstation controller processor performance is acceptable . if the workstation controller processor utilization is above a second threshold , the user is informed that the workstation controller processor performance is unacceptable . in the preferred embodiment , the second threshold is 70 %. the threshold numbers are largely a design choice and could change depending upon the environment . for example , a multithreaded environment could have thresholds higher than in an environment that was not multithreaded . also , if the environment employs a task priority scheme , the thresholds can be higher than an environment without a task priority scheme . if the workstation controller processor utilization falls between the first and second thresholds , the performance is marginal and further analysis is necessary to determine if the workstation controller processor performance is acceptable . if the workstation controller processor workload evenness exceeds a third threshold , the workstation controller processor workload is considered to be uneven . an uneven workload is considered to be undesireable because the user could periodically notice poor response time . in the preferred embodiment , the third threshold is three times the workstation controller processor utilization . this , in addition , to a workstation controller processor utilization between the first and second thresholds would indicate that the workstation controller processor performance is not acceptable and this result is sent to the user . block 97 analyzes the workstation controller communication line utilization and workload unevenness in a similar manner . specifically , if the work station controller communications line utilization is less than the first threshold of 50 % in the preferred embodiment , the workstation controller communications line performance is considered to be acceptable and that result is sent to the user . if the workstation controller communication line utilization is above the second threshold of 70 % in the preferred embodiment , the workstation controller communication line performance is considered to be unacceptable and that result is sent to the user . if , however , the workstation controller communication line utilization is between the first and second thresholds , the performance is marginal and further analysis of the workstation controller communication line workload evenness is necessary to determine whether the performance is acceptable or not . in the preferred embodiment , if the workstation controller communication line workload evenness is more than the third threshold of 3 times the workstation controller communications line utilization , the workload is considered to be uneven and that , in addition to a workstation controller communications line utilization between the first and second threshold would indicate that the performance of the workstation controller communication line is unacceptable , and that result is sent to the user . if the workstation controller communication line workload evenness number is less than the third threshold , the communications line performance is considered to be acceptable and that result is sent to the user . the workload evenness thresholds for both the workstation controller processor and communications line are a design choice and can be more or less than the preferred embodiment of three times utilization , depending on the application . for example , if the wsc typically processes very many small tasks , a number greater than 3 times the utilization can still be considered acceptable . while the preferred embodiment has been described , an alternative embodiment has been contemplated and will briefly be described . in the alternate embodiment , line 17 connecting host 10 with wsc 20 is also a communications line , and an additional communications usage counter and communications queue counter are used in calculating the performance of communications line 17 in the same manner that the performance of communications line 29 is determined . while the invention has been described with respect to preferred embodiments , it will be understood by those skilled in the art that various changes in detail may be made therein without departing from the spirit , scope and teaching of the invention . accordingly , the herein disclosed is to be limited only as specified in the following claims .	6
for the purposes of promoting and understanding the principles disclosed herein , reference will now be made to the preferred embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope is thereby intended . such alterations and further modifications in the illustrated device and such further applications are the principles disclosed as illustrated therein as being contemplated as would normally occur to one skilled in the art to which this disclosure relates . in accordance with one principle aspect of the present disclosure , a thermoelectric cooling apparatus comprises a thermoelectric module including a heatsink contiguous with one side of the thermoelectric module and a coldsink contiguous with another side of the thermoelectric module . at least one of the heatsink and the coldsink is configured from a generally continuous planar element and includes a series of lands and opposing grooves , which are each defined about a fold line normal to a longitudinal axis of the continuous planar element . further , a substantially planar intermediate portion is disposed between each adjacent land and groove . each groove is contiguous with the thermoelectric module so that heat is transferred by the peltier effect when direct current is applied to the thermoelectric module . in accordance with another principal aspect of the present disclosure , the cooler comprises walls that enclose a volume . a thermoelectric module is connected to one of the walls such that a heatsink , contiguous with one side of the thermoelectric module , is disposed external to the volume and a coldsink , contiguous with another side of the thermoelectric module , is disposed within the volume of the cooler . at least one of the heatsink and the coldsink is configured from a generally continuous planar element and includes a series of lands and opposing grooves , which are each defined about a fold line normal to a longitudinal axis of the continuous planar element . further , a substantially planar intermediate portion is disposed between each adjacent land and groove . each groove is contiguous with the thermoelectric module so that heat is transferred by the peltier effect when direct current is applied to the thermoelectric module . in another aspect of the present disclosure , at least one aperture is formed in at least one of the lands and / or grooves adjacent the respective fold line . in another aspect of the present disclosure , at least one offset element is formed in the intermediate portion of the heat exchanger extending along the longitudinal axis . in another aspect of the present disclosure , a flange couples at least one of the heatsink and coldsink to the thermoelectric module . in another aspect of the present disclosure , the flange includes a plurality of channels that are complementary to the grooves on the heatsink and / or coldsink . in another aspect of the present disclosure , a plurality of offset elements are formed in each intermediate portion of the heat exchanger so that adjacent offset elements each project to an opposite side of the intermediate portion . fig1 illustrates a cooler 86 including a pair of thermoelectric apparatuses 20 and a plurality of vertical walls 80 and a mounting wall 81 ( collectively , the walls ) which define a volume 82 . the walls 80 and mounting wall 81 may be made of any suitable structural product , such as , for example , a preferred material would include , polystyrene which has been injected , extruded or blow molded , or any other suitable product that provides structural support for the cooler 86 and insulation for the volume 82 . indicia may be provided on the exterior of the walls 80 or on a sheath ( not shown ) contiguous with the walls 80 to show the contents disposed within the volume 82 . the mounting wall 81 facilitates installation and operation of the thermoelectric apparatuses 20 and fan 84 . a lid 28 is configured as the removable top portion of the cooler 86 and includes a hinged door 30 that permits access to the otherwise enclosed volume 82 of the cooler 86 . the lid 28 further includes a bridge portion 83 having a front 102 disposed above the door 30 , opposing ends 104 , 106 and a top 108 . the bridge portion 83 and the mounting wall 81 cooperatively define a volume that functions as an upper air channel when the cooler 86 is operative . vents 32 are formed in each of the opposing ends 104 , 106 and extend onto the top 108 so that the fan 84 , when operative , draws air into the upper air channel and over heatsinks 24 of the thermoelectric apparatus 20 that are disposed in the air channel . a spacer 90 is disposed in the upper air channel to facilitate efficient routing of the air . a vent 33 is formed in the top 108 of the bridge portion 83 to exhaust air drawn into the upper air channel by the fan 84 . further operation of the cooler 86 will be disclosed in more detail below . equipment ( not shown ) is disposed in the upper air channel and includes the necessary electrical and electronic components for the operation of the thermoelectric apparatus 20 , which will be recognized by one of skill in the art and is discussed in greater detail in reference to fig5 . the thermoelectric apparatus 20 , in this embodiment , is connected to the mounting wall 81 such that the coldsinks 26 are disposed within the volume 82 in order to facilitate adjustment of the temperature thereof . a deflector plate 54 , connected to the walls 80 and the mounting wall 81 , cooperatively define a lower air channel . the coldsinks 26 and the fan 84 are disposed in the lower air channel . the deflector plate 54 , in this embodiment , is configured as a plastic element that is connected to the mounting wall 81 and rear wall 80 and is spaced , at each end , from opposing side walls so that the fan 84 may exhaust air drawn into the lower air channel through a bottom air vent 34 . a drip hole 42 is configured as an aperture formed in the bottom wall of the cooler 86 that defines a passage from inside the volume 82 to the outside of the volume 82 . a wick 40 is disposed outside of the volume 82 such that condensate , i . e ., water , passing through the drip hole 42 must flow over the wick 40 in a convoluted path to a catch pan 52 . a rack element 36 is disposed adjacent each of the vertical walls 80 and the bottom wall to support the contents thereof and space the contents from the walls to avoid contact with any condensate . a thermometer 38 may be provided to display a temperature within the volume . in one embodiment , a thermometer 38 may be provided that is operatively coupled to appropriate equipment , as will be recognized by one of skill in the art , so that the thermoelectric apparatus 20 may be electronically controlled to adjust the temperature within the volume 82 . fig2 illustrates an exploded view of the thermoelectric apparatus 20 . the thermoelectric module 22 is centrally located within the thermoelectric apparatus 20 . as discussed above , the thermoelectric module is of conventional design . for example , it has been discovered that , in one embodiment , a cp series solid - state thermoelectric cooler from melcor corporation of trenton , n . j . performs in accordance with the present disclosure . other similar thermoelectric coolers may be specified in accordance with desired results . in the preferred embodiment , a heatsink 24 is connected to one side of the thermoelectric module 22 and a coldsink 26 is connected to another , opposite side of the thermoelectric module 22 . at least one of the heatsink 24 and the coldsink 26 is formed from a continuous generally planar element 44 . in the embodiment shown in fig2 , both such heat exchangers are so formed . the generally planar element 44 is preferably formed of a material that facilitates a high rate of heat transfer capability . for example , one commonly available material is aluminum and alloys thereof . other materials include iron , copper , steel , and any other suitable materials . the planar element 44 as shown in fig2 is formed to define a series of lands 46 and opposing grooves 48 , each about a fold line 50 normal to a longitudinal axis 51 of the planar element 44 . a substantially planar intermediate portion 62 is disposed between each adjacent land 46 and groove 48 . the planar element 44 has a thickness that is preferably less than 0 . 080 inches . more preferably , the planar element has a thickness in the range of 0 . 05 inches to 0 . 060 inches . in one embodiment , the thermoelectric module 22 is operatively thermally coupled to a spacer 68 which is configured with a specified thickness to facilitate orienting the coldsink 26 within the volume 82 and the heatsink 24 exterior to the volume 82 , substantially as thick as the walls 80 , not shown . in another embodiment , the thermoelectric apparatus 20 includes a flange 76 operatively associated with each heatsink 24 and coldsink 26 formed from the generally planar element 44 . each flange 76 , 78 has a series of channels 78 that are collectively formed with complementary surfaces to facilitate meshing with the grooves 48 . such heatsink 24 and / or coldsink 26 is connected to the respective flange 76 to facilitate increased heat transfer by way of greatly increased surface area . the heatsink 24 and / or coldsink 26 may be connected in any suitable manner sufficient to provide the transfer of heat . in one embodiment , threaded fasteners 58 are useful for coupling all the elements of the thermoelectric apparatus 20 together . in another embodiment , a thermal adhesive 56 may be disposed between the heatsink 24 and / or coldsink 26 and the respective flange 76 to facilitate the coupling . any suitable thermal adhesive may be used to perform the intended functionality . further , screw holes 60 and the screws 58 can be used to assemble the thermoelectric apparatus 20 . screw holes 60 are formed in the heatsink 24 , the coldsink 26 , the flange 76 , and the housing element 68 . in another embodiment , either the heatsink 24 and / or the coldsink 26 include a plurality of offset elements 66 . the plurality of offset elements 66 are formed in the intermediate portion 62 wherein adjacent offset elements each project to an opposite side of the intermediate portion 62 . each offset element 66 is formed so that the elongated height of the offset element 66 is generally normal to the fold line 50 . the offset element 66 is preferably formed with a press or stamp punch apparatus ( not shown ). further , the offset elements 66 are formed in the generally planar element 44 before the forming of the lands 46 and grooves 48 . further , the offset elements 66 facilitate an improved heat transfer rate in the heatsink / coldsink by way of creating a turbulent airflow in the heatsink / coldsink . the structural configuration of the offset portions 66 strengthens the intermediate portion 62 , keeps adjacent intermediate portions 62 spaced apart and provides turbulence to air flowing there between , thus facilitating an increased rate of heat transfer . while the particular preferred embodiment has been shown and described , it will be obvious to those skilled in the art that changes and modifications may be made . for example , changing the profile of the offset element 66 , or modifying the number and / or location of the offset elements 66 . fig3 illustrates an exploded end view of a portion of the thermoelectric apparatus 20 . in the preferred embodiment , the planar element 44 , of the heatsink 24 for example , is formed symmetrically about a fold line 50 . the planar element 44 has a thickness that is preferably less than 0 . 080 inches . more preferably , the planar element has a thickness in the range of 0 . 05 inches to 0 . 060 inches . further , the forming process creates the grooves 48 . in addition , the planar element 44 includes a substantially planar intermediate portion 62 . in another embodiment , the planar element 44 includes a plurality of offset elements 66 . each offset element extends from approximately the fold line 50 to the substantially planar intermediate portion 62 . however , it is possible to have other variations , such as the offset element 66 only being located on the substantially planar intermediate portion 62 . further , the offset elements 66 overlap , thus forcing the air to follow a convoluted path . this convoluted path creates turbulent airflow in the heatsink 24 . in another embodiment , the heatsink 24 , and more specifically the grooves 48 , will couple to the thermal adhesive 56 . further , the flange 76 has complementary surfaces , the flange channels 78 , to facilitate meshing with the grooves 48 and the thermal adhesive 56 . the flange 76 also thermally couples to the thermoelectric module 22 , and the housing element 68 . fig4 illustrates a cut - away view of one section of the cooler . in this embodiment , the two heatsinks 24 are disposed outside the volume 82 , separated therefrom by the mounting wall 81 , which partially encloses the volume 82 . further , the two corresponding coldsinks 26 are disposed within the volume 82 . a fan 84 moves a fluid , i . e . air in this embodiment , across the heatsinks 24 and coldsinks 26 . further , electrical power is supplied to a motor 91 outside of the volume , that includes a shaft 92 having a first end 93 outside the volume 82 and a second end 94 extending into the volume 82 . a fan blade is connected to each of the first end 93 and the second end 94 . during operation of the cooler 86 , ice may form on the coldsink and then may melt and drip from the cold sink , if the lid is opened for a certain period of time , because the warmer outside air flows into the volume 82 . apertures 64 formed in the coldsinks 26 allow the melted ice to drip out of the coldsink 26 . thus , the grooves 48 of the heatsink 24 have apertures 64 , which allows the water to flow out of the cold sink 26 . the deflector plate 54 , as discussed in fig1 , directs the water to flow to the back wall 80 of the cooler 86 and prevents water from dripping on the contents . then the water will flow to the bottom of the cooler 86 , and through the drip hole 42 . the water then can evaporate during passage through the wick 40 . if however , there was insufficient time or improper conditions for the water to have evaporated on the wick 40 , then the water drips into the catch pan 52 and either evaporates out of the catch pan 52 , or is emptied by a user . fig5 a illustrates a schematic drawing of the electrical components in one preferred embodiment . electricity from a normal wall outlet 100 provides the power to the cooler 86 . the electricity from the wall outlet 100 is ac power 96 . the ac power 96 is provided to the cooler 86 , which houses all of the remaining necessary components . the ac power 96 is converted by the converter 97 into dc power 98 . the dc power 98 then connects to the necessary electronics 99 . the necessary electronics 99 will vary depending on the embodiment , however resistors , on / off switches , capacitors , processors , and any other suitable electronic parts may be suitable . further , once the correct voltage and current is set , dc power 98 is provided to the fan motor 91 . on a separate dc power line 98 , two thermoelectric apparatuses 20 electrically connect in series . more specifically , dc power 98 is electrically provided to the thermoelectric modules 22 . fig5 b illustrates a schematic drawing of the electrical components in another preferred embodiment . electricity from a normal wall outlet 100 provides the power to the cooler 86 in the form of ac power 96 . the cooler 86 houses all of the remaining necessary components . ac power 96 is converted into dc power 98 by the converter 97 and then connects to the necessary electronics 99 which will vary depending on the desired embodiment , however resistors , on / off switches , capacitors , processors , and any other suitable electronic parts may be suitable . further , once the correct voltage and current is set , dc power 98 is provided to the fan motor 91 . in this embodiment , four thermoelectric apparatuses 20 electrically connected as two pairs of parallel devices to the dc power 98 . more specifically , dc power 98 is electrically provided to the thermoelectric modules 22 . in another embodiment , the thermometer ( 38 , in fig1 ) may electrically connect to the necessary electronics 99 . thus allowing the necessary electronics 99 to control the thermoelectric cooling apparatus 20 . alternatively , the thermometer ( 38 , in fig1 ) may be a mechanical unit used to save costs in construction and operation of the cooler . fig6 illustrates a perspective view of the heatsink 24 , which depicts the flow of air through the heatsink 24 . a portion of the heatsink 24 has been moved for discussion purposes only . in this view , the interior of the groove 48 of the heatsink 24 is visible . further , this view shows the thickness of the planar element 44 . the planar element 44 has a thickness that is preferably less than 0 . 080 inches . more preferably , the planar element has a thickness in the range of 0 . 05 inches to 0 . 060 inches . as briefly mentioned above , a fan draws air in through the vent 32 and then across the heatsinks 24 . the fan blade 95 on the second end 94 draws air in through bottom air vent 34 , which is formed in the deflector plate 54 , and then across the coldsinks 26 . as discussed in detail above , a plurality of offset elements 66 are formed in the intermediate portion 62 wherein adjacent offset elements each project to an opposite side of the intermediate portion 62 . the offset elements 66 increase the rigidity of the heatsink 24 and facilitate the use of a thin generally planar element 44 . accordingly , more grooves 48 and lands 46 may be formed as a heat exchanger . thereby increasing the surface area and the heat transfer rate . in the illustrated embodiment , utilizing four 40 mm .× 40 mm . thermoelectric modules 22 each producing 25 watts of cooling ( or 80 btu per hour ) and a door having a 1 . 8 r factor , a cooler storage volume 80 of 2 . 5 ft 3 maintains a 35 to 40 degree delta ( difference between ambient temperature and mean storage compartment temperature ) depending on humidity . in the illustrated embodiment , the door 30 is constructed of multiple , slightly spaced plies of plastic sheets to achieve a desired degree of insulation , it being understood that each spacing produces an r factor of approximately 0 . 6 . while the particular preferred embodiments have been shown and described , it will be obvious to those skilled in the art that changes and modifications may be made without departing from the teaching of the disclosure . for example , additional peltier devices may be used in any desired wiring configuration , different materials of construction , controllers and other suitable modification or changes . the matter set forth in the foregoing description and accompanying drawings is offered by way of illustration only and not as limitation . the actual scope of the disclosure is intended to be defined in the following claims when viewed in their proper perspective based on the related art .	5
referring now to fig1 an overall view of the printer is illustrated . mounted on a base 10 is a platen 11 with knobs 12 and 13 for rolling the platen 11 and the paper 14 wrapped thereon . of course , in normal use the platen would be rotated by the paper feed servo system which will be discussed below . in accordance with the invention a pair of carriages 16 , 17 are mounted for linear movement along guide rods , one of which is shown at 18 . such movement , of course , is along one predetermined common path where associated print wheels carrying printing characters will print . carriages 16 and 17 include rotary daisy type print wheels 19 and 20 , respectively . movement of both the print wheels and the carriages are provided by servo systems which are disclosed in one form in greater detail in a copending application , ser . no . 700 , 654 , filed june 28 , 1976 , now u . s . pat . no . 4 , 118 , 129 entitled &# 34 ; rotary wheel printing system &# 34 ; and assigned to the present assignee . in addition , a paper feed motor which , for example , may be an open loop controlled stepping motor , is also provided as shown in the above application . fig2 is a block diagram of the overall system where the separate carriages or print heads 16 and 17 in effect have duplicate control systems which by themselves are well - known in the art as illustrated by the above copending application and also in another form by u . s . pat . no . 3 , 954 , 163 assigned to xerox corporation . specifically and referring to fig2 each print wheel ( pw ) which shall hereinafter be referred to as a left and right pw includes its servo system components 22 , 23 which control the rotation of the print wheel , ribbon feed and print hammer . in normal use the print heads or carriages 16 and 17 are linked together by a rigid metal shaft 24 ( fig1 ) which spaces the printing positions of the two print heads exactly 55 printing columns apart ; therefore , for example , with a pitch of 10 characters per inch this is a distance of 51 / 2 inches . this distance has been chosen to place the print heads as close together as possible in order to achieve the maximum common area of printing indicated by the dashed line 26 which extends from printing columns 56 through 209 . upon examination , it is apparent that the left print head as indicated by dashed line 27 can print from column one through 209 and the right head as indicated by the dashed line 28 can print from columns 56 through 264 . referring again to fig2 in normal operation the movement of the permanently linked print heads or carriages 16 and 17 and the paper feed which is a rotation of platen 11 , are controlled by a common logic unit 31 which includes a carriage servo and paper feed drive . however , as an alternative embodiment as indicated by the dashed line 32 of fig1 on the platen 11 , indicating &# 34 ; split platen option &# 34 ; separate sheets of paper , for example , in an accounting environment may be used with the left and right print heads printing on both sheets at the same time . thus the platen 11 would have two paper feed motors . thus each platen half can be controlled separately or they can be rotated simultaneously . moreover , the left and right print heads could be separated a greater distance of 132 columns or 13 . 1 inches at a 10 pitch so that with the left print head at the left printing column of the left hand platen sheet the right print head would be at the left hand printing column of the right platen sheet . the left and right platen portions need not be of equal length . and moreover they can selectively be of the friction , tractor , and pinfeed types . referring again to fig2 the left and right print heads &# 39 ; control functions are respectively controlled by a master microcomputer 33 and a slave microcomputer 34 . master microcomputer 33 in general has exclusive control of the carriage servo and paper feed drive 31 as indicated by the data link 36 . as thus far described ( and except for mechanical link 24 ) the system of fig2 is in essence two separate daisywheel character printing systems which are complete in themselves and are well - known in the art as exemplified by the above cited patents . however , in accordance with the invention in order to coordinate the operation of the two printing systems and to achieve the several advantages of the present invention the coordination logic shown in block 37 is necessary . such coordination logic on an &# 34 ; a &# 34 ; bus is connected to a customer interface which has typical ascii type data and control instructions . a &# 34 ; b &# 34 ; bus links the master microcomputer 33 with the coordination logic and a &# 34 ; c &# 34 ; bus links the slave microcomputer 34 . as is apparent from the use of the terms &# 34 ; master &# 34 ; and &# 34 ; slave &# 34 ; the master system with its control of carriage and paper feed movement is dominant over the slave system . other control lines indicated between the coordination logic and the various blocks are a carriage clock ( ca clk ) which provides for step type incremental movement of the twin carriages . master and slave carriage position indications designated mcapos and scapos , respectively , are signals to the coordination logic indicating that the master and slave microcomputers are ready for carriage motion . the resulting capos signal from the coordination logic allows the carriage servo to move . a pair of lines designated mpclk en and apclk en are signals from the master microcomputer to the coordination logic indicating that the main paper feed motor of ( in the case of a split platen ) auxiliary or slave paper feed motor are in the process of completing motion . all of the control lines will be discussed in detail in the associated circuit block diagrams and flow charts . now referring to the flow chart consisting of fig3 a through 3h , the flow chart explains the operation of the coordination logic 37 shown in fig2 . fig3 a illustrates the start and idle mode where customer ascii type data and control information on the a bus is continuously sampled as indicated in the flow chart asking a series of questions ; for example is it a &# 34 ; carriage strobe &# 34 ; meaning that the customer wishes a carriage movement , is it a &# 34 ; paper feed main strobe &# 34 ;, an &# 34 ; auxiliary paper feed strobe &# 34 ; ( used in the split platen situation ) a &# 34 ; top of form strobe &# 34 ; or a &# 34 ; character strobe &# 34 ;. once an actual ascii signal is sensed then one of the five different numbered points is branched to . for example , if the carriage strobe is received , the branch is to fig3 b which is point 1 and the carriage command is steered by the coordination logic to both the master microcomputer and slave microcomputer . this will eventually cause the movement of the carriage to where the customer system has dictated it is to print and then branches to point 11 of fig3 a and the scanning continues looking for the next command . continuing with the flow chart of fig3 a , if a paper feed main strobe is received , then the branch is made to point 2 as illustrated in fig3 c . in this particular case the paper feed command only goes to the master microcomputer since as discussed above it has full control over the paper feed motion . hence the master microcomputer acts on the paper feed command setting the paper feed motion status to be true , disables the character ready status and branches to point 6 shown in fig3 d . here it is determined by the examination of the pclk en lines whether or not paper feed motion is complete . if it has been completed , then the logic &# 34 ; yes &# 34 ; resets the paper feed motion status . prior to determining this particular path back to point 11 of fig3 a , several more questions are asked including : ( 1 ) is a select x line false ( which is only used in the sequential mode ; in the parallel mode the answer to this question will always be yes ) and , ( 2 ) are the master and slave input buffer ready status true meaning that both the master and slave microcomputers are ready to receive the next input . such ready status is a well - known control indication in printers of this type . if both of these answers are &# 34 ; yes &# 34 ;, then the character ready is enabled again and the beginning of the loop in fig3 a is gone back to . the same loops occur as shown in fig3 b for the paper feed auxiliary strobe and the top of form strobe of fig3 a . top of form , of course , is normally used to move the platen to the first printing row to the next form . auxiliary paper feed is for a split platen . thus far there is very little coordination difficulty since as discussed above the left print wheel system ( the master system ) exercises supervisory control over both the carriage and paper feed movements . however , the character strobe which branches to point 5 of fig3 e is a complicated case and takes different paths depending on whether the parallel ( concurrent ) mode or sequential mode of operation is being used . the parallel of concurrent mode is the simplest and in the logic illustrated in fig3 e the most significant bit ( d2048 ) of the character data is sensed and if it is , for example , true or a 1 then it indicates a character is to be printed by the right print wheel and if it is false or a 0 , a character is to be printed by the left print wheel . the character strobe is thus sent to either the master of slave microcomputer . then point 11 is gone back to . the foregoing is therefore the sum total of the parallel mode of operation . it is apparent that with this mode of operation while the internal logic of the printer is relatively simple the customer or user must extensively modify their software program . in other words , the software ( or the hardware as provided by the capability of the special interface unit ) must be aware of the characters that can be printed by both print stations without moving the carriage . this involves a &# 34 ; look ahead &# 34 ; to determine if the character that will be printed at the position occupied by the second print station will be from the second print wheel . if it is , it should be printed , while the first station is printing at the other location . since the distance between the two print stations is a fixed 5 . 5 inches , the arithmetic for the &# 34 ; look ahead &# 34 ; is relatively simple . it requires that somewhere in the hardware or software there is a line buffer . it is usually practical to use the customer &# 39 ; s computer memory , accessing different memory locations to achieve the &# 34 ; look ahead &# 34 ; without actually moving or copying the data . when the characters are placed into the buffer the most significant eighth bit is attached to each character to designate printing by the right or left print wheel . other techniques can be devised to do the same to implement this parallel or concurrent mode . for example , on large , sophisticated processors , the raw text could be tested as it reaches the interface of the customer and left and right print wheel decisions made at that time . all possible printing would be done by the leading print wheel , and those characters that required the trailing print wheel would be &# 34 ; saved &# 34 ; and printed when that print wheel reached the proper position . on the other hand , as will now be discussed in detail below , in the case of the sequential mode of operation all that need be done by the customer is the modification of the most significant bit of the character data that indicates left or right print wheel . other than that , the capability of the present invention is transparent to the user . the parallel mode is , of course , the fastest reaching average speeds of 75 characters per second . the sequential mode time is consumed by the tabbing of the 51 / 2 inch distance by one print head or the other . referring to the flow chart of fig3 e , if sequential coordination logic is utilized , a branch is made to point 7 in fig3 f . there the question is asked if the most significant d2048 bit indicates a printing operation for the left print head or the right print head . both succeeding logic blocks ask whether the present print head request is the same as the previous active print head . if the answer is yes , which means that for example the left print head is already in position , then the carriage does not have to be moved to print the next character and hence the character strobe as indicated in the next block is merely sent to the master microcomputer , the state counter is reset and the branch is made back to the beginning ( fig3 a ). the same occurs if this condition occurs for the right print wheel . here the character strobe is sent directly to the slave microcomputer which then prints the character and resets the state counter . now , for example , if printing had occurred on the left hand and the answer to the present mode of printing requires the right head and vice versa then a branch must be made to the point 8 or point 9 . this is illustrated in fig3 g , and for example , referring to the point 8 branch , the carriage direction must be set to move right . this is because the previous active print head was by definition the right print head and now that it is desired to print with the left print head the carriage must , of course , be moved to the right to move into the subsequent printing column . it should be noted at this time that since the entire logic sequence was started by the sensing of a character strobe on the data lines and this character data is not to be executed immediately because of the need to command the carriage to move first , therefore , the character data must be stored in temporary character memory which is here indicated . at the same time , there is a select x command to select the preset print head distance ( in our case 51 / 2 inches ) which the carriage must move . this distance is stored in a memory to be discussed below in conjunction with the logic block diagrams . also different distances can , of course , be chosen depending on the application ; for example , in a split platen situation it might be 13 . 1 inches . next this preset distance is forced on the data lines . since increments of 1 / 60 of an inch are used the 51 / 2 inch distance would require 330 incremental moves by the carriage servo . with this data on the data lines , the carriage strobe is indicated and in the next block is sent to both the master and slave microcomputers so that together they will coordinate the motion of the left and right hand print heads . in the case of the opposite where the last active print head was the left one and it was desired to now use the right print head , then the flow chart falls through on point 9 where carriage direction is set to move left and the same steps occur thereafter . after each of these character print operations it is desired to remember which head was active last because of the obvious logic set out above , so therefore concurrently with the carriage strobe there is set into memory the current print head status . now that the carriage is in the proper position , the character that is in the character memory can be printed . this is point 10 and is branched to as illustrated in fig3 h . here a select y line ( which is shown in the logic block diagram ) selects the data in the character memory . the ascii code that is stored in the character memory is forced upon the selected data lines . at the same time the printer is looked to to determine if it is ready ( rdy ) to accept the particular command . if not , a waiting or idle loop is created until the printer is ready to accept that command at which time the character strobe is generated . such character strobe , shown by the next block , is sent either to the master microcomputer or slave microcomputer depending on which direction the carriage direction logic or flip - flop which was related to the carriage direction of fig3 g was previously set . the character is then strobed and printed . at the same time a state counter is reset along with select x and y associated flip - flops and the initial starting position is returned to . this thus completes the sequential mode of operation . the hardware or software as the case may be to accomplish the logic flow chart of fig3 is illustrated in fig4 a through 4d . the blocks in the diagram with an asterisk indicate that this block is needed only for the sequential mode of operation and is not necessary for the concurrent or parallel mode . referring now to fig4 a the a bus from the customer interface on its 13 standard data lines extends both to a character memory 41 and a multiplexer unit 42 . the character memory is for temporarily storing a character command when the incorrect print wheel is in the printing position . see fig3 g and 3h . multiplexer 42 in conjunction with a multiplexer 43 are related to the select x and select y commands in establishing one of three possible data paths to the master microcomputer or the slave microcomputer . these are ( 1 ) from the customer interface , ( 2 ) from the character memory 41 or ( 3 ) from the preset print head distance unit 44 which stores the 51 / 2 inch standard distance ( see fig3 g ). the paths are indicated in the multiplexers for select x and select y being true and with a solid connection and false with the dashed connection . thus as illustrated by the flow chart of fig3 g to force the preset print head distance from block 44 on the data lines of the printers select x is true and select y is false . block 46 designated &# 34 ; previous active print head memory &# 34 ; receives the most significant data bit , d2048 . this is discussed in fig3 g where the current print head status is set into memory . the purpose of this is to decide whether the present command uses the same print wheel or not . this is determined in comparator unit 47 which compares the present command with the previous active print wheel status to determine if it is necessary to move the carriage . hence a direction of travel bit is generated if a nonequal comparison occurs . however , if it is equal , then as illustrated in fig3 f a very simple situation occurs where the character strobe that did come through is steered by logic gating 48 to the master microcomputer or slave microcomputer depending on which head it is desired to do the printing at the time . thus the equal indication from comparator 47 extends directly to logic gate 48 which then steers the strobe to the proper master or slave bus ( b bus or c bus ). similarly , for the parallel mode there is a direction connection of the d2048 bit via line 50 to gating 48 to accomplish the logic of fig3 e . if not equal , then a state counter 49 is activated which executes the flow chart as illustrated in fig3 g . in addition , comparator 47 also has a line 51 connected to the multiplexer 42 to set select x to connect the preset printer distance unit memory 44 onto the data bus for both the master and slave microcomputer . in addition , multiplexer 43 already provides for connection of this carriage information to the data lines . block 54 is a carriage movement generator activated in accordance with the flow chart of fig3 g where when multiplexer 42 connects the preset print head distance to the data lines a carriage strobe ( caxstb ) is generated to move or tab it to the proper position . as also illustrated in fig3 h the y select , line 52 , is activated to connect the master or slave data lines to the character memory 41 in preparation for the reception of the character strobe . a ready ( rdy ) line is inputted to state counter 49 . this ready signal is the key signal that triggers the state counter to go into the next state ; that is , once the carriage has moved to the printing position a character is to be generated . this is illustrated in fig3 h also where a character strobe is generated . character strobe generator 53 , under control of state counter 49 , generates a character strobe which by means of logic gating 48 is sent to the master or slave bus . the next group of control lines illustrated in fig4 b all relate to the paper feed motions and can easily be correlated with the flow chart of fig3 c . here there is the main paper feed , the auxiliary paper feed ( in the case of a split platen ) and top of form which are all sent to the master microcomputer which has overall control of the system of the present invention . any of these paper feed commands will cause the paper feed not in motion status from the logic unit 56 to be false ( assuming negative logic ). this paper feed in motion signal on line 57 is utilized in determining , in conjunction with fig4 c , whether the ready lines are true or not . specifically referring to fig4 c such ready lines are the ready ( rdy ) indication used in conjunction with the state counter 49 of fig4 a and other ready indications including character ready . if there is paper motion , the character ready status will , of course , always be false due to the paper feed not in motion line 57 . the associated and gate 58 also depends on the coincidence inputs that the select x mode is not being used and that both master and slave input buffers are ready and that they are also completely empty . this is , of course , the rdy indication also . in general before commands can be given to the printer by the customer the input buffer must be ready and the associated ready ( viz , carriage , paper feed and character ) must be tested before that command can be strobed in . lastly , fig4 d relates to the coordination of the carriage movements in the servo and microcomputers as illustrated in fig2 . for example , the commands from the master and slave microcomputer to move are anded and thus both must coincide before the carriage moves . this assures that the two microcomputers operate in synchronism with each other . the foregoing coordination also provides for the fast that one printer may be finishing the printing of a character while the other print head and its associated microcomputer is theoretically idle and therefore ready for carriage movement . the flow charts and logic block diagrams can both be understood by reference to the timing diagrams of the fig5 and 7 . in the case of fig5 this relates to the carriage paper feed commands which are the same both for sequential or concurrent timing . the designations on the different timing diagrams are also found in fig4 b , c and d . fig6 illustrates the case of sequential or concurrent timing if the current print command uses the same print head as the previous command . this is obvious from inspection of the flow chart of fig3 e for parallel or concurrent timing and fig3 f for the sequential mode . note the two cases of the 2048 data bit where if it is low a printing occurs on the master print wheel and if high on the slave print wheel . the ready conditions of character ready , carriage ready , paper feed ready and input buffer empty are , of course , shown in fig4 c . lastly , the sequential timing mode only is shown in fig7 where the current print command uses the other print head as the previous print command which the flow charts of fig3 g and 3h are illustrated . here a select x and select y command must be given to displace or jump the carriage the preset distance . thus a character printer with enhanced character capability has been provided . although only two print heads have been illustrated three or more could be used . with respect to the most significant bit of character data controlling print head selection a more complex code could be utilized , especially with more than two print heads . many additional benefits arise from the character capability of two or more print wheels . for example print wheels with substantially identical character fonts can be used to print text , tabular , or columnized material with much greater speed and efficiency than a single - head printer . on the other hand each print wheel can contribute a part or building block of an overall printed construction . this may be used for printing complex arabic or oriental characters or in plotting topographical contour maps . many similar applications will become apparent .	1
in the following description , a preferred embodiment of the present invention will be described in terms that would ordinarily be implemented as a software program . those skilled in the art will readily recognize that the equivalent of such software may also be constructed in hardware . because image manipulation algorithms and systems are well known , the present description will be directed in particular to algorithms and systems forming part of , or cooperating more directly with , the system and method in accordance with the present invention . other aspects of such algorithms and systems , and hardware and / or software for producing and otherwise processing the image signals involved therewith , not specifically shown or described herein , may be selected from such systems , algorithms , components and elements known in the art . given the system as described according to the invention in the following materials , software not specifically shown , suggested or described herein that is useful for implementation of the invention is conventional and within the ordinary skill in such arts . still further , as used herein , the computer program may be stored in a computer readable storage medium , which may comprise , for example ; magnetic storage media such as a magnetic disk ( such as a hard drive or a floppy disk ) or magnetic tape ; optical storage media such as an optical disc , optical tape , or machine readable bar code ; solid state electronic storage devices such as random access memory ( ram ), or read only memory ( rom ); or any other physical device or medium employed to store a computer program . before describing the present invention , it facilitates understanding to note that the present invention is preferably utilized on any well - known computer system , such a personal computer . consequently , the computer system will not be discussed in detail herein . it is also instructive to note that the images are either directly input into the computer system ( for example by a digital camera ) or digitized before input into the computer system ( for example by scanning an original , such as a silver halide film ). referring to fig1 , there is illustrated a computer system 110 for implementing the present invention . although the computer system 110 is shown for the purpose of illustrating a preferred embodiment , the present invention is not limited to the computer system 110 shown , but may be used on any electronic processing system such as found in home computers , kiosks , retail or wholesale photofinishing , or any other system for the processing of digital images . the computer system 110 includes a microprocessor - based unit 112 for receiving and processing software programs and for performing other processing functions . a display 114 is electrically connected to the microprocessor - based unit 112 for displaying user - related information associated with the software , e . g ., by means of a graphical user interface . a keyboard 116 is also connected to the microprocessor based unit 112 for permitting a user to input information to the software . as an alternative to using the keyboard 116 for input , a mouse 118 may be used for moving a selector 120 on the display 114 and for selecting an item on which the selector 120 overlays , as is well known in the art . a compact disk - read only memory ( cd - rom ) 124 , which typically includes software programs , is inserted into the microprocessor based unit 112 for providing a means of inputting the software programs and other information to the microprocessor - based unit 112 . in addition , a floppy disk 126 may also include a software program , and is inserted into the microprocessor - based unit 112 for inputting the software program . the compact disk - read only memory ( cd - rom ) 124 or the floppy disk 126 may alternatively be inserted into an externally located disk drive unit 122 which is connected to the microprocessor - based unit 112 . still further , the microprocessor - based unit 112 may be programmed , as is well known in the art , for storing the software program internally . the microprocessor - based unit 112 may also have a network connection 127 , such as a telephone line , to an external network , such as a local area network or the internet . a printer 128 may also be connected to the microprocessor - based unit 112 for printing a hardcopy of the output from the computer system 110 . images may also be displayed on the display 114 via a personal computer card ( pc card ) 130 , such as , as it was formerly known , a pcmcia card ( based on the specifications of the personal computer memory card international association ) which contains digitized images electronically embodied in the card 130 . the pc card 130 is ultimately inserted into the microprocessor based unit 112 for permitting visual display of the image on the display 114 . alternatively , the pc card 130 can be inserted into an externally located pc card reader 132 connected to the microprocessor - based unit 112 . images may also be input via the compact disk 124 , the floppy disk 126 , or the network connection 127 . any images stored in the pc card 130 , the floppy disk 126 or the compact disk 124 , or input through the network connection 127 , may have been obtained from a variety of sources , such as a digital camera ( not shown ) or a scanner ( not shown ). images may also be input directly from a digital camera 134 via a camera docking port 136 connected to the microprocessor - based unit 112 or directly from the digital camera 134 via a cable connection 138 to the microprocessor - based unit 112 or via a wireless connection 140 to the microprocessor - based unit 112 . in accordance with the invention , the algorithm may be stored in any of the storage devices heretofore mentioned and applied to images in order to detect red eye in images . referring to fig2 , the digital camera 134 is responsible for creating the original flash image 202 and non - flash image 200 in a primary color space from the scene 300 . examples of typical primary - color spaces are red - green - blue ( rgb ) and cyan - magenta - yellow ( cmy ). fig3 is a high level diagram of the preferred embodiment . the flash image 202 and non - flash ( i . e ., without flash ) image 200 are processed through the red eye location operation 204 . the result is a red eye location 240 . referring to fig4 , the red eye location operation 204 is subdivided into a chrominance calculation 210 , a chrominance subtraction 220 , and a threshold step 230 . although fig4 shows the red eye location operation 204 including three steps ( i . e ., the steps 210 - 230 ), it is to be noted that the red eye location operation 204 can operate with fewer steps . for example , referring to fig5 , in an alternate embodiment , the red eye location operation 204 does not include the threshold step 230 . in this case , the red eye location 240 is directly populated with the result from the chrominance subtraction 220 . returning to the preferred embodiment , fig6 a and fig6 b are detailed diagrams of the chrominance calculation 210 a and chrominance calculation 210 b . the chrominance calculation for the preferred embodiment , which assumes rgb flash image 202 and rgb non - flash image 200 , is where r = red , g = green , b = blue , and c = the chrominance channel . it should be clear to others skilled in the art that other chrominance calculations could be used . for example , if animal red eye ( that is visually yellow ) is to be detected , an appropriate chrominance calculation would be referring to fig7 , the output from the chrominance calculation , chrominance channel from non - flash image 214 and chrominance channel from flash image 216 , is sent to the chrominance subtraction 220 . the calculation for the preferred embodiment is where c 224 is the chrominance difference image 224 pixel value , c 214 is the chrominance channel from non - flash image 214 pixel value and c 216 is the chrominance channel from flash image 216 pixel value . the result of the chrominance subtraction 220 is the chrominance difference image 224 . fig8 shows the details of threshold step 230 . the purpose of a levels threshold step 232 is to determine if the calculated chrominance difference pixel value is large enough to indicate a red eye location . the levels threshold step 232 is applied to chrominance difference image 224 . the levels threshold step 232 compares the pixel values in the chrominance difference image 224 to a predetermined levels threshold value . pixel values in the chrominance difference image 224 that are less than the predetermined levels threshold value are assigned to zero in the output levels threshold image 234 . pixel values that are not less than the predetermined levels threshold value are assigned unaltered to the output levels threshold image 234 . the resulting output levels threshold image 234 is refined by the color threshold step 236 . also required for the color threshold step 236 is the chrominance channel from flash image 216 . the purpose of the color threshold step 236 is to determine if the pixel value is substantially red ( or green or yellow for animal eyes ). for each non - zero value in the output levels threshold image 234 , the color threshold step 236 will examine the corresponding location in the chrominance channel from flash image 216 . for pixel values in the chrominance channel from flash image 216 that are less than the predetermined color threshold value , the corresponding pixel values in the output color threshold image 238 are assigned to zero . the remaining pixel values that are not less than the predetermined color threshold value are assigned unaltered from the output levels threshold image 234 to the output color threshold image 238 . the pixel values in the output color threshold image 238 are assigned unaltered to the red eye location 240 . a typical value for the aforementioned predetermined levels threshold value for an 8 - bit image is 5 . a typical value for the aforementioned predetermined color threshold value for an 8 - bit image is 30 . although fig8 shows that threshold step 230 includes four steps ( i . e ., the steps 232 - 238 ), it is to be noted that the threshold step 230 can operate with fewer steps . for example , referring to fig9 , the threshold step 230 does not include the levels threshold step 232 ( fig8 ). in this case , pixel values in the chrominance difference image 224 are assigned unaltered to the output levels threshold image 234 . as a further example , referring to fig1 , the threshold step 230 does not include the color threshold step 236 . in this case , pixel values in the output levels threshold image 234 are assigned unaltered to the output color threshold image 238 . fig1 shows the details of the threshold step 230 for another embodiment of the invention . the details are the same as those described for fig8 except that the pixel values in the output color threshold image 238 are further refined by the shape threshold step 250 . the purpose of the shape threshold step 250 is to determine if the red eye is substantially circular to confirm that red eye has been detected . for pixel values in the output color threshold image 238 that are greater than zero , the pixel coordinates are grouped to determine the shape . the shape of the grouped pixel coordinates is compared to a predetermined shape threshold in the shape threshold step 250 . for pixel coordinates that meet the shape threshold step 250 requirements , the pixel value is assigned unaltered to the red eye location 240 . for pixel coordinates that do not meet the shape threshold step 250 requirements , the pixel value is assigned to zero in the red eye location 240 . although fig1 shows the threshold step 230 includes five steps ( i . e ., the steps 232 - 250 ), it is to be noted that the threshold step 230 can operate with fewer steps . for example , referring to fig1 , the threshold step 230 does not include the levels threshold step 232 . in this case , pixel values in the chrominance difference image 224 are assigned unaltered to the output levels threshold image 234 . as a further example , referring to fig1 , the threshold step 230 does not include the color threshold step 236 . in this case , pixel values in the output levels threshold image 234 are assigned unaltered to the output color threshold image 238 . as a further example , referring to fig1 , the threshold step 230 does not include the levels threshold step 232 or the color threshold step 236 . in this case , pixel values in the chrominance difference image 224 are assigned unaltered to the output levels threshold image 234 . pixel values in the output levels threshold image 234 are assigned unaltered to the output color threshold image 238 . fig1 shows the details for the color threshold 236 in another embodiment of the invention . the purpose of a low threshold step 260 is to determine if the pixel value is substantially red ( or green or yellow for animal eyes ). for each non - zero value in the output levels threshold image 234 , the low threshold step 260 will examine the corresponding location in the chrominance channel from flash image 216 . for pixel values in the chrominance channel from flash image 216 that are less than the predetermined low threshold value , the corresponding pixel values in an output low threshold image 262 are assigned to zero . the remaining pixel values that are not less than the predetermined color threshold value are directly assigned from the output levels threshold image 234 to the output low threshold image 262 . the pixel values in the output low threshold image 262 are further refined by a region adjustment step 264 . also required for the region adjustment step 264 is the chrominance channel from flash image 216 and the chrominance difference image 224 . the purpose of the region adjustment step 264 is to examine pixels adjacent to the detected red eye to determine if they should be included in the detected red eye . for each non - zero value in the output low threshold image 262 , the region adjustment step 264 will examine the corresponding surrounding pixel values in the chrominance channel from flash image 216 . for pixel values in the chrominance channel from flash image 216 that are greater than the predetermined region adjustment value , the corresponding pixel values in the chrominance difference image 224 are assigned unaltered to the output color threshold image 238 . the remaining pixel values that are not greater than the predetermined color threshold value are assigned unaltered from the output low threshold image 262 to the output color threshold image 238 . although fig1 includes three steps , ( i . e . the steps 260 - 264 ), it is to be noted that the color threshold step 236 can operate with fewer steps . for example , referring to fig1 , the color threshold step 236 does not include the low threshold step 260 . in this case , the pixel values in the output levels threshold 234 are assigned unaltered to the output low threshold . although fig1 shows the pixel values of the pixel coordinates of the chrominance channel from flash image 216 being compared to a predetermined value given in the low threshold step 262 ; fig1 shows that the flash image 202 is used instead of the chrominance channel from the flash image 216 . although fig1 includes three steps , ( i . e . the steps 260 - 264 ), it is to be noted that the color threshold step 236 can operate without some of the steps 260 - 264 . for example , referring to fig1 , the color threshold step 236 does not include the low threshold step 260 . in this case , the pixel values in the output levels threshold image 234 are assigned unaltered to the output low threshold image 262 . the red eye detection algorithm disclosed in the preferred embodiment ( s ) of the present invention may be employed in a variety of user contexts and environments . exemplary contexts and environments include , without limitation , wholesale digital photofinishing ( which involves exemplary process steps or stages such as film in , digital processing , prints out ), retail digital photofinishing ( film in , digital processing , prints out ), home printing ( home scanned film or digital images , digital processing , prints out ), desktop software ( software that applies algorithms to digital prints to make them better — or even just to change them ), digital fulfillment ( digital images in — from media or over the web , digital processing , with images out — in digital form on media , digital form over the web , or printed on hard - copy prints ), kiosks ( digital or scanned input , digital processing , digital or scanned output ), mobile devices ( e . g ., pda or cell phone that can be used as a processing unit , a display unit , or a unit to give processing instructions ), and as a service offered via the world wide web . in each case , the red - eye algorithm may stand alone or may be a component of a larger system solution . furthermore , the interfaces with the algorithm , e . g ., the scanning or input , the digital processing , the display to a user ( if needed ), the input of user requests or processing instructions ( if needed ), the output , can each be on the same or different devices and physical locations , and communication between the devices and locations can be via public or private network connections , or media based communication . where consistent with the foregoing disclosure of the present invention , the algorithm itself can be fully automatic , may have user input ( be fully or partially manual ), may have user or operator review to accept / reject the result , or may be assisted by metadata ( metadata that may be user supplied , supplied by a measuring device ( e . g . in a camera ), or determined by an algorithm ). moreover , the algorithm may interface with a variety of workflow user interface schemes . the red - eye detection algorithm disclosed herein in accordance with the invention can also be employed with interior components that utilize various data detection and reduction techniques ( e . g ., face detection , eye detection , skin detection , flash detection ) the invention has been described in detail with particular reference to certain preferred embodiments thereof , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention .	6
it is anticipated that a normal application of the method and instrument of the present invention will be in planning for the harvesting of timber on a commercial scale . the person doing the planning needs to know how much total weight of timber is in a particular stand planned to be harvested and needs to know how much the individual logs will weigh . this information is needed in order to plan the number of manhours required to harvest the timber . it is also needed in order to allocate the types and sizes of equipment needed to handle the logs . if the equipment available is limited , the weight estimates produced by the invention will help decide the lengths to which the logs will be cut so that the equipment available will be able to handle such logs . this kind of consideration is highly critical in certain logging operations , particularly aerial logging operations , wherein helicopters are used . overloads in helicopter logging are dangerous and can produce impossible situations , that is the helicopter simply cannot lift the log . such overloads are extremely costly in lost time , having to do work over again , and often results in loss of otherwise merchantable timber . the estimates produced by the present invention for aerial logging prevents underloads . that is , where the logs are cut considerably too light for the ability of the helicopters . such underloads result in very severe cost penalties resulting from excess round trips made by the helicopters and the like . finally , where the logger does not own the property involved , as in logging operations on government - owned forest lands , such weight information in advance could help a logger decide on whether or not he wants to make a bid on the particular stand of timber at all . that is , the nature of the logs may be such that it is not economical for this particular logger , in view of the sizes and types of equipment which is available to him , to take that paticular job because the logs produced would be either too small or too large which would , in either case , result in uneconomical operation for that particular logger with his particular set of equipment available . the present invention comprises an instrument having two versions , shown in fig1 - 5 , and includes a method dependent upon this instrument . curves useful in this method are shown in fig6 - 9 . the invention instrument is in the nature of a hydrometer useful for measuring the specific gravity of materials . it works on a kind of reverse principle . that is , hydrometers such as are typically used to determine the freezing temperature of fluids used in automotive radiators , use solid materials of known density to determine the specific gravity and thus the freezing point of liquids of unknown density . the present invention utilizes a liquid of known density , preferably water , to determine the specific gravity and density of a solid material which is floated in a sample chamber in the water . the chamber and quill assembly are previously calibrated to float at a neutral or reference point in the water when there is no sample to be measured in the sample chamber . referring to fig1 this embodiment of the invention comprises an instrument 10 made up of a flotation chamber 12 and a quill and sample chamber assembly 14 . float chamber 12 is preferably made of tubular acrylic , a clear plastic , sealed at its lower end by an end cap 16 and formed with threads 18 for cooperation with a water - tight sealing plug 20 , shown in fig3 . chamber 12 is provided with a quantity of water 22 to a arbitrary level therein . the end cap 16 is secured in place as by glueing , heat sealing , or the like dependent upon the particular plastic used in the fabrication . it is important that the tube 12 have good optical qualities and allow the markings on the quill assembly 14 to be read through the wall of the tube 12 . because of the reverse hydrometer principle of operation of the instrument 10 as described above , the length of the flotation chamber , as well as the amount of water therein , are both not critical parameters . this facet of the invention facilitates manufacture and facilitates use in the field which are both very important advantages for the present invention . the criteria that are considered include that the tube 12 be sufficiently long as to float the assembly 14 therein , in such a manner that a full scale of the quill , from 0 - 100 , be readable on the meniscus of the water , and that sufficient water be in the tube that the assembly can sink up to the maximum mark ( 100 ), while the chamber still floats and does not strike the bottom sealing end 16 . the plug 20 of fig3 is shown as including a member 24 formed of soft resiliant material , the purpose of which will be described below in regard to fig5 . the plug 20 includes male threads 18 thereon , and an &# 34 ; o &# 34 ; ring 26 to form a fluid - tight seal , together with the female threads 18 at the top of the tube 12 . this permits the predetermined amount of water , preferably distilled water , to be held sealed in the chamber 12 between periods of use . during the experimental and development work on the invention , a quantity of water 22 has been reserved for many months and through many uses , again yielding important advantages to users who must cope with the rugged conditions of logging field use . the elastic material 24 is readily removable from the cavity 28 formed in the end of the plug 20 for a reason which will appear below . for ease of handling , a series of discs 30 are secured together and to the end of the plug 20 to serve as a handle in use . the top annular surface of the tube 12 has a smooth finish , and may even be tapered slightly , in order to cooperate with the &# 34 ; o &# 34 ; ring 26 to form a watertight seal . referring to fig2 the quill and sample chamber assembly 14 is made up of a quill 32 , a quill adapter 34 , a sample chamber 36 , and a sample chamber plug 38 . the following specific descriptions are taken from a prototype of the invention which has been built and which successfully demonstrate the applicability of the invention instrument and the viability of the invention method . the quill was machined from a length of x7 - 1614 easton aluminum arrow shafting . this material has the advantage of being manufactured to close tolerances , thus eliminating any machining of its diameter . the arrow shafting has an anodizing finish and is available in different colors . the preferred embodiment was black , and the numbering and lines 40 on the quill were created by engraving so that easy - to - read bright aluminum color indicia were created on the black background on the arrow shafting . the top of the quill is sealed off by a plug 42 to protect the end of the quill when it is stored and to prevent accidental entry of water or other material into the quill . the quill adapter 34 serves to join the quill 32 to the sample chamber 36 in a permanent manner , and also is provided with an edge 44 on a slightly enlarged upper main plate to keep the assembly 14 floating freely with respect to the inside surface of the tube 12 . that is , as the assembly 14 moves in use , the contact is between the inside of the tube 12 and the edge 44 , thus substantially eliminating the possibility of the assembly 14 &# 34 ; hanging up &# 34 ; in the tube . this edge 44 is preferably chamfered and polished in order to facilitate its motion with respect to the inside of the tube . the adapter 34 further includes a pin portion 46 at the upper end which fits inside the quill 32 and which is secured by any suitable means , such as , adhesives , crimping , or the like . the lower end of the adapter 34 is formed with a tubular portion 48 which is likewise secured to the upper end of the sample chamber 36 . the sample chamber 36 is simply a predetermined length of aluminum tubing having its inside surface finished at both ends , the one end to cooperate with the tubular portion 48 of the quill adapter 34 , and the other end to cooperate with the &# 34 ; o &# 34 ; ring 50 on the sample chamber plug 38 . the plug 38 serves a surprising number of purposes . most obviously , it permits rapid sealing and unsealing of the sample chamber 36 in order to remove and insert samples whose specific gravity is to be measured , see the sample 54 therein , in fig1 . sample 54 is a core of green wood as is useful in the method of the invention , described in more detail below . returning to plug 38 , this member is formed from a solid block of aluminum , and in addition to acting as a removable seal , also acts as a counterweight to hold the assembly 14 floating upright . it is also provided with a machined opening , preferably simply a drilled hole 52 , to permit a final trim adjustment or calibration of the assembly 14 during manufacture . the outside surface of the plug 38 should closely match that of the sample chamber 36 , to a smooth and to prevent sticking of the assembly 14 in the tube 12 during use . the end of the plug 38 may be knurled as at 56 to facilitate manually handling its sliding in and out of the mating surface at the bottom of the sample chamber 36 . further , waterproof silicone grease can also be provided at that interface to prolonge the life of the &# 34 ; o &# 34 ; ring 50 and to facilitate use . in regard to calibration using the drilled hole 52 , as the last step in manufacture , this hole is repeatedly drilled deeper and deeper until the assembly , empty of anything other than air inside the sample chamber 36 , will float in water with the zero indicia on the quill 30 at the meniscus of the quill in the water . after the assembly 14 is calibrated to float empty at the zero indicia , the spacing of the remaining indicia can be determined by inserting a volume of known weight or density into the sample chamber 36 and floating the assembly 14 in water in the tube 12 . the quill 32 can then be marked where it crosses the meniscus for the known weight or density . then , the other indicia can be proportioned appropriately . fig4 shows a scale 56 , which is a simple length of &# 34 ; l &# 34 ; shaped aluminum to a predetermined length and bearing indicia 58 thereon . the indicia 40 on the quill and the indicia 58 on the scale are dictated by the requirements of the method of the invention , and their use and applicability will be explained in more detail below in regard to the method . fig5 shows an embodiment of the invention highly suited to rugged logging field use . this is made up of the quill and sample chamber assembly 14 identical to that shown in the preceeding figures and described above . the fig5 instrument 10a , includes two identical tubes 12 , one of which is provided with the quantity of water 22 , and the other kept dry . the dry tube , called the storage chamber , is fitted with a spring protective assembly 60 made up of a plug 62 , having a recess in its upper end for acceptance of a coil spring 64 , which has its outer end turned over and its inner end fitted into a chamber 66 machined into one end of the plug 62 . referring back to fig3 the assembly 5 will include two of the plugs 20 . the one which goes in the storage chamber tube 12 will include the elastic plug 24 , and the companion plug for the water chamber , preferably , would not include that elastic material . the water would soak into the elastic shock absorbing material and be inconvenient to handle . however , if suitable materials were used , the two plugs 20 for the two tubes 12 of fig5 could be identical . the two tubes 12 are joined together in a side - by - side relationship by adhesive 68 , heatsealing , or the like to securely and permanently join the two tubes together . the free length of the spring 64 , with respect to the length of the plug 20 and the elastic material 24 , is selected so that the assembly 14 will be fairly rigidly , but yet resiliently held between the material 24 and the upper end of the spring 64 when the plug 20 is screwed tightly down on the threads 18 . this will prevent the quill and storage chamber assembly 14 from moving about as the assembly is transported . at the same time , the predetermined quantity of distilled water 22 can be held sealed in place by the companion plug 20 on the companion tube 12 . this has proved to be , during testing of the invention , highly advantageous for rugged field use . the instrument of fig1 - 5 has been developed for use with the invention method described below . however , this instrument has other utility . it is a basic scientific principle that a floating body will displace its own weight of the liquid in which it is floating . with the assembly 14 calibrated for the particular fluid , preferably water because of its easy availability , a sample in the chamber will produce a reading on the indicia on the quill at the meniscus proportional to the weight of the sample in the chamber . this is so because the assembly 14 has been previously calibrated , when empty , to float at the zero indicia on the quill . thus , the indicia can be in terms of grams , ounces , or whatever is desired . the present invention method depends upon producing cores of green wood of known volume . this is done by using a boring tool which produces a known diameter core , and using the scale 56 of fig4 to produce a core sample of predetermined length . with diameter and length fixed , the core will then have a known volume . this invention instrument will produce its weight . therefore , following the simple formula that weight is equal to density times volume , the remaining density parameter is easily produced . the indicia on the quill can then be in terms of density units , such as pounds per cubic foot or the like . this same thinking can be provided to any kind of sample , it is simply necessary to produce samples of known volume and to calibrate the indicia for the particular liquid as well as for the anticipated weights of the sample to produce readings directly in units of density and / or weight of the sample in the floating chamber of assembly 14 . the invention also has versitility as to size . that is , the length of the sample chamber and assembly 14 as well as the length of the scale in fig3 must match , and this length can be whatever is convenient for the particular purpose . for forestry operation core lengths in the range of 5 - 8 inches , with 6 - 7 inches being the most common , are anticipated . a sample core may be inserted into the sample chamber in pieces or sections , provided all parts of the sample core are included . in applying the method and apparatus of the invention to use with a stand of timber concerning which no previous curves in accordance with the invention have been generated , the first step is a characterization of the trees in the stand . an important advantage of the invention is that once curves are generated for a particular kind of woods situation , those curves can be used again when the same environment is encountered again . for purposes of explanation , the procedure will be gone through including the generation of curves using the invention instrument , and then the use of these curves to get the necessary weight estimates will be explained . the first step is the inventory or so - called timber cruise procedure . an experienced estimator will identify the mix of the species in the stand , the ages of the trees , the total number of trees , the height of the trees , the diameters of the trees , the aspect as to slope , and the like . this cruise or inventory is standard forestry procedure . at the end of this inventory , the estimator will prepare a chart of the trees broken down into classes . this classification will depend upon the nature of the stand of trees . the more uniform the trees in the stand , the greater the accuracy of the weight estimates . however , if it is desired to more finely divide the classes in order to enhance the accuracy of the final estimates , then the time and cost for weight estimation will also increase . the estimator uses his skill in this classification , in order to make compromises in accordance with the usual and sound forestry procedures . the invention has been used in experimental applications . once such application included a stand of 175 trees . this was a commercial stand , the trees had been thinned , and the remaining trees to be harvested were all of one species , douglas - fir , and had a distribution as a result of the inventory as follows : table 1______________________________________diameter at breast height ( dbh ) dbh number samples______________________________________up to 20 &# 34 ; 8 1over 20 &# 34 ; up to 30 &# 34 ; 93 10over 30 &# 34 ; up to 40 &# 34 ; 63 6over 40 &# 34 ; 11 1 175 18______________________________________ table 2______________________________________ heights number______________________________________ up to 99 &# 39 ; 1 100 - 111 2 112 - 123 3 124 - 135 2 136 - 147 38 148 - 159 45 100 - 171 42 172 - 183 28 184 - 195 6 over 196 8 175______________________________________ the third column , marked &# 34 ; samples &# 34 ; in table 1 , indicates the number of trees from each dbh category which was selected to prepare the curves which appear in the subsequent figures and are described below in regard to the method . the sampling was made on a roughly 10 percent basis to represent the entire stand . this particular stand was unusually uniform both as to containing essentially a single species , and as to age , size and diameters . in a mixed stand , or in a more rugged terrain , or the like , a larger sample might have to be taken to get statistically valid sampling or modeling of the entire stand . such techniques are well known to those skilled in statistical analysis as well as in the appropriate forestry arts . as the next step , the sample trees only are then cut down . this is usally not a serious problem since the stand of trees are soon to be harvested in any event . further work can then be done on these boles , but the invention method can be applied , if necessary , to standing living trees . the diameters inside and outside the bark at three - foot intervals along the entire merchantable length of the tree were then taken . these diameters were measured using tree calipers or a diameter tape , both common tools in forestry . the thickness of the bark was measured with a bark thickness gauge , or sometimes with a simple steel ruler . it was sometimes necessary to chop through the bark down to the sapwood . by substracting twice the thickness of the bark from the diameter outside the bark ( dob ), it is possible to calculate the diameter of the solid wood in the tree , i . e ., the diameter inside the bark ( dib ). all of this data is collected in tabular form , or stored in computer or programmable calculator memory , depending upon the facilities available . simultaneously with the measurement of diameters at three - foot intervals , the boles were also measured as to the density of the green wood at regular intervals . for this particular experiment , six - foot intervals were used . a standard increment core borer was used to extract a wood core at the regular intervals . each , core was examined to determine the thickness of the sapwood , inches of sapwood ( ios ), this thickness was measured directly on the fresh core using a ruler , and the measurements were recorded . knowing the diameter under the bark ( dib ) and the inches of sapwood ( ios ), the correct ratio of sapwood / heartwood can be calculated using a pocket calculator and the equation shown in fig6 alternatively , or the curves shown in fig6 can be used to determine the percent of sapwood in the tree at the height at which the core was taken . with this data , that is the percent sapwood known , as set forth immediately above , the cores were then placed on the scale of fig4 with the sapwood / heartwood transition , which is readily visible to skilled foresters and usually even to a lay person , at the appropriate point . this is , if the particular core had a 45 percent sapwood content , the core , which is considerably longer than the total length of the scale 56 , was placed with the sapwood / heartwood transition at the 45 percent mark , and the core was then cut off at both ends so that its total length would be equal to the total length of the scale 56 . as previously mentioned , the length of this scale corresponds to the capacity of the chamber 36 in the assembly 14 for any particular environment in which the invention method and apparatus is to be used . cores prepared in this manner now accurately represent the sapwood / heartwood ratio of the solid wood in the tree ( excluding the bark ) at the level or height on the tree at which the core was taken . the thus prepared cores were then inserted into the chamber 36 of the assembly 14 , the device floated in the water , and the density read off of the indicia at the meniscus of the water on the markings on the quill . the invention method uses a relative height relationship rather than an absolute height relationship in order to increase the versatility of the statistical method of the invention . this relative height also permits the combining of density data from all of the sample trees within the particular tree class . thus , tree height information was normalized to a relative height for each tree . for these purposes , relative height shall be understood to mean height with reference to a common base , such as the ground , the top of the stump , the breast height at which the diameter was taken , or some other consistent reference plane . all future heights then , are divided by the total height of that tree , with reference to the common base . for example , three feet up on a tree having a total height of 120 feet , is the same as a relative height of 0 . 0250 , assuming an earth reference plane . however , if the tree is cut leaving a one - foot stump , then three feet up on the butt log will have a relative height equal to 0 . 0252 , which is equal to three divided by 119 , rather than 120 , the one - foot correction being the allowance for the stump . in summary of this point , it can be seen that a relative height of 0 . 0 refers to the reference plane , a relative height of 1 . 0 means the height at the tip of the tree , and a relative height of 0 . 5 means half the height above the reference plane . referring back to the stand of 175 trees which was used in the experimental proving of the invention , table 2 shows the actual height distribution of those trees . this was converted to relative heights , and the relative heights as compared to the green density measurements for the 18 sample trees at all of the planes at which cores were taken are shown in fig9 . a smooth curve was drawn through all of the data points , this curve being fitted to the data by the method of least squares , a simple procedure using even only a programmable calculator . the equation shown in fig9 for this curve is a polynomial derived by linear regression analysis . a standard statistical analysis software package was used for this work . using similar logic , in order to combine the diameter data for all of the sample trees , a relative diameter was used . this parameter , shown in fig8 on the vertical axis , is simply the ratio of the actual diameter to the diameter at breast height . thus , the dbh is the data plane in effect . for example , when the ratio is 1 . 0 the tree diameter is the dbh . at a ratio of 0 . 25 , the diameter is one fourth of dbh , etc . the curve of fig8 uses a regression analysis equation similar to that in fig9 and all of the test data points are shown together with the curve which was fitted thereto using the least squares technique . fig7 shows a curve and an equation similar to that of fig8 but related to diameter outside the bark . at this juncture , the sample work ( on the 18 trees in this case ) is done and the curves of fig7 and 9 have been brought into existence and are highly representative of the entire stand of timber from which the sample data was drawn . if a similar stand of trees from which the curves of fig7 and 9 were made should be encountered again , then these curves can be used again . depending upon the criticality of the output estimates required , a more or less close &# 34 ; fit &# 34 ; of the data to the new stand of trees can be tolerated or not tolerated in deciding about reuse of these curves . in summary of this point , if another like stand of trees are encountered , the curves can be used again . continuing now the description of the example involving the 175 trees , these curves , the data on which they are based , and a very simple computer or even a hand - carried programmable calculator , can be used to calculate incremental weight for very short lengths of any one or all of the trees in the stand . in this example , this was done by numerical integration of the density and diameter curves . for example , the weight of one tree at its relative heights between 10 and 101 / 2 feet can be calculated . the product of density times volume is weight . the volume outside of the bark is calculated by using the curve of fig7 . this curve is entered at the relative heights for 10 and 101 / 2 feet . the volume can then be calculated using an appropriate formula . at this point , volumes for douglas - fir butt segments were calculated by bruce &# 39 ; s ( 1982 ) butt log equation : for western hemlock butt segments by the sub - neiloid rule , for midsegments of both species by the smalian rule , for top segments of both species by the two - end conic rule ( dilworth 1981 ); ## equ1 ## where : v = volume of the log in cubic feet ; d = average diameter outside bark for the large end of the log in inches ; and d = average diameter outside bark for the small end of the log in inches . the reason for the need for different formulas is that the taper of trees typically varies continously throughout the tree over its height . these equations are well - known in these arts and give accurate values for volume for the crown , middle and butt sections of commercial quality boles . using the curve of fig8 the volume of solid wood only is calculated . to this must be added the weight of the bark . the bark volume is the difference of the volume outside the bark less the volume of the solid wood inside of the bark . once this volume is determined by a very simple calculation , weight is obtained by multiplying the volume times bark density . values for bark density for different species are readily availble from handbooks and the like . returning to the example concerning a segment from 10 feet to 101 / 2 feet , the volume inside the bark is multiplied by the green density at 101 / 4 feet . the value for green density is taken from the curve of fig9 . this manipulation gives the weight of solid wood for the tree section between 10 and 101 / 2 feet . total weight for the section is that weight plus the weight of the bark determined as set forth above . in this manner , using a kind of an integration technique , the weight of the entire bole can be calculated . again , using a relatively simple computer or even a sophisticated programmable hand - held calculator , these mathematical manipulations can be readily done . the curves , of course , can be stored as data in the memory of the calculating machine or computer being used , and actual curves on paper need not be brought into existence . the classification of all of the trees in the stand into the tables 1 and 2 further simplifies and reduces the amount of calculations necessary . that is , the calculations can be performed on groups of trees of similar size , rather than on each tree of the entire stand individually . carrying the invention method another step , if the lengths of the desired logs are a controlling factor , or if the weights of the desired logs are a controlling factor , then the data can be manipulated as necessary to produce the appropriate estimates . that is , for example , the estimator may desire to know what the lengths of the logs will be if the weight of any one log is not to exceed a certain number of pounds . conversely , if logs of a certain minimum length are required , then the data can be manipulated to yield estimates of the weights of such minimum length logs . many other such approaches to the data produced in accordance with the invention will be clear to users familiar with the commercial demands of logging . while the invention has been described in detail above , it is to be understood that this detailed description is by way of example only , and the protection granted is to be limited only within the spirit of the invention and the scope of the following claims .	6
in fig1 the housing 1 of a document - examining device is shown . the housing is a desk - like construction and has a front plate 2 which is inclined at an angle 4 to the horizontal and within which a transparent supporting surface 3 ( for example , glass ) is disposed . the document to be examined is placed on the supporting surface and pressed against it with a defined pressure so that the document surface which is to be examined is visible from the underside of the supporting surface 3 . according to the invention , an x - y slide 7 , 8 is movably mounted in slide guides which are described below . the y slide 7 is movable in the y direction of arrow 5 and the x slide is movable in the direction of arrow 6 ( namely , transverse to the plane of the drawing of fig1 ). it is preferred that the outer y slide 7 carries the less sensitive evaluating components comprising an illuminating unit 14 which is inclined at an angle to the direction of the plane of front plate 2 in front of a focusing lens 15 . the illuminating unit 14 and focusing lens are preferably linear devices with the light from illuminating unit 14 focused by lens 15 onto the underside of the document resting on the supporting surface 3 . preferably , the illuminating unit 14 consists of a linear array of leds ( see fig6 ) and produce white light . however , other illuminating units may also be used , such as an illuminating unit in which leds are provided , one portion of which radiates white light and the other ir light . several illuminating units 14 may be disposed side by side or above one another , and each illuminating unit may generate a separate spectrum or a mixed spectrum . the light reflected by the illuminating unit from the underside of the document is passed over the beam path 13 onto a tilted mirror 12 and directed through a lens 11 onto a line camera 10 , which is suitable for evaluating the text of a document or other image information or hidden information , which , for example , can be read only in the nir range . a signal processor in the shape of a plate 9 evaluates the images received by camera 10 , and is fastened to the y slide 7 . this arrangement ensures that the information paths and the cable lengths are short ; therefore , the arrangement as a whole is not highly susceptible to interference . by comparing fig1 and 3 , it can be seen that the direction of the beam path 16 may differ . in fig1 the beam path 16 is inclined towards the front in the direction of the supporting surface 3 , and in fig3 it is inclined towards the rear . the arrangement of an inclined beam path 16 at an angle to the supporting surface 3 is advantageous . initially , the positions of the distinguishing diffraction features , which are to be detected with the laser evaluating unit , can be located roughly on the document during the scanning of the document . in other words , the position of the distinguishing diffraction features are initially noted roughly with the line camera 10 while the surface of the document is being scanned , and verified later with the laser evaluating component mounted on the x slide . it is preferred that the actual verification of the distinguishing diffraction feature is carried out using the components mounted on the x slide 8 . these components consist of a laser 21 which produces a beam 22 ( fig2 ) which is reflected by a tilted mirror 20 as a beam 23 onto the surface of the document to be examined . it is assumed here that the x - y slide is positioned precisely below the distinguishing diffraction feature which is to be examined ; that is , the x - y slide has been moved into a precisely fixed x - y position . fig1 shows only the basic position . in the evaluating position , the x - y slide is moved to a precisely fixed position which is suitable for evaluating the distinguishing diffraction feature . the reflected image produced by the distinguishing diffraction feature ( i . e ., the diffraction pattern ) is projected onto a screen , for example , a matt disk 19 , forming a diffraction pattern 49 which is viewed through the matt disk 19 from below through a lens 18 within a fixed angle 24 of an ocr matrix camera 17 , where it is evaluated . thus , the entire evaluating unit is a compact unit disposed in a tight space in the x slide 8 , and does not easily lose adjustment . u . s . patent application ser . no . ______ entitled “ device for evaluating diffractive authenticity features ”, filed on dec . ______ , 2002 ( attorney docket no . 4077 / 0m004 ) discloses a device for evaluating a diffraction pattern which is projected onto a matt disk , and that application is hereby incorporated by reference into this specification . the uv evaluating unit is next described . it is used for evaluating fluorescing distinguishing authenticity features on the surface of a document . the arrangement as a whole is oriented towards viewing in uv light . a uv flash 26 is equipped with a filter disk 27 which directs light with a high proportion of uv in the direction of arrow 30 onto the surface of the document . the light excites the surface of the document with fluorescing threads which light up characteristically . the light reflected by the document on surface 3 is guided between the limiting beam paths 32 , 33 onto the mirror 25 , imaged from there through a lens 28 onto a camera 29 , and detected by a ccd chip which is situated there . a uv filter , which blocks uv light , may be placed in front of the lens 28 so that only light from outside of the uv range is detected by the camera . this prevents the uv flash 26 from “ blinding ” the camera 29 . the mechanical components of the arrangement are described in greater detail with reference to fig3 to 6 . as shown in fig3 and 6 , two elongated guide rails 35 aligned in the y direction , are mounted parallel to one another and anchored firmly in the housing 1 by supports 39 . two cylindrical bushings 48 ( fig6 ) attached to the y slide 7 slide on the guide rails 35 . the y slide is thus free to move in a controlled manner in the y direction as indicated by arrows 5 . a stepper motor 34 which is firmly anchored in the housing 1 drives y slide 7 by means of a cogged belt 37 which engages the motor drive shaft 36 and passes around a diverting pulley 40 . one side of the cogged belt is connected to the y slide 7 . in fig6 the connection between the endless belt 37 , drive shaft 36 and pulley 40 is shown diagrammatically , the actual arrangement being conventional with drive shaft 36 including suitable means for engaging the belt 37 so that rotation of the belt will drive the y slide 7 in the directions of arrow 5 ( fig6 ). these elements are best shown in fig3 although , for purposes of clarity , belt 37 is not shown in engagement with pulley 40 . the invention is not limited to an upper guide with upper , parallel guide rails 35 ; other guiding elements can also be used , such as lower guide rails 35 . instead of four guide bushings 48 , more or fewer guide bushings can be used . indeed , the specific details of the xy slide and the mechanism for controlling its movement form no part of this invention . a housing 38 is mounted underneath the y slide . the line camera 10 and the lens 11 are secured in housing 38 so that they can be exchanged easily , and adjusted separately from one another . in other words , because it is mounted in housing 38 , camera 10 can be adjusted accurately in the plant with respect to the lens 11 and , later on , the housing 38 can be adjusted accurately with respect to the tilting mirror 12 which is positioned outside of the housing . the x slide 8 is mounted on the y slide so that it can be moved perpendicularly to the plane of the drawing of fig3 . the x slide 8 moves on a tubular guide 41 on its left side and a slideway 50 on its right side on which the y slide is seated with a slide block . the tubular guide 41 is secured by two supports 46 , which are spaced from one another in the y slide , as shown in fig5 . for adjusting the end position of the x slide 8 in the y slide 7 , two limit switches 42 , which are also shown in fig4 and 5 , are positioned at a distance from one another . the x and y axes thus each have two limit switches . the driving motor 43 for the x slide is fastened in the y slide 7 and drives the x slide 8 in the direction of arrow 6 by means of its drive shaft 44 , a cogged belt 45 , and a pulley 47 supported in the y slide . the arrangement of cogged belt 45 , drive shaft 44 and pulley 47 is best shown in fig5 wherein belt 45 is shown schematically . for purposes of clarity , belt 45 is only partially illustrated in fig6 . belt 45 , of course , can be connected to x - slide 8 in any suitable fashion and the connecting means is not shown in the drawings . the plan view ( fig6 ) shows that the x slide 8 can be moved between two different end positions , the second end position of the x slide being indicated by 8 ′. list of reference symbols 1 . housing 2 . front plate 3 . supporting surface 4 . angle 5 . y direction 6 . x direction 7 . y slide 8 . x slide 9 . signal processing plate 10 . line camera 11 . lens 12 . tilting mirror 13 . beam path 14 . illuminating unit 15 . focusing lens 16 . beam path ( illumination ) 17 . ocr matrix camera 18 . lens 19 . matt disk 20 . tilting mirror 21 . laser 22 . beam path 23 . beam path 24 . solid angle 25 . tilting mirror 26 . uv flash 27 . filter disk 28 . lens 29 . matrix camera 30 . direction of arrow 31 . image 32 . beam path 33 . beam path 34 . stepper motor 35 . guide rail 36 . drive shaft 37 . cogged belt 38 . housing 39 . support ( y ) 40 . diverting pulley 41 . tubular guide 42 . limit switch 43 . motor ( x ) 44 . drive shaft 45 . cogged belt 46 . support ( x ) 47 . diverting pulley ( x ) 48 . spherical bushing ( y ) 49 . diffraction pattern 50 . slideway	6
referring first to fig1 , a bedding foundation 10 , according to one embodiment of this invention , is illustrated . as shown in fig1 , the foundation 10 has a longitudinal dimension or length l , a transverse dimension or width w and a height h . although the length l is shown as being greater than the width w , they may be identical . the foundation 10 has a base 12 , including a rectangular base frame 13 on which transverse wooden slats 14 are attached . a nestably stackable spring assembly or wire core 16 is fixed atop the base 12 and , more particularly , secured to the transverse slats 14 of base 12 with staples 15 , as shown in fig2 . padding 18 overlies the nestably stackable spring assembly 16 , and a fabric covering 20 overlies the padding 18 and surrounds the nestably stackable spring assembly 16 and the base 12 . although the base 12 is usually made of wood , it may be made of any other material , such as plastic , for example . the nestably stackable spring assembly 16 includes a rectangular steel border wire 22 having two parallel sides 24 , 24 and two parallel ends 26 , 26 . the parallel sides 24 , 24 are longer than the parallel ends 26 , 26 in the embodiment illustrated . transversely spaced , parallel , and longitudinally extending steel support wires 28 are parallel to the border wire sides 24 , 24 and have ends 30 which are welded to and / or crimped around the ends 26 , 26 of the border wire 22 . these support wires 28 are formed so as to be generally corrugatedly - shaped along their lengths , having peaks 32 and valleys 34 . these peaks 32 and valleys 34 are flattened at their respective distal portions 36 and 38 , respectively . see fig6 . the adjacent distal portions 36 , 38 are joined together by linear connecting portions 39 of the support wire 28 . alternatively , the support wires may be resilient with non - linear arms or connecting portions joining adjacent flattened peaks and flattened valleys . examples of such support wires are disclosed in u . s . patent application ser . no . 12 / 352 , 208 , which is fully incorporated herein . longitudinally spaced , parallel and transversely extending steel upper connector wires 40 extend parallel to the border wire ends 26 , 26 and have ends 42 which are welded to and / or crimped around the border wire sides 24 , 24 . these upper connector wires 40 are welded intermediate of their ends 42 , 42 along their lengths at intersections 44 to the flattened peaks 32 of the support wires 28 . the support wires 28 have flattened distal peak portions 36 and flattened distal valley portions 38 , with the support wire ends 30 being welded to and / or crimped around the border wire 22 . in this embodiment , two upper connector wires 40 per flattened distal peak portion 36 are illustrated . however , any number of upper connector wires 40 may be secured , i . e ., welded to each flattened distal peak portion 36 of each support wire 28 . the distal valley portions 38 of the support wires 28 may be stapled or otherwise attached to the transverse slats 14 which are , in turn , affixed to the base frame 13 . if desired , additional steel end wires ( not shown ) may be added either before or after the stackable spring assembly 16 has reached its final assembly destination . these end wires have spaced ends which are crimped around the border wire 22 and the endmost upper connector wire 40 , respectively . these end wires provide additional stiffness to the stackable assembly 16 in an edgemost location of the ends of the assembly 16 so as to prevent the end border wires from deflecting and being permanently distorted when a person sits on the end of a bed of which the foundation forms a part . such steel end wires are shown in u . s . pat . no . 5 , 361 , 434 , which is hereby incorporated by reference in its entirety . referring again to fig1 , continuous longitudinal wires 46 may be included in the stackable spring assembly 16 . these longitudinal wires 46 have their ends 48 welded to and / or crimped around the border wire ends 26 , 26 . these longitudinal wires 46 may be welded along their lengths to the upper connector wires 40 as desired . in the illustrated embodiment , two longitudinal wires 46 per foundation 10 are illustrated . however , any number of longitudinal wires 46 may be incorporated into the foundation . the nestably stackable spring assembly 16 of bedding foundation 10 is generally manufactured by a supplier , who then ships it to an assembler . the assembler adds to the spring assembly 16 the wooden base 12 , incorporates padding 18 , and covers the components with upholstery 20 to make a completed product . this invention facilitates shipment of the metal core or stackable assembly 16 by a supplier to the assembler . with reference to fig7 , a first stackable spring assembly 16 may be placed upon a surface with the flattened distal valley portions 38 of the support wires 28 oriented downwardly and the flattened distal peak portions 36 of the support wires 28 oriented upwardly . next , a second like assembly 16 is placed atop the first assembly 16 , with its flattened distal valley portions 38 and flattened distal peak portions 36 likewise oriented downwardly and upwardly , respectively . the flattened distal valley portions 38 of the second assembly 16 are thereby allowed to enter into the voids between the flattened distal peak portions 36 of the first assembly 16 . the second assembly 16 nestles downwardly within the first assembly 16 until the outside dimension of the connecting portions 39 of the valleys 34 of the second assembly 16 is equal to the inside dimension of the connecting portions 39 of the valleys 34 of the first assembly 16 . at this point , the second assembly 16 comes to nest within the first assembly 16 , with the overall height of the nested assemblies 16 , 16 substantially less than the sum of the individual heights of the assemblies 16 , 16 . of course , any number of assemblies 16 may be nested and stacked together for storage or shipment . one advantage of the spring assembly 16 and associated bedding foundation 10 , according to this invention , is that the border wire 22 is uniquely configured to enable the border wire 22 to be made of a lesser gauge , smaller diameter wire than existing border wires without giving up any strength . in the embodiment of the bedding foundation 10 and associated spring assembly 16 shown in the drawings , the border wire 22 has a rectangular cross - sectional configuration with the height h 2 of border wire 22 being greater than the width w 2 of the border wire 22 . see fig5 . fig4 illustrates a cross - section of a prior art border wire 50 made of three - gauge wire . the cross - section is round and has a diameter of h 2 ( 0 . 243 inches in the case of three - gauge wire ). fig5 illustrates a rectangular cross - section of the border wire 22 of foundation 10 . the border wire 22 is re - shaped into a rectangular cross - section from a four - gauge wire having a round cross - section ( shown in dashed lines in fig5 ) having a diameter of h 1 , which is less than the diameter h 2 of the three - gauge wire shown in fig4 . in the example , h 1 is 0 . 224 inches and h 2 is 0 . 243 inches . the cross - section of border wire 22 shown in fig5 is rectangular and has a height of h 2 ( 0 . 243 inches , same as the diameter of the three - gauge wire shown in fig4 ) and a width of 0 . 153 inches . thus , in switching from a three - gauge wire having a round cross - section to a four - gauge wire having a rectangular cross - section , no height is lost . in changing the shape of the border wire 22 from a round cross - section to a rectangular cross - section , the cross - sectional area remains approximately identical . the generally rectangular cross - section of border wire has rounded corners 52 as shown in fig5 . fig3 a shows one of the upper connector wires 40 passing underneath one of the sides 24 of border wire 22 and having its end 42 wrapped over and around the border wire 22 . fig3 b shows one of the longitudinal wires 46 passing over one of the ends 26 of border wire 22 and having its end 48 wrapped under and around border wire 22 . fig8 - 11 illustrate an alternative embodiment of bedding foundation 10 a . as shown in fig8 , the foundation 10 a has a longitudinal dimension or length la , a transverse dimension or width wa and a height ha . although the length la is shown as being greater than the width wa , they may be identical . the foundation 10 a has a base 12 a , including a rectangular base frame 13 a on which transverse wooden slats 14 a are attached . a nestably stackable spring assembly or wire core 16 a is fixed atop the base 12 a and , more particularly , secured to the transverse slats 14 a of base 12 a with staples 15 a , as shown in fig9 . padding 18 a overlies the nestably stackable spring assembly 16 a , and a fabric covering 20 a overlies the padding 18 a and surrounds the nestably stackable spring assembly 16 a and the base 12 a . although the base 12 a is usually made of wood , it may be made of any other material , such as plastic , for example . the nestably stackable spring assembly 16 a includes a rectangular steel border wire 22 a having two parallel sides 24 a , 24 a and two parallel ends 26 a , 26 a . the parallel sides 24 a , 24 a are longer than the parallel ends 26 a , 26 a in the embodiment illustrated . transversely spaced , parallel , and longitudinally extending steel support wires 28 a are parallel to the border wire sides 24 a , 24 a and have end portions 30 a which are welded to the ends 26 a , 26 a of the border wire 22 a . these support wires 28 a are formed so as to be generally corrugatedly - shaped along their lengths , having flattened peaks 32 a and flattened valleys 34 a . these peaks 32 a and valleys 34 a have different lengths 36 a and 38 a , respectively . see fig1 . the lengths 36 a , 38 a are joined together by linear connecting portions 39 a of the support wire 28 a . alternatively , the support wires may be resilient with non - linear arms or connecting portions joining adjacent flattened peaks and flattened valleys . examples of such support wires are disclosed in u . s . pat . nos . 7 , 805 , 780 and 7 , 930 , 777 , each of which is fully incorporated herein . as best shown in fig9 , an end portion of each of the support wires 28 a is welded to a lower surface 50 of the border wire 22 a and , more specifically , to the lower surface 50 of one of the ends 26 a , 26 a of the border wire 22 a . longitudinally spaced , parallel and transversely extending steel upper connector wires 40 a extend parallel to the border wire ends 26 a , 26 a and have ends 42 a which are welded to the border wire sides 24 a , 24 a . these upper connector wires 40 a are welded intermediate of their ends 42 a , 42 a along their lengths at intersections 44 a to the flattened peaks 32 a of the support wires 28 a . as best shown in fig9 a , an end portion 42 a of each of the upper connector wires 40 a is welded to a top surface 52 of the border wire 22 a and , more specifically , to the top or upper surface 52 of one of the sides 24 a , 24 a of border wire 22 a . the support wires 28 a have flattened peaks 36 a and flattened valleys 38 a , with the support wire end portions 30 a being welded to the border wire 22 a . as best shown in fig9 c , an end portion 30 a of each of the support wires 28 a is welded to lower surface 50 of the border wire 22 a and , more specifically , to the bottom or lower surface 50 of one of the ends 26 a , 26 a of border wire 22 a . in this embodiment , two upper connector wires 40 a per flattened peak 36 a are illustrated . however , any number of upper connector wires 40 a may be secured , i . e ., welded to each flattened peak 36 a of each support wire 28 a . the flattened valleys 38 a of the support wires 28 a may be stapled using staples 15 a or otherwise attached to the transverse slats 14 a which are , in turn , affixed to the base frame 13 a . if desired , additional steel end wires ( not shown ) may be added either before or after the stackable spring assembly 16 a has reached its final assembly destination . these end wires have spaced ends which are secured to the border wire 22 a and the endmost upper connector wire 40 a , respectively . these end wires provide additional stiffness to the stackable assembly 16 a in an edgemost location of the ends of the assembly 16 a so as to prevent the end border wires from deflecting and being permanently distorted when a person sits on the end of a bed of which the foundation forms a part . such steel end wires are shown in u . s . pat . no . 5 , 361 , 434 , which is hereby incorporated by reference in its entirety . referring again to fig8 , continuous longitudinal wires 46 a may be included in the stackable spring assembly 16 a . these longitudinal wires 46 a have their ends 48 a welded to the border wire ends 26 a , 26 a . these longitudinal wires 46 a may be welded along their lengths to the upper connector wires 40 a as desired . in the illustrated embodiment , two longitudinal wires 46 a per foundation 10 a are illustrated . however , any number of longitudinal wires 46 a may be incorporated into the foundation . as best shown in fig9 b , an end portion of each of the continuous longitudinal wires 46 a is welded to lower surface 50 of the border wire 22 a and , more specifically , to the bottom or lower surface 50 of one of the ends 26 a , 26 a of border wire 22 a . the nestably stackable spring assembly 16 a of bedding foundation 10 a is generally manufactured by a supplier , who then ships it to an assembler . the assembler adds to the spring assembly 16 a the wooden base 12 a , incorporates padding 18 a , and covers the components with upholstery 20 a to make a completed product . this invention facilitates shipment of the metal core or stackable assembly 16 a by a supplier to the assembler . with reference to fig1 , a first stackable spring assembly 16 a may be placed upon a surface with the flattened valleys 38 a of the support wires 28 a oriented downwardly and the flattened peaks 36 a of the support wires 28 a oriented upwardly . next , a second like assembly 16 a is placed atop the first assembly 16 a , with its flattened valleys 38 a and flattened peaks 36 a likewise oriented downwardly and upwardly , respectively . the flattened valleys 38 a of the second assembly 16 a are thereby allowed to enter into the voids between the flattened peaks 36 a of the first assembly 16 a . the second assembly 16 a nestles downwardly within the first assembly 16 a until the outside dimension of the connecting portions 39 a of the valleys 34 a of the second assembly 16 a is equal to the inside dimension of the connecting portions 39 a of the valleys 34 a of the first assembly 16 a . at this point , the second assembly 16 a comes to nest within the first assembly 16 a , with the overall height of the nested assemblies 16 a , 16 a substantially less than the sum of the individual heights of the assemblies 16 a , 16 a . of course , any number of assemblies 16 a may be nested and stacked together for storage or shipment . one advantage of the spring assembly 16 a and associated bedding foundation 10 a , according to this invention , is that the border wire 22 a is uniquely configured to enable the border wire 22 a to be made of a lesser gauge , smaller diameter wire than existing border wires without giving up any strength . in the embodiment of the bedding foundation 10 a and associated spring assembly 16 a shown in the drawings , the border wire 22 a , like border wire 22 , has a rectangular cross - sectional configuration with the height h 2 of border wire 22 a being greater than the width w 2 of the border wire 22 a . border wire 22 a of the embodiment shown in fig8 - 11 is identical to border wire 22 and has the same characteristics and advantages described herein . one of ordinary skill in the art will readily recognize that the alternative embodiments of the foundations shown herein are exemplary only of a wide variety of alternative configurations that are readily possible within the scope of this invention . from the above disclosure of the general principles of the present invention and the preceding detailed description of at least one preferred embodiment , those skilled in the art will readily comprehend the various modifications to which this invention is susceptible . therefore , we desire to be limited only by the scope of the following claims and equivalents thereof .	1
it should be understood as used in this application that &# 34 ; non - stable &# 34 ; implies an antenna base that does not maintain the antenna pointed in a fixed direction . &# 34 ; non - directional &# 34 ;, as applied to an antenna , means an antenna or antenna combination which receives signals in approximately 360 ° of azimuth and in at least 50 ° in elevation from the vertical . as used in this application , &# 34 ; remote &# 34 ; is intended to imply distance greater than line of sight . &# 34 ; mobile &# 34 ; means that which at least occasionally moves . &# 34 ; location &# 34 ; as used is intened to imply not only position , but also rate of change of position , i . e . velocity , and rate of change of velocity , i . e . acceleration . location could be computed relative to other bodies or any one of a number of coordinate systems . it should be further understood that although the system is designed to be applicable to mobile users spread over a wide geographic area , including remote regions , it is equally applicable to non - remote stationary users and may well provide sufficient cost advantages to be the desirable system for any user of navigation information services . fig1 illustrates a preferred embodiment for the differential navigation system . reference receiver 10 is shown receiving navigation information from four navigation information system satellites 16 . reference receiver 10 includes antenna 20 , a receiver unit , a computer and a modem . reference receiver 10 decodes the navigation information received through antenna 20 and the receiver . based upon the navigation information and the reference station &# 39 ; s known location , differential corrections are computed for each of the satellites 16 , formatted and transmitted via modem 10 and leased line 22 to the modem of transmitting unit 14 . transmitting unit 14 receives the differential correction data , formats the data using spread spectrum techniques and pseudo random coding in transmitter unit 24 and transmit the coded signal to commercial geosynchronous earth satellite 18 . commercial geosynchronous earth satellite 18 receives the signals transmitted by transmitting unit 24 and relays such signals via one of its own linearly polarized transponders . user 12 is comprised of non - directional antenna 26 , for communicating with the commercial geosynchronous earth satellite , satellite communication receiver 28 , computer 32 , antenna 34 for receiving navigation information from navigation information system satellites 16 and navigation information receiver 30 . it should be noted that navigation information satellites 16 will travel in a lower earth orbit than a geosynchronous earth satellite . moreover , government operated navigation information system satellites need not follow the same fcc restrictions on power and band width as are imposed upon commercial communication satellites . hence , antenna 34 need not be operating under the same signal - to - noise constraints as antenna 26 . it is conceivable that the functions of antenna 34 could be performed by antenna 26 . in this case only antenna 26 would be required . navigation information receiver 30 outputs estimated location to computer 32 . satellite communication receiver 28 outputs differential corrections to computer 32 . computer 32 computes enhanced location information for user 12 . in order for the differential navigation system to offer broad coverage for users , remote and non - remote , mobile and non - mobile , throughout the general north american area , a proposed set of reference receivers and their communications link is described in fig2 . reference stations 52 and hub and reference stations 50 track the navigation information service and compute differential data . differential data with their respective station identifiers are relayed to the network hub which in turn relays the data to master earth station 54 , the transmitting unit . the preferred embodiment utilizes land lines 58 from reference stations 52 to network hubs 50 and land lines 56 from network hubs 50 to master earth station 54 , the satellite uplink . it is conceivable for some of this communication link to take place through an earth satellite relay . the differential data transmitted is preferably correlated , by appropriate identifiers , with the particular gps epoch from which the data was derived . this permits a user to apply differential data to the same navigation information received at the user as was used in determining the differential data at the reference unit . fig3 illustrates the coverage patterns of a typical non - directional antenna . it can be seen that the particular non - directional antenna chosen exhibits reception capability for 360 ° in azimuth and for approximately 60 ° in elevation from the vertical . the lower gain resulting from using a non - directional antenna is roughly 25 db less than a 24 - inch dish . there is also a 3 db loss due to circular polarization . however , there will be a 3 db increase in gain due to using an essentially hemispherical vertical array . therefore , the total gain loss due to using a non - directional circularly polarized antenna system would be 25 db . this loss can be regained by increasing the process gain achieved through spread spectrum techniques . the total process gain for the preferred embodiment needs to be approximately 46 db . differential data exists initially in digital binary form . according to spread spectrum techniques , each binary bit is reformatted into a word , possibly a long word , consisting of chips . each word representing one binary bit might be several thousand chips long . spreading a bit into a chip word yields process gain . in the preferred embodiment , a process gain of 46 db translates into a chip word in excess of 10 , 000 chips per bit . each chip in a word may be either the equivalent of a chip - one or a chip - zero . a chip - one may be achieved by phase modulating the information frequency band every 180 °. in that case , a chip - zero could be achieved by no modulation of the information frequency band at 180 ° of phase . fig4 a illustrates the process of phase modulation of a signal . at points 64 , 78 and 80 , corresponding to phase angles of 180 ° the signal is phase shifted . each formatter of information is assigned two chip patterns . one chip pattern represents a binary one . the other chip pattern represents a binary zero . the chip pattern itself , although definite for that formatter of information and for all users of that formatter &# 39 ; s transmissions , is selected to provide the minimum cross - correlation between formatters . this is referred to as pseudo - random coding . fig4 b illustrates a chip word . in the word 82 , 84 , 86 , 88 , 90 and 92 each illustrate a chip , either a chip - one or a chip - zero . picking code words such that the words exhibit minimum cross - correlation has the effect that multiple simultaneous transmission of such words within the same frequency band looks like noise . a particular user determines whether information is being transmitted for his use by determining whether his receiver detects correlation for his particular code word within the otherwise seeming signal noise . spread spectrum techniques employ a wide band width . the fcc limits earth satellite transponders to power per unit of band width , so use of a wide band width yields a power gain . a receiver of a pseudo - randomly coded chip word need demand only a certain level of correlation between the pseudo random code stored in the user &# 39 ; s receiver and the signals being received in order to make the decision that a binary one or a binary zero has been received . given a sufficiently long chip word , noise can obscure part of the signal and the user can still determine a sufficiently high correlation between the imperfect signal received and the user &# 39 ; s code word to determine that either a binary one or a binary zero has been transmitted . hence , a process gain . in the preferred embodiment , assuming an available spectrum space of 5 . 5 mhz and a process gain of 46 db , the resulting data rate would be approximately 60 bits per second . the preferred embodiment is designed to operate with the navstar gps a the navigation information service . with navstar , each gps satellite transmits at the same time . a user receiver times the arrival of each satellite signal to compute range to that satellite . navigation data also transmitted is used to calculate the location of each satellite at the time of transmission . if the receiver &# 39 ; s clock were perfectly aligned with the satellite clocks , a position solution could be achieved by just measuring the range to three satellites . in practice the user &# 39 ; s clock will have some bias and the user receiver must track four satellites in order to remove the clock bias term . there are several other ways known in the field , besides or in addition to ranging , to determine position from the gps satellites . one is to use integrated doppler , another is to use carrier beat phase measurements and another is to use carrier phase measurements . typical gps differential data could consist of a range ( known as pseudo - range ) correction , a range - rate ( or delta pseudo - range ) correction , a carrier beat phase measurement or a carrier phase correction . satellite identification and other satellite information may be included in the messages . such a messages may be transmitted within 45 bits . a data rate of 60 bits per second yields the possibility of one update on each of 8 gps satellites every 6 to 7 seconds . such data rate is sufficient for high accuracy navigation by mobile units .	6
the invention is explained in detail below with the aid of a first variant and the figures . in the context of the first variant , the genetic material involves the genomic dna ( sperm ) present in a haploid chromosome complement , and the delimitable partial amounts involve all chromosomes chr which may occur in the chromosome complement . the chromosome complement is a human sperm , for which reason the number of delimitable partial amounts is 23 . this corresponds to the number of possible chromosomes chr 1 - chr 23 present in the chromosome complement . for each delimitable partial amount chr 1 , chr 2 , . . . chr 23 there are target sequences which are only part of one or of a limited number of the delimitable partial amounts . this means that these target sequences are unique for the chromosome or chromosomes concerned , on which these target sequences occur . for each chromosome there is a multiplicity of such specific target sequences . for the method according to the invention , suitable primers are determined in a selection process in two stages . fig1 shows in schematic form a selection process for the selection of target sequences . this method begins with step s1 . in step s2 , all possible target sequences for all delimitable partial amounts are determined . this means that all possible amplifiable sections in the genetic material are determined . it is then determined ( s3 ) which of these target sequences are specific for a single delimitable partial amount in each case . delimitable partial amounts may be e . g . chromosomes . a target sequence is specific when it occurs in only one single delimitable partial amount but not in several delimitable partial amounts . for each delimitable partial amount , several different target sequences are selected ( s4 ). preferably the target sequences are selected on the basis of certain criteria , e . g . target sequences which are highly distinctive are preferred to other target sequences . in other words , target sequences with the lowest possible homology or complementarity to other target sequences are preferred in selection . it is also useful to select target sequences with similar hybridization properties ( e . g . melting temperature , formation rate ). in a second process section ( fig2 ), in each case a primer is determined which is suitable for the amplification according to the invention , and specifically in a selection process with the following steps : a ) within the genetic material , primer binding sites are determined ( s7 ) which are located in the vicinity of the 3 ′- end of the target sequences determined in the first step . in an amplification reaction , a primer hybridized at these primer binding sites is extended beyond the target sequence and a complement to the target sequence is produced . b ) from the primer binding sites determined in a ), a selection is made ( s8 ) of those which are substantially homologous to one another . here , those primer binding sites with a low homology to other primer binding sites determined under a ) are rejected . essentially homology means that the primer binding sites have a homology of at least 80 % to one another . c ) from the primer binding sites determined in a ), a selection is made ( s9 ) of those which are substantially in the vicinity of the 3 ′- end of a target sequence or its complement . in this context , proximity essentially means only that at least 50 % of the primer binding sites are in the vicinity of the 3 ′- end of a target sequence or its complement . these primer binding sites are combined to form a group of primer binding sites . for each of the primer binding sites of this group a primer is determined ( s10 ) which is substantially complementary to all primer binding sites of the group . in this context , complementary means essentially that the primer , under suitable reaction conditions , will form hybrids with all primer binding sites of the group . the primer binding sites of the group do not necessarily include the primer binding sites required for amplification of all target sequences . for this purpose , a primer binding site in the vicinity of the respective 3 ′- end of the target sequence is required at both strands of a target sequence , so that the latter is flanked in each case by two primer binding sites . if this is the case , then the second process step may be repeated , so as to determine one or more further groups of primer binding sites and the associated primers . in this way , one or several primers are selected which form hybrids with all primer binding sites required for amplification of the target sequences . that is to say , the primer binding sites are substantially to be found only in the vicinity of the 3 ′- end of the target sequences or their complements . the amplification only of target molecules means essentially , in the context of the invention , that at least 50 % of the amplified molecules are target molecules containing target sequences which are specific for at least one delimitable partial amount , but can not be traced back to all delimitable partial amounts . naturally the selection process described may be subject to various iteration processes , i . e . various of the specified criteria may be given different weightings and individual steps may be interchanged or repeated several times depending on previously obtained results . in particular , this may also mean that unspecific primers known in a first step may be used , allowing the amplification of the target sequences described above and only afterwards being checked for conformity with the criteria ( specificity of the target sequences , distinctiveness , similar hybridization properties , etc .) of the first step . within the scope of the selection process described , unspecific primers according to the prior art , such as used e . g . in the context of dop - pcr or inter - alu - pcr , may be so modified that they conform to the selection criteria cited above . the available genetic material of the chromosome complement undergoes an amplification process according to the invention . in this , the primer or primers in each hybridization bind to primer binding sites located in the vicinity of the 3 ′- end of target sequences , so that substantially only target molecules containing the target sequences are amplified . in the amplification product , each chromosome is represented by a number of different target sequences specific for the chromosome concerned and which is specific for this chromosome . the amplification reaction follows the formula y = sx ( 1 + e ) n , wherein y is the number of copies of an amplified target sequence produced , e is the efficiency of amplification , n the number of cycles , and s the number of originally existing “ start copies ” of a particular target sequence ( a target sequence specific for a chromosome may occur several times on the chromosome concerned ). in the sperm or in a polar body of a normally developed egg cell , the chromosomes occur in each case only once . in the event of chromosome maldistribution , certain chromosomes are present in a different number , e . g . 0 or 2 . this means that , in the amplification of target sequences with only a single molecule as start copy ( s = 1 ) it must be ensured experimentally for a quantitative statement , that in the first cycle of amplification a defined chromosome - specific target sequence is detected and amplified with certainty . in respect of an individual molecule , however , this is not generally possible . if the first cycle fails , then at the end only half the copies of these target sequences will be amplified . the error in amplification may lie in a greater range in which it is also intended to quantify ( factor 1 , 2 , 3 . . . ) the frequency with which a chromosome is represented in a sperm or polar body . quantitative statements with a single molecule as start sequence are therefore subject to such great uncertainty as to be in fact worthless . the same applies to efficiency e , which amounts to 1 only in the ideal case , i . e . in each cycle of the amplification a doubling of the starting material , i . e . all available copies , takes place . in reality , though , ideal efficiency never occurs , and the value for e must always be set & lt ; 1 . efficiency is incidentally dependent on a multitude of factors which are difficult to control , e . g . on the sequence amplified in the particular case , and on the length of the amplified sections of a genome . it varies in principle from one experiment to another . small deviations in efficiency e from the ideal efficiency of an amplification 1 lead to very great effects in typical cycle numbers for amplification processes of n = 20 - 30 . with the aid of the method according to the invention , for each chromosome present in the sperm or polar body , a multiplicity of different target sequences is amplified , virtually all ( at least 80 %) of them specific for at least one chromosome , and specifically with the aid of one or more primers . experimental imponderables , due to the fluctuating efficiency of the amplification process from one experiment to another , are ruled out by the fact that all target sequences are amplified simultaneously in a single process . errors in amplification , resulting from the failure to amplify certain target sequences of a chromosome in the first cycle , are offset by the fact that in any event a substantial portion of the target sequences which are specific for a chromosome are amplified in the first step . if e . g . the first chromosome chr1 of a chromosome complement contains 26 target sequences a - z , which occur only on this chromosome and are amplified simultaneously with the aid of a method according to the invention using one or more primers , and if the target sequences a , b are not amplified in the first cycle of the amplification , but the target sequences c - z are amplified in the first step , then the error relating to target sequences a , b is not significant in the amplification product , so long as ultimately the totality of the amplified target sequences a - z specific to the chromosome is used to provide a statement concerning the quantity of the chromosome in the sperm or polar body . the amplification product may then be applied to a dna chip on the surface of which are spots arranged in rows and columns , each with identical catcher molecules . the catcher molecules may form catcher - target sequence hybrids with the target sequences concerned . here a suitable spot on the chip is provided for each target sequence or for the overwhelming majority of the target sequences . depending on the probe molecules located on them , the spots are specific for one target sequence and therefore specific for at least one chromosome . when the amplification product is applied to such a dna chip under hybridization conditions , catcher - target sequence hybrids are formed , and these are then detected . if the amplification has been made using nucleotide triphosphates provided with fluorescent markers , it is possible to measure the fluorescence intensity of the individual spots . those spots chr1a - chr1z which are to be assigned to the target sequences a - z of the chromosome chr1 , are if the chromosome was never present in the chromosome complement , those with no fluorescence or only a very small amount which is due to impurities if the chromosome was present once or more in the chromosome complement , those with an average fluorescence intensity ichr1 . if target sequences a , b of chromosome 1 are amplified with poor efficiency , this leads to spots chr1a , chr1b in which no or only minimal fluorescence intensity is measured , shown in fig3 as measuring points without hatching . if the other target sequences c - z are amplified with high efficiency , then a correspondingly high fluorescence intensity is measured in the spots chr1c - chr1z , shown in fig3 as measuring points with line hatching . if the chromosome chr1 was present in the chromosome complement once , and chromosome 2 was present in the chromosome complement twice , then the average intensity ichr1 of the fluorescence of the spots chr1a - chr1z assigned to chromosome 1 will be half that of the average intensity ichr2 of the fluorescence of the spots chr2a - chr2z assigned to chromosome 2 , shown in fig3 by cross - hatching . it may occur that a target sequence aa , which is specific for chromosome chr 1 , is at the same time specific for a further chromosome , but not for all chromosomes of a chromosome complement . if both chromosomes occur frequently in a sample , the intensity of the fluorescence measured in the spot assigned to this target sequence aa will be approximately twice that measured in spots , the target sequence of which occurs only on one chromosome . for the analysis of the product of the amplification according to the invention , a multiplicity of further hybridization experiments is available to the person skilled in the art . thus the amplified sequences may for example also be analyzed by means of electrophoresis methods , capillary electrophoresis or mass spectrometry . the invention will be explained in detail below with the aid of a second variant . the genomic information of a human chromosome complement is amplified by means of an amplification method , in which the amplification product contains a multiplicity of target sequences , and in which each chromosome present in the polar body may be assigned target sequences which occur only on this chromosome or may stem from it . for this purpose the amplification method according to the above embodiment may be implemented , but unspecific amplification methods according to the prior art may also be used , while in principle other methods may also be used as pcr methods , e . g . using nasba , qβ replicase , or sda ( see k . hagen - mann , w . mann , 1995 , exp . clin . endocrinol 103 : 150 - 155 ). here it is important only that all or as many as possible of the target sequences are contained in the amplification product , i . e . that the target sequences are amplified in parallel . the amplification product is brought into combination with a dna chip on which each chromosome is represented by 10 spots . at the same time each spot contains catcher oligonucleotides which are able to form hybrids with target sequences , these hybrids being specific for one chromosome . one spot contains 10 different catcher oligonucleotides which are able to form hybrids with target sequences ; these hybrids differ from one another but are all assigned to the same chromosome . the same applies to the other nine spots which are assigned to the same chromosome . in the case of a chromosome chrn , of which 26 target sequences a - z may be captured on the chip by catcher oligonucleotide , the spots are mixed as follows : the first spot chrn / 1 contains catcher molecules for the target sequences a - j , the second spot chrn / 2 contains catcher oligonucleotides for the target sequences j - t , the third spot chrn / 3 contains catcher oligonucleotides for the target sequences u - d , the fourth spot chrn / 4 contains catcher oligonucleotides for the target sequences e - o , the fifth spot chrn / 5 contains catcher oligonucleotides for the target sequences p - z , the sixth spot chrn / 6 contains catcher oligonucleotides for the target sequences a , c , e , g , i , k , m , o , q , t , the seventh spot chrn / 7 contains catcher oligonucleotides for the target sequences b , d , f , h , j , 1 , n , p , r , t , the eighth spot chrn / 8 contains catcher oligonucleotides for the target sequences m , n , o , p , q , r , w , y , z , v , the ninth spot chrn / 9 contains catcher oligonucleotides for the target sequences a , e , i , j , m , n , o , p , r , s and the tenth spot chrn / 10 contains catcher oligonucleotides for the target sequences a , b , c , d , e , v , w , x , y , z . for each of the 23 chromosomes chr1 - chr23 of a chromosome complement which may be present in a chromosome complement of a human egg cell , the chip is provided with 10 such spots chrn / 1 - chrn10 , on which in each case 10 of 26 catcher oligonucleotides are mixed as detailed above . these catcher oligonucleotides are able to hybridise with target sequences which have been basically amplified in the course of an unspecific amplification , if the chromosome for which the relevant target sequences are specific is present in the chromosome . the amplification product is applied to the dna chip . here the catcher oligonucleotides hybridise with the target sequences a - z of each chromosome which are complementary to them . as part of the amplification , a marking agent is incorporated in the amplified target sequences ( a cy - 3 fluorescent marker ). the chip is washed , and the fluorescence of the individual spots is determined simultaneously . this involves detecting the intensity i chrn / x of each individual spot x assigned to a chromosome n . all intensities i chrn / x of a chromosome n are used in averaging the intensity of the spots which are specific for a chromosome ( resulting mean intensity : i n ). the intensities i 1 - i 23 are compared with one another . if the order of magnitude of the mean intensity of the spots assigned to a chromosome = approximately 0 , then this chromosome is not contained in the chromosome complement . if the mean intensity of the spots assigned to a chromosome has a value corresponding to the majority of the other intensities , then from this it is concluded that the chromosome to which these spots are assigned occurs in the chromosome complement exactly once . if the mean intensity of the spots representing one chromosome is twice , three times or several times the other intensities , then it is assumed that these chromosomes occur in the chromosome complement twice , three or four times or more often . the frequency of specific target sequences within a chromosome may be high or low . this frequency is where applicable to be taken into account by determining a suitable factor , and also the effect of the frequency of start copies of a target sequence on the formation of specific hybrids in a spot after carrying out a parallel amplification . the frequency of the target sequences of a specific chromosome may also depend on the size of the chromosome concerned . resultant effects are if applicable also to be incorporated in a suitable correction factor , which is used in the analysis . it is very unlikely that all chromosomes of a chromosome complement occur in it twice , for which reason the statement made with the aid of the method according to the invention , regarding the quantity of chromosomes in a chromosome complement , is very reliable . to enhance this reliability , however , a reference sample may be amplified in parallel , and analyzed simultaneously with the sample for analysis . if one of the spots of such a dna chip is faulty for production reasons , e . g . because it was poorly spotted , then nine further spots are still available to allow statements to be made on the relative quantity of a chromosome in the chromosome complement . through the mixing in one spot of catcher sequences which are different for one chromosome , but specific for different target sequences from this chromosome , each spot will have a measurable intensity — even with unequal efficiency of amplification with regard to the target sequence concerned — so long as suitable starting material was present in the chromosome complement , corresponding to a statistical mean . each spot in itself is therefore more meaningful than a spot in which only one type of catcher molecule has been provided . through the presence of several such mixed spots per chromosome , which also contain different mixed catcher molecules , inaccuracies in amplification are more readily excluded than in previous methods . if the measured intensities of the first , second , third . . . tenth mixed spots 1 , 2 , 3 . . . 10 which are each assigned to one of the chromosomes chr1 - chr23 of a chromosome complement are set in relation to one another , then 10 different statements are obtained on the quantitative occurrence of the up to 23 chromosomes normally occurring in a human chromosome complement . this equates to a multiple verification of the analysis result . instead of 10 different spots as just described , it is also possible to provide just one spot for each chromosome which — according to a variant of the embodiment — contains 26 catcher molecules corresponding to the target sequences a - z of a chromosome . arithmetical averaging is unnecessary — the mean intensity of all hybrids specific to a chromosome is obtained through the mixing of the catcher molecules in one spot . from the number determined for the chromosomes present in a chromosome complement , a direct conclusion may be made as to the number of chromosomes in the egg cell . in this way the chromosomal integrity of an egg cell may be determined with a high level of confidence . catcher molecules in the context of the invention preferably comprise synthetic oligonucleotides . however they may also contain : dna , cdna , rna , arna , lna and / or other modified nucleic acids . the invention is described below with the aid of a specific embodiment . for the amplification of the chromosome material , in each case isolated from a single cell , the following primer was selected in accordance with the method of fig2 : with this primer sequence , a pcr amplification is conducted under the following conditions : several different samples are first of all heated for 5 minutes to 95 ° c ., then for 35 times 30 seconds to 95 ° c ., 30 seconds to 62 ° c . and 30 seconds to 72 ° c . at the end of the last cycle , the samples are heated for 10 minutes to 72 ° c . and then cooled down to 4 ° c . the primer ale1 - k has proved to be extremely efficient in the conduct of the method according to the invention . in the replacement of only one base by another base the primer is still able to carry out its function , in particular when only the terminal primer sections are affected . even with the omission of two terminal bases from the primer , useful results can still be obtained . such variations , which are known to the person skilled in the art , do however lead to considerable loss of quality . if more than two bases of the primer according to the invention are replaced or omitted , then the method according to the invention is scarcely capable of implementation . the fact that the primer fulfils its function is explained below with the aid of fig4 and 5 . the amplification products are applied to a gel and subjected to a gel electrophoresis . a view of the resultant electrophoresis gel is shown in fig4 . on this , arranged from left to right , 9 traces 1 - 9 may be recognized . trace 1 is the molecular weight standard , trace 2 a negative control , and traces 3 - 9 are identical specimens of different samples , each with one haploid cell as starting material . detectable on the gel shown in fig4 are sequences which have been predicted in silico in accordance with a method as shown in fig1 . by way of example , two sequences are specified : shgc - 6833 and rh102636 , which are to be found under their respective designations in the ncbi database . both sequences are part of the specific sequences amplified by means of ale1 - k . shgc - 6833 is to be found specifically on chromosome 21 . the sequence , seq id no . : 2 , ( hereafter described as sequence tagged site sequence or sts sequence ) of shgc - 6833 reads : by hybridizing with a marked sts probe , i . e . a complement to the sts sequence , in which a marking agent is incorporated , on to the gel shown in fig4 ( trace 3 ), a specific signal of the anticipated size is obtained , as shown in fig5 . this signal is the proof of the existence of shgc - 6833 in the starting material and thus for the existence of chromosome 21 . rh102636 is to be found specifically on chromosome 1 . the sequence of rh102636 , seq id no . : 3 , reads as follows : the detection of rh 102636 on the gel is at the same time proof that rh102636 was present in the starting material and thus the proof for the existence of chromosome 1 . the sequence concerned occurs only a single time on the particular chromosome . at the point where the fluorescence intensity of the two sequence traces is roughly the same , it may be stated that chromosomes 1 and 21 are present in equal amounts in the sample concerned . in silico , further sequences have been predicted , each occurring only a single time on a particular chromosome . table 1 gives a summary of the sequences predicted to date . the first column in the table lists the respective human chromosome . the second column gives the number of different amplification products of an amplification with ale1 - k predicted in silico for the chromosomes concerned . almost all of the amplification products in the second column are specific . given in the third column is the number of formerly known and published specific sequences ( sts sequences ) for the particular chromosome , which are accessible in public databases and represent in each case a partial amount of the relevant pcr products in column 2 . the fourth column shows the number of primer binding sites for ale1 - k on the chromosome concerned . since the primer does not always have a binding site in the required proximity to a first binding site for successful amplification of a section , and at which it may also hybridise a complement in the reverse direction , a pcr product does not always automatically result . with the primer ale1 - k according to the invention , this occurs in only a fraction of cases . accordingly it might be assumed that with 71485 primer binding sites of chromosome 1 around 35000 pcr products would be obtained , but their number is only 4512 . a dna chip or microarray used for analysis of a reaction mixture obtained from an amplification according to the invention may be designed as shown in schematic form in fig6 a or fig6 b . one option is to provide only one separate measuring point for each sts sequence . such a measuring point contains only catcher molecules which will form a hybrid specifically with the relevant sts sequence or a section thereof . a fluorescence trace at a measuring point then indicates that this sequence was present in the sample . for chromosome 1 , for example , up to 30 different measuring points may be provided on a microarray . if in the course of an amplification , one of 30 of the sts sequences detectable on the microarray for chromosome 1 is poorly amplified , for example because in the first amplification cycle in this sequence the primer did not bind to the primer binding site provided , there are still 29 further sequences available , the detection of which is at the same time proof of the existence of chromosome 1 in the sample . if an amplification error of this kind leads to a lowering of the amplified amount of this sequence relative to the other sequences then , in the measuring point representing this sequence , a lower fluorescence intensity will be observed than in the other measuring points ( measuring point without hatching , top left in fig6 a ). due to the fact that , for each of 29 other amplification products specific for chromosome 1 , a measuring point is provided on the microarray , the faulty amplification product can be identified as such . only some of the other 29 measuring points ( line - hatched measuring points 2 - 29 in the first column of the microarray shown in fig6 a ) are then used in the analysis to determine the relative amount of chromosome 1 . if their intensity is roughly equal to the intensity measured for measuring points specifically representing in each case one sts sequence of chromosome 2 , then it follows that the amounts of the respectively amplified sts sequences of chromosomes 1 and 2 are approximately equal ( column 2 of the measuring points in fig6 a with line hatching ). from this it follows in turn that chromosomes 1 and 2 are present in the sample concerned in the same relative proportions . if chromosome 3 occurs in the sample twice as often as the other chromosomes , then the corresponding measuring points will show twice the fluorescence intensity of the other measuring points ( measuring points with cross - hatching , third column in fig6 a ). individual measuring points which , due to amplification errors , which occur regularly in the course of amplification from a very small amount of starting material , have no or only minimal fluorescence intensity , as just described with reference to the first measuring point for chromosome 1 , provide no impediment to the analysis so long as at least one sts sequence per chromosome is correctly amplified . the probability that , due to amplification errors , all sts sequences of a chromosome have been more poorly amplified than the sts sequences of another chromosome , is statistically very low . a microarray on which catcher molecules are provided at different measuring points and are present there in equal concentrations , and which each form hybrids with a specific sts sequence from table 1 , is therefore ideally suited to provide , in a rapid and reliable manner , a statement regarding the relative amount of the chromosomes in a sample which has been amplified by ale1 - k . one measuring point of a microarray according to the invention may also contain catcher molecules which are able to hybridise with all sts sequences which are specific for a certain chromosome , or with a certain number of such sequences . such a microarray is shown schematically in fig6 a . at each spot , the chromosome it is intended to detect is shown . if at an individual measuring point , all sts sequences are detectable which are each specific for one of the chromosomes of table 1 , then the intensities of the detected hybrids relative to one another behave in the signal analysis like the number of sts sequences detected for each chromosome ( i . e . maximum around 1 : 10 , chromosome 19 : chromosome 1 , shown in fig6 b by cross - hatching in spot chr1 and line hatching in spot chr19 ; the remaining spots or measuring points are not hatched for reasons of clarity ). also suitable is a microarray in which , at individual measuring points , different but not all sts sequences which are specific for a chromosome are detectable . these are to be weighted accordingly in the analysis of the measured intensities . finally , different types of measuring point may be integrated on one microarray , i . e . the microarray may have measuring points conforming to those in fig6 a , measuring points conforming to those in fig6 b , or measuring points as just described . the integration of a multitude of different types of measuring point on a single microarray makes available all of the possible types of analysis described , so that the results may be more easily verified . this makes the method according to the invention especially reliable . in the variants cited and in the embodiment , the invention has been explained with the aid of a sperm analysis . methods according to the invention may also be applied to other genetic material besides the genome contained in a sperm , in particular to the genome and its chromosomes contained in a single human cell or in a human polar body . the method according to the invention may also be applied to specific deletions or insertions as delimitable partial amounts within a genetic material , e . g . within an individual chromosome or a section thereof as genetic material . angell , r . r ., man , j . & amp ; keith , j . 1993 : chromosome anomalies in human oocytes in relation to age . hum reprod . 8 ( 7 ): 1047 54 . beier , m . & amp ; hoheisel , j . ( 1999 ): nucl . acids res . 27 : 1970 1977 . eckel , h ., kleinstein , j ., wieacker , p ., stumm , m ( 2001 ): die zytogenetische analyse von nicht fertilisierten oozyten — möglichkeiten und grenzen . [ the cytogenetic analysis of non - fertilised oocytes — options and limits ] medizinische genetik 13 : 25 - 30 . garvin , a m , holzgreve , w . & amp ; hahn , s . ( 1998 ): highly accurate analysis of heterozygous laci by single cell pcr . nucl . acids res . 26 : 3468 3472 . griffin , d . k . ( 1996 ): the incidence , origin , and etiology of aneuploidy . int rev cytol . 167 : 263 - 96 . grothues , d ., cantor , c . r . & amp ; smith , c . ( 1993 ): pcr amplification of megabase dna with tagged random primers ( t pcr ). nucl . acids res . 21 : 1321 1322 . hagen - mann , k . & amp ; mann , w . ( 1990 ): polymerase chain reaction - eine revolutionäre methode für die biologie . [ a revolutionary method for biology ] biuz 20 : 257 262 . hagen - mann , k . & amp ; mann , w . ( 1995 ): rt - pcr and alternative methods to pcr for in vitro amplification of nucleic acids . exp . clin . endocrinol . 103 : 150 - 155 . hardt , t ., h . himmelbauer , w . mann , h . m . ropers & amp ; haaf , t . ( 1999 ): towards identification of individual homologous chromosomes : comparative genomic hybridization and spectral karyotyping discriminating between paternal and maternal euchromatin in mus musculus × m . spretus interspecific hybrids . cytogen . cell genet . 86 : 187 193 . heller , a ., chudoba , l , bleck , c ., senger ; g ., claussen , u ., & amp ; liehr , t . ( 2000 ): cgh of microdissection based comparative genomic hybridization analysis micro huang , q , schantz , s . p ., rao , p . h ., mo , j ., mccormick , s . a . & amp ; chaganti , r . s . ( 2000 ): improving degenerate oligonucleotide primed pcr comparative genomic hybridization for analysis of dna copy number changes in tumors . genes chromosomes cancer 28 : 395 403 . kingsley , k , wirth , j ., van der maarel , s ., freier , s ., ropers , r r & amp ; haaf , t . ( 1997 ): complex fish probes for the subtelomeric regions of all human chromosomes : comparative genomic hybridization of ceph yacs to chromosomes of the old world monkey presbytis cristata and great apes . cytogenet cell genet 78 : 12 19 . klein , c . a ., schmidt - kitler , 0 ., schardt , j . a ., pantel , k , speicher , m . r . & amp ; riethmuller , g . ( 1999 ): comparative genomic hybridization , loss of heterozygosity , and dna sequence analysis of single cells . pnas 96 : 4494 4499 . pollack , j r , perou , c . m ., alizadeh , a . a ., eisen , m r , pergamenschikov , a ., williams , c . f ., jeffrey , s . s ., botstein , d . & amp ; p . o . brown ( 1999 ): genome wide analysis of dna copy number changes using cdna microarrays . nature genetics 23 : 41 46 . schnell , s . & amp ; mendoza , c . ( 1997 ): theoretical description of the polymerase chain reaction . j . theor . biol . 188 : 313 318 . stolovitzky g . & amp ; cecchi g . ( 1996 ): efficiency of dna replication in the polymerase chain reaction . pnas 93 : 12947 12952 . swaminathan , n ., mcmaster , k , skowron , p . m ., & amp ; mead , d . ( 1998 ): thermal cycle labeling : zeptomole detection sensitivity and microgram probe amplification using cvu1 restriction generated oligonucleotides . anal . biochem . 255 : 133 141 . telenius , h . carter , n . p ., bebb , c . e ., nordenskj61d , m ., ponder , b . a . j ., & amp ; tunnacliff , a . ( 1992 ): degenerate oligonucleotide primed pcr : general amplification of target dna by a single degenerated primer . genomics 13 : 718 725 . verlinsky , y ., cieslak , j ., ivakhnenko , v ., evsikov , s ., wolf , g ., white , m ., lifchez , k kaplan , b ., moise , j ., valle , 1 , ginsberg , n ., strom , c . & amp ; kuliev , a . ( 1998 ): preimplantation diagnosis of common aneuploidies by the first and second polar body fish analysis . j assist reprod genet . : 15 ( 5 ): 285 9 . voullaire , l ., wilton , l ., slater , h . & amp ; williamson , r . ( 1999 ): detection of aneuploidy in single cells using comparative genomic hybridization . prenat . diagn . 19 : 846 851 . wodicka , l ., dong , h , mittmann , m ., ho , m . h ., lockhart , d . 1 ( 1997 ) genome wide expression monitoring in saccharpmyces cerevisiae . nature biotechnol 15 : 1359 - 1367 . zenzes , m . t ., wang , p . & amp ; casper , r . f . ( 1992 ): evidence for maternal predisposition to chromosome aneuploidy in multiple oocytes of some in vitro fertilization patients . fertil steril . 57 ( 1 ): 143 9 . zhang , l ., cui , x ., schmitt , k , hubert , r ., navidi , w . & amp ; arnheim , n . ( 1992 ): whole genome amplification from a single cell : implications for genetic analysis . pnas 89 : 4847 5851 . zhou , y , wang , h ., wie , j ., cui , l . deng , x ., wang , x . & amp ; chen , z . ( 2000 ): comparison of two pcr techniques used in amplification of microdissected plant chromosomes from rice and wheat . biotechniques 28 : 766 774 . database pubmed at ncbi , address www . ncbi . nlm . nih . gov ., abstract : rapid detection of common autosomal aneuploidies by quantitative fluorescent pcr on uncultured amniocytes . rahil , h . et al ., eur . j . hum . genet . ( august 2002 ) 10 ( 8 ) 462 - 6 . database pubmed at ncbi , address www . ncbi . nlm . nih . gov ., abstract : identification of chromosomal translocations in leukaemias by hybridization with oligonucleotide microarrays . nasedkina , t . et al ., haematologica ( april 2002 ) 87 ( 4 ) 363 - 72 . database pubmed at ncbi , address www . ncbi . nlm . nih . gov ., abstract : dna microarray technology for neonatal screening . dobrowolski , s . f . et al ., acta paediatr . suppl . ( 1999 ) 88 ( 432 ) 61 - 4 . abstract on “ preimplantation genetic diagnosis , polar body biopsy ” from the first world congress on : controversies in obstetrics , gynaecology & amp ; infertility , prague , czech republic — 1999 by y . verlinsky , a . kuliew . journal für fertilität und reproduktion , [ journal for fertility and reproduction ] number 4 / 2002 , page 7ff , m . montag , k . van der ven , h . van der ven “ erste klinische erfahrungen mit der polkörperchendiagnostik in deutschland ” [ initial clinical experience with polar body diagnosis in germany ]. “ einführung in die präimplantationsdiagnostik ”, [“ introduction to pre - implantation diagnosis ”] e . schwinger , lübeck , source : http :// www . studgen . unimainz . de / manuskripte / schwinger . pdf . flyer zu polkörperchendiagnostik der pränatal - medizin münchen , [ flyer on polar body diagnosis from the prenatal medical centre , munich ] dr . med karl - philip gloning et al . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .	2
hereinafter , embodiments of the present invention are explained in detail in conjunction with drawings . fig1 a and fig1 b show steps for explaining an embodiment 1 of a manufacturing method of an organic el panel to which the present invention is applied . steps advance in order of ( a )→( b )→( c )→( d )→( e ) in fig1 a and , thereafter , ( f )→( g )→( h ) in fig1 b . first of all , an ito film having a thickness of 150 nm is formed by sputtering on a glass substrate sub 1 having a thickness of 1 . 1 mm on which thin film transistors are formed . next , a portion of the ito which is formed into the film is patterned by an etching treatment using a photolithography method thus forming anodes ad which constitute respective pixel portions . here , the anodes ad are connected with source electrodes of thin film transistors via contact holes . thin film transistors formed on the glass substrate sub 1 constitute driving transistors ( second switches described later in fig4 ). subsequently , banks psb having a film thickness of 2 μm which define pixel portions in a state that the banks psb surround the pixel portions are patterned by a photolithography method which uses acrylic polymer resin . thereafter , the fluorine plasma treatment is performed to impart the ink repellency to the banks psb . a solution which is formed by adding 20 wt % of tert - butanol to a pedot / pss aqueous solution ( made by bayer co .) is formed into hole injection material ink through a ptfe filter of 0 . 45 μm . this ink is discharged to the pixel portions of the glass substrate sub 1 using an ink jet printing device thus forming hole injection layers htl having a thickness of 60 nm and , thereafter , the hole injection layers htl are baked for 20 minutes at a temperature of 200 ° c . next , 1 , 3 , 5 - tris [ 4 -( diphenylamino ) phenyl ] benzene ( also abbreviated as tdapb ), fac - tris ( 2 - phenylpyridine ) iridium ( iii ),(‘ fac ’ indicating isomer of hexacoordinated regular octahedral complex , ( also abbreviated as ir ( ppy ) 3 ), and ( 1 , 3 - bis [( 5 - p - tert - butylphenyl )- 1 , 3 , 4 - oxadiazol - 2 - yl ] benzene ( also abbreviated as oxd - 7 ) are mixed at a weight ratio of 100 : 80 : 60 . the mixture is dissolved in a 1 : 1 mixed solvent of 1 , 2 - dimethoxybenzene ( boiling point : 206 ° c ., contact angle on teflon ( trade mark ): 69 °) and cyclohexanol ( boiling point : 161 ° c ., surface tension : 32 . 9 dyne / cm , contact angle on teflon ( trade mark ): 58 °) such that the concentration of solid content becomes 0 . 5 wt % thus forming light - emitting material ink through a ptfe filter of 0 . 2 μm . the viscosity of ink is 5 mpa . s . the light emitting material ink is discharged to the hole injection layer htl in the inside of the pixel portion using a piezoelectric ink jet device and , thereafter , the light emitting material ink is baked for 15 minutes using a hot plate of 85 ° c . after the solvent is evaporated thus obtaining an amorphous light emitting layer lm having a thickness of 50 nm . thereafter , alq3 having a thickness of 10 nm is vapor - deposited at a vapor deposition rate of 0 . 1 nm / second and a vacuum of 10 − 6 torr thus forming an electron injection layer etl . subsequently , lif having a thickness of 0 . 5 nm is vapor - deposited at a vapor deposition rate of 0 . 01 nm / second thus forming a buffer layer bf . finally , al having a thickness of 100 nm is vapor - deposited at a vapor deposition rate of 1 nm / second thus forming a cathode cd . in the organic el panel which is obtained in the above - mentioned manner , light is emitted by applying a dc voltage between ito which constitutes the anode electrode ad of the organic el panel and al which constitutes the cathode electrode cd of the organic el panel in a glove box with the oxygen concentration of 1 ppm or less . it is possible to obtain the green emitted light having the brightness of 1080 cd / m 2 in a state that the dc voltage of 10v is applied . further , although the embodiment 1 describes a case in which the present invention is applied to a so - called active matrix type organic el panel , the present invention is not limited to such a panel and is also applicable to a single matrix type organic el display device . that is , on a glass substrate on which a large number of stripe - like anodes are formed , partition wall layers are formed for respective pixel portions , and the ink composition containing an organic material refined by distillation or sublimation is applied to the inside of recessed regions defined by the partition wall layers using an inkjet method thus forming a morphous thin films . thereafter , using steps similar to the steps described in the embodiment 1 , hole injection layers , light emitting layers and electron injecting layers are formed . further , thereafter , a large number of stripe - like cathodes are formed in a state that the cathodes intersect the anodes . as a comparison example for confirming the advantageous effects of the embodiment 1 , an organic el panel is fabricated in the following manner . that is , an organic el panel is fabricated in accordance with the exactly same steps as the first embodiment except for that as the solvent of the light emitting material ink in the embodiment 1 , dichlorobenzene ( boiling point : 180 ° c ., surface tension : 36 . 6 dyne / cm , contact angle on teflon : 63 °) is used in place of 1 , 2 - dimethoxybenzene , and triacetin ( boiling point : 258 ° c ., contact angle on teflon : 70 °) is used in place of cyclohexyl alcohol . in this comparison example , ink does not fall in the inside of the pixel portion and the organic layer adheres to the bank . further , the aggregation is observed in the thin film in the inside of the pixel portion thus failing to form the uniform amorphous thin film . fig2 is a cross - sectional view for explaining a structural example of the vicinity of one pixel of the organic el panel manufactured in the embodiment 1 . in fig2 , a substrate trs provided with thin film transistors ( tft ) includes a silicon nitride film sin and a silicon oxide film sio on an inner surface of the glass substrate sub 1 as a background layer . on the background layer , a thin film transistor which is constituted of a polysilicon semiconductor layer psi , a gate electrode gt , a gate insulation film gi , a source electrode sd 1 , a drain electrode sd 2 and an insulation film lns is formed . an anode ad which is made of ito is formed above a passivation film pas as a film , wherein the anode ae is connected with the source electrode sd 1 via a contact hole . here , a portion of the insulation film lns right below the gate functions as a gate insulation film gi . above the anode ad which is formed of ito , a hole injection layer htl to which the ink having the above - mentioned composition is applied using a nozzle of an ink jet device is formed . a light emitting layer lm having a specific color is applied to the hole injection layer htl using an inkjet device . an electron injection layer etl is formed on the light emitting layer lml as a film and , subsequently , a ca layer is vapor - deposited to form a cathode buffer layer bf and , further , an aluminum film al is vapor - deposited to the cathode buffer layer bf to form a cathode cd . here , further , as an organic layer which is formed between the anode ad and the cathode cd and contributes to the emission of light , there exist layers such as the hole injection layer , the light emitting layer , the electron injection layer and the like which are divided depending on functions or a layer which performs these functions simultaneously . the substrate trs provided with the thin film transistors ( tft ) having the above - mentioned structure is hermetically sealed with a sealing substrate sub 2 . in the example shown in fig2 , between the cathodes cd of the substrate trs provided with the thin film transistors ( tft ) and the sealing substrate sub 2 , a filling material such as epoxy resin is arranged . however , a dry space may be formed between the substrate trs and the sealing substrate sub 2 . to maintain the dry space , it is desirable to arrange a desiccant at proper positions between both substrates . fig3 is a view showing a circuit constitutional example of an organic el panel to which the present invention is applied . as shown in fig3 , on a display region dip , a plurality of data lines dl ( dl ( m + 1 ), dl ( m ), dl ( m − 1 ) . . . ) and a plurality of gate lines gl ( gl ( n + 1 ), gl ( n ), gl ( n − 1 ) . . . ) are arranged in a matrix array . in each one of pixels px which are surrounded by the respective data lines dl and the respective gate lines gl , a thin film transistor sw 1 which constitutes a switching element ( control • transistor ), a thin film transistor sw 2 which constitutes a current supply transistor ( drive transistor ), a capacitor c for holding data and an organic el element ole are arranged . the control electrode ( gate ) of the thin film transistor element sw 1 is connected to the gate line gl , while one end ( drain ) of the channel of the thin film transistor element sw 1 is connected to the data line dl . the gate of the thin film transistor sw 2 is connected to another end ( source ) of the channel of the thin film transistor sw 1 , while one electrode (+ pole ) of the capacitor c is connected to this node . one end ( drain ) of the channel of the thin film transistor sw 2 is connected to the current supply line pl , while another end ( source ) of the thin film transistor sw 2 is connected to the anode of the organic el element ole . the data lines dl are driven by a data drive circuit ddr , while scanning lines ( gate lines ) gl are driven by a scanning drive circuit ddg . further , the current supply line pl is connected to a current supply circuit pw through a common potential supply bus line pla . in fig3 , when one pixel px is selected in response to a signal from the scanning line gl , and the thin film transistor sw 1 is turned on , the image data supplied from the data line dl is stored in the capacitor c . thereafter , at a point of time that the thin film transistor sw 1 is turned off , the thin film transistor sw 2 is turned on and an electric current flows into the organic el element ole from the current supply line pl for an approximately 1 frame period . the electric current which flows in the organic el element ole is regulated by the thin film transistor sw 2 , while a voltage corresponding to a charge stored in the capacitor c is applied to the gate of the thin film transistor sw 2 . by controlling the thin film transistor sw 2 for every pixel , it is possible to control the emission of light of the plurality of pixels and hence , a two - dimensional image is reproduced on a display region dip . fig4 shows steps for explaining an embodiment of a manufacturing method of an organic thin film transistor to which the present invention is applied . first of all , to a polyimide substrate sub 1 having a thickness of 150 μm , au having a thickness of 20 nm is vapor - deposited at a vapor deposition rate 0 . 1 nm / second under a vacuum of 10 − 6 torr . the vapor - deposited au is patterned using a photolithography method thus forming source electrodes sd 1 and drain electrodes sd 2 . a length of a channel between the source electrode sd 1 and the drain electrode sd 2 is set to 10 μm . next , 1 , 3 , 5 - tris [ 4 -( diphenylamino ) phenyl ]- benzene ( tdapb , produced by bayer co .) is dissolved in a 1 : 1 mixed solvent of 1 , 2 - dimethoxybenzene and cyclohexanol such that the concentration of solid content becomes 0 . 5 wt % thus forming organic - semiconductor - layer - forming ink through a ptfe filter of 0 . 2 μm . the ink is discharged using a nozzle of a piezoelectric ink jet device to form a film having a thickness of 50 nm onto the hole injection layer in the inside of the pixel portion . then , the film is baked for 15 minutes using a hot plate of 85 ° c . thus obtaining an amorphous semiconductor film osc . on a main surface of the polyimide substrate sub 1 on which the source electrodes sd 1 , the drain electrodes sd 2 and the semiconductor films osc are formed in the above - mentioned manner , an isopropanol solution containing polyvinyl phenol ( molecular weight : 20000 ) is applied by spin coating thus forming a gate insulation film gi made of polyvinyl phenol . here , although the gate insulation film gi is formed using the organic material such as polyvinyl phenol , the gate insulation film gi may be formed of a silicon oxide film using teos ( tetraethoxysilane ). thereafter , by screen printing which uses a silver ( ag ) paste , a gate electrode gt having a width of 20 μm is formed on an upper surface of the gate insulation film gi at “ a portion which covers the semiconductor film osc and is spaced apart from the source electrode sd 1 and the drain electrode sd 2 thus forming an organic thin film transistor ( field effect transistor ) which uses the semiconductor film osc made of 1 , 3 , 5 - tris [ 4 -( diphenylamine ) phenyl ] benzene ( tdapb ) as a channel . the semiconductor film osc functions as a so - called activation layer which controls a quantity of carrier ( electrons or holes ) which flows between the source electrode sd 1 and the drain electrode sd 2 through the semiconductor film osc in response to an electric field applied to the semiconductor film osc from the gate electrode gt through the gate insulation film gi . when the carrier mobility of the organic thin film transistor ( the channel formed of the semiconductor film osc ) is measured , the carrier mobility is 1 × 10 − 5 cm 2 / vs . in the above - mentioned manufacturing method of the organic thin film transistor which has been described in conjunction with fig4 , the semiconductor film osc which constitutes the activation layer ( channel ) is formed by the ink jet method . however , the source electrode sd 1 , the drain electrode sd 2 and the gate electrode gt of the organic thin film transistor can be formed by an ink jet method which uses ink containing a conductive organic material . in pages 1452 to 1455 of no . 12 , the volume 70 of “ applied physics ” published by japan society of applied physics , a technique which forms an electrode of an organic thin film transistor having the cross - sectional structure shown in fig5 by an ink jet method is disclosed . by applying this technique to the manufacturing method of the organic thin film transistor of the above - mentioned embodiment , it is possible to fabricate an electron device in which all parts such as the substrates , insulation layers , semiconductor layers , electrode layers , wiring and the like are formed using organic materials ( organic resins ). hereinafter , the explanation is made with respect to an example in which the organic thin film transistor shown in fig5 is formed on a main surface of the substrate sub formed of the glass substrate . members other than the substrate sub in the organic thin film transistor are formed of organic materials . first of all , by patterning a film formed of an acrylic positive resist ( made by jsr company ltd .) which is applied to a main surface ( one main surface ) of the glass substrate sub using a photolithography method , separators ( also referred to as separation layers or partition walls , a function of the separators being explained later ) psb formed of acrylic resin are formed . next , by applying the heat treatment to the separators psb , insolubility to the solvent of the ink described later is imparted to the acrylic resin layer which constitutes the separators psb . the separators psb to which the heat treatment is applied is made to be solvent - repellant in the ink with respect to the solvent of the above - mentioned ink using the cf 4 plasma treatment . thereafter , the ink which is prepared as an aqueous solution containing 25 wt % of tert - butanol in which pedot / pss is dispersed is discharged to both sides of the separators psb made of acrylic resin on the main surface of the above - mentioned substrate sub from a nozzle of an ink jet device , a pair of ink droplet patterns are formed on both sides of the separator psb in a state that the droplet patterns extend along the separator psp . by drying the pair of ink droplet patterns , by heating the main surface of the substrate sub , the source electrodes sd 1 and the drain electrodes sd 2 made of pedot / pss are formed on both sides of the separator psb . when the source electrodes sd 1 and the drain electrodes sd 2 are formed using the ( so - called low molecular weight material ) conductive organic material which is refined by distillation or sublimation in place of the pedot / pss , the conductive organic material may be contained in the above - mentioned ink according to the present invention . accordingly , the source electrodes sd 1 and the drain electrodes sd 2 which are made of the conductive organic material are formed by molding in the same manner as the source electrode and the drain electrode which are obtained by the vapor deposition of a metal material such as au or the like . between the source electrode sd 1 and the drain electrode sd 2 , the ink according to the present invention containing 1 , 3 , 5 - tris [ 4 -( diphenylamine ) phenyl ] benzene which is the ( so - called low molecular weight ) organic semiconductor material which is refined by distillation or sublimation is dropped as mentioned above thus forming an organic semiconductor layer ( semiconductor film ) osc which strides over the separator psb . further , as shown in fig5 , the organic semiconductor layer osc may be formed by applying the so - called high molecular fluorene - based polymer ( molecular weight : 300000 ), for example , a xylene solution containing fluorene - bithiophene by spin coating . in the latter case , by applying the heat treatment to the main surface of the substrate sub to which the xylene solution is applied in the nitrogen atmosphere at a temperature of 200 ° c ., the organic semiconductor layer osc is formed . accordingly , when the above - mentioned source electrode sd 1 and drain electrode sd 2 in the organic thin film transistor are formed using the so - called low molecular weight conductive organic material and the semiconductor film osc which . constitutes the activation layer thereof is formed using the so - called polymer organic semiconductor material , the technique according to the present invention is applied to the formation of the electrodes of the organic thin film transistors . on the organic semiconductor layer osc shown in fig5 , the gate insulation film gi made of an organic material such as polyvinyl phenol or the like is formed as explained in conjunction with fig4 . the plasma treatment cf 4 is applied to an upper surface of the gate insulation film gi , so as to make the upper surface repellant against the solvent of the ink used in the formation of the gate electrode gt by an ink jet method which is performed subsequently . to a region of the upper surface of the gate insulation film gi to which the cf 4 plasma treatment is applied which faces “ a portion ( so - called channel ) which is sandwiched between the source electrode sd 1 and the drain electrode sd 2 of the semiconductor film osc ”, laser beams are irradiated using a krf excimer laser and hence , the repellency against the solvent which is imparted to the region is eliminated . in the organic thin film transistor shown in fig5 , the “ region ” on the upper surface of the gate insulation film gi is inevitably positioned above the separator psb and hence , the laser beams are irradiated from the krf excimer laser to the upper surface of the gate insulation film gi while targeting the region . the gate electrode gt is formed as a thin film made of pedot / pss which is obtained by discharging the above - mentioned ink used in the formation of the source electrode sd 1 and the drain electrode sd 2 to the “ region ” on the upper surface of the gate insulation film gi to which the laser beams are irradiated from the krf excimer laser using an ink jet device and by drying the ink droplets adhered to the region by heating . here , on an upper surface of the gate insulation film gi on which the gate electrode gt is formed , a protective film made of an organic material ( not shown in fig5 ) is formed . the carrier mobility and the like are estimated with respect to the organic thin film transistor shown in fig5 which is fabricated in the above - mentioned manner . from the result of the estimation , the organic thin film transistor shown in fig5 exhibits the favorable properties in the same manner as the organic thin film transistor explained in conjunction with fig4 . in the above - mentioned embodiment , the formation of the source electrode , the drain electrode and the gate electrode which constitute the conductive layers of the thin film transistor and are common with respect to a point that these conductive layers require the patterning is performed using an ink jet method , while the formation of the semiconductor layer and the insulation layer is performed using spin coating . here , in performing the formation of the source electrode and the drain electrode using the separator psb which is the pattern made of acrylic resin as a guide and the formation of the gate electrode using the portion of the upper surface of the insulation layer which suppresses the ink repellency , the ink having the above - mentioned composition of the present invention is used . fig6 is a schematic view for explaining a mode in which the conductive layer which constitutes the organic thin film transistor explained in conjunction with fig5 is formed by the ink jet method using the ink of the present invention . in fig6 , the ink of the electrode material which has the composition of the present invention is discharged from the nozzle of the ink jet device along the electrode forming portion where the separator psb of the glass substrate sub is arranged . in fig6 a , the ink droplets made of the discharged ink and the ink which is dropped on the glass substrate sub and is still in a liquid form are indicated by ink ( l ). the ink is discharged while allowing the nozzle to scan in the direction indicated by an arrow s . the discharged ink ink ( l ) is prevented from being undesirably spread on the glass substrate sub attributed to the separator psb , and the liquid droplets are continuously coated in the scanning direction of the nozzle in a state that the droplets are coupled to each other . thereafter , by heating and drying the ink ink ( l ), the ink ink ( l ) is solidified thus forming the strip - like electrode ( source electrode sd 1 , drain electrode sd 2 or the gate electrode gt ) as shown in fig6 b . here , the solidified ink is indicated by ink ( d ). fig7 a and fig7 b are molecular structural views of one example of the polymer materials which constitute the electrode materials of the organic thin film transistor tft explained in conjunction with fig5 . the electrode materials used in the the organic thin film transistor tft explained in conjunction with fig5 are above - mentioned pedot and pss , wherein the molecular structure of pedot is shown in fig7 a and the molecular structure of pss is shown in fig7 b . fig8 is a molecular structural view of one example of the polymer material which constitutes the insulation material gi of the organic thin film transistor tft explained in conjunction with fig5 . the insulation material gi is a so - called gate insulation layer and is polyvinyl phenol .	7
the following description is provided to enable any person skilled in the optical arts to make and use the invention and sets forth the best modes contemplated by the inventor of carrying out his invention . various modifications , however , will remain readily apparent to those skilled in the art , since the generic principles of the present invention have been defined herein specifically to provide a catadioptric lens system that can be manufactured in a relatively economical manner . in the accompanying drawings which are further supplemented by the enclosed tables , the lenses in accordance with the present invention are illustrated diagrammatically with light being assumed to travel from left to right with reciprocation between the main - mirror and sub - mirror . optical components are designated with capital letters . the radii of curvature of the elements are indicated by r , and the axial distances between refractive or reflective surfaces by d . the subscripts are numbered in the order of the transmission of the light ray . the letter r or d with a single prime (&# 39 ;) means the second occurrence of the same surface r or axial distance d , e . g ., a ray once passed through r 3 is again transmitted through the same surface r 3 after reflection on r 4 , and r 3 in case of this second occurrence is represented by r 3 &# 39 ;. in a similar manner , a letter with a double prime (&# 34 ;) indicates the third occurrence thereof in accordance with the transmission of light ray . symbol d or n with a minus sign indicates that the ray travels from right to left within the axial distance . fig1 , 5 and 7 schematically show the first to fourth embodiments of the present invention , respectively , and the pertinent data of these embodiments are disclosed in tables 1 to 4 . as seen from the fig1 , 5 and 7 , the preferred embodiments of the present invention comprise , in the order of the transmission of light ray in the system , a positive single lens ( l 1 ) having an object side surface convex to the object side ; a main mirror element ( m 1 ) composed of a negative meniscus single lens element concave to the object side , the image side surface of which serves as a reflecting surface faced to the object side ; a sub - mirror element ( m 2 ) composed of a positive meniscus single lens element convex to the image side , the object side surface of which serves as a reflecting surface faced to the image side ; and a lens component ( l r ) of a negative refractive power including the last refracting surface of the system . the catadioptric lens system according to the present invention fulfills the following conditions : d represents the diagonal length of the rectangular focal plane on which the image is projected ; l represents the axial distance between the main - mirror element ( m 1 ) and the sub - mirror element ; f represents the focal length of the whole system ; r 3 represents the radius of curvature of the object side surface of the main - mirror element ( m 1 ); r 4 represents the radius of curvature of the image side surface ( reflecting surface ) of the main - mirror element ( m 1 ); r 5 represents the radius of curvature of the image side surface of the sub - mirror element ( m 2 ); r 6 represents the radius of curvature of the object side surface ( reflecting surface ) of the sub - mirror element ( m 2 ); and f r represents the focal length of the lens component ( l r ). condition ( 1 ) defines the distance between the main - mirror m 1 and the sub - mirror m 2 relative to the diagonal length of the rectangular focal plane for restricting the increase of the diameter and the total length of the lens system , which would be caused by the increase of the field angle , within the limit of practical size . if l increases beyond the upper limit of this condition , it becomes necessary to extremely increase the inner effective diameter of m 1 , hence , the outer effective diameter of m 1 is required to be increased . furthermore , in order to maintain the appropriate illumination in the marginal area of the image surface , it becomes necessary to increase considerably the effective diameter of l 1 . if l decreases below the lower limit of this condition , on the contrary , the back focal distance , which is the distance between the last image - side surface of the lens system and the image surface , will be increased to result in an undesirably long total length of the lens system . although , it may be possible to decrease the back focal distance alone by the decrease of - f r beyond the lower limit of condition ( 4 ), even in the case that l is reduced beyond the lower limit of condition ( 1 ), an increase of flare due to the spherical aberration would result in this case , and practical performance can not be achieved . condition ( 2 ) defines the lens shape of the main - mirror m 1 . if the upper limit of this condition is violated , the diameter of the sub - mirror would have to be enlarged , since the refractive power of the main - mirror would be excessively decreased , further , the diameter of l 1 would have to be enlarged in order to maintain the appropriate illumination at the image surface , and the total length of the lens system will be lengthened . if the lower limit of this condition is violated , the flare of the coma would be increasingly generated since the refractive power of the main - mirror would be excessively increased . condition ( 3 ) defines the lens shape of the sub - mirror m 2 . if the upper limit of this condition is violated , it will be required to lengthen the total length of the lens system since the refractive power of the sub - mirror would be excessively decreased . if the lower limit of this condition is violated , the flare due to the spherical aberration would be increasingly generated since the refractive power of the sub - mirror would be excessively increased . condition ( 4 ) defines the range of the focal length of the lens component l r to successfully reduce the total length of the lens system with the necessary aberration correction . if the upper limit of this condition is violated , the total length of the lens system would be increased since the back focal distance would be increased . if the lower limit of this condition is violated , the flare due to the spherical aberration and the positive distortion would be increasingly generated , although the total length of the lens system may be decreased . table 1__________________________________________________________________________ [ embodiment 1 ] f = 100 . 0 2ω = 9 ° 40 &# 39 ; radius of axial refractive abbecurvature distance index number__________________________________________________________________________ r . sub . 1 39 . 947 l . sub . 1 d . sub . 1 2 . 000 n . sub . 1 1 . 5168 ν . sub . 1 64 . 1 r . sub . 2 275 . 478 d . sub . 2 16 . 000 r . sub . 3 - 42 . 286 d . sub . 3 1 . 600 n . sub . 2 1 . 7005 ν . sub . 2 30 . 1 m . sub . 1 r . sub . 4 - 76 . 274 d . sub . 3 &# 39 ; - 1 . 600 n . sub . 2 &# 39 ; - 1 . 7005 ν . sub . 2 &# 39 ; 30 . 1 r . sub . 3 &# 39 ; - 42 . 286 d . sub . 4 - 14 . 000 r . sub . 5 - 30 . 214 d . sub . 5 - 1 . 000 n . sub . 3 - 1 . 7005 ν . sub . 3 30 . 1 m . sub . 2 r . sub . 6 - 61 . 263 d . sub . 5 &# 39 ; 1 . 000 n . sub . 3 &# 39 ; 1 . 7005 ν . sub . 3 &# 39 ; 30 . 1 r . sub . 5 &# 39 ; - 30 . 214 d . sub . 6 13 . 400 r . sub . 7 - 14 . 924 d . sub . 7 0 . 600 n . sub . 4 1 . 5168 ν . sub . 4 64 . 1l . sub . r r . sub . 3 &# 34 ; - 42 . 286 m . sub . 1 d . sub . 3 &# 34 ; 1 . 600 n . sub . 2 &# 34 ; 1 . 7005 ν . sub . 2 &# 34 ; 30 . 1 r . sub . 4 &# 39 ; - 76 . 274 d = 17 . 3 l = 14 . 0 f . sub . r = - 34 . 03__________________________________________________________________________ table 2__________________________________________________________________________ [ embodiment 2 ] f = 100 . 0 2ω = 9 ° 40 &# 39 ; radius of axial refractive abbecurvature distance index number__________________________________________________________________________ r . sub . 1 60 . 572 l . sub . 1 d . sub . 1 2 . 000 n . sub . 1 1 . 5176 ν . sub . 1 53 . 5 r . sub . 2 173 . 817 d . sub . 2 15 . 600 r . sub . 3 - 29 . 825 d . sub . 3 1 . 600 n . sub . 2 1 . 5168 ν . sub . 2 64 . 1 m . sub . 1 r . sub . 4 - 51 . 174 d . sub . 3 &# 39 ; - 1 . 600 n . sub . 2 &# 39 ; - 1 . 5168 ν . sub . 2 &# 39 ; 64 . 1 r . sub . 3 &# 39 ; - 29 . 825 d . sub . 4 - 13 . 600 r . sub . 5 - 19 . 373 d . sub . 5 - 1 . 000 n . sub . 3 - 1 . 5168 ν . sub . 3 64 . 1 m . sub . 2 r . sub . 6 - 36 . 927 d . sub . 5 &# 39 ; 1 . 000 n . sub . 3 &# 39 ; 1 . 5168 ν . sub . 3 &# 39 ; 64 . 1 r . sub . 5 &# 39 ; - 19 . 373 d . sub . 4 &# 39 ; 13 . 600 r . sub . 3 &# 34 ; - 29 . 825 m . sub . 1 d . sub . 3 &# 34 ; 1 . 600 n . sub . 2 &# 34 ; 1 . 5168 ν . sub . 2 &# 34 ; 64 . 1 r . sub . 4 &# 39 ; - 51 . 174 d . sub . 6 1 . 200l . sub . r r . sub . 7 - 13 . 015 d . sub . 7 0 . 560 n . sub . 4 1 . 5168 ν . sub . 4 64 . 1 r . sub . 8 266 . 647 d . sub . 8 0 . 760 n . sub . 5 11 . 7400 ν . sub . 5 28 . 3 r . sub . 9 - 77 . 979 d = 17 . 3 l = 13 . 6 f . sub . r = - 27 . 15__________________________________________________________________________ table 3__________________________________________________________________________ [ embodiment 3 ] f = 100 . 0 2ω = 9 ° 40 &# 39 ; radius of axial refractive abbecurvature distance index number__________________________________________________________________________ r . sub . 1 42 . 109 l . sub . 1 d . sub . 1 2 . 000 n . sub . 1 1 . 5168 ν . sub . 1 64 . 1 r . sub . 2 409 . 479 d . sub . 2 15 . 500 r . sub . 3 - 38 . 912 d . sub . 3 2 . 000 n . sub . 2 1 . 6830 ν . sub . 2 31 . 5 m . sub . 1 r . sub . 4 - 67 . 502 d . sub . 3 &# 39 ; - 2 . 000 n . sub . 2 &# 39 ; - 1 . 6830 ν . sub . 2 &# 39 ; 31 . 5 r . sub . 3 &# 39 ; - 38 . 912 d . sub . 4 - 14 . 000 r . sub . 5 - 24 . 806 d . sub . 5 - 1 . 000 n . sub . 3 - 1 . 7005 ν . sub . 3 30 . 1 m . sub . 2 r . sub . 6 - 46 . 654 d . sub . 5 &# 39 ; 1 . 000 n . sub . 3 &# 39 ; 1 . 7005 ν . sub . 3 &# 39 ; 30 . 1 r . sub . 5 &# 39 ; - 24 . 806 d . sub . 4 &# 39 ; 13 . 400 r . sub . 7 - 12 . 738 d . sub . 6 0 . 600 n . sub . 4 1 . 5168 ν . sub . 4 64 . 1 r . sub . 3 &# 34 ; - 38 . 912 m . sub . 1 d . sub . 3 &# 34 ; 2 . 000 n . sub . 2 &# 34 ; 1 . 6830 ν . sub . 2 &# 34 ; 31 . 5l . sub . r r . sub . 4 &# 39 ; - 67 . 502 d . sub . 7 1 . 000 r . sub . 8 - 24 . 225 d . sub . 8 0 . 600 n . sub . 5 1 . 5168 ν . sub . 5 64 . 1 r . sub . 9 - 41 . 271 d = 17 . 3 l = 14 . 0 f . sub . r = 22 . 97__________________________________________________________________________ table 4__________________________________________________________________________ [ embodiment 4 ] f = 100 . 0 2ω = 8 ° 14 &# 39 ; radius of axial refractive abbecurvature distance index number__________________________________________________________________________ r . sub . 1 48 . 806l . sub . 1 d . sub . 1 2 . 000 n . sub . 1 1 . 5176 ν . sub . 1 53 . 5 r . sub . 2 95 . 713 d . sub . 2 15 . 500 r . sub . 3 - 29 . 534 d . sub . 3 2 . 000 n . sub . 2 1 . 5168 ν . sub . 2 64 . 1m . sub . 1 r . sub . 4 - 50 . 139 d . sub . 3 &# 39 ; - 2 . 000 n . sub . 2 &# 39 ; - 1 . 5168 ν . sub . 2 &# 39 ; 64 . 1 r . sub . 3 &# 39 ; - 29 . 534 d . sub . 4 - 13 . 800 r . sub . 5 - 19 . 865 d . sub . 5 - 1 . 000 n . sub . 3 - 1 . 5176 ν . sub . 3 53 . 5m . sub . 2 r . sub . 6 - 36 . 711 d . sub . 5 &# 39 ; 1 . 000 n . sub . 3 &# 39 ; 1 . 5176 ν . sub . 3 &# 39 ; 53 . 5 r . sub . 5 &# 39 ; - 19 . 865 d . sub . 6 14 . 000 r . sub . 7 - 12 . 984 d . sub . 7 0 . 500 n . sub . 4 1 . 7495 ν . sub . 4 50 . 1 r . sub . 8 52 . 803l . sub . r d . sub . 8 0 . 200 r . sub . 9 52 . 632 d . sub . 9 1 . 000 n . sub . 5 1 . 7400 ν . sub . 5 28 . 3 r . sub . 10 - 67 . 502 d = 14 . 4 l = 13 . 8 f . sub . r = 21 . 74__________________________________________________________________________ in the first embodiment , lens component l r is formed by the central part of the main - mirror m 1 and the negative meniscus lens is cemented on the object side surface of the main - mirror m 1 . in this case , the lens system can be most economically produced since only four lens elements are required . further , the peripheral edge of the negative meniscus lens cemented on the main - mirror is available for mounting the light - shielding cylinder which is to be provided between the main - mirror and sub - mirror . in case of the second embodiment , lens component l r is composed of the central part of the main - mirror m 1 and a lens component located adjacently to the main - mirror m 1 at the image side thereof . the lens component at the image side of the main - mirror m 1 has an object side surface remarkably concave to the object side . this object side surface has a funtion of shifting the spherical aberration to the positive side as shown in fig4 a . fig4 a discloses that the actual focal plane is set behind the paraxial image plane . this setting of the actual focal plane may seem to contradict the image surface seen from fig4 b . however , this setting is correct since the zonal to marginal rays , which would generally focus behind the paraxial image plane as the flare component in case of the condition as in fig4 b , are intentionally utilized to form an image according to the present invention . it should be noted that the central part of the incident light pencil does not participate in forming the image since the present invention system is of catadioptric type . further , in the case of the second embodiment , the total length of the system can be reduced , since the refractive powers of the main - mirror and the sub - mirror are capable of being increased more than in the case of the first embodiment . the lens component l r in the third embodiment is realized by a combination of the central part of the main - mirror m 1 , the negative meniscus lens cemented to the main - mirror m 1 at the object side thereof and a negative meniscus lens concave to the object side located adjacently to the main - mirror m 1 at the image side thereof . this means that the first embodiment with one lens element added thereto makes a lens system of the type of the third embodiment , which is capable of having a lens component l r of a shorter focal length f r than that in the first embodiment . the third embodiment has greater powers for m 1 , m 2 and l r and less total length , than those in the first embodiment . in the fourth embodiment , it should be noted that lens component l r is composed of a negative lens having an object side surface remarkably concave to the object side and a positive lens , which are positioned within a space formed by hollowing out the central part of the main - mirror m 1 . in this case , the lens component l r can be formed by a cemented doublet or a single lens in place of the two separate single lenses as in fig7 . as it will be readily understood by those skilled in the optical arts the present invention is capable of many modifications and improvements within the scope and spirit thereof . accordingly the invention is not intended to be limited by the specific disclosed embodiments but should be measured solely from the following claims .	6
fig1 is a representation of the support which is liable to be implemented within the method of the invention . the support is in the form of a rotating disk ( 1 ) with striations extending from the center to the outside ( 2 ) and a spindle ( 3 ). on contact with the rotating disk , the liquid is transformed into droplets of a variable size depending on the speed of rotation and the rheology of the concentrated polymer liquid . in fig2 , the remainder of the equipment required for the implementation of the method is depicted . the equipment includes a recipient ( 4 ) filled with a dispersion of polyacrylamide ( 5 ) and provided with an air venting device ( 6 ). it also includes a peristaltic pump ( 7 ) and a pipe ( 8 ) connecting the tank to the support ( 9 ). in fig3 , a tractor ( 10 ) is shown , carrying a ramp ( 11 ) fitted with 8 application equipment units ( 12 ) capable of conditioning large surface areas in a reasonable time . we attempted to spread 10 kg of polyacrylamide with a conventional agricultural sprayer over an area of almost 1 hectare . we then applied the same quantities of polymer using the method of the invention . the area to be treated was marked out on a larger plot of land in a 72 m wide and 139 m long rectangle , adapted to the size of the spraying machines , i . e . 24 m wide for the conventional sprayer and 12 m wide for the equipment assembled according to the method of the invention . in the first case , in an agricultural sprayer tank , we diluted an acrylamide copolymer ( 70 % molar density ) and sodium acrylate ( 30 % molar density ) powder , marketed by snf sas under the name of flobond a30 , to the extent of 300 ppm , i . e . a total quantity of mixture to be pulverized amounting to 33 , 333 liters . with the sprayer having a carrying capacity of 3000 liters , we decided to carry out 12 applications of 2778 liters of the 300 ppm acrylamide copolymer preparation . each pass required the preparation of the mixture to be sprayed meaning that each time we were required to pour the acrylamide copolymer powder to be diluted slowly into the water of the sprayer tank while constantly stirring it , then to wait a maturation time of approximately 1 hour , while constantly stirring the mixture . only then could the mixture be sprayed . because the maximum flow rate of the sprayer is limited , we decided to carry out 3 successive passes at a speed of 5 km / h to spray all the mixture using the jet nozzles habitually used for the application of liquid fertilizers . the spraying of each 2778 liter mixture required approximately 20 minutes allowing for maneuvering . however , the filters of the sprayer had to be cleaned several times because they were easily fouled in the presence of at the dissolved acrylamide copolymer granules or insoluble particles . the time to prepare each mixture added to the time required for each of the 12 planned applications led us to realize that we would be unable to perform the complete operation in one day &# 39 ; s work for a surface area of only 1 hectare , forcing us to abandon the operation under way . in addition , for the needs of this experiment , we were obliged to choose a plot of land having a water point to allow us to make up the mixtures . it appears even less possible to implement this method on a plot of land distant from a water point , or in areas where there is a shortage of water . in addition , applying 33 , 333 liters of water to 1 hectare of soil is a considerable undertaking that we would compare to irrigation . furthermore , cleaning the spray and its tank called for large amounts of water because of the colloidal nature of the acrylamide copolymer . accordingly , this method cannot be implemented reasonably . according to the method of the invention , we assembled a 12 m wide rig with the 12 rotary supports as described previously , each supplied with product by a flexible pipe connected to a single flexible pouch filled with the product to be spread , itself fitted with a coarse filter , placed in a rigid tank with each flexible pipe plugged into its own peristaltic pump mounted on the pipe alongside each rotary atomizer . by advancing at a speed of 7 . 5 km / hour , 40 liters of aqueous acrylamide copolymer dispersion ( 70 % molar ) and of sodium acrylate ( 30 % molar ) sold by snf sas under the name of sfa 30 ( containing 25 % copolymer ) were applied in 10 minutes . when the operation was complete , the flexible pouch and the flexible pipes were discarded and the rotary supports disassembled then washed in running water .	2
embodiments of the present method and composition are a description of reducing graphene oxide to graphene in high boiling point solvents . as one of ordinary skill in the art will readily appreciate , graphene oxide decomposes to graphene when heated to temperatures around 200 ° c . when graphene oxide decomposes to graphene , however , it is desirable to keep the graphene as a dispersion so that it can be more easily used in commercial products . one way to reduce graphene oxide to graphene is to deoxygenate the graphene oxide . graphene oxide typically appears as water dispersible sheets . the graphene oxide may be reduced to graphene by deoxygenating the graphene oxide sheets to obtain sheets of graphene . when reducing the graphene oxide to graphene , graphene platelets tend to clump up or agglomerate . as mentioned , it is desirable to keep the graphene oxide as a dispersion as the graphene oxide is reduced to graphene . a method that may lead to the production of dispersible sheets of graphene involves dispersing graphene oxide in water to achieve a dispersion of single graphene oxide sheets and then adding a high boiling point solvent to the dispersion to form a solution . the high boiling point solvent may be a solvent with a boiling point of approximately 200 ° c . or higher . because the solvent has a high boiling point , the solution may be heated to approximately 200 ° c . without boiling off the solvent while deoxygenating the graphene oxide and ultimately to arriving at dispersible graphene . a more detailed description of this method follows . turning to fig1 , which is a flow chart that depicts a first embodiment 100 of a method of reducing graphene oxide to graphene . in step 110 , a dispersion is created . the dispersion may be comprised of graphene oxide dispersed into water by sonication . sonication as described herein may comprise inducing cavitation through the use of ultrasound for the purpose of achieving a dispersion . the graphene oxide may be in the form of water dispersible sheets . dispersing the graphene oxide by sonication may result in a dispersion comprised of single platelets of graphene oxide . the single platelets of graphene oxide may form a more stable dispersion . a stable dispersion of graphene oxide may be amenable to forming a dispersion of graphene . a ratio of water to graphene oxide in the dispersion may be approximately one milligram of graphene oxide to approximately one milliliter of water a solvent may be added to the dispersion 120 to form a solution . the solvent may be a water miscible solvent , such as , for example n - methylpyrrolidone , ethylene glycol , glycerin , dimethylpyrrolidone , acetone , tetrahydrofuran , acetonitrile , dimethylformamide , an amine or an alcohol . the amount of solvent added to the dispersion may be approximately equivalent to the amount of the dispersion . thus if the dispersion is comprised of one milliliter of water and one milligram of graphene oxide , a volume or amount of solvent that is approximately equivalent to one milliliter of water and one milligram of graphene oxide may be added to the dispersion . at this point the solution may be comprised of a mixture with a value that is approximately half graphene oxide / water dispersion and half high boiling point solvent . the solution may be gradually heated to approximately 200 ° c . 130 . in some embodiments , the solution may be heated in an autoclave or high pressure chamber . as one of ordinary skill in the art will readily appreciate , heating the solution in a pressurized environment may raise the boiling point of the solution , including the solvent . thus , the boiling point of the solution may reach or exceed 200 ° c . if the solution is heated in a pressurized environment , a solvent with a boiling point that is slightly below 200 ° c . may be used . as the solution is heated the solution may be stirred . water may be removed via evaporation from the solution as the solution is heated . as water is removed , the temperature of the solution is expected to rise . as the temperature rises the graphene oxide deoxygenates . when the temperature of the solution reaches approximately 200 ° c . a reduction may be formed . as the solution is heated , the surface of the graphene oxide may be functionalized , which may result in less clumping of the platelets in the final product . in an embodiment , the temperature may be held at approximately 200 ° c . for a period of time 140 to aid in functionalization of the reduction . in some embodiments the temperature may be held for as little as one hour . in other embodiments the temperature may be held as long as twenty - four hours . in still other embodiments the solution temperature may be held only a moment once the temperature reaches approximately 200 ° c . to form a reduction . the reduction may be removed from the heat to allow cooling . because the reduction may still comprise solvent , the reduction may be purified to remove as much of the remaining solvent as possible 150 . purifying the reduction may comprise filtrating the reduction . the reduction may also be re - disbursed in acetone and may be centrifuged as part of the purification process . the end result of the purification process may be a solid . the solid may be graphene comprising trace amounts of the solvent . turning to fig2 , which is a flow - chart that depicts a second embodiment 200 of the method of reducing graphene oxide to graphene . in step 210 of the method a dispersion is created . the dispersion may be comprised of water dispersible sheets of graphene oxide dispersed into water by sonication . the ratio of water to graphene oxide may be approximately two milligrams of graphene oxide to approximately one milligram of water . a solvent may be added to the dispersion 220 to form a solution . the solvent may be a water miscible solvent , such as , for example n - methlypyrrolidone , ethylene glycol , glycerin , dimethlypyrrolidone , acetone , tetrahydrofuran , acetonitrile , dimethylformamide , an amine or an alcohol . the amount of solvent added to the dispersion may be approximately equivalent to one half the amount of the dispersion . the if the dispersion is comprised of approximately two milligrams of graphene oxide and approximately one milligram of water , the amount of solvent added to the dispersion may be approximately one half the volume or amount of approximately two milligrams of graphene and approximately one milligram of water . the solution may be gradually heated 230 . in some embodiments , the solution may be heated in an autoclave or high pressure chamber . as one of ordinary skill in the art will readily appreciate , heating the solution in a pressurized environment may raise the boiling point of the solution , including the solvent . thus , the boiling point of the solution may reach or exceed 200 ° c . if the solution is heated in a pressurized environment , a solvent with a boiling point that is slightly below 200 ° c . may be used . as the solution is heated the solution may be stirred . as the solution is heated and stirred water may evaporate from the solution . as water evaporates from the solution , an amount of solvent approximately equivalent to an amount of evaporated water may be added to the dispersion . the steps of gradually heating the solution , stirring the solution and adding solvent to replace evaporated water may continue until the temperature of the solution reaches approximately 200 ° c . when the temperature reaches approximately 200 ° c . a reduction may be formed . as the solution is heated , the surface of the graphene oxide may be functionalized , which may result in less clumping of the platelets in the final product . in an embodiment , the temperature may be held at 200 ° c . for a period of time 240 to aid in functionalization of the reduction . in some embodiments the temperature may be held for as little as one hour . in other embodiments the temperature may be held as long as twenty - four hours . in still other embodiments the temperature may be held only a moment once the temperature of the solution reaches approximately 200 ° c . to form a reduction . the reduction may be removed from the heat to allow cooling . the cooled reduction may be purified 260 . purifying the reduction may comprise filtrating the reduction in an effort to remove solvent remaining in the reduction . the reduction may be re - disbursed in acetone and may be centrifuged to recover a solid . the solid may be graphene comprising trace amounts of the solvent . the present method and composition are not limited to the particular details of the depicted embodiments and other modifications and applications are contemplated . certain other changes may be made in the above - described embodiments without departing from the true spirit and scope of the present method and composition herein involved . it is intended , therefore , that the subject matter in the above depiction shall be interpreted as illustrative and not in a limiting sense .	2
conventionally , when taking the moving average of multiple moving averages , multiple moving average calculating circuits are connected in stages . in the present invention , a fir ( finite impulse response ) type filter is used to take the moving average of multiple moving averages . in what follows , an embodiment of the present invention will be explained with reference to the attached drawings . fig1 is a block diagram showing the moving average calculating circuit according to the first embodiment of the present invention . in this moving average calculating circuit , a 1 - bit signal is input to a data holding unit 101 having a ram or a shift register . this data holding unit 101 holds a minimum number of data required to calculate the moving average in the present invention . in the present embodiment , at least 22 successive data are held in the data holding unit 101 . two data are read from the data holding unit 101 as needed . these two data are input to the two input terminals of an adder 102 . the adder 102 then outputs a signal to a multiplier 103 . coefficient data are also input to the multiplier 103 from a coefficient rom 104 that functions as a coefficient storage unit . the multiplier 103 outputs a signal to one of the input terminals of another adder 105 . the adder 105 outputs a signal to a d - f / f 106 . the d - f / f 106 outputs a signal to the other input terminal of the adder 105 and a latch circuit 107 . the latch circuit 107 then outputs a signal that becomes the output signal out of the moving average . in the present embodiment , three moving average filters are serially connected in stages , each of which takes the moving average of eight data . first , the first data to be used to take the moving average is denoted by d 0 . the other data d 1 through d 7 to be used to take the moving average are input in sequence for every sampling time t . the time at which the eighth data d 7 is input is set to t = 0 . the moving average data ma 0 of the first stage moving average filter at t = 0 is since this is a moving average , this value changes every time the period of the sampling time t passes . the time at which the ( n + 8 )- th data d n + 7 is input is inductively set to t = n ( where n is a non - negative integer ). then , the moving average data ma n of the first stage moving average filter at t = n is the second stage moving average filter connected to the first stage moving average filter takes the average of the eight output data supplied from the first stage moving average filter . the moving average data output of the second stage moving average filter at t = 7 is denoted by mb 0 . then , mb 0 is expressed by substituting equation ( 1 ) into each of the ma 0 through ma 7 , the above - equation becomes mb 0 =( d 0 + 2d 1 + 3d 2 + . . . 6d 5 + 7d 6 + 8d 7 + 7d 8 + 6d 9 + . . . + 3d 12 + 2d 13 + d 14 )/ 8 2 . at t = n , the output of the second stage moving average filter is mb n =( d n + 2d n + 1 + 3d n + 2 + 4d n + 3 + 5d n + 4 + 6d n + 5 + 7d n + 6 + 8d n + 7 + 7d n + 8 + 6d n + 9 + 5d n + 10 + 4d n + 11 + 3d n + 12 + 2d n + 13 + d n + 14 )/ 8 2 ( 2 ). next , the third stage moving average filter connected to the second stage moving average filter takes the average of the eight output data supplied from the second stage moving average filter . the moving average data output of the third stage moving average filter at t = 14 is denoted by mc 0 . then , mc 0 is expressed by substituting equation ( 2 ) into each of the mb 0 through mb 7 , the output of the third stage moving average filter at time t = n becomes mc n =( d n + 3d n + 1 + 6d n + 2 + 10d n + 3 + 15d n + 4 + 21d n + 5 + 28d n + 6 + 36d n + 7 + 42d n + 8 + 46d n + 9 + 48d n + 10 + 48 d n + 11 + 46d n + 12 + 42d n + 13 + 36d n + 14 + 28d n + 15 + 21d n + 16 + 15d n + 17 + 10d n + 18 + 6d n + 19 + 3d n + 20 + d n + 21 )/ 8 3 ={ ( d n + d n + 21 )+ 3 ( d n + 1 + d n + 20 )+ 6 ( d n + 2 + d n + 19 )+ 10 ( d n + 3 + d n + 18 )+ 15 ( d n + 4 + d n + 17 )+ 21 ( d n + 5 + d n + 16 )+ 28 ( d n + 6 + d n + 15 )+ 36 ( d n + 7 + d n + 14 )+ 42 ( d n + 8 + d n + 13 )+ 46 ( d n + 9 + d n + 13 )+ 48 ( d n + 10 + d n + 11 )}/ 8 3 ( 3 ) equation ( 3 ) shows that the moving average can be obtained using a fir ( finite impulse response ) type filter of 11 - th order . fig2 shows the signal flow of the fir filter for realizing equation ( 3 ). in what follows , the operation of the moving average filter according to the first embodiment will be explained with reference to fig1 and 2 . 1 - bit data are input sequentially to the data holding unit 101 . the data holding unit 101 holds 22 successive data . the data holding unit 101 reads the newest data d n + 21 and the oldest data d n . these data d n and d n + 21 are sent to the adder 102 , and the adder 102 add up d n and d n + 21 . the adder 102 then sends the result of the addition to the multiplier 103 . the coefficient rom 104 reads and supplies the coefficient k 0 = 1 to the multiplier 103 . the multiplier 103 then multiplies the coefficient k 0 = 1 to the result of the addition . the multiplier 103 then sends the multiplication result to the adder 105 . the output data of the adder 105 is held in the d - f / f 106 temporarily . next , the data holding unit 101 reads data d n + 1 and d n + 20 . these data d n + 1 and d n + 20 are sent to the adder 102 , and the adder 102 add up d n + 1 and d n + 20 . the adder 102 then sends the result of the addition to the multiplier 103 . the coefficient rom 104 reads and supplies the coefficient k 1 = 3 to the multiplier 103 . the multiplier 103 then multiplies the coefficient k 1 = 3 to the result of the addition . the multiplier 103 then sends the multiplication result to one of the two input terminals of the adder 105 . the output data of the adder 105 temporarily held in the d - f / f 106 is fed back to the other input terminal of the adder 105 when the multiplication result ( d n + 1 + d n + 20 )* k 1 is input to the one input terminal of the adder 105 . in other words , the result that had been obtained in the previous timing by the adder 105 is cumulated . in the same manner , the adder 102 adds up the data d m and d 2n + 21 − m ( m = n , n + 1 , . . . , n + 10 ) read by the data holding unit 101 . the multiplier 103 then multiplies the sum d m + d 2n + 21 − m to the coefficient k 1 ( l = 1 through 10 ) read by the coefficient rom 104 . the adder 105 then cumulates the multiplication result . this process id repeated . after this , the latch circuit 107 receives a latch signal from a timing generating circuit not shown in the drawing when the quantities in the numerator of equation ( 3 ), that is , all the quantities shown in fig2 are all cumulated . the latch circuit 107 then latches the calculation result , and outputs the moving average as the final output . in order to make the final result precise , the denominator of equation ( 3 ) needs to be calculated and multiplied by k 11 = 1 / 8 8 ( division by 8 3 ). in general , a multiplication by 2 n in the binary system can be carried out by shifting the output upward by n bit , and a division by 2 n in the binary system can be carried out by shifting the output downward by n bit . hence in practice , when wiring from the d - f / f ( f ) to the latch circuit 107 , for example , a division by 2 9 in the binary system can be realized by connecting the d - f / f ( f ) to the latch circuit 107 so as to shift the output downward by 9 bit . therefore , a division by 8 3 in the decimal system , which is equivalent to a division by 2 9 in the binary system , can be realized by connecting the d - f / f ( f ) to the latch circuit 107 so as to shift the output downward by 9 bit . this division by 8 3 in the decimal system requires no additional special hardware and can be achieved easily . thus , according to the first embodiment of the present invention , a fir filter configuration is used . therefore , even if a calculation error is generated by a noise or an operation error , a normal output result can be obtained in the next calculation cycle . moreover , even if the average number of moving averages and the number of stages of the serial connection are changed , it suffices to adjust the number of bits in the adders and the multiplier and the coefficient rom to cope with these changes without significantly increasing the area of the hardware . fig3 is a block diagram showing the configuration of a moving average calculating circuit according to the second embodiment of the present invention . in this moving average calculating circuit , as in the case of the first embodiment , a 1 - bit input signal is input to a data holding unit 201 having a ram or shift register . this data holding unit 201 reads two data and sends the two data to the two input terminals of a decoder 210 . the decoder 210 then sends an output signal to the select terminal of a selector 220 . a coefficient rom 204 supplies coefficient data to the selector 220 . the selector 220 outputs an output signal to one of the two input terminals of an adder 205 . the adder 205 outputs an output signal to a d - f / f 206 . the output signal of the d - f / f 206 is input to the other input terminal of the adder 205 and a latch circuit 207 . the signal output from the latch circuit 207 is the moving average output signal out . in what follows , the operation in the second embodiment will be explained . 1 - bit data are input sequentially to the data holding unit 201 . the data holding unit 201 holds 22 successive data . as in the first embodiment , the data holding unit 201 reads pairs of data d n and d n + 21 , d n + 1 and d n + 20 , . . . , d n + 10 and d n + 11 as shown in equation ( 3 ). the decoder 210 outputs decode value signals corresponding to the values of the read two data as shown in table 1 . in other words , the decoder 210 outputs a zero signal when the sum of the two input signals is 0 , a through signal when the sum of the two input signals is 1 , and a shift signal when the sum of the two input signals is 2 . fig4 shows an exemplary circuit of the decoder 210 . the decoder 210 has an and circuit , an ex_or circuit , and a nor circuit , to each of which the above - mentioned two input signals are supplied . the and circuit outputs a shift signal . the ex_or circuit outputs a through signal . the nor circuit outputs a zero signal . this can be changed with a logic circuit that satisfied the logic shown in table 1 . the selector 220 , which functions as a coefficient processing unit , operates in response to the decode value signal supplied from the decoder 210 . when the selector 220 receives a zero signal from the decoder 210 , the selector 220 outputs an “ l ” level signal as addition data regardless of the signal supplied from the coefficient rom 204 . when the selector 220 receives a through signal from the decoder 210 , the selector 220 outputs the signal supplied from the coefficient rom 204 as it is . when the selector 220 receives a shift signal from the decoder 210 , the selector 220 shifts upward by 1 bit the signal supplied from the coefficient rom 204 and outputs the shifted signal . fig5 shows an exemplary circuit of the selector 220 . the adder 205 adds the addition result of the cycle immediately before the present cycle held in the d - f / f 206 to the addition data received from the selector 220 and outputs the new addition result to the d - f / f 206 . when the entire addition is over , the latch circuit 207 latches the output signal of the d - f / f 206 based on the latch signal . the output signal from the latch circuit 207 is output as the moving average . thus , the decoder 210 adds up the data inside the parentheses ( ) of equation ( 3 ), that is , pairs of data d n and d n + 21 , d n + 1 and d n + 20 , . . . , d n + 10 and d n + 11 , and outputs a decode value signal that corresponds to the addition result . based on this decode value signal , the coefficient value read by the coefficient rom 204 is processed . this processed coefficient value is cumulated to obtain the moving average . hence , according to the second embodiment , the same advantages as in the first embodiment can be achieved . moreover , since these advantages can be achieved using a simple decoder circuit and a selector circuit without using a multiplier , the area required by the hardware is reduced . fig6 is a block diagram showing a moving average calculating circuit according to the third embodiment of the present invention . in fig6 the same reference numerals are given to the same components that are already used in the second embodiment . the configurations of the decoder 310 , the selector 320 , the adder with carry - in terminal 350 of the moving average calculating circuit of the third embodiment differ from the configurations of corresponding ones of the second embodiment . the output signal from the decoder 310 is input to the selector 320 and the carry - in signal terminal ci of the adder with carry - in terminal 350 . the same two data are read by the decoder 310 as in the second embodiment . this decoder 310 performs the decoding operation shown in table 2 . the decoder 310 then outputs the result of the decoding as a select signal to the carry - in terminal ci of the adder with carry - in terminal 350 . for example , when the sum of d n and d n + 21 input to the decoder 310 is 0 , the decoder 310 outputs a minus signal . when the sum of d n and d n + 21 input to the decoder 310 is 1 , the decoder 310 outputs a zero signal . when the sum of d n and d n + 21 input to the decoder 310 is 10 , the decoder 310 outputs a through signal . when the selector 320 receives a minus signal from the decoder 310 , the selector 320 outputs a signal inverting the polarity of the signal received from the coefficient rom 204 . when the selector 320 receives a zero signal from the decoder 310 , the selector 320 outputs an “ l ” level signal regardless of the signal received from the coefficient rom 204 . when the selector 320 receives a through signal from the decoder 310 , the selector 320 outputs the signal received from the coefficient rom 204 as it is . only when the decoder 310 outputs a minus signal , the decoder 310 outputs an “ h ” level signal to the adder with carry - in terminal 350 . in all the other case , the decoder 310 outputs an “ l ” level signal to the adder with carry - in terminal 350 . in general , 1 - bit data output from the δσ system a / d converter is binary level data having “ h ” or “ l ” value . data of complement form of 2 is used in the calculation in the block after the moving average filter . in the circuit of the second embodiment , a conversion block is required after the moving average block for converting a binary level signal into data of complement form of 2 . however , by using the decoder 310 of the third embodiment , a binary level signal can be converted into data of complement form of 2 in the moving average block simultaneously . in other words , the coefficient value is added when the sum of the values inside the parenthesis ( ) of equation ( 3 ) is 10 , the coefficient value is not added when the sum of the values inside the parenthesis ( ) of equation ( 3 ) is 1 , and the coefficient value is subtracted when the sum of the values inside the parenthesis ( ) of equation ( 3 ) is 0 . in this way , the binary level signal can be converted into data of complement form of 2 whose output value has a sign . thus , by performing the operation using the decoder , processing the coefficient value based on the result of the operation , and cumulating the results of the addition , the moving average can be calculated . fig7 is a circuit diagram of the decoder according to the third embodiment of the present invention . fig8 is a circuit diagram of the selector according to the third embodiment of the present invention . hence , according to the third embodiment of the present invention , the same advantages can be achieved as in the first and second embodiments . moreover , since the converter for converting a binary level signal into data of complement form of 2 is used in the third embodiment , the area occupied by the hardware can be further reduced .	7
this invention involves combining polymerase chain reaction ( pcr ) with genetic sequencing to produce a genentic sequence unique to an individual organism , amplifying dna material using universal fungal primers and pcr techniques , transferring the amplified product into e coli cells and identifying the presence of the various fungi types using genetic sequencing methods , cloning amplified dna material into a host bacteria , culturing the host bacteria , harvesting dna material from the host bacteria and producing genetic sequences from the harvested dna material . by sequencing the pcr amplicon from numerous different organisms and developing a database , this procedure can plug environmental sequences into the database for positive identification of limitless fungal organisms . this method has the resolving power to accurately identify organisms at the species level based on the nucleic acid sequence of their ribosomal genes . other technologies utilize small stretches of nucleic acid sequence for probe binding , but this methodology is based on the sequence of the entire pcr amplified site . described herein is a multiplex pcr coupled to cloning and sequencing of the cloned insert that has been developed and optimized . this method as exemplified provides means for identifying four organisms via analysis of the ribosomal dna sequence . however , the methods of the invention are suitable for identification of many other fungal organisms from a single environmental sample . the object of this design is to optimize a fungal screen capable of identifying numerous medically relevant indoor contaminants . the organisms ( penicillium purpurogenum , stachybotrys chartarum , aspergillus sydowii , and cladosporium cladosporioides ) were all chosen based on their prevalence in buildings contaminated with fungal growth . research has shown that these organisms can serve as signature species for evaluating indoor environments . prior to multiplex reactions each organism was subjected to individual pcr to ensure that sufficient amplification was obtained with little or no spurious product formation and to confirm that the correct sequence was being amplified . primers its - 1 and its - 4 were used to generate amplified ribosomal fragments . these primers amplify from the 18s ribosomal rna gene , through the internal transcribed spacer 1 , 5 . 8s ribosomal rna gene , internal transcribed spacer 2 , and into the 28s ribosomal rna gene . all of the fungal strains that were used amplified successfully producing a single pcr product of the desired length , approximately 550 - 600 base pairs . the resultant pcr products were very clean and did not require additional purification prior to cloning and transformation . additional sequence analysis was carried out with a thorough search of ncbi ( national center for biotechnology information ) followed by alignment and analysis with bioedit software confirming that the proper fragments were being amplified and that the sequences corresponded to the organisms being used in this analysis ( table 1 ). aspergillus sydowii , cladosporium cladosporioides , and stachybotrys chartarum were all kindly provided by research triangle institute ( rti ). all of the organisms provided by rti were environmental isolates obtained from environmental dust samples from houses in cleveland , ohio . penicillium purpurogenum was kindly provided by steve vesper from epa / ord / nerl . it was also isolated from environmental dust samples from houses in cleveland , ohio . all fungal organisms were grown on sabouraud dextrose agar ( sda ) plates . plates were prepared according to the suppliers instructions . each organism was plated and grown to confluence on three different sda plates in preparation for spore harvest . organisms were allowed to grow for at least 10 days prior to spore harvest . spores were harvested as previously reported ( dean , t . r ., betancourt , d ., menetrez , m . y ., ( 2004 ) a rapid dna extraction method for pcr identification of fungal indoor air contaminants . j microbiol methods . 56 : 431 - 434 ; crow , s . a ., ahearn , d . g ., noble , j . a ., moyenuddin , m ., price , d . l ., ( 1994 ) microbial ecology of buildings : effects of fungi on indoor air quality . amer . environ . laboratory . 2 : 16 - 18 ). spores were harvested from plates with 3 ml of 0 . 01 m phosphate buffer with 0 . 05 % ( v / v ) tween 20 ( sigma chemical , st . louis , mo ., usa ) by gently agitating the plate surface with a bent glass rod . the supernatant from the three plates was combined and the spore suspension centrifuged at 12 , 000 × g for 5 min . the supernatant was then decanted leaving the spore pellet intact . the pellet was washed three times with 10 ml of phosphate buffer and stored at 4 ° c . until needed . the total spore counts were enumerated by direct microscopic counting on a hemacytometer as described by roe et al . ( roe , j . d ., haugland , r . a ., vesper , s . j ., wymer , l . j ., ( 2001 ) quantification of stachybotrys chartarum conidia in indoor dust using real time , fluorescent probe - based detection of pcr products . j . expo . anal . environ . epidemiol . 11 : 12 - 20 ). the spore dna was purified as previously reported ( dean et al ., 2004 , supra ). the spores were mechanically broken open using a bead milling method followed by a phenol : chcl 3 - ethanol precipitation step . for bead milling , 0 . 25 g of acid - washed glass beads ( 212 - 311 μm ) were placed in a 2 ml screw cap conical tube . 200 μl or approximately 10 7 spores were added to the glass beads . the tube was then shaken in a mini bead beater ( biospec products , bartlesville , okla .) for 50 seconds at the maximal rate . the tube was then placed on ice for 1 minute to cool the sample and then shaken a second time . the supernatant was removed from the beads and subjected to a phenol : chcl 3 extraction and an ethanol precipitation ( ausubel , f . m ., brent , r ., kingston , r . e ., moore , d . d ., seidman , j . g ., smith , j . a ., struhl , k ., ( 1994 ) phenol : chloroform extraction , in : current protocols in molecular biology , john wiley & amp ; sons , inc ., new york , pp . 2 . 1 . 1 - 2 . 1 . 3 ) following precipitation the samples were stored at minus 20 ec until needed . pcr reactions were carried out using forward primer its - 1 ( 5 ′ tccgtaggtgaacctgcgg 3 ′) ( seq . id no . 1 ) and reverse primer its - 4 ( 5 ′ tcctccgcttattgatatgc 3 ′) ( seq . id no . 2 ). these primers are considered universal fungal primers and have been shown to amplify the organisms used in this study . initial pcr optimization consisted of obtaining amplification of each target gene under individual reaction conditions ( table 2 ). these conditions resulted in the exact conditions written below . in the end , each pcr reaction contained : 0 . 2 mm each dntp , 1 . 5 mm mgcl2 , 1 . 5 u platinum taq dna polymerase , buffer ( 50 mm kcl , 10 mm tris - hcl , ph 9 . 0 at 25 ec , 0 . 1 % triton x - 100 ), and variable template concentrations . pcr was performed for 35 cycles of 96 ec 30 sec ; 50ec 15 sec ; and 68ec 2 min . the pcr products were separated by electrophoresis in 2 % low melting point agarose , and visualized by ethidium bromide staining . to confirm that the proper ribosomal sequences were being amplified , each pcr product was sequenced using an abi 3100 genetic analyzer with the output sequences analyzed for accuracy . plasmids were constructed and escherichia coli dh5α were transformed using the topo ta cloning system ( invitrogen life technologies , carlsbad , calif .). reactions were carried out following the manufacturer &# 39 ; s protocols . briefly , 1 μl of the pcr reaction was combined with 3 μl dh 2 o , 1 μl invitrogen salt solution , and 1 μl topo vector . the constituents were gently mixed and incubated at room temperature for 10 minutes . following incubation , 2 μl of the reaction mixture was added to 1 vial of one shot cells for transformation . following gentle mixing the reaction was placed on ice for 30 minutes , followed by a heat shock for 30 seconds at 42 ec . following heat shock , 250 μl of soc media were added to the reaction mixture , mixed gently and incubated at 37 ec for 1 hour at 200 rpm . after incubation 10 μl or 50 μl was plated onto luria - bertani media ( lb media ) containing 50 μg / ml kanamycin and 40 μl of 40 mg / ml x - gal in dimethyl formamide . plates were incubated overnight at 37 ec . following incubation white colonies were chosen and transferred to lb broth containing 50 μg / ml kanamycin and grown overnight for plasmid harvest . plasmids were harvested using the qiaprep spin miniprep system following the manufacturer &# 39 ; s protocols ( qiagen , inc . valencia , calif .). genetic sequencing of the amplified ribosomal sequences was carried out utilizing the big dye terminator system ( applied biosystems , foster city , calif .). to ensure that the entire amplified fragment was accurately sequenced , m13 forward ( 5 ′ gtaaaacgacggccag 3 ′) ( seq . id no . 3 ) and reverse ( 5 ′ caggaaacagctatgac 3 ′) ( seq . id no . 4 ) primers were used . these primers anneal to locations on the plasmid directly upstream and downstream of the cloning site . briefly , 1 μl of forward or reverse primer was combined with 4 μl dh 2 o , 5 μl plasmid template , and 4 μl big dye terminator ready reaction mixture and cycled through the same pcr regimen cited above except that only 25 cycles of replication were necessary . following removal of dye terminators ( micro bio - spin p - 30 spin columns bio - rad laboratories , hercules , calif .) samples were analyzed on an abi 3100 genetic analyzer ( applied biosystems , foster city , calif .) utilizing abi sequencing analysis software version 3 . 7 . pieces of gypsum wallboard were cut into coupons measuring 1 . 5 ″× 3 . 0 ″× 0 . 25 ″. in order to make the coupons suitable for fungal growth each piece was wetted with 10 ml sterilized dh 2 o . after allowing the dh 2 o to soak into the wallboard , 400 μl of 0 . 01 m phosphate buffer with 0 . 05 % ( v / v ) tween 20 ( sigma chemical , st . louis , mo ., usa ) containing 10 6 spores of each penicillium purpurogenum , stachybotrys chartarum , aspergillus sydowii , and cladosporium cladosporioides was pipetted into the center of the coupon . the spores were then allowed to grow for 3 weeks at room temperature and 100 % relative humidity . fungal spores were harvested from the wallboard coupons via mastication and washing . dna extraction and all subsequent enzymatic manipulations , cloning and sequencing were completed exactly as described as above . multiplex pcr reactions were carried out using the exact conditions outlined for successful single pcr reactions . using the primers and pcr conditions as described herein gave best results for single reaction / multiplex reactions listed in this section . if individual reactions are carried out using the above conditions amplification will be optimal . the only variables that were adjusted were the template concentrations and the concentration of taq polymerase . due to the varying size of the resultant pcr products it was possible to qualitatively judge the presence of all 4 organisms within a multiplex reaction prior to cloning and subsequent sequencing . these variations in size are the result of base deletions and substitutions throughout the amplified region . when observed on an agarose gel following electrophoresis the differences in size / mobility allow for a qualitative judgment . these sequence lengths are noted in table 2 . due to different amplification efficiencies the template concentrations were important variables in generating all 4 fragments in a single reaction . a . sydowii seemed to amplify with the greatest efficiency and required the greatest dilution down to the equivalent of 10 4 spores per reaction . c . cladosporioides and p . purpurogenum both generated good product amplification at 10 5 spores per reaction . s . chartarum seemed to amplify with the least efficiency . it was found that 10 6 spores per reaction were required for sufficient product generation in the presence of the other organisms . it is also possible that differences in ribosomal dna copy number impact amplification from the different organisms allowing certain organisms to out compete other members in the same reaction . shifting from single pcr to multiplex pcr reactions also required an increase in the concentration of taq polymerase necessary for robust product generation ( data not shown ). individual reactions required 0 . 75 units of taq polymerase for amplification , while multiplex reactions required 1 . 5 units of taq polymerase for robust product generation of all 4 reaction templates . this increase is most likely due to the increase in the amount of total template and the competition generated between these different template copies . individual pcr reactions were cloned into the topo ta cloning system and subsequently sequenced to ensure that each organism was amenable to the procedure . initial sequencing reactions using either its - 1 or its - 4 produced usable sequence data . however , while the middle of the sequence read was very robust , both the 5 ′ and 3 ′ ends of the fragment decreased in sequencing efficiency . to compensate for the decrease in efficiency at the ends of the sequence all cloned products were sequenced using both the m13 forward and reverse primers . these primers anneal outside of the cloning site and allowed for accurate base calls throughout the entire cloned fragment . this increase in sequencing efficiency allowed for unambiguous species identification to be made with each organism based on sequence data . multiplex reactions were completed and cloned into the plasmid vector . the goal was to obtain sequence data for all 4 organisms by analyzing 10 % or less of the white ( transformed ) colonies . table 3 clearly shows the differences that occurred when different concentrations of initial template were used . when each organism was present in the multiplex reaction at 10 5 spores it was possible to identify all 4 fungal species based on the resultant sequence data . however , the distribution was heavily skewed toward a . sydowii , which was present in 11 of 18 clones . by adjusting the initial concentrations of template for each of the organisms it was possible to generate a fairly even distribution of clones ( table 3 ). in order to test this methodology in a real world application small pieces of gypsum wall board were wetted with dh 2 o and inoculated with 10 6 of each penicillium purpurogenum , stachybotrys chartarum , aspergillus sydowii , and cladosporium cladosporioides . after allowing the fungi to grow on the wallboard for a 3 week period , it was visually observed that the surface was completely covered with fungal growth . due to the morphological characteristics of the fungal growth it was visually determined that s . chartarum was the dominant species present . it was at this point that the spores were harvested from the building material and subjected to sequencing analysis . previously it was shown that a very successful method of extracting fungal material from building materials ( wallboard , ceiling tile , etc .) is the use of a masticator blender . due to the visual growth characteristics noted above , following fungal extraction from the gypsum board a microscopic comparison was made of the spores . this comparison confirmed that the predominant spore present in the mixture was stachybotrys . this was not a surprising result because the environmental conditions in which the spores were allowed to grow ( heavy initial wetting and 100 % relative humidity ) favored stachybotrys . sequencing analysis involved comparison between published sequences and sequences derived from the experiments and also showed that the predominant species extracted from the gypsum board was stachybotrys chartarum . s . chartarum accounted for 17 of the 20 clones analyzed , while a . sydowii accounted for 2 clones and c . cladosporioides accounted for a single clone . p . purpurogenum did not show up in the analysis . it is believed that more natural growth conditions with varying levels of relative humidity and wetting would result in a more representative fungal culture , however , the identification of both a . sydowii and c . cladosporioides , as under - represented members of the fungal culture , clearly shows that the resolving power of the methodology is sufficient to give an accurate fungal contaminant screen in the indoor environment . the upside of this method is the potential to identify unlimited numbers of organisms , positive identifications being limited by the number of clones analyzed . this application in fungal screening in the indoor built environment may also be used for air sampling as well as surface analysis allowing for a more complete picture of the level of contamination in an indoor space .	2
to carry out the invention it is possible to apply a metal strip directly to the glass wall of the discharge tube , for example , by chemical plating or evaporating . such an arrangement is shown in fig1 where a gas - discharge tube 21 has an electrode 22 applied directly to its glass wall 21a . in accordance with the invention the electrode 22 is connected to earth by way of a reactance 23 . the application of the electrode to the tube wall in this manner , however , is often inconvenient and / or expensive and it is therefore usually preferred to employ wire or metal strip of the kind described above which can readily be applied to the tube after this has been formed into the desired shape . fig2 shows such an arrangement , in which there is applied to the glass wall 31a of the gas - discharge tube 31 a metal strip 32 which forms the electrode and is secured to the tube wall by the pressure - sensitive adhesive 33 carried on one of its surfaces . this strip is advantageously 3 mm wide , because strip of this width is strong enough for easy handling while not providing an excessive capacitance . this electrode is earthed by way of a reactance 34 . it is however possible to employ the invention when using an external electrode spaced from the wall of the discharge tube , if for some reason this is advantageous . fig3 shows one embodiment , in which a gas - discharge tube 41 , shown by way of example only as being of inverted - l shape , between internal electrodes 41a , 41b of which a progressively varying voltage is arranged to be applied from a voltage generator 50 . it is assumed that tube 41 has a length greater than that which is appropriately provided with a single , reactance - earthed external electrode , and therefore a two - part external electrode is applied , consisting of metal strips 42a , 42b applied as described in relation to fig1 or 2 to the tube and connected to earth by way of respective reactances , in this case capacitors 43 , 44 , which are preferably of the low ionisation type . as has been stated , either or each of capacitors 43 , 44 may be replaced by an inductor 45 of appropriate reactance , though the greater cost thus involved makes the use of capacitors usually preferable . fig4 shows another embodiment of apparatus in accordance with the invention in which two gas - discharge tubes 51 , 52 are energised in series from a voltage source 60 . tube 51 has electrodes at each end , of which one , electrode 51a is connected to voltage source 60 , while the other electrode 51b is connected to one internal electrode 52a of the second gas - discharge tube 52 , the other internal electrode 52b of which is earthed . each of tubes 51 , 52 carries an external electrode , 53 , 54 respectively which may be applied as described with reference to fig1 or 2 . each of electrodes 53 , 54 is connected to earth through a respective reactance , preferably capacitor 55 , 56 , as shown . as already stated , capacitors 55 , 56 may be replaced by inductors 57 , 58 of appropriate reactance if preferred . since the amplitude of the h . f . voltage at the advancing end of the discharge column remains at a constant low level as the said end progresses along the length of the tube , while that at the stationary end is increasing with the applied voltage , it follows that the difference in current density , and therefore in brightness , at opposite ends of the column , increases with the length of tube operated . this undesirable effect is the more marked if the current density along the column is allowed to increase along a constant gradient , as in the spaced wire system , where a single earthed wire along the length of the tube acts as the external electrode . however , owing to the non - linear response of the eye to changes in light intensity , this effect is not readily perceptible , provided that the length of tube operated is less than about 15 ft ., and that the &# 34 ; writing &# 34 ; speed is not unduly slow . but if the said length is exceeded , the effect can become objectionable due to excessive current density along portions of the discharge column adjacent to its stationary end . the present invention enables the said effect to be minimised ( a ) by using wire or strip as appropriate for the respective discrete electrodes , ( b ) by the choice of capacitors of appropriate value for the respective discrete electrodes , and ( c ) by employing a high - frequency generator the frequency of which decreases significantly fron low load to full load . thus in a typical embodiment of the invention comprising 31 ft . of tubing consisting of four neon - filled tubes 11 / 12 mm diameter , tube 1 6 ft . long , has one external wire electrode 0 . 015 &# 34 ; diameter , with a 100 pfd . capacitor in its earth - return lead , tube 2 , 9 ft . long , has one wire electrode 4 ft . long , and one metal strip electrode 3 mm wide , 5 ft . long , each with a 100 pfd capacitor in its return lead , tube 3 , 91 / 2 ft . long , has two metal electrodes , each 41 / 2 ft . long and each with a 200 pfd capacitor in its return lead , and tube 4 , 7 ft . long has one metal strip electrode 7 ft . long connected to its second internal electrode , which is earthed . the operating frequency of the h . f . generator employed decreases from about 11 khz when &# 34 ; writing &# 34 ; tube 1 to about 5 khz when tube 4 has been fully written out . while tube 1 is being &# 34 ; written &# 34 ; at 11 khz the reactance of its associated capacitor is correspondingly low , yielding adequate tube current . but at 5 khz when tube 4 is fully lit , the reactance of the said capacitor is correspondingly high , so that that part of the current in tube 1 , flowing via the said capacitor , is correspondingly low . the changing frequency produces similar changes in the current passed by tubes 2 , 3 and 4 respectively . this effect , in conjunction with the use of wire followed by strip , and of capacitors of increasing value in the order given above , makes for greater brightness along portions of the column near its advancing end , while preventing an excessive light intensity gradient along the column . when the discharge has extended to the earthed electrode of tube 4 , additional current flows which , distinct from the largely capacitive currents flowing during the &# 34 ; writing &# 34 ; action , is in phase with the applied voltage . the oscillator used , employed a cr timing circuit , and provided an output of which the amplitude was arranged to vary from 200v rms to 4500v rms . the said range of operating frequency is far removed from radio broadcast frequencies and , moreover , as the electric field between the discharge column and the external electrode is to a large extent confined to the glass wall of the tube which alone separates them , radio interference from the discharge is confined to the required levels . in embodiments of the invention difficulties in obtaining a smoothly progressive extension of the luminous discharge along the length of the tube are overcome by providing an associated electrode in very close proximity to the tube wall so that it may follow exactly all convolutions and doublings of tube , and by dividing this electrode into sections each of which is earthed through a respective impedance . in all embodiments of the invention a gas - discharge tube includes spaced - apart internal electrodes between which a progressively varying high - frequency voltage is applied from an appropriate generator and at least one external electrode connected to the generator through an impedance , preferably a reactive impedance .	7
the present invention is based on the idea that organizations and knowledge workers would be more efficient in their digital work flow with a holistic architecture that applies metadata to each digital file entered into the system , which can then be controlled in a precise manner through layering of modules to optimize the quality and quantity of digital work produced and consumed , thus providing a method for managing knowledge yield for individuals , groups , and organizations . the following discussion is intended to provide a brief description of an organization &# 39 ; s computing work environment in which the invention may be implemented in the preferred manner . it should be understood , however , that wireless , portable and other computing devices are contemplated for use in connection with the present invention . it is further contemplated that the present invention could be employed in a public version accessible within the internet and world wide web , a private version within an intranet or extranet , or some combination thereof . therefore , the description the embodiments that follow is for the purpose of illustration and not limitation . the knowledge worker in the modern computer work environment experiences high volumes of incoming disparate data from multiple sources and networks , which can then be viewed in one or more computing devices ( not shown ). fig1 depicts the process for dataflow through the invention system , which includes unstructured data 1 , heterogeneous metadata 2 , member original work 3 , and member messaging 4 , which could be unstructured or structured , or some combination thereof . each individual member subscribed to the system is provided a software module 5 that is used in conjunction with a computing device in part to input metadata describing the relationships , attributes , and values of each file entered into the system . each file processed for entity disambiguation 6 , which can scan the file for pre - existing metadata in languages such as rdf or owl for example , before indexing into the knowledge base 7 . by attaching a detailed metadata wrapper to each system file 5 , and processing to disambiguate the entity 6 for semantic reduction , the system knowledge base is indexed 7 for high value returns in querying and inference 8 of the databases , which then returns metadata descriptions and network links to be displayed 9 in the module , browser , or other viewer for retrieval , consumption , and application of additional metadata if deemed of value by the member . fig2 illustrates the modular system architecture from the execution of the pre - deployment survey 10 , which is the method of obtaining and inputting into the system specific data on the subject organization &# 39 ; s operational , regulatory , and technical restrictions , which provides the initial default settings in the cko module 11 . in the preferred method , the cko module is the tool by which organization management sets the system security parameters , administrative permissions , and mandatory messaging for the system , including for the business group modules 12 . each business group module 12 is the preferred method for further defining the quality and quantity of data according to the group objective for each individual module 13 , which includes components for each member to further tailor their information consumption , manage the data flow relating to their work projects , review their performance metrics , and view their system ratings . fig3 displays a screen capture of the cko module , which allows the administrator to create additional modules 14 with the action options of new , edit , store , or rename 15 , select type of module 16 , and select administrators from the system administrator database ( not shown ). in addition to managing system - wide mandatory messengers 18 , the cko module is used to create and manage system - wide courses by topic , pre - determined maximum volume 19 , and minimum quality 20 , exemplified as 1 being the lowest value and 10 being the highest . the course delivery time and date 21 is an option that reduces the common bandwidth bottleneck problem in large data networks . the mandatory 22 selection is made available for regulatory and other essential messaging . fig4 is a screen capture of a business group module , which is created with the cko module ( 14 ), exemplified herein in simple generic form , sharing the same functions as the parent module , with the exceptions , however , of optimizing courses for the specific business group objectives 23 , such as country cultural relations 24 , and has the ability to edit specific individual subscribers for each course 25 . fig5 is a screen capture of a generic module provided to each individual member within the system . the individual consumption module can be created with either the cko module ( fig3 ) or the business group module ( fig4 ). similarly to the parent module , the individual module can be used to create courses 26 with the same ability to manage volume 27 and quality 28 . additionally , however , under messaging settings the individual can increase or decrease both volume 29 and quality 30 by percentages . with the advanced settings object 31 , system members can change delivery settings , compare their metrics ( 35 ) and ratings ( 44 ), compare their metrics to system averages , request expert review of their performance , and review recommendations . the approval options in object 32 provides for transferring existing networks into the member &# 39 ; s approved database , ability to create a new database , or allow only approved system partners for the most restricted option . distribution options 33 for member messaging include the approved devices in the pre - deployment survey 10 , which can be restricted to a single device , all approved devices , or any combination thereof , to include file types in object 34 , thus allowing the member to adapt the system to each individual &# 39 ; s changing work patterns and tool selection . fig6 is a screen capture of the individual performance metrics by activity 35 and by project 41 for a hypothetical system member . the metrics for each activity displayed include hours weekly 36 , portion of total work 37 , weekly volume 38 , average rating 39 , and the system quotient 40 , which is a proprietary formula and trade secret ( not shown ). the accuracy of the metrics in part is dependent upon the specific software programs used by the subject such as email and word processing , for example , and whether the actual data can be integrated . an automated estimate based on system data may be implemented if actual data is unavailable . in the preferred embodiment , the metrics are visually displayed in color code 42 , highlighting areas needing improvement or deserving recognition , thus providing the option to input into an organizational compensation database or worker training courses . fig7 is a screen capture of the ratings for a hypothetical system member , as displayed in the individual module , device viewer , or browser . the member &# 39 ; s original work products 44 are shown as rated 43 by those selected with the individual and parent modules , exemplified here in the preferred embodiment as work groups , peers , master reviewers , and self assessment . in the fig7 example , simple averaging is employed . however , it is expected that subject organizations will employ pre - existing or new ratings formulas , which is reflected in the system adaptability . fig8 is a screen capture of the individual project module for a hypothetical system member . when the individual member proposes a new project 48 , the administrator of the parent modules are automatically messaged seeking their approval . upon approval , the role 46 of the individual is displayed which determines whether the member and module is authorized to only view the project files , or edit the project &# 39 ; s scope , tasks , members , and schedule . similar to other metadata files input into the system , project files are also rated 47 for the purpose of improving performance and knowledge yield . the present invention consists of a new system inclusive of a holistic architectural method in managing the persistent duel problems of information overload combined with the disincentives for the sharing of original work in the modern computerized workplace environment . it should be evident to those skilled in the art that the programming required to operate the system and method described herein is platform and device independent in scope and spirit , and could be applied in any modern computer network .	6
reference will now be made in detail to the embodiments of the present disclosure , examples of which are illustrated in the accompanying drawings . these embodiments introduced hereinafter are provided as examples in order to convey their spirits to the ordinary skilled person in the art . therefore , these embodiments might be embodied in a different shape , so are not limited to these embodiments described here . also , the size and thickness of the device might be expressed to be exaggerated for the sake of convenience in the drawings . wherever possible , the same reference numbers will be used throughout this disclosure including the drawings to refer to the same or like parts . fig1 is a cross - sectional view showing a unit pixel included in an lcd device . referring to fig1 , an lcd device includes upper and lower substrate 120 and 130 facing each other , and a liquid crystal layer 150 interposed between the upper and lower substrates 120 and 130 . the upper substrate 120 includes a plurality of color filters formed on it . the lower substrate 130 includes thin film transistor array formed on it . although it is not fully shown in the drawings , the lower substrate 130 includes a gate electrode 132 which is formed as an extension from a gate line ( not shown ) on a first transparent substrate 110 . the lower substrate 130 further includes a gate insulation film 115 formed on the entire surface of the first transparent substrate 110 which is loaded with the gate electrode 132 . a source electrode 136 and a drain electrode 138 are formed to be separated in a fixed distance from each other on the gate insulation film 115 . the source and drain electrodes 136 and 138 are arranged to partially overlap with the gate electrode 132 . the source electrode 136 extends from a data line ( not shown ) which defines a pixel region p by crossing the gate line 132 . also , a semiconductor layer 133 and an ohmic contact layer 134 are formed between the gate electrode 132 and the source / drain electrodes 136 and 138 , as a channel region . these gate electrode 132 , semiconductor layer 133 , ohmic contact layer 134 , and source / drain electrodes 136 and 138 configure a thin film transistor t . a passivation film ( or a protective film ) 145 is formed on the entire surface of the first transparent substrate with the source / drain electrodes 136 and 138 . the passivation layer 145 includes a contact hole ch 1 partially exposing the drain electrode 138 . also , a pixel electrode 140 contacting the drain electrode 138 through the contact hole ch 1 is formed on the passivation layer 145 . thereafter , a lower alignment film 148 controlling an alignment direction of liquid crystal is formed on the entire surface of the passivation layer 145 loaded with the pixel electrode 140 . the upper substrate 120 includes a black matrix 122 , and red , green , and blue color filters 124 which are formed on a second transparent substrate 10 . the black matrix 122 blocks off light in non - display regions . the red , green , and blue color filters 124 are arranged opposite to display regions . to rectify this , the black matrix 122 is positioned on the boundary regions between the color filters 124 . also , a common electrode 126 and an upper alignment film 149 are sequentially formed on the red , green , and blue color filters 124 . the upper alignment film 149 on the common electrode 126 faces the lower alignment film 148 . a light irradiation apparatus for photo - processing the upper and lower alignment films 148 and 149 of an lcd device will now be explained in detail referring to fig3 and 4 . fig2 is a schematic diagram showing the configuration of a light irradiation apparatus according to a first embodiment of the present disclosure . fig3 is a data sheet representing a uv light spectrum of a light irradiation apparatus with a filter according to a first embodiment of the present disclosure . as shown in fig2 , a light irradiation apparatus according to a first embodiment of the present disclosure is configured to include a light source 170 , a convergent unit 171 , a lens 173 , a polarizer 175 , a filter 177 , and a collimator 179 . the light source 170 is configured to generate uv light . the convergent unit 171 is configured to converge the uv light emitted from the light source 170 in one direction . the lens 173 is configured to diffuse and converge the uv light generated in the light source 170 . the polarizer 175 is configured to polarize the uv light from the lens 173 . the filter 177 is configured to pass a specific wavelength band of lights among a board wavelength band of lights from the polarizer 175 through it . the collimator 179 is configured to guide the light from the filter 177 toward a substrate 100 . the polarizer 175 is configured to include a plurality of quartz plates 176 . for example , the polarizer 175 can include 4 quartz plates 176 , in order to polarize non - polarized light to pass through it . the non - polarized light supplied to the polarizer 175 has a brewster &# 39 ; s angle b . the non - polarized light is partially reflected by and permeated through the polarizer 175 , so that polarized light is irradiated onto an alignment film formed on the substrate 100 . the brewster &# 39 ; s angle b depends on an inclination angle which is defined by the inclined quartz plate 176 and a horizontal line . also , the polarizer 175 can have a fixed polarization ratio p which corresponds to a ratio of the polarized light to a sum of the polarized light and the non - polarized light , as the following equation 1 . in the equation 1 , “ p ” is the polarization ratio , “ ip ” is an amount of polarized light , and “ iu ” is an amount of non - polarized light . in accordance therewith , when the polarization ratio is “ 0 ”, light from the polarizer 175 becomes non - polarized light . on the contrary , if the polarization ratio has a value of “ 1 ”, light from the polarizer 175 becomes polarized light . the filter 177 passes a specific wavelength band ( or a specific spectrum ) of light among a board wavelength band ( or a board spectrum ) of light through it . more specifically , the filter 177 included in a first embodiment of the present disclosure eliminates a short wavelength band of light inducing a rejection reaction which generates a carboxylic acid . to rectify this , the filter 177 blocks off the short wavelength band of light below an effective wavelength band ( or an effective spectrum ) which is used in a photo alignment , in order to suppress the rejection reaction . therefore , the filter is preferably configured to include a high pass filter eliminating the short wavelength band of light , for example , lights having wavelengths below 250 nm . although the high pass filter is explained to eliminate lights of the wavelengths below 250 nm , the filter included in a first embodiment is not limited to this . the wavelength band of light to be eliminated by the high pass filter can be changed by the desired specification . moreover , the filter 177 can be configured to further include a low pass filter eliminating lights of wavelengths above the effective wavelength band , for example , above 300 nm . the wavelength band of light to be eliminated by the low pass filter can also be changed by the desired specification . in this case , the filter 177 of the first embodiment enables only a specific wavelength band of light ( i . e ., wavelength lights of 250 nm ˜ 300 nm corresponding to the effective wavelength band of light ) being filtering by the high and low pass filters to be irradiated onto the substrate 100 . in this manner , the light irradiation apparatus according to a first embodiment of the present disclosure eliminates either only the short wavelength band ( i . e ., below 250 nm ) of light , or the long wavelength band ( i . e ., above 300 nm ) of light and the short wavelength band ( i . e ., below 250 nm ) of light , among the board wavelength band of light generated in its light source , using the filter 177 . as such , the light irradiation apparatus can suppress the generation of a carboxylic acid due to the rejection reaction such as a photo oxidation reaction . therefore , it can prevent the generation of residual images on the lcd device . fig4 is a data sheet representing a light spectrum of a light source included into a light irradiation apparatus according to a second embodiment of the present disclosure . fig5 is a data sheet representing a photo alignment time by a light irradiation apparatus with a light source having the light spectrum of fig4 . a light irradiation apparatus according to a second embodiment of the present disclosure includes a specific light source ( or a specific lamp ) largely generating an effective wavelength band of light for a photo alignment . the specific light source ( or a specific lamp ) may be selected from a variety of uv light sources ( or lamps ) through a process of analyzing the light spectrum of the uv light sources shown in fig4 and 5 . the light spectrum of a first lamp a represents relatively low peak values within the effective wavelength band of 200 nm ˜ 330 nm . on the other hand , the light spectrum of a second lamp b represents relatively high peak values within the effective wavelength band of 200 nm ˜ 330 nm . in other word , the second lamp b generates more of the effective wavelength band light , but the first lamp a generates less of the effective wavelength band light . moreover , it is evident that the second lamp b has an anisotropic reaching speed five times ˜ several hundred times faster than that of the first lamp a in a photo alignment process . in other words , the light irradiation apparatus according to a second embodiment of present disclosure uses the lamp ( or light source ) generating more of the effective spectrum light ( i . e ., the effective wavelength band light of about 200 nm ˜ 330 nm ). as such , the light irradiation apparatus enables the photo alignment speed to become faster , so that the manufacturing time of an alignment film is reduced . also , the light irradiation apparatus suppresses the generation of a carboxylic acid caused by the rejection reaction , thereby preventing the generation of residual images on an lcd device . fig6 is a data sheet representing an anisotropic reaching time of an alignment material along with the extinction ratio of a polarizing portion included in a light irradiation apparatus according to a third embodiment of the present disclosure . a light irradiation apparatus according to a third embodiment of the present disclosure employs a polarizer with an adjusted extinction ratio , in order to reduce the anisotropic reaching time of a previously selected alignment material . more specifically , the light irradiation apparatus of the third embodiment controls an extinction ratio of polarized light to be output from the polarizer ( 175 in fig2 ). to rectify this , the light irradiation apparatus adjusts a ratio of p - polarized light to s - polarized light . the data sheet represents the simulated data of an anisotropic reaching time when the extinction ratio ( i . e ., the ratio of p - polarized light to s - polarized light ) is set up to a range of about 34 : 1 ˜ 20 : 1 . if a target has the same anisotropy as the alignment material , the polarizer adjusted at the extinction ratio of 34 : 1 can reduce the anisotropic reaching time rather than that adjusted at the extinction ratio of 20 : 1 . in other words , the light irradiation apparatus of the third embodiment can decrease the photo alignment time by enlarging the ratio of p - polarized light to s - polarized light . the extinction ratio of the polarizer can be adjusted in accordance with the kind of alignment materials . therefore , the extinction ratio of the polarizer can be established within a range of 200 : 1 ˜ 3 : 1 , even though the extinction ration of the polarizer is explained to be set in a range of 34 : 1 ˜ 20 : 1 . in this way , the light irradiation apparatus according to a third embodiment of the present disclosure controls the extinction ratio ( the ratio of p - polarized light to s - polarized light ), thereby decreasing the anisotropic reaching time of the alignment material using a previously selected target . as such , the manufacturing time of the alignment film can be reduced . also , the reduction of the manufacturing time suppresses the generation of carboxylic acids caused by the rejection reaction . as a result , the generation of residual images in an lcd device with the alignment film can be prevented . as described above , the light irradiation apparatuses according to three embodiments of the present disclosure block off a specific wavelength band of uv light , use a light source generating more of an effective spectrum ( or an effective wavelength band ) of light , or control an extinction ratio ( a ratio of p - polarized light to s - polarized light ). therefore , a manufacturing time of the alignment film is reduced and the generation of carboxylic acids caused by a rejection reaction is suppressed . as a result , the generation of residual images in an lcd device with the alignment films can be prevented . although the present disclosure has been limitedly explained regarding only the embodiments described above , it should be understood by the ordinary skilled person in the art that the present disclosure is not limited to these embodiments , but rather that various changes or modifications thereof are possible without departing from the spirit of the present disclosure . accordingly , the scope of the present disclosure shall be determined only by the appended claims and their equivalents .	6
the detailed illustration according to fig1 illustrates the basic structure of an air filter 1 . in this context , basically any separator which is able to remove aerosols or other undesired suspended particles such as pathogens , pollen , dusts or gases from the air is regarded as an air filter . in its present embodiment , the air filter 1 serves for cleaning the intake air of the otto or diesel engine of a motor vehicle of dust , soot and tyre wear entrained in the air stream , in order to prevent premature wear on valves , cylinder running surfaces , piston rings , slide bearings and other machine parts , and disturbances to the injection of the engine . the structural stability of the air filter 1 is ensured here by means of two end plates 3 , which are provided with reinforcement grids . depending on their expected surface load , further support bodies of metal or plastic , not able to be seen in fig1 , can be arranged between the two end plates 3 . the air - permeable filter body 2 on the basis of a folded filter medium is situated as core component of the air filter 1 between the end plates 3 which are arranged substantially in a surface - parallel manner . the filter medium can be formed from a material web , similar to paper , with cellulose components or from a synthetic non - woven fibre fabric , as is commonly designated in specialist circles as a dry filter . a join connection between body 2 and housing 3 was produced for this for example by way of welding , plasticizing - in , vulcanizing or bonding . the horseshoe shape of the filter body 2 , indicated in fig1 , permits here an entry of non - cleaned external air substantially via the entire edge surface of the air filter 1 encircling the filter body 2 perpendicularly to the housing covers . finally , on a face side of the air filter 1 , facing the observer according to the viewing angle of fig1 , facing away from the u - shaped or horseshoe - shaped curvature of filter body 2 and filter housing 3 , the clean - air port 4 is arranged , held in a form - and force - fitting manner by the filter housing 3 , opening in to a passage surface , said clean - air port being in the form of a short attachment pipe piece , the configuration of which may be regarded as essential to the invention . the passage surface can be embodied in a circular shape or , as illustrated , in an oval shape . in this respect , a first air - flow grid 6 extends diametrically between two inner surfaces of the elliptical clean - air port 4 without , however , covering its entire passage surface . in contrast to the flow cross - section defined by the narrowest point of the clean - air port 4 , the first air - flow grid 6 has here substantially the shape of an elongated rectangle , which nevertheless nestles along its shorter edges up against the convex course of the clean - air port 4 . with regard to the individual meshes of the first air - flow grid 6 , an approximately square shape was selected here , which does not rule out the use of alternative geometries within the scope of the invention — for example , a honeycomb - shaped structure of the meshes of the air - flow grid 6 would come into consideration . the operating principle of the air filter 1 in the context of a superordinate filter module 7 is illustrated by fig2 , which uses a partial sectional illustration for reasons of clarity . however , the filter body 2 , clean - air port 4 and parts of the first air - flow grid 6 of the air filter remain visible , which air filter , on the part of its filter body 2 , is now connected fluidically with an intake opening of the filter module 7 which is not designated further in fig2 . the uniformly curved shaping of the clean - air channel 9 , 10 , 11 deserves particular attention , which supplies the air , filtered by the air filter 1 , to the combustion chamber of an internal combustion engine , not illustrated in fig2 , situated downstream . a flow guide rib 11 , running along the channel 9 , 10 , 11 , divides its flow cross - section here into an inner region 9 ( on the inside of the curve ) and an outer region 10 . although the diagrammatically simplified illustration of fig2 does not reflect this geometry , the flow guide rib 11 passes through the clean - air channel 9 , 10 , 11 for this purpose in its entire height , wherein the first air - flow grid 6 is arranged immediately upstream of the inner region 9 and is supported by a second air - flow grid 5 fastened on the end side in the inner region 9 . the outer region 10 of the clean - air channel 9 , 10 , 11 is kept free of air - flow grids and therefore only offers a small resistance to the air , so that the air pressure in the course of this outer region 10 only drops insignificantly . in fig2 it can be seen in addition that the first air - flow grid 6 extends in cross - section over the entire inner region 9 . in the example which is shown , the first air - flow grid 6 projects over the inner region 9 in cross - section and extends over the flow guide rib 11 into the outer region 10 . hereby , the occurrence of irregularities , in particular of turbulences , in the flow in the marginal regions of the inner region 9 is counteracted . the stabilizing of the cleaned air by the first air - flow grid 6 is therefore improved . here , the outer region 10 extends in cross - section only in certain areas over the outer region 10 . thereby , an improvement to the stabilizing of the air is also achieved . the housing of the filter module has two housing parts which are connected with one another and form the external geometry at least in the region of the clean - air channel . the connection of the housing parts can be embodied detachably or non - detachably . in particular , the housing parts can be welded , screwed or clipped . a possible additional housing cover ( not illustrated ) can close a mounting opening for the filter element in an openable manner , when the housing parts are connected non - detachably with one another . the flow guide rib 11 can be formed onto one of the housing parts and can rest on the opposite housing part . alternatively , each of the housing parts can have a portion of the flow guide rib . the flow guide rib parts then form jointly the flow guide rib . here , no air - tight embodiment of the flow guide rib is necessary . flow guide ribs with a minimal leakage are also conceivable . on the other side of the second air - flow grid 5 in the inner region 9 a mass air flow meter 8 is situated which — according to the operating principle of a thermal anemometer — comprises an electrically heated sensor element , the electrical resistance of which depends definitively on its ambient temperature . by the circulating flow around this sensor element , a heat transmission takes place to the filtered air emerging from the clean - air channel 9 , 10 , 11 , the amount of which alters with the speed of flow . through a continuous resistance measurement of the sensor element of the mass air flow meter 8 , a conclusion can thus be drawn as to the flow speed of the air directed out from the filter module 7 in the direction of the internal combustion engine . the sensor element is constructed here in the form of a film , so that the mass air flow meter 8 is to be assigned the type of construction of the so - called hot film mass air flow meter .	6
fig2 a to fig2 i are cross - sectional views illustrating a printed circuit board with embedded electronic components in accordance with a first embodiment of the present invention . referring to fig2 a , a substrate 200 is provided for forming a first circuit 201 thereon . the substrate 200 , preferably a conductive metal substrate , can be any suitable substrate , such as copper clad laminates or a thin stainless steel alloy plate . the first circuit 201 can be formed using a conventional printed circuit board fabrication process . for example , a dry film is formed over the substrate 200 , and then patterned to expose a portion of the surface of the substrate 200 . thereafter , with the dry film serving as a mask , a material including cu or ni is electroplated on the exposed surface of the substrate 200 . subsequently , removal of the dry film leads to formation of the first circuit 201 . as shown in fig2 b , a thin film 202 is deposited on the substrate 200 . for example , the thin film 202 having an end 202 a connected to the first circuit 201 can be directly formed on the surface of the substrate 200 . the thin film 202 serves a base for forming light emitting diodes ( leds ) thereon subsequently . in one embodiment , an led epitaxial layer grows employing the thin film 202 made of gsas , inp , gap , sapphire , or sic . the thin film 202 may be formed with patterned profile . formation of the thin film 202 can utilize appropriate film deposition and masking techniques , such as conventional sputtering , chemical vapor deposition or screening printing . referring to fig2 c , with the thin film 202 serving as a base , a light emitting structural layer 203 is formed on the substrate 200 using conventional epitaxy and semiconductor deposition techniques . the light emitting structural layer 203 includes several epitaxial layers , such as a first electronic semiconductor layer 204 , a light emitting layer 205 and a second electronic semiconductor layer 206 . for example , the first electronic semiconductor layer 204 can be a n - type epitaxial layer with the formula of ( al x ga l - x ) 0 . 5 in 0 . 5 p , and the light emitting layer 205 can be an undoped epitaxial layer with the formula of ( al x ga l - x ) 0 . 5 in 0 . 5 p , and the second electronic semiconductor layer 206 can be a p - type epitaxial layer with the formula of ( al x ga l - x ) 0 . 5 in 0 . 5 p . an electrical connection between the first electronic semiconductor layer 204 and the first circuit 201 is made through an appropriate relative thickness control for the thin film 202 , the first electronic semiconductor layer 204 and the first circuit 201 . notably , both of the light emitting layer 205 and the second electronic semiconductor layer 206 should be isolated from the first circuit 201 , or the light emitting structural layer 203 may not work . in other embodiments , the light emitting structural layer 203 also includes other functional layers , such as an ohmic contact layer , a barrier layer and a reflective layer . as shown in fig2 d , a dielectric layer 210 is blanketly formed , enclosing the light emitting structural layer 203 and the first circuit 201 . the dielectric layer 210 can be spin on glass , silicon resin , epoxy , polyimide , or prefluorocyclobutane . formation of the dielectric layer 210 can be conducted using a conventional precise coating process . it is noted that the light emitting structural layer 203 has not been packaged prior to formation of the dielectric layer 210 . referring to fig2 e , an appropriate chemical mechanical polishing technique is then employed to remove a portion of the dielectric layer 210 , such that an upper surface 203 a of the light emitting structural layer 203 is exposed . as shown in fig2 f , a second circuit 220 is formed on the dielectric layer 210 , and electrically connected to the light emitting structural layer 203 through appropriate adjustment . for example , a patterned dry film is formed on the dielectric layer 210 and the upper surface 203 a of the light emitting structural layer 203 . thereafter , a sputtering technique is performed to implant seeds of a conductive material with the patterned dry film serving as a mask . subsequently , a second circuit 220 is formed on the dielectric layer 210 by conducting an electroplating process with the use of the seeds , and electrically connected to the upper surface 203 a of the light emitting structural layer 203 . in other embodiments , a conductive material , such as copper paste or silver paste , is printed on the dielectric layer 210 to form the second circuit 220 by a screening printing process . then , referring to fig2 g , an insulating layer 230 is blanketly formed , and connected to the second circuit 220 , the light emitting structural layer 203 and the dielectric layer 210 . the insulating layer 230 can be polyester or polyimide , and it can further contain an appropriate reinforced material . the insulating layer 230 can be formed using a coating process . alternatively , the insulating layer 230 can be a laminate of the above materials , which is then attached to the second circuit 220 and the light emitting structural layer 203 . by way of appropriate adjustments , the insulating layer 230 can be thick and strong enough to serve as a support layer for the above elements , so that the substrate 200 can be removed using a conventional etching process . accordingly , the structure shown in fig2 h is obtained . fig2 i shows an optional step following that of fig2 h . as shown , the thin film 202 , which may absorb light , can be removed using an etching process . in doing so , luminescence of the light emitting diode can be enhanced . alternatively , as shown , the insulating layer 230 can be properly polished depending on needs , for exposing the second circuit 220 . as described above , the invention provides a method integrating the printed circuit board fabrication process and the semiconductor fabrication process or another electronic component fabrication process instead of directly adhering the whole resultant electronic component , such as a packaged electronic component , to the substrate . that is , in accordance with the present invention , the printed circuit board fabrication process is firstly used to form a peripheral circuit on the substrate , and the semiconductor fabrication process or another electronic component fabrication process is then employed to directly form a principal structure of the electronic component on the substrate . thereafter , another peripheral circuit electrically connected to the electronic component is formed using the printed circuit board fabrication process again . in the first embodiment of the invention , the electronic component refers to light emitting diode . alternatively , the method disclosed in first embodiment can be applied in various diodes , such as a pn junction diode , a photodiode or a laser diode . fig3 a to fig3 d illustrate a second embodiment of the present invention . the second embodiment differs from the first embodiment in that the embedded electronic component is a transistor . as shown in fig3 a , a substrate 300 is provided , and a first circuit 301 is formed thereon . referring to fig3 b , a thin film 302 is deposited on the substrate 300 . for example , the thin film 302 is directly formed on the surface of the substrate 300 , and possesses an end 302 a connected to the first circuit 301 . the thin film 302 can be made of si , gaas , inp , gap , sapphire , and sic . the thin film 302 can be formed using conventional techniques , such as sputtering , chemical vapor deposition or screening printing . as shown in fig3 c , with the thin film 302 serving as a base , a transistor structure 303 is formed thereon utilizing conventional semiconductor techniques and suitable semiconductor materials . the transistor structure 303 includes a source electrode 304 , a drain electrode 305 , a gate insulating layer 306 , and a gate electrode 307 . the source electrode 304 and the drain electrode 305 are respectively connected to the first circuit 301 . the subsequent steps of fig3 c are similar to those of the first embodiment . as shown in fig3 d , a dielectric layer 310 is blanketly formed , enclosing the transistor structure 303 and the first circuit 301 . it is noted that the transistor structure 303 has not been packaged prior to formation of the dielectric layer 310 . thereafter , an appropriate chemical mechanical polishing technique is then employed to remove a portion of the dielectric layer 310 , for exposing an upper surface 303 a of the transistor structure 303 . subsequently , a second circuit 320 is formed on the dielectric layer 310 , and electrically connected to the transistor structure 303 through appropriate adjustment . an insulating layer 330 is then blanketly formed , and connected to the second circuit 320 , the transistor structure 303 and the dielectric layer 310 . after appropriate adjustments , the insulating layer 330 is thick and strong enough to serve as a support layer for the above elements . finally , the substrate 300 is removed . although only the mos transistor is disclosed as an example of the electronic components in the second embodiment , other transistors , such as bipolar transistor or cmos transistor can alternatively serve as the electronic component in other embodiments . fig4 a to fig4 c illustrate a third embodiment of the present invention . the third embodiment differs from the first and second embodiments in that formation method of the electronic components excludes the step of forming the thin film 202 or 302 that serves as a base . in other words , processes that are not high temperature processes , such as vacuum evaporation , spin coating or printing including screening printing , inkjet printing or contact printing can also be employed for fabricating the embedded electronic components of the invention . in the third embodiment , an electroluminescent structure serves as the electronic component . in detail , as shown in fig4 a , a substrate 400 is provided , and a first circuit 401 is formed thereon . referring to fig4 b , an electroluminescent structure 403 is formed through evaporation , coating or printing accompanying suitable masking techniques . the electroluminescent structure 403 includes an electron injection layer 404 , an electron transport layer 405 , an electroluminescent layer 406 , a hole transport layer 407 , and a hole injection layer 408 . the electron injection layer 404 can be made of alkali metal doped organic materials . the electron transport layer 405 can be made of oxadiazole , triazoles or phenanthroline . the electroluminescent layer 406 can be made of polymers containing various fluorescent pigments . the hole transport layer 407 can be made of allylamine compounds . the hole injection layer 408 can be made of organic materials to which lewis acid is added . the subsequent steps of fig4 b are similar to those of the first and second embodiments . as shown in fig4 c , a dielectric layer 410 is blanketly formed , enclosing the electroluminescent structure 403 and the first circuit 401 . it is noted that the electroluminescent structure 403 has not been packaged prior to formation of the dielectric layer 410 . thereafter , an appropriate chemical mechanical polishing technique is then employed to remove a portion of the dielectric layer 410 , exposing an upper surface 403 a of the electroluminescent structure 403 . subsequently , a second circuit 420 is formed on the dielectric layer 410 , and electrically connected to the electroluminescent structure 403 through appropriate adjustment . an insulating layer 430 is then blanketly formed , and connected to the second circuit 420 , the electroluminescent structure 403 and the dielectric layer 410 . after appropriate adjustments , the insulating layer 430 is thick and strong enough to serve as a support layer for the above elements . finally , the substrate 400 is removed . although the embodiments of the invention disclose the light emitting diode , transistor and electroluminescent structure as examples of the electronic components , other electronic components suitable for the above - described methods , such as optical components , can also be used in other embodiments . although specific embodiments have been illustrated and described , it will be obvious to those skilled in the art that various modifications may be made without departing from what is intended to be limited solely by the appended claims .	7
abrin used as the active ingredient of the immunopotentiator of this invention is an immuno - adjuvant having the ability to potentiate both the aforesaid cellular and humoral immune responses . it is characterized by having a strong adjuvant activity in amounts which do not cause necrosis , swelling , etc . at a site of injection . the abrin in accordance with this invention also has the advantage that since it can be used in the form of an aqueous solution , it can be easily formulated into a dosage form by mixing with an antigen . jung - yaw lin et al ., j . formosan med . assoc . 68 , no . 6 , 322 - 324 ( 1969 ) reported that the acute toxicity ( ld 50 ) of abrin used in this invention is 0 . 020 mg / kg ( mouse , i . p .). experiments of the present inventors showed that ld 50 of abrin is 12 μg / kg ( mouse , i . p .). when administered to man and animals , the abrin of this invention increases immune responses to bacteria , viruses and other microorganisms and tumor cells , and is therefore useful for prevention and treatment of infections by microorganisms such as bacteria and viruses or cancer . the minimum dosage of abrin which shows an immunopotentiating activity is about 3 ng per human or animal irrespective of body weight . the maximum dosage is generally about 1 to about 1 . 5 μg / kg . these dosages are much lower than the lethal dose mentioned above . abrin in accordance with this invention may be administered together with various antigens , and the preferred route of administration is subcutaneous , intramuscular or intraperitoneal . furthermore , abrin can be administered separately from an antigen , and in this case , intravenous and intrapleural administrations are possible in addition to the aforesaid administration routes . or it may be administered directly to a tumor region . the administrations of abrin are preferably twice a week to once in two weeks . in administration , the abrin in accordance with this invention may be formulated into any desired injectable form by known formulating methods . for example , it may be in the form of an injecting ampoule containing 0 . 1 to 1 ml of a physiological saline or a neutral to weakly acidic buffer containing abrin in a concentration of about 100 μg to 1 mg / ml , or an abrin - containing lyophilized ampoule . the immunopotentiating activity of abrin is illustrated specifically by the following examples . the effect of abrin on the production of a humoral antibody in mice ( female cdf 1 ) each having a body weight of 20 to 23 g was examined using bovine serum albumin ( bsa ) as an antigen . a group of 5 mice ( group 1 ) was primarily immunized by injecting subcutaneously at their backs 0 . 2 ml of physiological saline containing 15 ng of abrin and 1 μg of bsa . two weeks after the primary immunization , secondary immunization was performed by injecting subcutaneously into their backs 0 . 2 ml of a physiological saline containing 15 ng of abrin and 1 μg of bsa . another five mice ( group 2 ) were each primarily immunized by simultaneously injecting subcutaneously 0 . 1 ml of a physiological saline containing 1 μg of bsa at the right side of their backs , and 0 . 1 ml of a physiological saline containing 15 ng of abrin into the left side of their backs . two weeks later , the mice were secondarily immunized by injecting subcutaneously into the same sites as above 0 . 1 ml of a physiological saline containing 15 ng of abrin and 0 . 1 ml of a physiological saline containing 1 μg of bsa separately . other five mice ( control group ) were treated with 0 . 2 ml of a physiological saline containing 1 μg of bsa in the same way as in the case of the group 1 . blood was taken from the mice in each of the groups seven days after the secondary immunization , and the plasma was separated . the antibody titer of the plasma was measured in accordance with a method of hemagglutination of tanned red blood cells of sheep passively sensitized with bsa [ proteins , nucleic acids , enzymes ; separate print &# 34 ; immuno - biochemistry &# 34 ;, vol . 11 , no . 15 , page 1506 , ( 1966 )]. the results are shown in table 1 . table 1______________________________________ability of abrin to increaseproduction of an anti - bsa antibody antibody titer ( ha titer ) significance of ( dilution of difference the plasma from thegroup immunization ± s . e . ) control______________________________________control bsa ( 1 μg ) 10 × 2 . sup . 1 . 0 ± 0 . 61 a mixture of 10 × 2 . sup . 5 . 80 ± 0 . 7 p & lt ; 0 . 01 abrin ( 15 ng ) and bsa ( 1 μg ) was admini - stered by injection . 2 abrin ( 15 ng ) 10 × 2 . sup . 4 . 6 ± 1 . 5 p & lt ; 0 . 05 and bsa ( 1 μg ) were separa - tely admini - stered by injection . ______________________________________ ha titer : hemagglutination titer s . e . : standard error it is seen from table 1 that abrin provides an increased immune response to an antigen , and that this effect is stronger when abrin is administered together with the antigen ( group 1 ), as compared with the effects of the separate administration of abrin and the antigen . furthermore , it is noted that abrin shows appreciable adjuvant activity even when administered separately from the antigen ( group 2 ). immunopotentiative effect of abrin on production of a humoral antibody in mice a solution ( 0 . 2 ml ) obtained by mixing 0 . 1 ml of a physiological saline containing 1 μg of bsa antigen with 0 . 1 ml of a physiological saline containing abrin in various amounts from 0 . 1 ng to 30 ng was subcutaneously injected into mice ( female cdf 1 ) having a body weight of 20 to 23 g . two weeks later , the same solution was injected into the mice in the same manner . twelve days after the second injection , blood was taken from each of the mice , and the plasma was separated . the antibody titer of the plasma was measured in the same way as described in example 1 , and the results are shown in table 2 . table 2______________________________________activity of abrin to increaseproduction of an anti - bsa antibody number of mice having plasma ha titer estimated by bsa - sensitized sheep red blood cell hemaggluti - dose of nation reactionabrin number of ha titer ( ng / mouse ) animals 0 20 40 80 160______________________________________0 10 100 . 1 5 50 . 3 5 4 11 . 0 5 3 1 13 . 0 4 1 310 . 0 5 1 430 . 0 5 1 1 2 1______________________________________ it is seen from table 2 that the activity of abrin to increase the humoral immunity is noted in 1 ng to 30 ng per mouse , and is the strongest at a dose of 10 ng . a physiological saline ( 0 . 2 ml ) containing 1 μg of bsa and various amount of abrin was injected subcutaneously into the back of each of mice ( female cdf 1 ) having a body weight of 20 to 23 g , and two weks later , the mice were treated with injection in the same way as above ( secondary immunization ). thirty - nine days after the secondary immunization , 10 μl of a physiological saline containing 10 μg of bsa was injected subcutaneously into the auricle of each mouse ( challenge ), in accordance with the method of j . h . robinsons et al . [ scand . j . immunol ., 5 , 299 ( 1976 )]. twenty - four hours later , an ear swelling was measured . the results are shown in table 3 . table 3______________________________________activity of abrin to increasecellular immune response signifi - cance ofnum - chal - the dif - ber immunization lenge ear swell - ference of abrin bsa bsa ing from the ani - ( ng / ( μg / ( μg / ( 10 . sup .- 3 cm controlgroup mals mouse ) mouse ) mouse ) ± s . e . ) ( p ) ______________________________________con - 6 0 1 10 5 . 0 ± 0 . 2trol1 5 1 1 10 3 . 6 ± 1 . 4 ns * 2 5 10 1 10 12 . 0 ± 1 . 7 & lt ; 0 . 013 4 30 1 10 14 . 0 ± 2 . 3 & lt ; 0 . 01______________________________________ * ns : not significant ; ** s . e . : standard error the results given in table 3 demonstrate that at a dose of 10 ng and 30 ng , abrin increases the cellular immune response to bsa . a physiological saline ( 0 . 5 ml ) containing 1 μg of bsa and 10 ng or 100 ng of abrin was injected subcutaneously into native japanese white male rabbits having a body weight of 2 . 5 to 3 kg at both sides of their back in a dose of 0 . 25 ml at each side . the date of the first injection was designated as 0 day , and the rabbits were immunized by injecting the same physiological saline in the same way as in the first injection on the 14th , 22nd and 55th days . blood was taken from the ear vein of each rabbit immediately before each injection and on the 29th and 68th days ( six times in total ), and the serum was separated . an aliquot ( 0 . 2 ml ) of the serum was mixed with 0 . 2 ml of 0 . 2m 2 - mercaptoethanol dissolved in the dulbecco &# 39 ; s phosphate buffer ( ph 7 . 2 ) [ to be abbreviated as pbs ( ph 7 . 2 )]. the mixture was allowed to stand for 17 hours at 4 ° c ., and in a dialyzing cellophane tube , was dialyzed at 4 ° c . for 15 hours against a 0 . 02m monoiodoacetamide in pbs ( ph 7 . 2 ), and then against pbs ( ph 7 . 2 ). on the next day , the serum within the cellophane tube was taken out to obtain a 2 - mercaptoethanol - treated serum . the anti - bsa antibody titer of the serum of each rabbit before and after treatment with 2 - mercaptoethanol was measured by the hemagglutination of tanned sheep red blood cells passively sensitized with bsa . the results are shown in table 4 . table 4______________________________________immunopotentiative effect ofabrin on production of ananti - bsa antibody in rabbitsdoseof anti - bsa antibody titer ( ha titer ) abrin before treatment with 2me ()/ after ( ng / treatment wtih 2merabbit rab - 14th 22nd 29th 55th 68thno . bit ) day day day day day______________________________________1 100 128 / 0 4 / 0 16 / 0 4 / 4 8 / 82 100 512 / 0 256 / 0 64 / 0 16 / 16 32 / 323 100 128 / 0 4 / 0 16 / 8 8 / 8 128 / 644 10 512 / 0 32 / 0 16 / 4 8 / 8 128 / 1285 10 256 / 0 0 / 0 0 / 0 0 / 0 64 / 06 10 32 / 0 0 / 0 4 / 0 0 / 0 32 / 4control7 0 64 / 0 0 / 0 0 / 0 0 / 0 0 / 08 0 0 / 0 0 / 0 0 / 0 0 / 0 0 / 09 0 0 / 0 0 / 0 0 / 0 0 / 0 0 / 010 0 0 / 0 0 / 0 0 / 0 0 / 0 0 / 0______________________________________ () 2me : 2mercaptoethanol it is known that there exist two types of antibody having different physicochemical properties , i . e ., igm and igg . while igm is produced only transiently , igg is produced continuously . treatment of the antiserum with 2 - mercaptoethanol selectively inactivates only the igm antibody , and does not affect the activity of the igg antibody . accordingly , in the above table 4 , the anti - bsa antibody titer before treatment with 2 - mercaptoethanol shows the total activity of the igm antibody and the igg antibody , and the anti - bsa antibody titer after the treatment shows the activity of the igg antibody . the results given in table 4 demonstrate that at a dose of 10 ng and 100 ng , abrin exhibits immunopotentiating activity , and promotes shift from potentiation of igm antibody production which is transient to potentiation of igg antibody production which is continuous . potentiation of immunogenicity of inactivated tumor cell vaccine due to the addition of abrin balb / c mice were inplanted into peritoneally with 1 × 10 7 syngenic meth - a ascitic tumor cells . the tumor cells were obtained from pelitoneal cavity of the tumor bearing mice 1 week after the inplantation and washed with eagle &# 39 ; s minimum essential medium ( hereafter referred to mem ). five ml of the tumor cell suspension ( 1 × 10 8 / ml in mem ) were placed into a plastic dish of 4 cm in diameter . the suspension was then irradiated 9000 r from a cobalt source to prepare an inactivated meth - a tumor cell vaccine . the vaccine was diluted with mem to the concentration of 2 × 10 7 / ml . to the diluted cell susponsion was added the equal volume of mem which contains abrin in the concentration 120 ng / ml . one tenth of the resulting tumor cell suspension added abrin was injected subcutaneously to balb / c mice on their right side of the back to effect the immunization . the mice were challenged subcutaneously with 1 × 10 6 viable meth - a tumor cells on the left side of the back 2 weeks after the immunization . activity of vaccine was measured by rejection ratio ( percentage ) of transplanted tumor cells . the results are shown in the following table 5 . table 5______________________________________potentiation by abrin of inactivatedmeth - a tumor cell vaccine number of tumor - free mice number of challenged mice significantgroup immunization ( percentage ) difference * ______________________________________1 1 × 10 . sup . 6 20 / 20 ( 100 %) irradiated cells plus abrin2 1 × 10 . sup . 6 16 / 25 ( 64 %) & lt ; 0 . 003 irradiated cells alone3 non - immune 0 / 12 ( 0 %) & lt ; 0 . 00001______________________________________ * probability test as compared with group 1 by fisher &# 39 ; s exact test . the table 5 discloses that the rejection ratio in group 2 that was immunized with irradiated tumor cells alone amounts to 16 / 25 ( 64 %). on the contrary , the rejection ratio in group 1 that was immunized with irradiated tumor cells plus abrin ( 6 ng ) amounts to 20 / 20 ( 100 %). it was thus proved that the addition of abrin significantly potentiated the immune response to an inactivated tumor cell vaccine , i . e . abrin was an adjuvant that enhances antitumor immunity . glacial acetic acid ( 0 . 05 ml ) was added on ice water bath to 5 ml of an aqueous suspension containing abrin crystals in a concentration of 10 mg / ml to dissolve the abrin crystals . to the resulting solution was added 10 ml of a 0 . 01m phosphate buffer ( ph 6 . 0 ) containing 0 . 15m of sodium chloride [ to be abbreviated as pbs ( ph 6 . 0 )]. then , 0 . 4 ml of a 1m na 2 hpo 4 solution was added to adjust the ph of the solution to about 5 . the solution was centrifuged at 15 , 000 rpm for 10 minutes . the supernatant solution was filtered by a 0 . 45 μm filter ( millipore filter , type ha ) to remove microbes . the filtrate was put into a cellophane tube , and dialyzed overnight against 5 liter of pbs ( ph 6 . 0 ). the dialyzate was diluted with pbs ( ph 6 . 0 ) to form a solution containing abrin in a concentration of 500 μg / ml . the concentration of abrin was adjusted according to its e 280 nm 1 % value of 15 . 9 reported by olsnes et al . [ j . biol . chem . 249 , 803 - 810 ( 1974 )]. the abrin solution was put separately in an amount of 0 . 1 ml into each of 1 ml glass ampoules to prepared injecting ampoules each containing 50 μg of abrin .	0
referring now to the drawings , fig1 shows in plan view one embodiment of the present invention , in which a lead frame for use in the resin - molded package of an ic is partially enlarged . as shown , the lead frame includes a tab 2 , a tab suspension lead 4 , an inner lead 3a , a dam 5 , and an outer lead 3b which are formed as an integral lead frame . a semiconductor chip 1 is mounted on the tab 2 with bonding pads 8 being provided along the peripheral edge of this chip . a bonding wire 7 ( for example , au wire ) is connected between one point 9 on the inner lead 3a near the inner end thereof and the bonding pad 8 of the chip 1 . the whole lead frame is formed by punching or etching a metal sheet made of cu or a cu alloy . if necessary , the surfaces of the tab 2 and the inner leads 3a are formed with plating films of gold ( au ), silver ( ag ) or the like . as illustrated in fig1 a characterizing feature of the lead frame according to the present invention is that the inner lead 3a inside the dam part 5 of the lead frame is shaped so as to extend toward the tab 2 ( or the chip 1 ) and bent once so that the inner end 3d thereof is formed so as to extend in a sense away from the tab 2 . that is , the inner lead 3a includes a first lead portion extending in a direction toward the tab , a second lead portion extending in a direction away from the tab and terminating in the inner end 3d and being contiguous with the first lead portion by way of an interconnecting third lead portion extending in a direction parallel with a peripheral wall of the tab facing the first lead portion . the first , second and third lead portions are contiguous . one end of the wire 7 is bonded by thermocompression by setting a bonding coordinate point at the point 9 lying on the inner end side of the inner lead 3a , while the other end of the wire is bonded to the bonding pad 8 on the side of the chip 1 . that is , a principle part of the third lead portion and the inner end 3d of the inner lead 3a lie along a straight line which connects the third lead portion and the wire bonding space on the chip as represented by the bonding wire 7 . owing to the above construction , even in a slim or thin package in which the dimension between the dam and the tab ( called &# 34 ; dimension a &# 34 ;) is short , the depth of the inner lead (&# 34 ; dimension b 2 &# 34 ;) is sufficient , so that the amount of a resin to be packed in the corresponding space increases to raise the mechanical and thermal strengths of the package . in addition , since a distance from a surface of a resin - molded package to the bonding point 9 can be maintained sufficiently long , a long leakage path can be provided whereby a semiconductor device having a good resistance to moisture is fabricated . moreover , a large area can be provided for the fore end part of the inner lead which is bent outwardly from the tab 2 or chip 1 , thereby enlarging a wire bonding area , with the result that a large margin for a positional deviation at the wire bonding step can be obtained . such inner leads are appropriately adopted principally as shorter leads which are arranged in a place where the spacing a between the tab ( chip ) and the resin mold line ( dam line ) is comparatively short . of course , the construction of the invention can be utilized also for the fore ends of leads in a place where the aforementioned spacing is large , for example , the fore end of a longer lead 3e extending in the direction of the tab suspension lead 4 as shown in fig1 . in this case , however , scrupulous care must be taken lest the interval of the leads should increase due to the presence of the bent portions . in the case of the shorter lead , modifications as shown in fig4 and fig5 ( a ) to ( g ) wherein the third lead portion is shortened or substantially eliminated are provided . the lead shown in fig4 has a structure in which the invasion path of water ( also termed the &# 34 ; leakage path &# 34 ;) is increased or lengthened . in the case of the shorter lead , it is preferable that a protrusion 10 at the root of the first lead portion , for preventing the lead from falling off or pulling away with respect to the resin mold member , is especially provided in a sideward or transverse direction to the lead extension direction . numeral 20 indicates a space portion , which is filled with the resin at the resin molding step thereby to enhance the resistance to moisture and the reliability of the semiconductor device . as shown in fig4 the second lead portion containing the bonding point 9 or forming the bonding surface has a trapezoidal shape , in plan view , with the lateral width thereof increasing in a direction away from the tab . on the other hand , fig5 ( a ) shows another modification wherein the second lead portion also has a trapezoidal shape with the lateral width thereof decreasing in a direction away from the tab . moreover , this consruction may be considered an elimination of the third lead portion with the first and second portions as described above forming the contiguous inner lead . thus , essentially first and second contiguous lead portions are provided with the first lead portion being bifurcated into two branches 30 and the second lead portion having the trapezoidal shape being contiguous with the respective branches and folded back in a direction extending away from the tab . as shown , the second lead portion is disposed within a region between the branches 30 . fig5 ( b ) shows another shape wherein lead corners 21 and 22 function also to prevent the lead from falling off . noteworthy is that the lead portion of trapezoidal shape and serving as a bonding surface spreads fanwise from the inner end 3d of the lead . therefore , the versatility of arrangement of the bonding pads is enhanced thereby to improve the versatility of design . a technique shown in fig1 is employed as a bonding method for attaining high reliability . to the end of preventing a short - circuit between the wires and a short - circuit between the wire and the tab due to the flow of the wires , the wire 7 is laid within the extent between dot - and - dash lines indicated in the figure . these dot - and - dash lines are straight lines which connect the bonding coordinate point 9 and the corners 21 and 22 at the fore end of the inner lead . accordingly to this method , the bonding pad 8 can be freely disposed within the extent indicated by arrows in the figure . according to the present invention , the bonding coordinate point 9 is set farther from the chip 1 ( or the tab 2 ) so as to enlarge the bonding area . in this regard , when a coordinate point 9 &# 39 ; is merely set farther by the use of a lead having substantially parallel sides as shown in fig1 , the versatility of installation of the bonding pad lowers as indicated by two - dot chain lines in the figure . in contrast , according to the present invention , the inner lead spreads fanwise toward the chip , i . e ., the sides are non - parallel as shown in fig1 , so that even when the bonding coordinate point is set farther at 9 &# 39 ;, a sufficient versatility of installation of the bonding pad ( indicated by arrows ) is achieved . in fig5 ( c ) and 5 ( d ), the outer lead 3b and the inner lead 3a are set approximately equal widths without providing the protrusion 10 for preventing the lead from falling off . the prevention of the falling - off of the lead is effected in such a way that the amount of the resin to enter the space portion 20 is increased by enlarging the space portion . this lead shape is suitable for increase in the number of pins , and makes it possible to provide a package which can sufficiently meet the requirements of a package having a reduced size and an increased number of pins and which has a high reliability . fig5 ( e ) shows a lead in which the protrusions 10 for preventing the lead from falling off are provided at the root of the first lead portion in the lead shape shown in fig5 ( b ), and which affords a high reliability and a high versatility of design . fig5 ( f ) shows a modified structure of the lead shape in fig5 ( c ), in which one side of the inner end 3d of the lead juts beyond the side of the outer lead 3b and functions also to prevent the lead from falling off . since the leads of fig5 ( c )- 5 ( f ) have the bonding leads surfaces of trapezoidal shape spread fanwise in a manner similar to the lead shape of fig5 ( b ), they produce similar effects . in the lead shape of fig5 ( g ), the corners 20 and 21 of the inner lead function to prevent the lead from falling off , and the space portion 20 is enlarged to achieve further enhancements in reliability and resistance to moisture . fig6 is a perspective view showing the general configuration of a thin or skinny ( slim ) type dual in - line package ( dip ) resin - molded semiconductor device which uses the lead frame described in the above embodiment and which is partly cut away . the present invention is particularly effective for the thin dip in which the dimension a on the shorter lead side is small . fig7 is a sectional view showing the internal structure of the semiconductor device shown in fig6 . in fig7 numeral 11 designates a resin mold member which serves for sealing the leads , chip , tab and wires with resin . the other structural portions common to the constituent portions shown in fig1 are assigned the same reference symbols . as seen from the figure , in the elongate type package called the &# 34 ; slim package &# 34 ;, the dimension a is very small on the shorter lead side . therefore , it has heretofore been impossible to satisfactorily attain the resistance to moisture , the mechanical strength , etc ., whereas an electronic device excellent in the resistance to moisture , the mechanical strength and the reliability is fabricated by the use of the lead frame of the present invention . with the lead frame having the internal end of the inner lead as in the aforementioned embodiment described above and the resin - molded semiconductor device employing this lead frame , the following effects are attained : ( 1 ) that an end of an inner lead which lies on the extension of a wire connecting the bonding pad of a chip and a bonding coordinate point on the lead side and which is bent to as to extend in a sense away from the chip is used as a wire bonding area , whereby a sufficient wire bonding area can be provided on the lead . ( 2 ) the bonding coordinate point is permitted to be set somewhat ( about 0 . 4 mm ) rearward of the end part of the inner lead on the chip side thereof ( set closer to an outer lead ). heretofore , since the bonding coordinate point 9 on the inner lead 3a has been set in the vicinity of the chip 1 as illustrated in fig8 a wire 7 has sometimes sagged between a tab 2 and the lead 3a at the wire bonding step . moreover , since the degree of inclination θ 1 of the wire from the chip side has become great , a wire loop has been able to collapse , and a fault may occur in which the wire short - circuits to the edge of the chip 1 . in contrast , in case of the present invention , the bonding coordinate point 9 on the lead is set rearwardly and a wire 7 is accordingly formed so as to extend over a large portion of the lead 3a as illustrated in fig9 whereby the sagging ability of the wire 7 lessens owing to the function that the portion of the lead under the wire supports the wire as indicated by a dot - and - dash line in the figure . besides , since the angle of inclination θ 2 of the wire is smaller than the angle θ 1 of fig8 a wire loop is less prone to collapse and the possibility of occurrence of a short - circuit to the chip 1 lessens . ( 3 ) the magnitude of an inner lead which enters a resin mold member can be rendered large . thus , a leakage path from the root of an outer lead to a bonding position on the mold side lengthens to enhance the reliability in regard to the resistance to moisture . ( 4 ) owing to a shape curved like a &# 34 ; hook &# 34 ;, an inner lead is effective to be prevented from falling off a resin mold member . ( 5 ) since a portion of an inner lead which serves as a bonding surface extends in a direction away from a tab , the magnitude of the inner lead for entering a resin mold member can be increased without enlarging the dimension ( dimension a ) between the tab and a dam , so that the mechanical strength of a package can be ensured . ( 6 ) owing to the above items ( 1 ), ( 2 ), ( 3 ), ( 4 ) and ( 5 ), a high resistance to moisture , a high reliability and a mechanical strength can be obtained without enlarging the dimension a , so that the moisture resistance and the reliability of a small - sized package , the dimension a of which is very small , can be enhanced . fig1 shows in plan view another embodiment of the present invention of the interior of a leadless type glass - encapsulated package , while fig1 is a sectional view corresponding to fig1 . referring to fig1 and 11 , there is shown a ceramic package base 12 which when provided with a metallized film 13 forming leads serves as a lead frame a semiconductor chip 1 is mounted on the inner surface thereof . the metallized film 13 which corresponds to the lead in the case of the resin encapsulation includes a part thereof which is buried in the ceramic base 12 . one side of the interconnection is exposed inside the package , while the other side is connected to a semicircular slot 14 outside the package base . a metallized film is deposited on the inner surface of the slot 14 and lies in contact with a pin ( not shown ) on a wired board , thereby to effect a wiring connection . as shown in fig1 , that part of the metallized interconnection 13 which is exposed inside the package base is bent on its inner side near the chip , and the inner end part 15 thereof extending outwardly away from the chip is used as a bonding portion , which is bonded by a wire 7 with a bonding pad disposed at the peripheral edge of the chip . numeral 16 denotes a cap made of metal or ceramic , and the space between this cap and the ceramic base is hermetically sealed through a glass film 17 or the like . with a semiconductor device wherein the inner end of the metallized interconnection of the ceramic package base as described above in the aforementioned embodiment of fig1 and 11 is formed in the opposite sense ( outwards ) to the lead - in sense of wire bonding , the following effects are attained : ( 1 ) a sufficient wire bonding area can be provided on a metallized interconnection in a ceramic base . ( 2 ) the sagging ability of a wire can be lessened to lessen the possibility of occurrence of a short - circuit between the edge of a chip and the wire . while , in the above , the invention has been described in conjunction with several embodiment , it is understood that the present invention is not limited to the foregoing embodiments but is susceptible of numerous changes and modification as would be known to those skilled in the art without departing from the scope of the present invention . by way of example , in a semiconductor device of the film carrier type wherein leads and a tabs are printed on the surface of a flexible insulating film a semiconductor chip is mounted on the tab , the chip and the leads are subsequently bonded by wires , and the resultant structure is thereafter molded in a resin . when the present invention is applied to the shape of the inner ends of the leads , effects similar to those of the embodiments are attained for securing bonding areas on the leads . in addition , similar effects are attained even with a configuration in which conventional leads and the leads of the present invention are alternately arranged . the present invention is applicable to all semiconductor devices and electronic devices of the type having a large number of pins or leads which are connected with the electrodes of a chip by wire bonding . the present invention is advantageous when utilized especially for small - sized packages intended for high density integration , for example , an elongate package such as of the slim type and a package having a large number of pins since the present invention provides the effects as described above .	7
fig1 shows an embodiment of a reciprocating compressor . however , in other embodiments , the compressor can be any suitable type of hermetic or semi - hermetic compressor including , but not limited to , a rotary compressor , screw compressor , swag link compressor , scroll compressor , spool compressor , centrifugal compressor , or turbine compressor . in fig1 , compressor 2 can have a suction port or fitting 14 that can be in fluid communication with an evaporator of a vapor compression system upon the connection of a suction line or conduit from the evaporator to the suction port 14 . the suction port 14 can be in fluid communication with a suction plenum 12 through one or more openings in a motor cap 13 . refrigerant gas from the evaporator can enter the compressor 2 through the suction port 14 and then flow to the suction plenum 12 before being compressed . in one embodiment , the refrigerant gas from the suction port 14 can also fill the interior space of the compressor housing before flowing to the suction plenum 12 . the compressor 2 can use an electrical motor 18 . as shown in fig1 , motor 18 is an induction motor having a stator 20 and a rotor 22 . however , in other embodiments , any other suitable type of electrical motor may be used including , but not limited to , a switched reluctance ( sr ) motor or an electronically commutated permanent magnet motor ( ecm ). a shaft assembly 24 extends through the rotor 22 . the bottom end 26 of the shaft assembly 24 extends into an oil sump 405 and includes a series of apertures 27 . connected to the shaft assembly 24 below the motor is a compression device 30 , such as a piston assembly as shown in fig1 . in fig1 , the piston assembly 30 has two pistons . a connecting rod 32 is connected to a piston head 34 , which moves back and forth within a cylinder 36 . the cylinder 36 includes a gas inlet port 38 and a gas discharge port 40 . associated with these ports 38 , 40 are associated suction valves and discharge valves . the gas inlet port 38 is connected to an intake tube 54 , which is in fluid communication with the suction plenum 12 . the motor 18 can be activated by a signal in response to the satisfaction of a predetermined condition , for example , an electrical signal from a thermostat when a preset temperature threshold is reached . while a thermostat is used as an example , it should be known that any type of device or signal may be used to activate the compressor . when the compressor is activated , electricity is supplied to the stator 20 , and the windings in the stator 20 cause the rotor 22 to rotate . rotation of the rotor 22 causes the shaft assembly 24 to turn . when the shaft assembly 24 is turning , oil sump fluid in the oil sump 405 enters the apertures 27 in the bottom end 26 of the shaft and then moves upward through and along the shaft 24 to lubricate the moving parts of the compressor 2 . rotation of the rotor 22 also causes reciprocating motion of the piston assembly 30 . as the assembly 30 moves to an intake position , the piston head 34 moves away from gas inlet port 38 , the suction valve opens and refrigerant fluid is introduced into an expanding cylinder 36 volume . the gas is pulled from the suction plenum 12 through the intake tube 54 to the gas inlet port 38 where the gas passes through the suction valve and is introduced into the cylinder 36 . when the piston assembly 30 reaches a first end ( or top ) of its stroke , shown by movement of the piston head 34 to the right side of the cylinder 36 of fig1 , the suction valve closes . the piston head 34 then compresses the refrigerant gas by reducing the cylinder 36 volume . when the piston assembly 30 moves to a second end ( or bottom ) of its stroke , shown by movement of piston head 34 to the left side of cylinder 36 of fig1 , a discharge valve is opened and the compressed refrigerant gas is expelled through the gas discharge port 40 . the compressed refrigerant gas flows from the gas discharge port 40 into a muffler 50 then through an exhaust or discharge tube 52 to a discharge port or fitting . the discharge port can be in fluid communication with a condenser upon the connection of a discharge line or conduit from the condenser to the discharge port . the compressor 2 may be connected to a vapor compression system that is included in a heating , ventilation and air conditioning ( hvac ) system , refrigeration system , chilled liquid system or other suitable type of system . fig2 and 3 show different embodiments of vapor compression systems . in fig2 , vapor compression system 300 includes the compressor 2 , a condenser 304 , and an evaporator 306 , while in fig3 , vapor compression system 300 includes the compressor 2 , a reversing valve 350 , an indoor unit 354 and an outdoor unit 352 . the vapor compression system 300 can be operated as an air conditioning system , where the evaporator 306 is located inside a structure or indoors , i . e ., the evaporator is part of indoor unit 354 , to provide cooling to the air in the structure and the condenser 304 is located outside a structure or outdoors , i . e ., the condenser is part of outdoor unit 352 , to discharge heat to the outdoor air . the vapor compression system 300 can also be operated as a heat pump system , i . e ., a system that can provide both heating and cooling to the air in the structure , with the inclusion of the reversing valve 350 to control and direct the flow of refrigerant from the compressor 2 . when the heat pump system is operated in an air conditioning mode , the reversing valve 350 is controlled to provide for refrigerant flow as described above for an air conditioning system . however , when the heat pump system is operated in a heating mode , the reversing valve 350 is controlled to provide for the flow of refrigerant in the opposite direction from the air conditioning mode . when operating in the heating mode , the condenser 304 is located inside a structure or indoors , i . e ., the condenser is part of indoor unit 354 , to provide heating to the air in the structure and the evaporator 306 is located outside a structure or outdoors , i . e ., the evaporator is part of outdoor unit 352 , to absorb heat from the outdoor air . in vapor compression system 300 , whether operated as a heat pump or as an air conditioner , the compressor 2 is driven by the motor 18 that is powered by a motor drive 104 . the motor drive 104 receives ac power having a particular fixed line voltage and fixed line frequency from ac power source 102 and provides power to the motor 18 . in another embodiment , the motor 18 can be powered directly from the ac power source 102 . the motor 18 used in the system 300 can be any suitable type of motor that can be powered by a motor drive 104 . referring back to fig2 and 3 , the compressor 2 compresses a refrigerant vapor and delivers the vapor to the condenser 304 through a discharge line ( and the reversing valve 350 if configured as a heat pump ). some examples of refrigerants that may be used in vapor compression system 300 are : hydrofluorocarbon ( hfc ) based refrigerants , for example , r - 410a , r - 407c , r - 404a , r - 134a and r - 32 ( a component of r410a and r407c ); hydrofluoro olefin ( hfo ) refrigerants , also known as “ unsaturated hfcs ,” such as r1234yf ; inorganic refrigerants like ammonia ( nh3 ), r - 717 and carbon dioxide ( co2 ), r - 744 ; hydrocarbon ( hc ) based refrigerants such as propane ( r - 290 ), isobutane ( r - 600a ) or propene ( r - 1270 ), or any other suitable type of refrigerant . the refrigerant vapor delivered by the compressor 2 to the condenser 304 enters into a heat exchange relationship with a process fluid , e . g ., air or water , and undergoes a phase change to a refrigerant liquid as a result of the heat exchange relationship with the process fluid . the condensed liquid refrigerant from the condenser 304 flows through an expansion device to the evaporator 306 . the condensed liquid refrigerant delivered to the evaporator 306 enters into a heat exchange relationship with another process fluid , e . g ., air or water , and undergoes a phase change to a refrigerant vapor as a result of the heat exchange relationship with the process fluid . the vapor refrigerant in the evaporator 306 exits the evaporator 306 and returns to the compressor 2 by a suction line ( and the reversing valve arrangement 350 if configured as a heat pump ) to complete the cycle . in other embodiments , any suitable configuration of the condenser 304 and the evaporator 306 can be used in the system 300 , provided that the appropriate phase change of the refrigerant in the condenser 304 and evaporator 306 is obtained . for example , if air is used as the process fluid to exchange heat with the refrigerant in the condenser 304 or the evaporator 306 , then one or more fans can be used to provide the necessary airflow through the condenser 304 or evaporator 306 . the motors for the one or more fans may be powered directly from the ac power source 102 or a motor drive , such as motor drive 104 . fig4 shows an embodiment of a suction fitting for a compressor . a suction fitting 80 can be mounted , fastened or installed in the shell or housing 98 of the compressor 2 by brazing or welding techniques to maintain a hermetic environment within the compressor shell 98 . however , any suitable technique , e . g ., epoxy , adhesives , compression fit , etc ., to fasten the suction fitting 80 to the shell 98 can be used so long as the hermetic environment within the compressor is maintained . the refrigerant fluid can pass through a first portion 82 of the suction fitting 80 that is substantially cylindrical and then enter into a second portion or expansion area 84 of the suction fitting 80 that has an expanding or increasing diameter from the first portion 82 . the refrigerant flow then enters the compressor shell 98 after passing through a screen 88 which can filter out and remove and debris or contaminants from the refrigerant flow and one or more louvers 86 which permit refrigerant gas to travel to the motor cap 13 and the interior of the compressor 2 . the louvers 86 can also direct liquids , such as refrigerant liquid or oil , to the compressor sump 405 at the bottom of the compressor 2 . fig5 - 17 show different views of different embodiments of a suction fitting for a compressor . the suction fitting 80 can include three main components : a housing 83 ; a screen 88 ; and a cover 85 . the housing 83 is mounted in the shell 98 of the compressor 2 and can include a first portion 82 that has a diameter that permits a tube from a system such as a heating , ventilation , and air conditioning ( hvac ) or refrigeration system to be connected to the suction fitting 80 . the housing 83 can have a second portion 84 of expanding diameter that is connected to a cylindrical third portion 87 that is located opposite the first portion 82 . the second portion 84 of the housing 83 can be at a predetermined angle a ( see fig1 ) relative to the first portion 82 of the housing 83 . in one embodiment , the predetermined angle can range between about 90 degrees and about 135 degrees and can be 125 degrees . in another embodiment , the diameter of the third portion 87 can be about 2 to 4 times greater than the diameter of the first portion 82 . in one embodiment , an end 89 of the third portion 87 can have an undulating , wavy or curved surface with high points and low points ( see fig9 , 11 , 12 or 17 ). in other words , the axial length of the third portion 87 can vary along the circumference of the third portion 87 between a minimum axial length corresponding to a low point and a maximum axial length corresponding to a high point . in another embodiment , the end 89 of the third portion 87 can have a substantially planar surface and the axial length of the third portion can be the same along the circumference of the third portion 87 the housing 83 can include fastening mechanisms 91 , 93 that receive screws or other fastening devices 92 , 94 to hold the screen 88 and cover 85 in place . in one embodiment , the fastening devices 92 , 94 can be placed at a predetermined angle b ( see fig1 ) between adjacent fastening devices 92 , 94 . the fastening mechanisms 91 can be integral with the third portion 87 of the housing 83 to receive the screws or fastening devices 92 used to attach the cover 85 to the housing 83 . the fastening mechanisms 93 can be integral with the second portion 84 of the housing 83 to receive the screws or fastening devices 94 used to attach the screen or filter 88 to the housing 83 . in other embodiments , the fastening mechanisms 91 , 93 can be attached to the housing 83 using any suitable technique such as welding or adhesives . a screen or filter 88 can be placed inside the housing 83 and mounted to the housing 83 at the end of the second portion 84 having the larger diameter using fastening devices 94 and fastening mechanisms 93 . the screen 88 can be a substantially circular piece of metal with one or more apertures 103 ( see fig1 ) to receive fastening devices 94 that can then be inserted into fastening mechanisms 93 in the housing 83 . in addition , the screen 88 can have one or more cutouts 105 ( see fig1 ) to help hold the screen 88 in position and to permit the screen 88 to be installed in the housing 83 without interfering with the fastening mechanisms 91 receiving the fastening devices 92 for the cover 85 . in one embodiment , the screen 88 can be positioned at the junction of the second portion 84 and the third portion 87 and have a diameter c ( see fig1 ) that corresponds to the inside diameter of the second portion 84 . the screen 88 can have holes 107 ( see fig1 ) that have a diameter that can be between about 0 . 01 inches and about 0 . 05 inches and can be 0 . 03 inches . the holes 107 can be positioned or arranged in the sheet 88 in a generally circular area having a diameter d ( see fig1 ) that is less than diameter c such that a border area is provided around the sheet 88 for improved stability and rigidity . the size and position of the holes 107 can be selected to capture debris and contaminants in the refrigerant flow while still permitting flow through the screen 88 . in other embodiments , the screen 88 can be connected or mounted to the housing 83 by any suitable technique such as welding , adhesive or compression fit . in still other embodiments , the screen 88 can be a stainless steel wire mesh having a mesh size of between 50 × 50 and 100 × 100 and a wire diameter between 0 . 0045 inches and 0 . 009 inches . a cover 85 with louvers 86 can be positioned and mounted on the end 89 and outer surface of the third portion 87 of the housing 83 . the cover 83 can have integral louvers 86 that can be used to coalesce any entrained liquids in the flow through the suction fitting 80 . the louvers can be arranged within a circular outline 113 ( see fig1 ). the louvers 86 can be angled such that the coalesced liquids then drain to the oil sump 405 in the bottom of the compressor 2 . the cover 85 can have a portion 109 that extends over the third portion 87 of the housing 83 . in addition , the cover 85 can have one or more openings 111 that can receive fastening devices 92 that mate with corresponding fastening mechanisms 91 in the housing 83 . in one embodiment , the cover 85 can have a curved shape to mate with the undulating or curved end surface 89 of the third portion 87 . in another embodiment , the cover 85 can be mounted within the housing 83 instead of outside of the housing 83 . in still other embodiments the cover 85 can be connected to the housing 83 by any suitable technique such as welding , adhesive or compression fit . in another embodiment , instead of using the suction fitting 80 to filter debris and contaminants from the refrigerant flow , a suction filter can be placed over ( or in front of ) the openings in the motor cap to prevent debris or contaminants from entering the motor or the compression mechanism . fig1 - 23 show different views of a motor cap and suction filter for the motor cap . the motor cap 13 can have holes 200 positioned on approximately 25 - 75 % of the top surface 202 of the motor cap 13 . in other embodiments , the holes 200 can be positioned over a greater or lesser percentage of the top surface 202 of the motor cap 13 so long as an appropriate amount of refrigerant enters the suction plenum 12 . in one embodiment , the motor cap 13 can have a first portion 204 and a second portion 206 . the holes 200 can be positioned or located on the second portion 206 of the motor cap 13 . a minor axis 210 of the motor cap 13 through a center point 212 of the depression 95 can be used as a divider between the first portion 204 and the second portion 206 . however , any suitable location or configuration for the divider between the first portion 204 and the second portion 206 can be used . the holes 200 can be arranged in a patterned configuration where the distances between holes 200 and the locations of the holes 200 are consistent , i . e ., the same predetermined distance ( s ) and location placement ( s ) are used in the configuration . in another embodiment , the holes 200 can have a more random configuration where the distances between holes 200 and the locations of the holes 200 are not consistent , i . e ., multiple predetermined distances and location placements can be used in a non - structured manner . in one embodiment , the holes 200 can be arranged in the shape of an arc , square , rectangle , triangle , circle , oval , trapezoid or any other suitable geometric shape . in addition , the holes 200 can be arranged using one or more geometric shapes , either symmetrically or asymmetrically placed about a major axis 214 of the motor cap 13 through the center point 212 of the depression 95 . the number of holes 200 in the top surface 202 of the motor cap 13 can vary between 2 holes and 200 or more holes depending on the size of the motor cap 13 and the diameter of the holes 200 . the holes 200 can be arranged in a patterned configuration having a plurality of rows and columns . in the embodiments of fig1 - 15 , the rows and columns can be arranged such that the holes 200 in one row or column are offset the holes 200 in the adjacent or neighboring rows or columns by 60 degrees ( see e . g ., fig1 ). in other embodiments , the offset angle between holes in adjacent rows or columns can be greater than or less than 60 degrees depending on the number and size of holes 200 . the number of holes 200 in a row or column can vary between 1 hole and 20 or more holes . as shown in fig2 , the predetermined spacing between holes in the same row or column is shown by dimension b and the predetermined spacing between holes in adjacent rows or columns in shown by dimension a . in one embodiment , dimension b can range between about 2 . 25 inches and about 2 . 65 inches and can be 2 . 45 inches and dimension a can range between about 0 . 50 inches and 1 . 00 inches and can be 0 . 75 inches . in one embodiment , the holes 200 can have a circular shape . however , in other embodiments , the holes 200 can use one or more suitable geometric shapes including , but not limited to , square , rectangle , triangle , circle , oval , hexagon and octagon . the holes 200 can use a constant predetermined diameter or size , i . e ., each hole 200 has the same diameter or size . however , in another embodiment , the holes 200 can have different predetermined diameters or sizes that can be arranged in particular configurations to obtain particular characteristics such as improved flow , noise control , etc . the diameter ( s ) for the holes 200 shown in fig2 can range between about 1 . 00 inches and about 1 . 50 inches and can be 1 . 25 inches . a filtering device 250 can be placed over the holes 200 in the motor cap 13 to prevent any debris or contaminants from entering the suction plenum 12 ( and possibly the motor 18 or compression device 30 ). the filtering device 250 can have a mesh 252 connected or fastened to a border or flange 254 . in one embodiment , the mesh 252 can be a stainless steel wire mesh having a mesh size of between 50 × 50 and 100 × 100 and a wire diameter between 0 . 0045 inches and 0 . 009 inches . the border or flange 254 can provide stability and rigidity to the mesh 252 and also provides an area for the filtering device 250 to be connected to the top surface 202 of the motor cap 13 . the filtering device 250 can be attached to the top surface 202 of the motor cap 13 by any suitable technique such as welding , adhesive or fasteners . the filtering device 250 can have shape that corresponds to the pattern of the holes 200 in the motor cap 13 and provides for the passage of refrigerant through both the mesh 252 and holes 200 . in other words , the filtering mechanism 250 has a shape that does not completely block any holes 200 . in another embodiment , the motor cap 13 can have a single hole 200 in either to the top surface 202 or a sidewall of the motor cap 13 to receive refrigerant and the filtering mechanism 250 can be placed directly over the single hole 200 to filter debris and contaminants . the motor cap 13 can also include numerous other features needed for the installation of the motor cap 13 and the operation of the compressor 2 . for example , the motor cap 12 can include openings 224 ( see fig1 ) for electrical connections . in addition , the motor cap 13 can include the depression or indentation 95 to receive a spring or other stabilizing device 96 to hold the motor 18 and compression mechanism 30 in position in the compressor shell 98 and to prevent vibrations in the shell or housing 98 from being transferred to the motor 18 and compression mechanism . as would be appreciated by those of ordinary skill in the pertinent art , the functions of several elements of the present application may , in alternative embodiments , be carried out by fewer elements , or a single element . similarly , in some embodiments , any functional element may perform fewer , or different , operations than those described with respect to the exemplary embodiment . also , functional elements shown as distinct in the drawings may be incorporated within other functional elements , separated in different hardware or distributed in various ways in a particular implementation . further , relative size and location are merely somewhat schematic and it is understood that not only the same but many other embodiments could have varying depictions . all relative descriptions herein such as above , below , left , right , up , and down are with reference to the figures , and not meant in a limiting sense . relative descriptions such as inner and inward are with reference to being a direction toward the interior of a compressor shell whereas outer and outward are a direction away from the compressor . the shown assemblies can be understood as providing exemplary features of varying detail of certain embodiments , and therefore , components , modules , elements , and / or aspects of the drawings can be otherwise added to , combined , interconnected , sequenced , separated , interchanged , positioned , and / or rearranged without materially departing from the disclosed systems or methods . additionally , the shapes and sizes of components are also exemplary and unless otherwise specified , can be altered without materially affecting or limiting the disclosed technology . it is important to note that the construction and arrangement of the present application as shown in the various exemplary embodiments is demonstrative only . although only a few embodiments have been described in detail in this application , those who review this application can readily appreciate that many modifications are possible ( e . g ., variations in sizes , dimensions , structures , shapes and proportions of the various elements , values of parameters ( e . g ., temperatures , pressures , etc . ), mounting arrangements , use of materials , colors , orientations , etc .) without materially departing from the novel teachings and advantages of the subject matter described in the application . for example , elements shown as integrally formed may be constructed of multiple parts or elements , the position of elements may be reversed or otherwise varied , and the nature or number of discrete elements or positions may be altered or varied . accordingly , all such modifications are intended to be included within the scope of the present application . the order or sequence of any process or method steps may be varied or re - sequenced according to alternative embodiments . in the claims , any means - plus - function clause is intended to cover the structures described herein as performing the recited function and not only structural equivalents but also equivalent structures . other substitutions , modifications , changes and omissions may be made in the design , operating conditions and arrangement of the exemplary embodiments without departing from the scope of the present application . accordingly , the present application is not limited to a particular embodiment , but extends to various modifications that nevertheless fall within the scope of the appended claims . furthermore , in an effort to provide a concise description of the exemplary embodiments , all features of an actual implementation may not have been described ( i . e ., those unrelated to the presently contemplated best mode of carrying out the invention , or those unrelated to enabling the invention ). it should be appreciated that in the development of any such actual implementation , as in any engineering or design project , numerous implementation specific decisions may be made . such a development effort might be complex and time consuming , but would nevertheless be a routine undertaking of design , fabrication , and manufacture for those of ordinary skill having the benefit of this disclosure , without undue experimentation .	5
the salt form of the compound can be protonated as shown in the following : wherein x — represents a negatively charged counterion . the salt forms can also be present in the form of a solvate . the crystalline forms of the compound are characterized below by virtue of their x - ray powder diffraction ( xrpd ) patterns . the xrpd patterns were collected on a philips pw 3710 mpd control automated powder diffractometer . the x - ray generator employed a copper target , an accelerating potential of 45 kv and a filament emission of 40 ma . diffraction patterns were collected from about 2 ° to about 40 °. the nep ( 1 - ethyl - 2 - pyrrolidinone ) was characterized as having an xrpd pattern at 4 . 490 , 4 . 242 , 4 . 042 , 3 . 993 , 3 . 912 , 3 . 790 and 3 . 274 angstroms . more complete xrpd data pertaining to the compound is shown below in table 1 . the crystalline compound of the present invention is useful in various salt forms , for the synthesis of carbapenem compounds that are in turn useful for the treatment of bacterial infections in animal and human subjects . factors which are important in the salt selection , are cost of the raw materials , ease of crystallization , purity , yield , stability , hygroscopicity and flowability of the resulting intermediate . typically the intermediate compound is protonated , and is found in association with a negatively charged counterion , represented by the generic x — . there are various possibilities for the charge balancing counterion x — representative examples of such counterions are the following : acetate , adipate , aminosalicylate , anhydromethylenecitrate , ascorbate , aspartate , benzoate , benzenesulfonate , bicarbonate , bisulfate , bromide , citrate , camphorate , camphorsulfonate , carbonate , chloride , digluconate , edetate , edisylate , estolate , ethanesulfonate , fumarate , glucoheptanoate , gluconate , glutamate , glycerophosphate , glycolate , hydroxynaphthoate , 2 - hydroxyethanesulfonate , iodide , lactate , lactobionate , malate , maleate , mandelate , methylenebis ( salicylate ), mucate , methanesulfonate , napadisylate , napsylate , pamoate , pantothenate , pectinate , phosphate / diphosphate , polygalacturonate , propionate , salicylate , stearate , succinate , sulfate , tartrate , triflate , tosylate and undecanoate . other anionic species will be apparent to the ordinarily skilled chemist . the preferred counterion is chloride . the preferred form of the crystalline compound is the nep solvate form . the compound can be produced in accordance with the following non - limiting example . the boc protected sidechain 1 ( prepared according to the teachings of pct w097 / 06154 published on feb . 20 , 1997 ) was dissolved in 1 . 5 l of a 1 n solution of dry hydrogen chloride in acetic acid ( 30 min ). gas evolution was observed and the reaction product slowly crystallized . after filtering , washing ( with acetic acid and hexane ) and drying 137 g of non - solvated product was obtained . a slurry of the above product ( 50 g ) in n - ethyl pyrrolidinone ( 250 ml ) was heated to 45 ° c . to effect complete dissolution . toluene ( 250 ml ) was added slowly to the resulting solution . after aging at 40 ° c . for 40 min solids were produced and the mixture was allowed to cool to ambient temperature . after an additional age of 4 h the product was filtered , washed with nep / toluene 1 / 1 and toluene , and dried in vacuo to yield the nep solvate ( 80 % yield ).	2
in the analyzer system illustrated in fig1 of the drawings , a motor 14 is connected to an idler shaft 13 by means of a belt device 18 . a tachometer generator 15 is attached to the motor 14 for the purpose of generating a voltage proportional to the speed of the motor . a flywheel 17 is attached to the shaft 13 . a clutch / brake 16 is connected between the idler shaft 13 and a rotor driving shaft 12 of the analyzer by means of a shaft 43 and a coupling member 44 . the other analyzer parts shown in fig1 are of a more conventional nature . these include an encoding disc 23 , which provides the timing for the rotor and cuvete pulses , and the associated photodetector ( light source and detector ) 24 . it should be understood that two photodetectors are generally employed in fast analyzers , but only one is shown here for simplicity . there are four slip rings 21 with their mating brushes 22 , and the slip rings 21 are coupled to the rotor driving shaft 12 . two slip ring / brush combinations are used to carry the rotor temperature signal from a thermistor 25 , and two are used to carry current to a thermoelectric heat pump module 20 . the heat pump 20 is located in a recess in the rotor holder 11 , and is positioned below a rotor 19 for any desired heating thereof . the thermistor 25 is encased in a copper - tipped pin that fits into a mating hole in the rotor 19 for monitoring the temperature of the rotor . the system of lamps , lenses and filters is likewise of conventional design . a side lamp 28 is used for light scattering and fluorescence measurements and a lens 42 and a filter 32 are associated therewith . a top lamp 29 is used for transmission / absorbence measurements , and a lens 41 and filters 37 and 31 are associated therewith . a photomultiplier tube 27 receives the primary data signals from the solution ( s ) in the cuvete ( s ) in the rotor 19 and gives the signal values by means of a line 9 to a microprocessor 26 after passage through an a / d converter 34 and a lead connection 46 . it should be understood that there are a plurality of filters 37 , one of which is selected by the filter select motor 45 , and also there are a plurality of filters 32 and 31 , a pair of which is selected by the filter select motor 35 for any given mode of operation . an interface 36 performs the necessary signal conversions between the fast analyzer and the microprocessor 26 . the various signals include signals to the lamps 28 and 29 over leads 1 and 2 respectively ; signals to the filter select motors 35 and 45 by means of leads 3 and 4 , respectively ; signals to the clutch / brake unit 16 by means of leads 10 ; signals to the heat pump 20 by means of the leads 5 and the associated pairs of brushes 22 and slip rings 21 ; signals from the thermistor 25 by means of the associated pairs of slip rings 21 and brushes 22 , and leads 6 to the interface 36 ; signals to the motor 14 by means of the leads 7 ; and signals from the tachometer generator 15 by means of the leads 8 to the interface 36 . the microprocessor 26 is also interconnected to a program storage unit 38 , to a data storage unit 39 , to a printer 33 over a lead line 47 , and to operator - actuated parameter input switches 40 . in the operation of the system of fig1 the following input parameters are selected by the operator dialing a selected program into the microprocessor by means of the parameter input switches 40 : the rotor 19 is loaded into the analyzer and , while being rotated at about 50 rpm , is preheated or precooled to the desired temperature . once the rotor is at the desired temperature ( as determined by the thermistor 25 ) the following sequence of events occur under the control of the microprocessor : 1 . the rotor is stopped with the light source 29 just in front of the first cuvete 30 . 2 . the motor 14 and the coupled flywheel 17 are accelerated to a speed of about 4500 rpm while at the same time the shaft 12 is held stationary by the energized brake of the unit 16 , the appropriate lamp ( 29 and / or 28 ) is turned on , the filter combination is selected by the motor 45 and / or the motor 35 , and the high voltage on the photomultiplier 27 is set . 3 . the brake is deenergized and the clutch is energized in the unit 16 . the rotor 19 is then accelerated to full running speed ( about 4000 rpm ) in about 100 msec . 4 . data acquisition begins at the beginning of the second revolution of the rotor , which is about 30 msec after the solutions have been transferred out into the cuvetes 30 . this acquisition is usually revolutions - based and continues for the sampling interval and number of samples based on the numer of revolutions of the rotor . each sample taken ( transmission counts for each of the seventeen cuvetes ) has a corresponding sample time that must be recorded to allow statistical interpretation of that data due to the changing rotor speed during the data acquisition . turning now to the results , the graph shown in fig2 is a plot of the counts per observation versus elapsed time for a mixture of two dye solutions at a constant acceleration of 3100 rad / sec 2 . it will be seen that transfer is completed in a 40 msec period of revolution from cuvete 4 to cuvete 17 , approximately . more than 90 % of the absorbence is observed by cuvete 11 and the time interval to reach this cuvete is about 22 msec . thus , transfer occurs completely in 22 to 40 msec after the liquid starts into the cuvetes . the rapid mixing of the respective samples and reagents in the respective cuvetes of the rotor , by the fast acceleration of the rotor after the clutch of the unit 16 is energized , will effect the rapid clearing away of any bubbles or froth from the reactions that would interfere with data taking . the above results show that the system described above is therefore capable of remarkable fast time - based data acquisition , and is ideally suited to reaction rate and stopped - flow types of measurements . it should be understood that there are at least three basic types of operation of the system of fig1 . the first is when only the lamp 29 is energized and the appropriate filter 37 is selected by the motor 45 for use with the lamp 29 for transmission / absorbence measurements ; the second is when only the lamp 28 is energized and the appropriate pair of filters 31 and 32 are selected by the motor 35 for use with the lamp 28 for light scattering and fluorescence measurements ; and the third is when neither lamp 28 nor 29 energized and chemiluninescence measurements from the reactions in the cuvetes are being made . it should be understood that there is still a fourth possible type of operation of the system of fig1 if such is desired , wherein both the lamps 28 and 29 are alternately energized and the selected ones of the respective filters 31 , 32 and 37 are selected for use with the respective lamps 28 and 29 . it should be apparent that this invention will allow rapid kinetic and stopped - flow analysis to be performed simultaneously up to 17 samples in parallel . this invention has been described by way of illustration rather than by limitation and it should be apparent that it is equally applicable in fields other than those described .	6
the inventive robot 100 has a large compartment 1 in fig1 which serves as the pedestal . it also serves as a container for three of the four motors and , in addition , optionally , the electronics to control the robot 100 . normally these electronics are partially housed in large remote cabinets connected to the robot with cables . a sleeve 2 is fixed to the top surface of 1 . this sleeve contains bearings through which runs the drive tube 3 . drive tube 3 is affixed at its lower end to a large synchronous belt pulley 4 . at its upper end it is bolted to the upper arm 5 . thus rotation of the pulley 4 will rotate the upper arm 5 in precisely the same degree . the drive tube 4 contains bearings wherein rotates concentrically , a drive tube 6 . at its lower end it is affixed to a synchronous pulley 7 . at its upper end it is affixed to a further synchronous pulley 8 . this provides means such that rotation of 7 causes rotation of 8 . the drive tube 6 in its turn contains bearings in which can rotate , concentrically , a drive tube 9 . again there are synchronous pulleys attached at the upper and lower ends of this drive tube . this arrangement therefore provides three rotatable drive tubes which can rotate concentrically but independently when driven by the pulleys at their lower ends . drive tube 9 has a synchronous pulley 18 at its upper end and another one 17 at its lower end . motors with suitable gearheads are provided within the compartment 1 such that these pulleys 4 , 7 , 17 can be appropriately driven by the use of synchronous belts . means are provided for sliding the motors and locking them in position in order to tension the belts . a further set of pulleys and a central concentric tube , 28 is provided . the function of this tube is to ensure safe passage for electrical wires and tubes to pass up the center of the composite structure . to the distal end of the upper arm 5 is affixed a hub 10 . this hub contains two bearings through which passes a drive tube 11 . to its lower end is bolted the lower arm 12 . to its upper end is bolted a synchronous pulley 13 . rotation of this pulley 13 therefore causes commensurate rotation of the lower arm . within the drive tube 11 are bearings in which runs a further drive tube 14 . to the top end of this drive tube is affixed a synchronous pulley 15 and to its lower end is affixed another synchronous pulley 16 . bearings and a central tube 29 are provided to ensure safe passage of wires and tubes through the center of this structure . the pulleys 8 and 13 are girdled by a synchronous belt with a suitable idler tensioner device such that rotation of pulley 7 leads to a proportional rotation of the lower arm 12 . pulleys 15 and 18 are similarly girdled such that rotation of 17 leads to a proportional rotation of 16 . idler pulleys 19 and 20 are positioned at the distal end of the lower arm . they are arranged so that the lower pitch surface of 19 and the upper pitch surface of 20 are both at the same height as the centerline of the pulley 16 . this is done to minimize distortion of the drive belt . it allows the belt teeth to mesh cleanly , even though the belt is twisted through 90 degrees . a quill 21 is arranged as to move vertically within a guidance system at the end of the lower arm 12 . a synchronous belt 22 is attached to the lower end of the quill at 23 . it passes over the idler pulley 20 , around the drive pulley 16 , under the idler pulley 19 and is attached , with means for tensioning at the top of the quill at 24 . thus any rotation of the pulley 17 will lead to rotation of the drive pulley 16 and thus to vertical movement of the quill 21 . this arrangement permits the quill to have a very large stroke . within the bottom end of the quill is affixed a motor 25 with gearhead 26 . a drive shaft 27 is driven via a coupling and suitable support bearings by the output shaft of the gearhead 26 . a flange 27a is affixed to the end of the drive shaft . each of the four motors has an encoder . in addition , encoders are provided at the endpoint of each motion except the final rotation of the motor 25 so that allowances can be made for the imprecisions of synchronous belt drives . these encoders can be magnetically encoded strips 27c wound around the pulleys 4 and 13 and fixed linearly to the quill 21 , together with reading heads . these well known components are commercially available and provide a reading of position at the point of final action and are independent of imprecision of the synchronous belts . a commercially available control printed circuit board , resident in a computer , is fed with these seven encoder signals and has suitable software and is otherwise capable of reconciling encoder readings so that the end motion is accurate , notwithstanding the vagaries of synchronous belt drive . thus , those skilled in the art can program a computer such that desired motions will be mediated by this control unit and result in precise movement of the end drive flange 27a in four degrees of freedom , when driven by the four motors through appropriate hardware . in addition to these encoders , a further set of absolute encoders is provided so that the unit can evaluate its joint positions at start up , without excessive movement . these take the form of thin metal disks attached to the pulleys 4 and 13 and to the drive flange 27 . in addition a linear scale is attached to the quill 21 . these encoder discs and scale have slits cut into their edges such that a light beam can be interrupted by the motion of the slit . the position of these slits is arranged so that their spacings follow an increasing progression . a light interruption module is positioned so that movement of the disc or scale leads to characteristic signal from the light interruption module . this signal is fed back to the controlling computer . at startup , the computer can mandate a slow move of all four motors and by monitoring the signals which it obtains from these absolute encoders , can infer the exact position of each axis with limited total motion . fig2 ( a - c ) shows the arrangement of the quill guidance system . in one configuration , the quill is formed upon a flat plate 30 . this baseplate has grooves along opposing edges , wherein can nestle hardened circular steel rods 31 . these rods are affixed to the base by screws . sides 32 are constructed from plate and bolted or cast onto the base in order to provide a compound structure of considerable rigidity . a cover 33 is bolted onto the front of the structure . the hardened rods 31 run within four sets of three cam followers each . in fig3 each cam follower is composed of a commercially available ball bearing 34 , with heavy outer race . each bearing 34 fits upon an eccentric shaft 35 , retained by a snap ring . this shaft is a portion of a larger threaded shaft 36 , with screw driver slot 37 and locknut 38 . by rotating this unit by means of a screwdriver , the cam followers 34 may be adjusted to bear correctly against the hardened rods 31 . the locknuts 38 may then be tightened to secure the arrangement . in this way the quill may slide up and down with very little friction , but , at the same time be very firmly guided so that it may not move laterally . one realization of this principle is depicted in fig4 . articulator 400 provides two further degrees of motion . the articulator 400 may bolt onto the drive shaft 27 in fig1 and in fig4 in place of the flange 27a in fig1 . a steel brake disk , 40 is attached to the quill body 21 . a bolt 41 and suitable spacers permits the drive flange 27 to be rigidly connected to the first motion shaft 42 . the arrangement is such that the very large tensile force of the bolt is transmitted down the spacers which surround the shaft . in this way , the radius arm of the torque is increased and there is adequate resistance to torque and bending moments . a helical bevel gear 43 is rigidly held on the end of the shaft 42 by the spacers . bearings are provided such that the shaft is firmly located axially within the first housing 45 but is free to rotate within the housing . a circular brake shoe 46 , covered with friction material 47 is fixed to the housing 45 by means of a thin sheet of spring steel 48 . this prevents any rotation of the brake shoe relative to the housing 45 but allows some axial float of the brake shoe 46 within the limits of elasticity of the sheet 48 . two springs 49 and two air cylinders 50 placed diametrically opposed to each other provide means whereby the brake shoe 47 can be withdrawn from contact with the brake disc 40 , thus allowing the housing 45 to rotate freely with respect to the quill 21 . when pressure is released from the air cylinders 50 , the springs 49 will cause the brake shoe 46 to bear strongly against the brake disc 40 and thus prevent relative movement between the housing 45 and the quill 21 . that is brake system a . as an alternative , an annular air cylinder arrangement could be used whereby an annular piston sealed by o rings could slide axially around the center shaft 42 . the housing 45 is firmly bolted to a housing 44 to make the two housings integral . this housing 44 contains a shaft 51 , running in bearings 52 . a bevel gear 53 , pressed onto this shaft runs together with the gear 43 to provide drive to this shaft from the primary shaft 42 . a braking system similar to the first system is deployed upon this structure and permits force to be applied to braking material 55 such that it will rub against a brake disc 60 . brake system b includes a brake disc 60 that is integral with the housing 61 which is bolted integrally to housing 61a . the shaft 51 extends out of the housing 44 and protrudes into housing 61 , being suitably supported in bearings 62 . the integral housings 61 , 61a have bearings 63 wherein runs a shaft 64 onto which is pressed a bevel gear 65 . a brake system similar to that previously described allows friction material 66a , structurally integral with the housing 61 , 61a to rub against a brake disc 66 which is integral with the output shaft 64 . that is brake system c . the output shaft 64 , for convenience , provides a rotatable air supply 68 , with ` o ` ring seals 69 so that grippers 71 attached to the output flange 67 can be air operated and have unlimited rotation without restriction . two dynamic encoders 70 are affixed to the housings 41 , 41a and 61 , 61a so that they can measure the relative motion of shaft 51 with respect to the housings . the drive motor 25 in fig1 also has an encoder . means are provided for a computer to read and report the values given by these three encoders . means are also provided that air solenoids can be switched under computer control , to activate any or all of the three brake systems . in order to control the orientation of the output flange , brake system ( c ) is released . then there is no restriction to the rotation of the output shaft 64 with respect to the housing 61 , 61a . brake systems a and b are locked thus the quill , housing 44 , 44a and 61 , 61a are rigidly juxtaposed . in this condition , any rotation of the motor 25 will operate through the gearhead , output flange 27 , shaft 42 , shaft 51 , and shaft 64 to rotate the final flange 67 . if only brake a is released and brakes b and c are locked , then any rotation of the shaft 27 will cause housing 44 , 44a to rotate with the shaft 27 . since housing 61 , 61a and flange 67 are locked together , they will both rotate together . similarly , if only brake ( b ) is released then relative motion between housings 44 , 44a and 61 , 61a can be accomplished . by reading the encoders 7 and the encoder of the motor 25 , and knowing the relative gear ratios , those skilled in the art can execute precise control of the end effector flange 67 in three degrees of motion by controlling each motion sequentially .	1
each embodiment is performed on series of ct image slices obtained from a ct scan of the chest area of a human or animal patient . each slice is a 2 - dimensional digital grey - scale image of the x - ray absorption of the scanned area . the properties of the slice depend on the ct scanner used ; for example , a high - resolution multi - slice ct scanner may produce images with a resolution of 0 . 5 - 0 . 6 mm / pixel in the x and y directions ( i . e . in the plane of the slice ). each pixel may have 32 - bit grayscale resolution . the intensity value of each pixel is normally expressed in hounsfield units ( hu ). sequential slices may be separated by a constant distance along the z direction ( i . e . the scan separation axis ); for example , by a distance of between 0 . 75 - 2 . 5 mm . hence , the scan image is a three - dimensional ( 3d ) grey scale image , with an overall size depending on the area and number of slices scanned . the present invention is not restricted to any specific scanning technique , and is applicable to electron beam computed tomography ( ebct ), multi - detector or spiral scans or any technique which produces as output a 2d or 3d image representing x - ray absorption . as shown in fig1 , the scan image is created by a computer 4 which receives scan data from a scanner 2 and constructs the scan image . the scan image is saved as an electronic file or a series of files which are stored on a storage medium 6 , such as a fixed or removable disc . the scan image may be processed by the computer 4 to identify the extent of a lung nodule , or the scan image may be transferred to another computer 8 which runs software for processing the image as described below . the image processing software may be stored on a carrier , such as a removable disc , or downloaded over a network . fig1 a illustrates an example computer system 200 , in which the present invention can be implemented as programmable code . various embodiments of the invention are described in terms of this example computer system 200 . after reading this description , it will become apparent to a person skilled in the art how to implement the invention using other computer systems and / or computer architectures . the computer system 200 includes one or more processors , such as processor 204 . processor 204 can be a special purpose or a general purpose digital signal processor . the processor 204 is connected to a communication infrastructure 206 ( for example , a bus or network ). various software implementations are described in terms of this exemplary computer system . after reading this description , it will become apparent to a person skilled in the art how to implement the invention using other computer systems and / or computer architectures . computer system 200 also includes a main memory 208 , preferably random access memory ( ram ), and may also include a secondary memory 210 . the secondary memory 210 may include , for example , a hard disk drive 212 and / or a removable storage drive 214 , representing a floppy disk drive , a magnetic tape drive , an optical disk drive , etc . the removable storage drive 214 reads from and / or writes to a removable storage unit 218 in a well known manner . removable storage unit 218 , represents a floppy disk , magnetic tape , optical disk , etc . which is read by and written to by removable storage drive 214 . as will be appreciated , the removable storage unit 218 includes a computer usable storage medium having stored therein computer software and / or data . in alternative implementations , secondary memory 210 may include other similar means for allowing computer programs or other instructions to be loaded into computer system 200 . such means may include , for example , a removable storage unit 222 and an interface 220 . examples of such means may include a program cartridge and cartridge interface ( such as that found in video game devices ), a removable memory chip ( such as an eprom , or prom ) and associated socket , and other removable storage units 222 and interfaces 220 which allow software and data to be transferred from the removable storage unit 222 to computer system 200 . computer system 200 may also include a communication interface 224 . communication interface 224 allows software and data to be transferred between computer system 200 and external devices . examples of communication interface 224 may include a modem , a network interface ( such as an ethernet card ), a communication port , a personal computer memory card international association ( pcmcia ) slot and card , etc . software and data transferred via communication interface 224 are in the form of signals 228 which may be electronic , electromagnetic , optical , or other signals capable of being received by communication interface 224 . these signals 228 are provided to communication interface 224 via a communication path 226 . communication path 226 carries signals 228 and may be implemented using wire or cable , fiber optics , a phone line , a cellular phone link , a radio frequency link , or any other suitable communication channel . for instance , the communication path 226 may be implemented using a combination of channels . in this document , the terms “ computer program medium ” and “ computer usable medium ” are used generally to refer to media such as removable storage drive 214 , a hard disk installed in hard disk drive 212 , and signals 228 . these computer program products are means for providing software to computer system 200 . computer programs ( also called computer control logic ) are stored in main memory 208 and / or secondary memory 210 . computer programs may also be received via communication interface 224 . such computer programs , when executed , enable the computer system 200 to implement the present invention as discussed herein . accordingly , such computer programs represent controllers of the computer system 200 . where the invention is implemented using software , the software may be stored in a computer program product and loaded into computer system 200 using removable storage drive 214 , hard disk drive 212 , or communication interface 224 , to provide some examples . an embodiment comprises image - processing software for detecting the extent of pulmonary nodules , which appear attached to one or more blood vessels within a ct image , or isolated nodules , which are not adjacent to any other feature in the ct image . this embodiment uses a fuzzy / contrast region - growing scheme as described below . a flowchart of the algorithm is shown in fig2 , and references to step numbers in the description below are to steps in this flowchart . a sample scan image is shown in fig3 , and the results of progressive processing steps on the image are shown in fig4 to 8 . an output of the algorithm , based on the sample scan image , is shown in fig9 . the user of the software inspects the image to identify an area containing a nodule and selects a seed point ( step 12 ), within a specified one of the slices , which appears to be within the nodule . the remainder of the image processing is preferably carried out without user input ; hence , the process is semi - automated . in an alternative embodiment , the user may be required to identify an area containing a nodule , for example by drawing a box or other shape around the area . the seed point may be derived from that area , for example by taking as the seed point the centre of the area or the point having the highest intensity within the area . the user of the software may be a radiologist , who can be relied upon to identify a point within a nodule . the user may instead identify a point close to a nodule , but not falling within it . as will be explained in more detail below , the method derives an optimum seed point which is insensitive to the precise seed point location chosen by the user , even in some cases where the initial seed point is outside but close to a nodule . however , if the initial seed point is clearly in a background area , because the intensity at the seed point is low , the initial seed point may be moved automatically to a nearby point of high intensity before the rest of the algorithm is applied . in an alternative embodiment , the seed point may be identified from the scan image automatically , and input to the processing steps below . in that case , no user input is required , so that the process becomes fully automatic . first , a rough estimate is obtained of the extent of the region by means of a local threshold - based segmentation process ( step 14 ). a local 3d volume of about 3 cm in each direction ( for example , 61 × 61 × 21 pixels at 0 . 5 mm / pixel in the x and y directions , 1 . 5 mm separation in the z direction ), centered on the seed point , is cropped from the whole 3d image , and a local adaptive segmentation algorithm is performed using a local 3d mask of 11 × 11 × 3 pixels , so as to segment the image into a plurality of connected objects , as described below . alternatively , a 2d local mask of 11 × 11 cm may be used . the local mask is used to derive a threshold intensity value for each point . this means that the threshold is sensitive to the local contrast and can distinguish low contrast nodules from their background . the threshold intensity is set to be the mean of the centroids of the intensity above and below the threshold . a . define the local mask for that pixel b . set initial threshold intensity as the average intensity within the mask c . calculate a histogram of intensity within the mask area d . repeat : i . calculate the centroid c 1 of the part of the histogram below the threshold intensity ii . calculate the centroid c 2 of the part of the histogram above the threshold intensity iii . update the threshold to the mean of c 1 and c 2 e . until the threshold converges to the mean of c 1 and c 2 f . shift the threshold by a constant intensity value , which is predetermined according to the application g . if the intensity of the current pixel is higher than the shifted threshold , define this pixel as foreground ; otherwise , define it as background the result of fine segmentation on the sample image is shown in fig4 . note that fig4 to 7 are binary images ; any grey levels in the images are printing artefacts . the foreground objects acquired by fine segmentation may include ‘ holes ’ i . e . background pixels surrounded by foreground pixels . this arises because of the sensitivity of the fine segmentation to small local differences in contrast . since the foreground objects may represent nodules , they are expected to be solid . hence , a hole - filling algorithm is used to fill such holes ( step 16 ), in other words to convert them to foreground pixels . any suitable hole - filling algorithm may be used . for example , a polygon is fitted to an object containing a hole within a slice , and the pixels within the polygon are all set as foreground . the result of hole filling in the sample image is shown in fig5 . the slice which contains the seed point will normally comprise many segmented regions . the region which contains the seed point is determined using a 3d binary region - growing scheme ( step 18 ). the binary region - growing algorithm is first performed on the slice containing the seed point , as follows : 1 ) label the seed point 3d pixel (‘ voxel ’) as belonging to the desired region 2 ) assign the same label to all neighboring foreground voxels 3 ) repeat a . take each labeled voxel and assign the same label to each of its neighboring foreground voxels in other words , the label propagates to neighboring foreground voxels , starting with the seed point . neighboring voxels are those within the slice that are displaced by one pixel spacing in the horizontal ( x ) and / or vertical ( y ) direction . one possible implementation of the binary region - growing algorithm involves the use of a stack to store unlabelled neighboring voxels . as is well known , a stack is last - in , first - out data structure in which the last element added or ‘ pushed ’ onto the stack is the first element which can be retrieved from or ‘ popped ’ off the stack . the implementation proceeds as follows : a . pop voxel off stack b . assign label to popped voxel c . push all adjacent unlabelled foreground voxels onto stack connected regions in adjacent slices , or in the z direction generally , are determined using the binary region - growing algorithm described above , but taking as the seed point the pixel having the same x and y coordinates as the seed point in the initial slice . in other words , the seed point is displaced in the slice spacing direction ( z ) to generate a seed point in the current slice and the corresponding regions in adjacent slices are labeled in the same way . the user may choose a seed point close to the edge of a nodule in a slice , which no longer falls within the nodule if directly transposed into the next slice . to solve this problem , in one alternative the seed point in the new slice may have the x and y coordinates of the centre of the labeled region in the previous slice . in a second alternative , once the labeled region has been determined in one slice , a circular core of pixels is defined around the centre of the labeled region . a foreground pixel in the new slice having the x and y coordinates of one of the core pixels in the old slice may be taken as the seed pixel in the new slice . if the seed point in the new slice is not a foreground pixel , or there are no foreground pixels in the displaced core of the second alternative , then no more slices are considered in that direction . once the regions have been connected in both directions from the initial slice , the process of identifying connected regions ends , with a single labeled 3d region encompassing the seed point . the labeled region in the sample image is shown in fig6 . the 3d labeled region encompassing the seed point is defined as the foreground region f ; this region is expanded as described below , to serve as a mask for further processing . the foreground region f is expanded using a distance transform method to obtain a mask m containing both foreground and background ( step 20 ). this is important , since lack of background will result in non - optimal estimation of parameters used in subsequent region - growing algorithms . the proportions of foreground and background may be approximately equal . a known 2d distance transform method is applied to the inside part of the foreground region f in each slice , and the maximum distance s to the boundary is obtained , indicating the size of the foreground region . the 2d distance transform method is then applied to the outer side of the region , until the boundary of the expanded region has a distance s from the boundary of the foreground region f . next , the foreground objects segmented by the fine segmentation process that are not labeled as part of the foreground region f are removed from expanded region . the expanded region including the foreground region f , but with the unlabelled foreground objects removed , is defined as a mask m . a background region b is defined by subtracting the foreground region f from the mask m . the mask m , the foreground region f and the background region b are used for subsequent calculations . the mask m for the sample image is shown in fig7 . as described so far , the definition of the mask m depends on the selection of the seed point by the user . for the results of the detection algorithm to be reproducible , a user - independent seed point must be obtained . this is done by defining an ‘ optimum union mask ’ m 0 , which is initially a null region . at the beginning of each iteration , m 0 is replaced by the union of m and m 0 . a central core or ‘ yolk ’ of the mask m 0 is found using a distance transform method to erode k layers of the mask m 0 . the pixel with highest intensity within the yolk of the mask m 0 ( or optionally , the highest intensity point on the longest line in the z direction within the yolk ) is defined as the seed point s 0 ( step 22 ) and the entire process described above from ‘ 1 . 1 find foreground region ’ ( steps 14 to 22 ) is repeated with s 0 instead of the initial user - selected seed point . the process is repeated until m 0 converges to m , to within a predetermined degree ( step 24 ). { findunion ( m 0 , m ) findyolk ( m 0 , yolk ) s 0 = getmaxintensitypoint ( yolk ) m = find mask ( m 0 , s 0 ) } while ( m 0 ! = m ) the optimum seed point s 0 is taken as the highest intensity point on the longest line in the z direction within the mask . if it is not the same as the user - provided seed point , the optimum seed point is taken as the new seed point . all subsequent steps are performed using the optimum mask m 0 and optimum seed point s 0 . foreground segmented objects excluded by the fine segmentation and binary growing , and therefore falling out side the mask m 0 , cannot therefore affect the determined extent of the nodule . the mean and the standard deviation of the intensity and gradient distributions of the foreground and background regions f and b are determined . the mean of the background intensity μ b , the mean of the foreground intensity μ f , the standard deviation of the background intensity σ b and the standard deviation of the foreground intensity σ f are calculated . a parameter ε is estimated by counting the number of the foreground standard deviations σ f that the seed point is away from the background mean intensity μ b and this is taken as the measure of the contrast , which is subsequently used in constructing a fuzzy map as described below . a fuzzy object extraction technique is used to define a 3d map of fuzzy connectivity of each pixel within the mask m 0 with respect to the optimum seed point s 0 ( step 26 ). a fuzzy affinity function between adjacent pixels is defined and the fuzzy connectivity between each pixel and the optimum seed point s 0 is derived by finding the affinity along a path between the pixel and the optimum seed point s 0 . the fuzzy connectivity between two points ( not necessarily adjacent ) is obtained by considering the path with the strongest affinity between two points . the path with the strongest affinity is chosen as the best path and the strength of each path is equal to that of the weakest affinity of adjacent points along the path . this concept is illustrated in fig1 , where two possible paths between points p 1 and p 10 are depicted . think of this as a set of ropes tied together with different thicknesses and therefore different strengths . if the top chain of ropes ( from p 1 to p 10 ) is pulled apart , it will break at the p 2 - p 3 link ; while the bottom set of ropes will break at the link p 8 - p 9 . therefore the bottom rope is stronger than the top one with the strength equal to the strength of p 8 - p 9 link . the strength between two adjacent points is the affinity between those points . the affinity between two spatial elements ( spels )— either 2d pixels or 3d voxels — is a measure of the probability that they belong to the same object . this probability is a function of closeness ( i . e . euclidian distance ) and the similarity of the image features ( i . e . intensity ) between those spels . fuzzy affinity must satisfy the following conditions : symmetric : for all ( x , y ) ε x × x , μ ( x , y )= μ ( y , x ) where μ ( μ : x × x −& gt ;[ 0 , 1 ]) represents the fuzzy affinity for a 2 - ary relation . the first condition indicates that the fuzzy affinity of a spel to itself is always 1 , and the second condition indicates that the fuzzy affinity of point 1 to point 2 is the same as that of point 2 to point 1 . μ k =( c , d )= h ( μ a ( c , d ), f ( c ), f ( d ), c , d ) where h is a scalar value with range [ 0 , 1 ], c and d are image locations of two spels , and f ( i ) is the intensity of spel i . μa is an adjacency function based on distance between two spels which , for n - dimensional coordinate spels , is given by , μ a ⁡ ( c , d ) = { 1 , if ⁢ ⁢ ∑ i = 1 n ⁢ ( c i - d i ) 2 ≤ 1 0 , otherwise μ k ( c , d )= μ a ( c , d )└ ω i h i ( f ( c ), f ( d ))+ ω g ( 1 . 0 − h gk ( f ( c ), f ( d )))┘ if c ≈ d , and where the subscripts ‘ i ’ represents the calculations related to intensity and ‘ gk ’ represents the calculations related to gradient values in relevant direction ( which could be x , y , z ) respectively . ω i and ω g are free parameter weight values whose sum is 1 . the value of 0 . 9 for ω i and 0 . 1 for ω g has been chosen to allow intensity similarity to have more effect . the fuzzy affinity that was used for the current function is : h i ⁡ ( f ⁡ ( c ) , f ⁡ ( d ) ) = ⅇ - [ ( 1 / 2 ) ⁢ ( f ⁡ ( c ) + f ⁡ ( d ) ) - m i ] 2 ( s d ) 2 h gx ⁡ ( f ⁡ ( c ) , f ⁡ ( d ) ) = ⅇ - [ (  f ⁡ ( c ) - f ⁡ ( ⅆ )  / ⅆ x ) - m gx ] 2 ( s gx ) 2 h gy ⁡ ( f ⁡ ( c ) , f ⁡ ( d ) ) = ⅇ - [ (  f ⁡ ( c ) - f ⁡ ( ⅆ )  / ⅆ y ) - m gy ] 2 ( s gy ) 2 h gz ⁡ ( f ⁡ ( c ) , f ⁡ ( d ) ) = ⅇ - [ (  f ⁡ ( c ) - f ⁡ ( ⅆ )  / ⅆ z ) - m gz ] 2 ( s gz ) 2 where m i , s i , m g and s g are the gaussian parameters for the intensity and gradient . these can be predefined , or are estimated from a small region around the seed point as described below . the mean and standard deviation σ of the intensity and gradient are calculated over all points within the optimum mask m 0 . the parameters related to the gradients are computed in three directions ( x , y and z ) separately . the corresponding σ are calculated based on the difference between maximum and minimum gradient . the calculation of the statistics is now described in more detail . the parameter m i is taken as the intensity of the seed whereas m gx , m gy and m gz are taken as the means of the gradients in x -, y -, and z - direction respectively . the parameters s gx , s gy and s gz are the standard deviation of the gradients in their respective direction . the standard deviation ( s d ) appearing in the affinity expression plays a major role in the formation of the fuzzy map and hence the determination of the boundary of the nodule . if it is too big , the affinity curve will be relatively flat . resultantly , the background region will have higher affinity and region growing will result in over - segmentation . on the other hand , if it is too small , the shape of the affinity curve will be narrow and the foreground will have less affinity with the seed and the result would be under - segmented . ideally , the curve should be spread to such an extent that the background has minimal but finite affinity with the seed . isolated nodules are under - segmented and pulmonary nodules are over - segmented if no correction is made for the standard deviation of the affinity curve . also , it has been observed that isolated nodules have higher contrast than pulmonary nodules . we therefore adjust s d by taking into consideration the above findings . a factor f t is determined and multiplied by the s f ( foreground standard deviation ) to get a value of s d which is actually used in the fuzzy expression . the significance of the difference of means of two samples can be measured by a statistic called students t . we use this as an indicator of the contrast between the foreground region f and the background region b . let n f be the number of the voxels in the foreground region f and n b be the number of voxels in the background region b . let x i be the intensity at voxel i . μ f and μ b are the means of the foreground and background regions . for two distributions having same variance , the t - value is calculated as follows : first , the standard error of the difference of the means from the pooled variance is calculated as : se = [ ∑ i ∈ a ⁢ ( x i - μ f ) 2 + ∑ i ∈ b ⁢ ( x i - μ b ) 2 n f + n b - 2 ⁢ ( 1 n f + 1 n b ) ] a higher value of t represents higher contrast . it has been observed that for isolated nodules the t - value is lower than for those attached to blood vessel , indicating that the isolated nodules have high partial volume effect . we use this information to expand / limit the affinity gaussian curve by modifying the standard deviation . for lower t - values , the curve is narrow and does not reach to the background mean , so the curve is expanded until the background has some affinity . for higher t - values , the background will have higher affinity , as it is closer to foreground , so the fuzzy affinity curve is made narrow by reducing its standard deviation . the inventor has conducted experiments and found an empirical relationship as follows . the values are clipped to 1 (− 1 ) if f - value is greater ( lower ) than 1 (− 1 ). if f & gt ; 0 , f is multiplied by 2 . 5 . if f & lt ; 0 , it is multiplied by 3 . let s f and s b be the standard deviations of the foreground and background regions respectively . s f is divided by 1 . 25 to make it more aggressive to ensure that we get more regions for isolated nodules . f t =( x seed −( μ b + s b * f ))/ s f f t is limited between 1 . 5 to 9 . a ) an n - dimensional ( nd ) array to hold the fuzzy connectivity of the voxels . b ) a queue ( q ) to which potential spels are added . c ) a threshold value ( x ). d ) f o ( c ) is the fuzzy connectivity of spel c e ) μ k ( c , d ) is the fuzzy affinity between two adjacent spels ‘ c ’ and ‘ d ’. 1 . set all nd cells to zero except for the seed value . 2 . push all spels whose fuzzy affinity to the seed is more than zero , i . e . μ k ( o , c )& gt ; 0 to q . while q not empty 3 . remove a spel c from q 4 . if ( f o ( c )& lt ; x ) then 5 . find f max = max [ min ( f o ( d ), μ k ( c , d ))] 6 . if f max & gt ; f o ( c ) and f max & gt ; x then 7 . set f o ( c )= f max 8 . push all spels e such that μ k ( o , e )& gt ; 0 to q . endif endif endwhile step 1 : the seed is the only spel in the object . step 2 : the immediate neighboring spels with fuzzy affinity more than zero are considered . step 3 : if its connectivity is higher than threshold , no need to check it again . step 4 : the neighbors added in step 2 are examined one by one step 5 : find which among all neighboring spels has the strongest link . the strength of each link is the minimum of the fuzzy connectivity value of the neighboring spel and the fuzzy affinity . i . e . the fuzzy connectivity of each spel holds the fuzzy path strength from the seed value . step 6 & amp ; 7 : if the calculated value in step 4 is larger than the threshold value , set the connectivity of the current spel to this value . step 8 : consider all the neighboring spels that have fuzzy affinity more than 0 when the fuzzy threshold is set to zero , the algorithm finds the fuzzy connectivity value for each voxel in the image relative to the seed point s 0 . this image can be considered as an enhanced image whose voxels represent how strongly they are attached to the seed point . the fuzzy map for the sample scan image is shown in fig8 . the fuzzy map can be used to find the approximate extent of the nodule , by setting a fuzzy threshold to a predetermined value greater than zero . experimental results using this technique are described below . fig1 and 12 each show a set of original scan slices , and the approximate boundary of the nodule superimposed on the original image . in fig1 , the threshold was set at 0 . 92 , with predetermined foreground mean of − 100 and standard deviation of 700 , while in fig1 , the threshold was set at 0 . 64 , with predetermined foreground mean of 10 and standard deviation of 1500 . the algorithm can find the initial estimate by calculating the standard deviation and mean of intensity and gradient within a sub - window around the seed point . fig1 and 14 show the results when the region statistics are estimated by the algorithm from the scan image , using the original images of fig1 and 12 respectively ; note that the results were obtained after trying various different values of the fuzzy threshold . for fig1 , the fuzzy threshold of 0 . 92 was set with the estimated mean of − 255 and standard deviation of 780 ; while for fig1 , the fuzzy threshold of 0 . 9 was used with an estimated mean of 22 and standard deviation of 3270 . the estimated number of voxels included in the nodule region provides a test for reproducibility . the region growing was carried out from different seed locations and all returned the same region size . this is shown in fig1 a to 15 c : 9 a ) seed : 114 , 170 , 9 9 b ) seed : 114 , 172 , 8 9 c ) seed : 112 , 170 , 10 which all produced the same region size of 180 voxels , as shown in fig1 d . to illustrate the effect of the fuzzy map , the fuzzy threshold was set to zero and region growing was performed to calculate the fuzzy connectivity of each voxel within a predetermined radius , without restriction to the mask m 0 . the results can be seen in fig1 a to 16 d , where 16 b is a fuzzy map of the nodule shown in 16 a , while 16 d is a fuzzy map of the nodule shown in 16 c . the accuracy of the nodule boundary detected using fuzzy thresholding depends on selection of a suitable threshold value . experimental results show that there is no one threshold value suitable for all scans of isolated and pulmonary lung nodules . thresholding on the fuzzy map may be acceptable in some circumstances , but a preferred technique is described below . instead of setting an arbitrary threshold , the unthresholded fuzzy map can be used as an input to further steps to improve the segmentation . in a preferred embodiment a parameter - free algorithm , using contrast based region growing , is applied to the fuzzy map . in this case , the user only needs to provide the seed point , with no threshold adjustment . the algorithm is applied only to the area within the mask , excluding its borders and the thorax region . the thorax region is estimated by employing a coarse segmentation scheme . the algorithm is applied to the fuzzy map of the scan image , rather than the original scan image . to explain the contrast - based region growing process the following terms are introduced . fig1 shows the intensity profile of an object ( a bright blob ). the current boundary is the set of pixels adjacent to the current region during the growing process . the internal boundary is defined as the boundary produced by the set of connected outermost pixels of the current region . the current region and the two boundaries dynamically change during the growing process . the peripheral contrast of the region is defined as the difference between the average grey level of the internal boundary and average grey level of the current boundary . c per is the peripheral contrast of a region , { overscore ( f )} 1b is the average fuzzy connectivity of the internal boundary and { overscore ( f )} cb is the average fuzzy connectivity of the current boundary . c per = ∑ ln ⁢  fx 2 + fy 2  n fx is the x - gradient of the fuzzy connectivity of the internal boundary points and fy is the y - gradient of the fuzzy connectivity of the internal boundary points . cav = ∑  f i - f _ f  n where f i is the fuzzy connectivity for point i on the current boundary , { overscore ( f )} f is the mean fuzzy connectivity of the foreground region f , and n is the number of points on the current boundary at each iteration of the contrast - based region growing ( step 28 ), one pixel is selected from the current boundary and added to the current region . the selection priority of pixels in the current boundary is determined on the basis of their intensity and the distance to the centre of the current region . the combination of intensity and distance produces a single priority factor w . w = w i * w d ( 1 ) w i = 1 1 + k1 * ( f i - f _ f ) ( 2 ) w d = 1 1 + k2 * d ( 3 ) k1 and k2 are the weighting factors . in general , k1 + k2 ≠ 1 . in one example , k1 = 0 . 01 and k2 = 0 . 1 . d is the distance between the candidate pixel and the seed s 0 . when a pixel is added into the current boundary , the internal boundary and the current boundary are updated . the peripheral contrast is then calculated and added to a vector which relates to the current region size . a schematic smoothed graph of peripheral contrast against region size is shown in fig1 . this process continues until the region reaches the pre - defined maximum size or extent — for example , until the region fills the extended mask m 0 . the highest peripheral contrast value obtained during region growing is selected ( step 30 ) as indicating the optimum region , with a boundary most likely to correspond to that of the nodule . this optimum boundary is then output ( step 32 ) as the detected boundary of the nodule . in an alternative embodiment , the region growing is started from a point different from the optimum seed point s 0 , for example , from the point having the highest intensity in the original scan image within the foreground region f . it is then necessary to check that the detected nodule boundary contains the optimum seed point s 0 . hence , region growing from the optimum seed point s 0 is preferred . in an alternative embodiment , the first maximum peripheral contrast value obtained during region growing is selected as indicating the optimum region , rather than the global maximum value . ( 1 ) define the maximum region size . ( 2 ) select the seed point s 0 and add it to the current region . ( 3 ) use second order connectivity ( 8 neighbors for 2d and 26 for 3d ) to find neighbors and first order connectivity ( 4 for 2d , 6 for 3d ) to find / update the current boundary . sort the points in the current boundary in ascending order by the priority factor given by equation ( 1 ) above . ( 4 ) find / update the internal boundary . ( 5 ) calculate the average / peripheral contrast and put the value in the average / peripheral contrast vector . ( 6 ) find the point with the highest priority w ( from equation 1 ) in the current boundary and add to the current region . if the region reaches the pre - defined maximum size , go to step 7 , otherwise go to step 3 . ( 7 ) in the average / peripheral contrast vector , find the highest maximum value ( local maximum ) and the corresponding region size and output the current region according to this size . the boundary of the current region is taken as the extent of the nodule . the detected nodule boundary may be output by displaying it as an outline superimposed on the original scan image . additionally or alternatively , various nodule metrics may be calculated from the optimum region and / or its boundary . for example , the presence of spikes on the nodule surface may indicate a malignant nodule . therefore , a shape metric calculated from the optimum boundary may be output . alternative significant metrics include the volume or surface area of the optimum region . the optimum region may be combined with data from the scan image to determine the mass and / or density of the nodule , which may also be output . the results of experiments conducted using the algorithm are described below : fig1 is a synthetic image with a binary circle ( pixel size 1291 ) and three blurred circles ( gaussian blur with sigma 1 , 2 and 3 respectively ) derived from the binary one . when the region growing algorithm was applied to the three blurred circles ( maximum size 2000 , k1 = 0 . 1 , k2 = 0 . 01 ) they all produced a circle as the result . using average contrast based region growing , the sizes of the circles are 1455 , 1611 and 1752 pixels respectively . these are much bigger than the true value ( 1291 pixels ). for peripheral contrast based region growing , according to the algorithm above , the sizes of the circles are 1290 , 1272 and 1224 pixels respectively . these are very close to the true value ( 1291 pixels ). therefore peripheral contrast based region growing appears more suitable for circular nodule detection . the tests described below all used peripheral contrast based region growing . another test was conducted on a synthetic image with an arrow shaped object as shown in fig2 and the results are shown in fig2 . the boundary of the arrow - shaped object was correctly identified , showing that the peripheral contrast based region growing algorithm is also suitable for detecting non - circular objects . in this test a ct lung image with an isolated nodule is used , and the peripheral contrast region - growing algorithm was used directly on the scan image , without calculating the fuzzy map . the maximum size is set to 100 pixels , k1 = 0 . 01 and k2 = 0 . 01 and a seed is put in the middle of the bright blob in fig2 a . the result image in fig2 b shows the optimal region of 2d region growing . the region size is 40 pixels . the result of 3d region growing is shown in fig2 c . fig2 a to 23 c show the results of a test on a real image as shown in fig2 a , with the fuzzy maps shown in fig2 b and the region - growing results shown in fig2 c . fig2 a to 24 c show comparative results using different techniques on a nodule attached to a blood vessel . fig2 a shows the result using peripheral contrast based region growing on a real image , fig2 b shows the result using fuzzy connectivity thresholding ( threshold of 0 . 6 ) and fig2 c shows the result of using peripheral contrast based region growing on an unthresholded fuzzy map with no predetermined parameters . fig2 a to 25 c show comparative results on a low - contrast nodule using the same three techniques ; for fig2 b , the threshold is 0 . 805 . fig2 a to 26 c show comparative results on an isolated nodule using the same three techniques ; for fig2 b , the threshold is 0 . 91 . fig2 a to 27 c show comparative results on a near wall nodule using the same three techniques ; for fig2 b , the threshold is 0 . 935 . the preferred embodiment uses a new region growing method . this method uses a combination of distance and intensity information as the growing mechanism and peripheral contrast as the stop criterion . after comprehensive tests with synthetic images and real images it was found that this region growing method can provide very good results for isolated or pulmonary nodules in ct lung images , especially when it is combined with a fuzzy map . it can be used to detect isolated or pulmonary lung nodules semi - automatically . the embodiments above are described by way of example , and are not intended to limit the scope of the invention . various alternatives may be envisaged which nevertheless fall within the scope of the claims . as will be apparent from the above discussion , the method can be performed on a 2d image consisting of a single ct slice , or a 3d image consisting of consecutive ct slices .	6
in a practical application of the invention , a patient endured the skin excoriation for 11 years , while experimenting with all types of conventional and non - conventional protective creams and ointments . the following is an account of an experimental application of a calcium , sodium poly ( vinyl methyl ether - maleate ). the material is commercially available as a denture adhesive cream sold under the tradename &# 34 ; fixodent &# 34 ; by the vick chemical company , division of richard - merrel , inc ., new york , n . y . 10017 . the denture adhesive is manufactured as described in u . s . pat . no . 3 , 003 , 988 , issued on 10 oct . 1961 , to donald p . germann et al . ______________________________________nov . 3 skin before application of &# 34 ; fixodent &# 34 ;, highly irritated burn lesions and ulceration . 9 a . m . after application , pain subsided within 30 min . 12 : 20 redness and swelling almost gone . p . m . 9 p . m . ulcerations almost completely healed , redness and swelling gone . nov . 4 ulcerations , redness and swelling completely healed . skin appears normal , new skin growth commencing . nov . 5 applied 4 times during day , skin still normal . - nov . 6 applied 3 times during day , skin still normal , highly protected , no sensitivity . nov . 7 applied 3 times , normal , no sensitivity . nov . 8 applied 3 times , normal , no sensitivity . nov . 9 normal , no sensitivity . nov . 10 normal . nov . 11 normal . nov . 12 normal . nov . 13 normal . nov . 14 normal . nov . 15 normal . nov . 16 normal , still no sensitivity . nov . 17 normal . nov . 18 normal . nov . 19 normalnov . 20 normalnov . 21 normal , no sensitivity . nov . 22 normal . nov . 23 normal . nov . 24 normal . nov . 25 normal , no sensitivity . nov . 26 normal . nov . 27 normal . nov . 28 normal . nov . 29 skin still normal , no sensitivity . substance highly resistant to fecal drainage and digestive acid , holds to skin . nov . 30 normal . months of december and january , skin still normal , highlyprotected against fecal drainage and irritation . stillno sensitivity . ______________________________________ the exact formulation and method of manufacture of the paste used in the present invention is described in the u . s . pat . no . 3 , 003 , 988 cited above . specifically the paste is an effective amount of at least 40 percent of a calcium , sodium poly ( vinyl methyl ether - maleate ) in a petroleum base . it is applied directly to the excoriated skin , three times daily . while it will be apparent that the illustrated embodiments of the invention herein disclosed are well calculated adequately to fulfill the objects and advantages primarily stated , it is to be understood that the invention is susceptible to variation , modification , and change within the spirit and scope of the subjoined claims .	0
referring to fig1 - 3 , a series of lateral views of vertebral segments 50 and 52 are shown , depicting the insertion and expansion of one embodiment of uec ( universally expanding cage ). the depicted vertebral bodies 50 and 52 have an average 8 mm gap between vertebral end plates , representing an average intervertebral space 54 . in a typical implementation , a complete discectomy is performed prior to the insertion of the uec 56 . the intervertebral disc occupying space 54 is removed using standard techniques including rongeur , curettage , and endplate preparation to bleeding subcondral bone . the posterior longitudinal ligament is divided to permit expansion of the intervertebral space . the intervertebral space 54 may be distracted to about 10 mm using a rotating spatula ( not shown ). this is a well - known device that looks like a wide screw driver that can be placed into the disc space horizontally and turned 90 degrees to separate the endplates . a novel feature of the uec is that after intervertebral disc space expansion and preparation ( by curetting or ideally arthroscopically facilitated disc material removal ), the uec implant per se can be inserted through any orifice or angle that does not cause injury to nerves or other structures , positioned at the immediate implant location and consequent expansion platform to yield both the best fusion and angular correction results . in the example implementation depicted in fig1 - 3 , uec 56 is inserted posteriorly ( in the direction of arrow 58 ) between vertebral bodies 50 and 52 , as shown in fig1 . the vertebral space 54 depicted is meant to represent any vertebral space in which it is desired to insert the uec ( sacral , lumbar , thoracic and / or cervical ), and from any direction permitted by the surrounding anatomy . in accordance with an aspect of the disclosure , the uec is reduced to a small size in its unexpanded state to enable it to be inserted through into the intervertebral space 54 as shown in fig1 . fig2 shows uec 56 inserted between vertebral bodies 50 and 52 , with uec 56 still in its unexpanded state . in one exemplary embodiment , dimensions of an unexpanded uec are : 10 - 12 mm wide , 10 mm high and 28 mm long to facilitate insertion and thereby minimize trauma to the patient and risk of injury to nerve roots . these dimensions may accommodate the flat external surfaces . once in place , the exemplary uec 56 may be expanded to 140 percent of its unexpanded size ( as shown in fig3 ), enabling 20 degrees or more of spinal correction depending on the 3d clinical pre - operation anatomic analysis . it should be noted that while the exemplary uec 56 depicted in fig1 - 3 is an implant intended to ideally fill the warranted space , other shapes of implants such as those shown in later figures and / or described herein may be used . in various embodiments , the implants may have a transverse cross - section that is circular , oval , elliptical , square , rectangular , trapezoidal , or other shape suited to fill the implant site and transmit the required loads . the implants may straight , curved , bean - shaped , and / or include other shapes and aspect ratios . additionally , the external surfaces may be smooth , spiked , threaded , coated and / or further adapted as subsequently described in more detail . the uec can be used at any spinal level the surgeon deems in need of fusion , and may be placed at any position and angle relative to the vertebral endplates as may be needed . one , two , or more uecs may be placed at any particular level to achieve the desired height and angles between vertebral bodies . as will be later described , multiple uecs may be used to adjust the overall cranio - caudal height , the anterior - posterior angle , and the medio - lateral angle between adjacent vertebral bodies . uecs may be implanted at multiple levels to obtain or restore the desired three dimensional curvature and positioning of the spine . referring to fig4 - 9 , a first embodiment of an exemplary uec 100 according to aspects of the disclosure is shown . fig4 is an enlarged perspective view which shows details of uec 100 . for ease of understanding , a proximal end 104 and a distal end 106 of uec 100 can be defined as shown in fig4 . it should be noted that while the distal end 106 of uec 100 is typically inserted first into a patient and proximal end 104 is typically closest to the surgeon , other orientations of this exemplary device and other devices described herein may be adopted in certain procedures despite the distal and proximal nomenclature being used . referring to fig5 , an exploded perspective view shows the individual components of uec 100 . in this first embodiment , uec 100 includes a cylindrically - shaped cage body 108 , a proximal plug 110 , a distal plug 112 , a threaded actuator 114 , and a washer 116 . the terms “ plug ” and “ plug member ” are used interchangeably herein . actuator 114 has a shank sized to slidably pass through a central bore within proximal plug 110 when uec 100 is assembled . actuator 114 also has threads on its distal end for engaging with a threaded central bore within distal plug 112 . proximal plug 110 and distal plug 112 each have outer surfaces that are inwardly tapered to match inwardly tapered surfaces within cage body 108 ( as best seen in fig9 ) with this arrangement , actuator 114 may be rotated in a first direction to draw distal plug 112 toward proximal plug 110 to outwardly expand cage body 108 , as will be subsequently described in more detail . referring to fig6 , this perspective view shows details of cage body 108 of the first exemplary embodiment of uec 100 . in this embodiment , cage body 108 includes eight longitudinally extending beam portions 118 , each separated from an adjacent beam portion 118 by a longitudinally extending gap 120 . in other embodiments ( not shown ), the cage body may include fewer or more than eight beam portions , and / or beam portions having a different or varying cross - section or shape . cage body 108 of the current embodiment also includes eight circumferentially extending connector portions 122 . the connector portions 122 interconnect the ends of the beam portions 118 . four of the connector portions 122 are located at the proximal end 104 of cage body 108 , and the other four connector portions 122 are located at the distal end 106 . the connector portions 122 located at the proximal end 104 are staggered in relation to the connector portions 122 located at the distal end 106 such that each pair of adjacent beam portions 118 are connected at only one end by a connector portion 122 . with this arrangement the beam portions 118 and connector portions 122 form a continuous serpentine or repeating s - shaped pattern . the beam portions 118 and or the connector portions 122 are configured to resiliently flex to allow the cage body 108 to increase in diameter when urged radially outward by plugs 110 and 112 ( shown in fig4 ). when plugs 110 and 112 are not urging cage body 108 radially outward , the resiliency of beam portions 118 and or connector portions 122 allows cage body 108 to return to its original reduced diameter . it can be appreciated that as beam portions 118 and or connector portions 122 flex outwardly , gaps 120 become wider at their open ends opposite connector portions 122 . the outwardly facing surfaces of beam portions 118 may each be provided with one or more points or spikes 123 as shown , to permit cage body 108 to grip the end plates of the vertebral bodies . referring to fig7 , an end view of the proximal end 104 of uec 100 is shown . the enlarged head at the proximal end of actuator 114 may be provided with a recessed socket 124 as shown for removably receiving a tool for turning actuator 114 . proximal plug 110 ( and distal plug 112 , not shown ) may be provided with radially outwardly extending protuberances 126 that reside in one or more gaps 120 and abut against the side of beam portions 118 . this arrangement prevents plugs 110 and 112 from rotating when actuator 114 is turned , thereby constraining plugs 110 and 112 to only move axially toward or away from each other . proximal plug 110 ( and distal plug 112 ) may be provided with through holes and or recesses 128 to allow for bony ingrowth from the vertebral bodies for more solidly healing / fusing uec 100 in place . longitudinally extending slots 130 ( shown in fig4 ) may also be provided for this purpose , and or for packing plugs 110 and 112 with autograft , allograft , and / or other materials for promoting healing / fusion . referring to fig8 and 9 , a side view and side cross - sectional view , respectively , are shown . in operation , uec 100 is expanded by inserting a tool such as a hex key wrench or driver ( not shown ) into the recessed socket 124 at the proximal end of actuator 114 and turning it clockwise . as best seen in fig9 , the distal end of actuator 114 is threaded into the central bore of distal plug 112 . turning actuator 114 clockwise causes the distal end of actuator 114 to pull distal plug 112 towards the center of cage body 108 while the enlarged head at the proximal and of actuator 114 pushes proximal plug 110 towards the center . this movement in turn causes the ramped surfaces 132 of plugs 110 and 112 to slide inwardly along the ramped surfaces 134 located along the inside of beam portions 118 and connector portions 122 to cause these elements to flex and expand radially outward as previously described . this process may be reversed by turning actuator 114 counterclockwise . the resilient inward forces from the beam portions 118 and or connector portions 122 ( and or the compressive forces from adjacent vertebral bodies ) against plugs 110 and 112 causes the two plugs to separate axially , thereby allowing uec 100 to return to its non - expanded state . referring to fig1 - 15 , a second embodiment of an exemplary uec 200 according to aspects of the disclosure is shown . fig1 is a perspective view which shows details of uec 200 . uec 200 includes a proximal end 204 and a distal end 206 , and shares many of the same features of previously described uec 100 , which are identified with similar reference numerals . referring to fig1 , an exploded perspective view shows the individual components of uec 200 . in this second embodiment , uec 200 includes an elongated cylindrical cage body 208 , a proximal plug 210 , and a distal plug 212 . distal plug 212 includes an integrally formed actuator rod 214 that extends along the internal central axis of cage body 208 towards proximal plug 210 when uec 200 is assembled . proximal plug 210 and distal plug 212 each have outer surfaces that are threaded and inwardly tapered to match threaded and inwardly tapered surfaces within cage body 208 ( as best seen in fig1 ). with this arrangement , each plug 210 and 212 may be independently rotated to move the particular plug axially toward the middle of cage body 208 to outwardly expand that particular end 204 or 206 of cage body 208 , as will be subsequently described in more detail . as shown in fig1 and 12 , cage body 208 includes eight longitudinally extending beam portions 218 , each separated from an adjacent beam portion 218 by a longitudinally extending gap 220 . in other embodiments ( not shown ), the cage body may include fewer or more than eight beam portions , and / or beam portions having a different or varying cross - section or shape . cage body 208 of the current embodiment also includes eight circumferentially extending connector portions 222 . the connector portions 222 interconnect the ends of the beam portions 218 . four of the connector portions 222 are located at the proximal end 204 of cage body 208 , and the other four connector portions 222 are located at the distal end 206 . the connector portions 222 located at the proximal end 204 are staggered in relation to the connector portions 222 located at the distal end 206 such that each pair of adjacent beam portions 218 are connected at only one end by a connector portion 222 . with this arrangement the beam portions 218 and connector portions 222 form a continuous serpentine or repeating s - shaped pattern . the beam portions 218 and or the connector portions 222 are configured to resiliently flex to allow the cage body 208 to increase in diameter when urged radially outward by plugs 210 and 212 . when plugs 210 and 212 are not urging cage body 208 radially outward , the resiliency of beam portions 218 and or connector portions 222 allows cage body 208 to return to its original reduced diameter . it can be appreciated that as beam portions 218 and or connector portions 222 flex outwardly , gaps 220 become wider at their open ends opposite connector portions 222 . the outwardly facing surfaces of beam portions 218 may each be provided with one or more points or spikes 223 as shown , to permit cage body 208 to grip the end plates of the vertebral bodies . referring to fig1 , an end view of the proximal end 204 of uec 200 is shown . the proximal plug 210 may be provided with a recessed socket 224 as shown for removably receiving a tool for turning proximal plug 210 in either direction , such as a five - lobed driver ( not shown ). alternatively , other suitable types of recessed sockets , slots , protruding and / or keyed features may be utilized with a mating driver . the proximal end of actuator shaft 214 ( which extends proximally from distal plug 212 inside cage body 208 ) may be accessed through a central bore 225 in proximal plug 210 . the proximal end of actuator shaft 214 may be shaped as shown to be received within a mating driver socket ( such as a five - lobed socket , not shown ), which can be removably extended into the center of cage body 208 through central bore 225 . with this arrangement , both the proximal plug 210 and the distal plug 212 can be independently accessed and rotated from the proximal end of uec 200 so that the proximal end 204 and the distal end 206 of uec 200 can be expanded or contracted independently . referring to fig1 , an end view of the distal end 206 of uec 200 is shown . by comparing fig1 and 14 , it can be appreciated that connector portions 222 at the proximal end 204 of uec 200 are staggered ( i . e . rotated 45 °) in relation to the connector portions 222 at the distal end 206 of uec 200 . referring to fig1 , a side cross - sectional view of uec 200 is shown . in operation , the proximal end 204 of uec 200 may be independently expanded by inserting a tool such as a five - lobed driver ( not shown ) into the recessed socket 224 of proximal plug 210 and turning it clockwise . turning proximal plug 210 clockwise causes the threaded ramped surfaces 232 of plug 210 to translate inwardly ( to the right in fig1 ) along the threaded ramped surfaces 234 located along the inside of beam portions 218 and connector portions 222 to cause these elements to flex and expand radially outward as previously described . this process may be reversed by turning proximal plug 210 counterclockwise , thereby allowing the proximal end 204 of uec 200 to return to its non - expanded state . similarly , the distal end 206 of uec 200 may be independently expanded by inserting a tool such as a five - lobed socket ( not shown ) through the central bore 225 in proximal plug 210 until it engages with the proximal end of actuator 214 , which is attached to distal plug 212 . turning distal plug 212 counterclockwise ( from the perspective of the proximal end ) causes the threaded ramped surfaces 232 of plug 212 to translate inwardly ( to the left in fig1 ) along the threaded ramped surfaces 234 located along the inside of beam portions 218 and connector portions 222 to cause these elements to flex and expand radially outward as previously described . this process may be reversed by turning distal plug 212 clockwise , thereby allowing the distal end 206 of uec 200 to return to its non - expanded state . the adjustment tools described above ( not shown ) for turning proximal plug 210 and distal plug 212 may be inserted one at a time into uec 200 . alternatively , the two tools may be nested together , with the tool for turning the distal plug 212 passing through a central bore in the tool for turning the proximal plug , as will be subsequently shown and described in relation to other embodiments . with this arrangement , both tools may be turned simultaneously or individually . in some embodiments , both proximal plug 210 and distal plug 212 are provided with right - handed threads , so that when both tools are simultaneously turned in the same direction , one end of uec 200 expands while the other end contracts , thereby changing the outer surface angle of uec 200 without substantially changing its overall diameter ( i . e . without substantially changing the diameter or height of the midpoint of uec 200 .) for example , by turning the two tools in the same direction , the lordotic angle between two vertebral bodies can be changed by uec 200 without substantially changing the height between the two vertebral bodies . in other embodiments , one of the plugs 210 or 212 may be provides with a right - handed thread and the other plug provided with a left - handed thread . in these embodiments , when both adjustment tools are simultaneously turned in the same direction , both ends 204 and 206 of uec 200 expand or contact together without substantially changing the outer surface angle of uec 200 . for example , by turning the two tools in the same direction , the height between the two vertebral bodies can be changed by uec 200 without substantially changing the lordotic angle between two vertebral bodies . in some embodiments , plugs 210 and 212 may each be provided with threads having a different pitch from the other . such an arrangement allows both the height and the angle between adjacent vertebral bodies to be adjusted simultaneously in a predetermined relationship when both adjustment tools are turned together in unison . for example , proximal plug 210 may be provided with right - handed threads of a particular pitch while distal plug 212 may be provided with finer , left - handed threads having half the pitch of the proximal plug threads . in this embodiment , when both adjustment tools are turned together in a clockwise direction , both ends of uec 200 expand at the same time but the proximal end 204 expands at twice the rate of the distal end 206 . this allows the surgeon to increase the height between adjacent vertebral bodies and at the same time angle the bodies away from him or her . one or both of the tools may then be turned individually to more finely adjust the height and angle between the vertebral bodies . in some embodiments the above - described adjustment tools may be removed from uec 200 before the surgical procedure is completed . in some embodiments the above adjustment tools may remain in place after the procedure is completed . in some embodiments , uec 200 is 50 mm long , has an unexpanded diameter of 10 mm , and an expanded diameter of 14 mm . in other embodiments , the uec may be configured to expand to about 11 , 12 , or 13 mm , or more than 14 mm . in still other embodiments , the uec may be configured with dimensions larger or smaller than these to conform to a particular anatomy or procedure . referring to fig1 - 20 , a third embodiment of an exemplary uec 300 according to aspects of the disclosure is shown . fig1 is a perspective view which shows details of uec 300 . uec 300 includes a proximal end 304 and a distal end 306 , and shares many of the same features of previously described uecs 100 and 200 , which are identified with similar reference numerals . referring to fig1 , an exploded perspective view shows the individual components of uec 300 . in this third embodiment , uec 300 includes a rectangular cage body 308 , a proximal plug 310 , a distal plug 312 , a proximal plug adjustment tool 313 , and a distal plug adjustment tool 314 . as in the previously described uec 200 , both plugs 310 and 312 are threaded and tapered , and each end of cage body 308 is provided with an inwardly tapered and threaded bore configured to receive one of the plugs 310 or 312 . adjustment tools 313 and 314 are similar in construction and operation to the adjustment tools previously described ( but not shown ) in reference to uec 200 . proximal plug 310 includes a mating recess on its proximal end ( not shown ) configured to removably receive the splined distal end of proximal plug adjustment tool 313 for rotating proximal plug 310 . distal plug 312 includes a smaller mating recess on its proximal end ( not shown ) configured to removably receive the smaller splined distal end of distal plug adjustment tool 314 for rotating distal plug 312 . both proximal plug adjustment tool 313 and proximal plug 312 are provided with central bores that permit the distal end of distal plug adjustment tool 314 to pass therethrough , through the center of cage body 308 , and partially into distal plug 312 . in this exemplary embodiment , the proximal ends of adjustment tools 313 and 314 each have a hexagonally - shaped head that permits them to be turned together in unison or individually ( as previously described in relation to uec 200 ), using wrench ( es ), socket ( s ) ( not shown ) and / or by hand . as shown in fig1 and 17 , cage body 308 includes eight longitudinally extending beam portions 318 , each separated from an adjacent beam portion 318 by a longitudinally extending gap 320 . in other embodiments ( not shown ), the cage body may include fewer or more than eight beam portions , and / or beam portions having a different or varying cross - section or shape . it can be seen that in this embodiment , four of the gaps 320 are formed through the middle of the four faces of cage body 308 , and the other four gaps 320 are formed along the corner edges of cage body 308 . cage body 308 also includes eight circumferentially extending connector portions 322 . the connector portions 322 interconnect the ends of the beam portions 318 . circular apertures 321 may be provided as shown between the ends of gaps 320 and the connector portions 322 to relieve stress concentrations at those locations as connector portions 322 flex . four of the connector portions / flexures 322 are located at the proximal end 304 of cage body 308 ( across the corner edges of cage body 308 ), and the other four connector portions / flexures 322 are located at the distal end 306 ( across the distal end of the faces of cage body 308 .) the connector portions 322 located at the proximal end 304 are staggered in relation to the connector portions 322 located at the distal end 306 such that each pair of adjacent beam portions 318 are connected at only one end by a connector portion 322 . as with previously described embodiments , the beam portions 318 and connector portions 322 form a continuous serpentine or repeating s - shaped pattern . the beam portions 318 and or the connector portions 322 are configured to resiliently flex to allow the cage body 308 to increase in circumference when urged radially outward by plugs 310 and 312 . when plugs 310 and 312 are not urging cage body 308 radially outward , the resiliency of beam portions 318 and or connector portions 322 allows cage body 308 to return to its original reduced circumference . it can be appreciated that as beam portions 318 and or connector portions 322 flex outwardly , gaps 320 become wider at their open ends opposite connector portions 322 . the outwardly facing surfaces of beam portions 318 may each be provided with one or more points or spikes 323 as shown , to permit cage body 308 to grip the end plates of the vertebral bodies . in this exemplary embodiment , spiked or knurled surfaces are provided along the top and bottom of uec 300 while the side surfaces are left smooth . referring to fig1 and 19 , a side view and a side cross - sectional view , respectively , of uec 300 are shown . in operation , the proximal end 304 of uec 300 may be independently expanded by inserting proximal plug adjustment tool 313 into the mating recessed socket of proximal plug 310 ( as shown in fig1 ) and turning it clockwise . turning proximal plug 310 clockwise causes the threaded ramped surfaces 332 of plug 310 to translate inwardly ( to the left in fig1 and 19 ) along the threaded ramped surfaces 334 located along the inside of beam portions 318 and connector portions 322 to cause these elements to flex and expand radially outward as previously described . this process may be reversed by turning proximal plug 310 counterclockwise , thereby allowing the proximal end 304 of uec 300 to return to its non - expanded state . similarly , the distal end 306 of uec 300 may be independently expanded by inserting a tool such as a five - lobed socket ( not shown ) through the central bore 325 in proximal plug 310 until it engages with the proximal end of actuator 314 , which is attached to distal plug 312 . turning distal plug 312 counterclockwise ( from the perspective of the proximal end ) causes the threaded ramped surfaces 332 of plug 312 to translate inwardly ( to the right in fig1 and 19 ) along the threaded ramped surfaces 334 located along the inside of beam portions 318 and connector portions 322 to cause these elements to flex and expand radially outward as previously described . this process may be reversed by turning distal plug 312 clockwise , thereby allowing the distal end 306 of uec 300 to return to its non - expanded state . referring to fig2 a - 20c , a series of sides views depicts the progression from a fully retracted and a fully expanded uec 300 . in fig2 a , cage body 308 is shown in a fully retracted position . in this figure , the height of each end of cage body 308 is labeled as 100 % of retracted cage height . in fig2 b , the proximal end 304 of cage body 308 has been fully expanded while the distal end 306 remains fully retracted . in this exemplary embodiment , each end is capable of being expanded to a height ( and therefore also a width ) that is 140 % of the fully retracted height , as shown . in fig2 c , the distal end 306 has also been expanded by 40 %. in some embodiments , uec 300 has a cage length of 50 mm , an unexpanded cage height of 10 mm , and an expanded cage height of 14 mm . the overall length of uec 300 with adjustment tools 313 and 314 in place and in the unexpanded state may be 75 mm . in other embodiments , the uec may be configured to expand to about 11 , 12 , or 13 mm , or more than 14 mm . in still other embodiments , the uec may be configured with dimensions larger or smaller than these to conform to a particular anatomy or procedure . in some embodiments , the uec can form an included angle between its top and bottom surfaces of at least 20 degrees . referring to fig2 , a fourth embodiment of an exemplary uec 400 according to aspects of the disclosure is shown . fig2 is a perspective view which shows details of uec 400 . uec 400 includes a proximal end 404 , a distal end 406 , cage body 408 , proximal plug 410 , distal plug 412 , proximal plug adjusting tool 413 , and distal plug adjusting tool 414 . other than cage body 408 having a circular cross - section rather than a square cross - section , uec 400 is essentially identical in construction and operation to previously described uec 300 . in other embodiments ( not shown ), the uec may have a cross - section transverse to the central longitudinal axis that is rectangular , trapezoidal , oval , elliptical or other shape . referring to fig2 - 25 , a fifth embodiment of an exemplary uec 500 according to aspects of the disclosure is shown . fig1 is a perspective view which shows details of uec 500 . uec 500 includes a proximal end 504 and a distal end 506 , and shares many of the same features of previously described uecs 100 - 400 , which are identified with similar reference numerals . uec 500 includes three components : a generally cylindrical , unitary cage body 508 ; a proximal actuator screw 510 ; and a distal actuator screw 512 . the heads of actuator screws 510 and 512 may be referred to as plug members . cage body 508 includes two longitudinal , off - center slots 550 which each extend about three - quarters of the length of cage body 508 , and emanate from opposite ends and opposite sides of cage body 508 . cage body 508 is also provided with two transverse slots 552 , each located adjacent to the closed end of one of the longitudinal slots 550 . each transverse slot 552 extends from the outer circumference of cage body 508 and approaches the base of a longitudinal slot 550 . each of the two pairings of a longitudinal slot 550 with a transverse slot 552 defines a cantilevered arm 554 that is connected with the remainder of the cage body 508 by a living hinge 556 near the closed ends of the two slots 550 and 552 . each living hinge 556 allows its associated arm 554 to flex outwardly against a vertebral body . the open ends of longitudinal slots 550 are outwardly tapered to receive the enlarged , tapered heads of an actuator screw 510 or 512 , as best seen in fig2 . the opposite ends of actuator screws 510 and 512 extend through longitudinal slots 550 and thread into the opposite ends of cage body 508 . with this arrangement , each actuator screw 510 and 512 may be turned independently of the other , causing the screw to move axially relative to bone cage 508 . this axial movement causes the head of the screw to urge the tapered tip of the associated arm 554 outward , or allowing it to flex back inward when the screw is turned in the opposite direction . if both actuator screws 510 and 512 are turned in the same direction the same amount , uec 500 expands uniformly and increases the height between adjacent vertebral bodies . if one of the two actuator screws 510 or 512 is turned more than the other , the surgeon is able to change the angle between the vertebral bodies . as best seen in fig2 , a slot 558 or other suitable feature may be provided in the end of each actuator screw 510 and 512 at the opposite end from the screw head . a hole 560 may also be provided through each end of cage body 508 to allow access to each of the two slots 558 . this arrangement allows both of the actuator screws 510 and 512 to be turned from either end 504 and / or 506 of cage body 508 . referring to fig2 - 28 , an example implementation utilizing two uecs 56 in tandem is shown . each uec 56 may be inserted as previously described in relation to fig1 - 3 . in this implementation , uecs 56 are placed non - parallel to one another . as best seen in fig2 , this arrangement allows the surgeon to adjust the angle between the vertebrae about two different axes , and also translate the vertebrae with respect to one another about another axis . fig2 is an oblique anterior view showing placement of an anterior column implant 56 on a vertebral body 52 . in this implementation , implant 56 is placed laterally across the vertebral body 52 , forward of the lateral midline . after adjustment of implant 56 , its plugs are flush with or recessed within the outer perimeter of the endplate of vertebral body 52 so as not to impinge upon adjacent tissue . referring to fig3 , a human spine 76 is shown that exhibits scoliosis . according to aspects of the disclosure , dual uecs may be placed at various levels of the spine to treat the condition . for example , a single uec or pairs of uecs may be implanted at the levels depicted by reference numerals 78 , 80 , 82 and 84 shown in fig3 . by using the adjustments described above relative to fig2 , the curvature of the spine may be adjusted in three dimensions at these four levels to a correct alignment , as shown in fig3 . fig3 a - 32c are anterior , lateral and oblique views , respectively , showing adjacent vertebral bodies 50 and 52 having misalignments / uneven spacing . fig3 a - 33c are anterior , lateral and oblique views , respectively , showing the vertebral bodies 50 and 52 of fig3 a - 32c with the misalignments / uneven spacing corrected according to aspects of the disclosure . the implants can be made of , for example , such materials as titanium , 64 titanium , or an alloy thereof , 316 or 321 stainless steel , biodegradeable and biologically active materials , e . g . stem cells , and polymers , such as semi - crystalline , high purity polymers comprised of repeating monomers of two ether groups and a ketone group , e . g . polyaryetheretherketone ( peek )™, or teflon ™. to prevent movement of proximal and distal plugs or actuators after implantation , in some implementations a biocompatible adhesive or thread locking compound may be applied to one or more of the moving parts . in some embodiments ( not shown ) a pin may be inserted radially or axially between the plug / actuator and the cage body to lock the parts in place post operatively . in some embodiments , a ratchet , spring loaded detent , or other locking mechanism may be provided for this purpose . in general , as disclosed in the above embodiments , the cage body is cut with openings at every other end of each slot , like a sine wave , allowing expansion when the center of the cage becomes occupied with a cone or mandrill shaped unit . the cage body &# 39 ; s series of alternating slots allows the expansion to take place while keeping the outside of the uec one single piece . the slots plus the teeth on the surface allow for a solid grip on the bone surfaces and plenty of opportunities for good bone ingrowth . also , by allowing the surgeon to make one end of the uec thicker than the other , the effects of the cone ( mandrill ) introduction vary from uniform to selective conduit expansion . the uec expansion mechanism is adaptable to both fixed fusion and mobile ‘ motion preservation ’ implants , with exteriors of the expanding implant per surgeon &# 39 ; s choice ( round , flat , custom , etc .) as such , in some implementations , relative motion may be preserved between the vertebral bodies adjacent the implanted uec ( s ). in other implementations , it may be desirable to fuse the adjacent vertebral bodies around the implanted uec ( s ). to provide motion preservation between adjacent vertebrae , robust compressible materials may be used between the uec and one or both of the vertebral endplates , and / or one or more components of the uec may comprise such materials . these materials may replicate the load distributing and shock absorbing functions of the annulus and nucleus of a natural disk . for example , in some embodiments the uec may be provided with tapered plugs made of a resilient polymer to allow the uec to compress and expand to accommodate relative motion of the adjacent vertebrae . examples of biocompatible materials suitable for some uec embodiments include bionate ®, a thermoplastic polycarbonate - urethane ( pcu ) provided by dsm biomedical in exton , pa ., and chronoflex ®, a pcu provided by advansource biomaterials in wilmington , mass . the uec provides advantages over currently existing technology that include correction of coronal plane deformity ; introduction of interbody lordosis and early stabilization of the interbody space with rigidity that is greater than present spacer devices . this early stability may improve post - operative pain , preclude the need for posterior implants including pedicle screws , and improve the rate of successful arthrodesis . importantly , the uec provides improvement of space available for the neural elements while improving lordosis . traditional implants are limited to spacer effects , as passive fillers of the intervertebral disc locations awaiting eventual fusion if and when bone graft in and around the implant fuses . by expanding and morphing into the calculated shape which physiologically corrects spine angulation , the uec immediately fixes the spine in its proper , painless , functional position . as infused osteoinductive / osteoconductive bone graft materials heal , the patient becomes well and the implant becomes inert and quiescent , embedded in bone , and no longer needed . in some embodiments , the external surface of the uec may be 3d printed to not only fit into the intervertebral space per se , but to match the surface topography at each insertion location . in other words , a 3d printed endplate may be utilized , computer calculated to fit and expand the disc space of the individual patient , resulting in both best ‘ goodness of fit ’ for fusion , and improved axial skeletal alignment . by creating to ‘ maps ’ that fit e . g . as a precisely congruent superior and inferior surface to fit into a particular patients disc space , and placing these uec end plates on either side the novel uec expansion mechanism , a patient &# 39 ; s disc space and overall spine alignment will be ideally treated toward best fusion ( or motion preservation ) and alignment . “ method of surgery ” instructions may recommend the surgeon and // or robotic unit deploy expansion as programmed to insert the uec into a particular disc level of pathology , to achieve best results . for example , preoperative patient scans / films can predict ideal uec surgeon use , such as “ turn knob a a certain number of rotations clockwise ,” to maximize visible , palpable , and roentgenographic ‘ goodness of fit ’. with this approach , post activation , the uec implant fits the location , entering at the predetermined best angle ( in 3 axes ) using the proprietary method of surgery and uec insertion tools provided . in some embodiments , the uec may be coated with hydroxyapatite . in some embodiments , toothed or 400 μm beaded surfaces may be utilized to promote bony ingrowth . inflatable chambers may be provided within the endplate that can expand after being implanted . this approach addresses the 3 - d congruence to proximate disc pathology . it can also allow for intervertebral arthrodesis or arthroplasty treatment and overall improved spinal alignment , integrating the internal proprietary expansion with the variable external endplate shapes and their contents . uec inflatable endplates of polymer may be employed , such as tiny vacuoles , “ bubblewrap ”, and multiple or singular bladder constructs . if a portion of the disk space were collapsed , that region could be aptly elevated or expanded by the uec endplate variation in material and / or inflation . the inflatable chambers may contain compressible gas ( such as air ,) granules as pharmacologics , and / or stem cells that are delivered via liquids . in cases where the uec is compressible or force absorbing , the material and / or chamber could be used as a cushion or to ‘ selectively direct and protect chondrocytes ’ toward improvement of existing pathophysiology via best drug use or regeneration . the ‘ preparation ’ of the uec insertion site will vary per surgeon . in some implementations , an arthroscopic burr may be advisable for removing 0 . 5 mm of cortical bone along with all aberrant disc contents under digital arthroscopic camera control . in other implementations , the surgeon may just carefully curette the intervertebral space to ‘ clean it out ’ in preparation for the uec implant insertion . the uec may be inserted directly into the insertion site , or may be inserted through proprietary or commercially available insertion tube . the insertion tube typically will have a blunt distal tip so that it can be inserted through an incision without causing tissue damage . the tube can be used with or without additional tissue retractors . the uec may be preloaded into the insertion tube , or placed into the tube after the tube has been introduced into the insertion site . a pusher rod or other device may be utilized to deploy the uec from the insertion tube into the insertion site . in some procedures , the placement of the uec may be arthroscopically assisted . note that regardless of the endplate preparation , in the deformed , aging , pathologic spine there will be pathology to correct . according to various aspects of the present disclosure , the uecs provided herein may accomplish this in several ways as pertains to the external implant composition . for example , the uec can expand as an externally threaded conduit , either uniformly end to end resulting in same diameters at each end post - operatively ( such as 40 % overall expansion ), or precisely at either end , thus creating an overall conical albeit expanded uec . also , the uec can be flat superiorly and inferiorly as shown in the above drawings , thus more likely matching the rather flat vertebral body end plates . however , according to further aspects of the present disclosure , special care should be taken to consider both the peripheral end plate boney rim as thicker more prominent cortical bone at the vertebral end plates with a sunken or concave thinner interior ( thus subject to potential subsidence ). the uec mos ( method of surgery ) contemplated herein considers the preoperative findings ( e . g . mri , 3d ct scan , x - rays ) to integrate information on bone density , specific disc space and longitudinal spine anatomy , topography and alignment . the various expanding cages disclosed herein and variations thereof are not limited to use in the spinal column but may be used between other bone segments throughout the human or animal body . for example , a uec can be used during arthrodesis of a metatarsal joint . the uec can aid in setting the orientation of the toe to a desired angle before fusion of the apposing bone segments occurs . similarly , a uec may be utilized in the knee , elbow or other body joints , or between two or more bone segments that have been fractured by trauma . 1 ) the uec corrects spine surgical pathology both locally via horizontal ( disc ) and longitudinal vertical axial ( scoliotic / kyphotic ) spine deformity improvements . a ) arthrodesis ( fusion ) or b ) arthroplasty ( motion preservation ) c ) drug / cell therapy delivery 3 ) the uec can expand uniformly throughout implant length , and / or expand only proximally ( toward the surgical incision ) or distally , thus enabling clinical adjustments favorable to spine diseased or injured patients for local and overall spondylopathies . 4 ) the uec can be surgically inserted via outpatient mis ( minimally invasive — outpatient surgery ) as safe , efficacious implants “ doing no harm ” applying advantages from a ) materials thicknesses for height differentials or b ) expansion adjustments surgically controlled ( before / during or after implantation ) or via prefabricated portals or injections — programing implant ‘ mapped ’ corrections using c ) polymers durometrically calculated with variable compressions , permanent or biodegradable activations at will . d ) inflation of the implant as via uec surface chambers or bladder ( s ). e ) adding endplate biologics , foam , or other adaptables for best results . f ) uec expansion can adapt to expand variable external surface parameters including flat , round , or customized external maximally congruent surfaces to interface as with proximate endplates . 5 ) delivery either via uec materials per se ( eluding substances — cells or pharmacologics ) or through extrusion from a uec container or delivery vesicle / depot / chamber / portal will enable not only immediate surgically correction but long term enhanced bone in growth and local / general therapeutic and / or regenerative clinical benefits . while the disclosure has been described in connection with example embodiments , it is to be understood that the disclosure is not limited to the disclosed embodiments and alternatives as set forth above , but on the contrary is intended to cover various modifications and equivalent arrangements included within the claim scope .	0
the present invention is an apparatus and a method that varies the temperature of the rock formation within a confined , local region adjacent to a borehole wall . any one of many known devices for nmr measurements may be adapted for the present invention . for example , when making measurements while drilling , a modification of an apparatus such as that disclosed in u . s . pat . no . 6 , 247 , 542 to kruspe et al , the contents of which are fully incorporated herein by reference , may be used . when making nmr measurements with a wireline logging tool , a suitable apparatus is a modification of the device shown in u . s . pat . no . 5 , 712 , 566 to taicher et al , the contents of which are fully incorporated herein by reference . these particular patents have been cited only as examples of devices that may be modified in a straightforward manner as described below , and the present invention may be a modification of any suitable nmr logging device . in particular , for efficiency of heating , it is desirable to use a tool with a small - apertured nmr sensor . a feature that is common to all such suitable devices is a permanent magnet to provide a static magnetic field for polarizing spins of nuclei in a formation and an rf assembly for producing a pulsed rf field in the formation for excitation and detection of nuclear spin magnetic moments . separate embodiments of the invention are comprised of either active or passive mechanisms for heating the local volume of formation surrounding the borehole . possible modifications of a basic nmr logging apparatus include a microwave heater proximate to the nmr assembly for heating the formation by irradiation with microwaves , or an inductive heating apparatus for heating the formation . for a very localized and small nmr sensor , another possible way of heating is by firing bullets into formation . passive methods include using the action of the drill tool , which produces heat , mainly from friction , to raise the local temperature in the rock formation . in current drilling processes , the dissipation of heat is hastened by effectively circulating the drilling mud . this cooler mud flows through the drill string and is injected on the drill bits ; the wasted , hotter mud in brought out through the wellbore . the temperature of incoming circulating mud is lower than the formation temperature . if the circulation is effective , the temperature of the outgoing mud is higher than the incoming mud . however , for deep wells , the formation temperature may be still higher than the outgoing mud temperature , resulting in cooling the near borehole formation . for instance , in average gulf of mexico wells , the circulation bottom hole temperature ( bht ) may be about 90 ° f . above static bht for depths over 10 , 000 ft . however , for shallow wells , where most of the world &# 39 ; s heavy oil reserves exist , the circulation bht is close to static bht . therefore , if the mud circulation rate is controlled such that the heat is dissipated sufficiently slowly , the circulated mud in the wellbore actually heats the formation , nmr measurements may be taken at the passively heated state . such temperature control may be achieved by controlling the amount of thinning and / or gelling agents in the mud . although it is desirable to operate the in a relatively cool state , due to the fact that the environment temperature for a shallow well is low (˜ 40 ° c . ), raising the temperature by 30 - 40 ° c . will not significantly degrade the drilling operation . although thermal conductivity of the formation is not high , it is still suitable for the present invention since nmr measurements have a shallow - depth of investigation . to make use of passive heating , the nmr sensor is positioned close to the drillbit and measurements are made before the heat produced by drilling is substantially dissipated by drilling mud . furthermore , additional measurements may be done at the equilibrium reservoir temperature , which may be accomplished on another trip using the same logging device . in another embodiment using passive methods , a refrigerating device is used to cool mud that has been heated by the drilling process and the waste heat from the refrigerating device is transferred to a heat sink for heating the formation near an nmr sensor . in another embodiment , the mud is heated from the surface mud pit and the heated mud is circulated into the formation to raise the temperature near the wellbore . this method is practical for wells that are planned to use a geothermal source for heating the formation for recovery from viscous oil formations . in one embodiment of the invention , a microwave device transfers electromagnetic energy from a microwave source to the formation , where the energy dissipates as heat . microwave energy is generated in a frequency that does not change the chemical bonds in the organic constituency of crude oil . at a preferred frequency of up to 2 , 450 mhz , microwave energy leaves the chemical structures of the oil intact because there is no ionization , yet it creates molecular motion in the form of translation motion of the molecules and rotation of the dipoles . the efficiency of the microwave absorption process is determined by several elements , including the size of the intended volume and dielectric losses due to both ionic conduction and dipolar rotation of the material in the formation rock and fluids . these individual dielectric loss rates are generally temperature - dependent but to different degrees . the loss due to dipolar rotation decreases with increasing temperature , while loss due to ionic conduction increases with increasing temperature . composite loss rates are therefore dependent on the dominant loss mechanism within the formation . as an example , for low - temperature wells , the dipolar rotation mechanism is usually the dominant mechanism . in this case , the heating time depends on dielectric relaxation time . for purposes of this invention , the rock formation outside a borehole is modeled as a dielectric medium with infinite extent . hence , there are no boundaries that might produce a reflecting wave . in the embodiment using microwaves , as energy progresses into the medium , its amplitude diminishes owing to the absorption of power and conversion to heat . the penetration depth , defined as the depth into the formation at which the power flux has fallen to 1 / e of its entry point value , is given by the formula d p = λ 0 2 ⁢ π ⁢ 2 ⁢ ɛ ′ · 1 [ 1 + ( ɛ ″ / ɛ ′ ) ] 2 - 1 ≈ λ ⁢ ɛ ′ 2 ⁢ π ⁢ ⁢ ɛ ″ where λ 0 is the incident wavelength of the source , ∈′ is the relative dielectric constant of the rock formation and ∈″ is the relative dielectric loss factor . the efficacy of temperature increase in the sensitive volume depends on the penetration of the microwave energy into the rock formation . penetration depth depends on the operating microwave frequency and is different for rock matrices and types of fluids . therefore , in rock formations , penetration depth depends on porosity and saturation . as an example , the microwave heating device can be operated at a frequency of 2 , 450 mhz and λ 0 = 12 . 24 cm at a temperature of 25 ° c . under these conditions , the measured penetration depths of the energy into corn oil , water , mica , and sandy soil , respectively , are 0 . 022 m , 0 . 013 m , 0 . 253 m , and 4 . 446 m . because water and oil generally coexist in the formation , the efficient heating of formation water and the heat conduction between local water and oil partially compensate for the relative inefficiency of dielectric heating of matrices and oil . also , crude oils often contain conductive impurities which may increase the loss , and thus generate substantial heat . in rock formation where matrix volume is greater than pore volume , it is reasonable to expect an effective penetration depth of 7 - 10 cm . this depth is sufficient for borehole nmr measurements . based on further experimentation on actual temperature dependence of properties of heavy oil , the expected depth of penetration may be different . the requirements for heating power depends on the specific heats of the materials that constitute the fluid - bearing rock formation . as an example , the values of specific heat for water , crude oil , clay , limestone at room temperature are 4 . 2 , 2 . 2 , 1 . 0 , and 0 . 92 kj / kg /° c ., respectively . for a 20 % porosity rock , in which 80 % of rock volume is matrix volume , the overall specific heat of formation is thus about 1 . 4 kj / kg / k . assuming an 8 ″ borehole and a 1 kw directional , idealized microwave device such as an open waveguide with an aperture of 36 ° and further assuming the formation response to this microwave source has a penetration depth of d p = 2 to 4 inches , the rise in temperature over this volume ranges from 57 to 25 ° c ./ min . these values assume a density of formation ρ f = 2 . 34 kg / liter . overall , power dissipation into the dielectric media is 64 % of the incident power . although power loss due to non - ideal microwave sources and conductive media need to be included for real situations , the heating time required for a small sensor is of the order of few minutes . this is acceptable for nmr logging or stationary measurements . due to exponential temperature decay at distances away from the borehole wall , it is desirable to use multiple frequency nmr sensors which measure signals at different depths of investigation . for large apertured nmr sensors , usually a stationary measurement of a large heated area is more practical . fig1 a shows the effect that changing the time interval between cpmg pulses , te , has on the appearance time of the t 2 peak of crude oil at a temperature of 30 ° c . the peak for a pulse sequence with te = 0 . 5 ms ( 101 ) appears at 0 . 5 ms . at the same temperature , increasing the duration of the pulse sequence to te = 2 . 4 ms causes the t 2 peak to appear at 2 ms ( 103 ). it is important to note that the 2 ms peak of te = 2 . 4 ms is incorrect because little can be detected for porosity components having t 2 & lt ; 2 ms . this situation results in an underestimation of porosity and viscous oil saturation . in fig1 b , the same pulse sequences are represented with the temperature now is raised to 75 ° c . at this temperature , the t 2 peak from a cpmg measurement with te = 0 . 5 ms now appears at approximately 2 ms ( 104 ). furthermore , the peak of the response to the te = 2 . 4 ms sequence also occurs at approximately 2 ms ( 106 ). there is no discernable diminution of the peak at te = 2 . 4 ms , allowing the practitioner a more accurate reading of the porosity . fig1 a and 1 b show that changing the temperature of the environment can have a noticeable effect on the peak response readings . the intrinsic relaxation time t 2 of oil , changes significantly depending on the temperature of the oil . specifically , as temperature increases , the t 2 peak of heavy oil appears at later times . fig2 a and 2 b display the effect of heating on the t 2 distributions . this shift in the t 2 spectrum is expected to occur only for oil , due to the fact that for a water - wet system , the surface reflexivity is independent of temperature , meaning that a smaller shift is expected for the t 2 of water . due to the diffusivity of water increasing with temperature , the diffusion effect tends to slightly shift the apparent t 2 to earlier times . therefore increasing temperatures will shift the heavy oil to longer t 2 times and will shift the water to shorter t 2 time , facilitating the differentiation of oil and water nmr signals . the shift of water t 2 usually is insignificant for the faster decaying bvi and cbw water signal is dominated by surface relaxation . furthermore , by comparing spectra acquired at different temperatures , the practitioner can identify and quantify oil and water saturation . fig2 a shows the effects of temperature on the timing of the response peaks , with te held constant at te = 0 . 5 ms . the curves represent readings taken at temperatures of 30 ° c ., 45 ° c ., 60 ° c ., and 75 ° c . the peak for t = 30 ° c . ( 201 ) occurs at approximately 2 ms . as temperature increases , the peak migrates to later times , such that the peak for t = 75 ° c . ( 202 ) occurs at approximately 10 ms . fig2 b shows the same experiment with the cpmg pulse interval maintained at te = 1 . 2 ms . as in fig2 a , temperature is changed from 30 ° c ., 45 ° c ., 60 ° c ., and finally 75 ° c . as in fig2 b , the peak migrates to later times as temperature increases . at 30 ° c ., the peak occurs at 2 ms ( 203 ), and at 75 ° c ., the peak occurs at 10 ms ( 204 ). the examples shown in fig2 a and 2 b indicate that 40 - 50 ° c . temperature rise does make important differences for detecting heavy oils . change from 2 ms to 10 ms clearly separates oil from cbw as the latter usually relaxes with t 2 ≦ 3 ms . the embodiment of the invention is designed to be operated in both single frequency mode or multiple frequency mode in order to obtain different types of information . in a single frequency mode , the practitioner can take nmr measurements indicative of porosity and saturation of heavy oils and interleave measurements with the microwave heating process to obtain temporal profiles of the nmr properties . using a multiple frequency tool , the practitioner can obtain profiles of the t 2 spectrum and other nmr properties as a function of depth of sensitive volume ( i . e ., depth of investigation , doi ). since the heating efficiency is depth dependent , the temperature is doi dependent , and , thus , the depth profiles of the nmr response correspond to the temperature profile of the nmr response . on the other hand , another method for determining near - wellbore formation temperature is to use the existing arts of simulation techniques . for example , fanchi in spe paper 20483 shows examples of temperature distribution in reservoirs heated by electromagnetic irradiation . principally any state - of - art nmr logging tools can be used in conjunction with the microwave heating device described in this invention . however , to heat a large volume in the formation usually requires longer times which may not be practical to logging applications . therefore , a small apertured , preferably pad or side looking , nmr sensor focused in a small locality of formation is more desirable . a small sensor also reduces the power consumption thus leaving more power for microwave heating . a heated formation volume usually takes quite long time to cool down , therefore , for continuous logging while heating , a long - slit type of microwave antenna is placed in the front of the nmr device to provide pre - measurement heating of the formation . the borehole fluid usually acts as a conductive media where microwave can be attenuated quickly . thus , the microwave heating device is desired to have a good contact , or at least in a very close proximity , of the borehole wall . in one embodiment of the invention , the microwave device used for heating is also used for determining dielectric properties of the earth formation , as the microwave frequency band is suitable for dielectric measurements . oil saturation can potentially be determined by utilizing their differences between the loss tangents of oil (& gt ; 1000e4 ) and water (& lt ; 100e4 ). a noticeable difference appears in the imaginary component of the dielectric constants of each ( 80 for oil and 2 for water ). the tan δ for water decrease as temperature increases . there is not enough current information on the temperature depend of tan δ for many types of oils . however , tan δ for water is also dependent on frequency . measuring formation at two frequencies provides additional means to determine oil / water saturations . another embodiment of the invention uses the reservoir fluid characterization rci ™ tool of baker hughes inc . at an increased temperature . details of the operation of the tool are given , for example , in u . s . pat . no . 5 , 377 , 755 and u . s . pat . no . 5 , 303 , 775 to michaels et al , having the same assignee as the present invention and which are fully incorporated herein by reference . although the embodiment is not for use in close contact with the rock formation , due to significant microwave attenuation in water , the source of the microwaves must be placed in contact with the formation . in the rci ™ operation , reservoir fluids are extracted from formation using a pressure pump . because of the low mobility of viscous oil , it requires very high pressure to extract viscous oils from formation , often in the risk of causing formation damage . when the local formation temperature is raised , the oil viscosity decreases . thus , the reservoir fluids can be extracted under a reduced pumping pressure thereby reducing the risk of formation damage . the data obtained at elevated temperature can be used in two ways . firstly , for petrophysical quantities that are temperature independent , such as saturation and porosity , the estimated values obtained at the increased temperature should be the same as that in original reservoir temperature condition . for fluid properties that are temperature dependent , such as viscosity , the values obtained at the increased temperature are extrapolated back to its equilibrium reservoir temperature . secondly , production of many heavy oil reservoirs requires the application of an enhanced oil recovery method because there is little spontaneous flow . the use of heating is one of the commonly used enhanced oil recovery methods . oil properties measured at the increased temperature provide the exact information useful to predict the production potential if the enhanced oil recovery method is necessary . any of the described methods above ( active or passive heating , refrigeration etc .) thus reversibly alters a property ( temperature ) of the formation . the alteration in temperature changes a parameter of interest that is measured by a sensing device within the formation . in broad terms , the present invention takes advantage of the difference in the parameter of interest . fig3 shows an exemplary tool suitable for use with the method of the present invention . shown is a borehole 310 which has been drilled in a typical fashion into a subsurface geological formation 312 to be investigated for potential hydrocarbon producing reservoirs . a logging tool 314 has been lowered into the hole 310 by means of a cable 316 and appropriate surface equipment represented diagrammatically by a reel 318 and is being raised through the formation 312 comprising a plurality of layers 312 a through 312 g of differing composition , to log one or more of the formation &# 39 ; s characteristics . the logging tool is provided with bowsprings 322 to maintain the tool in an eccentric position within the borehole with one side of the tool in proximity to the borehole wall . the logging tool 323 includes an nmr sensor 325 and a microwave heating device 327 . in the example shown , the microwave heating device is shown below the nmr sensor . alternatively , the microwave heating device may be placed above the nmr sensor . the latter arrangement is usually preferable wireline tools in which measurements are typically made with the wireline being pulled up from greater depths . the former arrangement ( i . e ., microwave heating device below the nmr sensor ) is usually preferable in mwd applications . as an alternative to or in addition to the nmr sensing device , dielectric measurements of the earth formation and / or fluids may be made by a suitable microwave sensing device ( not shown ). exemplary tools and methods for determination of dielectric properties of earth formations are described in u . s . pat . nos . 4 , 052 , 662 and 4 , 893 , 084 to rau , the contents of which are fully incorporated herein by reference . it should be noted that other microwave devices for determination of formation dielectric constant may also be used . it should also be noted that when a microwave sensing device is used , a heating device may not be necessary , i . e ., the heating device and the sensing device may be the same . signals generated by the tool 314 are passed to the surface through the cable 316 and from the cable 316 through another line 319 to appropriate surface equipment 320 for processing , recording and / or display or for transmission to another site for processing , recording and / or display . it should also be noted that in fig3 , the nmr sensor and the microwave heating device are shown on a single tool . it is also possible to have them on different assemblies that can be strung together . the present invention has been described with reference to a wireline device . however , the principles of the invention may also be embodied in and used with mwd devices conveyed on a drilling tubular such as a drillstring or coiled tubing . while the foregoing disclosure is directed to the preferred embodiments of the invention , various modifications will be apparent to those skilled in the art . it is intended that all variations within the scope and spirit of the appended claims be embraced by the foregoing disclosure .	6
one embodiment of the present invention will be described below referring to the drawings . fig1 is a functional block diagram showing an example of an imaging apparatus according to the present invention . in fig1 , the digital camera is provided with an external recording unit 11 for recording an image file of a photographed picture image , an imaging device 12 as an input portion of imaging information such as a ccd and an ad converter , a display device 13 configured to display various information relating to a photographing image setting , various information concerning photographing operations and the like , an operational table 14 with which an input operation from the outside can be carried out , a communication i / f 15 configured to control a communication interface to a printer 2 , and an entire control unit 10 configured to control the digital camera entirely . the external recording unit 11 includes a recording medium as typified by a flash memory , etc . and a driver unit for controlling operations of writing in / readout from the recording medium . the entire control unit 10 can be composed of a conventionally - known microcomputer including a cpu , a rom , a ram , an input / output port ( i / o port ), bus lines which connect therebetween and the like . the digital camera 1 can be connected to the external device 2 through a communication means 3 connected to the communication i / f 15 to be able to communicate with the external device 2 . either wire transmission or wireless transmission can be used for the communication means 3 . a usb ( universal serial bus ) can be a typical example for wire transmission . a short - range wireless communication system such as bluetooth , wi - fi ( wireless lan standards ), irda , etc . is commonly and widely used as a wireless transmission method . a usb is popularly used as a communication device . a storage portion composed of the rom and the ram may be provided with nonvolatile memories ( e . g . flash memories ) in which processing procedures for the cpu ( i . e . programs ) are stored . processes for displaying an operation selection screen according to the present invention can be embodied by such programs stored in the storage portion . when a print process program is executed , the storage portion records various parameters used by the program and functions as a work area used by the cpu and as a buffer memory while image files are transmitted to the printer 2 . an embodiment of a process for displaying an operation selection screen according to an imaging apparatus of the present invention will be described below referring to the flowchart in fig2 . each step in fig2 is designated by “ 301 ”, “ 302 ” . . . . when the digital camera as the imaging apparatus is connected to the printer 2 via the communication i / f 15 to be able to communicate thereto ( step 301 ), the cpu as a control portion of the digital camera requests the printer 2 to sent a printer capability value to receive the printer capability value ( step 302 ). then a process for judging whether the digital camera 1 has all data for display ( hereinafter “ data for display ” is designated as “ display data ”) corresponding to all capability items included in the received printer capability value or not is carried out ( step 303 ). if a result of the judgment process indicates that no display data corresponding to the printer capability value exists (“ no ” at step 303 ), a conversion process for generating displayable display data is carried out ( step 304 ). an operation selection screen is displayed on the display device with use of the display data generated in the conversion process . a user makes a desired selection from capability selection operations on the operation selection screen displayed as a result of the process by way of using the operation table 14 . after this process , the same processes described above are carried out ( step 205 in fig1 ). the conversion process will be described below . when the digital camera 1 receives printer capability value as shown in fig2 and if the digital camera does not have display data corresponding to a capability item groups 32 included in the printer capability value , digital camera 1 carries out a display process for displaying an operation selection screen with use of a character string ( s ) included in the capability item groups 32 . in an example of a printer capability value shown in fig3 , a capability item 33 includes the capability item groups 32 , character code information 34 and displaying order information 35 . in the case the character code type which the digital camera is capable of displaying is only “ us - ascii ”, when the digital camera receives the printer capability value shown in fig3 display data capable of being displayed ( i . e . “ displayable ”) on the operation selection screen are “ 1 up ” and “ index ”, and display data are generated so that “ 1 up ” and “ index ” respectively as first and second items of the operation selection screen corresponding to & lt ; layouts & gt ; designated by the item information identifier 31 are displayed . an example of the operation selection screen displayed according to the conversion process is shown in fig4 . as described above , if a function is added to the printer side so that a capability item included in a printer capability value is added , displayable display data can be generated with use of information included in the received printer capability value . thus , all operationally selectable items corresponding to the received printer capability value can be displayed the operation selection screen . another embodiment of the display process of the operation selection screen according to the imaging apparatus of the present invention will be described referring to the flowchart of fig5 . in fig5 each step is designated by “ 501 ”, “ 502 ” . . . . when the digital camera 1 as the imaging apparatus is connected to the printer 2 through the communication i / f 15 so that the status thereof becomes the one where the digital camera 1 is able to communicate with the printer ( step 501 ), the digital camera 1 requests the printer 2 to send a printer capability value . a printer capability value from the printer 2 is received ( step 502 ), and after it is received whether ( an ) icon files corresponding to the printer capability value are received or not is judged ( step 503 ). if ( an ) icon files are received in the receiving process (“ yes ” at step 503 ), a process for generating display data is carried out with use of the printer capability value and the icon files ( step 504 ) to display an operation selection screen according to the generated display data . examples of the printer capability value and the icon files transmitted from the printer 2 to the digital camera 1 are shown in fig6 and 7 for the above - mentioned embodiment . the same numerals which are used for the already - described printer capability value are applied to equivalent capability values in fig6 . a capability item group 32 included in the printer capability value is provided with selectable four capability items : & lt ; lineformata & gt ;; & lt ; lineformatb & gt ;; & lt ; lineformatc & gt ;; and & lt ; lineformatd & gt ;. the four capability items are layout capabilities . here , the “ icon files ” means files including a plurality of icons for displaying capabilities corresponding to the printer capability value with figure images . such icon files are a sort of image information in bitmap format and the like . an example of the icon files are shown if fig7 . in fig7 , file names each corresponding to capability items included in the printer capability value are allotted to the icon files , respectively . display data are generated with use of the icon files and the display data corresponding to the capability item group 32 and are displayed on the display apparatus 11 . an example of the operation selection screen is shown in fig8 . as shown in fig8 the operation selection screen is provided with a title 80 , selection items 81 , a setting operation expression 82 and icons 83 . by way of operating the operational table 14 to select and set one of the selection items , an image file can be printed with use of the set layout capability . in the display data generating process , if a printer capability value received by the digital camera 1 includes a display generating rule 35 as shown in fig9 rather than assigns icon files corresponding to the capability item group 32 , display icons each corresponding to capability items can be generated according to information about the number of frames & lt ; listlayoutkomanum & gt ; and information about existence / nonexistence of a ruled line & lt ; listlayoutline & gt ;. the operation selection screen shown in fig8 can be displayed in accordance with the generated display icons and the capability items of the capability item group 32 . another embodiment of the operation selection screen according to the imaging apparatus of the present invention will be described below . the digital camera 1 is connected to the printer 2 through the communication i / f 15 and receives a printer capability value from the printer 2 as well as ( an ) image files recorded in a storage portion ( not shown ) of the printer 2 . an example of image files transmitted from the printer 2 is shown in fig1 . in fig1 , the four image files are in jpeg format and recorded in the storage portion of the printer 2 . the image files are recorded in a file structure as shown in fig1 . the digital camera 1 executes a reduction process of the received image files and by way of using the reduced image files as substitutes for icons in a display data generating process the operation selection screen as shown in fig8 can be displayed . another embodiment of a display process for displaying the operation selection screen according to the imaging apparatus of the present invention will be described below . if the digital camera 1 connected to and capable of communicating with the printer 2 receives a printer capability value as shown in fig1 , the operation selection screen shown in fig1 can be displayed according to a character string of & lt ; original & gt ; included in the capability item group 32 . the example of the display screen in fig1 is the one where & lt ; original & gt ; is converted to “ construction photograph ” to generate display data . as described , display data corresponding to the prescribed capability items may be stored in the storage portion of the digital camera 1 so that a user can voluntarily set display data . the present invention is also applicable to a portable telephone with a camera and the like capable of being connected to a printer through usb connection .	7
referring to the drawings , wherein like reference numbers correspond to like or similar components throughout the several figures , a vehicle 10 is shown in fig1 . the vehicle 10 includes a fluid circuit 20 having a fluid pump 22 and one or more flow ( q ) control solenoid valves 24 . the valves 24 may be embodied as variable force flow control solenoid ( qvfs ) valves , which as is known in the art are responsive to electrical current signals so as to open and thereby pass pressurized fluid ( arrow 29 ) at a desired flow rate . such signals are indicated in fig1 as arrow i qc from a controller ( c ) 50 , the structure and function of which is discussed in detail below . the flow control valves 24 are connected to the fluid pump 22 by a suitable conduit 23 , such as hoses , clamps , fittings , and the like . the vehicle 10 includes various fluid powered components and control devices as explained below . the vehicle 10 therefore serves as a non - limiting example system suitable for use with a method 100 for adaptively learning the flow characteristics of the valve ( s ) 24 . however , those of ordinary skill in the art will appreciate that the present invention is not limited to vehicular applications . other possible systems may include , by way of example , hydraulic presses , conveyors , and lifts typically used on a plant floor , provided any of these systems includes a hydraulic device that is actuated via a piston or other movable actuator whose position can be measured and controlled . in all embodiments , the controller 50 of fig1 is in communication with the fluid circuit 20 . position sensors ( s p ) are disposed within the vehicle 10 as shown . measured position signals ( p x ) are output from the position sensors sp and transmitted to the controller 50 , for instance over a controller area network bus , serial bus , or other suitable connection , and used in the execution of the method 100 . an example embodiment of the method 100 is described below with reference to fig3 . as part of the method 100 , the controller 50 , using a processor ( p ) and memory ( m ), periodically updates a set of lookup tables ( lut ) 52 , an example of which is shown in fig2 . using the information recorded in the lookup tables 52 , the controller 50 ultimately derives and adapts the underlying commanded flow rate corresponding to flow control signals ( i qc ), with the term “ adapts ” indicating the changing nature of the flow control signals ( i qc ) over time to match the actual performance of the valve 24 . in a possible configuration , the vehicle 10 of fig1 may include an internal combustion engine ( e ) 12 and a transmission ( t ) 14 , for instance a dual - clutch transmission ( dct ) as shown having a first and a second input clutch ci 1 and ci 2 , respectively . only one input clutch may be used in an alternative automated manual transmission ( amt ). the transmission 14 includes an output member 17 that delivers output torque from the transmission 14 to the drive wheels 21 of the vehicle 10 , e . g ., via a differential 19 . additionally , a temperature sensor s t may be positioned in a fluid sump 26 of the fluid circuit 20 , with a fluid sump 26 containing a volume of fluid 27 , e . g ., oil or transmission fluid . a portion of this fluid 27 , once circulated under pressure via the pump 22 , is ultimately discharged via the valves 24 as the pressurized fluid ( arrows 29 ). the temperature sensor s t , which is in electrical communication with the controller 50 , may periodically or continuously transmit a measured fluid temperature ( t f ) to the controller 50 for use in control of the valves 24 . the controller 50 may receive other signals as part of its overall control function within the vehicle 10 . the controller 50 of fig1 may be embodied as a host computer device that includes elements such as the processor ( p ), the memory ( m ) including but not limited to read only memory ( rom ), random access memory ( ram ), electrically - programmable read - only memory ( eprom ), flash memory , etc ., and the required hardware devices 55 . hardware devices 55 may include a high - speed clock ( not shown ), timers for use in the execution of certain steps of the method 100 , analog - to - digital ( a / d ) circuitry , digital - to - analog ( d / a ) circuitry , a digital signal processor ( dsp ), and input / output ( i / o ) devices and / or other signal conditioning and / or buffer circuitry . within the transmission 14 , a gear box 16 may contain another clutch c 1 , for instance a friction clutch or a clutch synchronizer . for simplicity , only one additional clutch c 1 is shown in the schematic view of fig1 . however , in an actual embodiment , any number of clutches and / or synchronizers may be used . the description provided herein with respect to the clutch c 1 of transmission 14 therefore applies to any position - controlled clutch used in the transmission 14 or outside of the transmission 14 , e . g ., the input clutches ci 1 and ci 2 . the clutches ci 1 , ci 2 , and c 1 may each utilize a respective one of the position sensors s p , positioned with respect to a clutch apply piston 11 , with engagement of each input clutch ci 1 , ci 2 in a non - limiting dct embodiment respectively selecting only the oddly - numbered or evenly - numbered gears of the transmission 14 . as is known in the art , such a configuration allows the connection of an output shaft 13 of the engine 12 to such selected gears . that is , the transmission 14 may have an input member 15 a , 15 b , with the input member 15 a being the oddly - numbered gear shaft and input member 15 b being the evenly - numbered gear shaft , as is known in the art of dcts . the specific rotatable members that are selectively connected and disconnected via engagement of a given clutch , e . g ., ci 1 , ci 2 , or c 1 , may vary from those shown in fig1 , i . e ., the output shaft 13 or input members 15 a , 15 b , without departing from the intended inventive scope . the example clutches ci 1 , ci 2 , and c 1 are in fluid communication with the fluid pump 22 , and therefore are supplied with fluid 27 under pressure as needed to actuate the clutches ci 1 , ci 2 , and / or c 1 . the fluid 27 flows through the valve ( s ) 24 whenever the valves 24 are opened in response to receipt by the valves 24 of the flow control signals ( i qc ) from the controller 50 . such commands may be , as noted above , embodied as electrical current control signals transmitted to the valve ( s ) 24 , e . g ., a commanded current level needed for energizing the coil ( not shown ) of any solenoid portion of the valves 24 so as to open the valves 24 in a typical normally - off valve design . as one of its intended functions , the controller 50 of fig1 executes the instructions embodying the method 100 to thereby reduce the effects of variation in output flow from the valves 24 over time with respect to expected values . this in turn may help to reduce variation in clutch position and clutch torque , and ultimately improve overall shift quality . as is known in the art , conventional qvfs valves are provided with a characteristic flow / current ( q v . i ) characteristic curve that is valid at a given pressure and temperature , typically as seen during steady - state operating conditions . however , variation from the values in a calibrated q v . i characteristic curve may result at other pressures , temperatures , and / or due to age or wear of the valves 24 . to address this problem , the controller 50 of the present invention periodically learns the true output flow performance characteristics of the valves 24 and then adjusts the values in the lookup tables 52 in the manner set forth below so as to compensate for such variation , thereby creating a closer match between expected and actual performance . referring to fig2 , in an example embodiment the lookup tables 52 may include first , second , and third rows r 1 - 3 . the first row r 1 captures a commanded flow rate ( q cc ) underlying the flow control signals ( i qc ) of fig1 . this value is shown nominally in an example range of − 3 to + 3 , for instance in liters per minute or another suitable flow rate . the actual values in the first row r 1 will vary depending on the design of the valve 24 . in this instance , a negative flow , for instance − 3 , refers to an outflow of fluid 27 from the clutches ci 1 , ci 2 , or c 1 of fig1 , such as might occur when exhausting fluid 27 from the clutch ci 1 , ci 2 , or c 1 . the second row r 2 may be populated with corresponding actual flow rates q a , which as noted above may vary over time from the commanded flow rate q cc of the first row r 1 . the values in the second row r 2 are shown as q 1 , q 2 , q 3 , . . . , q n for illustrative simplicity . the actual values recorded in the second row r 2 may be calculated by the controller 50 , for instance using the following equation : where p 1 and p 2 are the measured positions of the clutch ci 1 , ci 2 , or c 1 , or more precisely of the clutch apply piston 11 thereof , as determined via the position signals p x for a corresponding position sensor s p for that clutch , a is the predetermined surface area of the same clutch apply piston 11 , and t 1 is a timer value indicating the elapsed time between the transition between positions p 1 and p 2 . the actual flow rate q a in other embodiments may be determined differently , for example using a flow meter , without departing from the intended inventive scope . multiple lookup tables 52 may be created for different temperatures in some embodiments , with the different temperatures indicated as t 1 , t 2 , t 3 , t 4 , and t 5 in the example five - table embodiment of fig2 . in such an embodiment , multiple lookup tables 52 may be recorded in memory m of the controller 50 shown in fig1 . more than five lookup tables 52 may be used in other embodiments , while fewer than five lookup tables 52 may also be used . this way , the lookup table closest in temperature to the actual temperature at the time of the analysis can be used to minimize error , or values from multiple lookup tables 52 can be used to extrapolate a final value for use in the method 100 . a sufficiently large number of lookup tables 52 should be used so as to cover a useful range of likely temperatures , such as the five tables for temperatures t 1 t 2 , t 3 , t 4 and t 5 as shown in fig2 . the controller 50 of fig1 uses the data in the respective first and second rows r 1 and r 2 of the lookup tables 52 to create a compensation scale factor f , and records this value in the third row r 3 , as indicated by the nominal scale factors f 1 , f 2 , f 3 , . . . , f n . the compensation scale factor f as used herein is a calculated ratio of the commanded flow rate q cc to the actual flow rate , i . e ., using the compensation scale factor f , the controller 50 can readily adjust the commanded flow rate q cc from a prior application of one of the clutches ci 1 , ci 2 , or c 1 via the recorded compensation scale factor f , with the result being to a new or adapted value for the flow control signals ( i qc ) of fig1 . because this process is iterative , the controller 50 periodically updates the lookup tables 52 based on the calculated or measured actual flow q a , a value which may change over time , to thereby ensure control accuracy of the valves 24 . referring to fig3 , an example embodiment of the method 100 begins at step 102 , wherein the controller 50 commands a positive flow rate from the valve 24 of fig1 via an initial set of flow control signals ( i qc ). step 102 may be executed in response to a request for such flow , for instance by a driver of the vehicle 10 of fig1 when the driver requests a shift of the transmission 14 via throttle and / or braking action requiring the application or release of any of the clutches ci 1 , ci 2 , or c 1 . the method 100 then proceeds to step 104 . step 104 entails receiving the measured position signals p x from the position sensors s p of the particular clutch , the valve 24 for which whose performance is being evaluated in the present control loop . this value may be temporarily stored in memory m . the method 100 then proceeds to step 106 . at step 106 , the controller 50 of fig1 next determines , from the received measured position signals p x of step 105 , whether the clutch whose valve 24 is being evaluated has reached a first calibrated position ( p 1 ). if the first calibrated position ( p 1 ) has been attained , the method 100 proceeds to step 108 . the method 100 otherwise repeats step 106 . at step 108 , the controller 50 starts a timer ( k +), which may be included as part of the hardware 55 of the controller 50 as shown in fig1 . as noted above with reference to fig2 , the time of transition between calibrated positions may be used to calculate the actual flow rate q a for recording in each of the lookup tables 52 , and therefore the timer steps of fig3 are important to this calculation . the method 100 proceeds to step 110 when the timer has started . step 110 may entail determining , from the received measured position signals p x , whether the clutch whose valve 24 is being evaluated has reached a second calibrated position ( p 2 ). if so , the method 100 proceeds to step 111 . the method 100 otherwise repeats step 110 while the timer continues counting . at step 111 , the controller 50 stops the timer that was previously initiated at step 108 before proceeding to step 112 . the value of the counter in the transition between points p 1 and p 2 may be recorded in memory m for use in calculating the actual flow rate q a for lookup tables 52 of fig1 and 2 . step 112 entails determining , from the received measured position p x , whether the clutch being evaluated has attained a third calibrated position ( p 3 ). if not , the method 100 repeats step 112 . otherwise , the method 100 proceeds to step 114 . at step 114 , the controller 50 commands a negative flow rate from the valve 24 of the clutch being evaluated , doing so in response to the determination at step 112 that the clutch ci 1 , i 2 , or c 1 has reached the third calibrated position ( p 3 ). that is , to arrive at step 114 , the controller 50 first determines at steps 106 and 110 that the clutch has passed the first and second position thresholds p 1 and p 2 , respectively , and is thus being fully applied . however , step 112 determines that the clutch has moved beyond the second calibrated position ( p 2 ) to the third calibrated position ( p 3 ). in response to this , the controller 50 may command an outflow of fluid 27 from the clutch so as to move the clutch , or rather its clutch apply piston , back in the direction of the second calibrated position ( p 2 ). after commanding such an outflow , the method 100 proceeds to step 116 . step 116 may entail determining whether the clutch position , from the measured position signals p x , has changed and is now less than the third calibrated position p 3 , i . e ., the clutch apply piston 11 for the clutch being evaluated is presently located between the second and the third calibrated positions p 2 and p 3 . if this is the case , the method 100 proceeds to step 117 , with the method 100 instead repeating step 116 if the position has not yet changed as expected . step 117 involves initiating the timer from zero anew before proceeding to step 118 . at step 118 , the controller 50 of fig1 next determines if the position of the clutch ci 1 , ci 2 , or c 1 , which was previously commanded by the controller 50 to approach the second position p 2 by the negative flow (− q ) commanded at step 114 , has in fact reached the second calibrated position p 2 . if so , the method proceeds to step 119 . otherwise , the controller 50 repeats step 118 . at step 119 , the timer that was previously started again at step 117 is now stopped ( k −). the elapsed time of the move from the third threshold position p 3 back to the second threshold position p 2 is recorded in memory m of the controller 50 . the method 100 thereafter proceeds to step 120 . step 120 may include determining if the clutch being evaluated has moved to below the first threshold position ( p 1 ), i . e ., to a position between fully exhausted and the first calibrated position ( p 1 ). if not , the method 100 repeats step 120 and continues to exhaust pressure from the clutch . the method 100 proceeds to step 122 once the clutch being evaluated has moved past the first threshold position ( p 1 ). at step 122 , the controller 50 of fig1 next calculates the compensation scale factor f for the positive and negative flow rates that occurred in the execution of steps 102 - 120 . as explained above with reference to fig2 , calculation of the compensation scale factor f involves the use of the data recorded in the lookup tables 52 , i . e ., commanded and actual flow rates q cc and q a , respectively , through the filling or emptying of the clutch ci 1 , ci 2 , or c 1 . the method 100 proceeds to step 123 when this step is complete . step 123 may optionally include incrementing a test counter ( k t + ). such a test counter , also available as part of the hardware 55 shown in fig1 , may be tied to how many pairs of test flow rates are commanded during testing . for example , in the lookup tables 52 shown in fig2 there are seven ( 7 ) pairs of commanded flow rates , i . e ., [− 3 , 3 ], [− 2 , 2 ], [− 1 , 1 ], [− 0 . 75 , 0 . 75 ], [− 0 . 50 , 0 . 50 ], [− 0 . 35 , 0 . 35 ], and [− 0 . 25 , 0 . 25 ], which in this example represents commanded flow rates ( q cc ) in liters per minute . the actual number of test pairs may vary with the design depending on the level of granularity that is desired , and the flow rates may likewise vary depending on the design of the transmission 14 . the method 100 then proceeds to step 124 . at step 124 , the controller 50 of fig1 next determines whether the count of the test counter incremented at step 123 indicates that a given pair of commanded flow rates has been tested , i . e ., k t = val ? the method 100 proceeds to step 126 if a given pair has been tested . alternatively , the method 100 may proceed to step 126 only if all seven flow rates pairs have been tested , although once a pair has been tested , that particular flow rate may be adapted for the next shift of the transmission 14 requiring that flow rate . the method 100 proceeds instead to step 129 if a given pair of commanded flow rates has not been tested . at step 126 , the controller 50 updates the lookup tables 52 of fig1 and 2 , as indicated by 52 + in fig3 , using the data determined in the execution of steps 102 - 124 , and after resetting the test timer for the particular pair of commanded flow rates whose test has been completed , thereafter proceeds to step 128 . step 128 entails applying the compensation scale factor f to the commanded flow q cc from the last application of the clutch ci 1 , ci 2 , or c 1 , indicated as q cci for an initial use of the method 100 , such q cci for the initial or an immediately prior shift action involving a particular commanded flow rate is set equal to the adapted commanded flow rate , as abbreviated by q cci = q cc in fig3 . this step allows the flow control signals ( i qc ) transmitted from the controller 50 to the valve 24 , upon the next application of a clutch controlled by the valve 24 , to be adjusted or adapted upward or downward as needed via the compensation scale factor f . the compensation scale factor f may be further limited by calibration values , and set to 1 when the learning process enabled by method 100 is not complete for a given commanded flow rate pair or temperature region . likewise , the commanded flow rate ( q cc ) may remain limited to levels allowed by any calibrated flow command limit tables of the controller 50 . the method 100 is then completed () for one control loop , repeating anew at step 102 . the method 100 therefore runs continuously , updating the lookup tables 52 over time in the background of any existing clutch control logic in a non - intrusive and computationally simple approach . step 129 may include using the prior value for the commanded flow rate ( q cci ) in the next use of the evaluated clutch . this decision is made based on a determination at step 124 that the test counter did not indicate that an affected pair of commanded flow rates , e . g ., [− 3 , 3 ] lpm , has been completely tested . the method 100 is then completed () for one control loop , repeating anew at step 102 . using the method 100 and controller 50 as described above , a vehicle such as the vehicle 10 of fig1 or any other fluidic system using a positioned - controlled clutch apply piston may enjoy certain performance improvements . current technology is to characterize flow versus solenoid current of a flow control solenoid valve at a single pressure and temperature , with this information provided via a supplier of the valve as noted above . the present invention as described above instead provides a nonintrusive , computationally efficient way to periodically characterize the actual output flow rate and adjust a commanded flow rate via the lookup tables 52 of fig2 so as to compensate for flow variation over time . the result should be a more predictable output flow from a given valve 24 . in turn , the improved accuracy in output flow control should result in an improved quality or feel of the particular fluid powered action that is being controlled , whether that is a shift of the transmission 14 in the example vehicle 10 of fig1 as described above or any other action of a positioned - controlled fluidic device . while the best modes for carrying out the invention have been described in detail , those familiar with the art to which this invention relates will recognize various alternative designs and embodiments for practicing the invention within the scope of the appended claims .	5
fig1 illustrates an lut according to a first embodiment . the lut 10 illustrated in fig1 is an ( n + 1 )- input lut . the lut 10 includes two luts 11 and 12 and a multiplexer 13 . each of the luts 11 and 12 is less in the number of inputs than the lut 10 . the following description is made by assuming that each of the luts 11 and 12 is an n - input lut . thus , the n - input lut 11 includes a memory group 21 a of 2 n memories and a multiplexer 22 a , and selectively outputs information stored in the memory group 21 a using n input signals . the n - input lut 12 includes a memory group 21 b of 2 n memories and a multiplexer 22 b , and selectively outputs information stored in the memory group 21 b using n input signals . the n - input luts 11 and 12 are connected to the n input signal wires , and output signals of the n - input luts 11 and 12 are input to the multiplexer 13 . one of the output signals input to the multiplexer 13 is selected to be output according to an ( n + 1 )- th input signal . consequently , an ( n + 1 )- input 1 - output lut 10 can be implemented . here , a direction of connecting the n - input lut 11 to the n input signal wires is opposite to a direction of connecting the n - input lut 12 to the n input signal wires . by making the connection directions of the n - input luts 11 and 12 with respect to the n input signal wires to be opposite to one another , loads of the n input signal wires can be uniformized . accordingly , a delay time from the input of each input signal to the output of the selected signal can be reduced . this effect is described hereinafter with reference to a circuit example of the lut 10 . fig2 illustrates a circuit example of the lut 10 . the lut 10 illustrated in fig2 is a 4 - input lut . the lut 10 configures multiplexers 13 , 22 a and 22 b using plural switches . in the case of the 4 - input lut 10 , 3 input wires a , b and c are connected to each of the multiplexers 22 a and 22 b , and 3 input signals a , b and c are input to the 3 input wires a , b and c , respectively . as illustrated in fig3 a , e . g ., a transfer gate configured by a parallel combination of an n - channel metal oxide semiconductor ( nmos ) transistor and a p - channel metal oxide semiconductor ( pmos ) transistor can be used as each of the transistors . incidentally , in fig2 and later , the transfer gate is designated with a symbol illustrated in fig3 b . alternatively , as illustrated in fig4 , either an nmos transistor switch or a pmos transistor switch can be used as each of the switches of the lut 10 . the memories of the memory groups 21 a and 21 b may be either volatile memories or nonvolatile memories . the memories of the memory group 21 a are connected to a switch that is connected to the input wire a , whereas the memories of the memory group 21 b are connected to a switch that is connected to the input wire c . as illustrated in fig2 , the stages of the multiplexers 22 a and 22 b having the largest number of switches are connected to the input wires a and c that are closest to the memory groups 21 a and 21 b , respectively . two switches are connected to the closest to output terminals of the multiplexers 22 a and 22 b , respectively . thus , by making the direction of connecting the multiplexer 22 a to the input wires a to c and the direction of connecting the multiplexer 22 b to the input wires a to c to be opposite to one another , the number of the switches of the multiplexer 22 a , which are connected to the input wire a , is larger than the number of the switches of the multiplexer 22 a , which are connected to the input wire c , while the number of the switches of the multiplexer 22 b , which are connected to the input wire a , is smaller than the number of the switches of the multiplexer 22 b , which are connected to the input wire c . consequently , the loads on the input wires can be uniformized . for example , if the direction of connecting the multiplexer 22 a to the input wires and the direction of connecting the multiplexer 22 b to the input wires are the same , as indicated in a comparative example illustrated in fig5 , the number of switches driven by signals input from the closest input wire ( i . e ., the input wire a ) to each of the memory groups are 16 . on the other hand , in the case of the lut 10 illustrated in fig2 , the number of switches driven by the input signal a is 10 . thus , time taken to charge and discharge the switch through the wire from which the signal a is input is shortened . consequently , the delay time of the lut can be shortened . if the connection directions of the multiplexers 22 a and 22 b with respect to the input wires are the same , the number of switches connected to the closest input wire ( i . e ., the input wire a ) to the memory group is twice or more the number of switches connected to the other input wires . therefore , load is concentrated onto the closest input wire to the memory group . delay time from the input of an input signal to the switch connected to this input wire to the output of the input signal is longer than the delay time of other switches . thus , circuit delay has considerably changed depending on whether the critical path of the circuit uses the closest input wire to the memory group . on the other hand , in the lut 10 illustrated in fig2 , the number of switches driven by an input signal a is 10 . the number of switches driven by an input signal b is 8 . the number of switches driven by an input signal c is 10 . thus , the loads on the input wires can be uniformized . consequently , the necessity of considering the balance of loads on input terminals at the configuration of the circuit is reduced . in the first embodiment , memory data stored in the memories of the memory group 21 a is set so as to differ in the order of values from that stored in the memories of the memory group 21 b . as illustrated in fig2 , the memory group 22 b is configured by reversing the memory group 22 a . data arranged considering the above - mentioned relationship are stored in the memory groups 21 a and 21 b . that is , the following data are respectively stored in the memories of the memory group 21 a , from the top , as viewed in fig2 . on the other hand , the following data are respectively stored in the memories of the memory group 21 b , from the top , as viewed in fig2 . each overbar represents logical negation . for example , low voltage level is assigned to logical negation . the data respectively stored in the memories of the memory group 21 a , which are sequentially arranged from the top , differ in arrangement - sequence from the data respectively stored in the memories of the memory group 21 b , which are sequentially arranged from the top . however , all the possible values represented by the data stored in the memories of the memory group 21 a correspond to those represented by the data stored in the memories of the memory group 21 b , respectively . the lut 10 serves as a 4 - input lut by selecting which of the memory groups 21 a and 21 b corresponds to each of an input from the wire d and the logical negation of this input . on the other hand , in the case of a comparative example illustrated in fig5 , the arrangement - sequence determined according to input signals a , b and c is the same between a memory group illustrated at an upper portion and a lower memory group illustrated at a lower portion . fig6 illustrates a first modification of the first embodiment . an ( n + 1 )- input lut 101 further includes wires for inputting , to an external circuit , signals output from two n - input luts 11 and 12 . consequently , the lut 101 can be used as either an ( n + 1 )- input lut or two n - input luts . fig7 illustrates a second modification of the first embodiment . an ( n + 2 )- input lut 102 includes four n - input luts 11 , 12 , 14 and 15 . the connection directions of the luts 11 and 14 with respect to input wires are opposite to the connection directions of the luts 12 and 15 with respect to the input wires . thus , an i - input lut (“ i ” is a positive integer ) may be configured by three or more j - input luts (“ j ” is a positive integer and less than the integer “ i ”). the number of the luts connected to the input wires in a first connection direction is not necessarily the same as the number of the luts connected to the input wires in a second connection direction that is opposite to the first connection direction . the more largely the number of the j - input luts configuring the i - input lut is increased , the more uniform the balance of loads on the input wires becomes . consequently , whatever input wire the critical path of the circuit uses , the variation of the delay time of the lut is reduced . fig8 illustrates a third modification of the first embodiment . an lut 103 includes an n - input lut 11 and an m - input lut 12 (“ m ” is a positive integer ) configured such that m is less than n . in the case of combining luts differing in size from one another , preferably , the small - size lut 12 is connected to the input wires which are connected to switches close to the output terminal of the large - size lut 11 , among input wires to which the large - size lut 11 is connected . this is because of the facts that a load on the input wire connected to the switch close to the output terminal of the large - size lut 11 , which is caused due to the switch of the large - size lut 11 , is small , and that even if the lut 12 is connected such an input wire , load on the input wire is suppressed . fig9 illustrates the case of combining a 3 - input lut and a 2 - input lut . even in the lut 103 illustrated in fig9 , the switches may be transfer gates , nmos transistors , or pmos transistors . assuming that the input wires of the 3 - input lut 113 are an input wire a , an input wire b , and an input wire c , the input wire a is connected to a switch that is connected to the memory of the 3 - input lut 113 . the input wire c is connected to a switch that is connected to an output of the 3 - input lut 113 . a 2 - input lut 123 is connected to the input wire b and the input wire c . the 2 - input lut 123 can be connected to the input wires a and b , or to the input wires a and c . however , because the wire a is the input wire to which the largest number of switches of the 3 - input lut 113 are connected , the load on the wire a is large . thus , the load on the wire a is large . therefore , a lowest load circuit configuration for the lut 103 is obtained by connecting the 2 - input lut 123 to the input wire b and the input wire c . in addition , the loads on the input wires are substantially equal to one another . thus , configuration with small variation of the delay time can be implemented . incidentally , this modification employs the combination of the 3 - input lut and the 2 - input lut by way of example . however , luts each having an optional number of inputs can be used . fig1 illustrates a fourth modification of the first embodiment . in an lut 104 , signals output from the luts 11 and 12 are input to an external circuit , instead of selecting one of outputs of the lut 11 and the lut 12 with a multiplexer . for example , in the case of configuring an adder , an output therefrom is surely represented by plural bits . in this case , it is unnecessary that one of outputs from plural luts is selected by a multiplexer . thus , since the lut 104 can be configured without providing a multiplexer therein , the area of the circuit and the power consumption thereof can be reduced . the above modifications may be combined with one another . for example , an i - input lut may be configured by three or more j - input luts , and a wire for inputting , to an external circuit , three or more j - input luts may be added . at that time , a multiplexer for selecting one of output signals from the j - input luts is not necessarily provided . in addition , the plural luts may differ in the number of inputs from one another . fig1 illustrates an lut 20 according to a second embodiment . the lut 20 is configured such that pmos power - supply - control switches 32 a and 32 b are connected to the memory groups 21 a and 21 b , respectively . power - supply - control memories 31 a and 31 b are connected to the gates of the power - supply - control switches 32 a and 32 b , respectively . in the case of the lut 20 illustrated in fig1 , the power - supply - control switches 32 a and 32 b are provided between the power supply wire and the memory group 21 a and between the power supply wire and the memory group 21 b , respectively . however , a pmos power - supply - control switch may be provided between the power supply wire and each of the memory groups 21 a and 21 b . in addition , an nmos power - supply - control switch may be provided between the ground wire and each of the memory groups 21 a and 21 b . the power - supply - control switch may be provided only between the power supply wire and the memory group . alternatively , the power - supply - control switch may be provided only between the memory group and the ground wire . the power supply wire and the ground wire may be referred correctively to as the power - supply / ground wire . the luts 11 and 12 and the multiplexer 13 may be configured similarly to those according to the first embodiment . thus , the power supply to the luts 11 and 12 may be interrupted by providing the power - supply - control switches . for example , in a case where the lut 20 is not used , the power consumption of the entire lut 20 can be reduced by shutting off both of the power - supply - control switches 32 a and 32 b . for example , in the case of using the ( n + 1 )- input lut 20 as an n - input lut , an output of a predetermined one ( e . g ., the lut 11 ) of the n - input luts 11 and 12 is selected by the multiplexer 13 . the selected signal is output from the lut 20 . thus , the ( n + 1 )- input lut 20 as an n - input lut . at that time , it is unnecessary to use the lut 12 . then , the power supply to the power - supply - control switch 32 b is interrupted . consequently , power consumption can be reduced . incidentally , fig1 illustrates the lut in which the power supply to the multiplexer 22 a and the power supply to the multiplexer 22 b are controlled according data stored in the power - supply - control memories 31 a and 31 b , respectively , independent of each other . however , the power supply to both of the multiplexers 22 a and 22 b may be controlled in common according to data stored in the power - supply - control memories 31 a and 31 b . fig1 illustrates such lut 200 . in the lut 200 , if “ 1 ” is stored in the power - supply - control memory 31 a , the power - supply - control switches 32 a and 33 a are put into an off - state . thus , the power supply to the memories connected to the power - supply - control switches 32 a and 33 a is shut off . if “ 1 ” is stored in the power - supply - control memory 31 b , the power - supply - control switches 32 b and 33 b are brought into an off - state . thus , the power supply to the memories connected to the power - supply - control switches 32 b and 33 b is shut off . in the lut 200 , inverters provided on the input wires a , b , and c are shared by the multiplexers 22 a and 22 b . power - supply - control switches 32 c , 33 c , 32 d and 33 d are connected to inverters provided on the input wires a , b , c and d . the power - supply - control switches 32 c and 33 c are put into an off - state , if “ 1 ” is stored in the power - supply - control memory 31 b . the power - supply - control switches 32 d and 33 d are brought into an off - state , if “ 1 ” is stored in the power - supply - control memory 31 a . that is , the power supply to the inverters provided on the input wires a , b , c , and d is shut off if “ 1 ” is stored in both of the power - supply - control memories 31 a and 31 b . thus , the power supply to the multiplexers 22 a , 22 b and 13 provided in the lut 200 can be shut off . as illustrated in fig1 and 12 , the power - supply - control memories 31 a and 3 lb and the power - supply - control switches 32 a and 32 b for all lut ( i . e ., the luts 11 and 12 ) configuring the lut 20 are provided . however , the power - supply - control memories and the power - supply - control switches are not necessarily provided for all the luts . the lut 20 may be configured such that if one of the luts 11 and 12 is always used , no power - supply - control memory and no power - supply - control switches are provided for the one of the luts , and that the other lut 12 or 11 is provided with a power - supply - control memory and a power - supply - control switch . thus , if both of the luts 11 and 12 are used in the lut 20 , the delay of the circuit is reduced because the connection directions of the luts 11 and 12 with respect to the input wires are made to be opposite to one another . in addition , the power supply to at least one of the luts 11 and 12 can be shut off . thus , the power consumption can be reduced . the memories of the memory groups 21 a and 21 b may be either volatile memories or nonvolatile memories . alternatively , both of volatile and nonvolatile memories may be used as the memories of the memory groups 21 a and 21 b . however , if nonvolatile memories are used as the memories of the memory groups 21 a and 21 b , the power supply can be shut off even during operation of the lut 20 . as illustrated in fig1 a and 13b , a floating type flash memory , a charge - trap type metal - oxide - nitride - oxide - semiconductor ( monos ) memory , a phase - change memory , mram , an ionic memory , and a resistance change type memory such as a resistance random access memory ( reram ) can be employed as the nonvolatile memory . further , as illustrated in fig1 c , 13 d , 13 e and 13 f , selection transistors , such as nmos transistors , pmos transistors and transfer gates , may be used in combination with the above nonvolatile memories . if the drive power of the memory is low , the drive power can be increased by connecting a buffer , such as a complementary metal - oxide semiconductor ( cmos ) inverter , to an output terminal of the memory , as illustrated in fig1 . incidentally , in the case described with reference to fig1 a , 13 b and 14 , the power supply wire is connected to one of two memories , while the ground wire is connected to the other memory . these figures illustrate a state at the time of causing the luts to operate . in addition , a programming power supply and a control circuit , which are used to write and erase data to and from each element , are connected to the memories , though this power supply and this control circuit are not illustrated . as an example of interrupting the power supply during operation of the lut 20 , the following case may be considered . that is , it is obvious or expected that only the lut 11 is used and the lut 12 is not used in a certain time period during operation of the lut 20 . in this case , the power supply to the lut 12 is interrupted . in addition , after a lapse of the certain time period in which the lut 12 is not used , the power supply to the lut 12 is restored . the power supply to a part of an lut may be interrupted using an input signal , as illustrated in fig1 . an lut 201 includes two 3 - input luts . 5 . power - supply - control switches 32 a , 32 b , 33 a and 33 b are provided on the input wire a of the lut 201 . consequently , if an input signal a represents “ 1 ”, the power - supply - control switches 32 a and 33 a are turned off . thus , the power supply to memories connected to the power - supply - control switches 32 a and 33 a is shut off . at that time , the power - supply - control switches 32 b and 33 b are in an on - state . therefore , power is supplied to memories connected to the power - supply - control switches 32 b and 33 b . on the other hand , if a signal input from the input wire a represents “ 0 ”, the power - supply - control switches 32 a and 33 a are turned on , while the power - supply - control switches 32 b and 33 b are turned off . the number of memories connected to the power - supply - control switches 32 a and 33 a is a half the number of memories provided in the lut 201 . memories connected to the power - supply - control switches 32 b and 33 b are the remaining half of the memories provided in the lut 201 . thus , leakage current can be reduced by half by providing the power - supply - control switches 32 a , 32 b , 33 a and 33 b in the lut 201 . in an example of fig1 , the input wire b functions as a first input wiring , the input wire c functions as a second input wiring , and the input wire a functions as a third input wiring . although the power - supply - control switches are connected to the input wire a in fig1 , the power - supply - control switches may be connected to the input wires b , c , and d other than the input wire a . whichever input - wire the power - supply - control switch is provided on , leakage current can be reduced by half . in addition , the power supply to a part of an lut can be interrupted using plural input signals , as illustrated in fig1 . an lut 202 is configured such that the power - supply - control switches 32 a , 33 a , 32 b , 33 b , 32 c , 33 c , 32 d and 33 d are connected to the input wire a and the input wire b . each of the power - supply - control switches 32 a , 32 b , 32 c and 32 d is configured by series - connecting a pmos transistor , whose gate is connected to the input wire a , and a pmos transistor , whose gate is connected to the input wire b . each of the power - supply - control switches 33 a , 33 b , 33 c and 33 d is configured by series - connecting an nmos transistor , whose gate is connected to the input wire a , and an nmos transistor , whose gate is connected to the input wire b . consequently , if the input signal a and the input signal b represent “ 1 ”, the power - supply - control switches 32 d and 33 d are turned on . other power - supply - control switches are turned off . thus , one of a pair of the power - supply - control switches 32 a and 33 a , a pair of the power - supply - control switches 32 b and 33 b , a pair of the power - supply - control switches 32 c and 33 c , and a pair of the power - supply - control switches 32 d and 33 d is turned on according to the combination of values respectively represented by the input signal a and the input signal b . other power - supply - control switches are turned off . therefore , leakage current of the memory groups included in the lut 202 may be reduced to ¼ . the power - supply - control switches illustrated in fig1 can be configured using logic gates . fig1 illustrates an example of an lut in the case of configuring the power - supply - control switches using nand - gates to control the power supply according to the combination of values respectively represented by the input signal a and the input signal b . an lut 203 is configured such that one of the power - supply - control switches 34 a to 34 d is turned on according to the combination of values respectively represented by the input signal a and the input signal b , and that other power - supply - control switches are turned off , similarly to the lut 202 . therefore , leakage current of the memory groups included in the lut 203 may be reduced to ¼ . incidentally , in the case of the luts respectively illustrated in fig1 and 17 , the power supply to the memories is controlled , based on the two input signals . however , the power supply to the memories may be performed , based on three or more input signals . leakage current may be more reduced using a larger number of input signals in controlling the power supply . the modifications of the first embodiment may be applied to the luts according to the second embodiment . for example , the number of inputs to the inner luts may vary thereamong . three or more inner luts may be provided . and , the multiplexer 13 for selecting one of outputs from the inner luts may be omitted . in the examples of fig1 - 17 , the power - supply - control switch is provided between the power supply wire and the memory group and between the memory group and the ground wire . however , as mentioned above in relation to the example of fig1 , the power - supply - control switch may be provided only between the power supply wire and the memory group , or between the memory group and the ground wire . according to the configuration of the above embodiments , luts with short delay time can be provided . the invention is not limited to the above embodiments . various changes can be made to the above embodiments without departing from the spirit and scope of the invention .	7
a mimo - cdma apparatus has a transmitter side and a receiver side . the transmitter side is a combination of the mimo - cdma apparatus and a plurality of transmitting antennas ; the receiver side is a combination of the mimo - cdma apparatus and a plurality of receiving antennas . in order to make the person skilled in the art understand the schemes of the present invention more clearly , in the following , a 2 - input 2 - output cdma apparatus ( abbreviated as 2 * 2mimo - cdma apparatus thereinafter ) is used as an example . first , the transmitter side of the 2 * 2mimo - cdma apparatus will be described . fig1 is a block diagram of the transmitter side of a 2 * 2mimo - cdma apparatus according to an embodiment of the present invention . in the present embodiment , the transmitter side of the 2 - input 2 - output cdma apparatus will be abbreviated as the transmitter side of the 2 * 2mimo - cdma thereinafter . the transmitter side of the 2 * 2mimo - cdma includes a coding unit 110 , a modulation unit 120 , a diversion - coding unit 130 , a spreading unit 140 , rf transmitting modules 150 , 155 , and transmitting antennas 161 , 165 . the modulation unit 120 couples between the diversion - coding unit 130 and the coding unit 110 . the spreading unit 140 couples between the diversion - coding unit 130 and the rf transmitting modules 150 , 155 , wherein the spreading unit 140 further includes data pilot - spreading units 142 , 146 , a preamble - spreading unit 144 , and multiplexers 148 , 149 . the rf transmitting modules 150 , 155 include , respectively , dacs 152 , 157 and rf transmitters 154 , 159 . the outputs of the diversion - coding unit 130 couple to the data pilot - spreading units 142 , 146 , respectively ; the data pilot - spreading units 142 , 146 couple to the multiplexers 148 , 149 , respectively . in addition , the preamble - spreading unit 144 couples to the multiplexers 148 , 149 , respectively . the dacs 152 , 157 couple between the rf transmitters 154 , 159 and the multiplexers 148 , 149 , respectively . the transmitting antennas 161 , 165 couple to the rf transmitters 154 , 159 . fig2 is a block diagram of the estimation unit of the receiver side of a 2 * 2mimo - cdma apparatus according to an embodiment of the present invention . as shown in the figure , the estimation unit 200 includes a rf receiving module 211 , a time - synchronization and frequency - shift estimation unit 214 , a channel estimation unit 215 , a cyclic - prefix removal unit 216 , and a phase estimation unit 217 , wherein the rf receiving module 211 further includes a rf receiver 212 and an adc 213 . the rf receiver 212 couples to the adc 213 . the outputs of the adc 213 couple to the time - synchronization and frequency - shift estimation unit 214 , the channel estimation unit 215 , and the cyclic - prefix removal unit 216 , respectively . the output of the cyclic - prefix removal unit 216 couples to the phase estimation unit 217 . after performing channel estimation , phase estimation , packet timing estimation and frequency - shift estimation , and removing cyclic prefix to the input signal int in terms of the estimation unit 200 , a channel - estimation value ( cev ), a phase - shift data ( psd ), and an output signal ( out ) are output , respectively . fig3 is a block diagram of the receiver side of a 2 * 2mimo - cdma apparatus according to an embodiment of the present invention . thereinafter , the receiver side of the 2 - input 2 - output cdma apparatus will be abbreviated as the receiver side of the 2 * 2mimo - cdma . the receiver side of the 2 * 2mimo - cdma includes two receiving antennas 301 , 305 , two estimation units 310 , 320 , a despreading unit 330 , a diversion - decoding unit 340 , and a demodulation unit 350 . the circuit composition units of the estimation units 310 , 320 are the identical . the connection of the internal circuits thereof is shown as the estimation unit 200 in fig2 according to the present embodiment , and will not be described again here . the rf receiver 212 in the estimation units 310 , 312 couples to the receiving antennas 301 , 305 , respectively . the outputs of the estimation units 310 , 320 couple to the despreading unit 330 , respectively ; while the diversion - coding unit 340 couples between the despreading unit 330 and the demodulation unit 350 . after describing the electrical connections of the transmitter and the receiver sides of the 2 * 2mimo - cdma apparatus according to the embodiment of the present invention , in the following , the operation method of the transmitter and the receiver sides of the 2 * 2mimo - cdma will be further described . first , the circuit operation method of transmitter side of the 2 * 2mimo - cdma will be described with reference to fig1 . the coding unit 110 receives a datum da . after coding , the result is output to the modulation unit 120 . the modulation unit 120 modulates the coded datum da . in the present embodiment , the modulation method includes qpsk . the diversion - coding unit 130 performs diversion coding to the output of the modulation unit 120 by using diversion - coding technology ( such as stbc ). after performing diversion coding , two block data bd 1 , bd 2 will be output . the number of the block data bd 1 , bd 2 is the same as the number of the receiving antennas . in the present embodiment , the number is two . in another embodiment , the diversion - coding technology used by the diversion - coding unit 130 also includes spatial demultiplexing ( demux ) algorithm . the block data bd 1 , bd 2 are transmitted , respectively , to the data pilot - spreading units 142 , 146 ; the data pilot - spreading units 142 , 146 perform data - spreading coding and pilot - spreading coding to the block data bd 1 , bd 2 by using the data - spreading code cd and the pilot - spreading code , respectively . the data - spreading code cd can be expressed mathematically as : cd =[ c d ( 0 ) c d ( 1 ) . . . c d ( n − 1 )] t the bit length of the data - spreading code cd is n , where n is a natural number . c d ( 0 ) . . . c d ( n − 1 ) are digital logic signals ( for example , logic 1 or logic 0 ), respectively . the data - spreading code cd is common to the block data bd 1 , bd 2 . in another embodiment , cd is common to all block codes output by the diversion - coding unit . the pilot - spreading code cp is also common to the block data bd 1 , bd 2 . cp =[ c p ( 0 ) c p ( 1 ) . . . c p ( n − 1 )] t the bit length of the pilot - spreading code cp is identical to the bit length of the data - spreading code cd , which is n . c p ( 0 ) . . . c p ( n − 1 ) are digital logic signals ( for example , logic 1 or logic 0 ), respectively . moreover , the pilot - spreading code cp maintains orthogonality with the data - spreading code cd , namely , cp t · cd = 0 . the preamble - spreading code cs provided by the preamble - spreading unit 144 includes two codes : the first preamble - spreading code cs 1 and the preamble - spreading code cs 2 , and they are output to the multiplexers 148 , 149 , respectively . the two codes correspond to the block data bd 1 , bd 2 output by the diversion - coding unit 130 , respectively . the mathematical expression of the preamble - spreading code cs is : cs =[ c s , i ( 0 ) c s , i ( 1 ) . . . c s , i ( n − 1 )] t , for i = 1 , 2 the bit length of each preamble - spreading code csi ( i = 1 , 2 ) is n , where n is a natural number . c s , i ( 0 ) . . . c s , i ( n − 1 ) are digital logic signals ( for example , logic 1 or logic 0 ), respectively . when i = 1 , the first preamble - spreading code cs 1 corresponds to the block data bd 1 , and outputs to the multiplexer 148 ; when i = 2 , the second preamble - spreading code cs 2 corresponds to the block data bd 2 , and outputs to the multiplexer 149 , wherein i represents the i - th antenna , and the preamble - spreading codes cs 1 , cs 2 of the two antenna are orthogonal to each other , namely , cs 1 . cs 2 = 0 . when the block data bd 1 , bd 2 are input to the data pilot - spreading units 142 , 146 , the data pilot - spreading units 142 , 146 perform the data operations of data spreading and pilot spreading to the block data bd 1 , bd 2 according to the data - spreading code cd and the pilot - spreading code cp described above . then , the coded data are transmitted to the multiplexers 148 , 149 , respectively . the multiplexers 148 , 149 use the output data of the preamble - spreading code cs and the data pilot - spreading units 142 , 146 to output spreading data sd 1 , sd 2 , respectively , by a timing - switching method . the multiplexers 148 , 149 output the spreading data sd 1 , sd 2 to the dacs 152 , 157 , respectively . the dacs 152 , 157 convert the spreading data sd 1 , sd 2 in digital data format to analog data format , and output to the rf transmitters 154 , 159 , respectively . the rf transmitters 154 , 159 convert the outputs of the dacs 152 , 157 to rf signals , and transmit them via the transmitting antennas 161 , 165 , respectively . next , the circuit operation method of the receiver side of the 2 * 2mimo - cdma will be described . in the following description , please refer to fig2 and fig3 simultaneously . the circuit operation method of the estimation unit 200 will be described first . the rf receiver 212 receives an input signal int from outside ( for example , from an antenna ). the input signal is converted to a digital signal in terms of the adc 213 , and is output to the time - synchronization and frequency - shift estimation unit 214 , the channel estimation unit 215 , and the cyclic - prefix removal unit 216 . the time - synchronization and frequency - shift estimation unit 214 estimates frequency - shift data fsd and packet timing pt according to the preamble - spreading code cs . the estimated frequency - shift data fsd and packet timing pt can be verified by the following method : first , by taking a frequency - selective channel as the transmission environment for example , the channel can be expressed by using discrete - time pulse response of length l as shown below : g i =[ α i , 0 α i , 1 . . . α i , l − 1 ] t , i = 1 , 2 where i represents the i - th antenna , and the l - th channel α i , 1 has the fading characteristics of rayleigh distribution . by the preamble - spreading code cs described above , the preamble - spreading code cs is comprised by c s , i ( 0 ) . . . c s , i ( n − 1 ) digital logic signals . if the location of c s , i ( k ) is the k - th preamble block , where k is a natural number , then the signal of the k - th preamble block can be expressed mathematically as : y ( k ) = ( ∑ l = 1 l ⁢ α 1 , l ( k ) ⁢ c s , 1 , l ⁢ s 1 ( k ) + ∑ l = 1 l ⁢ α 2 , l ( k ) ⁢ c s , 2 , l ⁢ s 2 ( k ) ) ⁢ diag ⁢ { z ( k ) } + n ( k ) where z ( k ) represents the frequency - shift vector of the k - th preamble block z ( k ) =[ 1 e j2πf 0 t c e j2πf o ( 2t c ) . . . e j2πf 0 ( n − 1 ) t c ] t e j2πf 0 knt c in the above equation , f 0 represents frequency shift , and t c represents effective pulse zone of spreading codes . likewise , let channels be located between two consecutive blocks , and then channel responses will be maintained equal . thereby , the k - th received preamble - block signal can be rewritten as : h = ( ∑ l = 1 l ⁢ α 1 , l ⁢ c s , 1 , l + α 2 , l ⁢ c s , 2 , l ) ⁢ diag ⁢ { 1 , ⅇ j2π ⁢ ⁢ f o ⁢ t c , … ⁢ , ⅇ j2π ⁢ ⁢ f o ⁡ ( n - 1 ) ⁢ t c } then , multiply the k - th received preamble - block signal with ( k + 1 )- th one , and get the statistical signal as follows : q = y ( k ) ⁢ ″ ⁢ y ( k + 1 ) = ∑ n = 1 n ⁢  h n  2 ⁢ ⅇ j2π ⁢ ⁢ f o ⁢ nt c + n ~ by the above equation , frequency - shift estimation value can be given as : f ^ o = 1 2 ⁢ π ⁢ ⁢ nt c ⁢ tan - 1 ⁢ { im ⁡ ( q ) re ⁡ ( q ) } next , the estimation packet timing pt can be verified by the following mathematical expression . when the packet data is arrived , the k - th received data can be expressed as : y ( k ) ⁡ ( n ) = { ∑ l = 1 l ⁢ α 1 , l ⁢ c s , 1 , l ⁡ ( n ) + α 2 , l ⁢ c s , 2 , l ⁡ ( n ) } ⁢ ⅇ j2π ⁢ ⁢ f o ⁡ ( n + kn ) ⁢ t c then , by using the matching filter of the preamble - spreading code cs , the matched signal is given as : y ~ ( k ) ⁡ ( n ) = ∑ l = 1 l ⁢ {  ∑ m = 1 n ⁢ c s , 1 , l ⁡ ( m ) ⁢ y ( k ) ⁡ ( n + m )  2 +  ∑ m = 1 n ⁢ c s , 2 , l ⁡ ( m ) ⁢ y ( k ) ⁡ ( n + m )  2 } at this time , in order to perform packet detection , a threshold will be provided for comparison . in the present embodiment , a moving average method will be used to get the adaption starting point . thereby , the starting point will be adjusted automatically to help detect the packet timing pt robustly . the mathematical expression is : t ( k ) ⁡ ( n ) = ∑ m = 1 n ⁢  y ( k ) ⁡ ( n + m )  2 because the transmitted preamble - spreading code cs has gains , thereby when the packet arrives , the matching - processed signals will be greater than the average - processed staring point . at this time , the packet timing pt will be detected as : n ^ = arg n ⁢ { y ~ ( k ) ⁡ ( n ) & gt ; t ( k ) ⁡ ( n ) * α } after performing estimations of the frequency - shift data fsd and the packet timing pt , by using the estimation values of the frequency - shift data fsd and the packet timing pt , the cyclic - prefix removal unit 216 performs frequency compensation and timing positioning of the input signal int , performs removal of the cyclic prefix , and produces an output signal out . however , after frequency compensation , residual frequency shift remains , which will cause phase shift of the received data int and then will further affect demodulation to the input signal by the demodulation unit 350 . to overcome the problem , the pilot - spreading code cp will be used to perform phase compensation . afterwards , the phase estimation unit 217 performs phase - shift estimation to the input signal int according to the pilot - spreading code cp and the output signal out of the cyclic - prefix removal unit 216 . first , it is known that after frequency - shift compensation , the k - th receiving pilot block with remaining frequency shift , which is the block where the c p ( k ) in c p ( 0 ) . . . c p ( n − 1 ) locates , k being a natural number , can be expressed with the following mathematical model : x ( k ) = { ∑ l = 1 l ⁢ α 1 , l ( k ) ⁡ ( c d , l ⁢ d 1 ( k ) + c p , l ⁢ p 1 ( k ) ) + ∑ l = 1 l ⁢ α 2 , l ( k ) ⁡ ( c d , l ⁢ d 2 ( k ) + c p , l ⁢ p 2 ( k ) ) } ⁢ • ⁢ ⁢ diag ⁢ { z ( k ) } + n ( k ) where c p , i represents the temporal signature vector of the pilot - spreading code cp after the ( l − 1 )- th delay as shown below : c p , 1 = [ c p ⁡ ( 0 ) ⁢ c p ⁡ ( 1 ) ⁢ ⁢ ⋯ ⁢ ⁢ c p ⁡ ( n - 1 ) ] t c p , 2 = [ c p ⁡ ( n - 1 ) ⁢ c p ⁡ ( 0 ) ⁢ ⁢ ⋯ ⁢ ⁢ c p ⁡ ( n - 2 ) ] t ⋮ c p , l = [ c p ⁡ ( n - ( l - 1 ) ) ⁢ ⁢ ⋯ ⁢ ⁢ c p ⁡ ( n - 1 ) ⁢ c p ⁡ ( 0 ) ⁢ ⁢ ⋯ ⁢ ⁢ c p ⁡ ( n - l ) ] t in addition , the ( l − 1 )- th delayed pilot - spreading code cp and the data - spreading code still maintain orthogonality , namely , c t p , l c d , l = 0 . besides , likewise , for simplicity , we set the k - th pilot symbol transmitted by the i - th antenna is equal to one ( p i ( k ) = 1 ). let z ( k ) represents the frequency - shift vector of the k - th preamble block as follows : z ( k ) =[ 1 e j2πδft c e j2πδf2t c . . . e j2πδf ( n − 1 ) t c ] t e j2πδfknt c where δf represents the residual frequency shift ( δf = f 0 −{ circumflex over ( f )} 0 ). by applying the characteristic that the normalized frequency shift is much less than one in a mimo - cdma system : ɛ = δ ⁢ ⁢ f 1 / nt c ⁢ • 1 by using the characteristic described above and combining channels in two consecutive blocks , the channel response will hold the same assumption . the k - th received preamble block signal can be rewritten as : x ( k ) =( h d + h p ) e jφ k + n ( k ) where the equivalent composite vector and phase shift of h d and h p are : h d = ∑ l = 1 l ⁢ ( α 1 , l + α 2 , l ) ⁢ c d , l h p = ∑ l = 1 l ⁢ ( α 1 , l + α 2 , l ) ⁢ c p , l ϕ k = 2 ⁢ ⁢ π ⁢ ⁢ f δ ⁢ knt c finally , by applying the orthogonality characteristic , namely , c t p , l c d , l = 0 , the k - th received preamble block signal of the matched equivalent composite vector of h p is : x ~ ( k ) = h p h ⁢ x ( k ) ⁢ • ⁢ ∑ n = 1 n ⁢  h p , n  2 ⁢ ⅇ j ⁢ ⁢ ϕ k + n ~ ( k ) at this time , the phase - shift data psd can be approximated as : next , perform channel estimation of the input signal int by the channel estimation unit 215 . in the present embodiment , the channel effect of the 2 * 2mimo - cdma apparatus is estimated by applying the preamble - spreading code cs . the mathematical model of the k - th received preamble block signal is : y ( k ) = ∑ l = 1 l ⁢ α 1 , l ( k ) ⁢ c s , 1 , l ⁢ s 1 ( k ) + ∑ l = 1 l ⁢ α 2 , l ( k ) ⁢ c s , 2 , l ⁢ s 2 ( k ) + n ( k ) where s i ( k ) represents the k - th preamble symbol of the i - th antenna . for simplicity , we set all of the preamble symbols are equal to one . in addition , c s , i , l represents the temporal signature vector of the i - th antenna after the ( l − 1 )- th delay as shown below : c s , i , 1 = [ c s , i ⁡ ( 0 ) ⁢ c s , i ⁡ ( 1 ) ⁢ ⁢ ⋯ ⁢ ⁢ c s , i ⁡ ( n - 1 ) ] t c s , i , 2 = [ c s , i ⁡ ( n - 1 ) ⁢ c s , i ⁡ ( 0 ) ⁢ ⁢ ⋯ ⁢ ⁢ c s , i ⁡ ( n - 2 ) ] t ⋮ c s , i , l = [ c s , i ⁡ ( n - ( l - 1 ) ) ⁢ ⁢ ⋯ ⁢ ⁢ c s , i ⁡ ( n - 1 ) ⁢ c s , i ⁡ ( 0 ) ⁢ ⁢ ⋯ ⁢ ⁢ c s , i ⁡ ( n - l ) ] t where orthogonality holds between two temporal signature vectors transmitted by two different antennas , namely , c s , 1 , 1 t c s , 2 , l = 0 . similarly , it is further assumed that channel response will remain the same for two consecutive blocks . then , the orthogonality characteristic of the preamble - spreading code can be used to perform despreading process . the channel - estimation value cev of the l - th path transmitted by the i - th antenna is given as follows : { circumflex over ( α )} i , l = c s , i , l t y ( k ) = α i , l + ñ ( k ) to sum up , the estimation unit 200 can estimate to the input signal int in terms of the preamble - spreading code cs and the pilot - spreading code cp to give the frequency - shift data fsd , the packet timing pt , the phase - shift data psd , and the channel - estimation value cev . moreover , after the frequency - shift data fsd and the packet timing pt are given , the cyclic prefix of the input signal int is eliminated to give an output signal out . after describing the circuit operation of the estimation unit 200 , in the following , the operation method of the whole circuit of the receiver side of the 2 * 2mimo - cdma according to the present invention will be described . please refer to fig3 . as shown in the circuit structure of fig3 , the receiver side of the 2 * 2mimo - cdma includes two receiving antennas 301 , 305 , two estimation units 310 , 320 , a despreading unit 330 , a diversion - decoding unit 340 , and a demodulation unit 350 . the receiving antennas 301 , 305 receive signals via different paths , respectively . the received signals are converted to an input signal of the first path int 1 and an input signal of the second path int 2 and then are transmitted to the estimation unit 310 , 320 . the estimation units 310 , 320 , as the circuit operation method of the estimation unit 200 described above , estimate the input signals int 1 , int 2 , respectively . the receiving antenna 301 outputs the input signal of the first path int 1 to the estimation unit 310 . the estimation unit 310 receives the input signal of the first path int 1 via the rf receiver 212 . in terms of an adc 213 , the input signal of the first path int 1 is transmitted to a time - synchronization and frequency - estimation unit 214 , a channel estimation unit 215 , and a cyclic - prefix removal unit 216 . the time - synchronization and frequency - estimation unit 214 estimates the frequency - shift data fsd 1 and the packet timing pt of the input signal of the first path int 1 according to a first and a second preamble - spreading code cs 1 , cs 2 , and outputs to the cyclic - prefix removal unit 216 . based on this , after verifying the input signal of the first path int 1 , the cyclic - prefix removal unit 216 removes the cyclic prefix of the input signal of the first path int 1 , and generates a first path output signal out 1 . the channel estimation unit 215 , likewise , performs channel estimation to the input signal of the first path int 1 according to the first and the second preamble - spreading code cs 1 , cs 2 , and outputs to a first path channel - estimation value cev 1 . the phase estimation unit 217 estimates the phase - shift data of the first path psd 1 according to the pilot - spreading code cp and the first path output signal out 1 . the receiving antenna 305 outputs the input signal of the second path int 2 to the estimation unit 320 . the method of circuit operation of the estimation unit 320 is similar to that of the estimation unit 310 . the main difference is that the time - synchronization and frequency - shift unit 214 and the channel estimation unit 215 of the estimation unit 320 is used to estimate a first and a second preamble - spreading code cs 1 , cs 2 of the frequency - shift data of the second path fsd 2 . the estimation unit 320 then uses the first and the second preamble - spreading code cs 1 , cs 2 , the pilot - spreading code cp to output a channel - estimation value cev 2 of the second path , phase - shift data of the second path psd 2 , and an output signal out 2 . a despreading unit 330 detects the output signals of the estimation units 310 , 320 by using data - spreading code cd . the despreading unit 330 receives the phase - shift data of the first path psd 1 , the output signal of the first path out 1 , and the channel - estimation value of the first path cev 1 to detect data of the input signal of the first path int 1 , and receives the phase - shift data of the second path psd 2 , the output signal of the second path out 2 , and the channel - estimation value of the second path cev 2 to detect data of the input signal of the second path int 2 . then , the method of maximum ratio combiner ( mrc ) is used to get the coherently combined received signal of the input signal of the first path int 1 and the input signal of the second path int 2 , and to output despreading data dsd . afterwards , by using the diversion - coding unit 340 and the demodulation unit 350 to recover the original data da transmitted by the transmitter side of the 2 * 2mimo - cdma . the method that the despreading unit 330 uses to detect data can be verified mathematically as follows : let the transmission environment is a frequency - selective channel , and the channel can be expressed by using discrete - time pulse response of length l as shown below : g i =[ α i , 0 α i , 1 . . . α i , l − 1 ] t , i = 1 , 2 where i represents the i - th antenna , and the l - th channel α i , 1 has the fading characteristics of rayleigh distribution . in addition , by taking a 2 - input 1 - output mimo - cdma ( namely , 2 * 1mimo - cdma ) apparatus for example , the receiving mathematical model can be expressed as : y ( j ) = ⁢ [ y ( j ) ⁡ ( 0 ) , y ( j ) ⁡ ( 1 ) , … ⁢ , y ( j ) ⁡ ( n - 1 ) ] t ⁢ ⁢ for ⁢ ⁢ j = k , k + 1 = ⁢ ∑ l = 1 l ⁢ α 1 , l ( j ) ⁡ ( c d , l ⁢ d 1 ( j ) + c p , l ⁢ p 1 ( j ) ) + ∑ l = 1 l ⁢ α 2 , l ( j ) ⁡ ( c d , l ⁢ d 2 ( j ) + c p , l ⁢ p 2 ( j ) ) + n ( j ) where j represents the j - th symbol block ( two blocks in total , namely , k and k + 1 ), α i , 1 ( j ) represents the channel response of the j - th block , d i ( j ) represents the j - th transmitted symbol data from the i - th antenna , and c d , l represents the temporal signature vector after the ( l − 1 )- th delay as shown below : c d , 1 = [ c d ⁡ ( 0 ) ⁢ c d ⁡ ( 1 ) ⁢ ⁢ ⋯ ⁢ ⁢ c d ⁡ ( n - 1 ) ] t c d , 2 = [ c d ⁡ ( n - 1 ) ⁢ c d ⁡ ( 0 ) ⁢ ⁢ ⋯ ⁢ ⁢ c d ⁡ ( n - 2 ) ] t ⋮ c d , l = [ c d ⁡ ( n - ( l - 1 ) ) ⁢ ⁢ ⋯ ⁢ ⁢ c d ⁡ ( n - 1 ) ⁢ c d ⁡ ( 0 ) ⁢ ⁢ ⋯ ⁢ ⁢ c d ⁡ ( n - l ) ] t because transmitted data adopts stbc technology , the transmitted symbol can be expressed as : next , in order to detect data the despreading technology will be adopted , wherein different paths will use different despreading code c d , l as below : { tilde over ( y )} l ( k ) = c d , 1 t y ( k ) = α 1 , l ( k ) d 1 ( k ) + α 2 , l ( k ) d 2 ( k ) + ñ l ( k ) for l = 1 , . . . , l { tilde over ( y )} l ( k + 1 ) = c d , 1 t y ( k + 1 ) =− α 1 , l ( k + 1 ) d 2 ( k ) + α 2 , l ( k + 1 ) d 1 ( k ) + ñ l ( k + 1 ) if the application environment of the system is an indoor environment , the change rate of the environment channel is very slow . thereby , it can be further assumed that in two consecutive blocks , channel responses will remain the same , and can be expressed as below : here , the despreading data of the k - th and the ( k + 1 )- th block can expressed by vectors as below : y ~ l ( k ) = [ y ~ l ( k ) y ~ l ( k + 1 ) * ] = [ α 1 , l α 2 , l α 2 , l * - α 1 , l * ] ⁡ [ d 1 ( k ) d 2 ( k ) ] + n ~ l ( k ) in order to get the optimum gain , the mrc method will be applied with the channel - estimation value cev to get coherently combined received signals of l paths . y _ ( k ) = ⁢ ∑ l = 1 l ⁢ [ α 1 , l α 2 , l α 2 , l * - α 1 , l * ] h y ~ l ( k ) = ⁢ ∑ l = 1 l ⁢ (  α 1 , l  2 +  α 2 , l  2 ) ⁡ [ d 1 ( k ) d 2 ( k ) ] + n _ l ( k ) ⁢ ⁢ where ⁢ ⁢ y _ ( k ) ⁢ • ⁡ [ y _ 1 ( k ) y _ 2 ( k ) ] the above equation is the despreading data dsd of a 2 - input 1 - output mimo - cdma ( namely , 2 * 1mimo - cdma ) apparatus . similarly , by using the method of mrc , it is easy to expand to a 2 - input 2 - output mimo - cdma ( namely , 2 * 2mimo - cdma ) apparatus . we can get diversity gain of space and path at the same time . the present embodiment is a 2 * 2mimo - cdma apparatus . after the disclosure of the present invention , the persons skilled in the art should be able to induce easily the structure and method of circuit operation of a mimo - cdma . it will not be described further . fig4 is a coding method of a mimo - cdma apparatus according to an embodiment of the present invention . the mimo - cdma apparatus includes m transmitting antennas and k receiving antennas , where m and k are natural numbers . the coding method includes the following steps : first , in the step s 410 , perform diversion - coding to modulated data and output m block data . the diversion coding method includes stbc algorithm ( in another embodiment of the present invention is the space - multiplexing algorithm ). in the step s 420 , perform spreading to m block data , respectively , by using the data - spreading code cd and the pilot - spreading code cp . in the step s 430 , by using the timing - switching method , combine the corresponding preamble - spreading code cs to form a complete frame format , and output m spreading data . then , in the step s 440 , transmit the m spreading data using rf carriers . fig5 is a decoding method of a mimo - cdma apparatus according to an embodiment of the present invention . the mimo - cdma apparatus includes m transmitting antennas and k receiving antennas , where m and k are natural numbers . before the beginning of the steps , use the k receiving antennas to receive , respectively , signals transmitted via different paths , and output k input signals int . the decoding method includes the following steps : in the step s 510 , by using the preamble - spreading code cs , perform frequency - shift estimation , packet timing estimation , and channel estimation to the input signal . then , in the step s 520 , perform channels estimation to the input signal int by using the preamble - spreading code cs . the execution order of the step s 510 and the step s 520 can be swapped in another embodiment . to further explain , the main accomplished task in the step s 510 and the step s 520 is to perform frequency - shift estimation and channels estimation to the input signal received by the i - th receiving antenna by using the preamble - spreading code cs . in the step s 530 , output the corresponding i - th frequency - shift data fsd , the i - th packet timing pt , and the i - th channel - estimation value cev , where i is a natural number , and 0 & lt ; i □ k . next , in the step s 540 , according to the i - th frequency - shift data fsd and the i - th packet timing pt , remove the cyclic prefix of the i - th input signal int . in the step s 550 , use a pilot - spreading code cp to perform phase estimation to the i - th input signal after removal of the cyclic prefix , and output the corresponding i - th phase - shift data psd . afterwards , in the step s 560 , use a data - spreading code cd , the i - th phase - shift data psd , and the i - th channel - estimation value to perform data spreading to the i - th input signal after removal of the cyclic prefix , and produce the i - th sub - despreading data . then , combine the first to the k - th sub - despreading data , and output despreading data dsd . after getting the despreading data dsd , use the method of diversion coding to recover the original data of the input data int . the data - spreading code and the pilot - spreading code describe above are orthogonal in the present embodiment . any two preamble - spreading codes cs ( for example , the first preamble - spreading code cs 1 and the second preamble - spreading code cs 2 ) are orthogonal as well . the details of the coding and decoding methods in the embodiment of fig4 and fig4 as described above have been disclosed in the description . the persons skilled in the art can implement the coding and decoding methods with ease . thereby , more details of the coding and decoding methods will not be addressed further . accordingly , the present invention conforms to the legal requirements owing to its novelty , unobviousness , and utility . however , the foregoing description is only a preferred embodiment of the present invention , not used to limit the scope and range of the present invention . those equivalent changes or modifications made according to the shape , structure , feature , or spirit described in the claims of the present invention are included in the appended claims of the present invention .	7
one aspect of the exemplary embodiments is a mapping of database data to ontologies , which guides a user in producing an ontology that on top of being semantically consistent with database schema also extends and customizes such schema . another aspect of the exemplary embodiments is a method that keeps mapping consistent through modifications and enhancements to the database and allows the database data to be accessed in the ontology in a scalable and efficient manner . ontologies are used in computer science , artificial intelligence , the semantic web , and software engineering as a form of knowledge representation about the world or some part of it . ontologies are generally made up of : ( i ) concepts : objects and sets of objects ( classes or categories ), ( ii ) properties : the attributes of objects ( slots , roles , or fields ), and ( iii ) relations : models of how concepts are related to one another . ontologies are a major piece of the semantic web framework . the ontology &# 39 ; s ability to both classify data , and store reasoning rules about the data allows a computer ( a user agent ) to infer new knowledge from the knowledge stored . concepts and instances are the basic objects stored in an ontology . concepts can represent entities , tasks , reasoning processes , functions or anything else in the domain ( s ) being modeled . they can also be viewed as sets of objects ( instances ) that share one or more common properties . instances are the actual items from the domain . to enable all this functionality , an iris ( information representation , inferencing and sharing ) is developed , which is an ontology infrastructure for the flexible access and customization of database data . the iris architecture consists of : a graph model that can represent and , in certain cases extend , rdf ontologies . this graph allows sections of the ontology to be named and used either as classes or as contexts to other queries . furthermore , part of the graph topology can be defined through high - level constraints consistent to queries . an inferencing module based on the definitions of arbitrary relations created by agents . this module transparently evaluates constraints and views as the graph is navigated . a set of tools that allows the semiautomatic mapping of database data into the ontology and the loading of this data into the ontology is needed . a jsp ( java server page ) based api ( application programming interface ) allows agents to access the ontology through queries and to customize the ontology . turning now to the drawings in greater detail , fig1 illustrates sample constraints when considering an online furniture catalog business . consider an online furniture catalog business , olie , which has a database with tables for furniture pieces , customer data , and transactions . olie desires to take advantage of the flexibility and power that the semantic web ontology technologies , like having its furniture catalog accessed and understood by search engines and other web applications . in olie &# 39 ; s case , it is clear that any new ontology technology needs to be integrated with the corporate database without changing it . furthermore , the current database needs to be preserved because it offers persistence and transaction services that ontologies do not have , apart from scalability unmatched in other data models . how can olie incorporate ontology technologies into its existing database , leveraging both the scalability and persistence services of the database and the flexibility and semantic organization of an ontology ? olie can use iris . iris stores information in spaces , which are networks of entities ( classes and instances ), relations among these entities , and views of areas of the ontology , together with inferencing knowledge for the intelligent navigation of the network . an iris network is made up of nodes and links , which are extensions of nodes and links in more traditional graphs , like the rdf graphs . the nodes represent any rdf resource . for example , an iris node can represent a class like ‘ person ’ or an ‘ instance ,’ like ‘ john .’ however , iris nodes can also represent collections of iris graphs , which means they can also represent collections of rdf networks . for example , the ‘ person ’ node can contain the ‘ firstname ’ and ‘ lastname ’ properties . nodes also contain graphs when they are used as contexts . for example a ‘ customercontext ’ node may contain ‘ furniturepiece ’ and some of its properties , like the ‘ retailprice ,’ but not others , like the ‘ wholesaleprice .’ iris allows slots in nodes as a shortcut for a simple property in rdf . conceptually , these are neighbors of the node where the links are implicit , like in the case of ‘ person ’ and its properties ‘ firstname ’ and ‘ lastname .’ hence , there are two types of content in a node . slots and links are considered neighbors of the node , as they are in the same epistemological level as the node itself . graphs or instances of a class are considered members of the node , as the node usually has constraints that regulate the membership to the node . in iris , the membership content of a node can be described with a set of constraints that are dynamically evaluated as needed . an example , defining the class ‘ silver - customer ’ as a view of customers that have purchased more than 1000 dollars in the previous year is shown in fig1 . the set of constraints has an anchor , which is a node where the evaluation starts . in this case , the anchor is the class ‘ customer .’ the remaining constraints refer to those sub - graphs that are included in this view . the constraint that restricts the instances to be part of this view is : ‘ customerstats has - attribute purchasedlastyear & gt ;= 1000 .’ the iris constraint language also includes cardinality and identity constraints on links . variables can be defined to link constraints and define any sub - graph in the space , not just simple classes . relations are represented , as nodes with slots , which describe their structural properties , like ‘ name ,’ ‘ arity ,’ ‘ reflexivity ,’ ‘ symmetry ,’ ‘ transitivity ,’ and ‘ inverse .’ all these properties are standard and they have the expected meaning in iris . there is also a semantic property of relations , ‘ semantic dominance ,’ which allows iris to navigate relations without knowing anything else about their specific semantics . given a binary relation r , it is semantically dominant in the first term if whenever arb , a either precedes b temporally or causally , or a can be thought of a material or conceptual context for b . in other words , a precedes b in an order naturally induced by the semantics of the relation . a similar definition holds for relations that are semantically dominant in the second term or have no semantic dominance . for example , ( 1 ) isa is dominant in the second term , ( 2 ) parent - of is dominant in the first term , and ( 3 ) has - sibling has no semantic dominance . this notion of semantic dominance is a computational simplification of ‘ pierce ’ s secondness &# 39 ; category . even though semantic dominance is , in some cases subjective , it works fairly well in practice . for example , if information is required to be known about a “ furniturepiece ,” relations with no semantic dominance or semantic dominance in the second term can be navigable to obtain all the properties of the “ furniturepiece ,” but not unrelated information . this heuristic guarantees that the search space is limited in order not to retrieve too much information or unrelated information . links are similar to the links in rdf graphs in that they are labeled with properties or relations that are themselves first order objects in the model . starting with a corporate database , it is assumed that someone who knows the schema of the database and becomes the ontology designer can create the initial ontology . the database is not required to be in any particular normal form , or place any constraints in the relation decomposition . an illustration of this process with the schemata of fig2 is described . the ontology is semi - automatically constructed from the database schema by identifying and characterizing several database entities which are associated to classes . column groups , which are sets of columns that are related semantically . in this example , ‘ street ,’ ‘ zipcode ,’ and ‘ city ’ columns in ‘ customers ’ becomes the ‘ address entity .’ it could also happen that the columns ‘ zipcode ’ and ‘ city ’ are in a separate table . each column group generates either a single class or a hierarchy of classes in the ontology . type column groups , which are special column groups whose values belong to an enumerated type and describe types of entities or properties of entities . ‘ furniturepieces : style ’ and ‘ customertxns : type ’ are examples of type columns . relations or properties are grouped in iris relations algebras , or i - algebras . in iris , like in rdf , users can dynamically define relations and inferencing does not depend on specific relations . in practice , this generic inferencing is enough to provide flexible data access to the underlying ontologies . an i - algebra is a finite group of relations closed under composition and inverse . specifically , it is a tuple i - algebra ={ rel , & lt ; c , runiversal , o , − 1 } where rel is a finite set of relations . & lt ; c is a partial order on rel defined as follows : r 1 & lt ; c r 2 iff r 1 is contained in r 2 . the pair { rel , & lt ; c } is the relation hierarchy . rel has a special relation , runiversal , which is the most general relation with respect to & lt ; c . the operation ‘ o ’ is relation composition , and − 1 is inverse of relations . when defining relations , users place them in the hierarchy as refinements of already existing relations . iris does offer simple relations , like is - a , has - attribute , has - member , etc . but these can be changed to suit the user &# 39 ; s needs . iris uses i - algebras to identify the data that belongs to a given entity . in this scenario , if the user queries the information available on dining tables , the system obtains the ‘ style ’ slot or the ‘ identifiers ’ that are linked to the ‘ furniturepiece ’ class automatically . this inferencing allows users to query a space without having to know all the details of the ontology organization . the constraint language of iris is designed to both retrieve instance data and concept data ( or metadata ) in queries . furthermore , constraints can also be used to define new classes in the ontology as well as views and contexts . an iris query is a set of constraints that describes entities ( classes or their instances ) and their properties . for example , as shown in fig3 , the query below requests colonial diningtable &# 39 ; s with prices less than 500 dollars . this example illustrates several characteristics of the query syntax . there needs to be at least one class that is referenced by name and can be used to start the evaluation . this is called the anchor of the query . in this case it is the class ‘ diningtable .’ user defined variables can be defined to relate the different constraints and they start with a question mark . in order to query the ontology , users must know its basic vocabulary , which can be discovered through queries , but they do not need to know all the details of the underlying space . for example , users can ask for ‘ colonial diningtable &# 39 ; s ’, as in the query above , regardless of whether ‘ colonial ’ is the name of a class or the value of a slot . iris searches the subspace dominated by the ‘ diningtable ’ class to locate the ‘ colonial ’ tag . in an equivalent sql query , users would have to select from the table ‘ furniturepieces where style = colonial .’ the result of the query above is a set of instances of ‘ diningtable ’ with slots that satisfy the constraints . constraints can be flagged to return their associated data in the result or not , which is similar to projection criteria in database terminology . this constraint only requires that a table have at least one attribute price to be selected and as a result all prices ( wholesale , retail , sale ) are returned with the result . the example above returns a collection of instances , but one of the options of an iris query is to return metadata only . in this option , value constraints are ignored and the result is the section of the ontology described by the constraints , as shown in fig4 . another example of metadata query is simply furniturepiece , which returns the sub - graph dominated by the furniturepiece class . this sub - graph is determined by navigating relations that are semantically dominant in the second term . as another example of a metadata query , consider diningtable has - attribute , which returns the attributes of diningtable and the attributes of its super classes . this type of query allows the exploration of the ontology and uses the same syntax as instance queries , as shown in fig4 . the capabilities of the present invention can be implemented in software , firmware , hardware or some combination thereof . as one example , one or more aspects of the present invention can be included in an article of manufacture ( e . g ., one or more computer program products ) having , for instance , computer usable media . the media has embodied therein , for instance , computer readable program code means for providing and facilitating the capabilities of the present invention . the article of manufacture can be included as a part of a computer system or sold separately . additionally , at least one program storage device readable by a machine , tangibly embodying at least one program of instructions executable by the machine to perform the capabilities of the present invention can be provided . the flow diagrams depicted herein are just examples . there may be many variations to these diagrams or the steps ( or operations ) described therein without departing from the spirit of the invention . for instance , the steps may be performed in a differing order , or steps may be added , deleted or modified . all of these variations are considered a part of the claimed invention . while the preferred embodiment to the invention has been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the invention first described .	6
referring now to fig1 and 2 , a toilet assembly includes a conventional toilet bowl 16 provided with the usual seat 10 and cover 11 . the seat 10 and cover 11 each include the usual rearwardly projecting ears 45 and 46 which extend over a rearward extension 15 of the toilet bowl 16 . the ears 45 / 46 each include a horizontal through bore 33 / 34 for receiving a horizontally extending mounting pin to pivotally mount the seat and cover for pivoting along a horizontal axis defined by hinge assemblies ( generally 23 ). referring now also to fig3 , the rearward extension 15 of the toilet bowl has the usual top surface 17 , through which vertical through holes 18 are formed to receive bolts 12 for mounting the hinge assemblies 23 to the toilet bowl 16 . as shown in fig4 , the two hinge assemblies 23 each include a base member 20 and a hinge support member 30 . the base members 20 have a vertical through hole 21 which opens at its top into an enlarged recess 22 . the bolts 12 are inserted through the holes 21 so that the heads 35 of the bolts 12 rest in the recesses 22 while lower portions 33 of the bolts extend down through the through holes 18 in the extension 15 . the lower portions 35 of the bolts 12 are threaded in the usual fashion so that nuts 13 can be threaded onto them with or without a washer to clamp the bases 20 in place . it should be appreciated that this is a relatively permanent connection as a tool would normally be needed to facilitate the removal . the bases 20 each have two side walls 26 and 27 which are made flexible relative to the bottom walls 24 of the bases 20 . further , the side walls 26 and 27 each have outwardly extending projections 25 . the projections 25 extend slightly farther outward than the side walls 26 and 27 . each hinge support member 30 includes a front wall 36 , two opposed side walls 37 and 38 , and a rear wall 39 . the side walls have side openings 41 and 42 which preferably have a corresponding cross section ( e . g . contoured triangular ) which matches that of the base projections 25 . the walls 36 , 37 , 38 , and 39 of each hinge support member 30 define an internal , downwardly open cavity 49 , sized and dimensioned to allow a support member 30 to be slid over and to surround a base member 20 . as the walls 36 , 37 , 38 , and 39 are slid over a base 20 , projections 25 are forced to flex inwardly until they align with the side openings 41 and 42 . as will be evident from fig5 , when the projections 25 align with the openings 41 and 42 , the projections 25 snap into the side openings 41 and 42 to “ lock ” the hinge support member 30 to the base member 20 , and thus lock the hinge support member 30 to the toilet bowl 16 . referring now to fig4 and 6 , the hinge assemblies 23 can each also include a top wall 40 including an opening 44 which , when present , is preferably aligned with the head 35 of the bolt 12 so that the bolt 12 can be accessed without removing the hinge support 30 . the hinge assemblies 23 can also include a pivotable cover 50 , which can be , as shown , formed integral with the hinge support 30 or , alternatively , as a separate piece anchored via legs ( not shown ). the cover 50 can be selectively positioned to cover ( fig2 ) or uncover ( fig6 ) the opening 44 . the hinge assemblies 23 each include a horizontal raised structure 31 which facilitates the coupling of the seat 10 , the cover 11 , or both , to the toilet bowl 16 . for example , as shown in fig7 , the horizontal raised structure 31 can be a hollow cylinder into which a dash pot cylinder 42 is positioned to damp motion of the seat 10 and cover 11 when released . the dash pot 42 extends through the hole 34 provided in the mounting tab 45 in the cover 11 , and through the cylindrical horizontal raised structure 31 . the dash pot 42 may further include an extending pin section 44 that is received in the hole 33 in the seat 10 to couple the seat 10 and cover 11 to the hinge assembly 23 , thereby forming a subassembly which can be removed from the toilet bowl 16 , as described below . as shown , the hole 33 and extending pin 44 are shaped and dimensioned to provide a mounting socket or receptacle . referring now to fig8 , in an alternative embodiment , the horizontal raised structure 31 can be integrally formed with a pin 32 that can be used to mount the seat 10 and / or cover 11 through the mounting holes 33 and 34 . the pin 32 provides for horizontal pivoting of the seat 10 and / or cover 11 about an axis defined through the holes 33 and 34 . the pin 32 can also be provided as a separate structure shaped and dimensioned to insert into an aperture in the horizontal structure , or be provided as a combination of both integral and separate pins . regardless of the form of the horizontal structure 31 , the hinge support members 30 connect the associated cover 10 and seat 11 to the base members 20 . to provide the connection , the support members 30 are moved vertically down over the base member 20 until the walls of the hinge support members 30 shroud the base member 20 , as described above . the hinge support member 30 can be selectively disconnected from the base member 20 by squeezing the side walls 37 and 38 of the hinge support members 30 inward through the openings to drive the projections 25 out of the side wall openings 41 and 42 of the hinge support member 30 . after the hinge support member 30 is unlocked from the base member 20 , the subassembly including the seat 10 , cover 11 and hinge support members 30 , can be lifted from the toilet bowl 16 to facilitate cleaning . while preferred embodiments have been shown , a wide variety of changes can be made to them without departing from the spirit or scope of the invention . for example , the pins on the hinge supports can point towards each other , or away from each other , or both ways , depending on the configuration of the rear attachment ears extending from the cover and seat . additionally , referring now to fig9 , although the hinge assembly is described as having openings in the hinge support and projections in the base member , it will be apparent that this configuration could be reversed , such that the projection 56 , 58 is provided in the hinge support 30 and the opening 52 , 54 in the base member 20 . further , although a toilet covering member including both a cover and a seat has been described , it will be apparent that various types or combinations of covering members can be used . for example , it is not necessary there be both a cover and seat . either can be attached alone if desired ( e . g . for a public restroom just a seat is more typical ). thus , the claims should be looked at in order to judge the full scope of the invention . the present invention provides a hinge assembly suitable to attach a toilet seat and / or cover to a toilet .	0
fig1 depicts an insert 1 for a rinsing basket 26 of a dish washer . the insert 1 is characterized by being structured as a separate component provided with receptacles 2 for bottles . it will be apparent to those skilled in the art that the insert 1 is adapted to cooperated with a rinsing basket 26 by being placed therein as shown in fig3 . the separate insert 1 firmly positions a neck or body of a bottle such that the opening of the bottle is directed to , and aligned with , the spray jet 3 from the spray arm 4 . the insert 1 essentially consists of a basic frame 5 in which individual receptacles 2 for bottles are positioned to coincide with the circular paths 6 . 1 , 6 . 2 , 6 . 3 , 6 . 4 and 6 . 5 of the nozzles 7 of the spray arm 4 . as will be recognized from the perspective view of an embodiment shown in fig2 , the separate insert 1 essentially consists of a basic frame 5 in which are positioned individual bottle receptacles 2 . an individual receptacle 2 consists of a receiving ring or sleeve 8 which surrounds a bottle neck or body of a bottle when inserted therein . obviously , when a baby bottle is inserted into the receiving ring or sleeve 8 it will assume a vertical but at any rate upright position within the basic frame 5 . it can be seen in the perspective view that in the area of the ring or sleeve 8 there are provided draining grooves 9 for preventing the formation of standing water , particularly in the area of the ring or sleeve 8 , during a washing operation . in the insert direction of a bottle , support abutments 10 are arranged or formed on the ring or sleeve 8 , which exert a clamping action on the neck or body of a bottle . it can also be clearly seen from the perspective view of fig2 that the basic frame 5 forming the insert 1 is made up of a coated wire frame 11 which in essence consists of two arms 12 and 13 extending parallel to each other . between the arms 12 and 13 there are arranged bridge - like bowed elements 14 which support the bottle receptacles 2 . the bowed elements 14 impart a certain inherent stability to the basic frame 5 . it can also be seen in fig2 that one free end 15 and 16 of the arms 12 and 13 is bent such that they form clamping protrusions 17 and 18 and that the other ends 19 and 20 of the arms 12 and 13 are joined to form a handle 21 . the handle 21 is arranged such that it extends substantially normal to the direction of the basic frame 5 so that by means of the handle 21 the insert 1 may be handled and clampingly inserted into the upper rinsing basket of a dish washer . for this purpose , the handle 21 is bent in a step - like fashion with latching shoulders 22 and 23 being preferably formed in the terminal portion of the handle 21 . the clamping protrusions 17 and 18 and the latching shoulders 22 and 23 make it possible to secure the insert 1 between lateral walls of a rinsing basket to provide a rigid position of the bottle receptacles 2 in the rinsing basket 26 . in an advantageous embodiment of the receiving ring or sleeve 8 supportive elements 24 may be provided at their lower surface for mounting on the arms 12 and 13 . fig3 to 7 show a further embodiment of an insert 1 structured as a basket for receiving and / or supporting different articles 25 to be washed . the insert 1 is of substantially rectangular configuration and may be used , when needed , as a separate component in the rinsing basket of a dish washer 26 for supporting different small articles such as lego ® and similar pieces of toys . the insert 1 consists of a housing 27 as clearly shown in the perspective view of fig4 . in its area of bottom 28 and side walls 29 the housing 27 is provided with separate receptacles 2 and separate brackets 30 and 31 , respectively , for accommodating different types of articles 25 to be washed and which may extend beyond the dimensions of the insert 1 . in addition , annular ribs 39 are arranged on the bottom 28 which point into the interior of the housing 27 and which at their margins are provided with supporting abutments 40 extending into the interior of the rings . they serve to receive and securely position suction nipples 41 ( see fig7 ). in order to achieve proper cleaning of the nipples , their brackets are positioned on the circular paths 6 . 1 , 6 . 2 , 6 . 3 , 6 . 4 , 6 . 5 of the nozzles 7 of the spray arm 4 . as may be seen from the perspective presentation of fig3 and 4 , the housing 27 is structured such that it may receive bottles 32 in its receptacles 2 at the bottom 28 . in addition , the side walls 29 of the housing 27 are preferably provided with brackets 30 for plates 33 . the brackets 30 are slotted to provide for a substantially upright position of any plates 33 . fig4 and 5 show the receptacle 2 for the bottles 32 to be an annular opening 34 in the bottom 28 of the housing 27 into which a bottle 32 ( see fig3 ) may be inserted . as seen in the side view depicted in fig6 , clamping abutments 35 are provided at the circumference of the openings 34 , below the surface of the bottom . in accordance with a particularly advantageous embodiment of the invention , pivotal lids 36 are provided for closing the openings 34 . thus it will be understood , that if no bottles are disposed in the insert 1 , the bottom surface will be closed by pivoting of the lids 36 . the result is a box - like housing 27 in which small articles , for instance children &# 39 ; s toys , may be securely placed since the bottom thus constitutes a safe deposit surface . looking at fig3 to 6 , it will be seen that the bottom 28 , the lids 36 as well as the end surfaces 37 and 38 of the housing 27 are of a sieve - like structure . grip openings ( not shown ) may be provided in the front and rear surfaces 37 and 38 to facilitate handling of the housing 27 . moreover , the front surface 37 of the housing 27 may be of stepped configuration . in order to be able economically to fabricate the insert 1 in accordance with the invention , the housing 27 and the lids 36 are preferably made of injection molded plastic components . skilled artisans will understand that the invention also relates to an insert 1 for the rinsing basket of a dish washer .	0
referring to fig1 the spaces between the curves b and a 1 , between b and a 2 and between b and a 3 represent the regions within which the distance &# 34 ; d &# 34 ; must lie for each withdrawal speed . the numbers in parentheses refer to the numbers of the process examples and the comparative examples . fig2 shows a spinneret area 1 which is positioned within the boundary line containing all of the spinneret capillaries or orifices 2 . the boundary line in this instance is a circle . thus , the spinneret area is not identical with the spinneret plate 3 but is always smaller than the latter . the spinneret area 1 represents the magnitude which forms the quotient in the computation of the spinneret load . fig3 is a schematic , strongly simplified representation of a spinning machine . the molten polymer is forced in a predetermined quantity through a spinneret 4 having the desired number of orifices or capillaries 2 ( see also fig2 ). the spinneret 4 is constructed in the form of a plate , but is usually referred to simply as &# 34 ; spinneret .&# 34 ; the emerging filaments 5 drop through a space of a given height into a blowing duct 6 which forms a cooling zone in which the filaments are subjected to a transverse air current 7 and are cooled . after solidification , the filaments are passed through yarn guiding and preparation devices , not shown , and possibly also godets , and are finally wound up at predetermined speeds . the spinneret 4 is a composite part of a spinneret assembly 8 which usually is also equipped with product distribution and filter units . the spinneret assembly 8 is enclosed within a heated spinning head 9 by which an intensive heat transfer to the spinneret assembly 8 is effected . the heat transfer surfaces extend up to and partly around the spinneret 4 . to prevent heat loss , the spinning head 9 is provided with an insulating jacket 10 . to prevent the spinneret 4 from losing heat , particularly by radiation , the spinneret 4 is slightly set back in the spinning head 9 and the spinning head insulating jacket 10 . this so - called spinneret recess or retreat is desirable also for the reason that a direct passing by of cooling air at the spinneret surface 11 is avoided . immediately below the spinning head insulation 10 is arranged a supporting plate 12 for the blowing duct 6 and a hood for the exhaust of vaporized polymer extract . immediately below the supporting plate 12 is located the highest blow point of the air flow 7 . the distance &# 34 ; d &# 34 ; defined according to the invention is identical with the drop distance of the filaments from their point of emergence from the spinneret , i . e . the underside of the spinneret plate , to the level of the uppermost blow point . the space about the blow point is a quiescent zone , not subject to the blown air currents . it will be noted that the distance &# 34 ; d &# 34 ; is composed of the given recess in the spinning head 9 , the thickness of the spinning head insulating jacket 10 and the thickness of the supporting plate 12 which may also be called a blowing duct collar . thus , the distance &# 34 ; d &# 34 ; is not identical with any one of these components , but is always greater . while in accordance with the invention the distance &# 34 ; d &# 34 ; is required to lie within a certain range , the requirements as to the individual components should be considered separately . the recess in the spinning head 9 must be great enough to ensure a sufficient heating of the spinneret . the thickness of the spinning head insulating jacket 10 must be such that radiation losses are minimal and the thickness of the carrier plate 12 is determined by mechanical considerations . consequently , a reduction in the depth of the recess or in the thickness of the spinning head insulation 10 to the extent of the length of the distance &# 34 ; d &# 34 ; will not suffice to obtain uniformly good filament properties when , in doing so , the length of the distance &# 34 ; d &# 34 ; is placed outside of the required range . attention is called in this respect to comparison example no . 5 . polyamide 66 having a relatve visocity η rel = 2 . 45 was melted at 293 ° c . and was passed at a rate of 9 . 6 g / min through a spinneret with seven orifices , each orifice having a diameter of 0 . 25 mm . the spinneret load was 0 . 7 g / min / cm 2 . having dropped through a space of length d = 35 mm to the level of the uppermost blow point , cooling of the filaments was commenced by subjecting them to a transverse current of air having a speed of 0 . 4 m / sec . subsequently , the cooled filaments were prepared and were withdrawn , without the use of a godet , at a speed of 3200 m / min and were wound up . these filaments strands were capable of being draw - textured , without problem , with the normal titre of the finished yarn being 22f7 dtex . the textile characteristics of the spun filaments are given in table 1 . the titre uniformity ( uster ) and the dyeability uniformity , judged by a sock knitted from such yarn , were excellent . compared with and relative to a yarn made on a conventional spinning plant , the load extension reference value was 81 %. while this value is still acceptable , it lies at the lower limit . the magnitude of the distance &# 34 ; d &# 34 ; was at the lower limit of the range assigned to the given spinning load . pa - 66 filaments were spun under the same conditions and the strands wound up as in example 1 . however , the drop distance of the filaments between spinneret plate and uppermost blow point was d = 50 mm . evenness of titre and dyeability of the filaments was excellent ; the load extension reference value was 99 % and thus was higher than in example 1 . pa - 66 filaments were spun and wound up under the same conditions as in example 1 , the difference being that the drop distance of the filaments from the spinneret plate to the uppermost blow point was d = 60 mm . the uniformity values again were comparable to those of example 2 . also the load extension reference value of 99 % was the same as in example 2 . pa - 66 filaments were spun and wound up under the same conditions as in example 1 , the difference being , that the drop distance of the filaments from the spinneret plate to the uppermost blow point was d = 120 mm ( conventional spinning plant ). the titre and dyeability properties of the filaments were not tolerable . given the speed employed in this example , the distance &# 34 ; d &# 34 ; is outside the range as specified by the invention . pa - 66 filaments were spun and wound up under the same conditions as in example 1 , except that the drop distance of the filaments between the spinneret plate and the uppermost blow point was d = 80 mm . the thickness of the insulating jacket , i . e . the distance of the spinneret plate from the top surface of the supporting plate , was adjusted to 40 mm . thus , while the thickness of the insulating layer was within the value range , the distance &# 34 ; d &# 34 ; was outside the limits set in accordance with the invention . titre uniformity was poorer than in the previous examples , and the dyeing was so streaky that these yarns were not acceptable . polyamide 6 having a relative visocity of η rel = 2 . 38 was melted at 265 ° c . and was spun at a rate of 33 g / min through a spinneret with 24 holes , each hole having a diameter of 0 . 25 mm . the spinneret load was 2 . 0 g / min / cm 2 . having dropped through a distance d = 60 mm to the level of the uppermost blow point , the filaments were cooled by subjecting them to the blowing action of a transverse current of air at a speed of 0 . 8 m / sec . the cooled filament strands were prepared and withdrawn at a speed of 6000 m / min and were wound up . this yarn was capable of being draw - textured without problems . the nominal titre of the finished product was 78f24 dtex . titre and dye evenness was flawless . the load extension reference value was about 100 . 5 %. pa - 6 filaments were spun under the same conditions as in example 1 , except that the filament strands were withdrawn at a speed of 1000 m / min and wound up . at this speed , the distance &# 34 ; d &# 34 ; is no longer within the range as specified by the invention . titre and dye evenness of these filaments were no longer acceptable . polyester of a relative viscosity η intr . = 0 . 64 was melted at 300 ° c . and was spun at a rate of 28 g / min through a spinneret with 48 orifices , each orifice having a diameter of 0 . 25 mm . the spinneret load was 1 . 1 g / min / cm 2 . having dropped through a length d = 35 mm to the level of the uppermost blow point , the filaments were cooled by subjecting them to the blowing action of a transverse air current at a speed of 0 . 5 m / sec . the cooled filament strands were prepared and withdrawn at a speed of 3200 m / min and wound up . these yarns were capable of being draw - textured without problem . the nominal titre of the finished yarn was 56f48 dtex . the textile characteristics of the spun years are compiled in table 1 . titre and dye evenness of the filament strands were impeccable . in comparison with and relative to a yarn produced on a conventional spinning plant , the load extension reference value was 107 %. the distance &# 34 ; d &# 34 ; lies within the range specified by the process of the invention . polyester filaments were spun and wound up under the same conditions as in example 8 , except that the distance between the spinneret plate and the level of the uppermost blow point was d = 120 mm ( conventional spinning plant ). this length was outside the value range as established by the invention . the evenness values obtained were not acceptable . table 1__________________________________________________________________________ example no . 1 2 3 4 5 6 7 8 9invention / comparison invent . invent . invent . compar . compar . invent . compar . invent . compar . __________________________________________________________________________polymer pa - 66 pa - 66 pa - 66 pa - 66 pa - 66 pa - 6 pa - 6 pet petnominal titer ( denier ) 22f7 22f7 22f7 22f7 22f7 78f24 78f24 56f48 56f48 ( dtex ) spinning withdrawal 3200 3200 3200 3200 3200 6000 1000 3200 3200speed ( m / min ) spinneret load 0 . 7 0 . 7 0 . 7 0 . 7 0 . 7 2 . 0 2 . 0 1 . 1 1 . 1 ( g / min / cm . sup . 2 ) magnitude &# 34 ; d &# 34 ; ( mm ) 35 50 60 120 80 60 60 35 120characteristics ofthe spun yarn : uster ( half inert ) (%) & lt ; 0 . 5 & lt ; 0 . 5 & lt ; 0 . 5 0 . 75 0 . 95 0 . 5 1 . 0 0 . 5 1 . 4evenness of dyeability * + + + - - + - + - ## str1 ## 81 99 99 100 101 . 5 100 . 5 - 107 100rel . (%) __________________________________________________________________________ * rating + very even - severely streaky	3
the invention described below is intended to disable an armored vehicle by penetrating its &# 34 ; belly &# 34 ; armor and accomplish this with a mine of such simplicity that the likelihood of its failing would be minimal . it incorporates a tripping / activation and placement structure which requires minimal care and minimal time and effort in deployment , is light in weight , and is sufficiently low in cost so that it could be deployed economically in very large numbers . the invention gives each mine the ability to act against a vehicle passing over a swathe of defended ground more than twice the width of a typical main battle tank . this invention would provide a device which acts against an armored vehicle as a result of the movement of the vehicle passing over it , such movement pushing over a treadle plate and thrusting a petard attached to the plate against the undercarriage of the vehicle with sufficient force to ignite a fuse in the attached munition . when the mine employed is a shaped - charge , a firing pin extending upwardly from the top face of the mine would cause the charge to explode at the optimal distance from the vehicle &# 39 ; s belly plating . when used with a squash charge , the petard would be fused to explode upon impinging against the belly armor . since the pivoting of the petard would be effected by the mechanical energy derived from the movement of the vehicle against the tripping plate , a more costly and complex means for projecting the explosive against the vehicle is unnecessary . the framework to which the mine would be attached and which would serve to thrust the mine upward is designed to be deployed on the surface of the ground . in practice it would be customary to conceal each device under a dusting of soil or snow or a swatch of camouflaging material except in the event that deployment took place in an area with ground - covering vegetation where concealment would be unnecessary . deployment would be such a simple matter that it could be done very quickly and easily . since the part of the framework would be made of wood and plastic , or of non - ferrous metals , the device would be light and cheap , and since its elements would be of low mass and density , it would not be easily detected by sweeping devices . since it would lie almost flat upon the ground , producing a low profile , it would be difficult to perceive from a moving vehicle . the configuration of the device would give it the ability to perform its function across a channel at least twice the width of an average main battle tank . referring to fig1 an armored vehicle or tank 11 is shown approaching a line of treadle assemblies 13a and 13b which are deployed in a parallel manner on the ground surface 15 . the single lever arm 17 treadle assembly 13a placed ahead of the double lever arm 17 assembly will come into contact first with the charging tank 11 . if the tank 11 tread rolls over the mine 19 at the end of the arm 17 of the assembly 13a and depresses the protruding firing pin 21 the munition 19 will explode . this will rupture the tread of the vehicle in the same manner as a conventional mine . if the tread of the tank 11 is not ruptured by this explosion , the tank 11 will next come into contact with the tripping batten 23 of the other assembly 13b thereby pressing it flat to the ground . as the tank 11 passes over this double lever arm 17 , treadle assembly 13b and the lever arm 17 is pivoted upwardly , raising the munition 19 into proximity with the undercarriage of the tank 11 . if it is a shaped charge , it explodes at the optimal distance from the undercarriage . if it is a squash charge it explodes when in direct contact with the undercarriage of the tank 11 . the munition 19 is available from various manufacturers , one of which is atiebolaget bofors , of bofors , sweden , model carl gustave . american suppliers include general electric , burlington , vermont ; olin corporation , marion , illinois ; dyna east corporation of philadelphia , pennsylvania ; and minneapolis - honeywell corporation , minneapolis , minnesota . munitions manufactured by these concerns are adaptable to the invention . many of these devices are sufficiently powerful to penetrate the tank underbelly with less than approximately 2 kilograms of explosive . other munitions , with more powerful plastic explosives may weigh even less . the entire invention assembly should weigh no more than about 8 kilograms . referring to fig2 the tripping batten 23 of the treadle assembly 13b is pressed flat to the ground 15 by the pressure of the track 25 of the tank passing over it . the tripping batten 23 is pushed flat to the ground 15 and the lever arm 17 being offset from the face of batten 23 is pivoted upwardly . the attached mine 19 is raised and is shown rupturing the underside of the tank 11 as a result of impacting with the underside of the tank 11 and activating the firing pin 21 . the tank 11 is thereby disabled . the treadle plate or batten 23 of a typical assembly 13b , fig3 can be made from a plank or beam of wood or plastic and can be rectangular in shape with all straight edges except for its upper edge which might be irregular in order to lend itself more readily to camouflage and concealment . this treadle plate or batten 23 can be made to any size , but is most easily handled manually when it is between 1 meter and 3 meters in length . for use against tank 11 , this batten 23 can be between 25 centimeters and 40 centimeters wide and between 2 centimeters and 4 centimeters in thickness . the lever arm 17 is implemented as a solid pole or a hollow tube or pipe . this lever arm ( pole ) 17 is straight and extends outwardly from the batten 23 a distance of from 60 centimeters to 2 meters . the length of this pole 17 which forms a leg of the assembly 13b is of sufficient length to impact the belly of the tank at a point beyond its comparatively thick forward armor . this distance can be adjusted by changing the length of the pole 17 to overcome counter - measures that might be employed to deal with lever arms of uniform length . a bracket 29 has a flat surface 29a for mating to the bottom edge 31 face area of the treadle plate 23 . the bracket 29 is shaped with a tubular socket 29b to receive an end of the pole 17 . the bracket 29 has a bend or angle 29c created between its flat surface 29a and its tubular socket 29b . this angle 29c is responsible for holding the leg ( pole ) 17 at a obtuse angle of about 120 to 150 degrees from the face of the batten 23 . the munition 19 is of a type available in the marketplace from a variety of munitions manufacturers . this munition 19 discussed further below has a cylindrical shape with a central protrusible firing pin 21 which when depressed into the mine body 19 activates the explosion . a second bracket 33 holds the munition 19 to the other or free end of the pole 17 . this bracket 33 has a tubular socket 33a for receiving the free end of the pole 17 . the bracket 33 fans outwardly from this socket 33a to form an arc - shaped plate portion 33b which is attached to the round side structure of the munition 19 . this bracket 33 likewise has a bend 33c to allow the munition 19 to be canted at an angle from the longitudinal axis of the pole 17 . this second bracket angle 33c can differ from the first bracket angle 29c or it can be the same . the purpose in these two angles 29c and 33c is to position the firing pin 21 properly against the undercarriage of a tank 11 . in operation the pole 17 pivots to thrust the munition 19 against a tank 11 as in the classical &# 34 ; petard &# 34 ; operation . fig4 and 5 show a top or plan view and a side elevation view , respectively , of the double &# 34 ; petard &# 34 ; embodiment . the attachments of the various components 17 , 19 , 23 , 29 , 33 of the assembly will depend upon the materials used for these components 17 , 19 , 23 , 29 , 33 . attachment can be by pinning , bolting , riveting , gluing , epoxying , soldering , brazing or other means . the invention can be deployed in straight successive rows across a line of advance , or in skewed rows or in other fashion . the tripping batten can be made of wood , plastic and / or any non - metallic material to which the bracket 29 can be attached . the material used to make the tripping batten 23 can be made with a metallic element , but such use would lend to easy detection by a metal detection device . the part of the batten 23 which is placed flush upon the ground is cut or made to lay flat or even with the ground . the portion of the batten 23 which ideally comes into contact with the track 25 of the tank 11 is preferably at an angle to the ground when deployed . the length of the batten 23 can be adjusted to a maximum of somewhat less than the width of an average armored vehicle . the thickness of the batten 23 should be sufficient to provide the strength not to break or shatter under the force of the tread or the impact necessary to detonate the munition 19 . as an alternative to the above , variations can be made to the structure and still be within the scope of the invention . the pole 17 can also be made flat and can include an offset , eliminating the need for the bracket 33 bend 33c . for example , if the batten 23 is placed at an 90 ° angle to the ground , the pole 17 could be straight ; if the batten 23 is placed at an angle greater than 90 ° with the ground , the lever or pole 17 would be offset to the batten 23 , so that optimal striking distance from the tank is achieved . as to any alternative designs of structure or materials , the lever or pole 17 should be of sufficient width or strength to enable it to hold a charge element at one end until such time as it strikes the underside of the tank 11 and detonates . it should be of a material which would lend itself to secure attachment to both ends of the assembly . the munition 19 containing the shaped charge 37 , fig6 and 7 , the primer 39 , the cone shaped copper liner 41 , the retracting firing column 47 , 55 and the compressed spring 51 is of a type that is commercially available from atiebolaget bofors and others as stated above . as the charge 41 is intended to explode a short distance from the underbelly of the tank 11 , the firing pin 47 extends outwardly a distance when armed ( fig7 ) so that the pin 47 movement necessary to cause an explosion occurs when contact is made upon the pin end 47 . the above description is intended to be illustrative of the invention and is not intended to be read as limiting the invention . many changes can be made in the invention without departing from the intent and scope thereof .	5
embodiments of this invention are explained below with reference to the accompanying drawings . the parts of fig2 are perspective views of the mechanical parts of an optical head according to one of the embodiments of this invention , fig2 ( a ) showing its lens barrel , fig2 ( b ) its stand , and fig2 ( c ) the composition of its magnetic circuit . fig3 is a general structural drawing of the optical head of this embodiment . in the parts of fig2 numeral 9 designates a condenser lens for converging the laser beam on a disc , to which are integrally affixed a driving coil 10 for focus servo ( hereinafter called focus coil 10 ) and a coil 11 for a tracking servo and driving to feed the disc in a radial direction ( tracking coil 11 ). numeral 12 designates a stand , and a mirror 13 having a reflection plane inclined 45 ° to the incident light in the middle part is secured to the stand 12 . approximately parallel laser beams entering from the direction of arrow a paass through a circular opening 14 in the stand 12 , and are reflected upward by the mirror 13 , and enter the condenser lens 9 . numeral 15 designates flexible support members which are fixed to upper end a 1 of the lens barrel by fixing part a &# 39 ; 1 , and to the lower end a 2 thereof by fixing parts a &# 39 ; 2 . the flexible support members ( hereinafter called leaf springs ) 15 are made of metallic leaf spring material , rubber , resin , etc ., and are designed to support the lens barrel , including the condenser lens 9 , so as to be movable in the vertical direction . the stand 12 shown in fig2 ( b ) moves on rails 17 by means of bearings 16 . the magnetic circuit shown in fig2 ( c ) is composed of magnet 18 and yoke 19 , and focus coil 10 and tracking coil 11 are inserted into gaps b 1 , b 2 . the bearings 16 roll on the slope of the rail 17 , and the stand slides . an opening 20 is intended to pass the approximately parallel incident light to the disc and the exit light from the disc . fig3 is a general structural drawing of the optical head of this embodiment , in which numeral 21 is a semiconductor laser . the light leaving the semiconductor laser 21 is formed into approximately parallel beams of light by a collimating lens 22 , passes through polarizing prism 23 and λ / 4 plate 25 , and is reflected by the mirror 13 which is fitted to the stand and which moves along rails 17 in the same direction as these approximately parallel light beams , that is , in the radial direction of the disc 24 , and is converged on the recording plane of the disc 24 by means of the condenser lens 9 . the reflected light from the disc 24 passes again through the condenser lens 9 , is reflected by mirror 13 and passes through λ / 4 plate 25 , and is turned into s polarized wave by the polarizing prism 23 and is reflected , and is divided into two parts by half mirror 26 , and one part enters a two - division photo detector 27 while the other part is converged by the lens 28 and is partly shielded by a shielding plate 29 and is converged on another two - division photo detector 30 . on the photo detector 27 , a tracking error signal is detected from the diffracted light of the track on the disc , and the focus error signal is detected by photo detector 30 . from the outputs of both photo detector 27 and two - division photo detector 30 , the information signal on the disc 24 is picked up . the focus error signal and tracking error signal are amplified and compensated for phase by the servo circuit , and an electric current is applied into the focus coil 10 and tracking coil 11 , and servo action is applied . numeral 31 denotes a disc drive motor . concerning the operation of the optical head of this embodiment , the optical system will be briefly explained , and the mechanical system will be described in detail . as for the optical system , in fig3 when accessing , only the mirror 13 and condenser lens 9 move , and only the condenser lens 9 moves in focus servo movement , so that the movements of these movable parts are all in the direction of the optical axis of the approximately parallel laser beams . therefore , this optical system is completely free of troubles , such as shift of the reflected light distribution from the disc due to movement of these optical parts , and , in this sense , the optical drawing range of tracking is infinite . concerning the mechanical system , a first feature is that the focus coil , tracking coil and access coil are integrally affixed to the condenser lens 9 . the magnetic circuit in fig2 ( c ) is common to focus and tracking , and there is a magnetic flux in a direction vertical to the magnetic gap . since only the lower part of the focus coil 10 is inserted into the gap , the electromagnetic force acts vertically . in the tracking coil , since the electric current flows in the vertical direction in the gap , the electromotive force acts along the rails 17 , i . e . in the radial direction of the disc . in the focus direction , only the condenser lens 9 moves vertically on the leaf spring 15 . the leaf spring 15 is possesses damping characteristics , and it has a resonance point , in the vertical direction , at a low frequency f 1 , that is , about 30 to 60 hz , so that in the focus direction the actuator has the same characteristics as the conventional actuator . the characteristic of this focus actuator is shown in fig4 ( a ), in which the solid line in the amplitude , and the dot - dash line refers to the phase , and the broken line is the characteristic after phase compensation by the servo circuit which comprises a high pass filter with a range of 500 hz to 5 khz . the phase compensation is applied because the system oscillates when the phase of the response of actuator deviates more than 180 ° from the error signal so that servo gain may not be obtained . thus , the characteristics of the focus actuator are exactly the same as in the prior art . on the other hand , the tracking and access operations are different from the conventional performances . that is , the condenser lens 9 is directly driven by the tracking coil 11 , and the driving force is applied to the stand through leaf spring 15 . the leaf spring 15 possesses a relatively high resonant frequency f 2 of 1 khz to 2 khz , in addition to the damping characteristics , with respect to the tracking and access direction . when the input signal frequency to the tracking coil 11 for tracking and access is sufficiently lower than f 2 , the condenser lens 9 and stand move in unity , but when the input frequency is sufficiently larger than f 2 , the stand does not move , and only the lens barrel including the condenser lens 9 moves . supposing the mass of the movable part to be m and input frequency to be f , the amplitude w of movable part is where c is a constant proportional to the amplitude of the input voltage . it becomes a straight line in fig4 . incidentally , the mass of movable part movable in the tracking direction is the sum of the mass m 1 of the lens barrel and the mass m 2 of the stand at a low frequency as mentioned above , but it is only the mass m 1 of the lens barrel when the frequency is high , so that the amplitude w is , when the frequency is lower than f 1 as in fig4 ( b ) , therefore , the characteristics of the actuator in the tracking and access direction are same as those after phase compensation in the circuit , with the phase being lifted at f 1 . as described in connection with fig1 ( c ) in the prior art , conventionally , so to speak , the tracking coil is fixed to the stand , and the secondary resonance was delayed in phase and the servo gain can not be raised . in this embodiment , by contrast , the secondary resonance rather works in a direction to raise the servo gain , and further favorable actuator characteristics are obtained by applying phase compensation by the servo circuit . since the mirror 13 is fixed to the stand , it does not respond to the input signal in the tracking direction at high frequency , but the difference in the dislocation in the tracking direction between mirror 13 and condenser lens is less than several μm , and there is no adverse effect on the optical system or servo system . in this embodiment , m 1 is 4 g and m 2 is 5 g , and the maximum power obtained by the coil is 0 . 6n ( newton ) in the focus direction and 1n in the tracking and access direction . therefore , the maximum acceleration is , supposing the gravitational acceleration to be g , 15 g in the focus direction , and 25 g at high frequency and 11 . 3 g at low frequency in the tracking direction . therefore , for a moving distance of 40 mm , the rough access time is notably shortened to 0 . 038 sec . thus , in this embodiment , the access time can be shortened by the increase of the moving speed in the radial direction of the disc due to reduction of the weight of the movable part , extension of the drawing range of tracking servo , and intensification of tracking servo gain . in this optical head , accordingly , as compared to three sets of a magnetic circuit , forcus coil , tracking coil and access coil have been required conventionally , only one magnetic circuit and two coils are needed , and the number of parts is reduced , and the cost is lowered , too . besides , in the conventional method of moving the entire optical head , there are about 20 wires leading from movable parts to fixed parts for feeding electric power to the laser , coils , photo detectors , head amplifiers , and other elements , and it has been difficult to arrange the wires without disturbing the movement of the movable parts . in this invention , by contrast only four wires are coming from the movable parts to the fixed parts , and the wire arrangement is quite easy . meanwhile , in this embodiment , the tracking and access coils are fixed only to the lens barrel , but the access coil may be fitted to the stand in order to increase the force of access . concerning the position and winding method of the focus coil , several methods are possible . an example of winding is shown in fig5 in which the trackig coil 32 is wound same as in fig3 and numeral 33 designates the focus drive coil . in the first embodiment , the tracking servo is controlled by the far - field method , but the three - beam method , wobbling method , and phase difference method may be equally applied . the same applies also to the pickup method of the focus error signal , and the astigmatism method , critical angle method , and phase difference method may be equally used . this may be used also in multi - beam recording , and in a two - beam optical system having a recording beam and an erasing beam for recording on erasable recording materials . in the above embodiment , the stand slides on the rail by means of roller bearings , but , of course , other sliding bearings may be used . possibility of industrial use in the present invention , the driving mechanism and movable parts for access are identical with those for tracking , the access speed can be notably increased by the reduction of weight of the movable parts , the moving direction of the movable parts of lens and mirror in the focus , tracking , and access are all in the direction of the optical axis so as to be free from deviation of the optical path due to servo action of focus or tracking , the optical system is always in an ideal state , the tracking and access coils are fixed to the condenser lens , and the stand on which a mirror is mounted is moved by means of a leaf spring . by this composition , the secondary resonance of the leaf spring , which has been one of the conventional problems , can be prevented , and the servo can be stabilized by giving the same effect as the phase compensation of the servo circuit . moreover , the cost can be lowered because the number of coils and magnetic circuits is reduced , and there are many other effects in various aspects . more important , the instability of servo action due to narrowness of the drawing range of tracking servo , long access time , and high cost of the optical head , which were conventionally major problems for general use of an optical disc , can be solved all at once , and the industrial effect is enormous .	6
the method according to the invention , applied to a synchronous alternating - current permanent - magnet machine , is as follows . considering a permanent - magnet anisotropic machine , the method entails writing the equations of the machine in the reference system coupled to the stator of said machine . the equations of the machine are produced by a matrix of the inductances of the machine , in which there is a fixed part and a part that depends on the electrical angle of the machine . lind = lfix + lvar ( θ ) lfix := ( ls0 - lm0 - lm0 - lm0 ls0 - lm0 - lm0 - lm0 ls0 ) lvar  ( θ ) := ( ls2 · cos  ( 2 · θ ) lm2 · cos  ( 2 · θ + 2 · π 3 ) lm2 · cos  ( 2 · θ - 2 · π 3 ) lm2 · cos  ( 2 · θ + 2 · π 3 ) ls2 · cos  ( 2 · θ - 2  π 3 ) lm2 · cos  ( 2 · θ ) lm2 · cos  ( 2 · θ - 2 · π 3 ) lm2 · cos  ( 2 · θ ) ls2 · cos  ( 2 · θ + 2  π 3 ) ) assuming the simplest case , in which the variation according to the angle is sinusoidal , there is therefore a matrix of inductances that is determined by a fixed part and by a part in which the inductances are linked sinusoidally to the variation of the angle . at this point it is necessary to define a park matrix with fixed axes , and the park transform is applied to the equations mentioned above , written in the reference system coupled to the stator of the machine , so as to describe said equations according to axes α and β . park := 2 3 · ( 1 - 1 2 - 1 2 0 3 2 - 3 2 1 2 1 2 1 2 ) the park transform therefore produces the matrix of inductances transformed in the reference system α , β . ( ls0 + lm0 0 0 0 ls0 + lm0 0 0 0 ls0 - 2 · lm0 ) + ( 3 2 · lm2 · cos  ( 2 · θ ) 3 2 · lm2 · sin  ( 2 · θ ) 0 3 2 · lm2 · sin  ( 2 · θ ) - 3 2 · lm2 · cos  ( 2 · θ ) 0 0 0 0 ) -& gt ; ( ls0 + lm0 + 3 2 · lm2 · cos  ( 2 · θ ) 3 2 · lm2 · sin  ( 2 · θ ) 0 3 2 · lm2 · sin  ( 2 · θ ) ls0 + lm0 - 3 2 · lm2 · cos  ( 2 · θ ) 0 0 0 ls0 - 2 · lm0 ) at this point a high - frequency voltage is injected into the motor and , by applying the principle of overlapping effects , it is possible to ignore the effect of the sinusoidal counter - electromotive force in the equations of the machine with fixed axes . for example , for a 50 - hz machine , the injected high - frequency voltage can be a voltage at 800 hz , with a switching frequency of 10 khz , which overlaps the voltage dispensed by the machine control system . at this point the current of the motor is measured and the current linked to the injected voltage is extracted by filtering . essentially , the injected high - frequency voltage can be broken down into the two components along the axes α and β . the equations of the injected voltage contain the derivative with respect to time of the flux with respect to the axes α and β , respectively , and therefore by integrating these equations one obtains the fluxes along the axes α and β , which are given by the product of the matrix of inductances along the axes α and β and the current , along the axes α and β , linked to the injected voltage a system of two equations in the unknowns sin ( 2θ ) and cos ( 2θ ) is thus obtained . { φ   α - ls0 - lm0 = 3 2 · lm2 · sin  ( 2 · ϑ ) · i   β + 3 2 · lm2 · cos  ( 2 · ϑ ) · i   α φ   β - ls0 - lm0 = 3 2 · lm2 · sin  ( 2 · ϑ ) · i   α - 3 2 · lm2 · cos  ( 2 · ϑ ) · i   β det = - ( 3 2  lm2 ) 2  ( i α 2 + i β 2 ) which is constituted by the product of the inductances of the machine , along the axes α and β , and the injected current along the axes α and β , linked to the injected voltage , is constantly negative and nonzero if the injected current is not nil . the system of equations described above therefore allows to obtain sin ( 2θ ) and cos ( 2θ ). at this point , the problem is to obtain sin ( θ ) from sin ( 2θ ) and cos ( θ ) from cos ( 2θ ). the filtering step performed to measure the current of the motor and thus extract the current linked to the injected voltage can be obtained by implementing a hardware or software filter that is suitable to obtain only the currents produced by the injection of high - frequency voltage , without thereby altering their information content , eliminating the components at the frequency of the fundamental and those derived from high - frequency pulse width modulation . for example , it is possible to use second - order bandpass filters implemented analogically or digitally in the processor . it is noted that when the rotor is locked ( i . e ., the frequency of the fundamental is zero ), filtering is practically useless and the results are highly valid . therefore , the method described above allows to determine the initial position of the motor , minus a 180 ° angle , and also allows to control the machine when the rotor is locked ( torque control with locked rotor ). once sin ( 2θ ) and cos ( 2θ ) have been determined , there are two possible solutions for sin ( θ ) and cos ( θ ). this means that the position of the rotor is known in terms of orientation , but its orientation is not known , i . e ., the magnetic north and south of the rotor are not known . in order to define the direction of the position of the rotor , when the machine starts it is sufficient to inject a very small voltage for a very short time in the direction of the axis cc , thus obtaining a small movement of the rotor , and then observe the change in position ; the north of the rotor tends to align with the axis α , and therefore the variation of sin ( 2θ ) and cos ( 2θ ) that is observed allows to define the direction of the rotor position . from that moment onward , at each step k of the observation algorithm , one chooses from the two possible solutions for sin ( θ ) and cos ( θ ) the solution that is closest to the one found in the preceding step , i . e ., k − 1 , while the other solution is spaced by an angle θ which is equal to approximately 180 °. in greater detail , assuming that one has two mutually different values of the angle θ , and assuming that the correct solution of the equations is the first value , for example the north pole is close to the axis α , at 45 °, if a positive voltage is applied along the α axis , the cosine of the angle increases , while the sine decreases , because the north pole tends to align with the axis α . if instead the solution is the second one found ( i . e ., the south pole is close to the axis a , at 45 °, and therefore the north pole is at 225 °), the cosine of the angle is seen to decrease , while the sine increases because the south pole tends to move away from the axis α . in practice it has been found that the method according to the invention allows to determine the position of the rotor of a permanent - magnet anisotropic alternating - current machine without using a position sensor for said rotor . the method according to the invention , moreover , can be implemented with computational resources that are commonly available in ordinary hardware platforms used for motor control . furthermore , the method for determining the electrical angle θ , starting from the sine and cosine of the angle 2θ , obtained by means of the method according to the invention , is performed without resorting to pre - calculated tables of machine inductances as a function of rotor position and by using solving algorithms that are extremely simple with respect to known solutions .	7
a first slatboard constructed in accordance with one of the preferred embodiments of the invention is illustrated in fig1 and 2 and generally designated 10 . the slatboard generally comprises baseboard 12 , a plurality of t - shaped slats 14 secured to the baseboard to define t - shaped slots 16 , and decor strips 18 positioned within each of the slots . the t - shaped cross section of slots 16 enables both &# 34 ; groove wall &# 34 ; hardware , such as hanger 20 , or &# 34 ; traditional slatboard &# 34 ; hardware , such as hanger 22 , to be suspended therefrom . because decor strips 18 are removably slidable within slots 16 , the appearance of the slatboard can be altered by replacing the decor strips with other decor strips having a desired appearance . baseboard 12 ( fig1 and 2 ) is a generally planar member and in the preferred embodiment comprises medium density fiberboard ( mdf ) such as that manufactured by plum creek . alternatively , baseboard 12 could be particle board . baseboard 12 includes forward face 24 and rear face 26 . if rear face 26 is to be exposed in the merchandising display , plastic laminate 28 is adhesively secured thereto to provide a desired appearance . slats 14 ( fig1 and 2 ) are generally t - shaped in cross section and are preferably also fabricated of mdf . each slat includes stem portion 30 adhesively secured to baseboard 12 and crossbar portion 32 including overhangs 32a and b . stem 30 defines a pair of opposite beveled walls 34a and b which are angled away from one another as they extend away from baseboard 12 . each wall 34a defines the lower wall of a slot 16 , while each wall 34b defines the upper wall of a slot 16 . consequently , the upper and lower walls 34b and a of each slot 16 extend toward one another and away from baseboard 12 to define a portion of a v . the portion of baseboard face 24 between each pair of upper and lower walls 34 defines rear wall 35 of slot 16 . overhangs 32a and b ( fig2 ) of crossbar portion 32 terminate in beveled ends 36a and b , respectively , which define a portion of a v . opposing ends 36 of adjacent slats 14 define mouth 42 of slot 16 . overhang walls 38a and b extend between walls 34 and ends 36 and are generally parallel to baseboard 12 . consequently , each of slots 16 is generally t - shaped including crossbar portion 40 and mouth portion 42 . front faces 44 of slats 14 are finished to provide a desired appearance . for example , plastic laminate 46 can be adhered to front surface 44 to provide a visually attractive and protective finish . in the preferred embodiment , the distance between rear wall 35 and overhang walls 38 is one - fourth inch , and the distance between the face of laminate 46 and walls 38 is also one - quarter inch . decor strips 18 ( fig1 and 2 ) are slidably received within slots 16 . strip 18a ( fig1 ) is shown partially withdrawn from its associated slot 16a . srips 18 have a generally uniform height which is substantially the same as the distance between upper and lower walls 34b and a at rear wall 35 . walls 34 therefore cooperate to provide a means for maintaining decor strip 18 proximate or adjacent rear wall 35 . consequently , decor strip 18 cannot flip - flop or fall forward in slot 16 . preferably , decor strips 18 are fabricated of polyvinyl chloride . of course , a wide variety of materials can be substituted to provide a desired appearance to strips 18 and slatboard 10 . a second embodiment of the invention is illustrated in fig3 and generally designated 110 . this slatboard includes baseboard 112 , a plurality of slats 114 secured thereto , and a c - shaped reinforcing insert 150 positioned within each of slots 116 . baseboard 112 , slats 114 , slots 116 , and laminates 128 and 146 are substantially identical to those described in conjunction with slatboard 10 . consequently , their detailed construction will not be repeated here . c - shaped inserts 150 are preferably roll - formed of 24 - gauge cold - rolled steel stock . the inserts include rear wall 152 , upper and lower walls 154a and b extending forwardly therefrom , and front walls 156a and b extending toward one another from upper and lower walls 154a and b , respectively . walls 156a and b terminate in opposed edges 158a and b , respectively , which define the open side of insert 150 . the distance between opposed edges 158 is substantially the same as the largest distance between beveled ends 136 and consequently less than the smallest distance between the beveled ends . edges 158a and b are therefore not readily visible within slot 116 . the cross - sectional shape of insert 150 conforms closely to crossbar portion 140 of slot 116 . insert 150 provides reinforcement to slatboard assembly 110 so that hardware supported within the slatboard can bear relatively heavy forces without breaking fragile extensions 132 . this greatly improves the safety and load - bearing capabilities of the resultant assembly . preferably , insert 150 is finished prior to rolling to provide a desired visual effect through slot 16 . a third embodiment of the invention is illustrated in fig4 and generally designated 210 . this embodiment includes slatboard 212 which is routed using conventional techniques to form slot 216 . the width of board 212 is substantially the same as the combined width of baseboard 12 and slats 14 in embodiment 10 . the configuration of slot 216 is generally identical to the configuration of slot 16 . c - shaped insert 250 , generally identical to insert 150 of embodiment 110 , is positioned within slot 216 . consequently , embodiment 210 of fig4 is generally identical to embodiment 110 of fig3 with the exception that a single board 212 is substituted for the baseboard 112 and slats 114 of the previous embodiment . consequently , assembly 210 possesses the safety and strength characteristics of assembly 110 . a fourth embodiment of the invention is illustrated in fig5 and generally designated 310 . this embodiment includes baseboard 312 and a plurality of slats 314 adhesively secured thereto . baseboard 312 and slats 314 are generally identical to their counterparts in embodiment 10 previously described and consequently will not be redescribed in detail . colored adhesive or glue 350 is applied to front face 324 of baseboard 312 in a desired pattern and preferably overlies the entire baseboard in an even coat . in the preferred embodiment , adhesive 350 is the polyvinyl adhesive sold by national casing under designation &# 34 ; 4700 &# 34 ;. adhesive is visible within slots 316 and therefore contributes to the aesthetic appeal or visual effect of resultant assembly 310 . laminate or melimine 346 is applied to slats 314 to provide the slats with a desired finish . the color of adhesive 350 and the color of laminate 346 are selected to provide a desired visual effect , for example matching colors , contrasting colors , or complimentary colors . slats 14 of slatboard 10 are fabricated by adhesively securing laminate 46 to front face 44 of each slat and routing the slat to form walls 34 , ends 36 , and overhang walls 38a . slats 14 are arranged on baseboard 12 generally parallel to one another in side - by - side fashion to define slots 16 therebetween . slats 14 are adhesively secured to baseboard 12 . optionally , staples 48 are inserted through baseboard 12 and into slats 14 to further secure the baseboard and slats together . the decor strips are slid into each slot as indicated in fig1 . the color of the decor strips is selected to provide a desired visual effect in combination with plastic laminate 46 . the t - shaped configuration of slots 16 enables board 10 to receive both standard groove wall brackets 20 and slatwall brackets 22 . additionally , slatwall 10 can be installed either right side up or upside down because slots 16 are symmetrical . any time that a variation in the appearance of the assembly 10 is desired , decor strips 18 are removed and replaced with decor strips having other desired visual characteristics . the configuration of slots 16 is such that each of decor strips 18 is maintained against or proximate rear wall 35 of the slot . assembly 110 ( fig3 ) is assembled in a similar fashion to assembly 10 previously described . the only difference is that channel inserts 150 are arranged on baseboard 112 prior to the securement of slats 114 thereto . as slats 114 are secured to baseboard 112 , inserts 150 are entrapped between the baseboard and the slats . both brackets 20 and 22 pull outwardly on channel walls 156 and overhang portions 32 ; and the reinforcement provided by insert 150 substantially reduces the possibility that the slatwall will fracture under the load of the brackets . consequently , the load - carrying capabilities and safety of the slatwall are greatly improved . alternative assembly 310 is also fabricated in a manner generally identical to that of assembly 10 . colored adhesive 350 is applied to baseboard 312 in a selected manner to intersecure the baseboard and slats 314 . in the preferred embodiment , adhesive 350 is applied as an even coat over the entire surface of baseboard 312 . however , it is anticipated that the adhesive could be applied as parallel lines , stripes , or other patterns to provide a desired effect . the colored glue 350 visible within slot 316 , together with plastic laminate 346 provides an aesthetically pleasing appearance to the slatboard assembly 310 . assembly 210 is fabricated by first routing slots 216 in board 212 . the slots are routed in a two - pass operation . the first pass forms mouth portion 242 , while the second pass forms crossbar portion 240 . c - shaped inserts are slid laterally into slots 216 and preferably extend the full length of the slot . the resultant assembly 210 has the strengthened structural advantages of assembly 110 previously described . the above descriptions are those of preferred embodiments of the invention . various changes and alterations can be made without departing from the spirit and broader aspects of the invention as set forth in the appended claims , which are to be interpreted in accordance with the principles of patent law , including the doctrine of equivalents .	0
disclosed herein are systems , methods , and computer program products for user authentication using behavioral biometrics of a computer pointing device , such as pointing device behaviometrics . a computer system , method , and / or the like , may collect data generated by a pointing device from a particular user during an enrollment or training session , and use the data to generate one or more models that identify the particular user using a particular application on the computer . for example , the pointing device may be a mouse , a touch screen , a stylus , a trackball , and / or the like , and the data may be screen coordinates , timestamps , button status , and / or the like . according to embodiments of the present disclosure , the pointing device data may be spatially clustered into screen regions to automatically identify screen regions related to input fields , user interaction fields , user significant fields , and / or the like . within each screen region , patterns specific to a user are statistically modelled during the training session , such as using machine learning or the like . the pointing device motion between each screen region may be separately modelled during the training session to determine path models for the user between the regions . some of these specific patterns and regions may be unique to each user and application , and provide the basis for the statistical model used in a later verification session . computing a statistical model may use features extracted from the pointing device data , such as by position and velocity calculations , a machine learning analysis , a neural network analysis , and / or the like . many different methods of feature extraction are disclosed in the literature or may be developed in the future , and the techniques described herein for automatic region selection may be applied in addition to the specific choice of features to extract or methods to determine the statistical model . for example , different methods for pointing device behaviometrics are discussed by jorgensen et al . in “ on mouse dynamics as a behavioral biometric for authentication ” published in proceedings of the 6th acm symposium on information , computer and communications security , pages 476 - 482 , association for computing machines , new york , which is incorporated herein by reference in its entirety . pointing device behaviometrics for use in user authentication may be applied as a static authentication , such as during an initial logon for access to a computerized system , or as a continuous authentication , such as to prevent a “ lunch time ” imposter from accessing a secure system . during the verification session , new pointing device data is collected , features extracted , and compared to the model to authenticate the user . the new pointing device data is segregated into the screen regions according to one or more models , and the new pointing device data compared to the statistical models of each screen region and for the path models between the regions . each comparison may generate a similarity score and / or a confidence score , and the similarity and / or confidence scores are aggregated for multiple regions and pointing device motion between regions . as the comparisons are performed over time , as more pointing device data is collected and received , the scores may be combined , such as aggregated , to continuously monitor the user authentication . the aggregation continues until the similarity score is below a threshold , indicating that the new pointing device data is not following the user patterns , and the confidence score is above a threshold indicating that similarity score is accurate . an aggregate score may be used to determine whether the user is legitimate and / or authorized , and may be calculated by combining the similarity and / or confidence scores from the analysis individual screen regions , such as clusters , optionally with scores of user interaction for path models created travelling between screen regions . optionally , the scores are weighted by the cluster quality , importance , the significance of the considered feature in the model , the accuracy of the model , and / or the like . for example , starting at a certain time point , the new pointing device data indicates no similarity to the authorized user model in a specific screen region of entering a medical test result , and the confidence score starts at a low value , but as time goes on and the similarity score is still low the confidence score increases until there is a high confidence score that indicates the low similarity score truly reflects that the user is not the authorized user . the similarity and confidence scores are used to reduce the statistical type i and type ii errors . for example , in biometric matching the probability of type i errors may be called the “ false reject rate ” ( frr ) or false non - match rate ( fnmr ), while the probability of type ii errors may be called the “ false accept rate ” ( far ) or false match rate ( fmr ). in this way , when an authorized user makes a temporary change to the pointing device motions there may be some time before the authorized user is rejected by the security system . the similarity score may be analogously compared to a correlation statistic and the confidence score may be analogously compared to a p - value statistic . optionally , the similarity and / or confidence scores are computed for a temporal subset of the new point device data . for example , the similarity and / or confidence scores are computed from the new data during a time window , during a moving time window , at discrete time windows , at overlapping time windows , and / or the like . when more than one user has access to a system , such as two people sharing a joint bank account , when one person uses different types of systems to access a single account , and / or the like , multiple models may be used to allow multiple confidence scores to be computed and combined into a single composite score for all users and / or systems . a pointing device may be a computer mouse , a touch pad , a track pad , a track ball , a finger , a stylus , and / or the like . in some cases , the display has sensor elements that interact physically with the pointing device , such as a touchscreen , or the like . when a pointing device moves between identified screen regions , paths particular to a user are recorded and statistically modeled . once the pattern and / or path models are determined based on the screen regions , the pointing device motions are monitored and compared with the models to compute the similarity and / or confidence scores that the user is operating the pointing device . when the similarity score is below a similarity threshold and / or confidence scores is above a confidence threshold , a security threat may be issued , such as an alert to the system , a notification sent , the user locked out of the system , and / or the like . the problem of identity theft and fraud may be relevant to many types of applications , such as cyber security , medical systems , online finance , e - commerce , enterprise information systems , and / or the like . this method is susceptible to imposters that may have acquired the user &# 39 ; s credentials and are using the account for fraudulent activity and / or to gain access to restricted resources . the exact nature of the pointing device data that is gathered by the system may be unknown to the user , making it much more difficult for an imposter to successfully violate the system for a long period of time . many current methods for user identification and verification based on pointing device movements extract a certain set of features from the data and then train classifiers to recognize the different users . new data may be classified using these classifiers in order to identify the specific user or to verify his identity . most current methods differ in the feature - set they use and in the learning method utilized . many of the current methods suffer from major drawbacks , including : task specificity — requiring the user to repeat the same operation , or relying on a tightly controlled environment , poor ability to scale to large numbers of different users while maintaining acceptable error levels , and sensitivity to behavioral variability caused by different legitimate users of the same account , different input devices , natural changes in user behavior over time , and the like . using spatial clustering to automatically separate the training data into screen regions , and analyzing the features in each region separately , may solve these issues , such as reduce the amount of data needed to train and test the user model , analyze and reduce variability , dynamically adapt to different system layouts and user interaction , verify a large number of users while maintaining good prediction performance , and / or the like . reference is now made to fig1 and fig2 , which show a schematic illustration of a system 100 and flowcharts 200 and 210 , respectively , for spatial segmentation of behaviometric pointing device data . computerized system 100 comprises one or more hardware processors 101 , a user interface 110 , and a storage medium 102 , such as a non - transitory computer readable storage medium . user interface 110 comprises a screen 120 for presenting electronic forms to a user and a pointing device 111 for receiving user pointer movements and selections on screen 120 . storage medium 120 comprises program code embodied therewith , such as embodied in modules , the program code executable by hardware processor ( s ) 101 . for example , the program code is embodied in a feature extractor 102 a , a screen region selector 102 b and a score aggregator 102 c . screen region selector 102 b may comprise instruction that when executed on hardware processor ( s ) 101 cause hardware processor ( s ) 101 to receive pointing device 111 raw data , such as monitoring 202 and 211 pointing device 111 data . for brevity , the modules may be described in active voice as performing the method actions , while it is known that the instructions are executed by the hardware processor ( s ) 101 . screen region selector 102 b may segregate 203 and 212 temporal and / or spatial subsets of the monitored pointing device 111 data . for example , screen region selector 102 b extracts a temporal subset based on a fixed time window , optionally with window overlap . for example , screen region selector 102 b extracts a temporal subset based on a fixed number of pointing device strokes , optionally with overlap . for example , screen region selector 102 b extracts a temporal subset based on a fixed number of pointing device strokes , optionally with overlap . for example , screen region selector 102 b a subset of pointing device data from a small screen region , such as an input field screen region , a button screen region , and / or the like . feature extractor 102 a computes 204 and 213 features of the pointing device 111 data , statistical models of the features , and scores between models and new pointing 111 device data . for example , a machine learning technique is used to extract features and compute statistical models . for example , a support vector machine ( svm ) technique is used to extract features and compute statistical models . for example , a neural network technique is used to extract features and compute statistical models . computed 204 scores may comprise a similarity score , a confidence score , and the like . score aggregator 102 c aggregates multiple scores over time , as data is collected and received , for both similarity and confidence , and periodically check the scores against thresholds for each score to check 206 if an unauthorized user is operating the pointing device 111 . for example , if the similarity score is below a similarity threshold , such as a value of 0 . 5 , a security action 207 is initiated . for example , if the confidence score is above a confidence threshold , such as a value of 0 . 8 , a security action 207 is initiated . for example , security action 207 is a notification to a security system , presenting a request for user authentication , system lockout , sounding an alarm , and / or the like . for example , different thresholds may be used depending on the sensitivity of the software system . for example , a financial system may require a very low similarity and / or confidence thresholds . for example , a user feedback and / or survey system may use a very high similarity and / or confidence thresholds . pointing device data may be monitored during one or more user &# 39 ; s interaction with a screen of a software system . for example , the data may be screen coordinates of the pointer ( e . g . mouse cursor or another pointing device ), a timestamp ( indicating when the pointing device was in that location ), pointing device button status , pointing device button status change , a finger pressure , and / or the like . the pointing device data may be segregated into movement strokes , which are defined as consecutive data points which terminate either with a button change or a period of device inactivity . data may be segregated into subsets , such as subsets of a fixed number of data points , subsets of a certain time window , subsets of a certain number of strokes , and / or the like . the subsets may be selected with overlap between the subsets . for example , when a user makes 40 strokes in one session , the group size is 20 and the overlap is 10 moves , this session would result in 3 groups : moves 1 - 20 , moves 11 - 30 , moves 21 - 40 . the system may capture characteristic movement blocks of the user and thereby continuously test the user behavior in real - time during the session . in order to reduce the verification time considerably , a continuous similarity and / or confidence score calculation technique may be implemented , such as in overlapping time windows . for example , when an overlap of 80 % is used , the verification time may be reduced up to 5 - fold . the continuous similarity and / or confidence score calculation may create a short - term memory effect which may prevent accidental false - positives while still allowing fast detection of behavioral changes . screen regions of user activity are automatically recognized and may be used to generate separate clusters of 2d movements in space ( traces ) and 3d movements in space and time ( interactions ). this step results in a segmentation of the screen to regions of user interaction and transit between them . the user &# 39 ; s behavior may be analyzed separately in each of the screen regions to build one or more unique models for each region ( pattern models ) and for the paths between regions ( path models ). the user interaction with the software system varies between different parts of the system ( both different screens / pages and different parts of the screen / page ). spatial clustering of the pointer coordinates and / or movements into screen regions may regions of interest for modelling , such as hot spots of user activity , input field locations , screen regions the user “ parks ” the pointer , and / or the like . these screen regions may have unique meaning for each application and , thus , the user &# 39 ; s behavior may be analyzed separately in each of the screen regions . this also enables analysis of the movements between the different screen regions as discussed herein . the calculated probability of whether the user is legitimate and / or authorized is achieved by combining the similarity and / or confidence scores from the analysis of individual clusters ( possibly weighted by the cluster quality ) with similarity and / or confidence scores of user interaction when travelling between screen regions . for example , one embodiment for automatically extracting spatial clusters and transition areas is by using multi - scale two - dimensional accumulator matrices . in this example , each interaction point “ votes ” for cells in the matrices that contain it . for example , the plane is iteratively divided to cells , such that in the i - th iteration , the grid contains 2 ̂ i × 2 ̂ i cells . optionally , the voting of each interaction point is weighted using several parameters , such as the speed of movement through the point , pressure , and / or other like characteristics . after the voting process , the accumulator matrices may be segmented — adjacent regions with high scores correspond to spatial clusters while regions with low scores are paths between spatial clusters . the multi - scale voting embodiment allows for automatic detection of screen regions with different sizes . optionally , spatial clusters and transition areas are automatically extracted using a model - based agglomerative hierarchical clustering method . in addition , this method may also include a trimming step of spurious clusters ( representing transition areas ). for example , in some embodiments , a mixture of density functions is fitted to the data using maximum likelihood estimation to find the optimal number of clusters g , where the likelihood function is : l mix = π i = 1 n σ k = 1 g τ k f k ( y i \| θ k ). f k , θ k denote the density and parameters of the kth - component in the mixture and τ k is the probability that a data point belongs to the kth component . a good choice for the density function may be the multivariate normal distribution . an initial classification for each potential value of g may be found by performing hierarchical agglomeration that approximately maximizes the classification likelihood : l cl = π i = 1 n f l i \| θ l i ), where l i denotes labels indicating the unique classification of each observation ( instead of probability in l mix ). this alternative starts with each data point in a singleton cluster and successively merges pairs of clusters that maximize the increase in classification likelihood , until only g clusters are left . the joint estimation and maximization of said likelihood function l mix , for each selection of g may be computed using an expectation - maximization ( em ) algorithm , possibly using the initial classification result from the aforementioned hierarchical agglomeration . the optimal clustering result may be determined by several selection methods such as maximizing the bayes information criterion ( bic ). the additional trimming step may ignore the data points which are least likely to fit to any of the resulting mixture components , and these areas may be classified as transitional . optionally , a background model is created by taking a large sample of movement blocks from the entire population of users and using spatial clustering methods in order to generate the common representative behaviors of all the users , and characterize each user relative to the background model . this may allow the statistical model generated to achieve better separation between the user and the population . given a sufficient amount of such pointing device data from a single user , a statistical model representing the user &# 39 ; s behavior is built using this data , possibly relative to a background model . this may involve the user - specific feature - set learning , and the exact amount of data needed may be decided based on performance measurements of the method . the use of screen regions determined automatically from pointing device data spatial clustering may assist in improving any existing or future statistical model . the pointing device data of each user may be described by a different set of features which are most characteristic to that specific user . for example , a fuzzy , multi - feature statistical model of pointing device data is constructed separately for each user in a hold - one - out manner . for example , one user may be described by long consecutive pointing device strokes with high curvature while a different user might be identified by slow strokes with long silence times . these data may be identified by combining the base features of each user into high - level descriptors which best separate this user from others and may be used to perform authentication and / or identification . each user may have a different subset of the entire feature space which is more specific for their identification using pointing device strokes . the features which best separate the pointing device activities of a user from the general population may be selected this way and features discarded which do not add to the separation ability . optionally , a hold - one - out method , where each feature is removed from the data and the performance difference between the complete model and the model evaluated without this feature , indicates the marginal importance of that feature to the user &# 39 ; s model . for example , features with least importance are discarded from this user &# 39 ; s model . optionally , basic features may be combined into higher - level sets of features , or descriptors . the descriptors may be chosen randomly for each user model , from the features - set selected for that user . each descriptor may be used in a statistical model and the response from all of the independent descriptor models is combined to generate the overall system response to new data . for each subset of pointer data , different measures , metrics , and / or features may be calculated , such as measuring the movements speed , acceleration , distance , angles and curvatures , click times , silence periods , and the like . as mentioned above , an aggregate score may be used to determine whether the user is legitimate and / or authorized , and may be calculated by combining the similarity and / or confidence scores from the analysis individual screen regions , such as clusters , optionally with scores of user interaction for path models created travelling between screen regions . optionally , the scores are weighted by the cluster quality , importance , the significance of the considered feature in the model , the accuracy of the model , and / or the like . for example , the similarity score between the observed user interactions with those recorded in the database may be calculated by the following formula : similarity - score ( observed - trace , stored - trace )= sum - features [ w − feature ( sum − all − i [ w − cluster − i similarity − cluster − i ]+ sum − all − ij [ similarity − path − ij ])]. reference is now made to fig3 , which shows a schematic illustration of spatial segmentation of pointing device data . for example , transitions 304 between screen regions 301 , 302 , and 303 are not modelled as just another screen region cluster . for example , significant clusters may be modeled as at 301 , 302 and 303 , and transitions 304 to those and other clusters may be modelled by path models to calculate the aggregated similarity and / or confidence scores . reference is now made to fig4 shows a schematic illustration of spatial segmentation of pointing device and pressure data . the pressure data 401 a , 401 b and 401 c may be further modelled in addition to clusters 401 , 402 , and 403 . optionally , path data 404 is modelled . since several legitimate users may be using an application with the same credentials , a behavior variability technique may determine the number of legitimate users based on the analysis of multiple models from multiple users . given a set of pointing device data originating from the same application training session , an embodiment may automatically calculate whether a single model may be built for this user or multiple models . multiple models may be required when more than one pattern is detected within the same spatial region . for example , a husband and wife using the same bank account , a user who accesses the account from two computers with differing hardware configuration and input devices , and the like . spatial , temporal , or feature cluster analysis may be used to split the user data to different clusters of similar pointing device behavior . these clusters may be spatially analyzed by judging the intra - distances of each cluster and the inter - distances between clusters . when there are compact screen region clusters that are far apart , the data set may be sub - divided to create multiple models that capture each unique behavior of the user . reference is now made to fig5 , which shows a schematic illustration of segmented pointing device data on a display 500 . display 500 shows data points of the pointing device , and the clusters computed as at 501 , 502 , 503 , 504 and 505 . data points between the clusters are the transition regions . methods may also be used to identify outliers in the training data , which may indicate fraudulent activity in the training phase of the enrollment process . optionally , a fraud detection system may use application level information regarding the registered number of users / owners , expected attributes , and / or the like , to refine the clustering of user pointing device data within the same account enrollment . for example , detection of new types of pointing device interactions may trigger contacting a higher level application . for example , detection of new features or sub - clusters of features may trigger contacting a higher level application . the higher level application may provide information assisting in classification of new activities as anomaly , fraud , benign , and the like . new pointing device data collected from user sessions may sub - divided into temporal windows and tested against the models by grouping the data points to strokes , movements , and the like . the same model features may be extracted as in the learning phase and compared to the pattern and path models to determine the similarity and / or confidence scores . overlapping windows may be used to continuously update the scores , with older scores optionally being removed from the aggregate scores . if the similarity score drops below a certain threshold , and optionally the confidence score increase above a threshold , the system may take measures against the user , such as disconnect the session , requesting additional identity information , block the user from accessing restricted data , blocking sensitive actions , and / or the like . to address the problem of long verification time , the continuously calculated aggregate scores from overlapping time windows allow a quick detection of an unauthorized user , and this allows more test results per time unit . the aggregate scores may be updated with each new test result available , such as each new time window . optionally , the time parameter may be added as a third dimension to allow on - line verification of the performed continuous interactions . in this case the interactions between the user and the pointing device are verified in a manner similar to chirography algorithms for on - line signature verification . the present invention may be a system , a method , and / or a computer program product . the computer program product may include a computer readable storage medium ( or media ) having computer readable program instructions thereon for causing a processor to carry out aspects of the present invention . the computer readable storage medium can be a tangible device that can retain and store instructions for use by an instruction execution device . the computer readable storage medium may be , for example , but is not limited to , an electronic storage device , a magnetic storage device , an optical storage device , an electromagnetic storage device , a semiconductor storage device , or any suitable combination of the foregoing . a non - exhaustive list of more specific examples of the computer readable storage medium includes the following : a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), a static random access memory ( sram ), a portable compact disc read - only memory ( cd - rom ), a digital versatile disk ( dvd ), a memory stick , a floppy disk , a mechanically encoded device having instructions recorded thereon , and any suitable combination of the foregoing . a computer readable storage medium , as used herein , is not to be construed as being transitory signals per se , such as radio waves or other freely propagating electromagnetic waves , electromagnetic waves propagating through a waveguide or other transmission media ( e . g ., light pulses passing through a fiber - optic cable ), or electrical signals transmitted through a wire . rather , the computer readable storage medium is a non - transient ( i . e ., not - volatile ) medium . computer readable program instructions described herein can be downloaded to respective computing / processing devices from a computer readable storage medium or to an external computer or external storage device via a network , for example , the internet , a local area network , a wide area network and / or a wireless network . the network may comprise copper transmission cables , optical transmission fibers , wireless transmission , routers , firewalls , switches , gateway computers and / or edge servers . a network adapter card or network interface in each computing / processing device receives computer readable program instructions from the network and forwards the computer readable program instructions for storage in a computer readable storage medium within the respective computing / processing device . computer readable program instructions for carrying out operations of the present invention may be assembler instructions , instruction - set - architecture ( isa ) instructions , machine instructions , machine dependent instructions , microcode , firmware instructions , state - setting data , or either source code or object code written in any combination of one or more programming languages , including an object oriented programming language such as java , smalltalk , c ++ or the like , and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the computer readable program instructions may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). in some embodiments , electronic circuitry including , for example , programmable logic circuitry , field - programmable gate arrays ( fpga ), or programmable logic arrays ( pla ) may execute the computer readable program instructions by utilizing state information of the computer readable program instructions to personalize the electronic circuitry , in order to perform aspects of the present invention . aspects of the present invention are described herein with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ), and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer readable program instructions . these computer readable program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer readable program instructions may also be stored in a computer readable storage medium that can direct a computer , a programmable data processing apparatus , and / or other devices to function in a particular manner , such that the computer readable storage medium having instructions stored therein comprises an article of manufacture including instructions which implement aspects of the function / act specified in the flowchart and / or block diagram block or blocks . the computer readable program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other device to cause a series of operational steps to be performed on the computer , other programmable apparatus or other device to produce a computer implemented process , such that the instructions which execute on the computer , other programmable apparatus , or other device implement the functions / acts specified in the flowchart and / or block diagram block or blocks . the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods , and computer program products according to various embodiments of the present invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of instructions , which comprises one or more executable instructions for implementing the specified logical function ( s ). in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts or carry out combinations of special purpose hardware and computer instructions . the descriptions of the various embodiments of the present invention have been presented for purposes of illustration , but are not intended to be exhaustive or limited to the embodiments disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments . the terminology used herein was chosen to best explain the principles of the embodiments , the practical application or technical improvement over technologies found in the marketplace , or to enable others of ordinary skill in the art to understand the embodiments disclosed herein .	6
the present invention will be described more closely below in association with the accompanying drawings in which fig1 shows a correlation between the number of blood neutrophils and the concentration of mpo protein in detergent extracted whole blood . fig2 shows ratio between mpo and lactoferrin in detergent extracted whole blood . fig3 shows a correlation between the number of eosinophils and the concentration of epo protein in detergent extracted whole blood . granules were prepared from the buffy coat of granulocytes obtained from healthy blood donors using a modification of the procedure described by peterson et al ( eur . j . haematol . 40 ( 1988 ) 415 - 423 ). in brief , the red blood cells were allowed to sediment using dextran t - 500 before collection of the leukocyte rich plasma . leucocytes were washed twice in 0 . 34 m sucrose and the suspended in 5 volumes of 0 . 34 m sucrose . the leukocytes were cavitated using n 2 at a pressure of 750 psi for 30 min at + 4 ° c . ( klempner et al ., j . cell . biol . 86 ( 1980 ) 21 - 28 ; and borregaard et al ., j . cell . biol . 97 ( 1983 ) 52 - 61 ). the cavitate was suspended in 0 . 34 m sucrose , 0 . 17 m nacl and centrifuged for 20 min at 450 × g at + 4 ° c . the supernatant was centrifuged for 20 min at 10 , 000 × g at + 4 ° c . to sediment the granules . myeloperoxidase ( mpo ) was purified from granule extracts according olsson et al ( scand . j . haematol . 9 ( 1972 ) 483 - 491 ) and cooray et al ( vet . immunol . immunopathol . 38 ( 1993 ) 261 - 272 ). the final preparation was completely homogenous according to the absorbance ratio a430 nm / a280 m which was 0 . 80 ( agner acta . chem . scand . 12 ( 1958 ) 89 - 94 . human neutrophil lipocalin ( hnl ) was purified as described ( xu et al ., scand j clin lab invest 54 ( 1994 ) 365 - 376 . hnl was purified to homogeneity according sds - page electrophoresis and silver staining and the antigen did not react with antibodies against the other neutrophil proteins , mpo ; lactoferrin , cathepsin g , elastase and lysozyme . lactoferrin was purified as described ( reiter int . j . tissue react . 5 ( 1983 ) 87 - 96 . eosinophil peroxidase ( epo ) was purified as described ( carlson et al j . immunol . 134 ( 1985 ) 1875 - 1879 ) and the final preparation was homogenous according to the absorbance ratio a415 nm / a280 nm that was 1 . 15 . eosinophil protein ( epx ) was purified to homogeneity as described ( peterson et al ., immunol . 50 ( 1983 ) 19 - 26 . the final preparation appeared as one band on sds - page electrophoresis and did not react with antibodies against eosinophil cationic protein ( ecp ), elastase , cathepsin g , mpo and epo . antibodies against mpo , hnl , epo and epx was raised in rabbits by multiple site intracutaneous injections into the rabbits of total 50 - 100 μg of the purified proteins suspended in freund &# 39 ; s complete and incomplete adjuvant . the specificity of the antibodies was evaluated by double immuno diffussion ( ouchterlony acta pathol . microbiol . scand 26 ( 1949 ) 507 -) in agarose and tested against extracts of neutrophils and eosinophil granules and the following purified proteins : cathepsin g , elastase , mpo , lysozyme , lactoferrin , ecp , epx ; epo . female balb / c mice were immunized subcutaneously with purified protein . priming was done by injecting 50 μg of pure protein mixed with freund &# 39 ; s complete adjuvant . three boosters were done with approximately 50 μg of pure protein in pbs ( phosphate buffered saline ). spleen cells were fused as described ( galfré et al ., nature 266 ( 1977 ) 550 - 552 ) with sp2 / 0 myeloma cells . supernatants from the cell cultures were screened for antibodies using elisa technique with antigen - coated wells . antibodies in supernatants were also screened for specificity to respective granule protein and mapped for epitopes in biacore ® ( biacore , uppsala , sweden ). hybridomas were selected according to the elisa and biacore experiments and cloned , expanded and purified . all selected antibodies were of iggi subtype . hnl was assessed using a radioimmunoassay as described ( xu et al ., j . immunol . methods 171 ( 1994 ) 245 - 252 . inter - and intra assay variations were less than 10 % and detection limit was less than 4 μg / l . epx and myeloperoxidase was measured using commercially available radioimmunoassays ( pharmacia diagnostics ab , uppsala , sweden ). inter - and intra assay variations were less than 10 % and detection limit was less than 3 and 8 μg / l , respectively epo was measured using a protype immunofluorometric assay utilising the pharmacia cap system ® as described ( nielsen et al ., allergy 53 ( 1998 ) 778 - 785 . inter - and intra assay variations were less than 8 % and detection limit was less than 0 . 5 μg / l . lactoferrin was estimated as described ( olofsson et al ., scand j haematol 18 ( 1977 ) 73 - 80 ). inter - and intra assay variations were less than 8 % and detection limit was less than 2 μg / l . edta - containing blood samples drawn from patients were randomly collected at the university hospital , uppsala , sweden . blood cell counts were performed on each sample by means of a coulter stks ( beckman coulter , inc .) cell counter . granule proteins were extracted from granulocytes by means of adding ctab ( n - cetyl - n , n , n - trimethyl - ammonium bromide ) at a final concentration of 0 . 05 - 0 . 5 % to a small aliquot of blood , 1 - 10 μl . the mixture was then incubated for at least 1 minute and then stored frozen at − 20 ° c . before analysis . regression analysis was performed using the statistical package , statistica ( statsoft , tulsa , usa ). the present invention shows that extraction of a small aliquot of blood , 1 - 10 μl , with ctab , final concentration 0 . 05 - 0 . 5 %, for at least 1 minute and subsequent measurement of the neutrophil protein mpo by means of a specific immunoassay accurately estimates the numbers of neutrophils in the blood . as shown in fig1 , the concentration of mpo in the extract was significantly and linearly correlated ( r = 0 . 96 ) to the number of neutrophils in the extracted blood as estimated by means of a coulter stks ( beckman coulter , inc .) cell counter . from the equation of the regression line it is apparent that the deviation from origo was minimal , indicating the cell specificity of the measurement . the results were obtained from a mixed population of hospitalized patients ( n = 275 ) having both elevated and reduced levels of neutrophils in the their blood . thus , some patients had highly elevated levels due to acute bacterial infections and others had seriously reduced levels due to leukemia or cytostatic drug treatment . in spite of the inclusion of these extremes in the calculation , the relationship between number of neutrophils and the concentration of mpo was linear over the entire range measured . when hnl was measured the corresponding correlation was r = 0 . 93 and also with a linear relationship to the number of neutrophils over the entire range . lactoferrin measurement also showed a linear relationship over the entire range and a correlation coefficient of r = 0 . 82 . it is well known that mpo is stored in the primary granules of neutrophils , whereas lactoferrin and hnl are stored in secondary granules . this is because the production of mpo primarily takes place during the early maturation steps i . e . by myeloblasts and promyelocytes , whereas lactoferrin and hnl primarily are produced during later maturation steps i . e . by myelocytes . it is also known that production of mpo is less affected by an increased requirement of neutrophils in the circulation , such as in acute infections , than the production of lactoferrin and hnl . the ratio between the content of either of the secondary granule proteins and mpo would therefore provide us with an estimate of the relative size of the various maturation stages of neutrophils in the blood and an indication of the bone marrow turnover of neutrophils . it is shown in fig2 that a ratio between mpo concentration and lactoferrin concentration in extracted whole blood varies about 20 - fold between patients , with myeloid leukemia patients having the highest ratios . in this example it is shown that extraction of a small aliquot of blood , 1 - 10 μl , with ctab , 0 . 05 - 0 . 5 %, for at least 1 minute and the subsequent measurement of the eosinophil protein epo by means of a specific immunoassay accurately estimates the numbers of eosinophils in the blood . as shown in fig3 , the concentration of epo in the extract was significantly and linearly correlated ( r = 0 . 95 ) to the number of eosinophils in the extracted blood as estimated by means of a coulter stks ( beckman coulter , inc .) cell counter . from the equation of the regression line it is apparent that the deviation from origo was minimal , indicating the cell specificity of the measurement . the results were obtained from a mixed population of hospitalized patients ( n = 275 ) having both elevated and reduced levels of eosinophils in the their blood . thus , some patients had elevated numbers because of allergy and asthma , chronic inflammatory diseases , cancer etc . and some had reduced numbers because of , among other things , acute infections . in spite of the inclusion of these extremes in the calculation , the relationship between number of eosinophils and the concentration of epo was linear over the entire range measured . when epx was measured the corresponding correlation was r = 0 . 93 and also with a linear relationship to the number of eosinophils over the entire range . the above examples 1 - 3 describe neutrophils , different maturation forms of neutrophils , and eosinophils . however the invention is not to be construed as limited to these cell types . cell surface markers such as cd20 may measure b - lymphocytes and cd3 t - lymphocytes . the cell surface markers cd4 and cd8 may be used to measure different lymphocyte populations . determination of ratios is especially interesting for myeloid cells as described in example 2 , but also for various subpopulations of lymphocytes . borregaard n , heiple jm , simons er et al . subcellular localization of the b - cytochrome component of the human neutrophil microbicidal oxidase : translocation during activation . j . cell . biol . 1983 ; 97 : 52 - 61 carlson mgch , peterson cgb , venge p . human eosinophil peroxidase : purification and characterization . j immunol 1985 ; 134 : 1875 - 9 . cooray r , petersson cgb , holmberg o . isolation and purification of bovine myeloperoxidase from neutrophil granules . vet immunol immunopathol 1993 ; 38 : 261 - 72 . galfré g , howe sc , milstein c et al . antibodies to major histocompatibility antigens produced by hybrid cell lines . nature 1977 ; 266 : 550 - 552 klempner ms , mikkelsen rb , corfman dh et al . neutrophil plasma membranes . i . high - yield purification of human neutrophil plasma membrane vesicles by nitrogen cavitation and differential centrifugation . et al ., j cell biol july 1980 ; 86 ( 1 ): 21 - 28 . nielsen lp , bjerke t , christensen mb et al . eosinophil markers in seasonal allergic rhinitis . intranasal fluticasone propionate inhibits local and systemic increases during the pollen season . allergy 1998 ; 53 : 778 - 85 . olofsson t , olsson i , venge p et al . serum myeloperoxidase and lactoferrin in neutropenia . scand j haematol 1977 ; 18 ( 1 ): 73 - 80 . olsson i , olofsson t , odeberg h . myeloperoxidase - mediated iodination in granulocytes . scand j haematol 1972 ; 9 ( 5 ): 483 - 91 . oucterlony ö . antigen antibody reactions in gels . acta pathol microbiol scand 1949 ; 26 : 507 . peterson cgb , jörnvall h , venge p . purification and characterization of eosinophil cationic protein from normal human eosinophils . eur j haematol 1988 ; 40 : 415 - 23 . peterson cgb , venge p . purification and characterization of a new cationic protein - eosinophil protein - x ( epx )— from granules of human eosinophils . immunol 1983 ; 50 : 19 - 26 . reiter b . the biological significance of lactoferrin . int j tissue react 1983 ; 5 : 87 - 96 . xu sy , carlson m , engström et al . purification and characterization of a human neutrophil lipocalin ( hnl ) from the secondary granules of human neutrophils . scand j clin lab invest 1994 ; 54 : 365 - 76 . xu sy , peterson cgb , carlson m et al . the development of an assay for human neutrophil lipocalin ( hnl )— to be used as a specific marker of neutrophil activity in vivo and vitro . j immunol methods 1994 ; 171 : 245 - 52 .	6
refer to fig2 a sectional view schematically showing a pcb structure according to one embodiment of the present invention . the pcb structure 1 of the present invention comprises a first body 10 , a second body 12 and a sleeve / adapter 14 . in substance , the sleeve 14 is a hollow column or hollow disc where a through hole penetrates . the sleeve 14 is disposed between the first body 10 and the second body 12 and separates the first body 10 from the second body 12 . in detail , the first body 10 is detachably connected with the outer surface of the sleeve 14 ( disposed outside the through hole ); the second body 12 is detachably connected with the inner surface of the sleeve 14 ( disposed inside the through hole ). preferably , the first body 10 has a plurality of first electrodes 20 , and the second body 12 has a plurality of second electrodes 30 respectively corresponding to the first electrodes 20 . preferably , a wire 40 is disposed between each of the first electrodes 20 and the corresponding one of the second electrodes 30 , electrically connecting the first electrode 20 with the corresponding second electrode 30 . preferably , each of the second electrodes 30 has a corresponding third electrode 32 disposed on the second body 12 . preferably , a plated through hole 34 is formed between each second electrode 30 and the corresponding third electrode 32 , penetrating through the second body 12 and electrically connecting the second electrode 30 and the corresponding third electrode 32 . refer to fig2 again and refer to fig3 . preferably , each of the third electrodes 32 has a signal trace 36 ; the signal trace 36 gradually shrinks in width and extends to a specified / test area 38 where the signal traces 36 contact probes of a probe card ( not shown in the drawing ). it should be noted : fig3 is not to limit but only to exemplify the quantities and layout of the third electrodes 32 and the signal traces 36 . in one embodiment , the second body 12 has at least one electric barrier ( not shown in the drawing ) disposed between each two adjacent signal traces 36 , especially among the rear ends of at least two signal traces 36 . the electric barrier has a higher insulation coefficient , such as an insulation coefficient equal to or higher than the insulation coefficient of air , so as to reduce the probability of current leakage between two adjacent signal traces 36 . preferably , the electric barrier is in form of at least one of slots , holes and structures made of an insulating material ; the slots are through slots or blind slots ; the holes are through holes or blind holes ; the insulating material has an insulation coefficient higher than the insulation coefficient of air . refer to fig4 for the detailed structure of the sleeve 14 . the sleeve 14 includes a wall 50 , a first protrusion 60 and a second protrusion 70 . the wall 50 extends axially , having an outer wall surface 50 a and an inner wall surface 50 b in the radial direction and having a first wall end 52 and a second wall end 54 opposite the first wall end 52 in the axial direction . the first protrusion 60 extends outward radially from the first wall end 52 and defines a first outer side 62 and a first inner side 64 opposite the first outer side 62 in the axial direction . the second protrusion 70 extends inward radially from the second wall end 54 and defines a second outer side 72 and a second inner side 74 opposite the second outer side 72 in the axial direction . the first body 10 is disposed in the outer wall surface 50 a of the sleeve 14 . preferably , the first body 10 is detachably connected with the first protrusion 60 of the sleeve 14 . in one embodiment , the first body 10 is detachably connected with the first inner side 64 of the first protrusion 60 of the sleeve 14 . the second body 12 is disposed in the inner wall surface 50 b of the sleeve 14 . preferably , the second body 12 is detachably connected with the second protrusion 70 of the sleeve 14 . in one embodiment , the second body 12 is detachably connected with the second inner side 74 of the second protrusion 70 of the sleeve 14 . the abovementioned structure defines a sleeve inner side height h a1 between the first inner side 64 and the second inner side 74 , which is greater than the first body thickness h b1 of the first body 10 . thus , a differential height h diff exists between the second inner side 74 and one side of the first body 10 , which is near the second inner side 74 . in other words , the differential height h diff exists between one side of the second body 12 , which contacts the second inner side 74 , and one side of the first body 10 , which is near the second inner side 74 . the configuration of the second electrodes 30 and the third electrodes 32 in the second body 12 is further described in detail below . the second electrodes 30 are disposed on one side 12 a of the second body 12 , which is far away from the second protrusion 70 . the third electrodes 32 are disposed on another side 12 b of the second body 12 , which is near the second protrusion 70 , and correspond to the second electrodes 30 . refer to fig5 a diagram schematically showing the configuration of a pcb structure and a tested wafer / semiconductor device according to one embodiment of the present invention . the pcb structure 1 is disposed over a wafer 80 for wafer sort . the differential height h diff of the sleeve inner side height h a1 and the first body thickness h b1 makes the adjustment height h ad , which is defined by the second body 12 and the wafer 80 , smaller than a predefined probe depth h pd , which is defined by the first body 10 and the wafer 80 . while chip miniaturization demands that the diameter of the probes should be reduced , the distance between the second body 12 and the wafer 80 that are connected by the probes of the probe card ( not shown in the drawing ), especially the probe length at which the probes connect the second body 12 and the wafer 80 , can be reduced without varying the predefined grip length / predefined probe depth h pd between the pcb structure 1 ( especially the first body 10 ) and the wafer 80 because of the abovementioned configuration . thereby , the diameter - to - length ratio of the probes exposed from the probe card can be maintained within a specified range .	6
although the invention is described in terms of a specific embodiment , it will be readily apparent to those skilled in this art that various modifications , rearrangements and substitutions can be made without departing from the spirit of the invention . the scope of the invention is defined by the claims appended hereto . now referring to fig1 shown is the preferred embodiment of the instant invention 10 comprising a base frame 12 having five wheels 14 secured to the bottom of said frame 12 . wheels 14 are placed around the perimeter of the base frame 12 and preferably have a central locking and steering ability similar to conventional stretchers wherein they can be fully locked , locked to roll straight ahead , or free wheel . in such an embodiment , two levers , not shown , are mounted on each end of the frame 12 . one lever locks two wheels at that end forcing the united to roll straight ahead for optimum steering . the back wheels pivot free for steering purposes . alternatively , foot operate levers 15 provide simplified engagement of the wheel locks . pivotally mounted to an end 13 of the base frame 12 is a first leg 16 having a shoe plate 18 mounted at a distal end 19 of the leg 16 . structure 20 provides a support housing for electric motors used for operating the components as well as an upper articulating point 21 for the legs 16 and 16a . a first strut 22 is pivotally coupled to said upper articulating point 21 and to the illustrated leg 16 at lower pivot point 26 . the strut 22 utilizes a centrally disposed over - center hinge 28 which folds inward so as to allow the leg 16 into a vertical stance for purposes of storage . to retract the legs , motor 50 is mechanically linked to the legs 16 and 16a and boom motor 52 provides retraction of the boom 34 in a similar manner . a hoist motor 54 provides the lifting and lowering of the hook 58 , and a swing motor 56 is used to modulate the angular arc of the boom 34 . the support frame 20 includes hand grips 30 placed along an upper rail 31 providing an operator with a predetermined position for moving of the lifting device . the handgrips 30 can be accompanied by hand brakes , not shown , for use in preventing wheel 14 rotation . in such an embodiment , the operator can prevent movement of the unit by simply squeezing a hand brake in a similar fashion as a brake used on a bicycle . once stopped , the apparatus can be locked in position through the use of the aforementioned wheel locks 15 . an alternate embodiment is to use hand grips that apply constant braking force so as to require the operator to maintain their hands on the apparatus during transportation . this is especially useful in those circumstances where a ramp is encountered during transportation . in such an embodiment , should a unit free roll down a ramp the brakes will engage to bring the unit to a stop . boom head 32 is supported by the frame 20 and is shown in its extended position . extension of the boom 34 is made possible by an electric motor driven linear actuator 66 which extends crutch 36 which is coupled to the boom 34 by upper pivot point 38 and lower pivot point 40 . the centrally disposed hinge 42 is forced over - center by the linear actuator causing said hinge to lock in a fixed position . storage of the boom occurs by folding of the boom 34 downward by allowing the boom 34 to fold within the confines of the frame 20 by reversal of the above steps . similarly , the legs 16 are folded upward by the inward movement of the strut hinge 28 so as to provide a compact unit that stores in a small closet and can be maneuvered through doorways . an additional cable runs parallel to strut 22 and when said cable is pulled in by the leg motor , after the solenoid releases the over - center hinge , the leg folds to the near vertical position . now referring to fig2 shown is the lifting device 10 in a retracted position wherein the base frame 12 provides the footprint for the structure 20 made portable by the wheels 14 . the boom 34 is shown in its downwardly folded position while the legs 16 are shown in an upwardly folded position , all within the confines of the support structure 20 . as depicted by this view , the crutch 36 is hinged 42 at a center point allowing the boom 34 to form a near vertical position thus eliminating the space necessary for a conventional hoisting unit and preventing the possibility of harm to an operator who inattentively walks into a fully extended boom . the over - center hinge is pulled from its locked state by use of a boom motor 52 which pulls the crutch cable 64 , see fig1 causing the crutch 36 to fold in the center . linear actuator 66 operates to place the boom 34 in an extended or upright position . similarly , the legs 16 fold upright to maintain the unit &# 39 ; s small storage footprint while further eliminating an unguarded leg extension common among those units in the industry , thus eliminating the possibility of injury to tripping an individual attempting to step over an extended support leg . the strut 22 is hinged 28 at a center point allowing the leg 16 to form a near vertical position . the over - center hinge is pulled from its locked state by use of a leg motor 50 which pulls the strut cable 61 , see fig1 causing the strut 22 to fold in the center . gravity operates to bias the leg 16 into the extended position . a spring , not shown , can be incorporated in the leg to facilitate the biasing of the leg in an extended position . fig3 sets forth a top view of the instant device 10 in a fully extended form illustrating the wide u - shaped structure . leg 16a operates in conjunction with leg 16 providing enhanced stability during operation . each leg is raised and lowered by use of the same electric leg motor 50 so to operate in unison at all times . the leg support position is made possible wherein strut 22 and 22a is in a fully extended position allowing the strut hinges 28 and 28a to be locked in position forcing the shoe skid 18 and 18a to press against the floor . the stance provides stability for the boom 34 as it extends outward over the patient to be lifted . in operation , the device 10 is moved into position so that the legs and boom 34 can extend without interference . as the unit is electrically powered , an ac cord is provided for insertion into an available wall socket to power the electrical motors , namely , the leg hoist 50 , the hoist motor 52 , the swing motor 54 , and the boom motor linear actuator 66 . control of the system is performed by a control panel positioned in a hand held control ball fabricated from a three inch thick solid resilient ball as described later in this specification . placement of the leg and boom components in an operating position is accomplished by depressing a button on the control panel which simultaneously operates the leg motor 50 and boom motor linear actuator 66 allowing the legs 16 & amp ; 16a and the boom 34 to extend into their operating position . the operator may stop the extension procedure at any time should the legs or boom encounter interference . led lamps are provided to represent the position of the legs and boom . the lamps will change from a blinking red color to a continuous green color when sensors , not shown , confirm a positive lock in the extended position similar to the indicators used with airplane landing gear . the boom 34 has an angular sweep d 1 between legs 16 and 16a allowing the operator to pick up a patient at one position and transport the patient to a second position . boom swing angle is approximately forty degrees with a twenty degree tolerance . the reach of the boom is sixty inches , slightly less than the preferred leg reach of approximately eighty inches . in operation it is recommended that a patient is placed upon a support sling wherein the boom 34 is swung over the patient in a lifting bar properly positioned over the support sling . this will minimize any swinging tendency as the support sling and patient is pulled upward . a hook 58 is located at the end of the boom 34 . during this position the device 10 can be rolled slightly so as to facilitate correct positioning . once the device 10 is properly located the wheels can be locked by use of the foot lever 15 . a frame mounted lever , not shown , can be used to lock the wheels in a position allowing straight roll . using the control panel a button is provided to lower the hook 58 until the lifting assembly is attached . raising the patient is performed by depressing a button on the control panel allowing upward movement so as the patient and sling are above both departure and arrival surfaces . the patient can then be swung from the departure surface to the arrival surface by provision of a right and left directional control button allowing movement of the boom 34 . the patient is then unhooked from the hook 58 and the device 10 is positioned such that the legs 16 and boom 34 can be retracted without interference . when the unit is to be transported or stored , a control button is provided so as to retract the legs and boom , the movement can be halted at any point if necessary . during the retraction the led &# 39 ; s representing the legs and the boom will blink red until sensors ( not shown ) detect a positive latch for storage . at that point , the led &# 39 ; s will stop blinking and be in a continuous red position . the device 10 can then be turned off and the ac cord unplugged and coiled for storage with the device 10 . referring to fig4 the boom 34 is mounted on a rotatable boom head 32 that provides a pivot point 62 for one end of the boom 34 that is used in the retracted state . in particular the pivot point 62 allows the boom 34 to fold downward in a retracted position . the hinge 42 is an over - center hinge causing the crutch to lock into position . collapsing of the boom requires that the hinge 42 is pulled off center by the cable 64 by a solenoid , not shown . the rotatable sleeve is manufactured from light weight aluminum having a five and a half inch diameter which is rotatably coupled to the frame 20 by a rotatable bearing 74 located at the bottom of the head 32 to allow rotation about a predetermined angle . the frame 20 incorporates a support post 76 which is placed on the inner side surface of the pipe 72 having a plurality of inwardly facing centering components which are plastic guides 78 maintaining a fixed distance between the head pipe 72 and the support post 76 . fig5 illustrates a first side of the control system in its preferred embodiment comprising a hand held control ball 90 fabricated from a three inch diameter solid resilient ball . a control panel 91 is mounted in a recess 93 inside the ball 90 wherein a coiled cord , not shown , suspends the ball 90 at a convenient height for the operator to use . the rubber portion 95 of the ball 90 protects both the key pad 91 from damage and accidental button activation should the ball 90 swing free . depressing of the control button 92 labeled &# 34 ; e &# 34 ; causes the legs and boom to extend so that the leg and boom actuator motor allow their respective latches to extend and lock into position . the leg motor is recommended to be geared to extend the legs at a linear speed at approximately 1 ( one ) inch per second . optical sensors , such as honeywell ultra thin reflective sensors are utilized to confirm that the legs have extended and locked before the hoist can be operated . the reflective sensors each contain an optical infrared emitting diode and a detector mounted in side by side converging optical axis . the detector responds to the radiant power only when a reflector object passes within the field of view . similarly , the boom extends allowing the over - center hinge on the crutch to lock into position wherein the aforementioned optical sensor confirms the fully locked position by lighting of the led lights for the legs 96 , 98 and the boom 100 . during retraction the retraction button 94 is depressed wherein the legs and the boom return to their retracted position and the led lights 96 , 98 , and 100 illuminate to indicate the stored position . the back side of the control panel shown in fig6 causes the hoist to move in the upward position by depressing of directional positioning switches . depressing of an up switch 102 will operate the hoist motor for lifting of the hook . depressing of a down switch 104 will operate the hoist motor for lowering of the hook . movement of the boom to the left is accomplished by depressing the left switch 106 and movement of the hoist to the right is accomplished by depressing of the right switch 108 . lights are provided for indication of the leg 110 lock , boom 112 lock and wheel 114 lock . the hoist cable and pulleys should be rated for at least one - thousand pounds with a preferred linear cable speed of about 1 ( one ) inch per second . the hoist motor should be able to drive the cable reel via a worm gear thus the weight on the cable cannot cause the cable reel to rotate . it is to be understood that while i have illustrated and described certain forms of my invention , it is not to be limited to the specific forms or arrangement of parts herein describe and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown in the drawings and described in the specification .	0
the present invention will be explained below with reference to the accompanying drawings . fig1 illustrates a structure of a positioning terminal 1 in accordance with one embodiment of the present invention . the positioning terminal 1 is adapted to be used for tracking the position of a freight or any moving object from a control center ( not shown ). the position information of the freight such as the latitude and the longitude is obtained by transmitting and receiving signals to and from an artificial satellite , and by transmitting and receiving signals to and from the control center . the positioning terminal 1 is provided with a radio frequency identification ( rfid ) module 2 , a global positioning system ( gps ) module 3 , a communication module 4 and a terminal controller 5 . the rfid module 2 includes an antenna and an ic module . the gps module 3 is provided to obtain the position information of the positioning terminal 1 , such as the latitude and the longitude , by transmitting and receiving the signals to and from an artificial satellite . the communication module 4 is provided for transmitting and receiving data to and from a control center including the position information obtained with the gps module 3 . the communication module enables the control center to accumulate the position information of the positioning terminal 1 , and accordingly , the accompanying freight being transported . the terminal controller 5 is used for reading data from the memory of the rfid module 2 and for controlling the functions of the gps module 3 and the communication module 4 . the terminal controller 5 may be implemented as a software program adapted to run in a processor or it may also be implemented as a firmware or using hard circuitry . tracking of a freight by the positioning terminal 1 is now explained with reference to fig2 . the present invention assumes transportation of a freight by an aircraft , as one example . however , land and sea transportation are also contemplated . at the start , the positioning terminal 1 is made to accompany the freight or object being transported . typically , freight is transported to the departing airport by land transportation and passed through an rfid reader / writer 6 provided at the departing airport , where a predetermined value is written in the predetermined area of an rfid memory 21 in the rfid module 2 . an example of the rfid memory 21 is shown in fig3 ( a ), which shows that a flag is set in the “ departing airport flag ” field . the freight having completed the process at the departing airport is then passed through an rfid reader / writer 7 provided at the arriving airport . here , another predetermined value is written to the predetermined area of the rfid memory 21 provided in the rfid module 2 . in the example shown in fig3 ( a ), a flag is set in the “ arriving airport flag ” field . the freight is then transported by land transportation to its next destination . fig3 ( a )- 3 ( c ) illustrate different examples of the structure of the rfid memory 21 provided in the rfid module 2 . the rfid memory 21 of fig3 ( a ) is an example of the memory provided with the fields for the “ departing airport flag ” and the “ arriving airport flag ”. when the freight passes through the rfid reader / writer 6 provided at the departing airport , “ 1 ” is written to the “ departing airport flag ” field , and when the freight passes through the rfid reader / writer 7 provided at the arriving airport , “ 1 ” is written to the “ arriving airport flag ” field . fig3 ( b ) is an example in which the rfid memory 21 is provided with field for “ departing airport time ” and “ arriving airport time ”. the respective times are written when the freight passes through the rfid reader / writers 6 , 7 at the departing airport and arriving airport , respectively . the rfid memory 21 of fig3 ( c ) is provided with a field for “ scheduled arrival time ” in addition to the fields for the departing and arriving times shown in fig3 ( b ). this field is provided to enable the rfid reader / writer 6 of the departing airport to write the scheduled arrival time at the arriving airport . the scheduled arrival time for each flight number is normally listed in a typical operation time table 8 illustrated in fig4 , which may be stored in a storage device of an airport computer system accessible by the rfid reader / writers 6 , 7 . for example , in the case where a freight is loaded in the flight number “ fj201 ”, the rfid reader / writer 6 at the departing airport writes the value “ 13 : 15 ” from the “ arrival time ” field read from the operation time table 8 , in the “ scheduled arrival time ” field of the rfid memory 21 . fig5 illustrates a process for tracking the position of a freight in accordance with one embodiment of the present invention . the rfid module 2 is assumed to be provided with the rfid memory 21 shown in fig3 ( a ). in steps s 51 to s 53 , a polling process is executed , where the predetermined area of the rfid memory 21 is read every predetermined time . more specifically , in step s 51 , data is read from the “ departing airport flag ” field of the rfid memory 21 by the terminal controller 5 . in step s 52 , it is determined whether the departing airport flag is set from the read data . for example , whether the value “ 0 ” has been updated to “ 1 ” is determined . if the value “ 1 ” has been written as the predetermined value in the “ departing airport flag ” field of the rfid memory 21 by the rfid reader / writer 6 of the departing airport , the process goes to step s 54 . if not , the process goes to step s 53 for a predetermined time period , after which the process goes back to step s 51 . the predetermined time period in the step s 53 may be set so as to minimize power consumption of the positioning terminal 1 . in step s 54 , the terminal controller 5 executes the operations to inactivate the gps module 3 and the communication module 4 . in steps s 55 to s 57 , the polling process similar to that of steps s 51 to s 53 is also executed in order to monitor the “ arriving airport flag ” field of the rfid memory 21 . in step s 55 , data is read from the “ arriving airport flag ” field of the rfid memory 21 instead of “ departing airport flag ” as in step s 51 . in step s 56 , whether the read data is a predetermined value is determined . in other words , a determination is made as to whether the arriving airport flag is set . if “ 1 ” has been written as the predetermined value in the “ arriving airport flag ” field of the rfid memory 21 by the rfid reader / writer 7 at the arriving airport , the process goes to the step s 58 . if not , the process goes to step s 57 for a predetermined time period , after which the process goes back to step s 55 . in step s 58 , operations of the gps module 3 and the communication module 4 are activated again by issuing a control command to these modules by the terminal controller 5 . in the rfid memory 21 of fig3 ( b ), the current time is written in the rfid memory 21 in place of the predetermined flag . as such , the conditions in steps s 52 and s 56 may also be satisfied when the departing airport time and the arriving airport time are written in their respective fields of the rfid memory 21 . the flowchart of fig6 illustrates an example of the process in which the “ scheduled arrival time ” is written in the rfid memory 21 shown in fig3 ( c ) by the rfid reader / writer 6 at the departing airport . although not illustrated , the rfid reader / writer 6 is adapted to access the operation time table 8 ( shown in fig4 ) available from the airport computer system . the corresponding scheduled arrival time from the table 8 is written in the “ scheduled arrival time ” field of the rfid memory 21 at the time the freight and the accompanying positioning terminal 1 pass through and make communication with the rfid reader / writer 6 at the departing airport . in the example illustrated in fig3 ( c ), the time “ 13 : 15 ” is written in the “ scheduled arrival time ” field . the polling process in the steps s 61 to s 64 are similar to the processes in steps s 51 to s 54 of fig5 . in step s 65 , time data is read from the “ scheduled arriving time ” field of the rfid memory 21 . in step s 66 , all functions other than the function required for determining whether the scheduled arrival time has come , are suspended until the actual scheduled arrival time . in the example of fig5 , the terminal controller 5 executes the processes for checking for the arriving airport flag in steps s 55 to s 57 , even during the flight . accordingly , operations of the positioning terminal 1 consume some electric power , although only a little . however , in the example of fig6 , since the process of step s 66 is executed , the same processes in steps s 67 to s 69 for checking for the arriving airport flag are not executed until the scheduled arrival time . in this manner , operations and power consumption can be restrained . it is contemplated that a deviation may occur between the scheduled arrival time and the actual arrival time of the aircraft . however , in the environment in which the present invention is applied , it is desired that no signal from the gps module 3 or the communication module 4 be generated within the aircraft . therefore , the restarting functions of the gps module 3 immediately after arriving at the arriving airport is low in comparison with the importance of the condition described above . accordingly , the process of step s 66 is effective for its intended purpose . to prevent the gps module 3 from restarting while the freight and the positioning terminal 1 are still loaded in the aircraft , the terminal controller 5 recognizes arrival at the arriving airport through communication with the rfid module 2 . the polling processes in steps s 67 to s 68 for monitoring the “ arrival airport flag ” field of the rfid memory 21 are similar to those of steps s 55 to s 57 in fig5 . the gps module 3 and the communication module 4 are activated in step s 70 when the flag is set in the “ arriving airport flag ” field of the rfid memory 21 . the present invention is not limited only to the embodiments disclosed above but allows various changes and modifications without departing from the scope of claims . according to the present invention , the gps and the communication functions of a positioning terminal for tracking the position information of a freight can be automatically inactivated without any manual operations , so that generation of electric waves can be restrained during transportation in an aircraft . moreover , operations such as gps function or the like can be reactivated when transportation by the aircraft is terminated . while various embodiments of the present invention have been shown and described , it should be understood that other modifications , substitutions and alternatives are apparent to one of ordinary skill in the art . such modifications , substitutions and alternatives can be made without departing from the spirit and scope of the invention , which should be determined from the appended claims . various features of the invention are set forth in the appended claims .	6
the antimicrobial compositions of the invention comprise an antimicrobial agent and a potentiator therefor . in use , the combination of antimicrobial agent and potentiator is preferably dissolved , suspended or dispersed in a suitable carrier . although generally not as desirable as employing a separate carrier , it has been found suitable to employ the same chemical compound as both the potentiator and the carrier , thus eliminating the need for a separate carrier or vehicle . examples of antimicrobial agents which may be employed in the potentiated antimicrobial compositions of this invention include the antibiotics such as tetracycline , oxytetracycline , chlorotetracycline , neomycin , erythromycin and its derivatives , bacitracin , streptomycin , rifampicin and its derivatives , such as n - demethylrifampicin , kanamycin and chloromycetin ; the anti - fungal agents such as griseofulvin , mycostatin , miconazole , and its derivatives as described in u . s . pat . no . 3 , 717 , 655 ; bisdiguanides such as chlorhexidine ; quaternary ammonium compounds such as domiphen bromide , domiphen chloride , domiphen fluoride , benzalkonium chloride , cetyl pyridinium chloride , dequalinium chloride , the cis isomer of 1 -( 3 - chloroallyl )- 3 , 5 , 7 - triaza - 1 - azoniaadamantane chloride ( available commercially from the dow chemical company under the trademark dowicil 200 ) and its analogues as described in u . s . pat . no . 3 , 228 , 829 , cetyl trimethyl ammonium bromide as well as benzethonium chloride and methylbenzethonium chloride such as described in u . s . pat . nos . 2 , 170 , 111 , 2 , 115 , 250 and 2 , 229 , 024 ; the carbanilides and salicylanilides such as 3 , 4 , 4 &# 39 ;- trichlorocarbanilide , and 3 , 4 &# 39 ; 5 - tribromosalicylanilide ; the hydroxydiphenyls such as dichlorophene , tetrachlorophene , hexachlorophene , and 2 , 4 , 4 &# 39 ;- trichloro - 2 &# 39 ;- hydroxydiphenylether ; and organometallic and halogen antiseptics such as zinc pyrithione , silver sulfadiazine , silver uracil , iodine , and the iodophores derived from non - ionic surface active agents such as are described in u . s . pat . nos . 2 , 710 , 277 and 2 , 977 , 315 and from polyvinylpyrrolidone such as described in u . s . pat . nos . 2 , 706 , 701 , 2 , 826 , 532 and 2 , 900 , 305 . the potentiators which can be suitably employed in the antimicrobial compositions of this invention include members selected from the group consisting of : i . primary , secondary and tertiary straight or branched chain monohydric aliphatic alcohols , wherein the straight chain alcohols have from about 5 to about 10 carbon atoms and the branched chain alcohols have up to about 17 carbon atoms , their longest chain of carbon to carbon bonds having from about 5 to about 10 carbon atoms ; ii . a cyclohexyl substituted alkanol of the structure ## str1 ## wherein r 1 is c 1 to c 4 alkyl , halogen or hydrogen ; r 2 and r 3 are independently selected from hydrogen , c 1 to c 3 alkyl , and cyclopropyl ; and n is 1 to 4 , provided that only one of said r 2 and r 3 of a ## str2 ## moiety may be propyl or cyclopropyl ; iii . phenyl alkanols of the structure ## str3 ## wherein m is 0 or 1 ; r 4 is hydrogen , halogen , c 1 to c 4 alkyl , or cyclopropyl ; r 5 , r 6 and r 7 are independently selected from hydrogen , c 1 to c 3 alkyl and cyclopropyl , provided , however that only one of r 5 , r 6 and r 7 is a propyl or cyclopropyl group , and , when m is 0 , at least one r 5 is other than hydrogen ; and the total of the carbon atoms in the structure ## str4 ## is from 3 to 9 carbon atoms ; and iv . phenol derivatives of the structure ## str5 ## wherein r 8 is hydrogen , c 1 to c 3 alkyl , c 1 to c 3 alkoxy , hydroxy , halogen , amino , or mono or di c 1 to c 3 alkyl amino , provided that the total number of carbon atoms in the alkyl groups substituted on the amino does not exceed 5 carbon atoms . preferably , when r 8 is halogen , di - c 1 to c 3 alkylamino , or c 1 to c 3 alkoxy , then r 8 is para to the phenolic hydroxyl group . examples of the preferred aliphatic alcohol potentiators from group i include : n - hexanol ; n - heptanol ; n - octanol ; n - nonanol ; n - decanol ; 2 , 3 - dimethyl - 2 - hexanol ; 2 , 5 - dimethyl - 2 - hexanol ; 2 - methyl - 3 - hexanol ; 2 - heptanol ; 3 - heptanol ; 4 - heptanol and 2 - ethyl - 1 - hexanol . examples of the preferred potentiators from group ii include : cyclohexylmethanol ; 1 - cyclohexylethanol ; 2 - cyclohexylethanol ; 1 - cyclohexyl - 1 - propanol ; ( cyclohexyl ) dimethyl - carbinol ; ( 4 - isopropylcyclohexyl )- dimethylcarbinol ; 3 - cyclohexyl - 1 - propanol ; 2 - cyclohexyl - 1 - propanol ; 1 - cyclohexyl - 2 - propanol ; 2 - cyclohexyl - 1 , 1 - dimethylethanol ; 2 - cyclohexyl - 2 - methylpropanol ; 2 - cyclohexyl - 1 - methylpropanol ; 2 - cyclohexyl - 1 , 2 - dimethylpropanol ; 2 - cyclohexyl - 1 , 1 - dimethylpropanol ; 3 - cyclohexyl - 2 - methylpropanol ; 3 - cyclohexyl - 1 - methylpropanol ; 3 - cyclohexylbutanol ; 3 - cyclohexyl - 2 - methylbutanol ; and 3 - cyclohexyl - 1 , 2 - dimethylbutanol . preferred examples from group iii include : 3 - phenyl - 1 - propanol ; benzyl - t - butanol ; 1 -( p - chlorophenyl ) 2 - methyl - 2 - propanol , 1 - phenyl - 2 - methyl - 2 - propanol ; 1 - phenyl - 3 - butanol ; 2 - methyl - 3 - phenyl - propanol ; 2 , 2 - dimethyl - 3 - phenylpropanol ; 3 (- p - chlorophenyl ) propanol ; 4 (- p - chlorophenyl )- 2 - butanol ; 2 , 2 - dimethyl - 3 ( p - chlorophenyl )- propanol , 2 - methyl - 3 ( p - chlorophenyl )- propanol ; 1 - phenyl - 2 - propanol ; and 1 -( p - chlorophenyl )- 2 - propanol . preferred examples from group iv include : 2 - cyclohexylphenol ; 4 - cyclohexylresorcinol ; 2 - chloro - 6 - cyclohexylphenol ; 4 - amino - 2 - cyclohexylphenol hydrochloride ; o - cyclohexyl - p - methoxyphenol ; o - cyclohexyl - p - cresol ; o -( 4 - methylcyclohexyl ) p - cresol ; and 4 - chloro - 2 - cyclohexylphenol . the antimicrobial compositions of this invention include at least one antimicrobial agent and at least one of the potentiators selected from groups i , ii , iii and iv . in general , the composition comprises at least 0 . 1 percent of the potentiator and at least 0 . 001 percent of the antimicrobial agent . however amounts of as little as 0 . 05 percent potentiator have been found to be effective when the potentiator is selected from compounds of group iv . the balance of the composition , if any , is supplied by a suitable carrier as is hereinafter described . generally , the antimicrobial agent is employed in a quantity less than that of the potentiator . it is entirely suitable that up to 99 . 999 % of the composition be potentiator , thus obviating the need for using an additional component as a carrier . however , if desired , a carrier , preferably ethanol , can be employed . the more desirable compositions comprise from 0 . 1 to 90 . 0 percent potentiator and 0 . 001 to about 10 . 0 percent antimicrobial agent , and preferably from 0 . 1 to 10 . 0 percent potentiator and from 0 . 001 to 0 . 5 percent antimicrobial agent , depending on the particular materials used , with the balance of the composition comprising a suitable carrier , or combination of carriers . examples of such compositions are ethanol solution of : 0 . 05 % miconazole and 0 . 50 % 1 - cyclohexylethanol ; 0 . 05 % neomycin sulfate and 0 . 60 % 2 - cyclohexylethanol ; 0 . 05 % tetracycline and 0 . 75 % n - hexanol ; 0 . 05 % tetracycline and 0 . 50 % 1 - cyclohexylethanol ; 0 . 05 % neomycin sulfate and 0 . 75 % 2 , 3 - dimethyl - 2 - hexanol ; 0 . 05 % neomycin sulfate and 0 . 75 % 1 - cyclohexylethanol ; 0 . 75 % iodine and 0 . 40 % 2 - cyclohexylethanol ; and 0 . 05 % 3 , 3 &# 39 ;, 4 , 5 &# 39 ;- tetrachlorosalicylanilide and 0 . 50 % 1 - cyclohexylethanol . examples of the antimicrobial compositions of this invention where there is a synergistic effect provided by the combination of the antimicrobial agent and the potentiator include ethanol solutions of : 0 . 05 % 3 , 3 &# 39 ;, 4 , 5 - tetrachlorosalicylanilide and 0 . 50 % n - hexanol ; 0 . 025 % dequalinium chloride and 0 . 50 % 1 -( p - chlorophenyl )- 2 - methyl - 2 - propanol ; 0 . 025 % domiphen bromide and 1 . 0 % n - pentanol ; 0 . 025 % domiphen bromide and 0 . 75 % 2 - heptanol ; 0 . 025 % domiphen bromide and 0 . 50 % 2 , 3 - dimethyl - 2 - hexanol ; 0 . 025 % domiphen bromide and 0 . 75 % 2 , 3 - dimethyl - 2 - hexanol ; 0 . 0125 % domiphen bromide and 0 . 6 % hexanol ; 0 . 05 % hibitane and 0 . 10 % 2 - cyclohexylphenol ; 0 . 05 % griseofulvin and 0 . 75 % hexanol ; 0 . 05 % griseofulvin and 0 . 5 % 2 , 3 - dimethyl - 2 - hexanol ; 0 . 05 % griseofulvin and 0 . 75 % 2 , 3 - dimethyl - 2 - hexanol ; 0 . 05 % griseofulvin and 0 . 5 % 1 - cyclohexylethanol ; 0 . 05 % griseofulvin and 0 . 75 % 1 - cyclohexylethanol ; 0 . 05 % tetracycline and 0 . 5 % 1 -( p - chlorophenyl )- 2 - methyl - 2 - propanol ; 0 . 1 % zinc pyrithione and 0 . 5 % 1 - cyclohexylethanol ; 0 . 1 % zinc pyrithione and 0 . 75 % 2 , 3 - dimethyl - b 2 - hexanol ; 1 . 0 % zinc pyrithione and 0 . 5 % 1 -( p - chlorophenyl )- 2 - methyl - 2 - propanol ; and 0 . 5 % zinc pyrithione and 0 . 6 % 2 - cyclohexylethanol . in use , the antimicrobial agent and the potentiator are conveniently dissolved or dispersed in an inert fluid medium which serves as a carrier . the term inert means that the carrier does not have a deleterious effect on the antimicrobial agent upon storage , nor substantially diminish its activity , nor adversely react with any other component of the composition of this invention . suitable carriers include water , lower alkanols such as ethanol , the known pharmaceutical vehicles such as conventionally employed for topical applications such , for example , as ointments , creams , lotions , aerosols , suspensions and solutions . the preferred carriers are ethanol and water . the topical compositions of the present invention exhibiting enhanced penetration through the intact skin or enhanced topical activity comprise , in admixture , a medicament , for example , an anesthetic compound , such as lidocaine , benzocaine , tetracain , carbocaine , rodocaine , etc ., with a potentiator . this may be employed in any of the known forms for applying medicaments topically , including solutions , creams , gels and the like . preferably both the known medicament and the potentiator are dissolved , suspended or dispersed in a suitable carrier . as in the case of the antimicrobial compositions of the present invention , the potentiator may also serve as the carrier , although , generally , a separate pharmaceutically acceptable carrier is preferred , and an aqueous carrier is particularly preferred . for the topical compositions of the present invention , the potentiator is selected from the group consisting of : i . primary , secondary and tertiary straight or branched chain monohydric aliphatic alcohols wherein the straight chain alcohols have from about 5 to about 10 carbon atoms and the branched chain alcohols have up to about 17 carbon atoms , their longest chain of carbon to carbon bonds having from about 5 to about 10 carbon atoms ; ii . a cyclohexyl substituted alkanol of the structure ## str6 ## wherein r 1 is c 1 to c 4 alkyl , halogen or hydrogen ; r 2 and r 3 are independently selected from hydrogen , c 1 to c 3 alkyl , and cyclopropyl ; and n is 1 to 4 , provided that only one of said r 2 and r 3 of a ## str7 ## moiety may be propyl or cyclopropyl ; and iii . phenyl alkanols of the structure ## str8 ## wherein m is 0 or 1 ; r 4 is hydrogen , halogen , c 1 to c 4 alkyl , or cyclopropyl ; r 5 , r 6 and r 7 are independently selected from hydrogen , c 1 to c 3 alkyl and cyclopropyl , provided , however , that only one of r 5 , r 6 and r 7 is a propyl or cyclopropyl group , and when m is 0 , at least one r 5 is other than hydrogen ; and the total of the carbon atoms in the structure ## str9 ## is from 3 to 9 carbon atoms . examples of the preferred aliphatic alcohol potentiators from group i include : n - pentanol ; n - hexanol ; n - heptanol ; n - octanol ; n - nonanol ; n - decanol ; 2 , 3 - dimethyl - 2 - hexanol ; 2 , 5 - dimethyl - 2 - hexanol ; 2 - methyl - 3 - hexanol ; 2 - heptanol ; 3 - heptanol ; 4 - heptanol and 2 - ethyl - 1 - hexanol . examples of the preferred potentiators from group ii include : cyclohexylmethanol ; 1 - cyclohexylethanol ; 2 - cyclohexylethanol ; 1 - cyclohexyl - 1 - propanol ; ( cyclohexyl ) dimethyl - carbinol ; ( 4 - isopropylcyclohexyl )- dimethylcarbinol ; 3 - cyclohexyl - 1 - propanol ; 2 - cyclohexyl - 1 - propanol ; 1 - cyclohexyl - 2 - propanol ; 2 - cyclohexyl - 1 , 1 - dimethylethanol ; 2 - cyclohexyl - 2 - methylpropanol ; 2 - cyclohexyl - 1 - methylpropanol ; 2 - cyclohexyl - 1 , 2 - dimethylpropanol ; 2 - cyclohexyl - 1 , 1 - dimethylpropanol ; 3 - cyclohexyl - 2 - methylpropanol ; 3 - cyclohexyl - 1 - methylpropanol ; 3 - cyclohexylbutanol ; 3 - cyclohexyl - 2 - methylbutanol ; and 3 - cyclohexyl - 1 , 2 - dimethylbutanol . preferred examples from group iii include : 3 - phenyl - 1 - propanol ; benzyl - t - butanol ; 1 - phenyl - 2 - methyl - 2 - propanol ; 1 - phenyl - 3 - butanol ; 2 - methyl - 3 - phenyl - propanol ; 2 , 2 - dimethyl - 3 - phenylpropanol ; and 1 - phenyl - 2 - propanol . it will be seen that many of the foregoing potentiators for use in the topical compositions of the present invention are also useful as potentiators for the antimicrobial compositions . indeed , as will become more apparent from the following discussion , many of the antimicrobial compositions disclosed above are also useful topically , and fall within the scope of the topical compositions of the present invention . thus , the main difference between the two sets of potentiators is that the potentiators of group iv for the antimicrobial compositions have not been found to be particularly effective for enhancing penetration of medicaments through intact skin . the medicaments of which may be used in the topical compositions of the invention include antimicrobial agents , such as the antibiotics , for example , tetracycline , oxytetracycline , chlorotetracycline , neomycin , erythromycin and its derivatives , cycloserine , bacitracin , streptomycin , rifampicin and its derivatives , such as n - demethylrifampicin , kanamycin and chloromycetin ; the anti - fungal agents such as griseofulvin , mycostatin , miconazole , and its derivatives as described in u . s . pat . no . 3 , 717 , 655 ; quaternary ammonium compounds such as domiphen bromide , domiphen chloride , domiphen fluoride , benzalkonium chloride , cetyl pyridinium chloride , dequalinium chloride ; and organometallic and halogen antiseptics such as zinc pyrithione , sodium pyrithione , silver sulfadiazine , silver uracil , iodine , and the iodophores derived from nonionic surface active agents such as are described in u . s . pat . nos . 2 , 710 , 277 and 2 , 977 , 315 and from polyvinylpyrrolidone such as described in u . s . pat . nos . 2 , 706 , 701 , 2 , 826 , 532 and 2 , 900 , 305 . other medicaments whose penetration through the skin and topical activity are enhanced , and may thus be used in the topical compositions of the present invention include antiviral and cell regulatory agents such as 5 - iodo - 2 &# 39 ;- deoxyuridine , 5 - iodo - 2 &# 39 ;- deoxyuridine triphosphate , 5 - bromouracyl , 5 - fluorouracyl , cyclic adenosine monophosphate ( c - amp ), cyclic adenosine monophosphate dibutyrate ( c - amp - dibutyrate ), cyclic adenosine monophosphate succinate , cyclic guanosine monophosphate ( c - gmp ), methotrexate , 6 - azauridine triacetate ( azaribin ), epinephrine , phenephrine , l - dihydroxyphenyl alanine ( l - dopa ) and dopamine . a particularly preferred application of the topical compositions of the present invention is as topical anesthetic compositions , and much of the remainder of the discussion of the topical compositions of the present invention will be directed to such compositions for illustrative purposes . suitable anesthetic agents for use in the topical anesthetic compositions of the present invention include lidocaine , benzocaine , tetracain , carbocain , rodocain and the like . the topical compositions of this invention include at least one medicament , e . g . an anesthetic agent , and one or more of the potentiators selected from groups i , ii and iii above . the anesthetic compositions comprise at least 0 . 5 % by weight of the anesthetic agent , and a potentiating amount of the potentiator or penetrant accelerator , sufficient to enhance the skin penetration of the anesthetic agent , with the rest of the composition , if any , comprising one or more of ethanol , water and other conventional vehicles . generally , beyond a concentration of about 15 to 18 % by weight of potentiator no further enhancement of the penetration or activity of the anesthetic is observed . thus , while more potentiator could be used , for example as the vehicle , there is no particular advantage in using a concentration of potentiator in excess of about 15 % by weight . a preferred range for the concentration of potentiator is from about 1 % to about 12 % by weight of the composition . a preferred range for the concentration of anesthetic is from about 1 % to about 10 % by weight , although as much as 12 % by weight or more may be employed . suitable vehicles include water , lower alcohols such as ethanol and isopropanol , propylene glycol , and other conventionally employed pharmaceutical vehicles for topical application such as ointments , creams , lotions , aerosols , suspensions and solutions . preferably the topical composition contains from about 10 % to about 50 % by weight of water , more preferably , from about 20 % to about 40 % water . examples of such compositions are ethanol solutions of 4 % lidocaine and 12 % 2 - cyclohexylethanol ; 4 % lodocaine and 6 % 2 - cyclohexyl - 1 , 1 - dimethylethanol ; 4 % carbocaine and 6 % 2 - cyclohexyl - 2 - methyl - propanol ; 3 % tetracaine and 8 % 2 - cyclohexyl - 1 - methylpropanol ; 6 % benzocaine and 6 % 1 - cyclohexyl - 1 - propanol ; 4 % rodocaine and 12 % n - hexanol ; 4 % lidocaine and 8 % benzyl - t - butanol ; 2 % tetracaine and 8 % 3 - phenyl - 1 - propanol ; and the like . currently available topically used anesthetic preparations are generally ineffective or only partially effective when applied onto intact skin . one preparation that has been shown to be effective to cause surface anesthesia contains 20 % benzocaine . this high concentration of benzocaine is believed to be undesirable and dangerous because of possible toxic side effects . a significant improvement in the speed of action and in the duration of efficacy of the currently used anesthetics can be achieved when they are combined with a penetrant accelerator in accordance with the present invention . some of the accelerators themselves possess anesthetic activity and it is conceivable that their combination with the conventional anesthetics ( lidocaine , benzocaine , carbocaine , etc .) results in the potentiation of their anesthetic activity . in addition , it is postulated that the potentiators themselves alter membrane permeability and enhance the penetration of the anesthetics into the receptor sites even through the intact skin and cell membranes . because of this unique ability of the accelerators to alter the permeability barrier of the skin and also of the cell membranes , low concentrations of the conventional anesthetics are sufficient to achieve good anesthesia at the treated site . the following specific examples will further serve to illustrate the compositions of this invention . the procedure described below together with the results obrained according to that procedure will further illustrate the antimicrobial compositions of this invention and their unusual degree of effectiveness . the procedure entails admixing ( 1 ) 3 ml citrated human blood , ( 2 ) 5 ml peptone water , ( 3 ) 1 ml cell suspension ( bacteria , yeast or fungi ), and ( 4 ) 1 ml of a test solution , which test solution comprises 40 % ethanol and may include either or both of an antimicrobial agent and a potentiator . the first three components are admixed and preincubated at room temperature for ten minutes before the addition of the test solution . after the ten minute preincubation period , the test solution comprising 40 % ethanol , alone or together with the antimicrobial agent alone , the potentiator alone , or the combination of the two , is added . at intervals of one , ten and thirty minutes after this final addition , one ml of the treated mixture is removed and transferred to a dilution tube that contains 9 ml of a neutralizing composition comprising peptone water and an antimicrobial neutralizer . the neutralizer is required to inactivate the unadsorbed antimicrobial agent that otherwise may give rise to false positive results . after neutralization , serial dilutions are made with peptone water , and each dilution is plated out in a petri dish , and then covered with 15 ml of trypticase soy or mycophil agar media . the plates are incubated at appropriate temperature for two to three days , then the colonies are counted at each dilution . the number of surviving organisms are determined by multiplying the number of colonies that are counted at the lowest dilution with the power of that dilution . a series of the following four solutions was prepared in accordance with the foregoing procedure : ______________________________________i ethanol 40 % water 60 % ii ethanol 40 % water 60 % + antimicrobial agent ; iii ethanol 40 % water 57 % + potentiator ; andiv ethanol 40 % water 57 % + antimicrobial agent + potentiator . ______________________________________ table i______________________________________bactericidal ( killing ) efficacy number of cells survived contact times : organism solution 1 minute 10 minutes 30 minutes______________________________________s . aureus i 3 . 2 × 10 . sup . 9 3 . 1 × 10 . sup . 9 3 . 2 × 10 . sup . 9 ii ( 1 ) 2 . 3 × 10 . sup . 7 1 . 9 × 10 . sup . 7 1 . 0 × 10 . sup . 7 iii ( 2 ) 7 . 0 × 10 . sup . 5 6 . 0 × 10 . sup . 3 460 iv ( 3 ) 0 0 0s . aureus i 3 . 2 × 10 . sup . 9 3 . 1 × 10 . sup . 9 3 . 2 × 10 . sup . 9 ii ( 4 ) 2 . 3 × 10 . sup . 7 1 . 9 × 10 . sup . 7 1 . 0 × 10 . sup . 7 iii ( 5 ) 8 . 9 × 10 . sup . 7 8 . 6 × 10 . sup . 7 1 . 6 × 10 . sup . 7 iv ( 6 ) 4 . 0 × 10 . sup . 6 7 . 0 × 10 . sup . 3 90c . albicans i 9 . 1 × 10 . sup . 8 9 . 0 × 10 . sup . 8 8 . 2 × 10 . sup . 8 ii ( 4 ) 9 . 0 × 10 . sup . 8 8 . 2 × 10 . sup . 8 7 . 1 × 10 . sup . 8 iii ( 7 ) 3 . 0 × 10 . sup . 8 8 . 8 × 10 . sup . 8 5 . 0 × 10 . sup . 5 iv ( 8 ) 1 . 6 × 10 . sup . 6 4 . 0 × 10 . sup . 3 30c . albicans i 2 . 5 × 10 . sup . 9 3 . 0 × 10 . sup . 9 3 . 5 × 10 . sup . 9 ii ( 9 ) 3 . 8 × 10 . sup . 6 2 . 4 × 10 . sup . 6 2 , 4 × 10 . sup . 6 iii ( 10 ) 9 × 10 . sup . 6 7 . 5 × 10 . sup . 6 4 × 10 . sup . 5 iv ( 11 ) 9 × 10 . sup . 5 0 0c . albicans i 2 . 5 × 10 . sup . 8 2 . 2 × 10 . sup . 8 2 . 9 × 10 . sup . 8 ii ( 12 ) 3 . 4 × 10 . sup . 7 3 . 5 × 10 . sup . 7 3 . 5 × 10 . sup . 7 iii ( 13 ) 8 . 0 × 10 . sup . 7 1 . 2 × 10 . sup . 7 5 × 10 . sup . 5 iv ( 14 ) 6 . 0 × 10 . sup . 5 20 0c . albicans i 1 . 3 × 10 . sup . 9 1 . 0 × 10 . sup . 9 1 . 0 × 10 . sup . 9 ii ( 15 ) 9 × 10 . sup . 8 8 . 0 × 10 . sup . 8 7 × 10 . sup . 8 iii ( 16 ) 1 . 7 × 10 . sup . 6 2 × 10 . sup . 3 2 × 10 . sup . 3 iv ( 17 ) 5 × 10 . sup . 4 0 0p . aeruginosa i 9 . 2 × 10 . sup . 8 9 . 0 × 10 . sup . 8 9 . 6 × 10 . sup . 8 ii ( 18 ) 7 . 4 × 10 . sup . 8 7 . 0 × 10 . sup . 8 6 . 8 × 10 . sup . 8 iii ( 19 ) 1 . 1 × 10 . sup . 6 7 . 8 × 10 . sup . 4 4 . 8 × 10 . sup . 4 iv ( 20 ) 1 . 9 × 10 . sup . 4 1 0p . aeruginosa i 9 . 2 × 10 . sup . 8 9 . 0 × 10 . sup . 8 9 . 6 × 10 . sup . 8 ii ( 18 ) 7 . 4 × 10 . sup . 8 7 . 0 × 10 . sup . 8 6 . 8 × 10 . sup . 8 iii ( 21 ) 8 . 5 × 10 . sup . 6 7 . 6 × 10 . sup . 6 5 . 1 × 10 . sup . 6 iv ( 22 ) 8 . 0 × 10 . sup . 3 3 . 0 × 10 . sup . 3 9 . 0 × 10 . sup . 2c . albicans i 1 . 1 × 10 . sup . 9 1 . 2 × 10 . sup . 9 1 . 2 × 10 . sup . 9 ii ( 18 ) 2 . 8 × 10 . sup . 7 2 . 6 × 10 . sup . 7 2 . 7 × 10 . sup . 7 iii ( 23 ) 2 . 6 × 10 . sup . 6 3 . 0 × 10 . sup . 5 1 . 6 × 10 . sup . 4 iv ( 24 ) 2 . 8 × 10 . sup . 5 20 0s . aureus i 2 . 4 × 10 . sup . 9 2 . 0 × 10 . sup . 9 2 . 1 × 10 . sup . 9 ii ( 18 ) 1 . 4 × 10 . sup . 9 1 . 2 × 10 . sup . 9 9 . 2 × 10 . sup . 8 iii ( 21 ) 1 . 3 × 10 . sup . 8 3 . 0 × 10 . sup . 5 1 . 0 × 10 . sup . 4 iv ( 22 ) 2 . 9 × 10 . sup . 7 2 . 0 × 10 . sup . 3 80c . albicans ii * ( 25 ) 12 × 10 . sup . 7 12 × 10 . sup . 7 12 × 10 . sup . 7 iii * ( 26 ) 17 × 10 . sup . 7 40 × 10 . sup . 5 10 × 10 . sup . 5 iv * ( 27 ) 11 × 10 . sup . 6 10 × 10 . sup . 3 10 × 10 . sup . 3s . aureus ii * ( 25 ) 40 × 10 . sup . 8 40 × 10 . sup . 8 40 × 10 . sup . 8 iii * ( 26 ) 50 × 10 . sup . 7 10 × 10 . sup . 5 30 × 10 . sup . 3 iv * ( 27 ) 20 × 10 . sup . 6 0 0s . aureus ii ( 28 ) 13 × 10 . sup . 7 13 × 10 . sup . 7 14 × 10 . sup . 7 iii ( 29 ) 84 × 10 . sup . 6 17 × 10 . sup . 4 60 × 10 . sup . 3 iv ( 30 ) 13 × 10 . sup . 6 10 × 10 . sup . 2 500______________________________________ ( 1 ) domiphen bromide ( 0 . 0125 %) ( 2 ) hexanol ( 0 . 6 %) ( 3 ) domiphen bromide ( 0 . 0125 %) + hexanol ( 0 . 6 %) ( 4 ) domiphen bromide ( 0 . 0250 %) ( 5 ) 2heptanol ( 0 . 5 %) ( 6 ) domiphen bromide ( 0 . 0250 %) + 2heptanol ( 0 . 50 %) ( 7 ) 2 , 3dimethyl - 2 - hexanol ( 0 . 50 %) ( 8 ) domiphen bromide ( 0 . 0250 %) + 2 , 3dimethyl - 2 - hexanol ( 0 . 50 %) ( 9 ) hibitane ( 0 . 050 %) ( 10 ) 2cyclohexylphenol ( 0 . 1 %) ( 11 ) hibitane ( 0 . 05 %) plus 2cyclohexylphenol ( 0 . 1 %) ( 12 ) griseofulvin ( 0 . 05 %) ( 13 ) 2 , 3dimethyl - 2 - hexanol ( 0 . 5 %) ( 14 ) griseofulvin ( 0 . 03 %) + 2 , 3dimethyl - 2 - hexanol ( 0 . 5 %) ( 15 ) znomadine ( 0 . 1 %) ( 16 ) 2cyclohexylethanol ( 0 . 6 %) ( 17 ) znomadine ( 0 . 1 %) + 2cyclohexylethanol ( 0 . 6 %) ( 18 ) miconazoleno . sub . 3 ( 0 . 05 %) ( 19 ) 2cyclohexylethanol ( 0 . 4 %) ( 20 ) miconazoleno . sub . 3 ( 0 . 05 %) + 2cyclohexylethanol ( 0 . 4 %) ( 21 ) 2 , 3dimethyl - 2 - hexanol ( 0 . 75 %) ( 22 ) miconazoleno . sub . 3 ( 0 . 05 %) + 2 , 3dimethyl - 2 - hexanol ( 0 . 75 %) ( 23 ) 1cyclohexylethanol ( 0 . 75 %) ( 24 ) miconazoleno . sub . 3 ( 0 . 05 %) + 1cyclohexylethanol ( 0 . 75 %) ( 25 ) rifampicin ( 0 . 0125 %) ( 26 ) 2cyclohexylethanol ( 0 . 6 %) ( 27 ) rifampicin ( 0 . 0125 %) + 2cyclohexylethanol ( 0 . 6 %) ( 28 ) agsulfadiazine ( 0 . 050 %) ( 29 ) 2cyclohexylethanol ( 0 . 5 %) ( 30 ) agsulfadiazine ( 0 . 050 %) + 2cyclohexylethanol ( 0 . 5 ) * bacteriostatic activity can be observed up to 0 . 00125 % thus , it can be seen that when the antimicrobial compositions of this invention are employed , the killing efficacy of the antimicrobial agent in the presence of blood is greatly enhanced . in a similar manner , additional antimicrobial compositions of this invention have been tested and a summary of the test results appears in table ii . table ii__________________________________________________________________________bactericidal ( killing ) efficacy number of cells survived contact times : organism solution 1 minute 10 minutes 30 minutes__________________________________________________________________________c . albicans tetracycline ( 0 . 05 %) 4 . 3 × 10 . sup . 7 3 . 9 × 10 . sup . 7 3 . 6 × 10 . sup . 7 a * + 1 -( p - chlorophenyl )- 2 - methyl - 2 - propanol 1 . 8 × 10 . sup . 6 1950 0 ( 0 . 5 %) c . albicans tetracycline ( 0 . 05 %) 4 . 3 × 10 . sup . 7 3 . 9 × 10 . sup . 7 3 . 6 × 10 . sup . 7 a + 1 - cyclohexyl - 1 - ethanol ( 0 . 50 %) 1 . 3 × 10 . sup . 7 2 . 9 × 10 . sup . 4 110c . albicans neomycin so . sub . 4 ( 0 . 05 %) 6 . 4 × 10 . sup . 7 4 . 2 × 10 . sup . 7 2 . 6 × 10 . sup . 7 a + 1 - cyclohexyl - 1 - ethanol ( 0 . 75 %) 8 . 8 × 10 . sup . 5 1 . 9 × 10 . sup . 3 100c . albicans erythromycin ( 0 . 025 %) 7 . 2 × 10 . sup . 8 7 . 1 × 10 . sup . 8 9 . 2 × 10 . sup . 7 a + 2 , 3 - dimethyl - 2 - hexanol ( 0 . 75 %) 1 . 5 × 10 . sup . 6 1 . 3 × 10 . sup . 4 0s . aureus erythromycin ( 0 . 025 %) 4 . 9 × 10 . sup . 7 4 . 6 × 10 . sup . 7 4 . 3 × 10 . sup . 7 a + 2 , 3 - dimethyl - 2 - hexanol ( 0 . 75 %) 1 . 2 × 10 . sup . 6 2 . 0 × 10 . sup . 4 500s . aureus tetracycline ( 0 . 05 %) 4 . 2 × 10 . sup . 8 4 . 1 × 10 . sup . 8 3 . 8 × 10 . sup . 7 a + 1 -( p - chlorophenyl )- 2 - methyl - 2 - propanol 1 . 7 × 10 . sup . 7 1 . 0 × 10 . sup . 4 100 ( 0 . 5 %) s . aureus tetracycline ( 0 . 05 %) 4 . 2 × 10 . sup . 8 4 . 1 × 10 . sup . 8 3 . 8 × 10 . sup . 7 a + 2 - cyclohexyl - 1 - propanol ( 0 . 40 %) 2 . 1 × 10 . sup . 7 2 . 0 × 10 . sup . 5s . aureus 1000 benzalkonium chloride ( 0 . 05 %) 9 . 0 × 10 . sup . 5 1 . 0 × 10 . sup . 5 2 . 9 × 10 . sup . 3 a + 1 - cyclohexylethanol ( 0 . 40 %) 1 . 0 × 10 . sup . 3 10 0s . aureus benzalkonium chloride ( 0 . 05 %) 9 . 0 × 10 . sup . 5 1 . 0 × 10 . sup . 5 2 . 9 × 10 . sup . 3 a + 1 - cyclohexyl - 1 - propanol ( 0 . 60 %) 6 . 0 × 10 . sup . 3 700 0s . aureus 3 , 4 , 4 &# 39 ;- chlorocarbanilide ( 0 . 05 %) 6 . 1 × 10 . sup . 7 5 . 2 × 10 . sup . 7 3 . 0 × 10 . sup . 7 a + 2 - cyclohexyl - 1 - propanol ( 0 . 40 %) 4 . 2 × 10 . sup . 7 1 . 0 × 10 . sup . 5 3200s . aureus temasept iv ( 0 . 05 %) 4 . 2 × 10 . sup . 8 4 . 0 × 10 . sup . 8 1 . 2 × 10 . sup . 8 a + 2 - cyclohexyl ethanol ( 0 . 4 %) 3 . 9 × 10 . sup . 7 1 . 0 × 10 . sup . 4 20s . aureus 5 - iodo - 2 - deoxyuridine ( 0 . 2 %) 30 × 10 . sup . 7 30 × 10 . sup . 7 30 × 10 . sup . 7s . aureus a + 2 - cyclohexylethanol ( 0 . 6 %) 10 × 10 . sup . 3 10 × 10 . sup . 2 100s . aureus cycloserine ( 0 . 0125 %) 60 × 10 . sup . 7 60 × 10 . sup . 7 60 × 10 . sup . 7s . aureus a + 2 - cyclohexylethanol ( 0 . 6 %) 74 × 10 . sup . 5 12 × 10 . sup . 3 500c . acnes erhthromycin ( 0 . 0125 %)* 22 × 10 . sup . 5 21 × 10 . sup . 5 18 × 10 . sup . 5c . acnes a + 2 - cyclohexylethanol ( 0 . 3 %) 70 × 10 . sup . 3 0 0c . acnes dequalinium chloride ( 0 . 00125 %) 26 × 10 . sup . 5 14 × 10 . sup . 2 30c . acnes a + 2 - cyclohexylethanol ( 0 . 3 %) 81 × 10 . sup . 3 0 0c . acnes rifampicin ( 0 . 0125 %)* 17 × 10 . sup . 6 17 × 10 . sup . 6 13 × 10 . sup . 6c . acnes a + 2 - cyclohexylethanol ( 0 . 6 %)* 80 × 10 . sup . 3 0 0c . acnes hibitane ( 0 . 0125 %) 45 × 10 . sup . 6 51 × 10 . sup . 5 0c . acnes a + 2 - cyclohexylethanol ( 0 . 3 %) 0 0 0c . acnes griseofulvin ( 0 . 0125 %) 94 × 10 . sup . 5 99 × 10 . sup . 5 92 × 10 . sup . 5c . acnes a + 2 - cyclohexylethanol ( 0 . 3 %) 50 × 10 . sup . 4 11 × 10 . sup . 3 90__________________________________________________________________________ * a represents the immediately preceding antimicrobial in the indicated concentration e . g ., tetracycline ( 0 . 05 %); neomycin so . sub . 4 ( 0 . 05 %) etc . 3 , 4 &# 39 ;, 5tribromosalicylanilide * bacteriostatic activity can be observed up to 0 . 00125 % ______________________________________anti - plaque mouthrinse composition______________________________________ethanol 20 % glycerine usp 10 % flavor 0 . 2 % domiphen bromide from 0 . 05 to 0 . 10 % 2 - cyclohexylethanol from 0 . 1 to 3 . 0 % amaranth solution 0 . 04 % distilled water q . s . to 100 % ______________________________________ to use this mouthwash solution , the mouth is rinsed with 15 to 20 ml for 30 to 60 seconds twice daily . in vitro models show a reduction of 85 to 95 % in dental plaque formation as compared to controls under identical experimental conditions . ______________________________________surgical scrub______________________________________potentiator , 1 -( p - chlorophenol )- 2 - methyl - 2propanol 3 . 0 to 6 . 0 % antimicrobial , irgasan dp 300 ( 2 , 4 , 4 &# 39 ;- trichloro - 2 &# 39 ;- hydroxy - diphenyl - ether ) 0 . 05 to 0 . 25 % surfactant , emcol e607 2 . 0 % glycerine usp 5 . 0 % p . e . g . 6000 distearate 1 . 5 % distilled water q . s . to 100 % ______________________________________ to use this surgical scrub , the hands are rubbed together with 10 to 15 ml of the above solution for one to three minutes in the same manner as currently used surgical scrub solutions . ______________________________________hard surface disinfectant______________________________________potentiator , 2 , 3 - dimethyl - 2 - hexanol 3 . 0 to 10 % antimicrobial , dequalinium cl 0 . 05 to 3 . 0 % iso - propanol 40 . 0 % propylene glycol 5 . 0 % distilled water q . s . to 100 . 00 % ______________________________________ in using this disinfectant , the solution is spread onto the surface with a soft cloth , or by spraying in the form of an aerosol spray , resulting in sterilization of the surface within one to five minutes . ______________________________________wound irrigating solution______________________________________antimicrobial , domiphen bromide 0 . 125 % potentiator , 1 - cyclohexyl - 1 - propanol 3 . 0 % ethanol or isopropanol 40 . 0 % distilled water 56 . 87 % ______________________________________ in tests and operative techniques carried out according to the procedure set forth in f . goldschmidt , reproducible topical staphylococcal infection in rats , applied microbiology , 23 , no . 1 , p . 130 ( 1972 ), established infections with abscess formation were demonstrated in 91 . 4 % of the infected control animals with recoverable staphylococcus aureus in amounts of 10 5 cells or more per gram of excised body wall . in the experimental group composition of this example , infection was prevented , abscess did not develop , and staphylococcus aureus could be recovered only from 28 . 6 % of the animals in amounts of 10 5 or more cells per gram of excised body wall . using 3 . 0 % 1 - cyclohexyl - 1 - propanol alone , abscess formation occurred in 100 % of the animals , with recoverable staphylococcus aureus in amounts of 10 6 cells or more per gram of excised body wall . with domiphen bromide alone , abscess formation occurred in , and staphylococcus aureus could be recovered from , 82 . 3 % of the animals in amounts of 10 5 or more cells per gram of excised body wall . in summary , approximately five out of seven animals responded to the combination therapy , whereas neither agent alone was sufficient to prevent the infection . to illustrate the enhanced penetration of the topical compositions of the invention , the following formulation was employed to prepare compositions which were then tested in a standardized skin blanching test wherein the degree of blanching corresponds to the degree of penetration . the results are shown in table iii . ______________________________________formulation______________________________________ethanol 50 . 00 % w / wpropylene glycol 10 . 00cetyl alcohol 0 . 50dl - epinephrine 0 . 10dithiothreitol 0 . 001water 29 . 40penetrant potentiator 10 . 00 100 . 00______________________________________ note -- in formula ( 1 ) of table iii below the above formulation was varied by substituting ethanol for the penetrant potentiator , so that formula ( 1 ) contained a total of 60 % w / w ethanol . table iii__________________________________________________________________________penetration of epinephrine through the intact human skin time elapsed after applicationcombinations 10 min 20 min 30 min 40 min 50 min 60 min__________________________________________________________________________epinephrine ( e ) 0 . 05 % 0 0 - 1 0 0 0 0e + pentanol 0 0 0e + hexanol 0 1 - 2 0 - 1e ± heptanol 0 - 1 0 - 1 0e + 2 - heptanol 0 1 0e + 2 , 3 - dimethyl - 2 - hexanol 0 0 - 1 0 - 1e + dimethyl sulfoxide 0 0 0e + 1 - cyclohexylethanol 1 1 - 2 1 - 2 --* 1 - 2e + 1 , 1 - dimethylcyclohexyl methanol 0 - 1 0 - 1 1 - 2 -- 1 - 3e + ( 4 - isopropylcyclohexyl )- dimethyl carbinol 0 - 1 1 2 - 3 -- 3 3e + 1 - cyclohexyl - 1 - propanol 0 - 1 2 2 - 3 -- 3 3e + 2 - cyclohexylethanol 1 1 1 -- -- 1 - 3e + 1 - cyclohexyl - 1 - butanol 0 - 1 0 - 1 0 -- -- 1 - 2e + 2 - cyclohexyl - 2 - methyl propanol 1 - 2 2 - 3 -- 3e + 2 - cyclohexyl - 1 , 1 - dimethyl ethanol 0 1 - 2 -- 2 - 3e + 1 - phenyl - 2 - methyl - 2 - propanol 0 1 1 - 2 1 - 3e + benzyl - t - butanol 1 - 2 3 3 1 - 3__________________________________________________________________________ scoring grade : 0 no visible blanching 1 slight visible blanching 2 medium blanching 3 very strong blanching * a means not tested at this time interval . also some compositions were only tested for 30 , 40 or 50 minutes . ( all the alcohol potentiators were used in 10 % concentration ) ______________________________________topical anesthetic solution formulation______________________________________ethanol 10 - 80 . 0 % w / wpenetrant accelerator 1 - 12 . 0 % anesthetic agent 1 - 10 . 0 % water q . s . to 100 . 0 % ph 8 . 0______________________________________ ______________________________________topical anesthetic gel formulation______________________________________ethanol 50 . 0 % w / wpenetrant accelerator 12 . 0 % anesthetic agent 4 . 0 % water 31 . 0 % klucel hf 3 . 0 % ______________________________________ ______________________________________topical anesthetic gel formulation______________________________________ethanol 21 . 0 % w / wpenetrant accelerator 12 . 0 % anesthetic agent 4 . 0 % dibutylphthalate 35 . 0 % isopropylmyristate 23 . 0 % cabosil 5 . 0 % ______________________________________ ______________________________________topical anesthetic solution formulation______________________________________ethanol 50 . 0 % w / wpropylene glycol 10 . 0 % anesthetic agent 4 . 0 % penetrant accelerator 12 . 0 % water 24 . 0 % ______________________________________ ______________________________________topical anesthetic solution formulation______________________________________ethanol 50 . 0 % propylene glycol 10 . 0 % cetyl alcohol 0 . 5 % anesthetic agent 4 . 0 % penetrant accelerator 10 . 0 % water 25 . 5 % ______________________________________ when the formulations of examples 7 - 11 , prepared using lidocaine hcl as the anesthetic agent and 2 - cyclohexyl - 1 , 1 - dimethyl ethanol as the penetrant accelerator , were applied topically to intact human skin with a &# 34 ; band - aid &# 34 ;® brand adhesive bandage , surface to deep anesthesia was obtained within 15 to 60 minutes . the onset time of anesthesia was rapid ( 15 to 30 minutes ) and anesthesia lasted for several hours ( 3 to 6 hours ). the results of similar studies are summarized in tables iv and v . similar animal studies with guinea pigs , the preparation being applied onto the intact skin , showed that the combination of the anesthetic with the penetrant accelerator elicits quick and deep anesthesia at the treated site (& lt ; 5 min . ), the anesthesia lasting up to several hours . these results are summarized in table vi . &# 34 ; in vitro &# 34 ; percutaneous absorption studies with intact guinea pig skin showed that the combination of lidocaine with a penetrant accelerator results in 20 to 30 fold more lidocaine penetration through the intact skin than without the accelerator . table iv______________________________________anesthetic response time in minutesformula 30 - 35 60 - 70 110 - 120 250 - 300______________________________________a * 0 / 4 0 / 4 0 / 4 0 / 4 ( 0 %) ( 0 %) ( 0 %) ( 0 %) b ** 9 / 13 13 / 14 13 / 13 6 / 10 ( 69 . 2 %) ( 92 . 8 %) ( 100 %) ( 60 %) ______________________________________ a * = 5 % lidocaine hcl in 50 % aqueous ethanol b ** = 4 % lidocaine in 50 % aqueous ethanol with 10 % propylene glycol plus 12 % 2cyclohexyl - 1 , 1 - dimethyl ethanol . table v______________________________________anesthetic responsedegree of time in minutesformula anesthesia 30 - 35 60 - 70 110 - 120 250 - 300______________________________________c * 0 4 / 13 1 / 14 0 / 13 4 / 16 ( 30 . 8 %) ( 72 %) ( 0 %) ( 40 %) 1 9 / 13 3 / 14 4 / 13 5 / 10 ( 69 . 2 %) ( 21 . 4 %) ( 30 . 8 %) ( 50 %) 2 3 / 14 3 / 13 1 / 10 ( 21 . 4 %) ( 23 . 1 %) ( 10 %) 3 7 / 14 6 / 13 ( 50 %) ( 46 . 1 %) ______________________________________ degree of anesthesia : 0 no anesthesia 1 slight anesthesia 2 moderate anesthesia 3 profound anesthesia c * = 4 % lidocaine in 50 % aqueous ethanol with 10 % propylene glycol plus 12 % α , dimethyl - 2 - cyclohexylethanol - table vi______________________________________local anesthesia following two applications to intact skin - tested following 2nd application only no . affected onset durationformula no . tested ( min .) ( min . ) ______________________________________d 0 / 6 -- -- e 6 / 6 & lt ; 5 15 - 30f 0 / 6 -- -- g 6 / 6 & lt ; 5 & gt ; 120______________________________________ formula d = 45 % ethanol formula e = 12 % 2cyclohexylethanol in 45 % ethanol formula f = 4 % lidocaine in water , ph 4 . 0 formula g = 4 % lidocaine plus 12 % 2cyclohexylethanol in 45 % ethanol , ph 8 . 0 thus , it can be seen that when the anesthetic compositions of this invention are employed , the anesthetic activity of the conventional anesthetic agents is greatly enhanced even through the intact skin . as will be apparent to those skilled in the art , many changes and modifications may be made which do not depart from the scope or spirit of the invention .	0
the structure and method of fabrication of the present invention is applicable to a dual primary winding and a dual secondary winding transformer . both primary windings may be connected either in series or in parallel utilizing a primary selective switch . the circuit comprising the primary windings is connected to a source of alternating current acting as power mains for the apparatus . another switch , independently operable from the primary control switch , places the secondary windings in either a series or a parallel circuit , utilized to provide voltage to a full wave bridge solid state rectifier circuit . a pair of adjacent legs of the rectifier circuit employs s . c . r .&# 39 ; s , back to back . the gates of the s . c . r .&# 39 ; s are symetrically coupled to the secondary of a pulse transformer . the conduction angle of the s . c . r .&# 39 ; s is controlled by the appearance of a pulse of voltage at the secondary of the pulse transformer . the output terminals of the rectifier circuit feed a filter circuit utilizing an inductance input filter , followed by a pi filter having series inductive elements and shunt capacitive elements in series and in parallel with the output terminals of the present invention . a potentiometer , forming a voltage dividing network circuit , is disposed across the output terminals of the invention . a pair of resistors , disposed in a series circuit , is connected in parallel with an inductive element in series with the output terminals of the present invention , and an output terminal of the bridge rectifier . the wiper arm contact of the potentiometer and the juncture of the pair of resistors are connected to the input terminals of an operational amplifier . the output terminals of the operational amplifier are coupled to a uni - junction transistor disposed in a relaxation oscillator circuit . the primary of the pulse transformer is disposed installed in series with the output terminals of the uni - junction transistor . thus , voltage and current variations experienced at the output terminals of the apparatus are fed back to the operational amplifier controlling the rate at which voltage pulses appear at the gates of the s . c . r .&# 39 ; s , thereby effectively regulating the direct current output of the present invention over a wide range of load induced variations . now referring to the figure showing plug 10 adapted to be electrically coupled to a source of alternating voltage whose magnitude is compensated for by the operation of switch 12 and switch 14 . switch 12 controls primary windings 16 and 18 of transformer 20 , disposing them in a series or parallel circuit . secondary windings 22 and 24 may also be disposed in either a series or a parallel circuit by the selective positioning of switch 14 . lamp 26 and transformer 20 are energized when main on - off switch 28 is closed . a bridge rectifier , comprising diodes 30 and 32 , and s . c . r .&# 39 ; s 34 and 36 are provided with alternating voltage by way of wires 38 and 40 at input terminals 42 and 44 . resistors 46 and capacitors 48 serve to suppress spurious spikes of voltage appearing in the bridge rectifier circuit , due to transients generated by s . c . r .&# 39 ; s 34 and 36 . output terminals 50 and 52 are connected to fixed load resistor 54 and a high frequency attenuating network including resistor 56 and capacitor 58 . series inductors 60 and 62 , in conjunction with shunt capacitors 64 and 66 , filter out ripple components appearing at terminals 50 and 52 from output terminals 68 and 70 . fixed value resistor 72 and potentiometer 74 are shown connected in a series voltage dividing circuit across output terminals 68 and 70 . series inductance 76 , disposed between input terminal 50 and output terminal 70 , is shown having a pair of resistors 78 and 80 , coupled in a series circuit , in parallel with series inductance 76 . both wiper arm 82 , of potentiometer 74 , and wire 84 , coupled to the juncture of resistors 78 and 80 , are connected to the input terminal 86 of operational amplifier 88 , utilizing series coupling resistors 90 and 92 therefor . transformer 94 provides an alternating voltage of suitable magnitude to a conventional bridge rectifier denoted by block 96 , whose output terminals 98 provide operating power for operational amplifier 88 , controlled in magnitude by zener diode 100 . should diode 100 be eliminated from the circuit , the signal available at the output terminal 102 of operational amplifier 88 , would vary in magnitude . this variation of output signal would make the present invention controllable by voltage variations experienced at the primary winding of transformer 94 . alternatively , selecting the voltage level available at terminals 98 , would provide another means of control of the output voltage obtained at the output terminals 68 and 70 . the method of obtaining such output voltage variations utilizes uni - junction transistor 104 , disposed in a relaxation oscillator circuit employing charging capacitor 106 and charging resistor 108 and current limiting resistor 110 and load resistor 112 installed in the output terminal 114 of the transistor . gate 116 is shown connected to diode 118 and current limiting resistor 120 to output terminal 102 . capacitors 122 and 124 , and resistors 126 and 128 comprise a feedback path across input terminal 86 and output terminal 102 so as to improve the stability of amplifier 88 . voltage variations , experienced at input terminal 86 due to output voltage and output current variations of the present invention , are amplified and translated into current pulses , occurring in primary winding 130 of pulse transformer , disposed in parallel with load resistor 112 . gates 132 , of s . c . r .&# 39 ; s 34 and 36 , are symetrically and simultaneously caused to gate the s . c . r .&# 39 ; s when secondary winding 134 is energized by a voltage pulse due to the discharge current emanating from capacitor 106 through primary winding 130 . resistors 136 limit the gate current , due to excessive voltage present at secondary winding 134 , thereby protecting s . c . r .&# 39 ; s 34 and 36 from damage . diodes 138 provide a clean uni - directional pulse at gates 132 , overcoming the tendency of ringing of secondary winding 134 . one of the advantages of the present invention provide a regulated power supply capable of operating from a . c . mains over a wide range of voltage . another advantage of the present invention is a regulator circuit utilizing a minimum of component parts . still another advantage of the present invention is a regulator with a full wave bridge rectifier circuit , thereby minimizing the ripple level . yet another advantage of the present invention is a voltage regulator whose output voltage may be varied in accordance with a manual adjustment of a potentiometer . a further advantage of the present invention is a voltage regulator which automatically detects current or voltage variations occurring at the output terminals due to load variations which automatically adjusts therefor . a still further advantage of the present invention is a power supply which can produce a wide range of output currents and voltages utilizing a unitary regulator circuit for all ranges of use . thus there is disclosed in the above description and in the drawings , an embodiment of the invention which fully and effectively accomplishes the objects thereof . however , it will become apparent to those skilled in the art , how to make variations and modifications to the instant invention . therefore , this invention is to be limited , not by the specific disclosure herein , but only by the appending claims . the embodiment of the invention in which an exclusive privilege or property is claimed are defined as follows :	7
materials could be placed into the defective region or regions of the annulus fibrosus ( af ) to promote healing across the entire thickness of the defective region of the af . for example , a clot of blood marrow aspirated from the vertebrae or other bone in the skeleton could be injected into and over the defective region of the af . the marrow aspirate could also be injected into and over the in - growth mesh patch or sheet . the cells of the marrow aspirate could be concentrated using such systems as the “ harvest select ” system by depuy spine . alternative materials , such as fibrin glue (“ tisseal ”, baxter ), or other bio - glue could be inserted into and / or over the defective region of the af . portions of the vertebrae near the defective region of the af , could be perforated , for example with a 1 - 2 mm diameter drill bit or bur , to improve the blood supply to the relatively avascular af . the holes are preferably drilled through the vertebral endplates ( veps ) near the defective region of the af . the invention may seal the defective region of the af to promote healing on one side of the device and to prevent anti - adhesion materials from entering the defective region of the af . additionally , anti - adhesion materials such coseal ( baxter ) could be injected over the device . fig1 is a lateral view of suture anchor 100 . suture anchor 100 comprises suture 101 with a flattened end 102 and screw ( or anchor ) 103 . anchor 103 has a first portion capable of being inserted into or otherwise attached to a bone , such as a vertebrae . anchor 103 also has a second portion with an opening 104 adapted to receive a suture therethrough . in one embodiment , anchor 103 is a screw having a hole through the head of screw . suture 101 is threaded through hole 104 . suture 101 is preferably made of polyester or other weldable material and has a break - strength of greater than about 22 lbs . screw or anchor 103 is preferably about 3 mm in diameter , alternatively about 4 mm in diameter , and between about 5 mm and about 10 mm in length . however , alternative sized sutures or screws may be used with this invention . anchors 103 are preferably made of a mri compatible and radio - opaque material such as titanium . plastic or bioresorbable anchors may also used with this invention . anchors 103 are preferably self - drilling and self - tapping . fig2 a is a posterior view of a surgical incision and a mesh device 111 , attached thereto . mesh device 111 has four suture anchors 100 a - d coupled to mesh patch ( or mesh sheet ) 110 . screws 103 ( or anchors ) are located underneath / behind the surgical incision 108 . the size of mesh patch 110 will depend on the defect being treated . in one embodiment , the size may be between about 5 and about 45 mm in width , and between about 5 and about 25 mm in height . the shape of mesh patch 110 will also depend on the defect being treated . the mesh patches could be supplied to surgeons in various sizes and shapes . alternatively , surgeons could cut the mesh patch and anti - adhesion cover at the time of surgery . mesh patch 110 may be a symmetrical or an asymmetrical shape . shapes of mesh patch 110 may include , but not be limited to , a rectangle , a square , a polygon , a circle , an ellipse , an oval , a planar disc , and a triangle . flattened ends 102 a - b of sutures 101 a - d have been attached to the corners of mesh patch 110 . in one embodiment , flattened ends 102 a - b may be attached by welding . mesh patch 110 is preferably made of polyester or other material with pores of approximately 1 mm in diameter , alternatively approximately 1 . 5 mm in diameter , alternatively approximately 2 . 0 mm in diameter , or any other pore size that will facilitate tissue in - growth . mesh patch 110 is preferably less than 1 mm thick and has a burst strength of greater than 738 kpa and a break - strength of greater than 400 n . additionally , mesh patch 110 is preferably inelastic . for example , mesh patch 110 could have a break elongation % ( astm d - 5034 ) of at least 112 md and 109 cmd . mesh patch 110 may also include reinforced areas ( not shown ). mesh patch 110 preferably overlaps the intact af and / or the vertebrae by at least 2 mm , alternatively by at least 2 . 5 mm , alternatively by at least 3 . 0 mm , alternatively by at least 3 . 5 mm , alternatively by at least 4 . 0 mm , alternatively by at least 4 . 5 mm , alternatively by at least 5 . 0 mm , alternatively by at least 5 . 5 mm , alternatively by at least 6 . 0 mm , in one or more directions around the defect or surgical incision . in use , sutures 101 a - d are preferably welded or otherwise attached to mesh patch 110 after threading the anchors 103 into the vertebrae . sutures 101 a - d may be welded or otherwise attached to mesh patch 110 outside surgical wound 108 . the break - strength of the weld ( or attachment ) between the flattened end 102 a - d of sutures 101 a - d and mesh patch 110 preferably exceeds 22 lbs . free ends 105 a - d of sutures 101 a - d may then be pulled in order to bring mesh patch 110 flush against the defect . alternatively , flat ends 102 a - d of sutures 101 a - d may be attached to mesh patch 110 prior to inserting anchors 103 , or other fastening members , to the spine . anchors 103 may be forced into the vertebrae rather than threaded into the vertebrae in the alternative embodiment of the invention . the anchors may include deployable components that lock the anchors into the vertebrae . the anchors or fixation members do not pass through the mesh in either embodiment of the device . sutures 101 a - d may be attached to mesh patch 110 in numerous ways . as discussed previously , flattened ends 102 a - d may be welded to the corners of mesh patch 110 using a welding tool . the materials could be welded with a tool from axya medical ( beverly , mass .). the welding tool could weld one suture at a time to the mesh patch . the mesh could be treated to increase the strength of the weld to the sutures . for example , the mesh could be abraided , treated with acid , or an adhesive material to strengthen the weld . alternatively , more than one suture could be welded to the mesh patch simultaneously . the ends of the sutures could also be fastened to the mesh in other manners . for example , the ends of the sutures could be passed through holes in the mesh and welded to the sutures to create loops at the ends of the sutures ( not shown ). fig2 b is a posterior view of a surgical incision and an alternative embodiment of a mesh device comprising the embodiment of the invention drawn in fig2 a , a suture holding instrument , and an anti - adhesion cover . anti - adhesion cover 115 is made of a material that discourages tissue in - growth or adhesions . for example , anti - adhesion cover 115 may be made of eptfe , sepratfilm , allograft , or absorbable materials . these absorbable materials include oxidized atelocollagen type i , polyethylene glycol , glycerol , or combinations thereof . anti - adhesion cover 115 will have interstitial pore sizes of 3 microns or less to discourage tissue in - growth . anti - adhesion cover 115 will have a larger size than mesh patch 110 . anti - adhesion cover 115 may have a symmetrical or asymmetrical shape . shapes of anti - adhesion cover 115 may include , but not be limited to , a rectangle , a square , a polygon , a circle , an ellipse , an oval , a planar disc , and a triangle . this will enable complete coverage of welded sutures 101 a - d and anchors 103 a - d once it is deployed , thereby discouraging tissue in - growth and adhesions from outside the wound site . anti - adhesion cover 115 is loosely connected to mesh patch 110 by a loop ( not shown ) of suture 117 . this loose connection through suture 117 allows anti - adhesion cover 115 to be moved away from mesh patch 110 while sutures 101 a - d are welded or otherwise fastened to mesh patch 110 . in one embodiment , suture 117 may be passed through reinforced sections of mesh patch 110 . after sutures 101 a - d have been attached to mesh patch 110 , anti - adhesion cover 115 may be brought into contact with mesh patch 110 by sliding anti - adhesion patch 115 along suture 117 towards mesh patch 110 . mesh patch 110 may be brought into contact with the wound by pulling free ends 105 a - d of sutures 101 a - d either before or after anti - adhesion device is brought into contact with mesh patch 110 . free ends 105 a - d of sutures 101 a - d may be held away from the wound site until needed using suture holding instrument 118 , which is preferably made of an elastomeric material . free ends 105 a - b of the top two sutures are held in openings 119 a - b in the corners of suture holding instrument 118 . free ends 105 c - d of the bottom two sutures have not yet been placed into holes 119 c - d in the bottom of suture holding instrument 118 . suture holding instrument 118 is designed to allow more movement of sutures 101 a - d within holes 119 a - d of the device than within slits 120 a - d leading to holes 119 a - d of the device . holes 119 a - d of the device may accommodate both ends of each suture . surgeons may use the tool to organize the ends of the sutures during surgical procedures . fig3 a is lateral view of mesh patch 110 and two suture anchors 101 . flattened ends 102 of the sutures have been welded or otherwise attached to the corners of mesh patch 110 . flattening the ends of the sutures increases the weldable surface area and reduces the profile of the assembled device . fig3 b is a lateral view of the embodiment of the invention drawn in fig3 a . mesh patch 110 is advanced towards anchors 103 by pulling on free ends 105 of the sutures . the eyelets 104 in anchors 103 are designed to minimize injury to the suture as sutures 101 are advanced through eyelets 104 . multifilament sutures are also used to further reduce the risk of damaging the sutures as the sutures are advanced through the eyelets . fig4 is posterior view of the surgical incision drawn in fig2 a . mesh patch 110 has been advanced into the wound by pulling on free ends 105 a - d of sutures 101 a - d . fig5 a is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig2 a . the spine has been bisected through the pedicles of the vertebrae . two anchors 103 a - b have been inserted into the vertebra 122 cranial ( towards the head ) to the disc 120 and two anchors 103 c - d have been inserted into the vertebra 124 caudal ( towards the feet ) to the disc 120 . the free ends 105 a - b of the sutures that pass through the anchors 103 a - b in the cranial 122 vertebra were welded to each other and the free ends 105 c - d of the sutures that pass through the anchors 103 c - d in the caudal vertebra 124 were welded to each other . tension is applied to the ends of the sutures before welding or otherwise connecting the ends of the sutures . mesh patch 110 is smaller than the area between the four anchors 103 a - d . the mesh patch could be smaller than the distance between the anchors by a ratio of 4 : 5 . for example , if the distance between the anchors in the same vertebra is about 10 mm and the distance between anchors in the adjacent vertebra is about 15 mm , a rectangular mesh patch would preferably be about 8 mm × 12 mm . alternatively , the ratio may be about 4 . 5 : 5 , alternatively about 3 . 5 : 5 , alternatively about 3 . 0 : 5 , alternatively about 2 . 5 : 5 . the size of the mesh patch could be determined by the pair of suture anchors that are closest together in the vertical and the horizontal directions . the configuration enables the welded sutures 101 a - d to apply tension to the four corners of mesh patch 110 . fig5 b is a lateral view of the spine and the embodiment of the invention drawn in fig5 a . fig6 a is an oblique view of a portion of the alternative mesh device described in fig2 b . suture 117 , such as a 2 - 0 nylon suture , loosely connects mesh patch 110 and anti - adhesion cover 115 . for example , the anti - adhesion cover could be a sheet of eptfe that is attached to the mesh patch 110 . anti - adhesion cover 115 has a thickness of preferably about 0 . 4 mm or less , alternatively about 0 . 3 mm or less . anti - adhesion cover 115 preferably has a pore size that inhibits tissue in - growth . the interstices of anti - adhesion cover 115 may be approximately 3 . 0 microns , alternatively approximately 3 . 5 microns , alternatively approximately 4 . 0 microns . suture 117 is preferably made of a monofilament suture in order to reduce the risk of adhesions . the device is preferably supplied to hospitals in the assembled configuration . fig6 b is a posterior view of the embodiment of the invention drawn in fig2 b and 6a . anti - adhesion cover 115 is held outside the wound as mesh patch 110 is fastened to the spine using sutures 101 a - d and anchors 103 a - d . fig6 c is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig6 b . the ends of suture 117 have been welded together . anti - adhesion cover 115 covers mesh patch ( not shown ) and the attached sutures 101 . the invention reduces the risk of adhesions to the nerves within the spinal canal . fig6 d is a view of the undersurface of mesh patch 110 and the anti - adhesion cover 115 connected through loop or stitch of suture 117 through the pores of mesh patch 110 . fig7 a is an oblique view of an alternative embodiment of the invention drawn in fig6 d . anti - adhesion cover 115 has been fastened to mesh patch 110 at or near an edge of mesh patch 110 . as seen in fig7 a , a stitch of suture 117 located near the edge of anti - adhesion cover 115 and mesh patch 110 can be used to connect them . alternatively , the components may be fastened together with other technologies such as adhesives . fig7 b is an oblique view of the undersurface of the embodiment of the invention drawn in fig7 a . the ends of suture 117 have been welded over or onto mesh patch 110 . fig7 c is a posterior view of the embodiment of the invention drawn in fig5 a and 7a . anti - adhesion cover 115 is connected or coupled to mesh device 110 along an edge . mesh patch 110 has been connected to anchors 103 a - d with welded sutures 101 a - d . the device is opened like a book to enable welding of mesh patch 110 to sutures 101 a - d . fig7 d is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig7 c . anti - adhesion cover 115 has been folded over mesh patch 110 ( not shown ), much like closing a book . fig7 e is a view of the undersurface of mesh patch 110 drawn in fig7 d . the drawing shows the free ends of suture 117 welded together . placing the suture weld under mesh patch 110 may reduce the risk of adhesions . fig8 a is a posterior view of an alternative embodiment of the invention drawn in fig6 b . in this embodiment , suture 117 is threaded through anti - adhesion cover 115 , such that stitch or loop of suture 117 is on anti - adhesion cover 115 . the ends of suture 117 extend from mesh patch 110 rather than anti - adhesion cover 115 . anti - adhesion cover 115 and mesh patch 110 may have a marking 128 , such as a circle , to determine the orientation of the components . fig8 b is a posterior view of a surgical incision and the embodiment of the invention drawn in fig8 a . ends 102 a - d of sutures 101 a - d have been welded or otherwise fastened to mesh patch 110 . anchors 103 a - d ( not shown ) have also been attached to the surrounding vertebra . fig8 c is a posterior view of a surgical incision and the embodiment of the invention drawn in fig8 b . after welding the ends 102 a - d ( not shown ) of the sutures to mesh patch 110 ( not shown ), suture 117 ( not shown ) connecting mesh patch 110 ( not shown ) and anti - adhesion cover 115 has been tightened and welded or otherwise secured . anti - adhesion cover 115 and mesh patch 110 are fastened together before placing or tightening the assembled device onto the spine by pulling free ends 105 a - d of sutures 101 a - d through eyelets 104 a - d ( not shown ) of anchors 103 a - d ( not shown ). fig8 d is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig8 c . free ends 105 a - d of sutures 101 a - d can be seen extending beyond anti - adhesion cover 115 . fig8 e is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig8 d . the cranial half of anti - adhesion cover 115 has been folded in a caudal direction ( towards the feet ) to expose mesh patch 110 and the welded ends of sutures 101 a - b in the vertebra 122 cranial to disc 120 . the invention facilitates welding of sutures 101 a - b from the anchors 103 a - b in the vertebrae 122 cranial to disc 120 . tension is applied to free ends 105 a - b of the sutures before welding the sutures . fig8 f is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig8 e . anti - adhesion cover 115 has been folded in a cranial direction ( towards the head ). free ends 105 c - d of the sutures from anchors 103 c - d in the vertebra 124 caudal to disc 120 have been welded together . welding fixation sutures 101 c - d under tension applies tension to mesh patch 110 . the distance between anchors 103 c - d is greater than the length of mesh patch 110 in the vertical and horizontal directions . fig8 g is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig8 f . anti - adhesion patch 115 will have a larger size than mesh patch 110 . this will enable complete coverage of welded sutures 101 a - d and anchors 103 a - d once it is deployed , thereby discouraging tissue in - growth and adhesions from outside the wound site . as seen in fig8 g , anti - adhesion cover 115 has been unfolded to cover mesh patch 110 ( not shown ), fixation sutures 101 a - d ( not shown ), and anchors 103 a - d ( not shown ). fig9 a is a posterior view of an exploded alternative embodiment of the suture drawn in fig1 . the invention includes component 202 , such as a flattened mesh component , that is fastened to the end of suture 201 . component 202 could be welded or otherwise attached to the end of suture 201 . suture 201 has mark 206 that can be used to help surgeons determine the optimal place to weld suture 201 onto mesh patch 110 . fig9 b is a posterior view of the embodiment of the invention drawn in fig9 a . component 202 has been attached to the end of suture 201 to increase the surface area of suture 201 . fig9 c is a posterior view of the embodiments of the invention drawn in fig8 a and 9b . enlarged ends 202 a - d of the sutures 201 a - d have been welded to mesh patch 110 . fig9 d is a lateral view of a portion of an alternative embodiment invention drawn in fig9 a . the end of suture 201 is covered with biocompatible polymer sleeve 207 . for example , sleeve 207 could be made of polyurethane , silicon , polyethylene , polyester , or other biocompatible material . the end of suture 201 distal to sleeve 207 could be enlarged in alternative embodiments of the invention ( not shown ). an enlarged end of the suture would increase the pullout resistance of the suture through polymer sleeve . fig9 e is a lateral view of the tip of instrument 210 used to melt the polymer sleeve 207 drawn in fig9 d . instrument 207 is used outside the surgical incision . jaws 211 of instrument 210 apply heat and pressure to the mesh patch and the tip of suture 201 drawn in fig9 d . fig9 f is a lateral view of a portion of mesh patch 110 and the tip of suture 201 with sleeve 207 drawn in fig9 d . fig9 g is cross section of the embodiment of mesh patch 110 and suture 201 drawn in fig9 f . polymer sleeve 207 has been melted by instrument 210 drawn in fig9 e . the melted polymer 208 flowed and set within the porous mesh , thus attaching suture 201 to mesh patch 110 . alternatively , a melted polymer could be injected between suture and the mesh . the alternative embodiment would be similar to injecting hot glue with a “ glue gun .” the polymer could have adhesive properties or simply form a mechanical lock with the pores of the mesh patch . fig9 h is view of the embodiments of mesh patch 110 and sutures 201 a - d drawn in fig9 g , on the disc surface . the melted polymer 208 can be seen within the pores of mesh patch 110 . the melted polymer could pass through adjacent pores and flow together , thus surrounding portions of mesh patch 110 . fig9 i is a lateral view of the ends of two sutures 201 and an alternative embodiment of the polymer sleeve drawn in fig9 d . sleeve 216 has two holes . sleeve 216 can be melted to connect the ends of two sutures 201 . fig1 is an oblique view of tip 221 of instrument 220 that may be used to create abrasions over the af , vertebrae , and the periosteum . tip 221 is covered with an abrasive material such as a wire mesh or a wire brush . fig1 is a posterior view of a coronal cross section of the spine , sutures 101 a - d from four anchors 103 a - d , and preferred area of abrasion 222 surrounding and including defective region 224 within the anulus fibrosus of disc 120 . fig1 a is a posterior view of a coronal cross section of the spine and an alternative embodiment of the invention drawn in fig5 a . ends 102 a - d of the sutures are welded or otherwise fastened to mesh patch 110 . free ends 105 a - d of the sutures can be seen extending through eyelets 104 a - d ( not shown ) in anchors 103 a - d . fig1 b is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig1 a . free ends 105 a - d of the sutures were welded to the free ends of the sutures anchored to the adjacent vertebra rather than to the sutures from the same vertebra . for example , where sutures 101 a and b are anchored to vertebrae 122 cranial to disc 120 and sutures 101 c and d are anchored to vertebrae 124 caudal to disc 120 , free ends 105 a and 105 d are welded together and free ends 105 b and 105 c are welded together . the sutures could be relatively elastic to allow spinal movement across the disc . alternatively , in - elastic sutures could be used to restrict spinal flexion and axial rotation across the disc . restricting spinal motion reduces the pressure on the defective region of the af . fig1 a is a posterior view of a coronal cross section of the spine and an alternative embodiment of the invention drawn in fig1 a . the suture assemblies of this invention comprise sutures 251 a - d having first ends 251 a - d and second or free ends 255 a - d . first ends 251 a - d are attached or connected to anchors 250 a - d . anchors 250 a - b are inserted into or otherwise attached to vertebrae 122 cranial to disc 120 . anchors 250 c - d are inserted into or otherwise attached to vertebrae 124 caudal to disc 120 . fig1 b is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig1 a . free ends 255 a - d of the sutures were welded to each other over mesh patch 110 . two of the sutures , for example , sutures 251 a and b or sutures 251 c and d , pass through mesh patch 110 . the sutures may pass through a reinforced portion ( not shown ) of mesh patch 110 . sutures 251 a - d are not welded to mesh patch 110 in this embodiment of the invention . fig1 a is a posterior view of an alternative embodiment of the invention . support structure 270 comprises body 272 and eyelets 274 a - b . the number of holes or eyelets 274 may vary depending on the number of sutures present . there may be 2 holes or eyelets , alternatively 3 holes or eyelets , alternatively 4 holes or eyelets , alternatively 5 holes or eyelets , alternatively 6 holes or eyelets . eyelets 274 are adapted to receive sutures 251 therethrough . support structure 270 is preferably stiffer than the porous mesh and is able to provide more structural support . support structure 270 serves to reinforce mesh patch 110 . support structure 270 could be made of absorbable materials such as hydrosorb ( macropore , san diego , calif .) or non - absorbable materials such as peek or polyethylene . fig1 b is a posterior view of a coronal cross section of the spine and the embodiments of the invention drawn in fig1 a and 13b . sutures 251 a - b pass through eyelets 274 a - b . free ends 255 a and d are welded together or otherwise attached . similarly , free ends 255 b and c are welded together or otherwise attached . fig1 a is an anterior view of an alternative embodiment of the mesh patch drawn in fig2 a . the corners 312 a - d of mesh patch 310 are reinforced and have holes or eyelets 314 a - d . fig1 b is a lateral view of suture anchor 300 , an alternative embodiment of the invention drawn in fig1 . suture anchor 300 comprises suture 301 with stiff component 302 and screw ( or anchor ) 103 . anchor 103 has a first portion capable of being inserted into or otherwise attached to a bone , such as a vertebra . anchor 103 also has a second portion with an opening 104 adapted to receive a suture therethrough . in one embodiment , anchor 103 is a screw having a hole through the head of screw . suture 301 is threaded through hole 104 . suture 301 is preferably made of polyester or other weldable material and has a break - strength of greater than about 22 lbs . screw or anchor 103 is preferably about 3 mm in diameter , alternatively about 4 mm in diameter , and between about 5 mm and about 10 mm in length . however , alternative sized sutures or screws may be used with this invention . anchors 103 are preferably made of a mri compatible and radio - opaque material such as titanium . plastic or bioresorbable anchors may also used with this invention . anchors 103 are preferably self - drilling and self - tapping . stiff component ( or enlarged or transverse component ) 302 is attached to one end of suture 301 . the ends of stiff component 302 are blunt to prevent penetration into or injury of the nerves or disc . stiff component 302 is attached at angle , preferably about ninety degrees , alternatively about 85 degrees , alternatively about 80 degrees , alternatively about 75 degrees , alternatively about 70 degrees , alternatively about 60 degrees , relative to a longitudinal axis of a region of suture 301 near or adjacent to stiff component 302 . holes or eyelets 314 are adapted to receive stiff component 302 therethrough . stiff component ( or transverse component 302 ) may be a t - anchor . fig1 c is a lateral view of the embodiments of the invention drawn in fig1 a and 15b . stiff or transverse component 302 is adjacent to eyelet 314 in mesh patch 310 . the flexibility of suture 301 allows the angle between the suture and stiff or transverse component 302 to vary between about 90 degrees and about 180 degrees . in other words , in a resting state and / or when deployed , stiff or transverse component 302 is substantially non - parallel , or approximately perpendicular , to a longitudinal axis of a region of the suture near or adjacent to the point of attachment of stiff or transverse component 302 and suture 301 . stiff or transverse component 302 can , however , be manipulated for delivery such that its longitudinal axis is substantially parallel to the longitudinal axis of a region of the suture near or adjacent to the point of attachment of stiff or transverse component 302 and suture 301 . changing the angle between suture 301 and stiff component 302 facilitates insertion of stiff component 302 through eyelet 314 in mesh patch 310 . stiff components 302 of four sutures are placed through mesh patch 310 outside the surgical incision in the preferred embodiment of the device . fig1 d is a posterior view of the embodiments of the invention drawn in fig1 c . stiff or transverse component 302 a has been placed through eyelet 314 a ( not shown ) in mesh patch 310 . stiff component 302 a prevents suture 301 a from pulling out of mesh patch 310 when tension is applied to the suture . fig1 e is a posterior view of a coronal cross section of the spine and the embodiment of the invention drawn in fig1 d . four sutures 301 a - d have been placed through corners 312 a - d of mesh patch 310 . as described in the text of fig1 b , the second ends 305 a - d of the sutures have been welded or otherwise fastened to each other under tension . anti - adhesion cover 115 can be seen connected to mesh patch 310 through suture 117 . in an alternative embodiment ( not shown ), anti - adhesion cover 115 could be laminated to mesh patch 310 . stiff components 302 from the suture anchors could be passed through eyelets in mesh patch 310 and anti - adhesion cover 115 . the second ends of sutures 301 a - d could be welded over the combined mesh patch / anti - adhesion cover . the alternative embodiment provides a tighter seal of the disc . the tight seal helps prevent the extrusion of the np and the escape of liquids , gels , or other therapeutic material that may be placed into the disc . alternative materials , such as dual mesh ( w . l . gore and associates , flagstaff , ariz . ), with anti - adhesion and tissue in - growth sides on a single patch component could be used the alternative embodiment of the invention . the second ends of the sutures 301 a - d may be welded in various configurations that help seal liquids or gels within the disc . mesh patches with smaller pores could be also be used to seal the disc . the mesh patch could have variable porosity . for example , the mesh patch could have large pores ( about 1000 microns ) around the periphery of the mesh patch and small pores ( less than about 999 microns to about 3 microns ) directly in the center of the mesh . the configuration encourages tissue in - growth over the portion of the device that overlies intact regions of the af and seals the disc over portion of the device that overlies an aperture or defective regions of the af . bio - glues , such as tisseal , may be placed between the patch and the af to help seal the disc . lastly , the anti - adhesion cover may be used without the mesh patch component in embodiments of the invention that are designed to seal the disc . fig1 a is an exploded lateral view of an alternative embodiment of the invention drawn in fig1 c . stiff component 302 is attached to one end of suture 301 after passing one end of suture 301 through eyelet 104 in reinforced mesh patch 310 . stiff component 302 may be welded to suture 301 . alternative methods may be used to fasten the components including but not limited to the use of adhesives , press - fit components , or the use of plastic components that snap together . the components are fastened together outside the surgical wound . fig1 b is a posterior view of the embodiment of the invention drawn in fig1 a . fig1 is a posterior view of an alternative embodiment of the invention drawn in fig1 b . four sutures 301 a - d with enlargements 322 a - d at the first ends of the sutures are passed through eyelets 314 a - d ( not shown ) in the corners of mesh patch 310 then passed through eyelets 104 a - d in anchors 103 a - d . anchors 103 a - d are placed into the vertebrae after assembling the components . enlarged ends 322 a - d of the sutures are rotated in the opposite directions that screws 103 a - d were rotated to remove the twists that occur in sutures 301 a - d during anchor insertion . sutures 301 a - d freely rotate with eyelets 314 a - d of mesh patch 310 . a tool , such as a wire twister , may be used to grasp and counter rotate the sutures . the second ends ( or free ends ) 305 a - d of the sutures are fastened to each other as previously described , after the sutures are counter - rotated . fig1 a is a lateral view of an alternative embodiment of the invention drawn in fig1 b . one end of suture 301 has deformable component 332 . one or more arms of deformable component 332 bend in one direction easier than they bend in a second direction . fig1 b is a lateral view of mesh patch 310 and the embodiment of the invention drawn in fig1 a . deformable end 332 of the suture was passed through opening 314 in mesh patch 310 . the shape of deformable component 332 allows the component to be passed through a hole in the mesh . fig1 c is a lateral view of the embodiment of the invention drawn in fig1 b . tension has been applied to free end 305 of suture 301 . deformable component 332 prevents suture 301 from pulling out of mesh patch 310 . deformable component 332 resists bending beyond about ninety degrees . shape memory materials , such as nitinol , or elastic materials , such as plastics or metals may be used in this embodiment of the invention . although the foregoing invention has , for the purposes of clarity and understanding , been described in some detail by way of illustration and example , it will be obvious that certain changes and modifications may be practiced which will still fall within the scope of the appended claims .	0
with reference now to the drawings , and in particular to fig1 thereof , the preferred embodiment of the new and improved aircraft anti - theft system embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . the present invention , the aircraft anti - theft system 10 is comprised of a plurality of components . such components in their broadest context include a biometric data input device , a fixed program processor , an electronic system interrupter , an air pressure sensor , a power source , and electronic coupling . such components are individually configured and correlated with respect to each other so as to attain the desired objective . first provided is a starter assembly 12 . the starter assembly is electronically coupled to an aircraft engine having both an enabled state and a disabled state . the starter assembly further includes a starter solenoid 14 . an identity / authorization reader 16 is next provided . the reader is adapted to collect definable human characteristics and authorization data from a potential user prior to starting an aircraft . the reader is also adapted to compare inputted data with stored user and authorization data . the definable human characteristic includes , but is not limited to , authorization data being stored on various means and is selected from the class of biometric data including fingerprints , finger images , retinal images , retinal scans , magnetic strip cards , passwords , chips and numerical sequences entered by a fingertip activated input board of the data input device . the storage mans includes , but is not limited to , magnetic strap cards , passwords , access codes and chips . next provided is an air pressure sensor 18 . the air pressure sensor is adapted to signal if the aircraft is in motion at a speed beyond a preset threshold . the air pressure sensor includes a pitot or air collecting tube or source 19 attached to the aircraft . the air pressure sensor also includes a relay switch 20 . a power source 22 is next provided . the power source is adapted to provide power to the system . the power source includes a power switch 24 . finally , a processing unit 26 is provided . the processing unit is comprised of a timer relay 28 , a double pole double throw switch , including a pair of separate switches 30 , 32 . the processing unit further has an inductor 34 . the processing unit also has a comparator relay 36 which includes a pair of relay switches 38 , 40 . the processing unit is electrically coupled to the starter assembly , identity / authorization reader and air pressure sensor and power source . the processor unit is adapted to put the starter assembly in the enabled state upon receipt of the authorized identity and authorization reader input . in this manner , once the identity is authorized , the identity / authorization reader returns the aircraft back to normal starting configuration , the aircraft is activated , the identity / authorization reader is inactivated . when the air pressure sensor is activated by the aircraft exceeding a threshold speed the starter assembly remains in the enabled state . in this manner , assurance is provided that while in - flight the aircraft can be restarted without having to activate the identity / authorization reader . only when the aircraft master switch has been de - energized will the processor unit require the activation of identity and authorization reader before the starter assembly will again be put into the enabled state . a perspective illustration of the preferred embodiment of the invention is shown in fig1 . fig2 is an excitation diagram correlating to the various components during the various stages of activation . region 1 shows when the power to the aircraft is off and none of the components are activated . region 2 shows an aircraft with the power enabled , but the starter assembly is in the disabled state . region 3 shows when a proper user input is given to the identity / authorization reader . the identity / authorization reader circuitry normally puts out an energized signal until input data is authorized at which time it puts out a de - energized signal which enables the starter assembly . during this time the starter assembly can start the engines which increases the speed of the aircraft . during region 4 , the aircraft reaches a threshold air speed and the air pressure sensor maintains the starter assembly in the enabled state . in region 5 the air speed has dropped below the threshold of the pressure sensor , the relay will remain energized until the main power supply has been interrupted . the relay will continue to hold both switches closed for normal aircraft operation . this acts as a safety precaution against in - flight stall situations . region 6 shows the power has been disconnected and values reset . a schematic diagram is provided in fig3 . the relay positions are shown when the system has power applied , the aircraft is not in flight , and the identity and authorization reader has not been properly activated . when the starter assembly is pressed , the starter solenoid is not enabled because switch 40 is open and switch 32 is open . in the schematic diagram of fig4 the relay positions are shown when the system has no power applied . in the schematic diagram of fig5 the relay positions when the system is in - flight are shown . the identity and authorization reader has verified the user . once the aircraft has achieved the threshold velocity , the air pressure sensor will provide a ground , the previously energized relay 34 will remove the starter assembly energizing the de - energizing circuit through switch 40 creating a redundant condition enabling the starter solenoid . this provides independent redundancy to protect the starer in case switch 40 fails . in the schematic diagram of fig6 the relay positions are shown after the identity / authorization reader has not been properly activated and the aircraft is not in flight . the starter assembly cannot be enabled due to switch 32 and 40 being open . the aircraft anti - theft system of the present invention is a biometric aircraft security device which includes a security technology that utilizes a physical human characteristic , such as fingerprint , voice print , retinal or iris scan , etc . this invention provides a security system and apparatus for eliminating the possibility of the theft of an aircraft . the system includes both an access code input device and a biometric reader , which is connected to a starter motor interconnect kit , which prohibits an engine of the aircraft from starting . the biometric reader functions to positively identify and check the authorization of the user or pilot of an aircraft prior to starting the aircraft . the system compares a biometric template of an individual with that individual to verify it is one and the same person . if both code and biometric verification is not confirmed , the airplane will not start or ever leave the ground . the biometric security device is positioned and installed in an aircraft that prohibits the main power supply of that aircraft from being transmitted to the starting system unless authorized verification of the individual is guaranteed by using a security code and comparing the biometric template with the template of the user . once verification is compared at the biometric device and verification of the user is confirmed , the main power is activated allowing the authorized person to start the aircraft . once the power in the aircraft has been activated , the biometric device is rendered inactive through internal circuitry and a fail - safe mechanism . this fail - safe mechanism is activated by air pressure during the aircraft &# 39 ; s takeoff roll . once the aircraft reaches the preset speed , an air switch takes over the biometric device and keeps it from activating until the airplane has safely landed and drops below the preset airspeed . the air switch device is used to ensure that the system does not impose a flight hazard by preventing in - flight restarts . this device will make it impossible for the biometric device to interfere in any way with the flight . in addition to the fail - safe mechanism , there is a delay timer in the circuit that allows for short drops in air flow that may be experienced at some stage in training flights , such as during stall maneuvers . this delay switch will allow the airspeed to drop below a certain amount for a predetermined number of seconds and then return to normal operation if this time is not used up . this gives our system not two , but three , safeguards against interfering with the normal use of the aircraft as designed and built by the manufacturer . operation of the fingerprint reader begins when an authorized individual enters the aircraft . the individual positions himself in front of the fingerprint reader and turns the master switch to the on position . after turning on the master switch two separate processes take place . process 1 . the fingerprint reader receives power from the main aircraft battery . once power is received at the fingerprint reader the reader activates an initializing sequence of events . this sequence consists of checking the processor board firmware , a simple device test , and testing the communication between the processor board and the fingerprint reader scanning head and its memory board . when checking the firmware , the fingerprint reader &# 39 ; s red and green led &# 39 ; s flash repeatedly ; then the fingerprint reader &# 39 ; s self test initializes the scanner head , the scanner head flashes a red light on and then turns off . the testing of the electronic circuitry of the fingerprint reader is indicated by three flashes of the green led approximately one second apart , the scanner head flashes the red light again , and if all circuits are operating properly , the green led lights for approximately 2 seconds . another 10 seconds later , if there is a master user enrolled in the fingerprint reader , the green led lights again and remains on for 3 seconds . process 2 . simultaneously an independent relay board also receives power from the aircraft battery . the processor on the relay board engages the relays . the contacts of the relays which were in the n / c position are now switched to n / o . this disconnects the power to the starter solenoid . the starter switch still has power , but since the power to the starter solenoid is disconnected , the ignition cannot operate . with the fingerprint reader and the relay board initialized , the relay board now transmits a signal to the fingerprint reader that flashes the red led indicating that the relays are engaged . it is at this time that the system is ready and waiting for an authorized fingerprint to be scanned . the operator activates the reader head by depressing a pin number on a keypad located on the front of the fingerprint reader . a red light flashes on the scanner head and the operator places a finger on the scanner head . if the operator is an authorized user of the aircraft , a minutiae comparison takes place between the operator &# 39 ; s scanned fingerprint image and a previously enrolled image . if the match is successful , the green led will light , and the fingerprint reader transmits the proper command to the relay board . the processor on the relay board receives the command and disengages the relays . the relay board is now disarmed . simultaneously the fingerprint reader disengages and becomes dormant . the relays on the relay board , now in the disarmed state , revert back to the n / c position allowing power to reach the starter solenoid . this now allows the starter switch to initiate the starter solenoid and the aircraft can now be operated . the backup safety system for this device is an airflow switch attached to a relay . at rest , the airflow switch is in the n / c position and is activated when pressure is received into the airflow intake tube . in its normally closed position , the airflow switch cannot activate the safety relay . also , when the relay board is armed , one of its relays keeps the airflow switch disconnected from the safety relay . the safety relay can only be activated when the relay board has been disarmed by verification of an authorized finger and there is airflow present . when activated , the safety relay takes control of the starter solenoid away from the relay board and the relay board becomes disengaged and independent of the aircraft electrical system . the aircraft security remains disarmed until the plane is at rest on the ground with the master power switch in the off position . when the master switch is turned back on this process repeats itself . the system of the present invention is not programmable by the user . the system merely accepts or rejects the input from the user in determining whether to allow the operation of the vehicle . a modification or reprogramming of the system may only be done by the manufacturer or authorized service technician , not the user . as to the manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily - occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	1
while the present invention will be described more fully hereinafter with reference to the accompanying drawings , in which particular embodiments are shown , it is to be understood at the outset that persons skilled in the art may modify the invention herein described while achieving the functions and results of this invention . accordingly , the descriptions which follow are to be understood as illustrative and exemplary of specific structures , aspects and features within the broad scope of the present invention and not as limiting of such broad scope . referring specifically to the embodiment illustrated in fig1 a - b , a preferred embodiment of the present invention is shown in a disassembled view to clearly illustrate two cooperating elements of the embodiment . it should be understood that the outset that more than two elements can be used to achieve the described functionality , and the invention is not limited to the use of a particular number of elements of any embodiment described herein . the first element 102 supports a light source 108 , and the second element 118 supports at least one shield 130 , 132 that can be made to envelop the light source 108 when the elements 102 , 118 are brought together . inasmuch as the shields 130 , 132 are concentric and each has at least one opaque portion and at least one translucent ( or transparent ) portion , rotation of the shields 130 , 132 with respect to one another can either block the light from the light source 108 , or reveal the light when the light source 108 is enveloped . inasmuch as the first element 102 and the second element 118 need not touch during this operation , the embodiment , as with all embodiments described herein , may be deemed suitable for use with religious observance requirements such as those related to shabbos . the first element 102 , shown in fig1 a , includes a base 104 , which should be a stable and solid structural element , and a mounting arm 106 extending upwardly from a top surface of the base 104 . the light source 108 extends from the mounting arm 106 , preferably parallel to the base 104 as shown . the light source 108 in this embodiment is electrically connected to a socket 110 formed on the mounting arm 106 . preferably , as shown , an opening hatch 112 formed on the mounting arm 106 allows the light source 108 to be inserted directly into the socket 110 housed inside the hatch 112 , which is in turn , connected to a ballast ( or functionally equivalent element ) housed in the first element 102 . the opening hatch 112 also allows users to extract the light source 108 for replacement . alternately , light source 108 can be inserted directly into the socket 110 , obviating the need for the hatch 112 . the electrical connection in this embodiment is provided by a cord 114 with a standard electric plug 116 that can be inserted into a wall outlet , and an on / off switch 117 that regulates the provision of electricity to the light source 108 . it should be understood that other electrical connections are contemplated , including , but not limited to , an electrical connection between the socket 110 and a battery . in this manner , the present invention provides for portable embodiments . it should be understood that all embodiments discussed herein can be adapted for use as portable or permanent illumination devices , and the provision of power to the light sources described herein can be accomplished in any known manner , and is not limited to electrical power from wall outlets , or limited to electrical power from batteries . preferably in this embodiment and the other embodiments discussed herein , the light source 108 is a low heat bulb , such that even when it is shielded by the shields 130 , 132 for an extended period of time , the shields 130 , 132 can be comfortably touched by a bare hand and the risk of fire is minimal . fluorescent bulbs that are commercially available are suitable in this respect ; a slender u - shaped fluorescent bulb of the type shown , referred to in some cases as a compact fluorescent bulb , is preferable . also preferably , for ease of loading the light source 108 into the socket 110 , the light source 108 that is used should not need to be rotated into two opposed ballasts , but rather should simply be insertable into the single ballast housed inside the hatch 112 , or even directly into the socket 110 . the second element 118 , shown in fig1 b , includes a base 120 and two support arms 126 a , 126 b . one of the support arms 126 a has an aperture 128 leading to an enclosure defined by the shields 130 , 132 . the shields in this embodiment are outer and inner concentric cylinders 130 , 132 extending between the support arms 126 a , 126 b . the enclosure is dimensioned to accommodate the light source 108 with room to spare so that no portion of the light source touches the wall of the inner cylinder 132 . as best shown in fig2 a - c , the outer cylinder 130 encloses the inner cylinder 132 . referring to fig2 b , the concentric cylinders 130 , 132 can be mounted to the support arms ( support arm 126 b is shown for example ) in that a mounting cylinder 146 is provided on the support arm . the mounting cylinder 146 is dimensioned so that the concentric cylinders 130 , 132 can be placed on the mounting cylinder 146 with the mounting cylinder 146 passing between the concentric cylinders 130 , 132 . alternatively , the concentric cylinders 130 , 132 can be mounted into and rotate around apertures in the support arms 126 a , 126 b . as shown in fig2 a and 2 c , the outer cylinder 130 is opaque except for a translucent ( or transparent ) strip 134 running approximately ¾ the length of one side and a slot 136 cut along ¼ of its circumference . the inner cylinder 132 also has a translucent ( or transparent ) portion 138 and an opaque portion 140 . preferably , as shown , the inner cylinder 132 is half opaque and half translucent . the outer cylinder 130 can be rotated by an attached control rod 142 . preferably , as shown , the outer cylinder control rod 142 is mounted just above the translucent strip 134 . the inner cylinder 132 can be rotated by an attached control rod 144 . preferably , as shown , the inner cylinder control rod 144 is mounted to pass through the slot 136 in the outer cylinder 130 so that it can be easily accessed . it should be understood that other elements can be used to allow the cylinders to be rotated , and that the described control rods and slot are merely one way in which to achieve this functionality . for example , the support arms can comprise solid towers with apertures in the solid towers of varying diameters around which the outer and inner cylinders rotate . referring again to fig1 a - b , the first element base 104 and the second element base 120 preferably interact to assist users in placing the light source 108 within the enclosure . in this embodiment , the interaction is provided by a convex surface 122 on the first element base 104 and a convex surface 124 on the second element base 120 . as the bases are brought together in the intended manner to cause the light source 108 to fit within the enclosure , the surfaces 122 , 124 become flush with one another without touching . it should be understood that other devices and ways can be used to allow the bases to interact . preferably , gaskets and / or baffles ( not shown ) are provided around the light source 108 and corresponding reverse gaskets and / or baffles ( not shown ) are provided in the aperture 128 to prevent light from escaping through the aperture when the light source 108 is within the enclosure . in operation of this preferred embodiment , the light source 108 would be turned on , for example , before sunset on friday night . first , the bases 104 , 120 would be brought together to make the surfaces 122 , 124 flush and to cause the light source 108 to fit through the aperture 128 and fully within the enclosure formed by the inner and outer cylinders 130 , 132 . it should be understood that , in accordance with religious observance requirements , the element 108 should not touch the wall of the inner cylinder 108 during use on shabbos . thereafter , the plug 116 would be placed into an electrical outlet to provide electricity to the light source 108 and the switch 117 would be turned “ on ” to cause the light source 108 to generate light . the cylinders 130 , 132 can then be rotated as desired and as described below to effect use of the device without violation of religious observance requirements . more particularly , when the translucent portion 138 of the inner cylinder 132 is congruent with the translucent strip 134 of the outer cylinder 130 , the light from the light source 108 is revealed . this light can be directed by rotation of the cylinders 130 , 132 with the control rods 142 , 144 . when the opaque portion 140 of the inner cylinder 132 is congruent with the translucent strip 134 of the outer cylinder 130 , the light of the light source 108 is blocked . during these operations , no portions of the first element 102 comes into physical contact with the second element 118 . in this manner , the second element can be used to effectively block the light while the light source 108 remains lit , and without physically interacting with the first element 102 . referring to fig3 , another embodiment of the present invention , shown in a perspective view , integrates the first and second elements of the preferred embodiment into a single element having one or more lights sources extending from one or both support arms into the cylindrical enclosure , which is preferably structurally and functionally identical to that of the second element of the preferred embodiment . this other embodiment includes a base 302 , which should be a stable and solid structural element . a pair of upwardly extending mounting arms 304 a , 304 b extend from the top surface of the base 302 . disposed at the upper ends 306 a , 306 b of the mounting arms 304 a , 304 b are inner and outer concentric cylindrical members 308 , 310 . within the inner cylindrical member 308 is a light source 312 . preferably , similarly to the preferred embodiment , this light source 312 is a low heat bulb , for example a slender and / or u - shaped fluorescent bulb , and it is electrically coupled to a socket formed on one , or both , of the upwardly extending mounting arms 340 a , 304 b . the inner and outer concentrically disposed cylindrical members 308 , 310 are formed such that a portion 308 a , 310 a of each is opaque and a portion 308 b , 310 b is translucent , preferably as described above in the discussion of the preferred embodiment . preferably , as shown , these portions 308 b , 310 b , each of which are translucent , form axially extending sections which encompass less than half of the total circumference of the corresponding cylinder . the cylinders 308 , 310 are mounted to the upwardly extending mounting arms 304 a , 304 b in such a manner that at least one of the cylinders may be rotated relative to the other , preferably as described in the discussion of the preferred embodiment . here , as shown in fig3 , the inner cylinder 308 is rotationally mounted to the mounting arms 304 a , 304 b such it may be rotated relative to the outer cylinder 310 . more particularly , the inner cylinder 308 comprises a rod 314 which extends through a groove 316 in the outer cylinder 310 , thereby permitting a user to rotate the inner cylinder 308 . selective adjustment of the cylinders &# 39 ; relative disposition , therefore , allows the opaque portions to entirely block the light . alternatively , the translucent portions may be aligned to permit the light to shine through the cylinders and illuminate the region around the device . while the embodiments discussed above include horizontally oriented light sources and / or one or more horizontally oriented shields , other embodiments can have vertically oriented light sources and / or one or more vertically oriented shields . accordingly , referring now to fig4 , yet another embodiment of the present invention is provided in a perspective view . in this embodiment , a base member 402 includes a socket for receiving a light source 404 . disposed about the light source 404 are a pair of concentric domes 406 , 408 which nest on the base 402 . as with the embodiment of fig3 , portions 406 a , 408 a of each of the screening domes are translucent , while other portions 406 b , 408 b are opaque . alignment of the domes 406 , 408 such that translucent regions 406 a , 408 a are coincident provides for illumination . conversely , alignment of the opaque regions 406 b , 408 b such that there are no coincident translucent portions provides for complete darkness . in a preferable embodiment , the base member 402 is disposed around , but not connected to , a light source which it and the other elements described enclose , such that the light source itself is a free - standing element not touched while it is revealed or blocked partially or completely . the present invention also contemplates other embodiments in which light sources and / or shields are vertically oriented . referring to fig5 a - c , in still another embodiment , the first element ( shown in fig5 a ) includes a base 504 that supports a vertically - oriented light source 506 and that rests on a support surface 508 , such as a table . the second element ( shown by fig5 b - c ) includes at least one shield that envelopes the entire first element and which is supported by a base 510 that rests on the support surface 508 so that it surrounds the base 504 of the first element without touching the base 504 or the first element . preferably , the second element includes inner 512 and outer 514 cylinders that envelop the light source 506 without touching the light source 506 and interlock on the base 510 that rests on the support surface 508 in surrounding relation to the base 504 of the first element without touching the base 504 or the first element . the base 510 of the second element preferably has an opening 516 for a cord 518 that supplies electricity to the light source 506 ( in portable embodiments , where batteries are used for power , such an opening is not necessary ). the inner cylinder 512 is translucent ( or transparent ), and the outer cylinder 514 is opaque . when illumination is desired , the outer cylinder 514 can be removed so that only the inner cylinder 512 covers the light source 506 . the inner cylinder 512 can be translucent to reduce glare from the light source 506 . alternatively , the inner cylinder 512 can be transparent , and the first element can include a translucent covering 520 over the light source 506 for glare reduction . it should be understood that such glare reduction features are merely optional in all of the embodiments described herein and the present invention encompasses embodiments where such glare reduction features are not present . when darkness is desired , the outer cylinder 514 can be lowered over the inner cylinder 512 and fixed into a slot 522 in the base 510 of the second element , so that it is concentric with the inner cylinder 512 and completely covers the inner cylinder 512 . in this manner , the light can be restricted without contact being made between the shields 512 , 514 and the light source 506 , and without turning off the light source 506 . optionally , shading baffles 524 around the top of the base 504 of the first element , skirtings 526 around the bottom of the base 510 of the second element , and shields 528 around the electric cord 518 ( if any ), can be used to further ensure that light leakage is prevented . the skirtings 526 can be a flexible material such as rubber , cloth , or the like . the outer cylinder 514 can be removed and replaced as desired to restrict or allow the light to escape , without turning the light on or off , and without causing physical contact with the light source . referring to fig6 a - d , in still another embodiment , the first element ( the example shown in fig5 a is suitable for use with this embodiment ) supporting the vertically oriented light source can be enveloped by a second element ( shown in fig6 a - d ) that includes an inner translucent ( or transparent ) cylinder 602 and an outer cylinder , the outer cylinder being defined by at least one fixed opaque semi - cylindrical panel 606 and at least one movable opaque semi - cylindrical panel 608 ( alternatively , an opaque section of a cylinder may be employed in lieu of panels ). the movable panel 608 travels within a circumferential track 610 in the base 612 of the second element , the circumferential track 610 being formed radially inward ( or outward , if desired ) from the bottom of the fixed panel 606 . therefore , the movable panel 608 can be placed adjacent the fixed panel 606 , as shown in fig6 a - b , to allow a portion of the inner cylinder 602 to be exposed , thereby allowing light from the light source ( not shown ) to escape . the movable panel 608 can also be placed opposite the fixed panel 606 , as shown in fig6 c - d , to cause the inner cylinder 602 to be complete enclosed by the panels 606 , 608 , thereby preventing light from the light source ( not shown ) from escaping . preferably , in this position , the panels 606 , 608 at least slightly overlap to ensure that light leakage is prevented . it should be understood that positions of the movable panel other than these two positions can be used to vary the amount of light that is released . therefore , the second element can be lowered over the first element without touching the first element or the light source , and the movable panel 608 can be moved as desired to restrict the light or allow the light to escape , without turning the light on or off and without causing physical contact with the light source . to further ensure that light leakage is prevented when the inner cylinder 602 is completely enclosed , the top of the inner cylinder can be covered by an opaque circular cap 614 . the position of the panels 606 , 608 can be tailored to the particular surroundings in which the embodiment of the invention will be used . for example , if the embodiment is adjacent a wall of a room , the fixed panel can be facing the wall , and the movable panel can be moved to allow light to project into the room rather than toward the wall . or , for example , an opposite arrangement can be provided if indirect lighting of the room is desired . the movement of the panels can be effected in any suitable manner . preferably , at least one control knob 616 , mechanically attached to the movable panel 608 , is provided that can be gripped by a user to move the panel 608 . preferably , this knob 616 is disposed on top of the cap 614 and is mechanically connected to a rod 618 within the cap that attaches to the movable panel 608 or cylinder ). if desired , a slot ( not shown ) with appropriate light baffling features can be provided in the fixed panel 606 to accommodate the rod 618 ( and / or the parts attaching the knob 616 to the movable panel 608 ) as the movable panel 608 is moved through a certain range of positions in which the fixed panel 606 would otherwise block the rod 618 to prevent movement of the movable panel 608 . it should be understood that instead of a fixed panel and a movable panel , other embodiments may have two movable opaque panels that can be moved relative to one another to be placed in positions completely enclosing the inner cylinder , and positions exposing the inner cylinder . it should also be understood that more than two panels can be used to effect the described functionality , and that the use of two panels discussed herein is merely one way to achieve that functionality . referring to fig7 a - b , in still another embodiment , instead of a solid outer cylinder or fixed and / or movable panels of an outer cylinder providing for selective shielding of the light source , a sliding folding door 704 is used to block the light from the light source . more particularly , the first element ( the example shown in fig5 a is suitable for use with this embodiment ) supporting the vertically oriented light source can be enveloped by a second element ( shown in top views in fig7 a - b ) that includes an inner translucent ( or transparent ) cylinder 702 and an outer cylinder , the outer cylinder being defined by an opaque folding door 704 that can be opened and closed about the inner cylinder 702 . the door 704 can be formed from any suitable flexible material , but preferably includes a flexible , opaque fabric with properties such that it will become flat when stretched , but will return to its folded position when contracted . while any suitable manner of attaching the ends of the door 704 and effecting the opening and closing of the door 704 about the inner cylinder 702 can be used , in the illustrated embodiment one end 706 of the door 704 is fixed to the inner cylinder 702 , and another end 708 travels in a track 710 in a base 712 of the second element and a corresponding track ( not shown ) in the cap of the second element . a knob 716 on the cap , attached to the one end 706 of the door 704 by a rod 718 , can be rotated to cause the one end 706 to travel within the tracks to bring it toward the other end 708 . when the knob 716 is rotated clockwise , the ends 706 , 708 are brought together as shown in fig7 b and can be locked in this position with a connection shield 720 . the connection shield is preferably opaque to prevent light leakage . at this maximum extension , the door 704 is completely unfolded and encompasses the inner cylinder 702 to completely block the light from the light source ( not shown ). when the knob 716 is rotated counter - clockwise , the ends 706 , 708 are moved apart as shown in fig7 a . the door 704 is then folded and allows at least a portion of the light to escape . it should be understood that the ends 706 , 708 can be placed in any position in between the positions shown in fig7 a and 7 b , to selectively vary the amount of light that escapes . it should also be understood that in some embodiments , the rotation can be reversed , so that clockwise rotation of the knob 716 closes the door 704 , and counter - clockwise rotation of the knob 716 opens the door 704 . fig7 c illustrates an embodiment of the present invention showing a second , translucent , outer cylinder 719 enclosing the folding door 704 and the movement mechanism in between the inner cylinder 702 and the second outer cylinder 719 , to protect the door 704 and / or the mechanism from dirt and / or damage , and / or for aesthetic or other reasons and / or provide additional conformance to religious requirements , inasmuch as the strictest interpretations of relevant jewish law require that the opening and closing of enclosing elements be minimized or avoided . it should be understood that the present invention contemplates wall - mounted embodiments , in which , for example , one or more of the bases of a particular embodiment , as applicable , are mounted on a bedroom wall , living room wall , or other wall . it may be particularly desirable to mount an embodiment on the wall above a couch or a headboard . it should be understood that weights and dimensions of the material and elements of the embodiments described above can be changed , added , and / or subtracted to enable such mountings . it should be further understood that the present invention contemplates easily portable embodiments . for example , such models could feature battery - powered operation and other features common to portable devices . it should also be understood that while the use of concentric cylinder and domes are described , the present invention encompasses embodiments in which concentric cone - shaped elements are used . moreover , the substitution of cylinder , domes and cones and other geometric shapes for others in the described or discussed embodiments should be understood to create other embodiments contemplated by the present invention . finally , it shall be understood that in alternative embodiments , or subtle but obvious modifications of the present invention , the translucent portions may be fully transparent and the opaque portions may be incompletely opaque . for example , some of these portions may be semi - opaque , polarized glass , colored glass , or other form of glass which interrupts the complete transmission of the light from within the device . various designs , shapes , and geometric orientations of the opaque and translucent regions are also contemplated , but are viewed simply as artistic variations of the same principles which are embodied in this invention . while there has been described and illustrated specific embodiments of new and novel illumination devices for use by religiously observant jews , it will be apparent to those skilled in the art that variations and modifications are possible without deviating from the broad spirit and principle of the present invention .	0
the subject matter is now described with reference to the drawings , wherein like reference numerals are used to refer to like elements throughout . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the subject matter . it may be evident , however , that subject matter embodiments may be practiced without these specific details . in other instances , well - known structures and devices are shown in block diagram form in order to facilitate describing the embodiments . as used in this application , the term “ component ” is intended to refer to a computer - related entity , either hardware , a combination of hardware and software , software , or software in execution . for example , a component may be , but is not limited to being , a process running on a processor , a processor , an object , an executable , a thread of execution , a program , and / or a computer . by way of illustration , both an application running on a server and the server can be a computer component . one or more components may reside within a process and / or thread of execution and a component may be localized on one computer and / or distributed between two or more computers . rich storage systems allow extra information to be associated with data being stored . the extra information is typically referred to as “ rich data ” and generally is associated with stored data items using a primary reference or “ item identification ( itemid )” that refers to the stored data items . the mechanisms disclosed herein allow rich storage systems to interact with “ non - rich ” systems and applications and still maintain rich data . the mechanisms accomplish this in constant time regardless of the size and / or quantity of rich data . this allows rich storage systems to interact with relational and legacy file systems alike without losing and / or corrupting data . fig1 illustrates a data preservation system 100 that utilizes a rich data preservation component 102 to tunnel rich data 108 associated with original data 104 via its primary reference identification ( e . g ., itemid # 1 ). in this example , original data 104 has a primary reference identification of itemid # 1 106 . changed data 110 represents , in this example , a copy of the original data 104 that has been altered prior to a data save . the changed data 110 has a primary reference identification of itemid # 2 112 . the rich data preservation component 102 typically provides rich data tunneling for data items when triggered by an event such as , for example , move , rename , create , etc . in this illustration , a save has been commanded and the intent is for the changed data 110 to overwrite the original data 104 while preserving the rich data 108 associated with the original data 104 . the rich data preservation component 102 leverages the association between the rich data 108 and the primary reference identification itemid # 1 106 to preserve the rich data 108 . the itemid &# 39 ; s 106 , 112 are stored in temporary storage ( e . g ., tunnel cache ) where they are swapped . thus , the rich data preservation component 102 re - identifies the changed data 110 from primary reference itemid # 2 112 to primary reference itemid # 1 . the rich data 108 association to the primary reference id # 1 remains intact and , thus , the rich data 108 is now effectively attached to the changed data 110 since the changed data 110 is now referenced as itemid # 1 106 . the data preservation system 100 can tunnel rich data even if a data system is unaware of the rich data 108 . this allows the data preservation system 100 to operate within rich and / or non - rich systems and / or applications alike to preserve the rich data 108 . this is especially useful when rich data systems / applications are utilized with legacy systems / applications . another advantage of the rich data preservation system 100 is that the rich data 108 is preserved in constant time regardless of the size and / or number of rich data elements contained in the rich data 108 . since the rich data 108 is not duplicated , its size and / or number of elements does not impact the preservation of the rich data utilizing mechanisms disclosed herein . this can substantially increase the performance of a system and / or application and the like and allow for better resource utilization and / or planning ( process time is a constant value ). a data preservation system 200 shown in fig2 employs a rich data preservation component 202 that utilizes a trigger monitoring component 216 and a tunneling component 218 . the trigger monitoring component 216 monitors tunneling triggers 214 and initiates rich data tunneling when a trigger event occurs . the tunneling triggers 214 can include , but are not limited to , a rename - rename file system operation , a delete - create file system operation , a delete - rename file system operation , and / or a rename - create file system operation and the like that causes a file name to disappear and reappear in the same directory ( namespace ). once initiated by the trigger monitoring component 216 , the tunneling component 218 receives original data 204 with itemid # 1 206 and changed data 210 with itemid # 2 212 . the primary references of the data sets 206 , 212 are stored , for example , in tunnel cache and switched to preserve rich data 208 associated to itemid # 1 206 . in this manner , the changed data 210 is now associated with a primary reference of itemid # 1 206 . since rich data 208 is associated with itemid # 1 206 , this effectively transfers the rich data 208 from the original data 204 to the changed data 210 in constant time . occasionally , systems / applications can levy restrictions on altering primary references . these restrictions can interfere with the mechanisms described supra . thus , when the primary references are immutable , primary identification associations stored with the rich data itself can be utilized , typically by introducing another level of indirection . thus , in fig3 , a data preservation system 300 employs a rich data preservation component 302 that acts on primary identification associations 306 , 312 ( itemid # 1 , and itemid # 2 ), used by rich data set id # 1 and rich data set id # 2 , respectively . the primary identification associations 306 , 312 respectively point ( associate ) the rich data sets 304 , 3 10 , and original data 305 , or changed data 311 to their respective data sets 308 , 314 . when triggered , the rich data preservation component 302 swaps the primary identification associations ( itemid # 1 , itemid # 2 ) 306 , 312 of the rich data sets 304 , 310 . now , rich data set id # 1 304 is effectively associated with rich data set id # 2 314 instead of rich data set id # 1 ( previous association ). this allows rich data set id # 1 304 to be preserved with rich data set id # 2 314 in constant time via switching of the primary reference associations of the rich data sets 304 , 3 10 . thus , data set primary references were not altered while rich data from an original data set ( e . g ., original document before editing ) was preserved ( e . g ., associated ) with another data set ( e . g ., a changed document , etc .). it can be appreciated that this technique can be applied to further levels of association as desired . this allows preservation of data in constant time despite the number of restrictions on primary , association , and / or identifying / linking information and the like . in yet other instances , proxies can be established as necessary to allow linking to a proxy and then between proxies and then back to the original source . this allows tunneling of rich data despite restrictions between two data sets . as an implementation example , a rich data preservation system can be utilized in a rich storage system that can include relational file systems . typically , every item in a relational file system has a unique identifier or itemid . relational file systems have richer capabilities that let users create and attach additional data to files . the attached data is often arbitrary in number and size . this rich data can include , for example , sticky notes , annotations , additional properties normally not contained in a basic file type , references to other files , and / or a variety of custom data that a user can add on . in addition , the relational file system can further store additional derived data to support , for example , efficient searches . legacy applications are not aware of the presence of the rich data and , thus , it can get lost during a system store process of files and / or documents . the mechanisms herein prevent the loss of rich data attached to data items in relational file systems and other systems . they accomplish this in constant time regardless of the size of the rich data and / or the number of rich data elements . knowledge of whether rich data elements exist or not is also not required to employ these mechanisms . for example , traditional attribute tunneling for a data item is typically triggered when a name of a file disappears and reappears in a directory within a prescribed time window . a name can appear , for example , through a create or rename / move operation . similarly , a name can disappear from a namespace through a delete or rename / move operation . in this traditional attribute tunneling , using microsoft windows as an example , what gets tunneled is a fixed set of properties { creationtime , objectid , shortname / longname }. microsoft windows , for example , provides an api named replacefilew ( ) that helps tunnel additional data / metadata like file attributes , alternate / named streams etc . however , in a rich storage system items can have any amount , arbitrary in their number and size , of rich data attached to it . the mechanisms disclosed herein can accomplish the tunneling of this rich data in an efficient manner that ensures very high performance under varying conditions . since arbitrary amount of rich data can be attached to items , it is often stored in a normalized manner . the normalization of storage implies that rather than storing along with an item in the same table , the rich data is instead stored in one or more separate tables . the association of rich data to an item happens by mapping the data ( referential integrity ) to the itemid . in one instance , to achieve rich data tunneling , the itemid is stored in a tunnel cache . when rich data tunneling is triggered , the itemids of the related items are switched . thus , tunneling is accomplished without actually having to copy over the rich data itself to further illustrate rich data tunneling , an assumption is made that a triggering event involves two rename operations ( other triggering scenarios can include , but are not limited to , delete - create , delete - rename , rename - create ). for example , a user opens a document ( e . g ., trip . doc ), through a word processing application . when the user makes changes to the document and saves it , the original document is not directly updated . instead the word processor writes the latest contents to a temporary file , for example , x . tmp . if the write to the file x . tmp completed without any errors then as part of a safe save operation what may happen is the following two renames . the first rename operation renames the original document to create a backup ( e . g ., backup . doc ). now , the document that has the updated content ( x . tmp ) is renamed to the original document ( trip . doc ). fig4 illustrates a logical data flow 400 during rich data tunneling for a file system . in this example , rich data tunneling is triggered on a successful call to a rename - rename like the following : rename trip . doc backup . tmp rename x . tmp trip . doc fig4 shows the state of the items after the second rename operation . and , the arrows 402 indicate the logical work that occurs as part of the rich data tunneling . to explain what happens underneath to achieve rich data tunneling , consider abstractions of rich data element tables as follows . table 1 shows an two item table and associated primary reference identifications i1 and i2 for two different data sets . in this case , the tunneling of rich data between items i1 and i2 can be accomplished , in constant time , by swapping the itemid in table 1 as shown in table 3 . however , if a storage system has a constraint that itemid of an item is immutable during the life of the item an additional level of indirection can be utilized to achieve tunneling in constant time as follows : a new table may then be introduced to provide the additional level of indirection / normalization such as , for example , table 5 depicting an itemtoitemfragmentmapping table . alternatively we can add the column fragmentcollectionid to the item table ( table 4 ) itself to avoid the creation of an extra table . in view of the exemplary systems shown and described above , methodologies that may be implemented in accordance with the embodiments will be better appreciated with reference to the flow charts of fig5 - 6 . while , for purposes of simplicity of explanation , the methodologies are shown and described as a series of blocks , it is to be understood and appreciated that the embodiments are not limited by the order of the blocks , as some blocks may , in accordance with an embodiment , occur in different orders and / or concurrently with other blocks from that shown and described herein . moreover , not all illustrated blocks may be required to implement the methodologies in accordance with the embodiments . the embodiments may be described in the general context of computer - executable instructions , such as program modules , executed by one or more components . generally , program modules include routines , programs , objects , data structures , etc ., that perform particular tasks or implement particular abstract data types . typically , the functionality of the program modules may be combined or distributed as desired in various instances of the embodiments . in fig5 , a flow diagram of a method 500 for preserving data in accordance with an aspect of an embodiment is shown . the method 500 starts 502 by retaining an item identification relating to a first data set in temporary storage 504 . the temporary storage can include , but is not limited to , tunnel cache and the like . the first data set item identification is then switched with a second data set item identification in temporary storage to transfer rich data from the second data set to the first data set in constant time 506 , ending the flow 508 . the item identification is typically a primary reference indicator that allows a system / application to uniquely identify data . this method 500 can be utilized even if a data system / application is unaware of the rich data . this allows rich data tunneling within rich and / or non - rich systems and / or applications alike to preserve the rich data . this is especially useful when rich data systems / applications are utilized with legacy systems / applications . the rich data is preserved in constant time regardless of the size and / or number of rich data elements contained in the rich data . since the rich data is not duplicated , its size and / or number of elements does not impact the preservation of the rich data . this can substantially increase the performance of a system and / or application and the like and allow for better resource utilization and / or planning ( process time is a constant value ). one can appreciate that method 500 can be employed with any number of data sets . looking at fig6 , another flow diagram of a method 600 for preserving data in accordance with an aspect of an embodiment is depicted . the method 600 starts 602 by retaining an association identification relating to a first rich data set in temporary storage 604 . an association identification facilitates in linking / identifying rich data and its associated data / file . new levels of indirection / normalization can be added to obtain association identifications for data / files that have immutable properties . if tables are employed for linking / associating rich data , additional intermediate tables can be employed to accomplish this . the temporary storage can include , but is not limited to , tunnel cache and the like . the first rich data set association identification is then switched with a second rich data set association identification in temporary storage to transfer the first rich data set from a first data set to a second data set in constant time 606 , ending the flow 608 . thus , without modifying primary references / itemids of data sets , rich data can be preserved . one can appreciate that method 600 can be employed with any number of rich data sets . it can also be utilized in rich and / or non - rich environments as well , with or without knowledge of the existence of the rich data and in constant time . in order to provide additional context for implementing various aspects of the embodiments , fig7 and the following discussion is intended to provide a brief , general description of a suitable computing environment 700 in which the various aspects of the embodiments can be performed . while the embodiments have been described above in the general context of computer - executable instructions of a computer program that runs on a local computer and / or remote computer , those skilled in the art will recognize that the embodiments can also be performed in combination with other program modules . generally , program modules include routines , programs , components , data structures , etc ., that perform particular tasks and / or implement particular abstract data types . moreover , those skilled in the art will appreciate that the inventive methods can be practiced with other computer system configurations , including single - processor or multi - processor computer systems , minicomputers , mainframe computers , as well as personal computers , hand - held computing devices , microprocessor - based and / or programmable consumer electronics , and the like , each of which can operatively communicate with one or more associated devices . the illustrated aspects of the embodiments can also be practiced in distributed computing environments where certain tasks are performed by remote processing devices that are linked through a communications network . however , some , if not all , aspects of the embodiments can be practiced on stand - alone computers . in a distributed computing environment , program modules can be located in local and / or remote memory storage devices . with reference to fig7 , an exemplary system environment 700 for performing the various aspects of the embodiments include a conventional computer 702 , including a processing unit 704 , a system memory 706 , and a system bus 708 that couples various system components , including the system memory , to the processing unit 704 . the processing unit 704 can be any commercially available or proprietary processor . in addition , the processing unit can be implemented as multi - processor formed of more than one processor , such as can be connected in parallel . the system bus 708 can be any of several types of bus structure including a memory bus or memory controller , a peripheral bus , and a local bus using any of a variety of conventional bus architectures such as pci , vesa , microchannel , isa , and eisa , to name a few . the system memory 706 includes read only memory ( rom ) 710 and random access memory ( ram ) 712 . a basic input / output system ( bios ) 714 , containing the basic routines that help to transfer information between elements within the computer 702 , such as during start - up , is stored in rom 710 . the computer 702 also can include , for example , a hard disk drive 716 , a magnetic disk drive 718 , e . g ., to read from or write to a removable disk 720 , and an optical disk drive 722 , e . g ., for reading from or writing to a cd - rom disk 724 or other optical media . the hard disk drive 716 , magnetic disk drive 718 , and optical disk drive 722 are connected to the system bus 708 by a hard disk drive interface 726 , a magnetic disk drive interface 728 , and an optical drive interface 730 , respectively . the drives 716 - 722 and their associated computer - readable media provide nonvolatile storage of data , data structures , computer - executable instructions , etc . for the computer 702 . although the description of computer - readable media above refers to a hard disk , a removable magnetic disk and a cd , it should be appreciated by those skilled in the art that other types of media which are readable by a computer , such as magnetic cassettes , flash memory , digital video disks , bernoulli cartridges , and the like , can also be used in the exemplary operating environment 700 , and further that any such media can contain computer - executable instructions for performing the methods of the embodiments . a number of program modules can be stored in the drives 716 - 722 and ram 712 , including an operating system 732 , one or more application programs 734 , other program modules 736 , and program data 738 . the operating system 732 can be any suitable operating system or combination of operating systems . by way of example , the application programs 734 and program modules 736 can include a data preservation scheme in accordance with an aspect of an embodiment . a user can enter commands and information into the computer 702 through one or more user input devices , such as a keyboard 740 and a pointing device ( e . g ., a mouse 742 ). other input devices ( not shown ) can include a microphone , a joystick , a game pad , a satellite dish , a wireless remote , a scanner , or the like . these and other input devices are often connected to the processing unit 704 through a serial port interface 744 that is coupled to the system bus 708 , but can be connected by other interfaces , such as a parallel port , a game port or a universal serial bus ( usb ). a monitor 746 or other type of display device is also connected to the system bus 708 via an interface , such as a video adapter 748 . in addition to the monitor 746 , the computer 702 can include other peripheral output devices ( not shown ), such as speakers , printers , etc . it is to be appreciated that the computer 702 can operate in a networked environment using logical connections to one or more remote computers 760 . the remote computer 760 can be a workstation , a server computer , a router , a peer device or other common network node , and typically includes many or all of the elements described relative to the computer 702 , although for purposes of brevity , only a memory storage device 762 is illustrated in fig7 . the logical connections depicted in fig7 can include a local area network ( lan ) 764 and a wide area network ( wan ) 766 . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets and the internet . when used in a lan networking environment , for example , the computer 702 is connected to the local network 764 through a network interface or adapter 768 . when used in a wan networking environment , the computer 702 typically includes a modem ( e . g ., telephone , dsl , cable , etc .) 770 , or is connected to a communications server on the lan , or has other means for establishing communications over the wan 766 , such as the internet . the modem 770 , which can be internal or external relative to the computer 702 , is connected to the system bus 708 via the serial port interface 744 . in a networked environment , program modules ( including application programs 734 ) and / or program data 738 can be stored in the remote memory storage device 762 . it will be appreciated that the network connections shown are exemplary and other means ( e . g . wired or wireless ) of establishing a communications link between the computers 702 and 760 can be used when carrying out an aspect of an embodiment . in accordance with the practices of persons skilled in the art of computer programming , the embodiments have been described with reference to acts and symbolic representations of operations that are performed by a computer , such as the computer 702 or remote computer 760 , unless otherwise indicated . such acts and operations are sometimes referred to as being computer - executed . it will be appreciated that the acts and symbolically represented operations include the manipulation by the processing unit 704 of electrical signals representing data bits which causes a resulting transformation or reduction of the electrical signal representation , and the maintenance of data bits at memory locations in the memory system ( including the system memory 706 , hard drive 716 , floppy disks 720 , cd - rom 724 , and remote memory 762 ) to thereby reconfigure or otherwise alter the computer system &# 39 ; s operation , as well as other processing of signals . the memory locations where such data bits are maintained are physical locations that have particular electrical , magnetic , or optical properties corresponding to the data bits . fig8 is another block diagram of a sample computing environment 800 with which embodiments can interact . the system 800 further illustrates a system that includes one or more client ( s ) 802 . the client ( s ) 802 can be hardware and / or software ( e . g ., threads , processes , computing devices ). the system 800 also includes one or more server ( s ) 804 . the server ( s ) 804 can also be hardware and / or software ( e . g ., threads , processes , computing devices ). one possible communication between a client 802 and a server 804 can be in the form of a data packet adapted to be transmitted between two or more computer processes . the system 800 includes a communication framework 808 that can be employed to facilitate communications between the client ( s ) 802 and the server ( s ) 804 . the client ( s ) 802 are connected to one or more client data store ( s ) 810 that can be employed to store information local to the client ( s ) 802 . similarly , the server ( s ) 804 are connected to one or more server data store ( s ) 806 that can be employed to store information local to the server ( s ) 804 . it is to be appreciated that the systems and / or methods of the embodiments can be utilized in data preservation facilitating computer components and non - computer related components alike . further , those skilled in the art will recognize that the systems and / or methods of the embodiments are employable in a vast array of electronic related technologies , including , but not limited to , computers , servers and / or handheld electronic devices , and the like . what has been described above includes examples of the embodiments . it is , of course , not possible to describe every conceivable combination of components or methodologies for purposes of describing the embodiments , but one of ordinary skill in the art may recognize that many further combinations and permutations of the embodiments are possible . accordingly , the subject matter is intended to embrace all such alterations , modifications and variations that fall within the spirit and scope of the appended claims . furthermore , to the extent that the term “ includes ” is used in either the detailed description or the claims , such term is intended to be inclusive in a manner similar to the term “ comprising ” as “ comprising ” is interpreted when employed as a transitional word in a claim .	6
referring now in more detail to the drawings , in which like numerals indicate like parts throughout the several views , fig1 illustrates a pair of shoes that can be sized and shaped for wear by children or adults . the pair of shoes 10 includes a left shoe 12 and a right shoe 14 . the left shoe is shaped for fitting the left foot of a wearer , the right shoe is shaped for fitting the right foot of the wearer , and the left and right shoes are reversed shaped . this is conventional . each shoe includes a sole 16 and an upper structure 18 , with the upper structure 18 being joined by adhesive , stitching or other conventional means to the perimeter of the sole 16 . as illustrated in fig3 the upper structure 18 of each shoe includes a u - shaped perimeter wall 22 joined to and extending upwardly from the perimeter of the sole 16 , and shaped for extending about the toes of the foot of the wearer ( not shown ). a top panel 24 is attached at its perimeter to the upper edges of the u - shaped perimeter wall 22 for covering the toes of the foot of the wearer . a heel wall 26 is also u - shaped and is joined at its edge to the perimeter of the sole and is shaped to extend upwardly about the heel of the foot of the wearer of the shoes . this leaves the opening 28 for inserting the foot into and withdrawing the foot from the shoe . as shown in fig1 a continuous design 30 is formed on the top panels 24 of both the left and right shoes 12 and 14 of the pair of shoes . the design is segmented so that a left portion , or segment 32 , is formed on the upper structure 18 of the left shoe 12 and the right portion , or segment 34 , is formed on the upper structure 18 of the right shoe 14 . this example is a “ smiley face ” design . in this embodiment , the continuous design 30 is formed of a pair of reverse or “ mirror ” images , each design portion being substantially identical to but the reverse of the other design portion and neither segment of the design forming a complete design . the design portions 32 and 34 are arranged so that they form a continuous when paired together , as when the shoes are placed on the correct feet of the wearer and the wearer places his or her feet in adjacent , inside to inside relationship . the design portions 32 and 34 of the two shoes form the continuous design 30 extending across both shoes . neither design portion is a complete design without the other design portion . while the continuous design 30 of fig1 is formed of a pair of reverse image portions , a continuous design across the pair of shoes can be formed with other design portions that are not mirror images of each other . for example , fig2 illustrates a pair of sports shoes 40 having features similar to those of fig1 but having a continuous design 50 that is formed of dissimilar left and right design portions 52 and 54 . the example of the continuous design 50 is a tomahawk and includes a left portion 52 that is the lower portion of the handle of the tomahawk and the right portion 54 that is the blade or head portion of the tomahawk . if the shoes are placed on the correct feet of the wearer , with the left shoe on the left foot and the right shoe on the right foot , and the feet are brought together in side by side relationship , the left and right design portions 52 and 54 will complete the continuous design 50 of the tomahawk . as illustrated in fig4 similar continuous designs can be formed on the heel walls 26 of a pair of shoes , such as shoes 10 of fig1 or shoes 40 of fig2 . the continuous design can be in addition to or an alternative to the continuous design formed on the upper structure of the shoes . the example illustrated in fig4 is that of a swimmer , with the lower abdomen and legs on the left shoe 12 and the upper abdomen , arms and head on the right shoe 14 . again , when the left shoe is placed on the left foot of the wearer and the right shoe is placed on the right foot of the wearer and the shoes are brought in adjacent side - by - side relationship , the left and right design portions of the swimmer will be placed adjacent each other , completing the continuous design across the pair of shoes . neither design segment forms a complete design , but when the shoes are brought together as described , the compete or continuous design of the swimmer is formed . [ 0029 ] fig5 and 6 are additional continuous design concepts for children &# 39 ; s shoes . when forming a design on young children &# 39 ; s shoes , it may be more important to have mirror image left portion 44 and right portion 46 of a continuous design 48 . fig5 shows a continuous design of a sunburst , with the sunburst design divided in halves , each half being a mirror image of the other half . when the shoes are matched together as described above , the completed continuous design 48 of a sunburst is formed by the shoes . a young child is likely to learn about which shoe fits which foot when the mirror image of the left and right design portions of the continuous design are mirror images of each other , so that they “ match ” one another , like adjacent pieces of a puzzle . [ 0030 ] fig6 shows a similar but more sophisticated version of the mirror image design portions for the left and right children &# 39 ; s shoes . the continuous design of a butterfly 50 is formed by the mirror image design portions . [ 0031 ] fig7 illustrates a pair of adult women &# 39 ; s shoes having a continuous design 54 formed by the shoes . in this instance , the continuous image is not formed by left and right mirror images , but by dissimilar mirror images 56 and 58 . this provides a more sophisticated look for a person of more discriminating taste . [ 0032 ] fig8 shows a pair of women &# 39 ; s boots having continuous color design from one boot to the other and continuous structural design features from one boot to the other . as with fig7 the boots of fig8 show left and right design portions 60 and 62 that are not mirror images of each other , but the designs , when mated together as described above , show a continuous design from one boot to the other . in addition , the upper edges of the boots of fig8 are shaped differently , yet the design of each boot forms a continuous design across both boots of the pair of boots . this is a more sophisticated design feature for the discriminating adult . it should be noted in all of the illustrated examples that if the shoes should be placed on the wrong feet , with the left shoe on the right foot and the right shoe on the left foot , the left and right design portions of the shoes will form an indiscriminate design , not a continuous matching design . for example , if the pair of children &# 39 ; s shoes of fig5 are placed on the wrong feet and the feet are brought together , the sunburst will not be formed . indeed , the design of the sunburst , which is likely to be in a bright orange color , will be segmented and facing outwardly on the shoes , instead of the design portions facing together , thus forming an unrecognizable design . this is likely to alert the child and the adult caring for the child that the shoes have been improperly placed on the feet of the child . likewise , the shoes of fig6 should also alert the child and the person caring for the child when the shoes are placed on the wrong feet . when the continuous design is applied to the heels of the pair of shoes as illustrated in fig4 again , the adult caring for the child or anyone positioned behind the child should immediately recognize when the shoes are placed on the wrong feet . [ 0037 ] fig2 and 8 are intended to show a continuous design formed of a matching pair of dissimilar design portions , suitable for the sports person . while a tomahawk is shown as the continuous design in fig2 other sports images , and images of other types , that are more desirable for the adult sports person can be applied , such as shown in fig7 and 8 . for example , the continuous image of a sports mascot could be segmented , with the left portion placed on the left shoe and the right portion placed on the right shoe . while the shoes of fig1 and 2 are shown to be more of an athletic style where there is a definite u - shaped perimeter wall 22 that extends upwardly from the sole 16 and then a top panel 24 is formed on the perimeter wall to cover the toes of the foot , the shoes of fig7 which may be “ ballerina ” shoes , may have less of a departure between the perimeter wall and the top panel . accordingly , the design of fig7 might extend across both the top panel 24 and the perimeter , down to the sole , assuring that the continuous design extends from one shoe to the other . while the continuous designs illustrated herein show a single object divided so as to place the left portion of the continuous design on one shoe and the right portion on the other shoe , it is also within the scope of this invention to have a complete design on each shoe , with the complete designs coming together to form a continuous design that incorporates the two dissimilar designs . for example , the image of a basketball could be placed on one shoe and the image of a basketball goal could be placed on the other shoe so that the two images together form a continuous design and when taken together become identifiable with each other . while the drawings illustrate the invention in black and white , it should be understood that the designs applied to the shoes are likely to be in color that contrasts with the background color of the shoes . similar color extending from one shoe to the other tends to enhance the recognition of a continuous design across both shoes . it is important to the invention that the continuous design from shoe to shoe be visible to the wearer in the situations where the wearer is a child and relies upon the continuous design to determine if the shoes are being placed on the correct foot of the wearer . typically , this will be on the top panels 24 of the upper structure 18 of the shoes . as illustrated in fig8 the boots can have the continuous design formed of different materials as well as different colors , so that one colored segment can be formed of one material and the adjacent segment of a different color can be formed of a different material . however , the general arrangement is that the continuous design applied to the boots as well as to the other shoes of the drawings will be artistic rather than structural design features . although the footwear is described herein as “ shoes ,” it is intended that the expression “ shoes ” is to include not only conventional shoes but also boots , sandals , athletic shoes , and other footwear for both children and adults . although preferred embodiments of the invention have been disclosed in detail herein , it will be obvious to those skilled in the art that variations and modifications of the disclosed embodiments can be made without departing from the spirit and scope of the invention as set forth in the following claims .	0
with initial reference to fig1 and 2 , a turbidity sensor 10 is mounted within a cabinet 11 . the sensor 10 includes a housing 12 which in the preferred embodiment has a cylindrical shape . the housing 12 consists of a main body 13 , annular end cap 14 and a flat , circular end plate 15 . the main body 13 has a cylindrical cavity 16 with a longitudinal axis 17 . an inlet opening 18 extends through the main housing near one end of the cavity 16 and an outlet opening 19 extends through the main body near the other end of the cavity . pipe threads are cut in the housing surfaces forming the inlet and outlet openings 18 and 19 to accept pipe fittings 24 and 25 , respectively . the other end of the cavity 16 opens through an annular projection 20 that has external threads 21 on its outer circumferential surface . an 0 - ring 22 lies within a grove on the planar end surface of projection 20 to provide a fluid tight seal between the main body 13 and the end plate 15 . the inner curved surface of the annular end cap 14 has internal threads 23 which engage the external threads 21 on the main body projection 20 when the housing 12 is assembled . this engagement holds the end plate 15 tightly against the main body 13 sealing the cavity 16 . four radial apertures 26 , 27 , 28 and 29 extend through the cylindrical main body 13 as illustrated in fig4 . these apertures preferably lie in a common plane orthogonal to the longitudinal axis 17 of the cavity 16 and between the inlet and outlet openings 18 and 19 . the radial apertures 26 - 29 are spaced at substantially 90 ° increments around the cavity 16 . specifically , the first radial aperture 26 is centered on a common first radial axis 51 with the third radial aperture 28 . similarly , the second and fourth radial apertures 27 and 29 are centered on a second radial axis 52 which is substantially perpendicular to the first radial axis 51 . a first light emitter 41 is located within the first radial aperture 26 and emits a beam of light through the cavity along the first radial axis 51 . a second light emitter 42 is mounted with the second radial aperture 27 and emits a beam of light through the cavity along the second radial axis 52 . a first light detector 43 is positioned within the third radial aperture 28 and a second light detector 44 is mounted within the fourth radial aperture 29 . fluid tight seals are provided between the main body 13 and each of the light emitters and detectors 41 - 44 by o - rings 45 . as shown in fig1 the turbidity sensor 10 is mounted within the cabinet 11 at an orientation in which the longitudinal axis 17 of the cavity 16 is substantially horizontal . the turbidimeter housing 12 is further positioned so that the inlet opening 18 is at the bottom of the cavity 16 and the outlet opening 19 is at the highest port of the cavity . the significance of this orientation will become apparent from a description of the turbidimeter operation subsequently herein . located within the cavity 16 is a baffle assembly 30 formed by three plates 31 , 32 and 33 . the first plate 31 has a generally d - shape with a horizontal straight edge 34 at the upper portion of the plate in the assembled turbidimeter , as illustrated in fig1 and 3 . the curved edge of the first plate 31 has a radius substantially equal to the radius of the cylindrical cavity 16 so that the curved edge of the first plate abuts the inner surface of the cavity . the first plate is fixedly attached near its center to one end of a first spacer 35 . with reference to fig1 and 4 , the other end of the first spacer 35 is attached near the center of the second baffle plate 32 . the second plate 32 has a generally square shape with rounded corners conforming to the cylindrical surface of the cavity 16 . the upper edge of the second plate 32 contains an indentation 36 providing a gap between the surface of the cavity and the second plate . a number of apertures 37 extend through a lower portion of the second plate . the apertures 37 permit fluid which is introduced into the cavity 16 via inlet opening 18 to flow through the second plate 32 , as will be described . the second and third plates 32 and 33 are spaced from one another by four slat - like vanes 46 - 49 and two cylindrical posts 50 . the ends of the vanes 46 - 49 are attached to the second and third plates . when the baffle assembly 30 is positioned within the sensor 10 as shown in fig4 the first vane 46 lies near the curved surface of chamber 16 between the first and third radial apertures 26 and 28 at an acute angle to the second radial axis 52 . the first vane 46 blocks light produced by the first emitter 41 from traveling in a straight path to the second detector 44 . thus the only way that the second detector 44 can receive light from the first emitter 41 is due to scattering of the light by fluid flowing through the cavity . the second and third vanes 47 and 48 are positioned between the second and third plates 32 and 33 approximately 90 ° around the edge of the plates from the first vane 46 . this positioning of the second and third vanes 47 and 48 places them between the third and forth radial apertures 28 and 29 in the main body . in this location these latter two vanes prevent light from being reflected from the surface of one of the detectors 43 or 44 directly on to the other detector . the fourth vane 49 is located adjacent the cavity surface between the second and third radial apertures 27 and 28 at an acute angle to the first radial axis 51 when the baffle assembly 30 is within cavity 16 . the fourth vane 49 blocks light from traveling in a straight line between the second emitter 42 and the first detector 43 . thus , the only way the first detector 43 can receive light from the second emitter 42 is due to scattering of the light by fluid flowing through the cavity . the four vanes 46 - 49 act as blinders by narrowing the angles of view of the detectors 43 and 44 . this limits the amount of stray light reflected by the surfaces of housing 12 and baffle 30 which can reach the detectors . referring to fig1 and 5 , the third plate 33 is spaced from the housing end plate 15 by a second spacer 38 . the third plate 33 has a generally square shape with the corners rounded to conform with the curved surface of cavity 16 . an indentation 39 is located in the upper most portion of the edge of the third plate . a series of apertures 40 extend through the upper portion of the third plate 33 . a cylindrical retainer post 55 is fixedly attached to end wall 54 of the main body 13 and extends within the cavity 16 parallel to but offset from longitudinal axis 17 . each of the baffle plates 31 - 33 has a circular aperture through which the retainer post 55 extends when the baffle assembly is inserted into the cavity 16 . the engagement of the retainer post 55 with the plates prevents the baffle assembly 30 from rotating within the cavity due to the force of fluid flowing therethrough . the baffle assembly 30 is restricted from moving longitudinally within the cavity 16 by the second spacer 38 abutting end plate 15 and by the first plate 31 abutting a ridge 53 extending around the inner surface of the cavity near inlet opening 18 . the components of the baffle assembly 30 , the inner surfaces of housing 12 and retainer post 55 all are colored black to reduce their reflectivity . when the turbidity sensor 10 is coupled to a plumbing system , fluid flows through the inlet opening 18 into the cavity 16 exiting through outlet opening 19 . as shown in fig1 the fluid enters the cavity between the first baffle plate 31 and the end wall 54 . because the curved edge of the first plate 31 conforms to the cavity surface , the fluid can flow around the first plate substantially only between the straight edge 34 of the plate and the main body 13 at the upper region of the cavity . thus the first plate 31 forces the incoming fluid to the upper region of the cavity , i . e . the region above the upper edge 34 of the plate . since gas bubbles entrained in the fluid are lighter than the fluid , the bubbles flow along a passage created in the upper region between indentation 36 in the second plate 32 and a grove 56 which extends in the main body 13 longitudinally along the upper cavity surface . the passage continues along this grove 56 and through the indentation 39 in the second baffle plate 32 until it reaches the outlet opening 19 . the gas bubbles carried by the fluid will flow across the upper region of the cavity and not intersect the radial axes on which the light emitters and detectors 41 - 44 are located . as a result , the gas bubbles will not interfere with the optical sensing of the fluid turbidity . however , the cross sectional area of the passage at the upper region of the cavity is relatively small as compared to the size of the inlet and the combined cross sectional areas of the apertures 37 in the second plate 32 . as a result , most of the flow volume will be forced downward in a section of the cavity between the first and second plates and through apertures 37 . alternatively , indentations can be provided in edges of the lower half of the second plate 32 to accommodate the fluid flow the fluid flows from the apertures 37 in the second baffle plate 32 in a upward angular direction to the apertures 40 in the third plate 33 . by vertically offsetting the apertures 37 and 40 in the second and third baffle plates 32 and 33 the fluid is directed through the central region of the cavity formed between the two plates and through the beams of light produced by the emitters 41 and 42 . this central region forms the turbidity sensing zone . the baffle assembly 30 performs the functions of removing entrained gas from the fluid flow before the sensing zone of the turbidimeter and directing the flow of fluid that is substantially gas bubble free through that sensing zone . as shown in fig6 the light emitters 41 and 42 and detectors 43 and 44 are connected to a circuit 80 for deriving a turbidity value based on signals from detectors 43 and 44 . the light emitters 41 and 42 are alternately energized by an emitter driver 81 in response to a signal from control circuit 82 . the signals from the detectors 43 and 44 are coupled by preamplifiers 83 and 84 to a turbidity computing circuit 86 . from the two input signals , the turbidity computing circuit calculates a turbidity value in a manner similar to that described in u . s . pat . no . 3 , 775 , 013 . this value is presented on display 88 . in order for the signal processing circuit 80 to convert the light intensity sensed by detectors 43 and 44 into a correct turbidity measurement , the circuitry must be calibrated . the present turbidimeter also provides an improved method of calibration compared to previous methods which used a fluid having a known turbidity . a novel calibration device used in this process is illustrated in fig7 - 9 . to calibrate the instrument , the baffle assembly 30 is removed from the turbidimeter 10 and the calibration device 60 is inserted in its place . the calibration device 60 is similar to the baffle assembly 30 in that it has two plates 61 and 62 spaced apart by four vanes 63 and rods 64 . the plates 61 and 62 have a shape which conforms to the cross section of the cavity 16 . the vanes 63 and rods 64 of the calibration device 60 extend between the two plates 61 and 62 in positions similar to the vanes 46 - 49 of the baffle assembly 30 and perform similar functions . each calibration device plate 61 and 62 has an aperture 66 and 67 , respectively , for receiving the retainer post 55 when the calibration device is inserted into the cavity 16 . a first positioning post 68 extends from the outer surface of the first plate 61 , while a second positioning post 69 extends from the outer surface of the second plate 62 . the two positioning posts 68 and 69 locate the calibration device 60 longitudinally within the cavity 16 by abutting the end plate 15 and the main body end wall 54 , respectively . a calibration standard 70 is mounted centrally between the two calibration device plates 61 and 62 and the vanes 63 . in the preferred embodiment , the calibration standard 70 is a rectangular solid with a square cross section in a plane parallel to plates 61 and 62 . when the calibration device 60 is inserted into the turbidimeter 10 the flat surfaces of the calibration standard 70 are orthogonal to the radial axes on which the light emitters and detectors 41 - 44 are mounted . due to its square cross sectional shape , the calibration standard 70 has the same dimension along the first radial axis 51 between the first light emitter 41 and the first detector 43 as along the second radial axis 52 between the second emitter 42 and the second detector 44 . thus , the two light paths through the standard along these axes are the same . the calibration standard 70 is a glass ceramic composite . one example of a suitable glass ceramic composite is marketed under the trademark &# 34 ; zerodur &# 34 ; by schott glaswerke of mainz , west germany . such composites are formed by heat treating a glass block so that it becomes partially crystalline , i . e . the material has both a vitreous and a crystalline phase . since the two phases have different indices of refraction , a given amount of light will be scattered as it passes through the standard 70 . thus , the calibration standard 70 can simulate a fluid having a defined turbidity . prior to using the calibration device 60 , the equivalent turbidity of the standard 70 must be determined . to do so , the calibration device is placed in a reference turbidimeter that was previously calibrated by a conventional liquid primary standard introduced into the cavity 16 . after the reference turbidimeter has been calibrated and drained , its baffle assembly 30 is removed and replaced by the calibration device 70 . the reference turbidimeter then is sealed and operated to measure the turbidity simulated by the calibration standard 70 . once the equivalent turbidity of the calibration device 60 is known , it can be used to calibrate other turbidimeters . the calibration device is placed in the cavity of another turbidimeter and its control circuitry is adjusted until the measured turbidity coincides which the turbidity simulated by the calibration standard 70 . following this process , the calibration device 60 is removed and the baffle assembly 30 is inserted into the cavity which then is sealed by the end cap and plate 14 and 16 so that the device may be placed in operation .	6
ti and al are added to ni base superalloys to increase the high temperature strength of the component , but at the expense of drastically increasing the difficulty of producing satisfactory welds . a more careful study of factors affecting weldability of ni base superalloys has led the present inventors to conclude that a γ ′ phase present in an amount less than about 30 weight percent is indicative of advantageous weldability , γ ′ greater than about 60 % is indicative of nonweldability while intermediate γ ′ values typically indicates difficult and expensive welding . in summary , the welding process described herein makes use of elemental partitioning of al and ti into γ and γ ′ phases through a step cool and hold process . this depletes the γ phase from al in a controlled fashion and ti and improves weldability , typically be achieving a low weight % of γ ′. when the al and ti content of the stress relieved γ in the joint is reduced to weldable values , the step cool and hold process is terminated and replaced with conventional weld argon cooling . typical embodiments of this invention use two heat sources . a first heat source is used for joining , that is a conventional welding process . a laser heat source is advantageously used as this first heat source but other heat sources are not inherently excluded such as arcs , discharges , electron beams , particle beams , among others . ( af ), [ 0023 ] (&# 39 ; 157 ) a second heat source is used for the hold and cool portion of the process and adjusts the isothermal hold temperature of the joint to produce no more than about 30 % γ ′ from the γ at any isothermal hold temperature . a laser heat source is advantageously used as this second heat source but other heat sources are not inherently excluded such as induction heating , electron beams , tungsten halogen bulbs , infrared heating , among others . ( af ), [ 0024 ] (&# 39 ; 157 ) elemental partitioning of al and ti is calculated from available thermodynamic data that allows a maximum 30 % γ ′ formation at any isothermal hold temperature . hold times needed to achieve 30 % γ ′ are calculated from the known phase transformation kinetics of the γ - γ ′ system . fig1 is a graphical depiction of the weldability zone of typical superalloys as a function of their al and ti content ( in weight percent ). those alloys lying above line 100 are generally considered not to be weldable . a more detailed study of the compositions of the alloys in fig1 shows that the alloys listed above line 100 have more than 60 % of the γ ′ phase in their final structures . in contrast , superalloys lying below line 101 have less than 20 % γ ′ phase in their final structures . thus , it is anticipated that ni base superalloys with γ ′ less than about 20 % are expected to be weldable . alloys of particular interest here include those noted , on fig1 . ( af ), [ 0027 ] (&# 39 ; 157 ) cooling of a superalloy from its melting temperature tends to have superalloys undergoing a transition from γ phase to γ ′+ γ phases . the hold and cool process described herein employs the elemental partitioning of al and ti into γ and γ ′ phases in full thermodynamic phase equilibrium to produce no more than 30 % γ ′ at any hold time during the hold and cool process . this depletes the γ phase from al and ti and moves the final γ composition into the weldable region as depicted in fig1 . fig3 shows a typical joining system including hold and cool capabilities for carrying out processes pursuant to some embodiments of the present invention . the apparatus typically included a heat source for conducting the welding , 201 ( typically a laser , laser 1 ), and a second heat source for heating the substrate to a predetermined temperature ( typically a laser , laser 2 ). heating of the weld location is carried out prior to welding , prior to or as soon as laser 1 ( 201 ) is turned on at the joining location . the initial predetermined temperature of the joining location is advantageously selected to be above about 2100 deg . f . fig2 is a schematic depiction of metallurgical reactions for typical high strength ni superalloys joined by some embodiments of the present hold and cool process . the heat source 202 of fig3 is operational when the joining operation carried out by the welding laser 201 is completed . for the particular example depicted in fig2 , the following process was employed after the laser welding process and laser 201 is off : b . cool to t 2 and hold for 2 - 15 minutes . produce less than 30 % γ ′. c . cool to t 3 and hold for 2 - 30 minutes . produce less than 30 % γ ′. d . cool to t 4 and hold for 0 . 1 - 2 hrs . produce less than 30 % γ ′. y . cool to t n , and hold for 1 - 20 hrs . ( n = 120 ) produce less than 30 % γ ′ z . cool to room temperature to produce final 30 % or less γ ′. in this process as depicted in fig2 , γ is depleted from al and ti through elemental partitioning until its final composition is reduced below the weldable line 100 in fig2 d . compositional change of γ is shown with spots t 1 - t n in fig2 a . fig2 e and 2c show the anticipated shift in the cooling curves and the stress vs . time curve after each hold step due to stress relief of the weld at each hold step . it is expected that the general hold and cool process as described herein can be used on almost any superalloy that experiences hot cracking as well as strain age cracking . elemental partitioning of al and ti during the hold portions of the process reduces the likelihood of strain age cracking and hot cracking . such partitioning also significantly reduces the tendency towards strain age cracking during post weld heat treatment since γ is substantially depleted from al and ti , and stress relieved , at each step of the hold and cool process . although various embodiments which incorporate the teachings of the present invention have been shown and described in detail herein , those skilled in the art can readily devise many other varied embodiments that still incorporate these teachings .	1
the accompanying drawings and the description which follows set forth this invention in its preferred embodiment . however , it is contemplated that persons generally familiar with welding systems and techniques will be able to apply the novel characteristics of the structures illustrated and described herein in other contexts by modification of certain details . accordingly , the drawings and description are not to be taken as restrictive on the scope of this invention , but are to be understood as broad and general teachings . referring now to the drawings in detail , wherein like reference characters represent like elements or features throughout the various views , the welding system of the present invention is indicated generally in the figures by reference character 10 . referring now in more detail to the embodiment chosen for the purpose of illustrating the present invention , reference numeral 10 a in fig1 denotes a metal tube having weld metal overlay 11 . a carbon and low alloy steel material is typical stock for tube 10 a , and alloy 625 is suitable weld overlay material 11 . however , the method and apparatus of the present invention are equally suitable for any other tube stock or other weld overlay material . the weld overlay material in the form of wire 11 a is applied at a first location 12 on tube 10 a by heating the tube boa using a high frequency wave pulse gas tungsten arc welding ( gtaw ) torch , or welding head , generally 13 , which is also known as a tungsten inert gas ( tig ) torch . gas tungsten arc welding power supply 20 provides power to the welding head 13 , and a wire feeder 15 associated with pre - heat holder 14 feeds metal overlay wire 11 a to location 12 . alternating current ( a . c .) power supply 16 preheats the weld wire overlay 11 a by resistance heating through cable 17 , and wire 11 a is fed through a holder 14 into the weld overlay location 12 . inert gas 19 is directed against weld overlay location 12 to protect the wire 11 a from oxidation . the inert gas is , in one preferred embodiment , a mixture of argon and helium , or a mixture of argon and hydrogen , with a flow rate of between 30 and 40 cfh ( cubic feet per hour ). the pre - heating of weld wire overlay 11 a is controlled by adjusting the current supplied to pre - heat holder 14 from the power supply 16 . the preheat holder 14 is , in one preferred embodiment , positioned at an angle of 30 to 60 degrees with respect to the welding head 13 . the gas tungsten arc welding head 13 , together with preheat holder 14 , is longitudinally advanced using a welding robot 22 mounted on a track 24 , while the tube stock 10 is simultaneously rotated beneath the torch 13 in the direction indicated by the arrow 18 . as shown in fig1 when viewed from the right end of tube stock 10 the tube ( fig2 ), tube 10 rotates in a clockwise direction , and the gtaw torch head 13 is preferably positioned at 20 to 35 degrees from the top of the tube stock . by , and in conjunction with , the addition of high frequency wave pulsing to the gtaw torch head , the tube stock overlay 28 can be produced with dilution of less than 20 %. during operation , the weld head 13 oscillates in a direction generally parallel to the longitudinal axis of the tube stock 10 , and the height of the weld head 13 is controlled through use of an automatic arc voltage control , which provides precise arc length . to control the temperature of the tube stock 10 a and to control the rate of cooling of the weld overlay metal , water flows through the tube stock 10 during the welding process , as shown in fig2 . as also shown in fig2 welding robot 22 is mounted on track 24 , and moves along the length of the tube stock 10 a while applying the overlay to tube 10 a in a single pass . in a preferred embodiment , one end of the tube stock is gripped in a chuck 30 , which is rotationally driven by an electric motor ( not shown ) or other suitable means . each end of the tube stock is capped by rotary unions with hoses 32 coupled to the rotary unions , which introduce water into one end of the tube stock and withdraws it from the other . the welding robot 22 arm extends through a suitable mounting bracket to hold welding head 13 and pre - heat holder 14 , preferably at an angle of 20 to 35 degrees from the top of the tube stock . during operation , the welding robot 22 moves along the longitudinal axis of the tube stock . the tube stock simultaneously rotates underneath the welding robot arm , while the weld pool is mechanically oscillated by the welding robot head in the longitudinal axis of the tube stock to provide a smooth surface finish . the speed at which the robot 22 moves along the axis of the tube stock is controlled with respect to the speed at which the tube is rotated , so the weld head 13 is advanced by a distance equal to the width of the weld bead for each rotation of the tube . to support the weight of the tube stock along its length , metal roller supports 34 are provided . these metal rollers 34 are positioned along the length of the tube stock . at the initiation of the weld overlay process , the robot 22 starts at the chuck end of the tube stock and moves on the track 24 along the axis of the tube stock until the desired length of weld overlay is completed . the position and movements of the welding robot 22 are controlled through control pendants or other operator interfaces , and specific welding parameters are preferably controlled through robot software interfaces . fig3 is a longitudinal cross sectional view of a tube with weld overlay . there are three primary zones in an overlaid pipe : ( 1 ) the weld ; ( 2 ) the heat - affected zone ; and ( 3 ) unaffected base metal . the boundary between the weld and the heat - affected zone is also known as the “ fusion boundary ”. the nature of the gas tungsten arc high frequency wave pulse welding process allows for extremely close control of the welding parameters . by close control of the welding parameters , the heat input on the tube stock can also be controlled . controlling the heat input during welding produces weld overlay with a generally accurate control of dilution , and a reduced heat - affected zone and solid uniform fusion line . this , along with a smooth and even exterior finish provided by the weld overlay system of the present invention , makes the overlaid tubes easier to bend and should prolong tube life . in one example of application of the present invention , tube stock 10 two and half inches ( 2 . 50 ″ o . d ) diameter sa - 210 material was weld - overlaid using gas tungsten arc high frequency pulse current with pre - heat of weld wire overlay . the tube stock was rotated at four ( 4 ) to seven ( 7 ) rotations per minute ( rpm ). cooling water with temperature of 80 to 120 degrees f . flowed through the tube at a rate of seven ( 7 ) to twelve ( 12 ) gallons per minute . overlay material alloy 625 in a form of weld wire with diameter of 0 . 045 inches was pre - heated by ac power supply 16 with frequency set at 30 to 80 hz at current amperage of 75 to 100 ac amps and 6 to 8 ac volts . the weld wire was shielded by a gas mixture of argon and helium , or a gas mixture of argon and hydrogen , at 35 to 40 cubic feet per hour ( cfh ). gas tungsten arc ( gtaw ) weld torch 13 was positioned at 20 to 35 degrees head angle and applied heat to tube stock 10 . the gtaw weld torch operated at a wave pulse frequency of between 300 and 600 hz , 200 to 400 amps , and voltage of 8 to 12 volts with a gas mixture of argon ( 25 %) and helium ( 75 %), or a gas mixture of argon ( 95 %) and hydrogen ( 5 %), and flow rate of 35 to 40 cubic feet per minute ( cfm ). weld overlay with deposit thickness of 0 . 070 ″ was deposited on the outer surface of the tube stock with a smooth surface finish . while preferred embodiments of the invention have been described using specific terms , such description is for present illustrative purposes only , and it is to be understood that changes and variations to such embodiments , including but not limited to the substitution of equivalent features or parts , and the reversal of various features thereof , may be practiced by those of ordinary skill in the art without departing from the spirit or scope of the present invention and the claims .	1
fig2 shows the layout of a pixel unit in a tft lcd panel manufactured according to the present invention . referring to fig2 a thin film transistor ( tft ) 201 serving as a switching device is disposed near the cross section of a scanning line 202 and a data line 203 in the pixel unit . a common electrode layer 204 at the bottom of the pixel unit is in the shape of a plate . a plurality of pixel electrodes 205 at the top of the pixel unit are in the shape of a comb or fingers . the pixel electrodes 205 are mutually disposed in parallel , and electrically connected together via at least a common contact ( not shown in fig2 ). the common electrode layer 204 electrically connects to the first source / drain electrode 207 of the tft 201 via a first connecting portion 206 . the top electrode of a storage capacitor 209 electrically connects to the common electrode layer 204 via a second connecting portion 208 . fig3 a to 3 f show the fabricating process of the pixel unit of the lcd panel ( fig2 ) according to a preferred embodiment of the present invention . in fig3 a to 3 f , the region i shows a cross sectional view of the tft 201 taken along line a - a ′ in fig2 ; the region ii shows a cross sectional view of the electrode structure taken along line b - b ′ in fig2 ; the region iii shows a cross sectional view of the storage capacitor 209 taken along line c - c ′ in fig2 ; and the region iv shows the region forming the common contact ( not shown in fig2 ) in a cross sectional view . the method of fabricating the pixel unit of the lcd panel in fig2 comprises the following steps . first , form a first conduction layer , for example a first metal layer ( metal - 1 ), on a substrate 300 . the substrate is a glass substrate or a quartz substrate . carry out the first photolithography process ( using the first mask ) to pattern and etch the first metal layer ( metal - 1 ), thereby forming a gate layer 301 and a bottom electrode layer 302 on the substrate 300 , as depicted in fig3 a . form a first isolation 303 over the substrate 300 . next , form an active layer on the first isolation layer 303 . the active layer is an amorphous silicon layer or a polysilicon layer . carry out the second photolithography process ( using the second mask ) to pattern and etch the active layer , thereby forming an island - like layer 304 over the gate layer 301 , as depicted in fig3 b . further , form a second conduction layer , for example a second metal layer ( metal - 2 ), over the substrate 300 . although the first and second conduction layers are metal layers in this embodiment , they also can be polysilicon layers . carry out the third photolithography process ( using the third mask ) to pattern and etch the second metal layer ( metal - 2 ), thereby forming a first source / drain electrode 305 , a second source / drain electrode 306 , a top electrode layer 307 , and a common contact layer 308 , as depicted in fig3 c . it is noted that the first and second source / drain electrodes ( 305 , 306 ) respectively overlap side portions of the island - like layer 304 . the island - like layer 304 , serving as the channel region of the tft 201 ( fig2 ), is revealed between the first and second source / drain electrodes ( 305 and 306 ). the bottom electrode layer 302 , the top electrode layer 307 , and the first isolation layer 303 constitute a storage capacitor of the pixel unit in the lcd panel . subsequently , form a second isolation layer 309 over the substrate 300 . form a third conduction layer , for example a first ito layer ( ito 1 ), on the second isolation layer 309 . carry out the fourth photolithography process ( using the fourth mask ) to pattern and etch the first ito layer ( ito 1 ), thereby forming a common electrode layer 310 , as depicted in fig3 d . further , form a third isolation layer 311 over the substrate 300 . then , carry out the fifth photolithography process ( using the fifth mask ) to pattern and etch the third and second isolation layers ( 311 and 309 ), thereby forming a first opening ( or contact hole )( op 1 ), a second opening ( op 2 ), a third opening ( op 3 ), a fourth opening ( op 4 ), and at least a fifth opening ( op 5 ), as depicted in fig3 e . it is noted that the first source / drain electrode 305 is revealed in the first opening ( op 1 ), the common electrode layer 310 is revealed in the second and third openings ( op 2 and op 3 ), the top electrode layer 307 is revealed in the fourth opening ( op 4 ), and the common contact layer 308 is revealed in the fifth opening ( op 5 ). subsequently , form a fourth conduction layer , for example a second ito layer ( ito 2 ), on the isolation layer 311 , wherein the second ito layer ( ito 2 ) fills into the first to fifth openings . ( op 1 ˜ op 5 ). further , carry out the sixth photolithography process ( using the sixth mask ) to pattern and etch the second ito layer ( ito 2 ), thereby forming a plurality of pixel electrodes 312 , a first connecting layer 313 , and a second connecting layer 314 on the third isolation layer 311 , as depicted in fig3 f . it is noted that the first source / drain electrode 305 in the first opening op 1 and the common electrode layer 310 in the second opening op 2 are electrically connected via the first connecting layer 313 . the common electrode layer 310 in the third opening op 3 and the top electrode layer 307 in the fourth opening op 4 are electrically connected via the second connecting layer 314 . the pixel electrodes 312 electrically connect to the common contact layer 308 through the fifth opening op 5 . from the above descriptions , the features of the present invention are quite clear . after forming the second isolation layer 309 , no step of forming contact holes ( or openings ) is immediately carried out , according to the present invention . instead , the required openings or contact holes ( op 1 ˜ op 5 ) are formed together after forming the third isolation layer 311 and the required circuitry is formed by defining the second ito layer ( ito 2 ) at the non - pixel and opaque region thereof , whereby only six masks are required to manufacture the pixel unit of the lcd panel and the cost is reduced . while the invention has been described by way of example and in terms of the preferred embodiment , it is to be understood that the invention is not limited to the disclosed embodiments . on the contrary , it is intended to cover various modifications and similar arrangements as would be apparent to those skilled in the art . therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements .	7
the method for surface modification of synthetic , artificial and natural polymers and polymer compositions using metals , non - metals and gases , according to the invention , comprises implanting accelerated ions of any chemical element in the polymer material at low energies , mainly within the range of from 10 2 to 10 7 electronvolts . the process of implantation is accomplished at low , room or high temperatures of the polymer material , these temperatures being within the limits of its resistance . the quantity of implanted ions ( or the so called &# 34 ; dose of implantation &# 34 ;) is 10 10 to 10 23 ions / cm 2 . the current ( i . e . density of the ion beam ) is of from 10 - 8 a / cm 2 to 10 - 2 a / cm 2 . the depth of penetration of the ions implanted into the polymer material is up to 10 - 6 m . this method is applicable for the implantation of ions of all the elements included in the periodic chart into all types of polymer materials . accelerated ions of given chemical element are implanted into the polymer materials subject to a surface modification . for this purpose , ions of a given element ( together with ions of other substances arising directly from this chemical element or from its compounds ) are obtained within an ion source . the ions thus obtained are accelerated and passed through an electromagnetic separator wherein they are separated based on their masses , and the ions of a selected element are directed to the material being treated . this electromagnetic separation of the ions ensures an absolute purity of the implanted element ( at an isotopic level ) and makes the implanting installation universally applicable . if a high purity of the element which is implanted is not required by the technological purposes of the process , a simplification of the installation is possible by elimination of the electromagnetic separator . a high precision dosage of implantation is possible by measuring the ion beam density during the process of implantation and period of its action upon the polymer material . depending on the energy and atomic number of the accelerated ions and the type of polymer material used , a certain depth of penetration of accelerated ions is reached and a space modified layer is formed , having a modified and qualitatively new structure . this method can be used in the metallization of polymer surfaces by ion implantation especially for : creation of thin metal conductive layers on various plastics ; coating by metallization of foil materials for capacitors ; cooling by metallization of polymer surfaces having both heat and light reflective properties intended for agricultural needs , civil engineering and solar energy recovery ; antistatic coatings on parts used in surgery and antiseptic coatings with medical application ; coating by metallization of fabrics having heat reflective properties , intended for the preparation of clothes , sport articles , articles for everyday use and decorative use ; and improvement of surface properties of wood boards and marking of securities . metal implantation modified polymer surfaces can serve as a stable sublayer for the application of metal coatings thereto by known methods so as to fix the metal of the coating onto the implantation modified metal sublayer rather than onto the polymer material . moreover , the method of ion implantation modification of polymers provides for successive complex implantation of an arbitrary number of metals . polymer materials with their surface modified by non - metal implantation can be used for semiconductor elements ( such as layers of silicon , germanium , selenium , tellurium , etc ) on plastic supports ; implantation of carbon to form new phases ; thin heat resistance coatings based on silicon ; inclusion of various non - metal admixtures having an effect on the process of ageing ( i . e . photo , electrical , mechanical ageing , etc ) of polyethylene modification of the surface optical properties . the layers formed by non - metal implantation can serve as sublayers for an additional application of coatings with various substances as well as by other known methods . polymer materials modified by gas implantation can be used : in increasing the adhesiveness of polymer surfaces to paints , adhesive compositions and printing inks ; and for improvement of the surface quality of packing materials and development of new packing materials of useful properties . polymer materials modified by gas implantation can serve as sublayers for application of coatings by other known methods . simultaneously , the method ensures the possibility of implanting successively an arbitrary number of elements for the gaseous state . the advantage of the method of the invention , is that ions of the required metal or non - metal can be produced in the ion source while using an insignificant quantity ( i . e . dozens of square meters of area are treated with a quantity of the order of grams ) of low price salts , essentially chalcogens of low melting points , without any limit of their purity being set , due to the electromagnetic separation , which ensures an absolute purity of the element being implanted . the other advantages of the method so proposed are as follows : a strong bond between implanted metal and polymer material is formed , ensured by internal structural bonds , where said metal forms a layer , which is not practically affected by mechanical actions ( i . e . the layer does not crack or disconnect when rubbed , folded , crumpled etc .). moreover , the adhesion force of the implanted layer is so high that the need for additional fixing varnished and coatings as well as preliminary treatment of the polymer surfaces is eliminated . when necessary , the polymer surface can be metallized using a metal of maximal purity ( at an isotopic level ) so that high precision control of the quantity of metal implanted is possible by measuring the ion current during the process of implantation . the surface electrical resistance of the polymer materials can be varied ( i . e . reduced ) in a wide range ( of from 10 14 ohms to 10 6 ohms or less ) according to the dose of the metal being implanted . 1 . aluminum ions are implanted into an impregnated fabric ( nylon 6 ) under the following conditions : e = 16 kev , d = 10 16 ions / cm 2 , i = 10 μa / cm 2 . 2 . tin ions are implanted into a low density polyethylene foil ( ropoten ob - 03 - 110 ) under the following conditions : e = 40 kev , d = 7 . 10 16 ions / cm 2 , i = 4 μa / cm 2 . 3 . nickelous ions are implanted into a cotton fabric under the following conditions : e = 26 kev , d = 6 . 10 16 ions / cm 2 , i = 5 μa / cm 2 . 4 . aluminum ions are implanted into synthetic fabric ( jambolen ) under the following conditions : e = 26 kev , d = 5 . 10 16 ions / cm 2 , i = 2 μa / cm 2 . 5 . boron ions are implanted in polyethylene foil under the following conditions : e = 15 kev , d = 2 . 10 16 ions / cm 2 , i = 2 μa / cm 2 . 6 . phosphorus ions are implanted into a polystyrene foil under the following conditions : e = 30 kev , d = 2 . 10 16 ions / cm 2 , i = 1 μa / cm 2 . 7 . silicon ions are implanted into a synthetic fabric under the following conditions : e = 25 kev , d = 10 16 ions / cm 2 , i = 2 μa / cm 2 . 8 . carbon ions are implanted into polypropylene under the following conditions : e = 25 kev , d = 5 . 10 16 ions / cm 2 , i = 10 μa / cm 2 . 9 . oxygen ions are implanted into a polyethylene foil under the following conditions : e = 15 kev , d = 10 16 ions / cm 2 , i = 5 μa / cm 2 . in these examples e is the energy of the accelerated ions in kiloelectronvolt , d is the dose of implantation and i is the density of the ion beam in μa / cm 2 . in all of the above given examples the working vacuum was of the order of 10 - 5 to 10 - 4 torr . polymers modified by metal or non - metal implantation showed a reduced surface electrical resistance in the range of from 10 6 to 10 7 ohms at the dosages given above .	3
( in the formula , r 1 — and r 2 — are each ( i ) or ( ii ) below , and at least one of r 1 — and r 2 — is ( i ). ( where ar 1 represents an aromatic hydrocarbon group or heteroaromatic group which may have a substituent , ar 2 represents an aromatic hydrocarbon group which may have a substituent or a heteroaromatic group which may have a substituent , and r ′ represents a hydrogen atom , a trialkylsilyl group having an alkyl group having 1 to 4 carbon atoms , an alkyl group having 1 to 20 carbon atoms , or an aromatic hydrocarbon group or heteroaromatic group which may have a substituent .) an alkyl group having 2 to 20 carbon atoms , an alkenyl group having 2 to 20 carbon atoms , an alkyl group having a halogen atom and 2 to 20 carbon atoms , an alkoxyalkyl group having 3 to 20 carbon atoms , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , an alkylaminoalkyl group having 3 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group , and an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having 1 to 20 carbon atoms , an alkenyl group having 2 to 20 carbon atoms , an alkyl group having a halogen atom and 1 to 20 carbon atoms , an alkoxyalkyl group having 3 to 20 carbon atoms , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , or an alkylaminoalkyl group having 3 to 20 carbon atoms .) 2 . the benzothienobenzothiophene derivative according to item 1 , represented by general formula ( 4 ) below . ( in the formula , r 1 — is a group represented by general formula ( 2 ) or ( 3 ) below : ( where ar 1 , ar 2 , and r ′ represent the same as the above , and r 2 — is a group selected from an alkyl group having 2 to 20 carbon atoms , an alkenyl group having 2 to 20 carbon atoms , an alkyl group having a halogen atom and 2 to 20 carbon atoms , an alkoxyalkyl group having 3 to 20 carbon atoms , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , an alkylaminoalkyl group having 3 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group , and an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having 1 to 20 carbon atoms , an alkenyl group having 2 to 20 carbon atoms , an alkyl group having a halogen atom and 1 to 20 carbon atoms , an alkoxyalkyl group having 3 to 20 carbon atoms , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , or an alkylaminoalkyl group having 3 to 20 carbon atoms .) 3 . an organic semiconductor material using the benzothienobenzothiophene derivative according to item 1 or 2 . 4 . an organic semiconductor ink containing the organic semiconductor material according to item 3 . 5 . an organic semiconductor film containing the organic semiconductor material according to item 3 . 6 . an organic semiconductor device produced by using the organic semiconductor material according to item 3 . 7 . an organic transistor including the organic semiconductor material according to item 3 as an organic semiconductor layer . the compound represented by general formula ( 1 ) is a compound having a btbt skeleton having substituents , and characterized in that at least one of the substituents is a group which comprises a particular arylene acetylene structure , or is represented by general formula ( 2 ) or ( 3 ), and the other is a group selected from an alkyl group having 2 to 20 carbon atoms , an alkenyl group having 2 to 20 carbon atoms , an alkyl group having a halogen atom and 2 to 20 carbon atoms , an alkoxyalkyl group having 3 to 20 carbon atoms , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , an alkylaminoalkyl group having 3 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having 2 to 20 carbon atoms or an alkenyl group having 2 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having a halogen atom and 2 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkoxyalkyl group having 3 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , and an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkylaminoalkyl group having 3 to 20 carbon atoms , and a group represented by general formula ( 2 ) or ( 3 ). in the organic semiconductor material of the present invention , a btbt ring is connected to an aromatic ring with an acetylene site therebetween . this structure contributes to an improvement in the mobility due to the extension of the π - conjugated plane and the exhibition of a high - order liquid crystal phase due to the suppression of a rotational movement of the btbt ring and the substituents . thus , a semiconductor element which has a high mobility and in which the variation in mobility is small can be realized . at least one of r 1 and r 2 of the compound represented by general formula ( 1 ) of the present invention is ar 1 of the substituent represented by general formula ( 2 ) is not particularly limited as long as ar 1 is an aromatic hydrocarbon group which may have a substituent or a heteroaromatic group which may have a substituent . for example , ar 1 may be any of the following groups . examples of the aromatic hydrocarbon group which may have a substituent include unsubstituted monocyclic or polycyclic aromatic hydrocarbon groups having 6 to 24 carbon atoms , such as a phenyl group , a naphthyl group , an azulenyl group , an acenaphthenyl group , an anthranyl group , a phenanthryl group , a naphthacenyl group , a fluorenyl group , a pyrenyl group , a chrysenyl group , a perylenyl group , a biphenyl group , a p - terphenyl group , and a quaterphenyl group ; alkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkyl group having 1 to 18 carbon atoms , such as o - tolyl group , a m - tolyl group , a p - tolyl group , a 2 , 4 - xylyl group , a 2 , 6 - xylyl group , a mesityl group , a duryl group , a 4 - ethylphenyl group , a 4 - n - propylphenyl group , a 4 - isopropylphenyl group , a 4 - n - butylphenyl group , a 4 - n - pentyl phenyl group , a 4 - n - hexylphenyl group , a 4 - n - decaphenyl group , a 4 - stearylphenyl group , and a 9 , 9 ′- dihexylfluorenyl group ; alkenyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with , an alkenyl group having 2 to 20 carbon atoms , such as a styryl group , a 4 - butenylphenyl group , and a 4 - octadecenylphenyl group ; halogenated aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with a halogen , e . g ., a fluorine atom , a chlorine atom , or a bromine atom , such as a 4 - fluorophenyl group , a 2 , 6 - fluorophenyl group , a 4 - chlorophenyl group , and a 2 , 3 , 4 , 5 , 6 - perfluorophenyl group ; alkoxyalkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkoxyalkyl group having 3 to 20 carbon atoms , such as a 4 -( 2 - ethoxyethyl ) phenyl group , a 4 -( 2 - n - hexyloxyethyl ) phenyl group , a 4 -( 2 - n - heptyloxyethyl ) phenyl group , a 4 -( 2 - n - tetradecyloxyethyl ) phenyl group , a 4 -( 2 - cyclohexyloxyethyl ) phenyl group , a 4 -( 12 - ethoxydodecyl ) phenyl group , and a 4 -( cyclohexyloxyethyl ) phenyl group ; alkylsulfanylalkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted , with an alkylsulfanylalkyl group having 3 to 20 carbon atoms , such as a 4 -( methyl sulfanylpropyl ) phenyl group , a 4 -( 2 - n - hexylsulfanylethyl ) phenyl group , a 4 -( 3 - n - decylsulfanylpropyl ) phenyl group , and a 4 -( cyclohexylsulfanylpropyl ) phenyl group ; and alkylaminoalkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkylaminoalkyl group having 3 to 20 carbon atoms , such as a 4 -( 3 - octylaminopropyl ) phenyl group , a 4 -( 3 - dodecylaminopropyl ) phenyl group , and a 4 -( diethylaminoethyl ) phenyl group . examples of the heteroaromatic group which may have a substituent include 5 - membered or 6 - membered heteroaromatic groups such as a pyrrolyl group , an indolyl group , a furyl group , a thienyl group , an imidasolyl group , a benzofuryl group , a triazolyl group , benzotriazolyl group , a benzothienyl group , a pyrazolyl group , an indolizinyl group , a quinolinyl group , an isoquinolinyl group , a carbazolyl group , a dibenzofuranyl group , a dibenzotniophenyl group , an indolinyl group , a thiazolyl group , a pyridyl group , a pyrimidyl group , a pyrazinyl group , a pyridazinyl group , a thiadiazinyl group , an oxadiazolyl group , a benzoquinolinyl group , a thiadiazolyl group , a pyrrolothiazolyl group , a pyrrolopyridazinyl group , a tetrazolyl group , and an oxazolyl group , and polycyclic heteroaromatic groups in which benzene is fused , to any of the heteroaromatic groups ; alkyl - substituted heteroaromatic groups in which any of the heteroaromatic groups is substituted with an alkyl group having 1 to 20 carbon atoms , such as a 5 - methylthienyl group , a 5 - hexylthienyl group , a 5 - decathienyl group , and a 5 - stearylthienyl group ; halogenated heteroaromatic groups in which any of the heteroaromatic groups is substituted with a halogen , e . g ., a fluorine atom , a chlorine atom , or a bromine atom , such as a fluoropyridinyl group and a fluoroindolyl group ; alkoxyalkyl - substituted heteroaromatic groups in which any of the aromatic hydrocarbon groups is substituted with an alkoxyalkyl group having 3 to 20 carbon atoms , such as a 5 -( 2 - ethoxyethyl ) thienyl group , a 5 -( 2 - n - tetradecyloxyethyl ) thienyl group , a 5 -( 2 - cyclohexyloxyethyl ) thienyl group , and a 5 -( 2 - ethoxydodecyl ) thienyl group ; alkylsulfanylalkyl - substituted heteroaromatic groups in which any of the aromatic hydrocarbon groups is substituted with an alkylsulfanylalkyl group having 3 to 20 carbon atoms , such as a 5 -( methylsulfanylpropyl ) thienyl group , a 5 -( 2 - n - hexylsulfanylethyl ) thienyl group , a 5 -( 3 - n - decylsulfanylpropyl ) thienyl group , and a 5 -( cyclohexylsulfanylpropyl ) thienyl group ; and alkylaminoalkyl - substituted heteroaromatic groups in which any of the heteroaromatic groups is substituted with an alkylaminoalkyl group having 3 to 20 carbon atoms , such as a 5 -( 3 - octylaminopropyl ) thienyl group , a 5 -( 3 - dodecylaminopropyl ) thienyl group , and a 5 -( diethylaminoethyl ) thienyl group . from the viewpoint of exhibiting a high - order liquid crystal phase and suppressing she variation in mobility due to the high - order liquid crystal phase , among the above groups , ar 1 is preferably an aromatic hydrocarbon group or heteroaromatic group which has a substituent , and particularly preferably an aromatic hydrocarbon group or heteroaromatic group which has a substituent having 1 to 12 carbon atoms . ar 2 of the substituent represented by general formula ( 3 ) is not particularly limited as long as ar 2 is an aromatic hydrocarbon group which may have a substituent or a heteroaromatic group which may have a substituent . for example , ar 2 may be any of the following groups . examples thereof include monocyclic or polycyclic aromatic hydrocarbon groups having 6 to 24 carbon atoms , such as a phenylene group , a naphthylene group , an azulenylene group , an acenaphthenylene group , an anthrylene group , a phenanthrylene group , a naphthacenylene group , a fluorenylene group , a pyrenylene group , a chrysenylene group , a perylenylene group , a biphenylene group , a p - terphenylene group , and a quaterphenylene group ; alkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkyl group having 1 to 10 carbon atoms , such as a tolylene group , a xylylene group , an ethylphenylene group , a propylphenylene group , a butylphenylene group , a methylnaphthylene group , and a 9 , 9 ′- dihexylfluorenylene group ; and halogenated aromatic , hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with a halogen , e . g ., a fluorine atom , a chlorine atom , or a bromine atom , such as a fluorophenylene group , a chlorophenylene group , and a bromophenylene group . furthermore , heteroaromatic groups such as thienylene and pyridylene and heteroaromatic groups , and heteroaromatic groups which is substituted with a substituent may also be used . r ′ of the substituent represented by general formula ( 3 ) is not particularly limited as long as r ′ is a hydrogen atom , a trialkylsilyl group having an alkyl group having 1 to 4 carbon atoms , an alkyl group having 1 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group which may have a substituent . for example , r ′ may be any of the following groups . examples of the trialkylsilyl group having an alkyl group having 1 to 4 carbon atoms include a trimethylsilyl group , a triethylsilyl group , a tri - n - propylsilyl group , a tri - isopropylsilyl group , a tri - n - butylsilyl , and a tri - sec - butyl group . examples of the alkyl group having 1 to 20 carbon atoms include linear , branched , or cyclic alkyl groups such as a methyl group , an ethyl group , a n - propyl group , an isopropyl group , a n - butyl group , an isobutyl group , a n - pentyl group , an isopentyl group , a neopentyl group , a n - hexyl group , a 1 - methylpentyl group , a 4 - methyl - 2 - pentyl group , a 3 , 3 - dimethylbutyl group , a 2 - ethylbutyl group , a n - heptyl group , a 1 - methylhexyl group , a cyclohexylmethyl group , a n - octyl group , a tert - octyl group , a 1 - methylheptyl group , a 2 - ethylhexyl group , a 2 - propylpentyl group , a n - nonyl group , a 2 , 2 - dimethylheptyl group , a 2 , 6 - dimethyl - 4 - heptyl group , a 3 , 5 , 5 - trimethylhexyl group , a n - decyl group , a n - undecyl group , a 1 - methyldecyl group , a n - dodecyl group , a n - tridecyl group , a 1 - hexylheptyl group , a n - tetradecyl group , a n - pentadecyl group , a n - hexadecyl group , a n - heptadecyl group , a n - octadecyl group , a n - eicosyl group , a cyclopentyl group , a cyclohexyl group , a 4 - methylcyclohexyl group , a cycloheptyl group , and a cyclooctyl group . examples of the aromatic hydrocarbon group which may have a substituent include monocyclic or polycyclic aromatic hydrocarbon groups having 6 to 24 carbon atoms , such as a phenyl group , a naphthyl group , an azulenyl group , an acenaphthenyl group , an anthranyl group , a phenanthryl group , a naphthacenyl group , a fluorenyl group , a pyrenyl group , a chrysenyl group , a perylenyl group , a biphenyl group , a p - terphenyl group , and a quaterphenyl group ; alkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkyl group having 1 to 18 carbon atoms , such as o - tolyl group , a m - tolyl group , a p - tolyl group , a 2 , 4 - xylyl group , a 2 , 6 - xylyl group , a mesityl group , a duryl group , a 4 - ethylphenyl group , a 4 - n - propylphenyl group , a 4 - isopropylphenyl group , a 4 - n - butylphenyl group , a 4 - n - pentylphenyl group , a 4 - n - hexylphenyl group , a 4 - n - decaphenyl group , a 4 - stearylphenyl group , and a 9 , 9 ′- dihexylfluorenyl group ; alkenyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkenyl group having 2 to 20 carbon atoms , such as a styryl group , a 4 - butenylphenyl group , and a 4 - octadecenylphenyl group ; halogenated aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with a halogen , e . g ., a fluorine atom , a chlorine atom , or a bromine atom , such as a 4 - fluorophenyl group , a 2 , 6 - fluorophenyl group , a 4 - chlorophenyl group , and a 2 , 3 , 4 , 5 , 6 - perfluorophenyl group ; alkoxyalkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkoxyalkyl group having 3 to 20 carbon atoms , such as a 4 -( 2 - ethoxyethyl ) phenyl group , a 4 -( 2 - n - hexyloxyethyl ) phenyl group , a 4 -( 2 - n - heptyloxyethyl ) phenyl group , a 4 -( 2 - n - tetradecyloxyethyl ) phenyl group , a 4 -( 2 - oyclohexyloxyethyl ) phenyl group , a 4 -( 12 - ethoxydodecyl ) phenyl group , and a 4 -( cyclohexyloxyethyl ) phenyl group ; alkylsulfanylalkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkylsulfanylalkyl , group having 3 to 20 carbon atoms , such as a 4 -( methylsulfanylpropyl ) phenyl group , a 4 -( 2 - n - hexylsulfanylethyl ) phenyl group , a 4 -( 3 - n - decylsulfanylpropyl ) phenyl group , and a 4 -( cyclohexylsulfanylpropyl ) phenyl group ; and alkylaminoalkyl - substituted aromatic hydrocarbon groups in which any of the aromatic hydrocarbon groups is substituted with an alkylaminoalkyl group having 3 to 20 cartoon atoms , such as a 4 -( 3 - octylaminopropyl ) phenyl group , a 4 -( 3 - dodecylaminopropyl ) phenyl group , and a 4 -( diethylaminoethyl ) phenyl group . examples of the heteroaromatic group which may have a substituent include 5 - membered or 6 - membered heteroaromatic groups such as a pyrrolyl group , an indolyl group , a furyl group , a thienyl group , an imidazolyl group , a benzofuryl group , a triazolyl group , benzotriazolyl group , a benzothienyl group , a pyrazolyl group , an indolizinyl group , a quinolinyl group , an isoquinolinyl group , a carbazolyl group , a dibenzofuranyl group , a dibenzothiophenyl group , an indolinyl group , a thiazolyl group , a pyridyl group , a pyrimidyl group , a pyrazinyl group , a pyridazinyl group , a thiadiazinyl group , an oxadiazolyl group , a benzoquinolinyl group , a thiadiazolyl group , a pyrrolothiazolyl group , a pyrrolopyridazinyl group , a tetrazolyl group , and an oxazolyl group , and polycyclic heteroaromatic groups in which benzene is fused to any of the heteroaromatic groups ; alkyl - substituted heteroaromatic groups in which any of the heteroaromatic groups is substituted with an alkyl group having 1 to 20 carbon atoms , such as a 5 - methylthienyl group , a 5 - hexylthienyl group , a 5 - decathienyl group , and a 5 - stearylthienyl group ; halogenated heteroaromatic groups in which any of the heteroaromatic groups is substituted with a halogen , e . g ., a fluorine atom , a chlorine atom , or a bromine atom , such as a fluoropyridinyl group and a fluoroindolyl group ; alkoxyalkyl - substituted heteroaromatic groups in which any of the aromatic hydrocarbon groups is substituted with an alkoxyalkyl group having 3 to 20 carbon atoms , such as a 5 -( 2 - ethoxyethyl ) thienyl group , a 5 -( 2 - n - tetradecyloxyethyl ) thienyl group , a 5 -( 2 - cyclohexyloxyethyl ) thienyl group , and a 5 -( 12 - ethoxydodecyl ) thienyl group ; alkylsulfanylalkyl - substituted heteroaromatic groups in which any of the aromatic hydrocarbon groups is substituted with an alkylsulfanylalkyl group having 3 to 20 carbon atoms , such as a 5 -( methylsulfanylpropyl ) thienyl group , a 5 -( 2 - n - hexylsulfanylethyl ) thienyl group , a 5 -( 3 - n - decylsulfanylpropyl ) thienyl group , and a 5 -( cyclohexylsulfanylpropyl ) thienyl group ; and alkylaminoalkyl - substituted heteroaromatic groups in which any of the heteroaromatic groups is substituted with an alkylaminoalkyl group having 3 to 20 carbon atoms , such as a 5 -( 3 - octylaminopropyl ) thienyl group , a 5 -( 3 - dodecylaminopropyl ) thienyl group , and a 5 -( diethylaminoethyl ) thienyl group . next , the other one of r 1 or r 2 of the compound represented by general formula ( 1 ) of the present invention is ( i ) a substituent represented by general formula ( 2 ) or general formula ( 3 ) above , or ( ii ) a group selected from an alkyl group having 2 to 20 carbon atoms , an alkenyl group having 2 to 20 carbon atoms , an alkyl group having a halogen atom and 2 to 20 carbon atoms , an alkoxyalkyl group having 3 to 20 carbon atoms , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , an alkylaminoalkyl group having 3 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having 2 to 20 carbon atoms or an alkenyl group having 2 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having a halogen atom and 2 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkoxyalkyl group having 3 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , and an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkylaminoalkyl group having 3 to 20 carbon atoms . examples of ( ii ) will be described . examples of the alkyl group having 2 to 20 carbon atoms include linear , branched , or cyclic alkyl groups such as an ethyl group , a n - propyl group , an isopropyl group , a n - butyl group , an isobutyl group , a n - pentyl group , an isopentyl group , a neopentyl group , a n - hexyl group , a 1 - methylpentyl group , a 4 - methyl - 2 - pentyl group , a 3 , 3 - dimethylbutyl group , a 2 - ethylbutyl group , a n - heptyl group , a 1 - methylhexyl group , a cyclohexylmethyl group , a n - octyl group , a tert - octyl group , a 1 - methylheptyl group , a 2 - ethylhexyl group , a 2 - propylpentyl group , a n - nonyl group , a 2 , 2 - dimethylheptyl group , a 2 , 6 - dimethyl - 4 - heptyl group , a 3 , 5 , 5 - trimethylhexyl group , a n - decyl group , a n - undecyl group , a 1 - methyldecyl group , a u - dodecyl group , a n - tridecyl group , a 1 - hexylheptyl group , a n - tetradecyl group , a n - pentadecyl group , a n - hexadecyl group , a n - heptadecyl group , a n - octadecyl group , a n - eicosyl group , a cyclopentyl group , a cyclohexyl group , a 4 - methylcyclohexyl group , a cycloheptyl group , and a cyclooctyl group . examples of the alkenyl group having 2 to 20 carbon atoms include linear , branched , or cyclic alkenyl groups such as a vinyl group , an allyl group , a butenyl group , a pentenyl group , a hexenyl group , a heptenyl group , an octenyl group , a decenyl group , a dodecenyl group , a tetradecenyl group , a hexadecenyl group , an octadecenyl group , a methylpentenyl group , cyclohexene , and 4 - methyl cyclohexene . examples of the alkyl group having a halogen atom and 2 to 20 carbon atoms include alkyl groups in which some of hydrogen atoms of any of the alkyl groups having 2 to 20 carbon atoms are substituted with fluorine atoms , such as a 2 , 2 , 3 , 3 , 3 - pentafluoropropyl group , a 2 , 2 , 3 , 3 , 4 , 4 , 4 - heptafluorobutyl group , a 2 , 2 , 3 , 3 , 4 , 4 , 5 , 5 , 5 - nonafluoropentyl group , a 2 , 2 , 3 , 3 , 4 , 4 , 5 , 5 , 6 , 6 , 6 - undecafluorohexyl group , and a 2 , 2 , 3 , 3 , 4 , 4 , 5 , 5 , 6 , 6 , 7 , 8 , 8 , 8 - pentadecafluorooctyl group . examples of the alkoxyalkyl group having 3 to 20 carbon atoms include linear , branched , or cyclic alkoxyalkyl groups such as a 2 - methoxyethyl group , a 2 - ethoxyethyl group , a 2 - n - propoxyethyl group , a 2 - isopropoxyethyl group , a 2 - n - butoxyethyl group , a 2 - n - hexyloxyethyl group , a 2 -( 2 ′- ethylbutyloxy ) ethyl group , a 2 - n - heptyloxyethyl group , a 2 - n - octyloxyethyl group , a 2 -( 2 ′- ethylhexyloxy ) ethyl group , a 2 - n - decyloxyethyl group , a 2 - n - dodecyloxyethyl group , a 2 - n - tetradecyloxyethyl group , a 2 - cyclohexyloxyethyl group , a 2 - methoxypropyl group , a 3 - methoxypropyl group , a 3 - ethoxypropyl group , a 3 - n - propoxypropyl group , a 3 - isopropoxypropyl group , a 3 - n - butoxypropyl group , a 3 - pentyloxypropyl group , a 3 - n - hexyloxypropyl group , a 3 -( 2 - ethylbutoxy ) propyl group , a 3 - n - octyloxypropyl group , a 3 -( 2 ′- ethylhexyloxy ) propyl group , a 3 - n - decyloxypropyl group , a 3 - n - dodecyloxypropyl group , a 3 - n - tetradecyloxypropyl group , a 3 - cyclohexyloxypropyl group , a 4 - methoxybutyl group , a 4 - ethoxybutyl group , a 4 - n - propoxybutyl group , a 4 - isopropoxybutyl group , a 4 - n - butoxybutyl group , a 4 - n - hexyloxybutyl group , a 4 - n - octyloxybutyl group , a 4 - n - decyloxybutyl group , a 4 - n - dodecyloxybutyl group , a 5 - methoxypentyl group , a 5 - ethoxypentyl group , a 5 - n - propoxypentyl group , a 5 - n - pentyloxypentyl group , a 6 - methoxyhexyl group , a 6 - ethoxyhexyl group , a 6 - isopropoxyhexyl group , a 6 - n - butoxyhexyl group , a 6 - n - hexyloxyhexyl group , a 6 - n - decyloxyhexyl group , a 4 - methoxycyclohexyl group , a 7 - methoxyheptyl group , a 7 - ethoxyheptyl group , a 7 - isopropoxyheptyl group , a 8 - methoxyoctyl group , a 8 - ethoxyoctyl group , a 9 - methoxynonyl group , a 9 - ethoxynonyl group , a 10 - methoxydecyl group , a 10 - ethoxydecyl group , a 10 - n - butoxydecyl group , a 11 - methoxyundecyl group , a 12 - methoxydodecyl group , a 12 - ethoxydodecyl group , a 12 - isopropoxydodecyl group , a 14 - methoxytetradecyl group , a cyclohexyloxyethyl group , and a cyclobexyloxypropyl group . examples of the alkylsulfanylalkyl group having 2 to 20 carbon atoms include alkylsulfanylalkyl groups such as a methylsulfanylpropyl group , an ethylsulfanylpropyl group , a butylsulfanylpropyl group , and a dodecylsulfanylpropyl group ; and linear , branched , or cyclic alkylsulfanylalkyl groups such as a 2 - methylsulfanylethyl group , a 2 - ethylsulfanylethyl group , a 2 - n - propylsulfanylethyl group , a 2 - isopropylsulfanylethyl group , a 2 - n - butylsulfanylethyl group , a 2 - n - hexylsulfanylethyl group , a 2 -( 2 ′- ethylbutylsulfanyl ) ethyl group , a 2 - n - heptylsulfanylethyl group , a 2 - n - octylsulfanylethyl group , a 2 -( 2 ′- ethylhexylsulfanyl ) ethyl group , a 2 - n - decylsulfanylethyl group , a 2 - n - dodecylsulfanylethyl group , a 2 - n - tetradecylsulfanylethyl group , a 2 - cyclohexylsulfanylethyl group , a 2 - methylsulfanylpropyl group , a 3 - methylsulfanylpropyl group , a 3 - ethylsulfanylpropyl group , a 3 - n - propylsulfanylpropyl group , a 3 - isopropylsulfanylpropyl group , a 3 - n - butylsulfanylpropyl group , a 3 - n - pentylsulfanylpropyl group , a 3 - n - hexylsulfanylpropyl group , a 3 -( 2 ′- ethylbutylsulfanyl ) propyl group , a 3 - n - octylsulfanylpropyl group , a 3 -( 2 ′- ethylhexylsulfanyl ) propyl group , a 3 - n - decylsulfanylpropyl group , a 3 - n - dodecylsulfanylpropyl group , a 3 - n - tetradecylsulfanylpropyl group , a 3 - cyclohexylsulfanylpropyl group , a 4 - methylsulfanylbutyl group , a 4 - ethylsulfanylbutyl group , a 4 - n - propylsulfanylbutyl group , a 4 - isopropylsulfanylbutyl group , a 4 - n - butylsulfanylbutyl group , a 4 - n - hexylsulfanylbutyl group , a 4 - n - octylsulfanylbutyl group , a 4 - n - decylsulfanylbutyl group , a 4 - n - dodecylsulfanylbutyl group , a 5 - methylsulfanylpentyl group , a 5 - ethylsulfanylpentyl group , a 5 - n - propylsulfanylpentyl group , a 5 - n - pentylsulfanylpentyl group , a 6 - methylsulflanylhexyl group , a 6 - ethylsulfanylhexyl group , a 6 - isopropylsulfanylhexyl group , a 6 - n - butylsulfanylhexyl group , a 6 - n - hexylsulfanylhexyl group , a 6 - n - decylsulfanylhexyl group , a 4 - methylsulfanylcyclohexyl group , a 7 - methylsulfanylheptyl group , a ethylsulfanylheptyl group , a 7 - isopropylsulfanylheptyl group , a 8 - methylsulfanyloctyl group , a 5 - ethylsulfanyloctyl group , a 9 - methylsulfanylnonyl group , a 9 - ethylsulfanylnonyl group , a 10 - methylsulfanyldecyl group , a 10 - ethylsulfanyldecyl group , a 10 - n - butylsulfanyldecyl group , a 11 - methylsulfanylundecyl group , a 12 - methylsulfanyldodecyl group , a 12 - ethylsulfanyldodecyl group , a 12 - isopropylsulfanyldodecyl group , a 14 - methylsulfanyltetradecyl group , a cyclohexylsulfanylethyl group , and a cyclohexylsulfanylpropyl group . examples thereof further include a 6 - n - propylsulfanylhexyl group , a 7 - n - propylsulfanylheptyl group , a 8 - n - propylsulfanyloctyl group , a 9 - n - propylsulfanylnonyl group , a 10 - n - propylsulfanyldecyl group , a 11 - ethylsulfanylundecyl group , and a 11 - n - propylsulfanylundecyl group . examples of the alkylaminoalkyl group having 3 to 20 carbon atoms include linear , branched , or cyclic n - alkylaminoalkyl groups such as an n - methylaminoethyl group , an n - ethylaminoethyl group , an n - n - propylaminoethyl group , an n - isopropylaminoethyl group , an n - n - butylaminoethyl group , an n - n - hexylaminoethyl group , an n - 2 - ethylbutylaminoethyl group , an n - n - heptylaminoethyl group , an n - n - octylaminoethyl group , an n - 2 - ethylhexylaminoethyl group , an n - n - decylaminoethyl group , an n - n - dodecylaminoethyl group , an n - n - tetradecylaminoethyl group , an n - cyclohexylaminoethyl group , an n - methylaminopropyl group , an n - methylaminopropyl group , an n - ethylaminopropyl group , an n - n - propylaminopropyl group , an n - isopropylaminopropyl group , an n - n - butylaminopropyl group , an n - n - pentylaminopropyl group , an n - n - hexylaminopropyl group , an n - 2 - ethylbutylaminopropyl group , an n - n - octylaminopropyl group , an n - 2 - ethylhexylaminopropyl group , an n - n - decylaminopropyl group , an n - n - dodecylaminopropyl group , an n - n - tetradecylaminopropyl group , an n - cyclohexylaminopropyl group , an n - methylaminobutyl group , an n - ethylaminobutyl group , an n - n - propylaminobutyl group , an n - isopropylaminobutyl group , an n - n - butylaminobutyl group , an n - n - hexylaminobutyl group , an n - n - octylaminobutyl group , an n - n - decylaminobutyl group , an n - n - dodecylaminobutyl group , an n - methylaminopentyl group , an n - ethylaminopentyl group , an n - n - propylaminopentyl group , an n - n - pentylaminopentyl group , an n - methylaminohexyl group , an n - ethylaminohexyl group , an n - isopropylaminohexyl group , an n - n - butylaminohexyl group , an n - n - hexylaminohexyl group , an n - n - decylaminohexyl group , an n - methylaminocyclohexyl group , an n - methylaminoheptyl group , an n - ethylaminoheptyl group , an n - isopropylaminoheptyl group , an n - methylaminooctyl group , an n - ethylaminooctyl group , an n - methylaminononyl group , an n - ethylaminononyl group , an n - methylaminodecyl group , an n - ethylaminodecyl group , an n - n - butylaminodecyl group , an n - methylaminoundecyl group , an n - methylaminododecyl group , an n - ethylaminododecyl group , an n - isopropylaminododecyl group , an n - methylaminotetradecyl group , an n - cyclohexylaminoethyl group , and an n - cyclohexylaminopropyl group . examples of the aromatic hydrocarbon group or the heteroaromatic group include a phenyl group , a naphthyl group , an azulenyl group , an acenaphthenyl group , an anthranyl group , a phenanthryl group , a naphthacenyl group , a fluorenyl group , a pyrenyl group , a chrysenyl group , a perylenyl group , a biphenyl group , a p - terphenyl group , and a quaterphenyl group ; a pyrrolyl group , an indolyl group , a furyl group , a thienyl group , an imidazolyl group , a benzofuryl group , a triazolyl group , benzotriazolyl group , a benzothienyl group , a pyrazolyl group , an indolizinyl group , a quinolinyl group , an isoquinolinyl group , a carbazolyl group , a dibenzofuranyl group , a dibenzothiophenyl group , an indolinyl group , a thiazolyl group , a pyridyl group , a pyrimidyl group , a pyrazinyl group , a pyridazinyl group , a thiadiazinyl group , an oxadiazolyl group , a benzoquinolinyl group , a thiadlazolyl group , a pyrrolothiazolyl group , a pyrrolopyridazinyl group , a tetrazolyl group , and an oxazolyl group ; and halogen - substituted aromatic hydrocarbon groups or heteroaromatic groups in which some of hydrogen atoms of any of the aromatic hydrocarbon groups or heteroaromatic groups are substituted with a fluorine atom , a chlorine atom , a bromine atom , or an iodine atom , such as a 2 - fluorophenyl group , a 3 - fluorophenyl group , a 4 - fluorophenyl group , a 2 - chlorophenyl group , a 3 - chlorophenyl group , a 4 - chlorophenyl group , a 4 - bromophenyl group , a 3 , 5 - difluorophenyl group , and a 2 , 3 , 4 , 5 , 6 - pentafluorophenyl group . examples of the aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having 2 to 20 carbon atoms or an alkenyl group having 2 to 20 carbon atoms include aromatic hydrocarbon groups or heteroaromatic groups in which any of the aromatic hydrocarbon groups or any of the heteroaromatic groups has , as a substituent , an alkyl group or alkenyl group having 2 to 20 carbon atoms , such as a 4 - ethylphenyl group , a 4 - n - propylphenyl group , a 4 - isopropylphenyl group , a 4 - n - butylphenyl group , a 4 - n - pentylphenyl group , a 4 - isopentylphenyl group , a 4 - n - hexylphenyl group , a 4 - cyclohexylphenyl group , a 4 - n - octylphenyl group , a 4 - n - nonylphenyl group , a 4 - n - decylphenyl group , a 4 - n - undecylphenyl group , a 4 - n - dodecylphenyl group , a 4 - n - tetradecylphenyl group , a 4 - n - octadecylphenyl group , a 5 - n - butyl - 2 - thienyl group , a 5 - n - hexyl - 2 - thienyl group , a 5 - n - octyl - 2 - thienyl group , a 5 - n - decyl - 2 - thienyl group , and a 5 - n - tridecyl - 2 - thienyl group . examples of the aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having a halogen atom and 2 to 20 carbon atoms include aromatic hydrocarbon groups or heteroaromatic groups in which any of the aromatic hydrocarbon groups or any of the heteroaromatic groups has , as a substituent , an alkyl group having a halogen , atom and 2 to 20 carbon atoms , such as a 4 - pentafluoropropylphenyl group , a 4 - heptafluorobutylphenyl group , a 4 - nonaflouropentylphenyl group , a 4 - pentadecaflourooctylphenyl group , a 4 - nonadecafluorodecylphenyl group , and a 5 - nonafluoropentyl - 2 - thienyl group . examples of the aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkoxyalkyl group having 3 to 20 carbon atoms include aromatic hydrocarbon groups or heteroaromatic groups in which any of the aromatic hydrocarbon groups or any of the heteroaromatic groups has , as a substituent , an alkoxyalkyl group having 3 to 20 carbon , atoms , such as a 4 -( 2 - ethoxyethyl ) phenyl group , a 4 -( 2 - n - hexyloxyethyl ) phenyl group , a 4 -( 2 - n - octyloxyethyl ) phenyl group , a 4 -( 3 - n - octyloxypropyl ) phenyl group , a 4 -( 3 - n - tetradecyloxypropyl ) phenyl group , a 4 -( 4 - n - octyloxybutyl ) phenyl group , a 4 -( 6 - n - decyloxyhexyl ) phenyl group , a 4 -( 10 - n - butoxydecyl ) phenyl group , and a 5 -( 2 - n - hexyloxyethyl )- 2 - thienyl group . examples of the aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkylsulfanylalkyl group having 3 to 20 carbon atoms include aromatic hydrocarbon groups or heteroaromatic groups in which any of the aromatic hydrocarbon groups or any of the heteroaromatic groups has , as a substituent , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , such as a 4 - methylsulfanylpropylphenyl group , a 4 - butylsulfanylpropylphenyl group , a 4 - dodecylsulfanylpropylphenyl group , and a 5 - methylsulfanylpropyl - 2 - thienyl group . examples of the aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkylaminoalkyl group having 3 to 20 carbon atoms include aromatic hydrocarbon groups or heteroaromatic groups in which any of the aromatic hydrocarbon groups or any of the heteroaromatic groups has , as a substituent , an alkylaminoalkyl group having 3 to 20 carbon atoms , such as an n - methylaminopropylphenyl group , an n - butylaminopropylphenyl group , an n - dodecylaminopropylphenyl group , and an n - methylaminopropyl - 2 - thienyl group . among the ( ii ) above , an alkyl group having 2 to 20 carbon atoms , an alkoxyalkyl group having 3 to 20 carbon atoms , an alkylsulfanylalkyl group having 3 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkyl group having 2 to 20 carbon atoms or an alkenyl group having 2 to 20 carbon atoms , an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkoxyalkyl group having 3 to 20 carbon atoms , and an aromatic hydrocarbon group or heteroaromatic group having , as a substituent , an alkylsulfanylalkyl group having 3 to 20 carbon atoms are preferable because these groups provide a high mobility . furthermore , from the viewpoint of exhibiting a high - order liquid crystal phase and suppressing the variation in mobility , the ( ii ) above is preferably an alkyl group having 2 to 20 carbon atoms , an alkoxyalkyl group having 3 to 20 carbon atoms , and an alkylsulfanylalkyl group having 3 to 20 carbon atoms , and particularly preferably an alkyl group having 4 to 18 carbon atoms , an alkoxyalkyl group having 4 to 18 carbon atoms , and an alkylsulfanylalkyl group having 4 to 18 carbon atoms . examples of specific compounds of the present invention having the substituents described above include the following compounds , but are not limited thereto . a compound of the present , invention can be synthesized by using known common methods in combination . first , btbt and an aliphatic carboxylic acid chloride are subjected to friedel - crafts acylation reaction , and then wolff - kishner reduction to obtain an alkylated compound . next , a portion on the opposite side of the alkyl - substituted site is nitrated with fuming nitric acid , subsequently reduced to an amino group with a tin powder , subsequently subjected to diazotization with a nitrous acid compound , and further subjected to iodination by sandmeyer reaction . lastly , the resulting iodinated compound is subjected to sonogashira coupling with an acetylene derivative . thus , a target compound can foe obtained . alternatively , the iodinated btbt compound obtained by the above reaction and an aromatic hydrocarbon compound having boric acid and bromine are allowed to react with each other by suzuki - miyaura coupling , and the resulting product is then subjected to sonogashira coupling with an acetylene derivative . thus , a target compound can be obtained . the above reactions are not particularly limited . known common reagents can be used . any known common reaction temperature can also be used . an organic semiconductor material of the present invention obtained as described , above is crystallized by way of a high - order liquid crystal phase having a highly ordered molecular arrangement , and the arrangement of the molecules of the organic semiconductor material is controlled after a film formation . thus , the organic semiconductor material of the present invention exhibits a high charge mobility . in particular , since the organic semiconductor material has a carbon - carbon triple bond , which does not inhibit the liquid crystal phase and has a highly ordered molecular arrangement , the variation in mobility between elements is reduced compared with existing compounds . accordingly , the organic semiconductor material , of the present invention is useful for various organic semiconductor devices . a liquid crystal phase exhibited by the compound of the present invention is preferably a liquid crystal phase selected from the group consisting of smb , smb cryst , smi , smf , sme , smj , smg , smk , and smh . the reason for this is as follows . in the case where the liquid crystal substance according to the present invention is used as an organic semiconductor in a liquid crystal phase , these liquid crystal phases have a low fluidity and thus do not easily induce ionic conduction , and these liquid crystal phases have a high order of molecular orientation and thus a high mobility can be expected in the liquid crystal phase . furthermore , in the case where the liquid crystal substance according to the present invention is used as an organic semiconductor in a crystal phase , these liquid crystal phases have a lower fluidity than the n phase , sma phase , and smc phase , and thus breaking of the resulting element does not easily occur , even when the crystal phase transits to a liquid crystal phase as a result of an increase in the temperature . in the case where the exhibition of a liquid crystal phase is observed only in a temperature - decreasing process , once crystallization occurs , the crystal temperature range is extended , and thus this is advantageous when the liquid crystal substance is used in a crystal phase . the compound of the present invention is characterized by exhibiting a phase of smb cryst , sme , smf , smi , smj , smg , smk or smh in a temperature - decreasing process . furthermore , among these smb cryst , sme , smf , smi , smj , smg , smk , and smh , smf , and smg , which are higher - order sm phases , are particularly preferable as a liquid crystal phase that appears in a temperature range adjacent to a liquid crystal phase when the temperature of the organic semiconductor material is increased from a crystal phase . in addition , in a liquid crystal substance in which , in addition to a low - order liquid crystal phase ( such as the n phase , sma phase , or smc phase ) having a strong liquid property , other high - order liquid crystal phase appears , since the low - order liquid crystal phase has a strong liquid property , the control of molecular orientation is easier than that in the high - order liquid crystal phase . accordingly , molecules are oriented in advance in the low - order liquid crystal phase , and then allowed to transit to the high - order liquid crystal phase , thereby obtaining a liquid crystal thin film in which fluctuation of the molecular orientation and orientation defects are suppressed . accordingly , an improvement in the quality of a liquid crystal thin film and a crystal thin film can be realized . in the case where a liquid crystal substance is used as an organic semiconductor , the operating temperature desired for a device including the liquid crystal substance is usually − 20 ° c . to 80 ° c . accordingly , in the invention of the subject application , it is desirable that a temperature range in which the smb cryst , sme , smf , smi , smj , smg , smk , or smh phase appears be − 20 ° c . or more . in addition , in the case where a liquid crystal substance according to the present invention is used as an organic semiconductor in a crystal phase , a thin film in the liquid crystal state ( liquid crystal thin film ) is preferably used as a precursor for the preparation of a crystal thin film from the viewpoint of improving the quality of the organic semiconductor . for this reason , in consideration of the simplicity of the process and the ease of the selection of the substrate , the temperature at which a liquid crystal phase of the liquid crystal substance appears is preferably 200 ° c . or less . by using a molecular unit including an aromatic π - electron fused ring having a number of rings of 3 or more as a charge transporting molecular unit corresponding to a core part in a liquid crystal molecule , redundancy of the transfer integral with respect to fluctuation of the molecular position can be ensured . similarly , by employing a molecular unit having a fused ring structure rather than a molecular unit including a π - electron conjugated system in which a plurality of benzenes , thiophenes , and the like are connected to each other with single bonds , the molecular conformation is fixed , and an increase in the transfer integral , can be expected , which is useful for an improvement in the mobility . accordingly , the btbt skeleton of the present invention is useful as the unit . in contrast , even when a charge transporting molecular unit having a large fused ring structure is employed as a core part , in a substance in which a hydrocarbon , chain is directly connected to the core part as in , for example , dialkylpentacene or dialkylbenzothienobenzothiophene , stabilization of a liquid crystal phase is not achieved , and , in general , a liquid crystal phase is not exhibited , or even if a liquid crystal phase is exhibited , only a low - order liquid crystal phase such as sma phase is exhibited ( literature : liquid crystals , vol . 34 , no . 9 ( 2007 ) 1001 - 1007 , liquid crystals , vol . 30 , no . 5 ( 2003 ) 603 - 610 ). therefore , even if a large fused ring structure is merely used in a charge transporting molecular unit , a high mobility cannot be realized in a liquid crystal phase . only when a molecular structure in which another structural unit for providing the degree of freedom of the flip - flop movement of a molecule is connected to the charge transporting molecular unit , such as the btbt skeleton , is employed in the core part , exhibition of a high - order liquid crystal phase and realization of a high mobility in a liquid crystal phase can be expected . a hydrocarbon chain may be connected to such a structure ( core part ) in which another rigid structural unit such as an arylene acetylene structure is connected to the btbt skeleton so as to provide the molecule with anisotropy of the rod - like molecular shape and a liquid property . in this case , exhibition of a liquid crystal phase can be induced with high probability . in the case of connecting a hydrocarbon chain , in general , two hydrocarbon chains are connected to the core part . however , even when a single hydrocarbon chain is connected to the core part , a liquid crystal phase can be often exhibited . in this case , the temperature range in which the liquid crystal phase appears is often asymmetric between a temperature - increasing process and a temperature - decreasing process . this is useful in that a liquid crystal phase temperature range generally extends to a low temperature in the temperature - decreasing process , whereas a crystal phase extends to a high - temperature range in the temperature - increasing process . this property means that , in the case where a polycrystalline thin film of a liquid crystal substance is used as an organic semiconductor , when a polycrystalline thin film is prepared by using a liquid crystal thin film ( thin film in a state of a liquid crystal phase ) as a precursor thereof , the liquid crystal thin film can be prepared at a lower temperature , and is advantageous in that the process is more easily performed . in addition , the extension of the crystal phase temperature in the temperature - increasing process to the high - temperature range means that thermal stability of the prepared polycrystalline film improves , and this is advantageous as a material . on the other hand , when two hydrocarbon chains are provided , in general , the exhibited liquid crystal phase is stabilized . this is advantageous for applications to a device or the like using a liquid crystal phase . in the case where a substance is synthesized on the basis of the basic molecular design described above , the usefulness of the substance relating to the present invention is achieved by selecting , fundamentally , a substance that exhibits a high - order smectic phase in the case where the substance is used as an organic semiconductor in a liquid crystal phase , and a substance in which , when cooled from a temperature higher than the crystal phase temperature , a crack or a void is not easily formed in a crystal thin film , and a low - order liquid crystal phase adjacent to the crystal phase is not exhibited in the case where the substance is used as an organic semiconductor in a crystal phase . in other words , the determination is made based on whether a liquid crystal phase other than a nematic phase , sma phase , and smc phase is exhibited in a temperature range adjacent to a crystal phase in the case where the substance is used as an organic semiconductor in a liquid crystal phase and whether a crack or a void is not easily formed when the substance is cooled from a temperature higher than the crystal phase temperature to allow the substance to transit to a crystal phase in the case where the substance is used as an organic semiconductor in a crystal phase . the above determination can be easily made by a screening method ( determination method described below . regarding the details of measuring methods used in this screening method , the literature below may be referred to , as required . literature a :. how to use polarizing microscope : jikken kagaku kouza ( experimental chemistry course ), fourth edition , vol . 1 , maruzen co . ltd ., pp . 439 to 435 literature b : evaluation of liquid crystal material : jikken kagaku kouza ( experimental chemistry course ), fifth edition , vol . 27 , pp . 295 to 300 , maruzen co . ltd . : ekisho kagaku jikken nyumon ( introduction of liquid crystal science experiments ) edited by the japanese liquid crystal society , sigma shuppan ( s1 ) after an isolated test substance is purified by column chromatography and recrystallization , it is confirmed by silica gel thin - layer chromatography that the test substance shows a single spot ( that is , the test substance is not a mixture ). ( s2 ) a sample heated to an isotropic phase is injected into a cell by using a capillary action , the cell having a thickness of 15 μm and being produced by bonding slide glasses to each other with a spacer therebetween . the cell is heated to an isotropic phase temperature and the texture of the isotropic phase is observed with a polarizing microscope to confirm that a dark field of view is not observed in a temperature range lower than the isotropic phase . this result shows that the molecular major axis is horizontally aligned with respect to a substrate , and becomes a requirement necessary for the subsequent texture observations . ( s3 ) the texture is observed with the microscope while cooling the cell at a suitable temperature - decreasing rate , for example , at a rate of about 5 ° c ./ min . in this case , if the cooling rate is excessively high , the structure to be formed becomes small , and a detailed observation becomes difficult . therefore , the temperature is increased to the isotropic phase again , and the cooling rate is adjusted so as to determine conditions for obtaining a structure size of 50 μm or more , under which the structure can be easily observed . ( s4 ) the texture is observed under the conditions determined in the section ( s3 ) above while cooling from the isotropic phase to room temperature ( 20 ° c .). during this process , when the sample is crystallized in the cell , a crack or a void is generated as a result of the contraction of the lattice , and a black line or a region having a certain size appears in the texture to be observed . it air enters during the injection of the sample , a similar black region ( in general , circular region ) is locally generated . however , since the black line or the region generated by the crystallization appears so as to be distributed in the structure or boundary , the black line or the region is easily distinguished . these black line and region can be easily discriminated from other structures observed in the texture because even when a polarizer and an analyzer are rotated , disappearance and a change in color are not observed . the temperature at which , this texture appears is defined as a crystallization temperature , and it is confirmed that a texture that appears in a temperature range higher than the crystallization temperature is not a nematic phase , sma phase , or smc phase . in the case where the sample exhibits a nematic phase , a characteristic schlieren texture ( typical schlieren texture ), which is expressed as a bobbin - like texture , is observed . in the case where the sample exhibits sma phase or smc phase , a characteristic texture ( typical fan - like texture ), which is called “ fan - like texture ” having a fan shape and having a uniform structure in the region , is observed . accordingly , these phases can be easily determined from the characteristic textures thereof . regarding a particular case , in a substance that undergoes transition from sma phase to smb phase or from smc phase to smf or smi phase , a change in the field of view may be momentarily observed at a phase transition temperature , however , a change in the texture after the phase transition may be hardly observed . accordingly , a careful observation may foe required because the textures of the formed smb phase , or smf phase or smi phase may be misidentified as sma phase or smc phase in some cases . in such a case , it is important to pay attention to a momentary change in the field of view , the change being observed at the phase transition temperature . in the case where this confirmation is necessary , the number of intermediate phases is determined by differential scanning calorimetry ( dsc ), x - ray diffraction is then measured at respective temperature ranges , and the presence or absence of a peak in a high - angle region ( from 15 to 30 degrees in the determination of θ - 2θ ) characteristic of each phase is confirmed . thus , the sma phase and smc phase ( both of which have no peak ) can easily be discriminated from the smb phase , smf phase , and smi phase ( each of which has a peak ). ( s5 ) a substance in which a black structure is not observed by the texture observation with a polarizing microscope at room temperature ( 20 ° c .) can be used as an organic semiconductor material . accordingly , regardless of a high - order liquid crystal phase or a crystal phase ( including a metastable crystal phase ) at room temperature , this substance is considered to be a substance in the scope of the present invention . from the viewpoint of applying the organic semiconductor material according to the present invention to a device , the energy levels of the highest occupied molecular orbital ( homo ) and the lowest unoccupied molecular orbital ( lumo ) of the core part are also important . in general , the homo level of an organic semiconductor can be estimated as follows . a test substance is dissolved in an organic solvent such as dehydrated dichloromethane so as to have a concentration of , for example , 1 to 10 mmol / l , and about 0 . 2 mol / l of a supporting electrolyte such as tetrabutylammonium salt is added thereto . a working electrode such as pt , a counter electrode such as pt , and a reference electrode such as ag / agcl are inserted into the resulting solution . a cv curve is then drawn by performing sweeping with a potentiostat at a rate of about 50 mv / sec . from the difference between the peak potential and a potential of a known substance such as ferrocene serving as a reference , the homo level and the lumo level can be estimated . in the case where the homo level or the lumo level deviates from the potential window of the organic solvent used , the homo level or the lumo level can be estimated by calculating the homo - lumo level from an absorption edge of an ultraviolet - visible absorption spectrum and subtracting the result from the level that has been measured . this method can be perforated , with reference to j . pommerehne , h . vestweber , w . guss , r . f . mahrt , h . bassler , m . porsch , and j . daub , adv . mater ., 7 , 551 ( 1995 ). in general , the homo and lumo levels of an organic semiconductor material provide a standard of electrical contact with an anode and a cathode , respectively . an attention should be paid because the charge injection is limited by the magnitude of energy barrier determined by the difference from the work function of an electrode material . with regard to the work function of a metal , examples of the work function of substances that are often used as an electrode include silver ( ag ): 4 . 0 ev , aluminum ( al ): 4 . 28 ev , gold ( au ): 5 . 1 ev , calcium ( ca ): 2 . 87 ev , chromium ( cr ): 4 . 5 ev , copper ( cu ): 4 . 65 ev , magnesium ( mg ): 3 . 66 ev , molybdenum ( mo ): 4 . 6 ev , platinum ( pt ): 5 . 65 ev , indium tin oxide ( ito ): 4 . 35 to 4 . 75 ev , and sine oxide ( sno ): 4 . 68 etc . from the viewpoint described above , the difference in the work function between the organic semiconductor material and the electrode substance is preferably 1 ev or less , more preferably 0 . 8 ev or less , and still more preferably 0 . 6 ev or less . regarding the work function of a metal , the following literature may be referred to , as required . literature d : kagaku binran ( handbook of chemistry ), basic edition , revised 5th edition , ii - 608 - 610 , 14 . 1 b work function ( maruzen co . ltd .) ( 2004 ) the homo and lumo energy levels are affected by the size of the conjugated π - electron system of the core part . therefore , the size of the conjugated system is used as a reference when the material is selected . furthermore , introduction of a hetero atom into the core part is effective as a method for changing the homo or lumo energy level . examples of applicable organic semiconductor devices include diodes , organic transistors , memories , photodiodes , light - emitting diodes , light - emitting transistors , sensors such as a gas sensor , a biosensor , a blood sensor , an immunological sensor , an artificial retina , and a taste sensor , and radio frequency identifiers ( rfids ). in particular , since the organic semiconductor material of the present invention has a high charge mobility of 0 . 1 cm 2 / vs or more , the organic semiconductor material is particularly useful to applications to an organic transistor or a light - emitting device . the organic transistor can be suitably used as a transistor for switching a pixel that forms a display , a signal driver circuit element , a memory circuit element , a signal processing circuit element , or the like . examples of the display include a liquid crystal display , a dispersion - type liquid crystal display , an electrophoresis display , a particle - rotation - type display element , an electrochromic display , an organic electroluminescence display , and electronic paper . in general , an organic transistor includes a source electrode , a drain electrode , a gate electrode , a gate insulating layer , and an organic semiconductor layer . there are various types of organic transistors depending on the arrangements of respective electrodes and respective layers . the organic semiconductor material of the present invention can be used in any transistor regardless of the type of the transistor . regarding the type of transistors , for example , fundamentals of material science vol . 6 “ fundamental of organic transistor ” published by sigma - aldrich co ., llc may be referred to . the mobility in the present invention refers to a mobility of a carrier such as a hole or an electron , and serves as an index that represents performance of an organic semiconductor material . with regard to the mobility , there are a mobility determined by a tof ( time - of - flight ) method ( μ tof : unit cm 2 / v · s ) and a mobility determined by an organic transistor ( μ fet : unit cm 2 / v · s ). the higher the μ tof or μ fet , the more easily a carrier flows . the mobility ( μ tof ) is determined by a formula ( i ) below where v represents a voltage between electrodes of a cell for measuring tof , d represents a distance between the electrodes , and tr represents a time during which & amp ; carrier passes through a film thickness calculated from a waveform of a photocurrent . the mobility ( μ fet ) is determined by a formula ( ii ) below using a transfer characteristic curve obtained by fixing a drain voltage v d and changing a gate voltage v g . [ math . ⁢ 1 ] μ top = d 2 ⁢ / ⁢ ( v ⁢ / ⁢ tr ) ( i ) [ math . ⁢ 2 ] i d = μ fet · c in · w 2 ⁢ l ⁢ ( v g - v th ) ( ii ) ( in the formula ( ii ), c in represents an electric capacity per unit area of a gate insulating film , i d represents a drain current , l represents a channel length , w represents a channel width , and v th represents a threshold voltage .) when an organic semiconductor is applied to a device , the mobility exhibited by the substance serves as a standard of the usefulness . this is because characteristics of the device are limited by the mobility . the mobility of existing amorphous organic semiconductors is about 10 − 2 cm 2 / vs even in a case of a high mobility , and is usually 10 − 2 to 10 − 3 cm 2 / vs . accordingly , it is difficult for amorphous organic semiconductor materials to realize a high mobility exceeding 10 − 2 cm 2 / vs exhibited by a liquid crystal phase , in particular , a mobility exceeding 0 . 1 cm 2 / vs exhibited by a high - order smectic phase . thus , the superiority of liquid crystal materials is clear . liquid crystalline substances exhibit a crystal phase , similarly to non - liquid crystal substances . therefore , when liquid crystal substances are used as organic semiconductors , the liquid crystal substances can be used as organic semiconductors not only in a liquid crystal phase but also in a crystal phase . in general , the mobility in a crystal phase is often higher than the mobility in a liquid crystal phase by approximately from half order to one order of magnitude . in particular , the use of a crystal phase is effective in applications to a transistor that requires a high mobility and applications to a solar cell or the like that requires a long diffusion length of an electric charge or an exciton . as described in examples , by producing an fet and evaluating the characteristics of the fet , it is possible to confirm that the organic semiconductor material of the present invention can be used as an organic transistor . with regard to details of the confirmation of the semiconductor device operation by this method , for example , the literature of s . f . nelsona , y .- y . lin , d . j , gundlach , and t . h . jackson , temperature - independent transport in high - mobility pentacene transistors , appl . phys . lett ., 72 , no . 15 , 1854 - 1856 ( 1998 ) may be referred to . the organic semiconductor material of the present invention may be subjected to vapor deposition to form a semiconductor film . however , the organic semiconductor material of the present invention is preferably used as a printing ink with which a film can be formed at a low temperature and which has good productivity . in the preparation of an ink , the organic semiconductor material of the present invention is dissolved in a solvent , and , in order to provide ink properties , a leveling agent such as a fluorine - based leveling agent or a silicon - based leveling agent , and a polymer compound , such as polystyrene or an acrylic resin , serving as a viscosity modifier may be added within a range where semiconductor performance is not impaired . any organic solvent may be used , and two or more organic solvents may be used as a mixture . specific examples thereof include , but are not limited to , aliphatic solvents such as n - hexane , n - octane , n - decane , and n - dodecane ; alicyclic solvents such as cyclohexane ; aromatic solvents such as benzene , toluene , cumene , o - xylene , m - xylene , p - xylene , p - cymene , mesitylene , anisole , 2 - methylanisole , 3 - methylanisole , 4 - methylanisole , 2 , 5 - dimethylanisole , 3 , 5 - dimethoxytoluene , 2 , 4 - dimethylanisole , phenetole , methyl benzoate , ethyl benzoate , propyl benzoate , butyl benzoate , 1 , 5 - dimethyltetralin , n - propyl benzene , n - butyl benzene , n - pentyl benzene , 1 , 3 , 5 - triethylbenzene , 1 , 3 - dimethoxybenzene , chlorobenzene , o - dichlorobenzene , and trichlorobenzene ; ether solvents such as tetrahydrofuran , dioxane , ethylene glycol diethyl ether , anisole , benzyl ethyl ether , ethyl phenyl ether , diphenyl ether , and methyl - t - butyl ether ; ester solvents such as methyl acetate , ethyl acetate , ethyl cellosolve , and propylene glycol methyl ether acetate ; alcohol solvents such as methanol , ethanol , and isopropanol ; ketone solvents such as acetone , methyl ethyl ketone , cyclohexanone , 2 - hexanone , 2 - heptanone , and 3 - heptanone ; dimethylformamide ; dimethyl sulfoxide ; and diethylformamide . the concentration of the organic semiconductor material of the present invention in a prepared liquid composition is preferably 0 . 01 % to 20 % by weight , and more preferably 0 . 1 % to 10 % by weight . the organic solvent may be used alone . in order to obtain a thin film having a desired high homogeneity , a plurality of solvents may be used as a mixture . next , an organic transistor that includes an organic semiconductor material of the present invention will be described . in general , an organic transistor includes a source electrode , a drain electrode , a gate electrode , a gate insulating layer , and an organic semiconductor layer . there are various types of transistors depending on the arrangements of respective electrodes and respective layers . the organic semiconductor material of the present invention can be used in any transistor regardless of the type of the transistor . regarding the types of transistors , for example , fundamentals of material science vol . 6 “ fundamental of organic transistor ” published by sigma - aldrich co ., llc may be referred to . a detailed description will be made using a bottom contact - type transistor shown in fig1 as an example . reference numeral 1 denotes a substrate , reference numeral 2 denotes a gate electrode , reference numeral 3 denotes a gate insulating layer , reference numeral 4 denotes an organic semiconductor , reference numeral 5 denotes a source electrode , and reference numeral 6 denotes a drain electrode . the substrate is constituted by glass or a flexible resin sheet . for example , a plastic film may be used as a sheet . examples of the plastic film include films composed of polyethylene terephthalate ( pet ), polyethylene naphthalate ( pen ), polyether sulfone ( pes ), polyetherimide , polyether ether ketone , polyphenylene sulfide , polyarylate , polyimide , polycarbonate ( pc ), cellulose triacetate ( tac ), cellulose acetate propionate ( cap ), or the like . by using a plastic film in this manner , a reduction in weight can be realized , portability can be enhanced , and the resistance to impact can be improve compared with the case where a glass substrate is used . an electrode material of the gate electrode , the source electrode , or the drain electrode is not particularly limited to as long as the material is an electrically conductive material . examples of the electrodes that are used include metal electrodes composed of platinum , gold , silver , nickel , chromium , copper , iron , tin , tin oxide / antimony , indium / tin oxide ( ito ), sine oxide doped with fluorine , carbon , graphite , glassy carbon , silver paste and carbon paste , lithium , beryllium , sodium , magnesium , potassium , calcium , scandium , titanium , manganese , zirconium , gallium , niobium , sodium , a sodium - potassium alloy , magnesium , lithium , aluminum , a magnesium / copper mixture , a magnesium / silver mixture , a magnesium / aluminum mixture , a magnesium / indium mixture , an aluminum / aluminum oxide mixture , a lithium / aluminum mixture , or the like . furthermore , known electrically conductive polymers in which the electrical conductivity is improved by doping or the like , for example , conductive polyaniline , conductive polypyrrole , conductive polythiophene , and a complex of polyethylenedioxythiophene and polystyrene sulfonic acid are also suitably used . examples of a method for forming an electrode include a method including forming a conductive thin film using the above material as a raw material by a method such as vapor deposition or sputtering , and forming an electrode using the conductive thin film by a known photolithographic method or lift - off method , and a method including etching a metal foil composed of aluminum , copper , or the like by using a resist formed on the metal foil by thermal transfer , ink - jetting , or the like . alternatively , a solution or dispersion of an electrically conductive polymer , or a dispersion of electrically conductive fine particles may be directly patterned by ink - jetting . alternatively , an electrode may be formed from a coating film by lithography , laser ablation , or the like . furthermore , a method may also be used in which an ink , conductive paste , or the like that contains an electrically conductive polymer or electrically conductive fine particles is patterned by a printing method such as letterpress printing , intaglio printing , planographic printing , screen printing , or the like . as the gate insulating layer , an organic thin film composed of a thermoplastic resin such as parylene , polystyrene , an acrylic resin , or a polyester resin ; a thermosetting resin such as an epoxy resin , a urethane resin , a phenolic resin , an unsaturated polyester resin , an alkyd resin , or a melamine resin ; or a uv - curable resin can be suitably used . alternatively , an inorganic material such as a silicon oxide film may also be used . the gate insulating layer may be formed by preparing a thin film using a known wet film forming method such as a spin , coating method , a casting method , a dip method , an ink - jet method , a doctor blade method , a screen printing method , an off - set printing method , a letterpress printing method , a reverse printing method , a microcontact printing method , a wire bar coating method , a spray coating method , or a dispensing method . the thin film may be patterned to have a desired shape by a photolithographic method , as required . the organic semiconductor layer can be produced by a known common production method such as a vacuum evaporation method . however , an ink for an organic semiconductor material may be prepared in the form of a composition , and the organic semiconductor layer can be easily formed by a printing method . examples of the printing method include a spin coating method , a casting method , a dip method , an ink - jet method , a doctor blade method , a gravure printing method , a screen printing method , an off - set printing method , a letterpress printing method , a reverse printing method , a microcontact printing method , a wire bar coating method , a spray coating method , and a dispensing method . a thin film can be prepared by such a known , wet film forming method . by using a casting method or the like , the form of a plate - shaped crystal or a thick film can also be obtained . an organic transistor of the present invention can be suitably used as a transistor for switching of a pixel that forms a display , a signal driver circuit element , a memory circuit element , a signal processing circuit element , or the like . examples of the display include a liquid crystal display , a dispersion - type liquid crystal display , an electrophoresis display , a particle - rotation - type display element , an electrochromic display , an organic electroluminescence display , and electronic paper . examples of applicable organic semiconductor devices , include diodes , organic transistors , memories , photodiodes , light - emitting diodes , light - emitting transistor , sensors such as a gas sensor , a biosensor , a blood sensor , an immunological sensor , an artificial retina , and a taste sensor , and rfids . the present invention will be described in more detail using examples . first , an organic semiconductor material was placed on a slide glass washed with ion exchange water and acetone in that order by using ultrasonic waves and then dried . a cover glass that had been similarly washed was placed thereon to prepare a specimen for measurement . the specimen was placed on an eclipse e600 pol ( eyepiece : 10 times , objective lens : 20 times ) manufactured by nikon corporation and equipped with a hot stage ( manufactured toy mettler - toledo international inc ., fp82ht ), and was heated until the temperature reached a melting point at a temperature - increasing rate of 5 ° c ./ min . the melting of the organic semiconductor material was confirmed . while pressing the cover glass with tweezers , the organic semiconductor material was stretched so as to form a thin film . next , a phase change in a cooling process was observed with a polarizing microscope while cooling the specimen at a rate of 5 ° c ./ min . in each figure , part ( a ) shows a texture of a crystal phase , and part ( b ) shows a texture of a high - order liquid crystal phase . a silicon wafer having a thermal oxidation film ( heavily doped p - type silicon ( p +- si ), thickness of thermal oxidation film ( sio 2 ): 300 nm ) was cut to have a size of 20 × 25 mm . the cut silicon wafer ( hereinafter abbreviated as “ substrate ”) was then washed by using ultrasonic waves with a neutral detergent , ultrapure water , isopropyl alcohol ( ipa ), acetone , and ipa in that order . next , a liquid crystalline organic semiconductor compound was dissolved in xylene to prepare a solution . the concentration of the solution was adjusted to 1 % to 0 . 5 % by weight . this solution and a glass pipette for applying the solution onto the substrate were heated in advance on the hot stage to a predetermined temperature . the substrate was placed on a spin coater installed in an oven , and the temperature in the oven was increased to 60 ° c . subsequently , the solution was applied onto the substrate , and the substrate was rotated ( at about 3 , 000 rpm for 30 seconds ). after the rotation was stopped , the substrate was rapidly taken out and cooled to room temperature . furthermore , gold was deposited , through a metal mask , on the substrate having an organic semiconductor layer thereon by a vacuum deposition method ( 2 × 10 − 6 torr ) so as to have a pattern . thus , source and drain , electrodes were formed ( channel length : channel width = 75 μm : 3 , 000 μm ). the prepared organic transistor was evaluated as follows . in a usual air atmosphere , a current flowing between the source electrode and the drain electrode was measured ( transfer characteristic ) by using a source - measurement unit having two power supplies while performing sweep application ( v sg : + 40 to − 60 v ) of a voltage to the gate electrode ( p +- si ) ( voltage v sd between source electrode and drain electrode : − 80 v ). the mobility was calculated from the slope of √ id - vg in the transfer characteristic by a well - known method using a formula of saturation characteristics . the measurement of the mobility was performed for five transistors , and an average thereof was calculated . furthermore , an error was calculated by determining a standard deviation of the measured values , and calculating from a formula “ error (%)=( standard deviation / average )× 100 ”. in 320 ml of dichloromethane , 4 . 96 g ( 13 mmol ) of 2 - decyl - btbt prepared by the method described in liquid crystals 31 , 137 - 1380 ( 2004 ) was dissolved , and the resulting solution was then cooled to − 50 ° c . subsequently , 24 ml of a 1 . 2 m dichloromethane solution of fuming nitric acid was added dropwise thereto over a period of 30 minutes . the resulting solution was further stirred at − 50 ° c . for two hours , and 26 ml of a saturated aqueous solution of sodium hydrogencarbonate was then added thereto to terminate the reaction . the resulting liquid was separated , and the lower layer was collected . the lower layer was washed with a 10 % saline solution , and dried with anhydrous magnesium sulfate . the resulting liquid was concentrated and dried to obtain a crude solid . the solid was recrystallized from 2 - butanone to obtain 3 . 72 g of a yellow crystal of 2 - decyl - 7 - nitro btbt ( yield 67 %). subsequently , 2 . 56 g ( 6 mmol ) of 2 - decyl - 7 - nitro btbt and 1 . 84 g of a tin powder were suspended in 30 ml of acetic acid , and 5 . 4 ml of concentrated hydrochloric acid was gradually added dropwise while heating at about 0 ° c . and stirring . furthermore , the reaction was performed at 100 ° c . for one hour , and the reaction mixture was then cooled to 10 ° c . or less . a solid was collected by filtration . the solid was dispersed in about 100 ml of chloroform , and washed with concentrated aqueous ammonia and a saturated saline solution in that order . the resulting dispersion was dried with anhydrous magnesium sulfate , and then concentrated and dried to obtain a crude solid . the solid was separated , and purified with a silica gel column ( chloroform / cyclohexane = 1 : 1 , 1 % triethylamine was added ), and recrystallized from petroleum benzine to obtain 1 . 72 g of light gray 2 - amino - 7 - decyl btbt ( yield 72 %). furthermore , 60 ml of dichloromethane was added to 1 . 58 g ( 4 mmol ) of 2 - amino - decyl btbt , and 864 mg of a trifluoroborate / ether complex and 504 mg of t - butyl nitrite were added dropwise to the solution under cooling at − 15 ° c . the reaction temperature was increased to 5 ° c . over a period of about one hour . subsequently , 12 ml of a solution of dichloromethane - tetrahydrofuran ( the ) mixed solvent ( 1 : 2 ) containing 1 . 6 g of iodine , 1 . 32 g of potassium iodide , and 100 mg of tetrabutylammonium iodide was added thereto . a reaction was performed under reflux by heating for eight hours . the reaction mixture was then diluted with chloroform , and sequentially washed with 10 % sodium thiosulfate , 5 m sodium hydroxide , and a 10 % saline solution . the reaction mixture was dried with anhydrous sodium sulfate , and concentrated and dried . the resulting deep brown crude solid was purified with a silica gel column ( chloroform / cyclohexane = 1 : 1 ), and crystallized from chloroform - methanol . the resulting crystal was then recrystallized from ligroin to obtain 912 mg of 2 - decyl - 7 - iodo btbt ( yield 45 %). lastly , 8 ml of dioxane , 0 . 5 ml of 2 m tripotassium phosphate , and 183 mg ( 0 . 6 mmol , aldrich ) of 4 -( phenylethyl ) phenylboric acid pinacol ester were added to 253 mg ( 0 . 5 mmol ) of 2 - decyl - 7 - iodo btbt , argon gas was bubbled for 20 minutes . subsequently , 30 mg ( 0 . 025 mmol , tokyo chemical industry co ., ltd .) of tetrakis ( triphenylphosphine ) palladium and 13 mg ( 0 . 045 mmol , wako pure chemical industries , ltd .) of tricyclohexylphosphine were added thereto , and resulting reaction mixture was heated while stirring at 95 ° c . for 22 hours . the reaction mixture was diluted with chloroform , and washed with a 10 % saline solution . the lower layer was concentrated and dried to obtain a crude solid . the solid was recrystallized from xylene to obtain 140 mg of btbt derivative a represented by ( chem . 15 ) ( yield 63 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 12 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 92 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 79 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 73 ( s , 1h , h - 1 ), 7 . 69 - 7 . 53 ( m , 9h , h - 8 , h - 2 ′, - 3 ′, - 5 ′, - 6 ′ of ph , h - 2 ′, - 3 ′, - 5 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 38 ( tt , 1h , j = 7 . 8 hz , h - 4 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 14h , ch 2 × 7 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). copper iodide ( 0 . 11 g , 0 . 6 mmol ), bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 0 . 08 g , 0 . 1 mmol ), and 36 ml of triethyl amine were added to 2 - decyl - 7 - iodo btbt ( 253 mg , 0 . 5 mmol ) obtained in example 1 , and nitrogen gas was bubbled at room temperature for 15 minutes . subsequently , 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene was added thereto in a nitrogen atmosphere , the temperature of the reaction mixture was increased to 35 ° c ., and the reaction mixture was then stirred for 30 minutes under heating . subsequently , the temperature of the reaction mixture was increased to 85 ° c ., and the reaction mixture was then stirred for 40 hours under heating . after being cooled to room temperature , the reaction mixture was added to 250 ml of water . the produced solid matter was collected by filtration , and washed with 100 ml of acetone . the solid matter was dissolved in 500 ml of cyclohexane heated at 50 ° c . subsequently , 2 g of silica gel and 2 g of a metal scavenger were added to the resulting solution to prepare a slurry . the slurry was stirred at 50 ° c . for one hour , and the silica gel and the metal scavenger were then removed by filtration . recrystallization from the filtrate was performed . as a result , 178 mg of a white crystal of btbt derivative b represented by ( chem . 16 ) was obtained ( yield 74 %). 1 hnmr ( 300 khz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 61 - 7 . 55 ( m , 3h , h - 8 , h - 2 ′, - 6 ′ of ph ), 7 . 38 - 7 . 35 ( m , 3h , h - 3 ′, - 4 ′, 5 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 3 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 14h , ch 2 × 7 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation , as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 0 . 82 g ( 5 . 4 mmol ) of 2 - ethynylnaphthalene . as a result , 197 mg of a white crystal of btbt derivative c represented by ( chem . 17 ) was obtained ( yield 74 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 48 ( d , 1h , h of naph ), 8 . 18 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 88 - 7 . 76 ( m , 5h , h - 9 , h - 4 , 3h of naph ), 7 . 72 ( m , 3h , h - 1 , h - 8 , 3h of naph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 14h , ch 2 × 7 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 0 . 93 g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - phenylbenzene . as a result , 189 mg of a white crystal of btbt derivative d represented by ( chem . 18 ) was obtained ( yield 71 %). 1 hnmr ( 300 khz , cdcl 3 ): δ 8 . 10 ( d , 1h , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 65 - 7 . 59 ( m , 7h , h - 8 , 6h of biph ), 7 . 45 ( t , 2h of biph ), 7 . 36 ( t , 1h of biph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 14h , ch 2 × 7 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 0 . 58 g ( 5 . 4 mmol ) of 3 - ethynylthiophene . as a result , 147 mg of a white crystal of btbt derivative e represented by ( chem . 19 ) was obtained ( yield 60 %). δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 56 ( dd , 1h , h - 8 ), 7 . 54 ( d , 1h of th ), 7 . 32 - 7 . 20 ( m , 3h , h - 3 , 2h of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 14h , ch 2 × 7 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 1 . 05 g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - phenoxybenzene . as a result , 62 mg of a white crystal of btbt derivative f represented by ( chem . 20 ) was obtained ( yield 22 %). δ 8 . 07 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 80 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 54 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 51 ( d , 2h of ph ), 7 . 36 ( m , 2h of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 15 ( tt , 1h of ph ), 7 . 06 ( dd , 2h of ph ), 6 . 98 ( dd , 2h of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 37 ( s , 3h , ph - ch 3 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 14h , ch 2 × 7 ), 0 . 88 ( h , 3h , j = 7 hz , ch 3 ). the same operation as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 0 , 63 g ( 5 . 4 mmol ) of 4 - ethynyltoluene . as a result , 94 mg of a white crystal of btbt derivative g represented by ( chem . 21 ) was obtained ( yield 38 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 3 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 37 ( s , 3h , ph - ch 3 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 14h , ch 2 × 7 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation , as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 0 . 78 g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - propyl benzene . as a result , 102 mg of a white crystal of btbt derivative h represented by ( chem . 22 ) was obtained ( yield 39 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 63 ( t , 2h , ph - ch 2 ), 1 . 63 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 16h , ch 2 × 8 ), 0 . 96 ( t , 3h , j = 7 hz , ch 3 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 2 was conducted except that 0 . 65 g ( 5 . 4 mmol 1 of ethynylbenzene in example 2 was changed to g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - t - butylbenzene . as a result , 113 mg of a white crystal of btbt derivative i represented by ( chem . 23 ) was obtained ( yield 40 %). δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 50 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 39 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 2 . 7 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 63 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 23h , ch 2 × 7 , ch 3 × 3 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 0 . 93 g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - pentylbenzene . as a result , 93 mg of a white crystal of btbt derivative j represented by ( chem . 24 ) was obtained ( yield 34 %). 1 hnmr ( 300 mhz , cdcl 2 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, h - 5 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ch 2 ), 2 . 63 ( t , 2h , ph - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , ph - ch 2 ch 2 ), 1 . 63 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 18h , ch 2 × 9 ), 0 . 88 ( t , 6h , j = 7 hz , ch 3 × 2 ). the same operation as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 1 . 0 g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - hexylbenzene . as a result , 107 mg of a white crystal of btbt derivative k represented by ( chem . 25 ) was obtained ( yield 38 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 63 ( t , 2h , ph - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , ph - ch 2 ch 2 ), 1 . 63 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 20h , ch 2 × 10 ), 0 . 88 ( t , 6h , j = 7 hz , ch 3 × 2 ). the same operation as that in example 2 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 2 was changed to 0 . 56 g ( 5 . 4 mmol ) of 3 - ethynyl - pyridine . as a result , 44 mg of a white crystal of btbt derivative 1 represented by ( chem . 26 ) was obtained ( yield 18 %). 1 hnmr ( 300 mhz , cdcl 2 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , k - 3 ′, - 5 ′ of ph ), 2 . 7 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 63 ( t , 2h , ph - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , ph - ch 2 ch 2 ), 1 . 63 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 20h , ch 2 × 10 ), 0 . 88 ( t , 6h , j = 7 hz , ch 3 × 2 ). first , btbt ( 6 g , 25 mmol ) was added to 300 ml of dichloromethane , and the mixture was stirred in a nitrogen gas atmosphere until the temperature became − 10 ° c . next , aluminum chloride ( 13 . 3 g , 0 . 1 mol ) was added to the mixture , and the temperature was decreased to − 70 ° c . after the temperature reached − 70 ° c ., tetradecanoyl chloride ( 6 . 9 g , 25 mmol ) was added dropwise over a period of 20 minutes , and the resulting reaction mixture was stirred for 3 . 5 hours . the reaction mixture was added , to 600 g of water , and 200 g of dichloromethane was then added thereto . the mixture was transferred to a separatory funnel . the resulting liquid was separated , and the lower layer was washed with 300 g of water . this operation was conducted twice , and an organic layer was then concentrated . the resulting precipitate was dissolved in 300 g of toluene under heating , and then recrystallized at room temperature . as a result , 9 . 7 g of a yellow crystal of 2 -( tetradecyl - 1 - one )- btbt was obtained ( yield 36 %). subsequently , 2 -( tetradecyl - 1 - one )- btbt ( 9 . 0 g , 20 mmol ), 85 . 5 % potassium hydroxide ( 3 . 5 g , 53 mmol ), and hydrazine monohydrate ( 6 . 5 g , 124 mmol ) were added to 300 ml of diethylene glycol . the reaction mixture was stirred in a nitrogen atmosphere , the temperature was increased to 100 ° c ., and stirring was performed for one hour . subsequently , the temperature was increased to 10 ° c ., water was removed from the reaction system using a decanter , and the reaction mixture was stirred under heating for 4 hours . the reaction mixture was cooled to room temperature . a solid matter precipitated in the reaction mixture was then collected by filtration , and washed with water and ethanol in that order . the solid matter after the washing was vacuum - dried at 70 ° c . to obtain 8 . 5 g of 2 - tetradecyl - btbt ( yield 97 %) furthermore , 2 - tetradecyl - btbt ( 8 . 5 g , 19 . 5 mmol ) was added to 150 ml of chloroform and 150 ml of acetic acid . the mixture was stirred at room temperature in a nitrogen gas atmosphere , and 3 . 9 g ( 24 . 4 mmol ) of bromine was added dropwise over a period of 20 minutes . subsequently , stirring was performed for 10 hours and the reaction was terminated . subsequently , 200 ml of water was added to the reaction mixture . the reaction mixture was separated , and the lower layer was collected . the lower layer was concentrated and dried to obtain a crude solid . the solid was recrystallized from acetone to obtain 5 . 82 g of a white crystal of 2 - tetradecyl - 7 - bromo btbt ( yield 58 %). lastly , copper iodide ( 0 . 11 g , 0 . 0 mmol ), bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 0 . 08 g , 0 . 1 mmol ), and 36 ml of triethylamine were added to 2 - tetradecyl - 7 - bromo btbt ( 258 mg , 0 . 5 mmol ), and nitrogen gas was bubbled at room temperature for 15 minutes . next , 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene was added , thereto in a nitrogen atmosphere , the temperature of the reaction mixture was increased to 35 ° c ., and the reaction mixture was then stirred for 30 minutes under heating . subsequently , the temperature of the reaction mixture was increased to 85 ° c ., and the reaction mixture was then stirred for 40 hours under heating . after being cooled , to room temperature , the reaction mixture was added to 250 ml of water . the produced solid matter was collected by filtration , and washed with 100 ml of acetone . the solid matter was dissolved in 500 ml of cyclohexane heated at 50 ° c . subsequently , 2 g of silica gel and 2 g of a metal scavenger were added to the resulting solution to prepare a slurry . the slurry was stirred at 50 ° c . for one hour , and the silica gel and the metal scavenger were then removed by filtration . recrystallization from the filtrate was performed . as a result , 180 mg of a white crystal of btbt derivative m represented by ( chem . 27 ) was obtained ( yield 67 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 61 - 7 . 55 ( m , 3h , h - 8 , h - 2 ′, - 6 ′ of ph ), 7 . 38 - 7 . 35 ( m , 3h , h - 3 ′, - 4 ′, - 5 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 22h , ch 2 × 11 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 13 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 13 was changed to 0 . 63 g ( 5 . 4 mmol ) of 4 - ethynyltoluene . as a result , 124 mg of a white crystal of btbt derivative n represented by ( chem . 28 ) was obtained ( yield 45 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 37 ( s , 3h , ph - ch 3 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 22h , ch 2 × 11 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 13 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 13 was changed to 0 . 93 g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - pentylbenzene . as a result , 162 mg of a white crystal of btbt derivative o represented by ( chem . 29 ) was obtained ( yield 53 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 63 ( t , 2h , ph - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , ph - ch 2 ch 2 ), 1 . 63 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 26h , ch 2 × 13 ), 0 . 88 ( t , 6h , j = 7 hz , ch 2 × 2 ). first , btbt ( 6 g , 25 mmol ) was added to 300 ml of dichloromethane , and the mixture was stirred in a nitrogen gas atmosphere until , the temperature became − 10 ° c . next , aluminum chloride ( 13 . 3 g , 0 . 1 mol ) was added to the mixture , and the temperature was decreased to − 70 ° c . after the temperature reached − 70 ° c ., octanoyl chloride ( 3 . 8 g , 25 mmol ) was added dropwise over a period of 20 minutes , and the resulting reaction mixture was stirred for 3 . 5 hours . the reaction mixture was added to 600 g of water , and 200 g of dichloromethane was then added thereto . the mixture was transferred to a separatory funnel . the resulting liquid was separated , and the lower layer was washed with 300 g of water . this operation was conducted twice , and an organic layer was then concentrated . the resulting precipitate was dissolved in 250 g of toluene under heating , and then recrystallized at room temperature . as a result , 7 . 9 g of a yellow crystal of 2 -( octyl - 1 - one )- btbt was obtained ( yield 84 %). subsequently , 2 -( octyl - 1 - one )- btbt ( 7 . 3 g , 20 mmol ), 85 . 5 % potassium hydroxide ( 3 . 5 g , 53 mmol ), and hydrazine monohydrate ( 6 . 5 g , 124 mmol ) were added to 300 ml of diethylene glycol . the resulting mixture was stirred in a nitrogen atmosphere , the temperature was increased to 10 ° c ., and stirring was performed for one hour . subsequently , the temperature was increased to 170 ° c ., water was removed from the reaction system using a decanter , and the reaction mixture was stirred under heating for 4 hours . the reaction mixture was cooled to room temperature . a solid matter precipitated in the reaction mixture was then collected by filtration , and washed with water and ethanol in that order . the solid matter after the washing was vacuum - dried at 70 ° c . to obtain 6 . 6 g of 2 - octyl - btbt ( yield 94 %). furthermore , 2 - octyl - btbt ( 6 . 5 g , 18 . 5 mmol ) was dissolved in 200 ml of chloroform . the resulting solution was then cooled to 0 ° c ., and 3 . 7 g ( 23 . 1 mmol ) of bromine was added dropwise to the solution over a period of 20 minutes . furthermore , stirring was conducted at 0 ° c . for 0 . 5 hours , and the temperature was then increased to room temperature . stirring was conducted for three hours , and the reaction was terminated . water was added to the solution , and the resulting mixture was separated . the lower layer was collected , and concentrated and dried to obtain a crude solid . the solid was recrystallized from acetone to obtain 4 . 39 g of a white crystal of 2 - octyl - 7 - bromo btbt ( yield 55 %). lastly , copper iodide ( 0 . 11 g , 0 . 6 mmol ), bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 0 . 08 g , 0 . 1 mmol ), and 36 ml of triethylamine were added to 2 - octyl - 7 - bromo btbt ( 216 mg , 0 . 5 mmol ), and nitrogen gas was bubbled at room temperature for 15 minutes . next , 0 . 93 g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - pentylbenzene was added thereto in a nitrogen atmosphere , the temperature of the reaction mixture was increased to 35 ° c ., and the reaction mixture was then stirred for 30 minutes under heating . subsequently , the temperature of the reaction mixture was increased to 85 ° c ., and the reaction mixture was then stirred for 40 hours under heating . after being cooled to room temperature , the reaction mixture was added to 250 ml of water . the produced solid matter was collected by filtration , and washed with 100 ml of acetone . the solid matter was dissolved in 500 ml , of cyclohexane heated at 50 ° c . subsequently , 2 g of silica gel and 2 g of a metal scavenger were added to the resulting solution to prepare a slurry . the slurry was stirred at 50 ° c . for one hour , and the silica gel and the metal scavenger were then removed by filtration . recrystallization from , the filtrate was performed . as a result , 118 mg of a white crystal of btbt derivative p represented by ( chem . 30 ) was obtained ( yield 45 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 63 ( t , 2h , ph - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , ph - ch 2 ch 2 ), 1 . 63 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 14h , ch 2 × 7 ), 0 . 88 ( t , 6h , j = 7 hz , ch 2 × 2 ). first , btbt ( 6 g , 25 mmol ) was added to 300 ml , of dichloromethane , and the mixture was stirred in a nitrogen gas atmosphere until the temperature became − 10 ° c . next , aluminum chloride ( 13 . 3 g , 0 . 1 mol ) was added to the mixture , and the temperature was decreased to − 70 ° c . after the temperature reached − 70 ° c ., hexanoyl chloride ( 3 . 37 g , 25 mmol ) was added dropwise over a period of 30 minutes , and the resulting reaction mixture was stirred for 3 . 5 hours . the reaction mixture was added to 600 g of water , and 200 g of dichloromethane was then added thereto . the mixture was transferred to a separatory funnel . the resulting liquid was separated , and the lower layer was washed with 300 g of water . this operation was conducted twice , and an organic layer was then concentrated . the resulting precipitate was dissolved in 250 g of toluene under heating , and then recrystallized at room temperature . as a result , 7 . 4 g of a yellow crystal of 2 -( hexyl - 1 - one )- btbt was obtained ( yield 88 %). subsequently , 3 -( hexyl - 1 - one )- btbt ( 6 . 8 g , 20 mmol ), 85 . 5 % potassium hydroxide ( 3 . 5 g , 53 mmol ), and hydrazine monohydrate ( 6 . 5 g , 124 mmol ) were added to 300 ml of diethylene glycol . the resulting mixture was stirred in a nitrogen atmosphere , the temperature was increased to 100 ° c ., and stirring was performed for one hour . subsequently , the temperature was increased to 170 ° c ., water was removed from the reaction system using a decanter , and the reaction mixture was stirred under heating for 4 hours . the reaction mixture was cooled to room temperature . a solid matter precipitated in the reaction mixture was then collected by filtration , and washed with water and ethanol in that order . the solid matter after the washing was vacuum - dried at 70 ° c . to obtain 6 . 0 g of 2 - hexyl - btbt ( yield 92 %). furthermore , 2 - hexyl - btbt ( 6 . 0 g , 18 . 5 mmol ) was dissolved in 200 ml of chloroform . the resulting solution was then cooled to 0 ° c ., and 3 . 7 g ( 23 . 1 mmol ) of bromine was added dropwise to the solution over a period of 20 minutes . furthermore , stirring was conducted at 0 ° c . for 0 . 5 hours , and the temperature was then increased to room temperature . stirring was conducted for three hours , and the reaction was terminated . water was added to the solution , and the resulting mixture was separated . the lower layer was collected , and concentrated and dried to obtain a crude solid . the solid was recrystallized from acetone to obtain 4 . 3 g of a white crystal of 2 - hexyl - 7 - bromo btbt ( yield 58 %). lastly , copper iodide ( 0 . 11 g , 0 . 6 mmol ), bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 0 . 08 g , 0 . 1 mmol ), and 36 ml of triethylamine were added to 2 - hexyl - bromo btbt ( 202 mg , 0 . 5 mmol ), and nitrogen gas was bubbled at room temperature for 15 minutes . next , 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene was added thereto in a nitrogen atmosphere , the temperature of the react ion mixture was increased to 35 ° c ., and the reaction mixture was then stirred for 30 minutes under heating . subsequently , the temperature of the reaction mixture was increased to 85 ° c ., and the reaction mixture was then stirred for 40 hours under heating . after being cooled to room temperature , the reaction mixture was added to 250 ml of water . the produced solid matter was collected by filtration , and washed with 100 ml of acetone . the solid matter was dissolved in 500 ml of cyclohexane heated at 50 ° c . subsequently , 2 g of silica gel and 2 g of a metal scavenger were added to the resulting solution to prepare a slurry . the slurry was stirred at 50 ° c . for one hour , and the silica gel and the metal scavenger were then removed by filtration . recrystallization from the filtrate was performed . as a result , 175 mg of a white crystal of btbt derivative q represented by ( chem . 31 ) was obtained ( yield 83 %). 1 hnmr ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 61 - 7 . 55 ( m , 3h , h - 8 , h - 2 ′, - 6 ′ of ph ), 7 . 38 - 7 . 35 ( m , 3h , h - 3 ′, - 4 ′, - 5 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 6h , ch 3 × 3 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 17 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 1 was changed to 0 . 63 g ( 5 . 4 mmol ) of 4 - ethynyltoluene . as a result , 107 mg of a white crystal of btbt derivative r represented by ( chem . 32 ) was obtained ( yield 49 %). 1 hnmr ( 300 khz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 57 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 37 ( s , 3h , ph - ch 3 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 6h , ch 2 × 3 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). the same operation as that in example 17 was conducted except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 17 was changed to 0 . 93 g ( 5 . 4 mmol ) of 1 - ethynyl - 4 - pentylbenzene . as a result , 114 mg of a white crystal of btbt derivative s represented by ( chem . 33 ) was obtained ( yield 46 %). 1 hnmr ( 300 khz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 5 ( dd , 1h , j = 8 . 2 hz , h - 8 ), 7 . 44 ( d , 2h , h - 2 ′, - 6 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 7 . 16 ( d , 2h , h - 3 ′, - 5 ′ of ph ), 2 . 7 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 63 ( t , 2h , ph - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , ph - ch 2 ch 2 ), 1 . 63 ( quint . 2h , j = 7 hz , btbt - ch 2 ch 2 ), 1 . 55 - 1 . 27 ( m , 10h , ch 2 × 5 ), 0 . 88 ( t , 6h , j = 7 hz , ch 3 × 2 ). the same operation as that in example 17 was conducted , except that 0 . 55 g ( 5 . 4 mmol ) of ethynylbenzene in example 17 was changed to 0 . 58 g ( 5 . 4 mmol ) of 3 - ethynylthiophene . as a result , 1 . 66 mg of a white crystal of btbt derivative t represented , by ( chem . 34 ) was obtained ( yield 77 %). 1 hnmr : ( 300 mhz , cdcl 3 ): δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 56 ( dd , 1h , h - 8 ), 7 . 54 ( d , 1h of th ), 7 . 32 - 7 . 20 ( m , 3h , h - 3 , 2h of th ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( quint . 2h , j = 7 hz , btbt - ch 3 ch 3 ), 1 . 55 - 1 . 27 ( m , 6h , ch 2 × 3 ), 0 . 88 ( t , 3h , j = 7 hz , ch 3 ). first , btbt ( 6 g , 25 mmol ) was added to 300 ml of dichloromethane , and the mixture was stirred in a nitrogen gas atmosphere until the temperature became − 10 ° c . next , aluminum chloride ( 13 . 3 g , 0 . 1 mol ) was added to the mixture , and the temperature was decreased to − 70 ° c . after the temperature reached − 0 ° c ., 10 - bromodecanoyl chloride ( 6 . 73 g , 25 mmol ) was added dropwise over a period of 20 minutes , and the resulting reaction mixture was stirred for 3 . 5 hours . the reaction mixture was added to 600 g of water , and 200 g of dichloromethane was then added thereto . the mixture was transferred to a separator / funnel . the resulting liquid was separated , and the lower layer was washed with 300 g of water . this operation was conducted twice , and an organic layer was then concentrated . the resulting precipitate was dissolved in 250 g of toluene under heating , and then recrystallized at room temperature . as a result , 9 . 0 g of a yellow crystal of 2 -( 10 - bromodecyl - 1 - one )- btbt was obtained ( yield 76 %). subsequently , 2 -( 10 - bromodecyl - 1 - one )- btbt ( 8 . 5 g , 18 mmol ), 85 . 5 % potassium hydroxide ( 3 . 2 g , 48 mmol ), and hydrazine monohydrate ( 5 . 85 g , 112 mmol ) were added to 300 ml of diethylene glycol . the resulting mixture was stirred in a nitrogen atmosphere , the temperature was increased to 100 ° c ., and stirring was performed for one hour . subsequently , the temperature was increased to 170 ° c ., water was removed from the reaction system using a decanter , and the reaction mixture was stirred under heating for 4 hours . the reaction mixture was cooled to room temperature . a solid matter precipitated in the reaction mixture was then collected by filtration , and washed with water and ethanol in that order . the solid matter after the washing was vacuum - dried at 70 ° c . to obtain 7 . 0 g of 2 -( 10 - bromodecyl )- btbt ( yield 85 %). furthermore , 2 -( 10 - bromodecyl )- btbt ( 6 . 9 g , 15 mmol ) was dissolved in 200 ml of chloroform . the resulting solution was then cooled to 0 ° c ., and 3 . 0 g ( 18 . 7 mmol ) of bromine was added dropwise to the solution over a period of 20 minutes . furthermore , stirring was conducted at 0 ° c . for 0 . 5 hours , and the temperature was then increased to room temperature . stirring was conducted for three hours , and the reaction was terminated . water was added to the solution , and the resulting mixture was separated . the lower layer was collected , and concentrated and dried to obtain a crude solid . the solid was recrystallized from acetone to obtain 3 . 63 g of a white crystal of 2 -( 10 - bromodecyl )- 7 - bromo btbt ( yield 48 %). next , copper iodide ( 0 . 88 g , 4 . 8 mmol ), bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 0 . 64 g , 0 . 8 mmol ), and 280 ml of triethylamine were added to 2 -( 10 - bromodecyl )- 7 - bromo btbt ( 2 . 16 g , 4 mmol ), and nitrogen gas was bubbled at room temperature for 15 minutes . next , 4 . 4 g ( 43 mmol ) of ethynylbenzene was added thereto in a nitrogen atmosphere , the temperature of the reaction mixture was increased to 35 ° c ., and the reaction mixture was then stirred for 30 minutes under heating . subsequently , the temperature of the reaction mixture was increased to 85 ° c ., and the reaction mixture was then stirred for 40 hours under heating . after being cooled to room temperature , the reaction mixture was added to 1 l of water . the produced solid matter was collected by filtration , and washed with 300 ml of acetone . the solid matter was dissolved in 800 ml of cyclohexane heated at 50 ° c . subsequently , 15 g of silica gel and 15 g of a metal scavenger were added to the resulting solution to prepare a slurry . the slurry was stirred at 50 ° c . for one hour , and the silica gel and the metal scavenger were then removed by filtration . recrystallization from the filtrate was performed . as a result , 1 . 45 g of a white crystal of 2 -( 10 - bromodecyl )- 7 - phenylethynyl btbt was obtained ( yield 65 %). lastly , 15 ml of thf , 15 ml of dimethylformamide ( dmf ), ethyl mercaptan ( 198 mg , 3 . 2 mmol ), cesium carbonate ( 1 . 04 g , 3 . 2 mmol ), and tetrabutylammonium iodo ( 1 . 18 g , 3 . 2 mmol ) were stirred at 0 ° c . a solution prepared by dissolving 2 -( 10 - bromodecyl )- 7 - phenylethynyl btbt ( 447 mg , 0 . 8 mmol ) in 10 ml of thf was added dropwise thereto . the reaction mixture was stirred at the same temperature for 24 hours , and 1 . 5 ml of a saturated ammonium chloride solution was added thereto to terminate the reaction . the reaction mixture was concentrated , and then poured into 100 ml of water . the resulting precipitated crystal was collected by filtration . the crystal was purified by silica gel chromatography ( cyclohexane / chloroform = 85 / 15 ) to obtain 133 mg of a white crystal of btbt derivative u represented by ( chem . 35 ) ( yield 26 %). δ 8 . 08 ( d , 1h , j = 1 . 8 hz , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 61 - 7 . 55 ( m , 3h , h - 8 , h - 2 ′, - 6 ′ of ph ), 7 . 38 - 7 . 35 ( m , 3h , h - 3 ′, - 4 ′, - 5 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 2 . 49 - 2 . 56 ( 4h , — ch 2 — s — ch 2 —), 1 . 70 ( q , 2h , btbt - ch 2 ch 2 ), 1 . 30 - 1 . 60 ( m , 14h , — ch 2 —), 1 . 25 ( t , 3h , ch 3 ). molecular sieves 4 a ( 0 . 5 g ) and cesium hydroxide monohydrate ( 274 mg , 1 . 6 mmol ) were added while stirring 2 -( 10 - bromodecyl )- 7 - phenylethynyl btbt ( 4 . 47 mg , 0 . 8 mmol ) obtained in example 21 , 10 ml of amyl alcohol , 20 ml of dehydrated thf , and 12 ml of dehydrated dmf at room temperature in a nitrogen atmosphere . the resulting reaction mixture was further stirred for 24 hours . furthermore , 100 ml of chloroform was added to the reaction mixture , and the mixture was filtered . the filtrate was washed with water and a saturated saline solution in that order , and an organic layer was concentrated . the residue was purified by silica gel chromatography ( cyclohexane / chloroform = 3 / 1 ) to obtain 56 mg of a white crystal of btbt derivative v represented by ( chem . 36 ) ( yield 12 %). δ 8 . 08 ( d , 1h , j = 1 . 8 hs , h - 6 ), 7 . 83 ( d , 1h , j = 8 . 2 hz , h - 9 ), 7 . 78 ( d , 1h , j = 7 . 8 hz , h - 4 ), 7 . 72 ( s , 1h , h - 1 ), 7 . 61 - 7 . 55 ( m , 3h , h - 8 , h - 2 ′, - 6 ′ of ph ), 7 . 38 - 7 . 35 ( m , 3h , h - 3 ′, - 4 ′, - 5 ′ of ph ), 7 . 29 ( dd , 1h , j = 7 . 8 hz , h - 3 ), 3 . 37 ( t , 4h , — ch 2 — o — ch 2 —), 2 . 77 ( t , 2h , j = 7 hz , btbt - ch 2 ), 1 . 70 ( q , 2h , btbt - ch 2 ch 2 ), 1 . 30 - 1 . 60 ( m , 20h , — ch 2 —), 0 . 90 ( t , 3h , ch 3 ). with regard to btbt derivatives a to v obtained in examples 1 to 22 , the transistor evaluation was performed by the method described above . the results are shown in table 1 . the results of the observation of liquid crystal phases are shown in fig2 to 23 . a compound represented by ( chem . 37 ) was synthesized by the method described in international publication no . wo 2006 / 077888 . with regard to the prepared compound , the observation of a liquid crystal phase was performed as in examples . according to the result , a liquid crystal phase could not be observed . evaluation results of a transistor prepared as in examples are shown in table 1 . a compound represented by ( chem . 38 ) was synthesized by the method described in japanese unexamined patent application publication no . 2013 - 1442 . with regard to the prepared compound , the observation of a liquid crystal phase was performed as in examples . according to the result , a high - order liquid crystal phase could not foe observed . evaluation results of a transistor prepared as in examples are shown in table 1 . referring to the results shown table 1 and fig2 to 23 , the organic semiconductor materials of the present invention exhibit a high - order liquid crystal phase , and thus provide transistor elements which have a practical mobility and in which the variation in mobility is small . in contrast , the compounds of comparative examples do not exhibit a high - order liquid crystal phase . the mobility of the resulting transistor characteristics is low , and the error of mobility is large . the compound of the present invention can be used as an organic semiconductor , and can be used in an organic transistor in which the organic semiconductor material , is used as an organic semiconductor layer .	7
the invention is best understood by reference to the figures wherein like parts are designated with like numerals throughout . fig1 illustrates a preferred monorail guideway assembly generally designated 10 and mounted upon vertical support columns generally designated 11 . a portion of an agt vehicle is generally depicted at 12 , with a portion of the vehicle &# 39 ; s sidewall illustrated as being broken away so as to reveal the positioning of the main drive wheels 54 and auxiliary traction system generally designated 14 . since the guideway assembly 10 is symmetrical about its longitudinal axis , for purposes of simplifying the description , only one half of the guideway assembly is described in detail , it being understood that the other half is identically constructed . each half of the guideway assembly 10 consists of a drive wheel running surface 38 and a support beam 20 . the support beams 20 of each half of the guideway assembly 10 are supported by the vertical side walls of a truss 40 . the running surfaces 38 of each half of guideway assembly 10 are normally coplanar and parallel , permitting the drive wheels 54 of the agt vehicle to traverse the guideway assembly 10 quietly and safely . each running surface 38 is rigidly mounted upon its corresponding support beam 20 , which is coextensive with the running surface 38 so as to give structural support thereto . each beam 20 is positioned under the running surface 38 so as to define a rail overhang 45 . the vertical sides of the beam 20 are essentially perpendicular to the plane of the drive wheel running surface 38 , and may be vertically extended by welding a corresponding length of angle iron 92 to the underside of beam 20 , thus forming a guide wheel running surface 23 ( see also fig2 ). with further reference to fig1 and 2 , a bracket 100 is shown welded to the underside of running surface overhang 45 . other brackets ( not shown ) are spaced along the length of the guideway assembly 10 and are used to secure clamps 101 and 102 which in turn support bus bars 103 and 104 . typically , two such bus bars 103 and 104 are mounted on each side of the guideway assembly 10 . the bus bars extend along the entire length of the guideway assembly , and are used to provide power and control signals to the agt vehicle 12 . as shown in fig1 and 2 , an overhanging skirt 152 is attached to the outer edge of running surface 38 and extends along the entire length of the guideway assembly 10 . the lower end of skirt 152 terminates at the lower end of bus bars 103 and 104 , thus shielding the bus bars 103 - 104 from wind - driven snow and other adverse weather conditions . also , the overhanging skirt 152 helps to shield the guide wheel running surface 23 from the weather . referring to fig3 the auxiliary traction system generally designated at 14 is attached by support struts 50 and 51 to the undercarriage assembly generally designated 49 . support struts 50 and 51 are secured at their lower ends to a fixed support member 76 . the top ends of struts 50 and 51 are attached to the lower outer ends of support beams 52 and 53 , respectively , which are in turn secured to the agt vehicle at attachment arms 56 and 57 . as shown in fig3 the auxiliary traction system 14 is constructed of two identical guide wheel assemblies . for purposes of simplifying the description , only one of the guide wheel assemblies is described in detail , it being understood that the other guide wheel assembly is similarly constructed . the outer end of support member 76 is rotatably connected to the guide wheel assembly at pin 78 ( see fig4 ). pin 78 is vertically oriented and is affixed between plates 58 and 60 , providing both support and a fixed pivot point for plates 58 and 60 relative to the support member 76 . plates 58 and 60 lie in horizontal planes essentially parallel to the plane of the running surface 38 . guide wheel 26 is positioned between plates 58 and 60 with its axle 27 extending on either side of plates 58 and 60 . a hydraulic bias system for the guide wheel assembly is generally designated at 70 and is attached to the outward face of support member 76 . hydraulic bias system 70 is comprised of two hydraulically - charged cylinders 71a and 71b affixed adjacent and parallel to each other , having spring - biased piston members 73 and 74 extending from each end . piston members 73 and 74 are affixed at their outer ends to a piston plate 75 . the plate 75 has an aperture in its midsection through which an adjusting bolt 77 is affixed . a piston arm 72 extends outward through the aperture in plates 75 , being releasably affixed thereto by the adjusting bolt 77 . the extendable length of arm 72 may be adjusted by adjusting bolt 77 . the piston arm 72 is pivotally secured at its outward end about a pin 80 ( see also fig4 ), so as to permit axial rotation of pin 80 relative to piston arm 72 . pin 80 is vertically affixed between plates 58 and 60 . an outward biasing force is communicated from the spring - biased hydraulic system 70 by means of pistons 73 , which force the piston plate 75 outward . plate 75 in turn pushes the arm 72 toward pin 80 . the bias force against pin 80 causes plates 58 and 60 to rotate inwardly about pin 78 ( see fig4 ), forcing the guide wheel 26 into frictional engagement against the guide wheel running surface 23 . the degree of frictional engagement between guide wheel 26 and running surface 23 is proportional to the amount of biasing force exerted by hydraulic system 70 , and may be adjusted by modifying the spring force and / or hydraulic pressure in the hydraulic system ( not shown ). with continued reference to fig3 it is seen that a bracket 63 is affixed across the outer ends of plates 58 and 60 opposite from the connecting point of pins 78 and 80 . bracket 63 is oriented perpendicular to the plates 58 and 60 . secured to the face of bracket 63 is a corresponding bracket 64 , to which is mounted a hydraulic motor 66 . motor 66 is connected to the hydraulic fluid supply system ( not shown ) of the agt vehicle and has a central shaft 79 extending from one end thereof , which shaft 79 may be rotated so as to drive the guide wheel 26 in either a forward or a reverse direction , as hereinafter more fully described . since the hydraulic motor 66 may operate independently of the main drive system of the agt vehicle , the guide wheel may advantageously be used as either an auxiliary drive traction system or , if need be , as the sole drive system of the agt vehicle in the event the main drive system becomes inoperative . as shown in fig4 the motor 66 has a sprocket 67 axially mounted on the protruding end of the motor shaft 79 . attached to the extended lower portion of guide wheel axle 27 is a clutch 62 . clutch 62 is of a conventional type which has a rotatable journaled bearing ( not shown ) at its center . clutch 62 is mounted to a clutch plate 59 ( see fig3 ) that may be selectively engaged or disengaged from a corresponding clutch plate 61 . clutch plate 61 is attached along its inner axial surface to the journaled bearing ( not shown ) of clutch 62 . sprocket 65 is coaxially mounted upon clutch plate 61 between clutch 62 and guide wheel 26 . clutch 62 is supported by a bracket assembly 69 that is secured to the lower face of plate 60 . a drive belt 68 is mounted upon sprockets 65 and 67 . by engaging clutch plates 59 and 61 , rotational force may be transmitted from sprocket 65 to clutch 62 and hence through axle 27 to guide wheel 26 . with clutch plates 59 and 61 disengaged , guide wheel 26 is not driven by the motor 66 . the clutch 62 may be operated by remote control from within the agt vehicle in accordance with well - known conventional techniques . an example of a suitable clutch which has been found to work well in this system is the horton air clutch no . 9103 - 5h5op . it is further notes that the uniroyal power - grip htd sprocket - p80 - 8m - 50 satisfies the requirements for both sprockets 65 and 67 , and may be used with a uniroyal power - grip htd belt 8m - 50 - 47 . 24 &# 34 ;. motors 66 may be , for example , a char - lynn model 110 - 1001 . clearly , motor 66 may be any type of hydraulic or electric motor having comparable characteristics to the motor described above . likewise , other suitable types of clutches , sprockets and drive belts could be used in accordance with the present invention . with further reference to fig2 and 4 , it is seen that in order to avoid contact with the skirt portion 152 of guideway assembly 10 , the motor 66 of each guide wheel assembly is positioned on the plate 60 so as to be situated outwardly of the skirt 152 . thus , as shown in fig4 sprocket 67 is diagonally offset somewhat in relation to sprocket 65 . referring now to fig5 another preferred embodiment of the invention is depicted . the structural elements of the embodiment of fig5 are designated by numerals having the superscript &# 34 ; a &# 34 ;, to denote that the structural elements of the embodiment of fig1 - 4 which are designated by like numerals have similar structure and function . in this embodiment , motor 66a of the guide wheel assembly is mounted to plate 60a directly under guide wheel 26a and is in axial alignment therewith . the shaft of motor 66a is coupled to the axle 27a of guide wheel 26a . thus , in this embodiment , the motor 66a is directly coupled to the guide wheel axle 27a without the use of clutches , belts and sprockets as in the previously described embodiment . as in the previously described embodiment , motor 66a is connected to the hydraulic fluid supply ( not shown ) of the agt vehicle , and is independently operable of the agt vehicle &# 39 ; s main drive system . the operation of motor 66a may be remotely controlled from within the operating cab of the agt vehicle 12 . from the foregoing description it will be apparent that the present invention provides an auxiliary drive traction system for agt vehicles which is both simple in operation and effective in terms of increasing the safety and efficiency of the agt vehicle &# 39 ; s drive system during adverse weather conditions . the auxiliary drive traction system of the present invention may be used in conjunction with any type of agt vehicle , including maintenance vehicles , which are commonly used to push or tow inoperative agt vehicles needing repair or maintenance . the auxiliary drive traction system of the present invention permits such maintenance vehicles to efficiently tow other agt vehicles even during heavy snow or ice conditions . the auxiliary drive traction system of the present invention also provides an independent drive system which may be used in the event the agt vehicle &# 39 ; s main drive system becomes inoperative , thus increasing the operational safety of the agt vehicle . the invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive and the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	8
embodiments of the present invention are directed toward a booster for the initiation of relatively insensitive explosives and a process for manufacturing the same . the basic booster design utilizes a blasting cap sensitive or detonating cord sensitive core surrounded by a less sensitive sheath explosive . in accordance with an embodiment of the present invention , a cup shaped aperture is formed in the core to mate with a blasting cap . the process used to make the core and booster allows for simple adjustments to account for various construction materials and end use applications . in addition , the process used to form the core and final booster assembly reduces the required manufacturing labor due to inherent design features of the core and booster that make them suitable for automated manufacturing techniques . the coupling between the initiation apertures and the core is critical to the proper function of a core - sheath style booster . fig5 a , b & amp ; c depicts a core / sheath booster denoting the ideal coupling zone for the core enveloped by the sheath explosive 13 with respect to the blasting cap aperture and the detonating cord aperture . fig6 depicts the typical explosive output , displayed as vectors , from the detonation of a typical blasting cap , fig6 a & amp ; b , and a length of detonator cord , fig6 c & amp ; d . since the output of the blasting cap emanates from the bottom end due to the base charge 9 , the core location 14 in fig5 a & amp ; b is located near the bottom end of the blasting cap aperture 1 . in addition , it is noted that the output from the blasting cap has both a radial component , fig6 b , and an axial component , fig6 a . on the other hand , the detonating cord effective output is only radial and is consistent along the length of the detonating cord and , therefore , the ideal core 15 , depicted in fig5 c & amp ; d , is equally distributed along the length of the detonating cord aperture 2 . the design specifications of the core , and in particular the cup dimensions , of an embodiment of the present invention are sized primarily in accordance with 1 ) the physical size and design of the blasting cap to be inserted in the cup shaped aperture , 2 ) the physical size of the detonating cord to be inserted in the thru channel aperture , 3 ) the detonation output available from the detonating cord and blasting cap for the particular application and , therefore , the required sensitivity of the core to the blasting cap or detonating cord output and 4 ) the required core output necessary to initiate the sheath explosive . embodiments of the present invention improve the initiating efficacy or detonation transfer between the initiation sources , e . g . the blasting cap or detonating cord , and the core . in particular , the booster utilizes a novel core design in the form of a cup that improves blasting cap to core detonation transfer . the embodiments primarily use three core features to improve detonation transfer ; pre - formed core shape , core material composition and core density . the core &# 39 ; s explosive composition may include a wide range of explosive materials such as melt pour - able compositions , cast - able compositions as well as granular explosives . thus , the core may be made using a variety of forming techniques such as cast - curing , melt pouring or powder consolidation . preferably , the core explosive composition has the form of a granular powder . the preference of a granular form for the explosive used to make the shaped core is based on the ability to use a high speed core manufacturing process , the flexibility to easily change the shape for various applications using the same process , the ability to easily modify the core sensitivity through either formulation or core density modifications . the explosive composition used for the preferred core form is selected from a range of granular explosives that have an initiation sensitivity that can be initiated by the output of the selected initiating device , e . g . a blasting cap or detonating cord . the core explosive composition may contain explosive materials such as , but not limited to , petn , rdx , hmx , tetryl et . al . the output of the initiating device may vary depending on the application and initiating device vendor . however , the output of a no . 8 strength blasting cap or a detonating cord with 18 grains per foot of petn charge represents the typical minimum output that can initiate a common core . the granular explosive composition used to make the preferred core form must be capable of retaining a structure and shape when consolidated . this capability is enhanced by the presence of a homogenously dispersed binder in the explosive composition . materials such as waxes and various polymers are used as the binders and are common to those skilled in the art of explosive formulation . in addition to providing the structural strength in the consolidated form , the binder may also impart other significant properties such as resistance to water ingress into the core , proper powder flow characteristics and safe handling properties . in accordance with an embodiment of the invention , a proper explosive composition used for the core will be a free - flowing granular powder with low friction sensitivity properties such that the powder can be formed into the core shape using a high speed tableting machine . the manufacturing principle of a high speed tableting press is based on filling a precise volume formed by a tooling cavity with the explosive powder . those skilled in the use of tableting presses recognize that in order to achieve a pre - formed core with a consistent weight and density , the granular powder must be free - flowing with consistent granulation . once the cavity is filled , a consolidation ram consolidates the powder in the cavity to form the consolidated core . the cavity and mating consolidation ram precisely define the shape of the consolidated pre - formed core . thus , the use of the proper explosive powder composition , a tableting type consolidation press and shape defining tooling for the press allow for the formation of core having a well defined shape with a precise , controllable density . since the density of the core is well controlled , the booster designer has the ability to precisely control the sensitivity of the core as well as the output of the core . the shape of the pre - formed core provides a predictable physical coupling between the initiation source and the core . this physical coupling increases the reliability of detonation transfer between the initiation source and the core . the pre - formed core design improves both the blasting cap - to - core coupling as well as the detonating cord - to - core coupling . to improve the blasting cap - to - core coupling , the invention utilizes a pre - formed core that is designed to closely couple with both the radial and axial output of a blasting cap . this is accomplished by forming a cup shape in the pre - formed core . fig9 a - d illustrate a booster with a cylindrical core 22 and fig9 e illustrates the cup form in the core 23 . to improve the detonating cord - to - core coupling , in addition to the greater radial coupling surface area , the pre - formed core provides a more uniform density to allow better initiation predictability . fig1 a - d depict a booster that uses a pre - formed core 24 , shown in fig1 e with the cup shaped feature 25 for the blasting cap aperture and also a thru - hole feature 26 for the detonator cord aperture . another unique feature of the pre - formed core design in accordance with an embodiment of the present invention is the ability to precisely locate the core within the sheath . fig1 and 12 depict the core locating features . the precise vertical location is a result of mating the pre - formed core cup feature with the short pin of the aperture forming pins 11 that form the blasting cap aperture during the casting process . fig1 a - c depict the simple cup shaped core 22 and its inherent locating feature . once positioned on the aperture pin , the core is fixed in the vertical position ( z axis ), as shown in fig1 b , simply due to the weight of the core and gravity . in this case , where the core is a simple cup shape as shown in fig1 a , the x - y direction is fixed simply by the mating core cup and the molding pin position . if the pre - formed core also has a design feature to couple with the detonating cord aperture , the long pin of the aperture forming pins 11 used to form the detonating cord aperture mates with a shape feature of the core to precisely locate the core along each of the x , y and z axes . fig1 a - c depict a core 24 having a shape with both a cup and through hole feature that precisely controls the core location within the sheath . once positioned on the aperture pins , the core is fixed in the vertical position ( z axis ) as shown in fig1 b simply due to the weight of the core and gravity . in this case , where the core has both a cup shape for the blasting cap and a thru hole for the detonator cord , the x - y direction is fixed per fig1 a by mating the pre - formed core cup aperture and the thru - hole aperture with the respective molding pin 11 . in accordance with an embodiment of the invention , the pre - formed core has a cup feature for the blasting cap aperture . an advantage of this is that simply by making a defined tooling change in the core forming process , the cup feature as well as other features can be formed that provide application specific improved core - initiating aperture coupling . in particular , the concept allows for the formation of a well defined channel that mates with the detonator cord aperture or forms a second blasting cap aperture . fig1 depicts a few examples of modified shapes that may accommodate particular applications or designs . fig1 a & amp ; b display a basic cylindrical core with the integral cup shape except that the cylinder has a major and minor outside diameter 25 . the larger diameter is designed to provide a tangential coupling with the detonator cord aperture . fig1 c & amp ; d display the basic cylindrical core with the integral cup shape plus a larger base form , mostly elliptical with a cutout 26 to provide a semi circular coupling between the core and the detonator cord channel 2 . fig1 e & amp ; f display a single core design that has two integral cup features 27 for the purpose of redundancy . in addition to the basic configuration , the overall size of the core can be modified to account for differing detonation transfer properties between the core and the sheath explosive . as an example , fig1 illustrates a comparison between two cores , fig1 a & amp ; b represent a standard size pre - formed core 28 used to initiate a common sheath material such as a 60 : 40 tnt - rdx mixture and fig1 c & amp ; d depict a larger pre - formed core 29 designed to initiate a less sensitive sheath explosive such as a 80 : 20 tnt - rdx mixture . because of the pre - determined core shape of embodiments of the present invention , the process for handling the core is predictable . this improved handling factor results in reduced labor and reduces the hazards associated with handling explosives . the presence of a binder in the core composition also tends to reduce the sensitivity of the explosive composition to normal handling hazards . in addition , the preferred core design utilizes a granular explosive composition that allows the core to be made using an automated high speed consolidation process . as a result , the core manufacturing labor content is minimal . fig1 a - e depict the booster manufacturing process for a pre - formed core that has the cup feature for the blasting cap aperture as well as a thru - hole for the detonator cord aperture . the unique cup shaped aperture of the pre - formed core allows the core to be seated onto the blasting cap aperture forming pin in the booster mold . in this case , where the core includes other features designed to couple with a detonating cord , the feature in the core for the detonating cord mates with the detonating cord aperture forming pin in the booster mold as shown in fig1 a . if the pre - formed core does not have a feature for the detonating cord aperture , the pre - formed core is only seated onto the pin that forms the blasting cap aperture . in accordance with the invention , the cup shape controls the vertical ( z ) position of the core in the booster while the x - y location , important when the core contains a detonating cord feature , is controlled by that features mating characteristic with the mold pin . thus , these features locate the core in the booster without the need to manually attach the core to the pins using elastic bands and the like . also , due to the well defined shape of the core and its inherent locating features , the placement of the core onto the pins can be accomplished manually or via conventional automation pick and place techniques . thus , the labor associated with placing and positioning the core onto the molding pins is significantly reduced in accordance with an embodiment of the present invention . due to the precise shape and density of the pre - formed core and the resultant coupling between the core and the initiation sources in accordance with embodiments of the present invention , the amount of core material can be minimized . similarly , the output of the core is very predictable thereby allowing the core to be sized to accurately meet the input needs of the sheath explosive . that is , the core output strength can be tailored to meet the initiation requirements of a range of booster sheath explosives . thus , savings in material costs are achieved by avoiding the use of excess charge sizes due to inefficiencies related to poor initiation source - core coupling and low output strength core densities . also , since the size and output of the pre - formed core can be easily adapted to meet the initiation needs of the sheath explosive , the sheath explosive material is not limited to common explosive compositions thereby allowing the use of the most economical composition . in accordance with an embodiment of the present invention , the pre - formed explosive core has the cup shape 22 shown in fig9 . the cup &# 39 ; s inside diameter is designed to allow a blasting cap to fit down into the cup . while special applications may require a specific inner diameter , the preferred inner diameter is 0 . 328 to accommodate the typical blasting cap diameters . for the exemplary embodiment shown , the core explosive composition can be comprised of 90 - 99 % granular explosive such as petn , rdx or hmx and 1 - 10 % organic binder such as paraffin wax . the sheath explosive can be a composition containing 40 - 50 % tnt , 40 - 50 % granular rdx and 0 - 10 % granular petn . the minimum length of the cup depth is designed to match up with the explosive base charge length of the common blasting cap . the typical minimum length is about 1 . 375 inches and the preferred cup depth is 1 . 125 inches . the thickness of the cup bottom is designed to provide sufficient output upon initiation by the end output from the blasting cap . while the thickness may vary based on the application and explosives used for the booster , the preferred minimum thickness is 0 . 250 inches . the outside diameter is sized to provide sufficient output from the core to initiate the booster sheath explosive . the preferred diameter is 0 . 62 inches . the resultant preferred weight is 7 to 9 grams . although there have been described particular embodiments of the present invention of a new and useful cast booster having a novel explosive core , it is not intended that such references be construed as limitations upon the scope of this invention except as set forth in the following claims .	5
with reference now to the drawings , and in particular to fig1 to 12 thereof , a new and improved paint brush assembly embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . more specifically , the paint brush assembly 10 of the instant invention essentially comprises a clip member 11 having a u - shaped body to include a first plate 12 coextensive with a second plate 13 spaced therefrom and joined by a connecting web 14 at respective first end portions of the first and second plates 12 and 13 permitting pivoting of the first plate relative to the second plate . a second end portion of the first plate includes a first clamp leg 16 extending from the first plate canted downwardly at a predetermined obtuse included angle beyond the second plate at its second end , with the second plate second end having a second clamp leg . the first clamp leg 16 includes a first clamp leg slot 17 , with a second clamp leg 18 directed through the first clamp leg slot 17 , as the second clamp leg 18 is directed and oriented at predetermined obtuse included angle between the second clamp leg and the second plate 13 . a spring member 15 is interposed between the first and second plates 12 and 13 adjacent their second ends as illustrated to bias the first and second plates in an opposed relationship relative to one another . the first clamp leg 16 includes a first clamp jaw plate 19 that is oriented parallel relative to the first plate 12 extending beyond the first plate 12 and a second clamp jaw plate 20 mounted fixedly to the second clamp leg 18 oriented parallel relative to the second plate 13 , with the first and second clamp jaw plates 19 and 20 arranged in confronting coextensive relationship relative to one another having respective first and second jaws 21 and 22 of interdigitated teeth biased towards one another by the spring member 15 . a first jaw plate flange 23 is fixedly and orthogonally mounted to the first clamp jaw plate 19 arranged in an aligned orientation relative to a second jaw plate flange 24 mounted in confronting relationship relative to the first jaw plate 23 , with the first jaw plate flange 24 fixedly and orthogonally mounted to the second jaw plate 20 . a brush head 26 is provided having a matrix of bristles 27 extending therefrom , with the brush head 26 including parallel and coextensive first and second grooves 28 and 29 receiving the first and second jaw plate flanges 23 and 24 respectively therewithin . the first and second jaws 21 and 22 extend beyond the first and second grooves 28 and 29 to engage the periphery of the brush head 26 at an inner face of the brush head 26 and the bristles 27 . the fig9 for example indicates the use of a transparent shield plate 30 fixedly mounted orthogonally to the tubular sleeve 25 at a second end of the tubular sleeve having an entrance opening 31 arranged to receive the clip member 11 , and more specifically the first and second plates 12 and 13 therewithin . the tubular sleeve opening 31 includes the shield plate 30 orthogonally mounted extending beyond the tubular sleeve 25 to afford protection of an individual &# 39 ; s hand during use of the organization . the sleeve 25 is also arranged to include a sleeve rear wall 32 at a first end of the sleeve 25 spaced from the entrance opening 31 . the sleeve rear wall 32 includes a through - extending slot 33 in communication with a cavity 35 within the sleeve , with a scraper blade 34 mounted within a cavity arranged for extension through the rear wall slot 33 . the scraper blade 34 includes a handle lug 37 mounted thereto , with the handle lug extending through a side wall slot 36 , whereupon engagement of the handle lug 37 permits sliding of the handle lug 37 and the associated scraper blade 34 from within the scraper blade cavity 35 to position exteriorly of the sleeve rear wall 32 to permit utilization of the scraper blade to effect scraping of loose paint and the like in use . as to the manner of usage and operation of the instant invention , the same should be apparent from the above disclosure , and accordingly no further discussion relative to the manner of usage and operation of the instant invention shall be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	0
fig1 is a diagram showing the basic approach of the invention . in fig1 , image information source 102 provides content such as broadcast or pre - stored digital video data . multiple streams are derived from the video data by retrieval hardware 104 . the multiple streams are shown as “ stream 1 ,” “ stream 2 ,” . . . “ stream n ” in fig1 . naturally , any number and type of streams can be used . different applications may used different types of streams , such as broadcast “ channels ,” hardwired “ feeds ,” etc . a preferred embodiment also includes auxiliary information with the streams . the auxiliary information can be included with the same carrier as the video stream information ( e . g ., embedded with the video signal ) or it can be provided as a distinct signal , or any other suitable approach may be used . one possibility is to use standard “ sub - picture ” information to carry auxiliary data about an associated stream . the stream and auxiliary data are provided to stream director 108 . stream director 108 directs the input streams among two or more display devices 130 . the directed streams at 120 do not have to correspond to the arrangement or number of the input streams at 106 . in other words , streams can be directed to display devices arbitrarily and dynamically . also , it is not necessary to direct all streams . some streams can be selectively suppressed . a single stream can be sent to multiple devices . streams can be combined into a single display device . other variations may be possible . other possible sources for auxiliary , or other , signals include control source 110 and user input device 112 . control source 110 can be an external device or an information source such as a local network , the internet , etc . a preferred embodiment uses a typical television remote control as a user input device and can allow a user to select streams for viewing or allow directing a specific stream to a specific display device . combinations of automated and manual ( i . e ., user controlled ) stream direction can be used . for example , the auxiliary information associated with a stream can describe what type of camera angle or view of a scene is contained within the stream . this allows a multi - screen “ expanded ” panoramic display ( or “ panoramic video ”) to be created by assigning multiple streams to their respectively positioned display devices . for example , three screens can be used in a “ left ,” “ center ” and “ right ” arrangement as is known in the art . then , left , center and right video streams can automatically be steered to their respective displays . such a panoramic video arrangement is shown in fig2 . in fig2 , system 200 is a portion of the system 100 of fig1 . system 200 includes stream director 202 that can be controlled by the means discussed , above , for fig1 . three streams “ stream 1 ,” “ stream 2 ” and “ stream 3 ” are detected and , using associated auxiliary information , directed to appropriate display devices “ a ,” “ b ” and “ c ” positioned as left , center and right displays , respectively . display device positioning can be communicated to stream director 202 by any suitable means . for example , hardwired connectors on a physical enclosure housing stream director 202 can be pre - assigned with left , center and right display outputs . or a user can manually configure connections for different displays . displays and their positions can be detected automatically . other approaches can be used . note that any number and position of display devices can be used . also , display devices can be any aspect ratio or shape . display devices can also be any suitable type such as liquid crystal display ( lcd ), cathode ray tube ( crt ), organic light - emitting polymer ( olep ), plasma display , etc . stream information can come from multiple content sources . for example , data from the internet can be used to comprise a stream . such data can , itself , be video ( e . g ., mpeg - 4 format ), can be computer generated images , text , web page information , etc . this allows a user to specially configure a viewing environment . in a first example , a user can use three screens to view a music video . a first screen can display a specific band member of the music video , a second screen can display an overall stage view of a performance and a third screen can display a close up of a musician &# 39 ; s hands playing an instrument . in a second example , a user can use 5 screen to view a sporting event . three screens can be set up as left , center , right displays for panoramic video , a fourth screen can be designated to display a particular player who is recorded with a dedicated camera and video stream , and the fifth screen can display a team &# 39 ; s performance statistics as obtained from the internet . although the invention has been described with reference to specific embodiments thereof , these embodiments are merely illustrative , and not restrictive , of the invention . for example , although the invention is discussed primarily with respect to digital video , any type of image information format can be employed , including analog formats . although a preferred embodiment contemplates obtaining streams from a dvd , any source of information can be used including any type of video player , television set ( tv ) set - top box ( e . g ., cable / tv / satellite ), etc . various digital transmission systems , formats ; encoding , encryption or compression approaches ; etc ., may be used with the present invention . any suitable programming language can be used to implement the routines of the present invention including c , c ++, java , assembly language , etc . different programming techniques can be employed such as procedural or object oriented . the routines can execute on a single processing device or multiple processors . although the steps , operations or computations may be presented in a specific order , this order may be changed in different embodiments . in some embodiments , multiple steps shown as sequential in this specification can be performed at the same time . the sequence of operations described herein can be interrupted , suspended , or otherwise controlled by another process , such as an operating system , kernel , etc . the routines can operate in an operating system environment or as stand - alone routines occupying all , or a substantial part , of the system processing . in the description herein , numerous specific details are provided , such as examples of components and / or methods , to provide a thorough understanding of embodiments of the present invention . one skilled in the relevant art will recognize , however , that an embodiment of the invention can be practiced without one or more of the specific details , or with other apparatus , systems , assemblies , methods , components , materials , parts , and / or the like . in other instances , well - known structures , materials , or operations are not specifically shown or described in detail to avoid obscuring aspects of embodiments of the present invention . a “ computer - readable medium ” for purposes of embodiments of the present invention may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , system or device . the computer readable medium can be , by way of example only but not by limitation , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , system , device , propagation medium , or computer memory . a “ processor ” or “ process ” includes any human , hardware and / or software system , mechanism or component that processes data , signals or other information . a processor can include a system with a general - purpose central processing unit , multiple processing units , dedicated circuitry for achieving functionality , or other systems . processing need not be limited to a geographic location , or have temporal limitations . for example , a processor can perform its functions in “ real time ,” “ offline ,” in a “ batch mode ,” etc . portions of processing can be performed at different times and at different locations , by different ( or the same ) processing systems . reference throughout this specification to “ one embodiment ”, “ an embodiment ”, or “ a specific embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention and not necessarily in all embodiments . thus , respective appearances of the phrases “ in one embodiment ”, “ in an embodiment ”, or “ in a specific embodiment ” in various places through out this specification are not necessarily referring to the same embodiment . furthermore , the particular features , structures , or characteristics of any specific embodiment of the present invention may be combined in any suitable manner with one or more other embodiments . it is to be understood that other variations and modifications of the embodiments of the present invention described and illustrated herein are possible in light of the teachings herein and are to be considered as part of the spirit and scope of the present invention . embodiments of the invention may be implemented by using a programmed general purpose digital computer , by using application specific integrated circuits , programmable logic devices , field programmable gate arrays , optical , chemical , biological , quantum or nanoengineered systems , components and mechanisms may be used . in general , the functions of the present invention can be achieved by any means as is known in the art . distributed , or networked systems , components and circuits can be used . communication , or transfer , of data may be wired , wireless , or by any other means . it will also be appreciated that one or more of the elements depicted in the drawings / figures can also be implemented in a more separated or integrated manner , or even removed or rendered as inoperable in certain cases , as is useful in accordance with a particular application . it is also within the spirit and scope of the present invention to implement a program or code that can be stored in a machine - readable medium to permit a computer to perform any of the methods described above . additionally , any signal arrows in the drawings / figures should be considered only as exemplary , and not limiting , unless otherwise specifically noted . furthermore , the term “ or ” as used herein is generally intended to mean “ and / or ” unless otherwise indicated . combinations of components or steps will also be considered as being noted , where terminology is foreseen as rendering the ability to separate or combine is unclear . as used in the description herein and throughout the claims that follow , “ a ”, “ an ”, and “ the ” includes plural references unless the context clearly dictates otherwise . also , as used in the description herein and throughout the claims that follow , the meaning of “ in ” includes “ in ” and “ on ” unless the context clearly dictates otherwise . the foregoing description of illustrated embodiments of the present invention , including what is described in the abstract , is not intended to be exhaustive or to limit the invention to the precise forms disclosed herein . while specific embodiments of , and examples for , the invention are described herein for illustrative purposes only , various equivalent modifications are possible within the spirit and scope of the present invention , as those skilled in the relevant art will recognize and appreciate . as indicated , these modifications may be made to the present invention in light of the foregoing description of illustrated embodiments of the present invention and are to be included within the spirit and scope of the present invention . thus , while the present invention has been described herein with reference to particular embodiments thereof , a latitude of modification , various changes and substitutions are intended in the foregoing disclosures , and it will be appreciated that in some instances some features of embodiments of the invention will be employed without a corresponding use of other features without departing from the scope and spirit of the invention as set forth . therefore , many modifications may be made to adapt a particular situation or material to the essential scope and spirit of the present invention . it is intended that the invention not be limited to the particular terms used in following claims and / or to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include any and all embodiments and equivalents falling within the scope of the appended claims . thus , the scope of the invention is to be determined solely by the appended claims .	7
a detailed description of one or more embodiments is provided below along with accompanying figures . the detailed description is provided in connection with such embodiments , but is not limited to any particular example . the scope is limited only by the claims and numerous alternatives , modifications , and equivalents are encompassed . numerous specific details are set forth in the following description in order to provide a thorough understanding . these details are provided for the purpose of example and the described techniques may be practiced according to the claims without some or all of these specific details . for the purpose of clarity , technical material that is known in the technical fields related to the embodiments has not been described in detail to avoid unnecessarily obscuring the description . in some embodiments , the present invention discloses systems and methods to deliver ozone flow at a wide range of concentration and flow rates . for example , the present ozone delivery system can provide ozone at high concentration with high flow , high concentration with low flow rate , low concentration with high flow rate , and low concentration with low flow rate . conventional ozone generators are typically limited to two operating regimes , such as high concentration with low flow rate and low concentration with high flow rate , or high concentration with low flow rate and high concentration with high flow rate . fig2 a illustrates typical behaviors of ozone concentration as a function of oxygen flow rates . in general , for corona discharge ozone generators , the concentration of ozone reduces with higher oxygen flow rates due to shorter residence time between the electrodes . the rates of reduction depend on the electrode configuration . for example , an ozone generator with long electrode configurations can have a smaller reduction slope 250 as compared to an ozone generator with shorter electrodes showing a more rapid reduction of ozone concentration 260 . ozone delivery systems thus can have four delivery regimes . highest ozone concentration regime 220 is at low flow region 220 . high ozone concentration with high flow rate can be provided at region 230 . in general , the concentration in region 230 is lower than that in region 220 . the two regions 220 and 230 can be achieved from a single ozone generator with low concentration loss , such as a generator with long electrode configuration or an ozone generator with multiple electrode sections . low ozone concentration with high flow rate can be provided at region 240 . the two regions 220 and 240 can be achieved from a single ozone generator with high concentration loss , such as a generator with short electrode configuration . different ozone concentrations at different flow rates can also be achieved by changing power delivered to ozone generator . low ozone concentration with low flow rate can be provided at region 210 . the region 210 is separate from other regions and typically requires a separate ozone generator ( for example , an ozone generator with a short electrode ) for generating low ozone concentration . in general , the ozone generators that can produce ozone specifications 270 according to region 210 cannot satisfy the high ozone concentrations of other regions 220 , 230 or 240 . thus in general , an ozone generator can cover two or three operation regimes . for example , an ozone generator having concentration / flow characteristics of 250 can provide high ozone concentration at low and high flow rates , e . g ., regions 220 , 230 and 240 . an ozone generator having concentration / flow characteristics of 260 can provide high ozone concentration at low flow rates and low ozone concentration at high flow rates , e . g ., regions 220 and 240 . an ozone generator having concentration / flow characteristics of 270 can provide low ozone concentration at low flow rates , e . g ., region 270 . in the figure , the characteristics of the generated ozone are shown as single curves representing functions of flow and concentration . in practice , different power levels can be used , resulting in regions or curves having finite widths . for example , at a flow value , multiple concentrations can be provided for a single ozone generator , depending on the applied powers . similarly , at a concentration value , multiple flows can be obtained , depending on the applied powers . thus . different flows can change the ozone concentration , but different powers are also able to change the ozone concentration at a same flow rate . in some embodiments , the present invention discloses systems and methods of operating an ozone delivery system capable of operating in more than two regimes , for example , three regions 220 , 240 , and 210 ; three regions 220 , 230 , and 240 ; or four regions 220 , 230 , 240 , and 210 . fig2 b - 2d illustrate exemplary behaviors of ozone concentration as a function of oxygen flow rates according to some embodiments of the present invention . fig2 b shows the operation characteristics of an ozone generator having concentration / flow characteristics of 260 , which can additionally be operated in region 210 . the ozone generator can operate in regions 220 and 240 , as exemplified by operating points 225 and 245 . the present invention further provides the ozone generator to be operated in region 210 . for example , to operate the ozone generator at operating point 215 , the corresponding high ozone flow rate can be determined from the characteristic curve 260 , showing operation point 245 . the ozone generator is then operated at operating point 245 , and the output flow is reduced 241 to reach the desired operating point 215 . in some embodiments , the flow reduction can be performed by a flow diverter assembly , which diverts an appropriate amount of ozone flow ( which is the difference between the flow at operating point 245 and the desired flow at operating point 215 ). fig2 c shows the operation characteristics of an ozone generator having concentration / flow characteristics of 250 , which can additionally be operated in region 240 . the ozone generator can operate in regions 220 and 230 , as exemplified by operating curve 250 . the present invention further provides the ozone generator to be operated in region 240 . for example , to operate the ozone generator at operating point 245 , the corresponding high ozone concentration can be determined from the characteristic curve 250 , showing operation point 252 . the ozone generator is then operated at operating point 252 , and the output flow is diluted 234 to reach the desired operating point 245 . in some embodiments , the flow dilution can be performed by a flow dilution assembly , which provides an appropriate amount of oxygen flow ( which is the oxygen flow that can be added to the oxygen / ozone mixture having concentration at 252 to reach the oxygen / ozone mixture having concentration at 245 ). with the oxygen dilution , the flow rate increases , and thus the corresponding operating point 252 should have a lower flow than the desired operating point 245 . the ozone generator can also be operated in region 210 . fig2 d shows the operation characteristics of an ozone generator having concentration / flow characteristics of 250 , which can additionally be operated in both regions 240 and 210 . for example , to operate the ozone generator at operating point 215 , the corresponding high ozone concentration can be determined from the characteristic curve 250 , showing operation point 252 . the ozone generator is then operated at operating point 252 , and the output flow is diluted 234 to reach the desired operating point 245 , for example , by a flow dilution assembly . the output flow is then reduced 241 to reach the desired operating point 215 , for example , by a flow diverter assembly . in some embodiments , the present invention discloses a flow diverter assembly to achieve a low flow configuration from a high flow operating point . in some embodiments , the present invention discloses a flow dilution assembly to achieve a low concentration configuration from a high concentration operating point . in some embodiments , the present invention discloses a combination of a flow dilution and flow diverter assemblies to achieve a low flow low concentration configuration from a high flow high concentration operating point . for example , the flow dilution assembly can provide a low concentration configuration from a high concentration operating point , but with a high flow . the flow diverter assembly then can provide the low flow configuration from the high flow condition . in some embodiments , a flow diverter assembly can be operated as a flow dilution assembly . the present invention describes a flow diverter assembly in detail , but a flow dilution assembly can be similarly constructed from the flow diverter assembly . for example , a flow diverter assembly can couple the ozone output flow to an exhaust port for diverting a portion of the ozone output flow . the same flow diverter assembly can also couple the ozone output flow to an oxygen source for adding an oxygen flow to the ozone output flow , resulting in a dilution effect . in addition , a flow diverter can be coupled to a flow dilution to achieve a low flow configuration after obtaining a low concentration configuration . in some embodiments , the present invention discloses flow diverter assemblies comprising conduits having fixed orifices . fig3 a - 3c illustrate exemplary flow diverter assemblies with fixed orifices according to some embodiments of the present invention . a flow diverter assembly 320 a , 320 b , or 320 c connects the output of an ozone generator 310 with a process chamber 340 . in fig3 a , flow diverter assembly 320 a comprises a divert conduit 325 having fixed orifice , coupled to a main conduit 329 also having fixed orifice . the amount of flow diverted from the ozone generator is proportional to the percentage of the divert conduit 325 . for example , if the two conduits 325 and 329 have same size orifice , then 50 % of the flow is diverted , resulting in 50 % of the ozone output from the ozone generator reaching the process chamber . valves 327 and 323 a are optional , and can be used to control the flow of the ozone . for example , when valve 323 a is close ( with valve 327 open ), 100 % of the ozone output is delivered to the process chamber . when valve 327 is closed ( with valve 323 a closed ), all output is diverted . when both valves are open , 50 % of the ozone output is delivered to the chamber . needle valves can be used to adjust the ratio of the divert flow . in fig3 b , flow diverter assembly 320 b comprises multiple conduits 324 , each with fixed orifice of different sizes . the different size conduits 324 are connected to a manifold 321 through individual valve 323 b . by opening the valves 323 b , different amount of flow can be diverted through the flow diverter assembly 320 b . the valves can be mutually exclusive , meaning only one valve can be open at a time . alternatively , multiple valves can be open at a same time . needle valves can be used to adjust the ratio of the divert flow . in fig3 c , flow diverter assembly 320 c comprises multiple conduits 326 , each with fixed orifice of same size . the same size conduits 324 are connected to a manifold 321 through individual valve 323 c . by opening the valves 323 c , different amount of flow can be diverted through the flow diverter assembly 320 c . the valves can be mutual exclusive , meaning only one valve can be open at a time . alternatively , multiple valves can be open at a same time . needle valves can be used to adjust the ratio of the divert flow . in some embodiments , the present invention discloses flow diverter assemblies comprising controllable exhaust . the flow diverter assemblies can reduce the flow rate generated by the ozone generator so that a desired flow rate can reach a process chamber . fig4 a illustrates an exemplary flow diverter assembly comprising a flow controller according to some embodiments of the present invention . an input flow 415 is supplied to an ozone generator 410 to generate an ozone / oxygen mixture output flow 450 . a flow controller 430 is fluidly coupled to the output flow 450 to provide a desired flow 435 . the flow controller 430 can reduce the flow 450 at the inlet , to produce a flow 435 at the outlet , which is less than the inlet flow 450 . the flows 435 and 425 can be controlled by signals 432 and 422 , which operate a variable orifice valve in the flow controllers 430 and 420 , respectively . in some embodiments , the flow controller 430 comprises a mass flow controller . in some embodiments , a relief valve can be used as of 420 in the line of 425 . the rest of the flow can be flowed out through the exhaust line of 425 . in operation , an ozone / oxygen mixture flow 450 with a desirable concentration is provided to the flow controller 430 . the flow 450 can have higher flow rate than a desirable flow rate 435 , and the flow controller 430 can restrict the flow 450 to achieve the desirable flow rate 435 . the remaining flow can be diverted through a flow diverter assembly 420 . for example , a control signal can be sent to the ozone generator 410 with the desired concentration and a setting flow rate that is higher than the desired flow rate . in some embodiments , the set flow rate is preferably slightly higher to account for the potential loss through the delivery system and assembly . in some embodiments , the set flow rate is the lowest flow rate that can provide the desired ozone concentration . the flow controller 430 is then set to the desired flow rate , and therefore the output flow 435 have the desired concentration and flow rate . the remaining flow rate , e . g ., the difference between the setting flow rate and the desired flow rate , can be diverted through the flow diverter assembly 420 . in some embodiments , the flow controller 420 is set to the remaining flow rate . in some embodiments , the flow controller 430 is optional , and can be omitted . alternatively , the flow controller 430 can be set to be fully open , allowing all gases to pass through . with the flow diverter assembly set to allow a difference flow between the output flow 450 and the desired flow 435 , the flow reaching the process chamber is the desired flow . for example , this configuration can be used when the desired flow 435 is coupled close to the process chamber . fig4 b illustrates an exemplary flow diverter assembly comprising a storage chamber according to some embodiments of the present invention . an input flow 415 is supplied to an ozone generator 410 to generate an ozone / oxygen mixture output flow 450 . a flow controller 430 is fluidly coupled to the output flow 450 to provide a desired flow 435 . the flow 435 can be controlled by signal 432 , which operates a variable orifice valve in the flow controller 430 . a flow diverter assembly 421 is coupled to the ozone / oxygen mixture output flow 450 to release the excess flow rate in 450 that does not pass through the controller 430 . flow diverter assembly 421 comprises a storage chamber 424 to absorb the difference between the output flow 450 and the desired flow 435 . a relief valve 426 can be coupled to the storage chamber 424 to release the pressure in the storage chamber . the relief valve can be controlled to be open only when the pressure exceeds a set value . other flow diverter assemblies can also be used , for example , using a diverter assembly without the flow controller 430 . in operation , an ozone / oxygen mixture flow 450 with a desirable concentration is provided to the flow controller 430 . the flow 450 can have higher flow rate than a desirable flow rate 435 , and the flow controller 430 can restrict the flow 450 to achieve the desirable flow rate 435 . the remaining flow can be diverted through a flow diverter assembly 421 and stored in the storage chamber 421 . when the pressure in the storage chamber exceeds a set point , the relief valve 426 is opened to reduce the pressure in the storage chamber . in some embodiments , the present invention discloses flow dilution assemblies comprising controllable gas supply . the flow dilution assemblies can reduce the concentration ( while increase the flow rate ) generated by the ozone generator so that a desired concentration can reach a process chamber . fig5 a illustrates an exemplary flow dilution assembly comprising a flow controller according to some embodiments of the present invention . an input flow 515 is supplied to an ozone generator 510 to generate an ozone / oxygen mixture output flow 550 . a first flow controller 530 is fluidly coupled to the output flow 550 to provide a desired flow 535 . an oxygen supply 575 can be provided through a flow dilution assembly 570 to mix with the output flow 550 , essentially reducing the concentration of the output flow 550 . the amount of oxygen flow can be controlled , for example , by signal 572 , to obtain the desired concentration at the outlet flow 535 . in operation , an ozone / oxygen mixture flow 550 is provided to the flow controller 530 . the flow 550 can have higher concentration than a desirable concentration at 535 , and the flow dilution assembly 570 can add additional oxygen to the flow 550 to achieve the desirable concentration 535 . the resulting flow rate 535 is higher than the flow rate of the output 550 . the dilution flow through the dilution assembly 570 can be controlled by signal 572 , which together with the flow rate of 550 , can be calculated to achieve the desired flow rate for 535 . in some embodiments , the flow controller 530 is optional , and can be omitted . alternatively , the flow controller 530 can be set to be fully open , allowing all gases to pass through . fig5 b illustrates an exemplary flow diverter and dilution assembly according to some embodiments of the present invention . a flow dilution assembly 570 is provided to reduce the concentration of the output flow 550 from the ozone generator to the desired concentration 551 . a flow diverter assembly 520 is provided to reduce the flow rate of the resulting flow 551 to the desired flow rate 535 . in operation , an input flow 515 is supplied to an ozone generator 510 . the input flow 515 can comprise oxygen , and some catalyst gas , such as nitrogen , to improve the operation of the ozone generator . an ozone / oxygen mixture flow 550 is output from the ozone generator . the flow 550 can have higher concentration than a desirable concentration at 535 , and the flow dilution assembly 570 can add additional oxygen to the flow 550 to achieve the desirable concentration 535 . the resulting flow rate 535 is thus higher than the flow rate of the output 550 . the amount of the additional oxygen flow 575 is controlled by signal 572 , calculated to achieve the desired concentration in the resulting flow 551 . if the resulting flow 551 has higher flow rate than the desired flow rate , a flow diverter assembly 520 is provided to reduce the flow rate of the resulting flow 551 . for example , the flow controller 530 is set to the desired flow rate , and therefore the output flow 535 have the desired concentration and flow rate . the remaining flow rate , e . g ., the difference between the setting flow rate and the desired flow rate , can be diverted through the flow diverter assembly 520 . in some embodiments , the flow controller 530 is optional , and can be omitted . alternatively , the flow controller 530 can be set to be fully open , allowing all gases to pass through . in some embodiments , the present invention discloses a process chamber utilizing the present ozone delivery system . the process chamber can be configured for application using ozone , such as teos / ozone deposition , or ald processes . many ald systems use ozone as an oxidant for film deposition , such as al 2 o 3 , hfo 2 , zro 2 , ta 2 o 5 and tio 2 . the ozone generator usually is located far away from the process chamber , and the ozone concentration is measured at ozone generator output . the long delivery line , which can be heated , can affect the ozone concentration , for example , some ozone could be lost before reaching process chamber . measuring , monitoring or controlling the ozone concentration at a point of use is therefore important for critical process control . in some embodiments , the present invention discloses hardware and process monitoring , troubleshooting as well as controlling , comprising positioning a portion of the ozone delivery system in a close vicinity of a process chamber , and configuring the system controller to accept the operation of the ozone delivery system . fig6 a - 6d illustrate exemplary ozone delivery systems according to some embodiments of the present invention . fig6 a shows a block diagram of an ozone delivery system , comprising a first portion 600 a coupled to a second portion 600 b before delivery to a process chamber 640 . the first portion can comprise an ozone generator 610 . the second portion can comprises a flow diverter / dilution assembly 620 coupled to an optional flow controller 630 . the second portion is preferably disposed in close proximity to the process chamber 640 , while the first portion can be disposed in a farther distance , for example , in a serviceable area . the ozone generator 610 comprises an input flow 614 , which can be an oxygen flow or an oxygen / nitrogen flow mixture . the flow diverter / dilution assembly can be a flow diverter assembly , a flow dilution assembly , or a combination of a flow diverter assembly and a flow dilution assembly . the flow diverter / dilution assembly can comprise outlet / inlet 625 for exhaust / supply . the outlet / inlet 625 can comprise multiple conduits , for example , one for exhaust outlet for a flow diverter assembly and one for oxygen supply inlet for a flow dilution assembly . the resulting flow 635 is achieved by adjusting the output flow from the ozone generator , for example , by reducing the flow rate through the flow diverter assembly and reducing concentration through the flow dilution assembly . fig6 b shows a schematic of the ozone delivery system , comprising a first portion 601 a and a second portion 601 b . first portion 601 a comprises an ozone generator , such as a conventional ozone generator disclosed above , using oxygen input 615 and nitrogen input 616 . second portion 601 b comprises a flow diverter assembly 621 coupled to a flow controller 631 . control signal 662 can be used to control the flow controller 631 to a desired set point . signal 660 can be used to control the flow diverter assembly , for example , generated from the flow controller 631 or from a central controller . other configurations can also be used , such as a flow diverter assembly 621 without a flow controller 631 , a flow dilution assembly , or a combination of flow diverter and dilution assembly . fig6 c shows a block diagram of an ozone delivery system , comprising a first portion 602 a coupled to a second portion 602 b before outputting to a process chamber 640 . the first portion can comprise an ozone generator 610 and a flow diverter / dilution assembly 620 . the second portion can comprise an optional flow controller 630 . the second portion is preferably disposed in close proximity to the process chamber 640 , while the first portion can be disposed in a farther distance , for example , in a serviceable area . fig6 d shows a schematic of the ozone delivery system , comprising a first portion 603 a and a second portion 603 b . first portion 603 a comprises an ozone generator 611 and a flow diverter assembly 621 . second portion 603 b comprises a flow controller 631 . control signal 662 can be used to control the flow controller 631 to a desired set point . signal 660 can be used to control the flow diverter assembly . other configurations can also be used . in some embodiments , the present invention discloses an ozone delivery system that is capable of delivering different ozone concentration at different flow rates . the present ozone delivery system can comprise an ozone generator that can generate ozone at high concentration , and a flow diverter / dilution assembly to reduce the concentration or a flow rate generated from the ozone generator to desired values . fig7 a - 7b illustrate an exemplary ozone delivery system according to some embodiments of the present invention . fig7 a shows a block diagram of an ozone delivery system 700 , comprising an ozone generator 710 coupled to a flow diverter / dilution assembly 720 coupled to an optional flow controller 730 . fig7 b shows a schematic of the ozone delivery system , comprising an ozone delivery system 701 coupled to a process chamber 740 . the ozone delivery system 701 comprises an ozone generator 711 , a flow diverter assembly 721 coupled to a flow controller 731 . control signals 762 and 760 can be used to control the flow controller 731 and the flow diverter assembly 721 to a desired set point . other configurations can also be used . in some embodiments , the present invention discloses an ozone delivery system comprising an ozone generator , wherein the ozone generator comprises a first outlet , wherein the ozone generator is operable to deliver ozone at a first operation condition and a second operation condition , wherein the first operation condition comprises a first ozone concentration and a first ozone flow rate , wherein the second operation condition comprises a second ozone concentration and a second ozone flow rate , wherein the first ozone concentration is higher than the second ozone concentration , wherein the first ozone flow rate is lower than the second ozone flow rate ; a flow controller in fluid contact with the first outlet of the ozone generator , wherein the flow controller comprises an inlet for accepting a first flow and a second outlet for outputting a second flow , wherein the inlet is in fluid contact with the first outlet of the ozone generator , wherein the flow controller is operable to control the flow rate of the second flow to be lower than the flow rate of the first flow ; and a flow assembly in fluid contact with the first outlet of the ozone generator , wherein the flow assembly comprises a controllable diversion path for accepting the difference between the first flow and the second flow . in some embodiments , the flow controller comprises a mass flow controller configured for controlling a mixture of oxygen / ozone . the flow controller comprises a mass flow controller configured for controlling an oxygen flow with a conversion factor suitable for the concentration of a mixture of oxygen / ozone . the flow assembly comprises one or more conduits of fixed orifice . the flow assembly comprises a conduit with controllable orifice . the flow assembly comprises a mass flow controller . the flow assembly comprises a storage volume with a relief valve . the first ozone concentration is higher than 15 wt %, and the second ozone concentration is lower than 5 wt %. the system can further comprise a circuit controller for controlling at least one of the flow controllers , the flow assembly , a power of the ozone generator and an oxygen flow rate of the ozone generator . the system can also comprise a second circuit controller controlling the flow assembly , wherein the second circuit controller controls the flow of the flow assembly with input from the flow controller . in some embodiments , a circuit controller can be included to control the ozone delivery system . the circuit controller can control the ozone generator the flow diverter / dilution assembly , and the flow controller . fig8 a - 8b illustrate exemplary control systems according to some embodiments of the present invention . in fig8 a , an ozone generator 810 comprising input controller 818 coupled to an ozone assembly 819 is coupled to a flow diverter / dilution assembly 820 , which is coupled to an optional flow controller 830 . a circuit controller 890 can be used to control the ozone delivery system , for example , to provide input flow setting 866 to the input controller 818 , provide power setting 864 to the ozone assembly 819 , provide flow setting 862 to the flow diverter / dilution assembly 820 , and provide flow setting 860 to the flow controller 830 . fig8 b shows another controlling scheme according to some embodiments of the present invention . flow setting 863 to the flow diverter / dilution assembly 820 can be provided by the flow controller 830 . alternatively , the flow controller 830 can be omitted , or the flow setting for the flow controller can be supplied by the flow diverter / dilution assembly 820 . in some embodiments , the flow controller or the flow diverter assembly can comprise a mass flow controller , designed for flow setting and measuring . in some embodiments , the mass flow controller can be an ozone / oxygen mixture controller . in some embodiments , the mass flow controller can be an oxygen ( or other gases ) controller . fig9 a - 9b illustrate exemplary flow controller systems according to some embodiments of the present invention . in fig9 a , an ozone generator 910 comprising input controller 918 coupled to an ozone assembly 919 is coupled to a flow diverter / dilution assembly 920 , which is coupled to an optional flow controller 930 . a circuit controller 990 can be used to control the ozone delivery system , for example , to provide flow setting 960 to the flow controller 930 . the flow controller 930 can comprise an ozone / oxygen mixture controller , with the flow setting 960 being the flow value of the mixture . in fig9 b , a flow controller 932 can comprise an oxygen controller , with the flow setting 968 being the flow value of oxygen , adjusted from the value of the ozone / oxygen mixture . for example , a concentration of the flow through the flow controller 932 is known , and thus the amount of ozone is converted to an equivalent amount of oxygen to obtain an effective oxygen flow to be inputted to the controller 932 . the controller 932 can be a mass flow controller calibrated to measure an oxygen flow , and the control signal 968 comprises an effective flow value for the oxygen flow . in some embodiments , the present ozone delivery system comprises a controller or sensor for an ozone / oxygen mixture flow . a detailed description of an ozone / oxygen controller or sensor system can be found in u . s . patent application ser . no . 13 / 271 , 471 , entitled “ systems and methods for measuring , monitoring , and controlling ozone concentration ” filed on oct . 12 , 2011 , and in u . s . patent application ser . no . 13 / 271 , 449 , entitled “ systems and methods for measuring , monitoring , and controlling ozone concentration ” filed on oct . 12 , 2011 , and which are herein incorporated in reference . in some embodiments , the present invention discloses a method to control the delivery of an ozone / oxygen mixture having desired concentration and flow rate . in general , it is difficult for an ozone generator to provide both high concentration and low concentration at specific flow rates . for example , a low concentration ozone generator cannot produce ozone output having high concentration . alternatively , a high concentration ozone generator can generate ozone output having low concentration at a higher flow rate , not at same flow rate as the high ozone concentration flow . in some embodiments , the present invention discloses a method of diverting a portion of an output flow to achieve an ozone / oxygen mixture having specific concentration and flow rate . for example , to achieve an ozone output having low concentration and low flow rate , a first ozone output having low concentration and high flow rate is produced by an ozone generator , and a portion of the first ozone output is diverted to generate a second ozone output having the desired low concentration and low flow rate . fig1 illustrates an exemplary flowchart for an ozone delivery according to some embodiments of the present invention . operation 1000 provides an ozone generator . the ozone generator can deliver ozone at multiple operation conditions . for example , a first operation condition comprises a first ozone concentration and a first ozone flow rate . and a second operation condition comprises a second ozone concentration and a second ozone flow rate . in some embodiments , the first ozone concentration is higher than the second ozone concentration , and the first ozone flow rate is lower than the second ozone flow rate . the present method discloses a process for providing an ozone output having the second ozone concentration with the first ozone flow rate . operation 1010 operates the ozone generator at the second operation condition to deliver a first output of ozone . thus the first output of ozone comprises the second ozone concentration and the second ozone flow rate . operation 1020 reduces the flow rate of the first output of ozone to achieve a second output of ozone . for example , a portion of the first output of ozone can be diverted to a flow diverter assembly , resulting in the second output of ozone comprising the second ozone concentration and the first ozone flow rate . in some embodiments , the method further comprises setting a flow rate for the second output of ozone . for example , the flow rate of the second output of ozone is set by a mass flow controller , either to the output flow , to the diverted flow , or to both flows . in some embodiments , reducing the flow rate comprises diverting a third flow from the first output of ozone , wherein the third flow equals to the difference between the first and second outputs of ozone . the first ozone concentration is higher than 15 wt %, and the second ozone concentration is lower than 5 wt %. the first ozone flow rate is lower than 300 sccm , and the second ozone flow rate is higher than 300 sccm . in some embodiments , the present invention discloses a method of diluting an output flow to achieve an ozone / oxygen mixture having specific concentration and flow rate . for example , to achieve an ozone output having low concentration and high flow rate , a first ozone output having high concentration and low flow rate is produced by an ozone generator , and an additional oxygen is added to the first ozone output to generate a second ozone output having the desired low concentration and high flow rate . fig1 illustrates another exemplary flowchart for an ozone delivery according to some embodiments of the present invention . operation 1100 provides an ozone generator . the ozone generator can deliver ozone at multiple operation conditions . for example , a first operation condition comprises a first ozone concentration and a first ozone flow rate . and a second operation condition comprises a second ozone concentration and a second ozone flow rate . in some embodiments , the first ozone concentration is higher than the second ozone concentration , and the first ozone flow rate is lower than the second ozone flow rate . the present method discloses a process for providing an ozone output having concentration lower than that of the second ozone concentration with a flow rate higher than that of the second ozone flow rate . operation 1110 operates the ozone generator at the second operation condition to deliver a first output of ozone . thus the first output of ozone comprises the second ozone concentration and the second ozone flow rate . alternatively , the ozone generator can be operated at the first operation condition , or in any operation condition between the first and second operations . operation 1120 adds an oxygen - containing gas to the first output of ozone to achieve a second output of ozone . for example , an oxygen gas can be added to the first output of ozone , resulting in the second output of ozone having lower ozone concentration with higher flow rate . in some embodiments , the present invention discloses a method of diluting and diverting a portion of an output flow to achieve an ozone / oxygen mixture having specific concentration and flow rate . for example , to achieve an ozone output having low concentration and low flow rate , a first ozone output having high concentration and low flow rate is produced by an ozone generator , and an additional oxygen is added to the first ozone output to generate a second ozone output having low concentration and high flow rate . then a portion of the second ozone output is diverted to generate a third ozone output having the desired low concentration and low flow rate . fig1 illustrates an exemplary flowchart for an ozone delivery according to some embodiments of the present invention . operation 1200 provides an ozone generator . the ozone generator can deliver ozone at multiple operation conditions . for example , a first operation condition comprises a first ozone concentration and a first ozone flow rate . and a second operation condition comprises a second ozone concentration and a second ozone flow rate . in some embodiments , the first ozone concentration is higher than the second ozone concentration , and the first ozone flow rate is lower than the second ozone flow rate . the present method discloses a process for providing an ozone output having concentration lower than that of the second ozone concentration with a flow rate lower than that of the second ozone flow rate . operation 1210 operates the ozone generator at the second operation condition to deliver a first output of ozone . thus the first output of ozone comprises the second ozone concentration and the second ozone flow rate . alternatively , the ozone generator can be operated at the first operation condition , or in any operation condition between the first and second operations . operation 1220 adds an oxygen - containing gas to the first output of ozone to achieve a second output of ozone . for example , an oxygen gas can be added to the first output of ozone , resulting in the second output of ozone having lower ozone concentration with higher flow rate . operation 1230 reduces the flow rate of the second output of ozone to achieve a third output of ozone . for example , a portion of the second output of ozone can be diverted to a flow diverter assembly , resulting in the third output of ozone comprising the desired concentration and flow rate . fig1 illustrates an exemplary configuration for a process chamber utilizing an ozone delivery system according to some embodiments of the present invention . a process chamber 1300 is controlled by a system controller 1310 , for example , to heat a substrate support , to transfer substrates in and out of the process chamber , or to control process gases and pressure in the process chamber . an ozone generator 1370 accepts an oxygen input flow 1320 and a nitrogen input flow 1330 , and outputs an ozone mixture 1340 ( e . g ., a mixture of oxygen , ozone and nitrogen ) to the process chamber . the controller can output a power signal 1371 to the ozone generator 1370 to regulate the ozone concentration . the system controller 1310 can control the flow rates of oxygen and nitrogen , through outputs 1328 and 1338 to the flow controller 1325 and 1335 , respectively . a flow diverter / dilution assembly 1360 is positioned in the path of the ozone mixture 1340 , in the vicinity of the process chamber . the distance 1380 between the flow diverter / dilution assembly 1360 and the process chamber 1300 is preferably short to provide point of use measurement and controlling . typically , the distance 1380 is preferably less than 1 m , and more preferably less than 10 cm from the process chamber . the controller can output a control signal 1365 to the flow diverter / dilution assembly 1360 to regulate the ozone concentration and flow rate to be provided to the chamber 1300 . in some embodiments , the present invention discloses a processing system comprising a process chamber ; an ozone generator , wherein the ozone generator comprises a first outlet , wherein the ozone generator is operable to deliver ozone at a first operation condition and a second operation condition , wherein the first operation condition comprises a first ozone concentration and a first ozone flow rate , wherein the second operation condition comprises a second ozone concentration and a second ozone flow rate , wherein the first ozone concentration is higher than the second ozone concentration , wherein the first ozone flow rate is lower than the second ozone flow rate ; a flow controller disposed in close proximity to the process chamber , wherein the flow controller comprises an inlet for accepting a first flow and a second outlet for outputting a second flow , wherein the inlet is in fluid contact with the outlet of the ozone generator , wherein the second outlet is in fluid contact with the process chamber , wherein the flow controller is operable to control the flow rate of the second flow to be lower than the flow rate of the first flow ; and a flow assembly in fluid contact with the first outlet of the ozone generator , wherein the flow assembly comprises a controllable diversion path for accepting the difference between the first flow and the second flow . in some embodiments , the flow assembly is disposed in close proximity with the ozone generator . the first ozone concentration is higher than 15 wt %, and the second ozone concentration is lower than 5 wt %. the first ozone flow rate is lower than 300 sccm , and the second ozone flow rate is higher than 300 sccm . in some embodiments , the flow further comprise a circuit controller for controlling at least one of the flow controller , the flow assembly , a power of the ozone generator and an oxygen flow rate of the ozone generator . although the foregoing examples have been described in some detail for purposes of clarity of understanding , the invention is not limited to the details provided . there are many alternative ways of implementing the invention . the disclosed examples are illustrative and not restrictive .	1
fig1 illustrates a typical respiratory humidification system , comprised of three parts : [ 0062 ] 1 ) a humidification chamber located at a distance from the patient , which heats and substantially saturates gases flowing through it ; [ 0063 ] 2 ) a delivery system consisting of a flexible tube which carries humidified gases from the humidification chamber 1 to the gas outlet 5 ; and [ 0064 ] 3 ) a heater base which heats the humidification chamber 1 and provides measurement and control functions . the gas to be humidified flows into the chamber 1 from port 4 and leaves the delivery system 2 at gas exit port 5 . gas from exit port 5 flows to a patient via a face mask or similar ( not shown ). the system is controlled using sensors located at positions 7 and 8 — typically temperature probes . dry gases at the gas input 4 are heated and humidified by passing over the surface of hot water 6 in the chamber 1 so that they are substantially saturated with water vapour when they leave chamber 1 at exit port 10 . hot water 6 is heated by heater plate 9 and the amount of heating is controlled so that the gas reaches a predetermined temperature at exit port 10 . this temperature is measured by sensor 7 . therefore the humidification chamber 1 acts to heat and humidify the medical gases so that they are substantially saturated at the output of chamber 1 , and are at a predetermined temperature . the gas delivery system 2 ( also known as a delivery tube or breathing circuit ) consists of a flexible tube 11 containing a heater 12 , which may consist of a heated resistance wire . the gas from the humidification chamber 1 passes through the tube 11 and is heated by heater 12 to offset heat losses through the walls of tube 11 . the amount of heating applied to heater 12 is regulated so that the gas reaches a predetermined temperature at gas outlet 5 , as measured by sensor 8 . the control temperature at sensor 8 is usually higher than the control temperature at sensor 7 , so that the gas is heated along tube 11 to ensure that condensation doesn &# 39 ; t occur in the tube . the system as described has gas entering gas inlet 4 from a continuous flow gas source ( not shown ) and exiting the system through gas outlet 5 . however the system is equally applicable where the gas source is a ventilator , which creates intermittent flow patterns to provide breaths to a patient . in this case gas outlet port 5 is connected directly to gas inlet port 16 . the patient is connected to port 17 via an endotracheal tube or similar ( not shown ). during patient inspiration dry gases from the ventilator enter the system at inlet port 4 , pass through chamber 1 , delivery system 2 , pass through wye - piece 13 and reach the patient through port 17 . during patient exhalation gases pass back through port 17 , through wye - piece 13 , tube 14 and leave through gas outlet port 18 . tube 14 may also be heated by heater 15 to prevent condensation . humidifiers incorporating humidity sensors for display or control have been described in the prior art , however all used humidity sensors which were positioned at the patient airway . the current work describes novel humidifier configurations incorporating a humidity generating chamber located at a position which is remote from the patient , a heated breathing circuit to transfer humidity to the patient , and humidity sensors to control the level of absolute or relative humidity supplied to the patient . these humidity sensors are to be located either : 1 ) at the chamber outlet only , 2 ) at both the chamber outlet and near the patient , or 3 ) near the patient only . one aspect of the present disclosure would be to use a humidity sensor as sensor 7 . the purpose of humidity sensor 7 is to determine the absolute amount of humidity which is being generated by chamber 1 . accordingly an absolute humidity sensor would be ideal for use as sensor 7 , although the use of a relative humidity sensor with associated temperature sensor could equally be used . this system has the advantage of creating a controlled level of absolute humidity at chamber outlet 10 , however this level of absolute humidity may not reach the patient if condensation is allowed to occur in tube 11 . an alternative system which would overcome this disadvantage is to use a second absolute humidity sensor at point 8 instead of a temperature sensor . the difference in absolute humidity between sensors 7 and 8 allows the humidifier to determine whether condensation is occurring between the two points . if the two absolute humidity sensors 7 and 8 read the same level of absolute humidity then no condensation is occurring in the tube . if the absolute humidity at sensor 7 is greater than at sensor 8 , then the difference shows the rate of condensation that is occurring . one control strategy would be to control the amount of heating provided to heater 12 so that the absolute humidity difference is reduced to zero . however the tube may still contain mobile condensate because the humidity difference only describes the rate of condensation , not the absolute amount of condensate in the tube . another control strategy is to remove this condensate and hence create a dry tube by heating heater 12 so that the rate of measured condensation is negative ( i . e . condensation is being evaporated in tube 11 ) until the measured condensation rate reaches zero , indicating that all of the condensate has been removed . the amount of heating can then be reduced until the sensors show that condensation has just started to occur , then the heating can be increased slightly to the optimum level . drying out of the tube may be a continuous process , or may be initiated at regular time intervals . another variation of the system shown in fig1 would be to use a temperature sensor for sensor 7 and an absolute humidity sensor at point 8 . this system is simpler than having an absolute humidity at both points 7 and 8 . in operation the controller would have to adjust the amount of heating at heater 12 and heater plate 9 so that the correct level of absolute humidity was reached without condensate in delivery tube 12 . in practice two separate control algorithms would be required , one to control the amount of heating occurring in tube 11 so that no condensation occurred , and another to control heater plate 9 so that the desired level of absolute humidity was generated in chamber 1 . the two algorithms could work concurrently because the heater plate 9 will respond slower than heater 12 , so quick changes in absolute humidity would indicate the action of heater 12 . sensor 7 provides a control point for heater plate 9 , but may not be needed . all systems described so far have used a chamber 1 which attempts to humidify the gas leaving gas outlet 10 to a high level of relative humidity . while this condition isn &# 39 ; t essential for the correct operation of the new humidification configurations just described because they use humidity control , it was essential for the prior art humidifier where control is purely based on temperature . however there are some advantages to be gained from using a chamber which heats gases to the correct absolute humidity , but at a low relative humidity ( i . e . the temperature of the gas is higher than the dewpoint of the gas , therefore the gas is not saturated ). the first advantage is that it is easier to design a heated delivery system to transport such a gas without condensation , since the gas doesn &# 39 ; t need to be heated immediately after it enters the delivery tube to prevent condensation . secondly , the use of low relative humidity gases leaving the chamber means that the heater element 12 can be rated at a lower power than would otherwise be the case , as the gas already has a higher energy content and can tolerate a greater loss of energy before the gas condenses in the tube 12 . it may even be possible to use an unheated , well insulated breathing circuit instead of a heated breathing circuit if the chamber provides gas with enough energy . note that low relative humidity chambers can only be used if the heating to the chamber is controlled using an absolute humidity sensor , not a temperature sensor , since otherwise the absolute humidity output would be too low . to this end , some humidification chamber configurations which provide a high temperature , low relative humidity gas output are shown in fig2 - 8 . fig2 shows a chamber which incorporates a metal element 20 ( e . g . a spiral scroll shape ), but without wicking paper attached . this provides both dry heating ( via the metal element ) and heated humidification from the heated water 21 . with this configuration the chamber 19 provides gas which is not saturated because some of the heating provided to the gas is dry heating via the metal scroll . the relative humidity generated by the chamber is affected by the gas flow path , scroll shape , dimensions , and the water level , and so is not readily adjustable in use . however chamber 19 does give the condensate reducing advantages provided by a low relative humidity , controlled absolute humidity output . fig3 and 4 are alternative humidification chambers which provide low relative humidity , high temperature gases at their output . fig3 shows a chamber using a porous material 22 ( such as a porous ceramic ) containing water 23 to provide a heating and humidifying function , while fig4 shows a chamber using a semipermeable membrane 24 to provide a barrier to the water 25 in the chamber . in both cases these chambers provide dry heating via the porous or semipermeable material , as well as heated humidification from the water . in both cases the ratio of heating to humidifying is fixed and cannot be easily adjusted except by limiting the water supply . fig5 to 8 show chambers that can supply gases at varying levels of relative humidity and temperature . in fig5 a variable valve 26 allows us to adjust the ratio of gas which passes through the dry bypass tube 27 to that which flows across the surface of the water 28 . the bypass tube passes under the water to heat the gas . the two gas streams merge at the output 29 . this is an example of a “ parallel ” system where the gas splits and takes two different paths to provide heating and humidification . in fig6 the gas is again split into two gas paths using an adjustable valve 30 . one part of the gas gets humidified by passing across the water 31 in chamber 32 , while the other is heated by heater 58 , which surrounds tube 33 . the gas paths merge at junction 34 . the angle of variable valves 26 and 30 in fig5 and 6 , may be permanently set , may be manually adjustable 1300 , or may be automatically adjustable for example by electromechanical actuation 1400 . one advantage of an automatically adjustable valve would be to provide a constant level of humidity out of the chamber when used with intermittent flow rates , for example when used with a ventilator . these flow patterns can be a problem because parts of the breath cycle contain less humidity than other parts , due to the chamber providing less humidity at higher flow rates . one way to overcome this problem is to measure the instantaneous flow rate using a fast response flow sensor , and then rapidly adjusting the angle of the variable valve . a more practical method of achieving this effect would be to spring - load valves 26 and 30 using springs 70 and 71 or use an elastic valve member to form the variable valve . this would mean that low flow rates would mostly pass through the bypass tubes , while high flow rates would operate the spring - loaded valve and allow more gas to pass across the water in the humidification chamber . the angle of the spring - loaded variable valve could also be used by the humidifier to measure the gas flow rate . fig7 and 8 show alternative series configurations for low relative humidity chambers , where the dry gas entering chamber 35 containing heated water 36 is either pre - heated via heater 37 in fig7 , or heated via heater 38 in fig8 after leaving the chamber . in both cases the heater provides dry heating to the gas and results in a low relative humidity , high temperature gas leaving outlet 39 . any of the low relative humidity , high temperature chambers shown in fig2 to 8 can be used in conjunction with the humidity control schemes described previously in this patent , but not successfully with the prior art humidifier due to it being temperature controlled , not humidity controlled . another facet of the disclosure is shown in fig9 . here the low relative humidity , high temperature humidification system from fig8 has been combined with an unheated , well insulated delivery tube . the incoming gas enters at port 135 into the standard humidification chamber 35 containing water 36 which is heated by heater plate 38 . the gas is substantially saturated in the chamber then leaves the chamber through gas outlet 39 and enters heated tube section 40 which heats the humid gas to a higher temperature , so that it has a low relative humidity . the gas then passes through tube 41 which has an insulating layer 42 around it . preferably the insulating layer is a thin jacket of stagnant air which reduces heat loss . as the high temperature gas , low relative humidity gas passes through the insulating tube , a small amount of heat is lost through the tube walls , and therefore the gas cools . however the amount of heating applied to heater 40 is controlled , so that the gas is never allowed to cool below its dewpoint , which would result in condensation within tube 41 . several different sensor configurations are proposed . firstly , sensor 43 could be an absolute humidity sensor which controls heater plate 38 so that chamber 36 produces the desired level of humidity . in one embodiment sensor 45 is a temperature sensor , which controls heater 40 so that the gas passing sensor 45 remains at a certain desired temperature . if this temperature is greater than the dewpoint of the gas at sensor 43 , then condensation should not occur in tube 41 . however there may already be condensate in tube 41 when the humidifier is turned on . if a humidity sensor is used for sensor 45 instead of a temperature sensor , then the level of condensate occurring in the tube 41 can be controlled . the algorithms described earlier in this patent for dual - humidity sensor control can be used with this system . an alternative location for the absolute humidity sensor is at position 44 instead of 43 . the absolute humidity here should be the same as at 43 because the gas has been heated and so hasn &# 39 ; t lost any moisture . however there may be advantages to placing the absolute humidity sensor at 44 , for instance due to better sensor operation in a low relative humidity environment . this location for the absolute humidity sensor can be used with either a temperature or absolute humidity sensor at location 45 . yet another aspect of this patent relates to removing the need for a sensor at the patient airway . to remove this sensor safely , we must be certain that the gas entering the delivery tube has a safe level of temperature and absolute humidity , and that the surfaces inside the delivery tube do not exceed safe temperature levels . this implies a delivery tube that has a constant internal wall temperature . it would be desirable , therefore , to have a heated delivery tube which self - regulates its temperature at a desired level . the heater could either be embedded in the wall of the delivery tube itself , or it could lie inside the lumen of the delivery tube , or it could be wrapped around the outside of the delivery tube . such a heater could be made from positive temperature coefficient ( ptc ) material ( such as “ winterguard ” from raychem corp ., menlo park , calif . usa ), so that the resistance of the heater increases if the heater is hot , resulting in reduced power . however the delivery tube may pass through more than one environment , or may have localised drafts present on certain parts of the tube . if the ptc elements are arranged in parallel , then the full benefit of the ptc heater can be envisaged . if the ptc elements are arranged in parallel , then the cold portions of the tube will have a lower resistance , which will result in more heat being dissipated . thus the tube will tend to regulate its own temperature . fig1 shows construction of a tube incorporating flexible ptc elements in a parallel wire configuration . the tube 48 is made of a flexible ptc material , which has two low resistive strip connections , 46 and 47 , on either side of it . this allows each portion of the tube to consist of short conducting segments of tube connected in parallel between conductors 46 and 47 . these segments are represented by dotted lines encircling the tube in fig1 . the conductors 46 and 47 are connected to adjustable voltage source 49 , which may be ac or dc . the tube would have an outer layer ( not shown ) which provides electrical insulation and thermal insulation to the tube . each longitudinal segment of the tube will be able to regulate its own temperature independently of the rest of the tube . to enhance this operation , it may be necessary to provide parallel slots 50 running perpendicular to the axis of the tube , to eliminate electrical cross - connection between the different ptc segments . although one specific ptc heated tube design has been envisaged and described , other ptc tube designs could be used . it may also be of advantage to create a ptc tube that has a differing temperature profile along its length rather than a constant temperature profile . the ptc design could also be extended to incorporate ptc heaters in other parts of the patient breathing circuit , such as the flexible extension tube which is usually connected between the y - piece ( port 17 of fig1 ) and the patient &# 39 ; s endotracheal tube . a further extension of the ptc tube concept would be into a self - heated and temperature controlled endotracheal tube . the ptc tube described in fig1 allows us to create a humidifier which doesn &# 39 ; t use any sensor at the patient airway . fig1 shows a humidifier configuration using this tube . gas enters humidification chamber 52 via inlet port 51 and is humidified by water 53 , heated by heater plate 54 . absolute humidity sensor 55 controls the heater plate so that the gas passing sensor 55 is at a desired level of absolute humidity . ptc tube 56 is heated by an external voltage ( not shown ) so that the internal surface temperature is at a constant desired temperature , which is selected to be above the dewpoint of the gas . the gas which leaves tube 56 at outlet 57 will therefore be near the temperature of the tube , and containing the desired level of absolute humidity which was controlled by absolute humidity sensor 55 . a variation of the system shown in fig1 would be to use a temperature sensor at position 55 . another variation of a tube with a constant internal wall temperature would a delivery tube with heated water or other fluid pumped through smaller conduits in the wall of the delivery tube . since the heated fluid has a high specific heat relative to air , the temperature of the fluid remains fairly constant during passage through the delivery wall conduits . traditional humidifiers have tended to use sensors that are probe shaped , so that they can be inserted through specifically designed holes in the side of the breathing circuit to measure temperature . however the humidifier configurations that have been described in this patent incorporate many sensors around the chamber , so the use of a manifold 59 as shown in fig1 may be useful . the humidification chamber 60 is a removable item which can be slid onto the humidifier base 61 as shown in fig1 . as the chamber 60 is slid onto the humidifier base 61 , its base makes contact with heater plate 62 and its inlet and outlet ports 63 and 64 make contact with holes 67 and 68 inside the manifold 59 . dry air to be humidified enters the manifold at port 65 , passes out of the manifold through port 67 , and flows through port 63 into the chamber 60 , where it is humidified . after leaving chamber 60 the humid gas passes through chamber port 64 into manifold port 68 . finally the humid gas leaves manifold 59 through port 66 and passes to the breathing circuit . the manifold may be a separate , removable assembly , or it may be an integral part of the humidifier base . it may contain temperature sensors , humidity sensors , flow sensors , or a heater element . these would be located inside the manifold 59 at positions 72 and 73 . the manifold 59 may be heated to prevent condensation of humid gas . it could connect to both chamber ports 63 and 64 as described , or it may only connect to the outlet port 64 . one advantage of using a manifold is that many sensors or heaters can be combined in a single , cleanable assembly , rather than requiring separate probes which need to be plugged into the breathing circuit . this simplifies connection and setup for the user . another advantage of a manifold is that the incoming dry gas temperature and flow rate can easily be measured without additional probes and connections . although absolute humidity sensors have been described with all of the different humidification schemes described in this patent , relative humidity sensors could also be used . this may involve slightly different control algorithms to the ones described in this patent . alternatively , a relative humidity sensor could be combined with a temperature sensor . this allows the absolute humidity to be calculated from relative humidity and temperature , rather than being measured directly . all of the novel humidification schemes that have been described in this patent could be used with additional temperature sensors . these may provide additional benefits such as providing a safety backup in the event of a failed humidity sensor . another benefit would be maintaining the temperature being delivered to the patient within certain limits so that the relative humidity is not too low , even though the absolute humidity was acceptable . similarly it may be useful to measure the air flowrate through the humidifier , as this is an important parameter which affects humidifier control . therefore flow sensors could be incorporated within any of the previously described systems . one useful prior art flow sensor construction would be to use a sensor based on heat loss from a hot element in the airstream . if a heated humidity sensor is used , the amount of heating that is required for the sensor to achieve temperature can be used to determine the gas flow rate . infection control is a prime consideration when designing medical components . to prevent bacterial colonisation of the components in the humidification system , any parts which come in contact with the gas stream could be made out of antibacterial plastic . to prevent contamination of sensor probes , the probe ports could incorporate a disposable sheath which protects the probe from pathogens in the breathing circuit . this would be particularly applicable to temperature probes . in general humidity probes need to have contact with the gas stream so a disposable sheath would be inapplicable to humidity sensors , unless they worked on optical principles , or unless the sheath was made of water vapour permeable material , which did not allow the passage of pathogens . the protective sheath could be an integral part of a disposable breathing circuit .	0
the present invention is drawn to a flexible heating element for use in a temperature sensing device and a method of assembling the temperature sensing device having the flexible heating element . a flexible circuit includes both the beating element and the temperature sensing element for use within the hollow probe tip the temperature sensing device . the flexible circuit can be bent without any effects detrimental to the function of either the heating element or the temperature sensing element . further , because it is flexible , the heating element may conformingly affix to the curved inner surface of the probe tip . during assembly , the flexible circuit can be bent for easy insertion into the probe tip . in some embodiments an assembly tool , which includes an expandable section , may be used . in a specific embodiment , the expandable section may be an inflatable balloon . the flexible circuit and inflatable balloon are then inserted into a temperature probe for deployment of the flexible circuit . the inflatable balloon is inflated until the flexible circuit contacts the inner surface of the probe . an adhesive on the flexible circuit serves to adhere the flexible circuit to the inner surface of the probe . the balloon is then deflated and removed . the assembly method described above provides for much easier manufacturing than conventional methods . using a flexible circuit allows for much more consistency in the preheating and temperature sensing elements , since they can be assembled without restrictions from the temperature probe . in addition , utilizing the inflatable balloon allows for consistent attachment of the flexible circuit to the probe , such that a more reliable temperature sensing device can be manufactured . example aspects of the present invention will now be further described with reference to fig2 a - 6 . fig2 a - f illustrate planar views of an example manufacturing process of a flexible circuit in accordance with aspects of the present invention . fig2 a illustrates a first step in an example manufacturing process of a flexible circuit in accordance with aspects of the present invention . as shown in the figure , a flexible circuit base 200 is provided . flexible circuit base 200 includes supply portion 202 and head portion 204 . flexible circuit base 200 may be constructed from polyimide , peek , polyester , polyethylene napthalate , polyetherimide , fep or any other material that is able to provide a flexible substrate . flexible circuit base 200 may include a removable film that when removed , exposes an adhesive layer . fig2 b illustrates a second step in an example manufacturing process of a flexible circuit in accordance with aspects of the present invention . as shown in the figure , the second step includes adding heating element 206 and sensor attachments 208 - 214 to flexible circuit base 200 . probe housing 102 provides power to heating element 206 by way of power line 211 , which extends from supply portion 202 . probe housing 102 additionally communicates with sensor attachments 208 - 214 via wires 213 that extend from head portion 204 . heating element 206 may be a conductive material that is able to conduct current in order to generate resistive heat . in some embodiments , heating element 206 may be constructed from resistance wire that is disposed on flexible circuit base 200 . in some embodiments , heating element 206 may be deposited by any known deposition method , a non - limiting example of which includes chemical vapor deposition . in this example embodiment , heating element 206 is a serpentine winding of a portion of power line 211 . in other non - limiting examples , heating element may be any arrangement , coiling or winding of power line 211 . heating element 206 is located on head portion 204 and is operable to preheat a temperature sensing device when the device is fully assembled . the distribution of power line 211 enables a relatively quick and distributed heating of the area of head portion 204 . sensor attachments 208 - 214 may be conductive pads that are disposed to provide a base to which a sensor will be subsequently attached . in some embodiments , sensor attachments 208 - 214 may be constructed from a conductive material that is disposed on flexible circuit base 200 . in some embodiments , sensor attachments 208 - 214 may be deposited by any known deposition method , a non - limiting example of which includes chemical vapor deposition . in some embodiments , sensor attachments 208 - 214 may be located on head portion 204 , while in other embodiments , sensor attachments 208 - 214 may be located on supply portion 202 . the heating element 206 is shown in one configuration in fig2 b , however it can be appreciated that heating element 206 may be disposed on flexible circuit base 200 in any other pattern that would provide heat in accordance with aspects of the present invention . in addition , sensor attachments 208 - 214 are also disposed on flexible circuit base 200 . in this example , sensor attachments 208 - 214 are arranged in a particular configuration . however , sensor attachments 208 - 214 may be arranged in any other configuration that would enable connection of a temperature detecting device in accordance with aspects of the present invention . fig2 c illustrates a third step in an example manufacturing process of a flexible circuit in accordance with aspects of the present invention . as shown in the figure , the third step includes adding a temperature sensor 216 . temperature sensor 216 is attached to sensor attachments 208 - 214 ( not shown ) by any known method or system , a non - limiting example of which includes an adhesive . fig2 d illustrates a fourth step in the example manufacturing process of a flexible circuit in accordance with aspects of the present invention . as shown in the figure , the fourth step includes adding adhesive layer 220 on top of heating element 206 and temperature sensor 216 to create an attachable flexible circuit 218 . adhesive layer 220 provides adhesion while still allowing the assembly to remain flexible . fig2 e illustrates attachable flexible circuit 218 being attached to the inside surface of a probe tip 222 . as shown in the figure , flexible circuit 218 is conformingly adhered to the curved inner surface of probe tip 222 using a method that will be described in more detail with reference to fig5 a - f . in general , adhesive layer 220 is conformingly adhered to the inner surface of probe tip 222 such that flexible circuit 218 is in conforming contact with the curved inner surface of probe tip 222 . fig2 f illustrates a cross sectional view of flexible circuit 218 . as shown in the figure , heating element 206 and temperature sensor 216 are disposed on head portion 204 of flexible circuit 218 . adhesive layer 220 is disposed on heating element 206 and temperature sensor 216 . adhesive layer 220 is a relatively weak adhesive that enables flexible circuit 218 to be detachably fixed to an insertion component to aid in assembly such that neither heating element 206 nor temperature sensor 216 are damaged during the insertion or detachment process . the insertion component and its interaction with flexible circuit 218 will be further described with reference to fig4 a - b and 5 a - e . additional example embodiments of a flexible circuit in accordance with aspects of the present invention will now be described with reference to fig3 a - c . fig3 a illustrates another example embodiment of a flexible circuit 300 in accordance with aspects of the present invention . as shown in the figure , flexible circuit 300 is similar to flexible circuit 218 . however , flexible circuit 300 includes a temperature sensor 302 that is located in a different position than temperature sensor 212 of flexible circuit 218 . providing temperature sensor 302 on supply portion 202 instead of head portion 204 may allow heating element 206 to reach the desired temperature earlier since more surface area of head portion 204 would be covered by heating element 206 . fig3 b illustrates another example embodiment of a flexible circuit 304 in accordance with aspects of the present invention . as shown in the figure , temperature sensor 306 is located in a different position than shown in fig2 c , as described with reference to fig3 a . it is also located on a separate flexible circuit base 308 that is disposed on top of heating element 206 , and heating element 206 is disposed on flexible circuit base 200 . thus , the circuit can be manufactured by disposing temperature sensor 306 on flexible circuit base 308 , and separately disposing heating element 206 on flexible circuit base 200 . then , flexible circuit base 308 may be disposed on top of flexible circuit base 200 , or vice versa , to create flexible circuit 304 . manufacturing the circuit in this manner may simplify the assembly by only requiring one component to be adhered to each of flexible circuit bases 200 and 308 . fig3 c illustrates another example embodiment of a flexible circuit 310 in accordance with aspects of the present invention . as shown in the figure , flexible circuit 310 is different from flexible circuit 220 , such that it can better conform to the shape of probe tip 222 . in particular , head portion 312 includes tapered end 314 to match tapered end 316 of probe tip 222 . previous methods of disposing a heating element and temperature sensor into the probe tip required operators to painstakingly adhere the elements to the inner surface of the probe tip . this required the use of small tools to enable the operator to position the parts properly within the probe tip . the conventional method was manually limited and precise replication from one assembled device to another was non - existent . it can be compared to making a ship in a bottle , each one is painstaking slow in assembly and each resulting assembly is slightly different from the next . in accordance with aspects of the present invention , the heating element and temperature sensor , being attached to the flexible base , are inserted into the probe tip using an inflatable member . this method may be automated , thus increasing assembly speed and increasing precision and duplication . in one example method , the head portion of the flexible circuit may be wrapped around the inflatable member , which is inserted into the probe tip and then inflated . inflating the inflatable member serves to push the head portion of the flexible base against the inner wall of the probe tip , such that the head portion conformingly adheres to the curved inner surface of the probe tip . this will now be further described with reference to fig4 a - b . fig4 a illustrates an insertion component in a first configuration , used in manufacturing a temperature sensing device in accordance with aspects of the present invention . as shown in the figure , insertion component 400 includes outer tube 402 , inner tube 404 , seal flange 406 and inflatable portion 408 . outer tube 402 and inner tube 404 may be constructed from metal , plastic , or any other material that can resist expansion under pressure or vacuum that is sufficient to inflate inflatable portion 408 . outer tube 402 is operable to connect to seal flange 406 and provide a conduit through which vacuum can be pulled . inner tube 404 is operable to connect to inflatable portion 408 and provide a conduit through which fluid may be used to inflate inflatable portion 408 . seal flange 406 is connected to outer tube 402 and is operable to create a seal when it is pressed against a mating surface . seal flange 406 may be made of rubber , silicone , or any other material suitable to create a seal . inflatable portion 408 is connected to inner tube 404 and is operable to inflate when positive pressure is provided inside inflatable portion 408 , when negative pressure is provided outside inflatable portion 408 , or a combination of both . inflatable portion 408 may be made of a compliant or non - compliant material . if a compliant material is used , the walls of inflatable portion 408 will stretch as it is inflated , thus it may be beneficial to use a compliant material if probe tips of different diameters are being produced . thus , a single insertion component could be used to manufacture multiple sizes of probe tips . a non - limiting example of a compliant material is latex . if a non - compliant material , such as nylon , is used , the walls of inflatable portion 408 will not stretch as it is inflated . instead , inflatable portion 408 would be created such that , when fully inflated , the outer diameter of inflatable portion 408 is substantially equivalent to the inner diameter of the probe tip . in a manufacturing process , this may be beneficial because the inflatable portion , when inflated with a specific volume of inflation material , will reach the same inflated size every time . this leads to a repeatable , reliable assembly process when one size probe tip is being manufactured . a non - limiting example of a non - compliant material is nylon . the operation of insertion component 400 is further described with reference to fig4 b . fig4 b illustrates insertion component 400 in a second configuration , used in manufacturing a temperature sensing device in accordance with aspects of the present invention . as shown in the figure , inflatable portion 408 is in an expanded configuration . the expansion can occur based on a pressure differential between the volume within inner tube 404 and the volume between inner tube 404 and outer tube 402 . in one embodiment , inflatable portion 408 expands as pressure is introduced through inner tube 404 . for example , the pressure within inner tube 404 increases when fluid is introduced into inner tube 404 , as shown by the arrow marked “ a ”. as pressure within inner tube 404 increases , the diameter of inner tube 404 does not increase . in contrast , the same pressure in inner tube 404 will be present in the interior volume of inflatable portion 408 , as inner tube 404 and inflatable portion 408 are in fluid communication with each other . as pressure increases in the interior volume of inflatable portion 408 , inflatable portion 408 will expand . any fluid may be used non - limiting examples of which include air and water . in another embodiment , inflatable portion 408 expands when pressure decreases in the volume between inner tube 404 and outer tube 402 . for example , the pressure in the volume between inner tube 404 and outer tube 402 may decrease by suctioning air through outer tube 402 ( as shown by the arrow marked “ b ”), while seal flange 406 is properly sealed against another surface . expanding inflatable portion 408 in this manner may require inner tube 404 , outer tube 402 and the surface against which seal flange 406 is sealed to be rigid in order to maintain structural rigidity under suction . in another embodiment , a combination of pressurized fluid and suction may be used together in order to inflate the inflatable member to the desired size . for example , the pressure in the volume within inner tube 404 may be increased by introducing fluid into inner tube 404 , as shown by the arrow marked “ a ,” and the pressure in the volume between inner tube 404 and outer tube 402 may be decreased by suctioning air through outer tube 402 ( as shown by the arrow marked “ b ”), while seal flange 406 is properly sealed against another surface . insertion component 400 is used to conformingly affix flexible circuit 218 to the curved inner surface of probe tip 222 as will be described in more detail with reference to fig5 a - f . fig5 a illustrates a first step of assembling a temperature sensing device in accordance with aspects of the present invention . ( shows the heater element .) as shown in the figure , system 500 includes flexible circuit 591 and insertion component 499 . flexible circuit 591 is disposed against inflatable portion 498 in preparation for deployment of flexible circuit 591 . in some embodiments , the surface of flexible circuit 501 may be coated with an adhesive in order to maintain contact between flexible circuit 501 and inflatable portion 408 . the adhesive layer will be described in greater detail with reference to fig5 b . the adhesive used for this purpose should be relatively weak as compared to adhesive layer 214 , which is coated on the surface of flexible circuit 220 that is not in contact with inflatable portion 408 . fig5 b illustrates a cross sectional view of flexible circuit 501 . as shown in the figure , flexible circuit 501 includes all of the elements discussed with reference to flexible circuit 218 , but also includes adhesive 502 and peel - off layer 504 . adhesive 502 is a stronger adhesive than adhesive 224 , and enables flexible circuit 501 to stick to another surface . once adhesive layer 502 deposited on head portion 204 , in some embodiments , peel - off layer 504 may be added . in this manner , flexible circuit 501 can be mass manufactured with peel - off adhesives . when flexible circuit 501 is to be added or inserted into a probe tip , the peel - off layer can be removed so adhesive layer 502 can be conformingly attached to the curved inner surface of the probe housing . employing this method will allow for a plurality of flexible circuit boards to be prefabricated and stored , such that the peel - off layer can be removed at the time of assembly . the attachment process will be further described with reference to fig5 c - e . in other embodiments , once adhesive 504 is applied to head portion 204 , flexible circuit 501 can be inserted and attached to the inside of the probe housing . in this embodiment the entire device is made at one time ( there is no need to store a plurality of ready to use flexible circuits as discussed above ). with reference to fig5 c - e , it is assumed that the peel - off layer has ahead been removed . fig5 c illustrates the second step of assembling a temperature sensing device in accordance with aspects of the present invention . as shown in the figure , system 506 includes flexible circuit 501 and insertion component 400 . in this step , flexible circuit 501 is wrapped around inflatable portion 408 . weak adhesive layer 224 will serve to adhere flexible circuit 501 to inflatable portion 408 . fig5 d illustrates the third step of assembling a temperature sensing device in accordance with aspects of the present invention . as shown in the figure , system 508 includes flexible circuit 501 , insertion component 400 and probe tip 222 . in this step , the assembly of the wrapped flexible circuit 501 and insertion component 400 is inserted into probe tip 222 . insertion is continued until seal flange 406 contacts and seals against probe tip 222 . fig5 e illustrates the fourth step of assembling a temperature sensing device in accordance with aspects of the present invention . as shown in the figure , system 510 includes insertion component 400 in an expanded state , flexible circuit 501 and probe tip 222 . in an example embodiment , an operator will inflate inflatable portion 408 by either introducing fluid through inner tube 404 ( shown by arrow “ a ”), suctioning fluid through outer tube 402 ( shown by arrow “ b ”), or using some combination thereof . inflatable portion 408 will continue to be expanded until flexible circuit 501 contacts the inner surface of probe tip 222 , thus putting adhesive 502 in contact with the inner surface of probe up 222 as well . adhesive 502 adheres to the inner surface of probe tip 222 . fig5 f illustrates the fifth step of assembling a temperature sensing device in accordance with aspects of the present invention . as shown in the figure , system 512 includes flexible circuit 501 and probe tip 222 . in this step , inflatable member 408 has been deflated and removed from probe tip 222 , leaving flexible circuit 501 adhered to the inner surface of probe tip 222 . the process of deflating inflatable member 408 includes detaching inflatable member 408 from flexible circuit 220 . as discussed with reference to fig5 a , adhesive layer 224 between inflatable member 408 and flexible circuit 501 provides a weak bond as compared to adhesive layer 502 between flexible circuit 501 and the inner surface of probe tip 222 . thus , when inflatable member 408 is deflated , the weak bond between inflatable member 408 and flexible circuit 501 is broken , allowing insertion component 400 to be removed , leaving flexible circuit 501 attached to the inner surface of probe tip 222 . fig5 g illustrates an alternate view of the system in fig5 f . as shown in the figure , a 3 - dimensional view of system 512 is shown . it can be appreciated that , while inflatable member 408 is expanding as shown in fig5 e , flexible circuit 501 is deforming so as to conform to the curved inner surface of probe tip 222 . as a non - limiting example , the two free ends of flexible circuit 501 may be in contact with one another when flexible circuit 501 is wrapped around inflatable member 408 in the deflated configuration . as inflatable member 408 is expanded , however , the two free ends of flexible circuit 501 will move apart from each other , and will continue to move apart until flexible circuit 501 contacts the inner surface of probe tip 222 . as shown in fig5 g , flexible circuit 501 does not contact the inner surface of probe tip 222 over its hill circumference due to the expansion discussed above . the amount of contact , though , is still sufficient for preheating probe tip 222 as needed . conventional assembly methods typically employ a single rigid heating element to preheat the probe tip . in many cases rigid heating element has a flat surface for affixing to the curved inner surface of the probe tip . accordingly , to reduce the space between the flat surface of the rigid heating element and the curved inner surface of the probe tip , the affixing surface of the rigid heating element is minimized . this minimized surface area inefficiently preheats the probe tip , because the heat must radiate from the relatively small single rigid heating element surface area . furthermore , the conventional assembly methods are typically manual , which results in imprecise duplication of heating element placement . in contrast , flexible circuit 220 of the present invention conformingly attaches to the inner surface of probe tip 216 , thus disposing heating element 202 over a large portion of the inner surface of probe tip 216 . the coil arrangement of heating element 202 allows for it to be in contact with much more surface area of the inner surface of probe tip 216 than the heating element of the prior art , and therefore it provides for more efficient preheating of probe tip 216 . in addition , because heating element 202 and temperature sensor 212 are disposed on flexible circuit 220 prior to insertion into probe tip 216 , the assembly method is much simpler . furthermore , an assembly method in accordance with aspects of the present invention may be automated , which results in very imprecise duplication of heating element placement . fig5 h illustrates another embodiment of the system in fig5 f . as shown in fig5 g , system 514 includes probe tip 222 , flexible circuit 501 and heat insulating material 516 . heat insulating material 516 may include curable insulating materials , expandable insulating materials , or any other insulating materials that could be applied inside probe tip 222 , provided that the materials used do not erode or degrade the circuit assembly . insulating material 516 serves multiple purposes . first , it may provide support to flexible circuit 501 to maintain contact between flexible circuit 501 and the inner diameter of probe tip 222 . thus , if adhesive layer 502 failed at some point and no longer was able to keep flexible circuit 501 in contact with the inner surface of probe tip 222 , heat insulating material 516 would prevent flexible circuit 501 from losing contact with the inner surface of probe tip 222 . second , heat insulating material 516 may help maintain probe tip 222 at a preheated temperature for a longer period of time , thus reducing the amount of power required to maintain the preheated temperature . fig5 i illustrates a final assembly of a temperature sensing device in accordance with aspects of the present invention . as shown in the figure , system 518 includes flexible circuit 501 , probe tip 222 , and probe 104 . system 518 is also shown as including optional heat insulating material 516 . probe 104 may be attached to probe tip 222 using standard joining methods , non - limiting examples of winch include adhesives , welding , soldering , mechanical fasteners , or any other joining method that would serve to connect probe 104 to probe tip 222 in a reliable and repeatable fashion . probe 104 can then be attached to probe housing 102 ( not shown ) using standard attachment methods or mechanisms . as described above , temperature sensor 212 is located in probe tip 222 , however in other embodiments the temperature sensor is not required to be at the probe tip , thus further simplifying the assembly process . in some embodiments , the temperature sensor is an infrared thermal detector that may be located elsewhere in the assembly . the infrared thermal detector will be designed to detect the temperature of probe tip 222 by sensing the infrared radiation emitted from the inner surface of probe tip 222 . an example embodiment wherein the temperature sensor is not disposed at the probe tip will now be described in greater detail with reference to fig6 . fig6 illustrates an alternate assembly configuration for a temperature sensing device in accordance with aspects of the present invention . as shown in the figure , system 600 includes probe housing 602 , infrared sensor 604 , probe 104 , probe tip 222 , heating element 206 and flexible circuit 606 . probe housing 602 is very similar to probe housing 102 ( not shown ), however it includes a space in which to mount infrared sensor 604 . infrared sensor 604 may be any standard infrared sensor that utilizes pyroelectric or ferroelectric materials , or that utilizes micro bolometer technology . flexible circuit 606 is substantially similar to flexible circuit 501 , however it does not include a temperature sensor , it only includes heating element 206 , as the temperature sensor from flexible circuit 501 was replaced by infrared sensor 604 . in operation , when probe tip 222 is placed at the site where the temperature reading is desired , infrared sensor 604 would sense the temperature at probe tip 222 and relay the temperature to the display module ( not shown ). this configuration would further simplify the assembly process by eliminating the need to provide a temperature sensor as part of flexible circuit 606 . in prior art temperature sensing devices , the assembly method is tedious , time - consuming , and not particularly reliable or repeatable . the assembly method is dependent on skilled operators manually attaching a heating element and temperature sensor to the inner surface of a probe , which is akin to assembling a ship in a bottle . in addition , the heating element does not necessarily conform to the inner surface of the probe , reducing the heating efficiency by reducing the amount of surface area in which the heating element is in contact with the inner surface of the probe tip . the present invention provides several methods of assembling a temperature sensing device that overcomes the limitations of the prior art . the heating element and temperature sensor are disposed on the head portion of a flexible circuit base . this allows for the heating element to cover the majority of the head portion of the flexible circuit base , while the temperature sensor covers the remaining space of the head portion . the head portion of the flexible circuit base is then wrapped around an inflatable member and inserted into the probe tip . the inflatable member is then inflated , expanding the head portion of the flexible circuit base until the head portion conformingly attaches to the curved inner surface of the probe tip . the inflatable member is then deflated and removed , thus leaving the assembled probe tip ready for further operations to attach the tip to the rest of the temperature sensing device using standard methods . the assembly method in accordance with aspects of the present invention provides for more efficient , uniform preheating of the probe tip because the heating element is conformingly attached to the curved inner surface of the probe tip , thus providing a larger surface area for preheating . in addition , the method of using an inflatable member to attach the flexible circuit to the probe tip eliminates the need for highly skilled workers , and provides a much more reliable and repeatable process with which a temperature sensing device may be manufactured . the foregoing description of various preferred embodiments have been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . the example embodiments , as described above , were chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto .	8
an embodiment is a method for combining private contact information and eas data in the same directory . in one embodiment , the eas data and contact information are stored on an erp server . fig1 is a block diagram of an erp server 101 in accordance with this embodiment . erp is a software architecture that facilitates the flow of information among the different functions within an enterprise . similarly , erp facilitates information sharing across organizational units and geographical locations . it enables decision - makers to have an enterprise - wide view of the information they need in a timely , reliable and consistent fashion . erp provides the backbone for an enterprise - wide information system . at the core of this enterprise software is a central database that draws data from and feeds data into modular applications that operate on a common computing platform , thus standardizing business processes and data definitions into a unified environment . with an erp system , data needs to be entered only once . the system provides consistency and visibility or transparency across the entire enterprise . a primary benefit of erp is easier access to reliable , integrated information . a related benefit is the elimination of redundant data and the rationalization of processes , which result in substantial cost savings . in one embodiment , erp server 101 is implemented as part of the oracle ® e - business suite . erp server 101 includes a processor ( not shown ) for executing instructions and a memory ( not shown ) for storing an operating system and software modules executable by the processor . erp server 101 is accessible by at least one administrator 120 and at least one employee 130 via , for example , network 140 . erp server 101 includes a plurality of modules 102 - 108 and a central database 110 including data collected , utilized and reported by modules 102 - 108 . manufacturing module 102 collects , utilizes and reports data relating to manufacturing engineering , bills of material , scheduling , capacity , workflow management , quality control , cost management , manufacturing process , manufacturing projects , and manufacturing flow , among other aspects . supply chain management module 103 collects , utilizes and reports data relating to inventory , order entry , purchasing , supply chain planning , supplier scheduling , inspection of goods , claim processing , and commission calculation , among other aspects . financials module 104 collects , utilizes and reports data relating to general ledgers , cash management , accounts payable , accounts receivable , and assets , among other aspects . projects module 105 collects , utilizes and reports data relating to costing , billing , and time and expenses of projects , employee activity on a project , among other aspects . customer relationships management module 106 collects , utilizes and reports data relating to sales and marketing , commissions , service , customer contact , and call center support , among other aspects . data warehouse module 107 includes interfaces for suppliers , customers , and employees to access a data warehouse . human resources module 108 collects , utilizes and reports data relating to position management , performance review , applicant tracking , payroll , training , time and attendance , and benefits , among other aspects . human resources module 108 is described in greater detail below . fig2 is a block diagram of human resources module 108 in accordance with an embodiment . human resources module 108 includes a plurality of modules 201 - 207 that collect , utilize and report data relating to human resources . position management module 201 collects , utilizes and reports data relating to positions held by employees within the organization , and any change in those positions , among other aspects . performance review module 202 collects , utilizes and reports data relating to performance evaluations of employees within an organization , for example , as the evaluations relate to promotion or compensation , among other aspects . applicant tracking module 203 collects , utilizes and reports data relating to potential candidates for employment within the organization , among other aspects . payroll module 204 collects , utilizes and reports data relating to employ compensation within the organization , among other aspects . training module 205 collects , utilizes and reports data relating to continuing education courses available to employees , and which employees have completed such courses , among other aspects . time and attendance module 206 collects , utilizes and reports data relating to hours worked , days present , sick leave , and vacation leave for employees within the organization , among other aspects . benefits module 207 collects , utilizes and reports data relating to employee benefits , for example , health and dental insurance , transit benefits , pension and retirement programs , and profit sharing programs , among other aspects . human resources module 108 further includes a rostering module 208 for collecting , maintaining and displaying contact information for employees in the organization . this information , stored in database 110 , typically includes but is not limited to work email , work phone , office location , title , supervisor , a picture of the employee , a public work calendar , social security number , home address , home phone , mobile phone , and emergency contact information . this information may be changed or created only by permitted personnel , such as a human resources administrator . when an employee 130 accesses the rostering module 208 to retrieve contact information for a coworker , for example , via an organizational intranet , the employee 130 receives a limited view of the information . typically , this information is limited to organizational information such as work email , work phone , office location , title , supervisor , public work calendar , and picture of the coworker . a human resources administrator 120 may configure which information should be displayed to coworkers . in addition to this information , employee 130 sees private contact information about their coworker that the employee added via the rostering module 208 . fig3 illustrates a directory user interface (“ ui ”) 301 displaying public organizational information 303 and private contact information 305 . for example , if employee 130 knows the private home phone , home address , and / or mobile phone of coworker a , then employee 130 adds that private contact information 305 to database 110 via rostering module 208 . the private contact information 305 regarding coworker a is visible and accessible only to the person that added it , that is , employee 130 . however , employee 130 may also grant permissions to other employees to allow them to see the data also , and push that data ( send an alert ) to other employees when that data changes or is updated . one or ordinary skill in the art will also understand that network administrator 120 could likely have access to the private contact information . furthermore , because the private contact information 305 is stored on erp server 101 , the private contact information enjoys the benefit of the periodic archiving of database 110 . when employee 130 views their own contact information , they see all of the information collected by rostering module 208 , and may select which private information to make public via rostering module 208 . fig4 illustrates a flow diagram of the functionality of erp server 101 in accordance with an embodiment when combining personal contact information and erp data . in one embodiment , the functionality of the flow diagram of fig4 is implemented by software stored in memory and executed by a processor . in other embodiments , the functionality can be performed by hardware , or any combination of hardware and software . an employee 130 accesses a coworker &# 39 ; s organizational information on erp server 101 via , for example , an intranet page ( 400 ). that page includes a limited view of organizational information regarding the coworker . employee 130 submits , via the page , private contact information 305 regarding the coworker ( 410 ). for example , employee 130 submits a home phone number for the coworker , acquired from the coworker . in one embodiment , employee 130 selects a group of users who are allowed to view the private contact information . in an embodiment , that group of users may be limited to employee 130 . rostering module receives the private contact information and stores it securely in database 110 ( 420 ). subsequently , employee 130 returns to the coworker &# 39 ; s intranet page and views the private contact information 305 ( 430 ). the private contact information is not retrievable by anyone else in the organization that is not permitted to see it . in the past , people had to have a separate repository for their personal data about another person and the erp data held by the organization about the person . this meant either visiting two or more sources to find the complete set of information , or holding information in multiple places , which led to it often getting out of date . this embodiment allows both organization and private information about a person to be stored in a single place . by having all of the data in a single repository , synchronization of data to mobile phones is also simplified , without the user having to worry about duplicate information from different sources . furthermore , because the data is stored on the erp server , the private contact information is securely stored and archived , thus the information is less likely to be exposed or lost . moreover , users may alert others that their contact information has changed . some embodiments of the invention have been described as computer - implemented processes . it is important to note , however , that those skilled in the art will appreciate that the mechanisms of the invention are capable of being distributed as a program product in a variety of forms . the foregoing description of example embodiments is provided for the purpose of illustrating the principles of the invention , and not in limitation thereof , since the scope of the invention is defined solely by the appended claims .	6
the presently preferred embodiment of the invention comprises employing a vulcanizable elastomeric blend , which is capable of molecular orientation upon stretching after vulcanization , with sufficient curing agents therein so that the blend is vulcanized when subjected to heat and pressure . the blend comprises epm or epdm elastomers and a polyolefin . the epm elastomers are ethylene - higher α - olefin copolymers and the epdm elastomers additionally contain a polyene and are well known . these elastomers normally contain from about 10 to 90 % by weight of ethylene with the remainder being at least one higher α - olefin . when such copolymers contain a polyene , the polyene content is about 0 . 5 to 20 % by weight . the higher α - olefins normally are propylene and butene - 1 . the polyenes can be conjugated dienes , nonconjugated dienes , trienes , and the like . preferred epm copolymers have ethylene contents from about 50 to 75 weight percent with 25 to 50 % propylene . preferred epdm elastomers contain from about 50 to 75 % by weight of ethylene , 25 to 50 % by weight propylene and about 1 to 10 % by weight of a nonconjugated cyclic diene . the polyolefin of the blend may be polyethylene or polypropylene and comprise from 10 to 55 parts by weight based upon 100 parts by weight of the elastomer . however , it is preferred that the plastic be present in the range of 30 to 35 parts by weight . the blend is formed into a generally annular preform 10 , which , as shown in fig1 is substantially cylindrical . preferably , the portion 11 , intermediate the edges and corresponding to the tread of the completed tire , is of greater thickness than the portions 12 and 13 at either side thereof , which will constitute the sidewalls of the completed tire . incorporated in the preform 10 adjacent the edges thereof , are wire hoops 14 and 15 , which constitute bead cores in the completed tire . these are of conventional construction , preferably of the type known as cable beads , formed of wire disposed in a plurality of convolutions and generally cylindrical in cross - section . the preform may be made employing a suitable generally annular mold having an appropriate tread anti - skid pattern . the bead cores 14 and 15 are placed in the mold and the blend is then introduced , as for example , by injection or transfer molding , the latter being preferred . the bead diameter of the preform corresponds to that of the completed tire but the transverse width and the circumference of the tread portion 11 are less than the arcuate transverse dimension and tread circumference of the completed tire . the preform is vulcanized within the mold by subjecting it to heat and pressure sufficient to effect cross - linking of the molecules of the elastomer portion of the composition , as is well understood in the art . preferably , the mold may have inserts which form axially spaced grooves 16 in the sidewalls 12 and 13 and circumferential grooves in the tread portion 11 of the preform for a purpose hereinafter described . the preform 10 is removed from the curing mold and is then shaped and stretched to the generally toroidal configuration of a conventional vehicle tire . this is effected by introducing the preform into a mold corresponding to the desired final size of the tire . the preform must be sufficiently hot to permit it to stretch to the generally torodial configuration , as shown in fig4 and cause it to conform with the mold surface under the influence of fluid pressure applied to the interior of the preform . since the preform is already vulcanized , it is not necessary to subject it to a full vulcanizing cycle . when shaping of the preform has been completed , the tire is cooled to a temperature below that which produces solidification of the plastic portion of the blend , by flushing the interior with cold water prior to removal of the tire from the mold . when removed from the mold , the completed tire 20 will have the appearance of a conventional pneumatic vehicle tire , as indicated in fig3 and 4 , with the running surface provided with an anti - skid pattern 21 in the portion of the tire which corresponds with the region 11 of the preform , as the result of the grooves formed in that portion of the preform , and with the bead cores 14 and 15 occupying their usual positions in the bead regions of the tire . examination of the completed tire demonstrates that the elastomer of which it is formed exhibits molecular orientation . this , in general , is biaxial with the orientation of the lower sidewalls being principally in the radial direction . maximum molecular orientation in the circumferential direction is found in the tread region and is less in the lower sidewalls being substantially nonexistent immediately adjacent the bead cores . the orientation is thought to be due to the stretching of the preform during the shaping operation and is retained by the tire being cooled or set in the stretched condition . the molecular orientation enhances the tensile strength and stiffness of the blend over that exhibited by the same material which has not been stretched and set in stretched condition after vulcanization . the sidewall strength of the tire if further augmented by the radial ribs 22 produced therein by the material intermediate the grooves 16 provided in the preform , which grooves , as a result of the stretching , have enlarged to form generally oblong - shaped panels 23 in the completed tire 20 . by way of example but not limitation , a 600 - 13 size inflatable tire is made and vulcanized in the form of a cylinder of 12 . 5 inches diameter . this vulcanized preform was then heated and stretched to final configuration and cooled in that configuration . this increased the distance from bead to bead measured on the surface of the tire from 7 inches to 14 inches while the tread portion increased from 12 . 5 inches to 21 . 76 inches inside diameter . the running surface of the tire may be formed of a different material than that of the carcass . for example , this surface may be provided by an elastomer of the same nature as that employed in the carcass , but without the addition of the polyolefin , with a band of the tread - forming material placed within the mold for the preform before the remainder of the material for the preform is introduced therein so that both materials are vulcanized together in a single composite unit . alternatively , the tread material can be applied to the vulcanized preform after it has been removed from the mold in which it is cured and before the composite is placed in the conventional tire mold to effect shaping of the preform in its final configuration . it is also possible to shape the preform 10 to a toroidal configuration without an anti - skid tread pattern for the running surface and then apply to the completed toroid a preformed tread band in a manner well known in the tire retreading art . the shape of the preform may be that of the zone of a sphere rather than generally cylindrical with the distance from the axis to the tread portion 11 being intermediate that dimension in the completed tire and the radius of the beads . the arcuate distance between the beads of the preform is so chosen as to provide the desired stretching and , hence , orientation of molecules in the completed tire . as mentioned above , the blend comprises epm or epdm elastomer and a polyolefin . the epm elastomers are ethylene - higher α - olefin copolymers and the epdm elastomers additionally contain a polyene . these elastomers normally contain from about 10 to 90 % by weight of ethylene with the remainder being at least one higher α - olefin . when such copolymers contain a polyene , the ethylene content is from about 10 to about 90 % by weight , the higher α - olefin from about 10 to about 80 % by weight and the polyene content of about 0 . 5 to 20 % by weight . the higher α - olefins may contain from about 3 to 14 carbon atoms but more normally are propylene and butene - 1 . the polyenes can be conjugated dienes such as butadiene , nonconjugated dienes , trienes , and the like . examples of trienes are 1 , 4 , 9 - decatriene . the nonconjugated dienes contain from about 5 to 25 carbon atoms such as 1 , 5 - hexadiene , cyclic dienes such as cyclopentadiene and dicyclopentadiene , vinyl cyclicenes , indenes , alkenyl norbornenes such as 5 - ethylidene - 2 - norbornene , and the like . preferred epm copolymers have ethylene contents from about 50 to 75 weight percent with 25 to 50 % propylene . preferred epdm elastomers contain from about 50 to 75 % by weight of ethylene , 25 to 50 % by weight propylene and about 1 to 10 % by weight of a nonconjugated cyclic diene . these elastomers have molecular weights from about 20 , 000 to about 2 , 000 , 000 or more . the polyolefin of the blend may be polyethylene or polypropylene . the blend of rubber and plastic may employ ingredients as set forth in u . s . pat . no . 3 , 862 , 106 . however , in accordance with this invention the monoolefin copolymer rubber is mixed with the polyolefin resin and shaped into the preform configuration before vulcanization . moreover , following vulcanization the material is sufficiently crosslinked that it is not thermoplastic as disclosed for the material when processed as taught in u . s . pat . no . 3 , 862 , 106 . ______________________________________ethylene propylene diene terpolymer 100 . 0polyethylene 35 . 0carbon black 50 . 0zinc oxide 5 . 0wax 3 . 0peroxide 3 . 3______________________________________ in this recipe , all quantities are expressed as parts by weight based upon 100 parts of the elastomer . the ethylene propylene diene terpolymer was that sold under the trademark epcar 587 by the bf goodrich company , the polyethylene may be the crosslinkable type sold under the trademark marlex cl - 100 by the phillips chemical company . ______________________________________ethylene propylene diene terpolymer 100 . 0polyethylene 45 . 0carbon black 60 . 0zinc oxide 5 . 0curing system 5 . 0______________________________________ in this recipe , all quantities are expressed as parts by weight based upon 100 parts of the elastomer . the ethylene propylene diene terpolymer was that sold under the trademark epcar 847 by the bf goodrich company , the polyethylene was that sold under the trademark marlex cl - 100 by the phillips chemical company and the curing system comprised sulfur or a sulfur donor plus suitable accelerators . the tread material may be the same as that of the preform . however , in order to provide improved traction , it may comprise a suitable ethylene propylene diene copolymer compound such as either of the two above examples but with the polyethylene omitted . alternatively , the tread compound may be any of these customarily employed for inflatable vehicle tires with a suitable tie gum or cement interposed between the tread elastomer and preform to effect proper union during vulcanization . moreover , the invention is not limited to use of the specific compounds given for the preform since modifications can be made therein and in the procedural steps described for constructing the tires by those skilled in the art .	1
fig2 illustrates an optoelectronic module 300 comprising a plurality of liquid lenses . module 300 , which is for example incorporated in a mobile telephone , comprises a processor 302 , which is for example the baseband processor of a mobile phone , an image signal processor ( isp ) 304 , lcd display 306 , a lens module 308 and a battery 310 which is for example a mobile phone battery . lens module 308 comprises a driver circuit 312 , for driving the plurality of variable focus liquid lenses 314 . in this example four liquid lenses are provided , one of which is used for focusing , a second for zooming , and third and fourth lenses for the correction of chromatic and field curvature aberrations . in alternative embodiments , different liquid lens arrangements having a different number of liquid lenses could be driven . the variable focus liquid lenses 314 are for example liquid lenses as described in relation to fig1 above , or any similar liquid lens having a focus variable by application of a drive voltage . each lens comprises first and second electrodes which receive an independent drive voltage signal from driver circuit 312 via lines 315 . alternatively , the four liquid lenses could be replaced by a single liquid lens having four electrodes and a common electrode , the independent drive voltages from driver circuit 312 being applied between the common electrode and each of the four electrodes . for example , a plurality of the electrodes 10 of fig1 , which are insulated from the liquids , could be provided and independently driven to control different parts of the liquid interface . independent voltages are then for example applied between the electrode 12 and each of the plurality of electrodes 10 . examples of this type of lens are discussed for example in u . s . pat . no . 6 , 538 , 823 , which is hereby incorporated by reference to the extent allowable by the law . alternatively , the single liquid lens could comprise a plurality of electrodes 12 in contact with the conducting liquid 8 of fig1 , to control different parts of the liquid interface . in this case , independent voltages are for example applied between the electrode 10 and each of the plurality of electrodes 12 . examples of such lenses are for example discussed in currently unpublished european application no . 06301000 . the lens module 308 preferably further comprises a number of fixed lenses 316 , and a cmos ( complementary metal oxide semiconductor ) sensor 318 for receiving images received via the variable focus lenses and fixed lenses . in alternative embodiments a different type of sensor could be used , such as a ccd ( charge - coupled device ) sensor . the cmos sensor 318 , fixed lenses 316 and variable focus lenses 314 are arranged along an optical axis δ of the lens module , and a variable diaphragm 320 provides means for adjusting the aperture of the lens module , allowing the light level entering the lens to be controlled . as illustrated , the processor 302 , lcd display 306 , isp 304 , cmos sensor 318 and driver 312 are for example powered by a dc voltage level v bat from battery 310 . in operation , isp 304 , under control of processor 302 , determines and generates data signals indicating the required drive voltages for each of the liquid lenses 314 , or in the case of a liquid lens with a common electrode and a plurality of electrodes in contact with the conducting liquid or a plurality of electrodes insulated from the conducting liquid , for each of the plurality of electrodes . the drive voltage levels for each lens / electrode are for example determined based on algorithms processed by the isp , which optimises focusing , zoom , and correction of optical aberrations such as chromatic aberration and field curvature aberration of the lens module . isp preferably receives signals from cmos sensor 318 , which are used in particular to indicate when focusing has been achieved . isp 304 provides these control signals on a serial bus 324 to driver circuit 312 , which generates drive signals for driving each of the electrodes of the liquid lenses based on these control signals . the drive signals are provided to each of the electrodes of the liquid lenses via lines 315 . in particular , the driver circuit 312 is connected via lines 315 to the first and second electrodes in each liquid lens , or in the case of multiple electrodes in a single lens , to one common electrode and each of the plurality of electrodes . the drive voltage to each liquid lens / electrode is preferably an oscillating ( ac ) voltage . isp 304 also controls cmos sensor 318 to capture the image received via the lenses , at an image formation region of the sensor . isp 304 receives signals generated by cmos sensor 318 based on the captured image on lines 322 . the captured image can then be displayed on lcd display 306 . diaphragm 320 is a mechanical diaphragm controlled by independent circuitry under control of the isp 304 . in alternative embodiments diaphragm 320 could be a liquid diaphragm comprising an opaque liquid moveable by electrowetting , and could be driven by the driver circuit 312 in the same way as the liquid lenses 314 . fig3 illustrates the driver circuit block 312 of fig2 in more detail . with reference to fig3 , driver circuit 312 comprises an integrated circuit ( ic ) 404 , an inductor 406 , and a capacitor 408 . ic 404 comprises a diode 410 and a mosfet ( metal oxide semiconductor field effect transistor ) 412 . ic 404 further comprises an rc ( resistor - capacitor ) oscillator 414 for generating a reference oscillating signal of a given frequency which is provided to a frequency generation block 416 . frequency generation block 416 generates a timing signal based on the reference oscillating signal , and outputs this signal on line 417 to a duty cycle controller 418 and to a dc - dc generator 420 . serial bus 324 is connected to ic 404 , and a serial bus decoder 421 is provided on ic 404 for decoding the serial data signals received via serial bus 324 and storing the data in first , second , third and fourth registers 422 , each of these registers storing drive voltage data associated with a respective one of the first , second , third and fourth liquid lenses / electrodes ( not shown in fig3 ). dc - dc generator 420 controls mosfet 412 based on a reference voltage v ref received on line 423 and a feedback signal received on line 424 . in particular , dc - dc generator 420 generates a switch control voltage signal v sc , based on the feedback and reference voltages , and provided to the gate terminal of mosfet 412 . the main current terminals of mosfet 412 are connected to ground and to a first terminal of inductor 406 . the first terminal of inductor 406 is also connected to a first terminal of capacitor 408 via diode 410 . the second terminal of inductor 406 is connected to v bat and the second terminal of capacitor 408 is connected to ground . the first terminal of capacitor 408 is also connected to first , second , third and fourth h - bridges 426 , 428 , 430 and 432 for driving the first , second , third and fourth liquid lenses . in particular , the first h - bridge 426 provides output voltages v oa1 and v ob1 on lines 434 and 436 respectively for driving a first liquid lens . in a similar fashion , second h - bridge 428 provides output voltages v oa2 and v ob2 on lines 438 and 440 respectively for driving a second liquid lens . the third h - bridge 430 provides output voltages v oa3 and v ob3 on lines 442 and 444 for driving a third liquid lens , and the fourth h - bridge 432 provides output voltages v oa4 and v ob4 on lines 446 and 448 for driving a fourth liquid lens . in operation , mosfet 412 is switched by dc - dc generator 420 such that current is driven through inductor 406 to capacitor 408 via diode 410 . in particular , when mosfet 412 is switched on , current is driven through inductor 406 to ground . when mosfet 412 is switched off , current continues to flow through inductor 406 , and is driven through diode 410 to charge capacitor 408 . diode 410 prevents capacitor 408 from discharging back through mosfet 412 . in this way a dc voltage v dc is generated across capacitor 408 which can be much higher than v bat . this dc voltage is for example fixed at 60 volts . in the present embodiment the voltage v dc is fixed by the reference voltage v ref . based on this reference voltage the required fixed dc voltage across capacitor 408 is provided . v ref will generally be constant to maintain the same fixed dc voltage across capacitor 408 , but in some embodiments this reference voltage could be increased slightly when high load is expected from the liquid lenses , to prevent the fixed dc voltage v dc dropping . in order to provide the fine voltage control of the drive voltage to each of the liquid lenses , rather than varying the level of the dc voltage generated , a duty cycle controller 418 is provided . duty cycle controller 418 controls the duty cycle of the drive signal to each of the h - bridges such that the duty cycle of the drive signal to each liquid lens is varied . duty cycle controller 418 generates the duty cycle signal for each liquid lens based on the data from the four registers 422 , which store data received via serial bus 324 and decoded by serial bus decoder 421 . the peak - to - peak voltage of the drive signal to each liquid lens is preferably fixed at 2v dc , which is for example at 120 v , however due to the variation in duty cycle of the drive voltage , the rms ( root mean squared ) voltage of each of the drive voltages is varied , thus varying the power provided to each liquid lens . in the case that the drive voltage is a square wave , a peak - to - peak voltage of 120 v provides an rms voltage of 60 v . given sufficient control of the duty cycle , each liquid lens can thus be controlled with the required precision . an example of the required precision is a drive voltage that can be controlled in steps of 60 mv rms between 0and 60 v rms . thus approximately 1000 steps are required between a duty cycle of 0 percent and a duty cycle of 100 percent . furthermore , 10 or more bits of data , converted and transmitted from the isp 304 to driver 312 via the serial bus 324 , is for example provided for each lens to determine the required duty cycle . fig4 illustrates the dc - dc generator 420 of fig3 in more detail . as shown in fig4 , dc - dc generator 420 preferably comprises a comparator 500 , in this example an operation amplifier ( op amp ), having two differential inputs , a first receiving the reference voltage v ref on line 423 and the second connected to a node 502 which is connected to ground via a first resistor 504 , and to v dc on line 424 via a second resistor 506 . the first and second resistors 504 , 506 act as a potential divider dividing the voltage v dc to a suitable value for comparison with v ref , for example dividing v dc by thirty if a value of 2 v for v ref corresponds to 60 v of v dc . op amp 500 provides an output on line 508 to a switch control block 510 . switch control block 510 also receives the timing signal on line 417 generated by frequency generation block 416 , and adjusts this signal based on the output of op amp 500 to provide the switch control signal v sc to control mosfet 412 . the first h - bridge 426 of fig3 is shown in more detail in fig5 a . the other h - bridges of fig3 comprise identical circuitry connected to the corresponding control lines . h - bridge 426 comprises four mosfets 601 , 602 , 603 and 604 . first and second mosfets 601 , 602 are connected in series via their main current terminals between the fixed voltage v dc and ground . third and fourth mosfets 603 , 604 are also connected in series via their main current terminals between the fixed voltage v dc and ground . a first liquid lens 605 is connected between output line 434 of ic 404 which is connected to the node between the third and fourth mosfets 603 , 604 and output line 436 of ic 404 which is connected to the node between the first and second mosfets 601 , 602 . alternatively , nodes 434 and 436 could be connected between one of a plurality of first electrodes of a liquid lens and a common second electrode , where the first electrodes are either in contact with the conducting liquid and the common electrode insulated from the conducting liquid , or vice versa . the gate terminals of the first and third mosfets 601 , 603 are connected to lines 450 , 452 respectively and thus directly receive the signals generated by the duty cycle controller 418 . the gate terminals of the second and fourth mosfets 602 , 604 are connected to outputs of first and second two - input or gates 606 , 607 respectively . each or gate 606 , 607 comprises a first input connected to lines 450 , 452 respectively . a second input of each or gate is connected to the output of a two - input nand gate 608 , which comprises first and second inputs connected to lines 450 , 452 respectively . in operation , when the control signal on line 452 is high whilst the control signal on line 450 is low , the first and fourth mosfets 601 , 604 are switched on and line 436 is connected to v dc whilst line 434 is connected to ground . on the other hand , when the control signal on line 452 is low whilst the control signal on line 450 is high , the second and third mosfets 602 , 603 are switched on and line 434 is connected to v dc whilst line 436 is connected to ground . when both control signals on lines 450 and 452 are low , the output of nand gate 608 is high , and thus both the second and fourth mosfets 602 , 604 will be switched on , connecting both lines 434 and 436 to ground . fig5 b illustrates an alternative embodiment of the first , second , third and fourth h - bridges 426 to 432 , in which the second electrode of each of the liquid lens is connected to a single pair of common mosfets . alternatively , in the case that a single lens comprises a plurality of electrodes and a common electrode , the common electrode is for example connected to a single pair of common mosfets . this circuitry comprises ten mosfets labelled 610 , 612 , 614 , 616 , 618 , 620 , 622 624 , 634 and 636 respectively . the first and second mosfests 610 , 612 , are connected in series between v dc and ground via their main current terminals . likewise , the third and fourth mosfets 614 , 616 , fifth and sixth mosfets 618 , 620 , and seventh and eighth mosfets 622 , 624 are also connected in series between v dc and ground via their main current terminals . the gates of the first and second mosfets 610 , 612 are connected to input lines 450 and 452 respectively . the gate terminals of the third , fourth , fifth , sixth , seventh and eighth mosfets are connected to input lines 454 , 456 , 458 , 460 , 462 and 464 respectively . the node between the first and second mosfets 610 , 612 is connected to output line 434 , providing the output voltage v oa1 to an electrode of a first liquid lens 626 . the node between the third and fourth mosfets 614 , 616 is connected to output line 438 connected to an electrode of a second liquid lens 628 providing output voltage v oa2 . the node between the fifth and sixth mosfets 618 , 620 is connected to output line 442 providing output voltage v oa3 to an electrode of a third liquid lens 630 . the node between the seventh and eighth mosfets 622 , 624 is connected to output line 446 providing output voltage v oa4 to an electrode of a fourth liquid lens 632 . alternatively , output lines 434 , 438 , 442 and 446 could each be connected to respective electrodes of a single lens . the ninth and tenth mosfets 634 , 636 of the circuit of fig5 b are common mosfets providing the connection to the second electrode of each of the first , second , third and fourth liquid lenses , or in the case of a single lens having multiple electrodes , to a common electrode of that lens . mosfets 634 and 636 are connected in series between v dc and ground via the main current terminals . the node between mosfets 634 and 636 is connected to each of the first , second , third and fourth liquid lenses , effectively providing output lines 436 , 440 , 444 and 448 of the h - bridges . the gate terminal of mosfet 634 is connected to the output of a first four - input or gate 638 , having its four input pins connected to the input lines 452 , 456 , 460 and 464 respectively such that mosfet 634 is switched on when the signal on any of these lines is high . the gate terminal of mosfet 636 is connected to the output of a second four - input or gate 640 , having its four input pins connected to the input lines 450 , 454 , 458 and 462 such that mosfet 636 is switched on when the signal on any of these lines is high . in operation , when any of the signals on lines 450 , 454 , 458 or 462 is high while the corresponding signal on lines 452 , 456 , 460 , 464 is low , the first electrode of the corresponding liquid lens will be connected to v dc , and the second electrode to ground via mosfet 636 . on the other hand , when any of the signals on lines 450 , 454 , 458 or 462 is low while the corresponding signal on lines 452 , 456 , 460 , 464 is high , the corresponding first electrode of the liquid lens will be connected to ground , and the second electrode to v dc via mosfet 634 . it will be apparent that that if a given lens is to be off during a certain period and during this period both control signals associated with the given lens are low , it is possible that one of the other signals on lines 452 , 456 , 460 , 464 is high at the same time . this will result in the given lens having a first electrode that is floating and a second electrode connected to v dc . in alternative embodiments , floating nodes can be avoided in this case when a given lens is to be off by instead connecting the first electrode of the given lens to v dc for the period when the second electrode is connected to v dc . operation of the circuitry of fig5 b is equivalent to the operation of four h - bridges arranged according to the circuitry of fig5 a described above , and thus this circuitry reduces the number of mosfets required for four h - bridges by six . given that sixteen mosfets are required in total in the h - bridge arrangement of fig5 a , and ten in fig5 b , this results in a reduction in circuit area of the h - bridge of approximately 40 percent . fig5 c illustrates an alternative embodiment of the h - bridges of fig3 , in this case showing the example when applied to a single lens having multiple electrodes . as illustrated , a liquid lens 650 comprises a plurality of electrodes 652 , 654 , 656 and 658 of a first type , which are all either the electrodes in contact with the conducting liquid in the lens , or the electrodes insulated from the liquids arranged close to the edge of the liquid interface . a common electrode 660 of a different type to the first type is provided , i . e . contacting the conducting liquid if the electrodes of the first type are insulated from the conductive liquid , or insulated from the conducting liquid if the electrodes of the first type contact the conducting liquid . in this example , a first full h - bridge 662 is provided , allowing the voltage vdc or ground to be connected to output lines 663 a and 633 b of h - bridge 662 . lines 663 a and 663 b are connected to four half h - bridges 664 , 666 , 668 and 670 . each electrode 652 , 654 , 656 and 658 is connectable via a respective one of the half h - bridges to either line 663 a or 663 b . electrode 660 is permanently connected to line 663 b . the full h - bridge 662 and the half h - bridges 664 , 666 , 668 and 670 are controlled by the control signals from the duty cycle controller , as will be apparent to those skilled in the art . the h - bridge arrangement in fig5 c could also be used for driving a plurality of lenses . fig6 a and 6b illustrate the timing of signals on line 417 , lines 450 and 452 , lines 434 and 436 , lines 454 and 456 , and lines 438 and 440 in the driving circuitry of fig3 . fig6 a illustrates a case in which the duty cycle controller 418 controls the width of each pulse , this width providing the variation in duty cycle for controlling the power to each of the different lenses . fig6 b illustrates an embodiment in which the duty cycle controller 418 varies the number of standard - width pulses provided during a determined period to each of the lenses , the number of these pulses providing the variation in the duty cycle for controlling the power to each of the different lenses . this second duty cycle control is particularly relevant to embodiment of the h - bridges 426 , 428 , 430 , 432 of fig5 b or the embodiment of fig5 c . firstly with reference to fig6 a , the timing signal in the form of a square wave generated by the frequency generator 416 on line 417 is shown labelled 417 . the duty cycle controller operates by counting pulses of this square wave in order to generate a square wave of required pulse width for controlling each h - bridge . in particular , a data value associated with each liquid lens is received via the serial bus 324 , the serial bus decoder 421 and registers 422 , and used by the duty cycle controller 418 to determine the required pulse width for driving each liquid lens . in fig6 a , the signals on lines 450 and 452 from the duty cycle controller are illustrated , in each case the count being set at three rising edges of the timing signal on line 417 . in the example shown , a 4 - bit counter is used , such that the counter counts from 0 to 15 and then resets . in practice , however , in order to generate the required precision for controlling each of the h - bridges , a 10 or 12 - bit counter could be used , providing , for example , between 1 and 1024 rising edges of the timing signal to be selected . with reference to the signals on lines 450 and 452 , the solid line illustrates the signal on line 450 , used for controlling the positive pulse of the drive signal for the first liquid lens , whilst the dashed line illustrates the signal on line 452 used for controlling the negative pulse of the drive signal for the first liquid lens . according to the embodiment of fig6 a , a fixed period of sixteen rising edges of the timing signal on line 417 is provided for the pulses , eight rising edges for the positive pulse and eight for the negative pulse . in practice such a period would be for example 1024 or 2048rising edges of the timing signal in order to provide sufficient precision , and this period would represent , for example , a frequency of approximately 500 or 1000 hertz , whilst the timing signal on line 417 has a frequency of , for example , approximately 1 mhz . in alternative embodiments the time period between rising edges of the positive and negative pulses is not fixed , but instead a second counter could be used to determine the rest duration between the end of one pulse and the start of the next . the output signal across lines 434 and 436 at the output of h - bridge 426 is also shown in fig6 a . the positive pulse is thus amplified to v dc , which is for example 60 volts . the negative pulse on line 452 is also amplified and provided across a liquid lens electrode in the opposite direction , thus providing a negative pulse of − v dc across the liquid lens . the peak - to - peak voltage is thus 2v dc . in a second example , the second liquid lens is controlled such that the pulse width of the positive and negative pulses is five cycles of the timing signal on line 417 plus one half cycle . this is possible if the counter counts positive and negative edges of the timing signal . again , the solid line illustrates signal line 454 , and the dashed line illustrates the signal line 456 . the amplified signal at the output of h - bridge 428 across lines 438 and 440 are also shown . fig6 b illustrates the timing of signals in a second embodiment of the duty cycle controller 418 . the timing signal on line 417 is again a square wave , again with a frequency of approximately 1 mhz . in this embodiment , the signal to the first liquid lens on line 450 , shown by the solid line , is a fixed - length pulse occurring at every other rising edge of the timing signal , thus five times in a ten pulse reference period . the signal for controlling the negative side of the liquid lens on line 452 , as shown by the dashed wave , is also the same fixed - length pulse , but occurring after each alternate falling edge of the timing signal . as shown on lines 434 and 436 , the positive and negative pulses , respectively , at the output of the first h - bridge 436 are thus fixed length pulses occurring at regular intervals . an alternative pattern is generated by the duty cycle controller 418 on lines 454 and 456 , in which three pulses are provided in within the ten - pulse reference period . whilst for clarity in the example illustrated in fig6 b a reference period comprises only ten cycles of the timing signal , in practice , the reference period comprises for example 1024 or more cycles of the timing signal , allowing the required precision in control of the duty cycle , and thus the required precision in the control of the power to each lens . the selected pulses may be at regular intervals throughout the 1000 cycles of the timing signal , or alternatively grouped into smaller blocks . thus circuitry has been described that independently drives a plurality of electrodes of one or more liquid lenses , the circuitry comprising a common means for generating a fixed voltage level , and a duty cycle controller for controlling the power provided to each lens / electrode . thus an independent drive voltage signal can be provided to each of the plurality of electrodes . by independent drive voltage signals , it is meant drive voltage signals that control either different liquid interfaces , or different parts a liquid interface if there are multiple electrodes of the same type in the same lens . the independent drive voltage signal for a particular electrode are applied between that electrode and a further electrode , thus a liquid lens having just two electrodes receives only one independent drive voltage . providing a common means for generating a fixed voltage level has the advantage that only one set of generating circuitry ( inductor 406 , capacitor 408 , diode 410 and mosfet 412 ) is required , minimizing the required resources . furthermore , reliability and durability of the driving circuit are improved by limiting the number of components required , and particularly by limiting the number of active components . whilst an optoelectronic module incorporating the present invention has been described above as being incorporated in a mobile telephone , embodiments of the invention could be incorporated in different applications , in particular applications in which area is restricted . this includes mobile devices in general , for example laptop computer , pdas ( personal digital assistants ) or wireless local area network devices , or other devices such as barcode readers . the type of electrowetting device that may be driven by driving circuitry according to embodiments of the invention is not limited to devices in which a refractive interface between liquids is directly moveable by electrowetting , but includes lenses in which electrowetting is used to move a secondary interface , which in turn causes a refractive interface to move . furthermore , electrowetting devices driven by embodiments of the invention could include alternative devices to lenses , such as variable liquid diaphragms . whilst the optoelectronic module 300 has been described as comprising an isp 304 for determining the values of the drive voltages to each lens , in other embodiments alternative processing means could be used for determining these values , such as the baseband processor of a mobile phone , or a cpu ( central processing unit ). furthermore , whilst a number of examples have been provided in fig6 a and 6b for the duty cycle control signals , alternative duty cycle formats are possible . whilst a serial bus 324 has been described for connecting the isp 304 to the driver circuit 312 , in alternative embodiments , a parallel bus or an alternative interface could be used , for example a wireless interface such as bluetooth . having thus described at least one illustrative embodiment of the invention , various alterations , modifications and improvements will readily occur to those skilled in the art . such alterations , modifications and improvements are intended to be within the scope of the invention . accordingly , the foregoing description is by way of example only and is not intended to be limiting . the invention is limited only as defined in the following claims and the equivalent thereto .	6
[ 0021 ] fig1 schematically illustrates a distribution centre in accordance with a first embodiment of the present invention . fig3 illustrates the trolley 8 and carrier 7 in more detail whilst fig2 illustrates the bulk delivered containers in more detail . at a food manufacturing centre , food products are manufactured and packaged e . g . rolls , sandwiches , pies etc . these are then placed in carriers 7 in accordance with an order from a distribution centre 1 . the carrier 7 will hold a designated number of any type of food products . alternatively , the carrier 7 may be required to be filled with a mixture of food products . this is dependent upon the order placed with the food manufacturer . each carrier 7 has applied to it or incorporated in it a unique electronic tag . the tag can comprise any conventional electronic tag such as an rf tag as will be understood by a skilled person in the art . the tag can be read by any form of tag reader such as a hand held tag reader or a static tag reader mounted in for example a doorway . thus in order to fulfil an order , a food manufacturing centre will package a number of carriers 7 into a bulk order 4 carried by a palette 4 a . the palette 4 a has mounted thereon or incorporated therein a unique electronic tag 6 . thus , when the bulk order 4 is put together at the food manufacturing centre , the tags 7 a of the carriers 7 which form a bulk load 4 are read together with the tag 6 of the palette 4 a . this information is read and stored on a computer system and the information is transmitted to a computer system 12 at the distribution centre 1 from which the order for the food products originated . in this way a food manufacturing centre records and tracks food products which leave the centre . the food products in each bulk order 4 are transported by a vehicle 2 to the distribution centre 1 . the bulk ordered products 4 are then unloaded by fork lift truck 3 and as they are delivered into the distribution centre 1 , a tag reader 5 will detect the palette tag 6 on the palette 4 a . the tag detections are transmitted to the computer system 12 in which the detected palette tag 6 can be matched to the identities of the carriers 7 carried on the palette 4 a . thus the reading of the palette tag 6 avoids the necessity for attempting to read each of the tags 7 a on each of the carriers 7 . alternatively however each of the tags 7 a could be detected in order to compare the expected load on the palette 4 a with the load that the food manufacturing centre alleges to have delivered . where the products are subject to strict hygiene regulations and require refrigeration for example , the lorry 2 will comprise a refrigeration unit and within the distribution centre 1 , the bulk orders 4 will be stored in refrigerated conditions . in order to monitor the temperature , each carrier 7 can include a temperature monitor with the tag 7 a . the temperature monitor can provide a warning if the temperature range rises above that required for the food product . the monitor can comprise an electronic arrangement for transmitting a signal to the computer system 12 to allow the remote monitoring of the conditions of the carriers 7 . alternatively a simple arrangement can comprise a visible indicator e . g . a liquid crystal strip which will register and display a warning if the temperature rises above a threshold . the warning will remain even after the temperature has dropped to point out that the food products in the carrier 7 were exposed to high temperatures for a predetermined period of time sufficient to raise a hygiene issue . within the distribution centre 1 , the carriers 7 are unloaded from the palette 4 a and loaded into trolleys 8 . the number of carriers 7 loaded into the trolleys 8 and the number of trolleys 8 will depend upon the order placed for a passenger vehicle . an order can be fulfilled by loading the appropriate number of trolleys 8 with the appropriate number of carriers 7 which contain the appropriate number of products . thus the trolleys 8 are loaded onto a truck 11 for distribution to the passenger carrying vehicles , the trolleys 8 pass through a tag detector 10 to detect the tags of the carriers 7 being delivered . the tag detections are received by the computer system 12 in order to track the movement of the carriers 7 . thus in this way the movement of the carriers 7 in and out of the distribution centre 1 can be detected . the truck 11 will provide the required conditions for the delivery of the food products e . g . it will comprise a refrigeration unit and will deliver the trolleys 8 to the aircraft . in such circumstances the distribution centre 1 comprises the sole distribution centre . in an alternative embodiment the distribution centre 1 comprises the hub distribution centre which receives the products directly from the food manufacturing centre . the hub distribution centre will then distribute the product to spoke distribution centres . thus in fig1 the trolleys 8 are filled with carriers 7 and the truck 11 delivers the trolleys 8 to the spoke distribution centres . within the spoke distribution centres , the number of carriers 7 within the trolleys 8 is adjusted as necessary in order to accurately fulfil the order from the passenger vehicle operator . it can thus be seen from fig1 that food products delivered from the food manufacturing centre are not repackaged . the carriers 7 are simply redistributed into trolleys 8 . this greatly reduces the handling of the food products thereby making it easier to comply with hygiene regulations . further , there is no requirement to repackage the products and there is thus no wastage of packing material or time and money expended in wasted repackaging . further , the use of a single carrier from the point of manufacture to the point of use on the passenger vehicle facilitates better control and tracking of delivery . in addition to the tags on the carriers 7 and the palettes 4 a , tags 9 can also be provided on the trolleys 8 . this enables the trolleys 8 to be tracked . it can also enable the tag detector 10 to simply detect the trolley 8 passing thereby . if the tags 7 a of the carriers 7 are read when the trolley 8 is loaded , and matched with the tag 9 of the trolley , the computer system 12 will have a record of the carriers 7 loaded in the trolleys 8 . thus the detection of the tags 9 of the trolleys 8 and the tag detector 10 is sufficient for the computer system to know which carriers 7 have been loaded on the truck 11 . [ 0029 ] fig4 is a schematic diagram of the hub and spoke distribution system in which there are three hubs 20 , 21 , 22 provided at separate locations and is connected by high speed communication lines 23 a and 23 b for the exchange of data therebetween . each hub 20 , 21 , 22 is connected to a spoke distribution centre 40 a , 40 b , 41 a , 41 b , 42 a , 42 b , 42 c and 42 d respectively . a food manufacturing centre 30 is connected to each of the hubs 20 , 21 and 22 via a communication line 25 . in this embodiment each spoke distribution centre is located at or near an airport or train station to provide airline or rail catering facilities . at each spoke orders will be received from airlines or rail operators being served in respect of food to be provided for specific journeys . this information can be electronically received and is passed from the spokes to the respective hub distribution centres 20 , 21 and 22 . the hub distribution centre 20 will collate all of the orders in order to form a bulk order for groups which is transmitted to the food manufacturer 30 . when the goods are delivered by the food manufacturer 30 to the hub distribution centre 20 , the hub distribution centre 20 , 21 and 22 uses the information received from the spoke distribution centres i . e . the orders from the airlines or rail operators in order to determine how to distribute the products to the spoke distribution centres . thus within the hub distribution centres 20 , 21 , 22 the bulk orders received from the food manufacturers 30 are split and distributed to the spoke distribution centres . as described hereinabove with reference to fig1 this redistribution is carried out by placing the carriers 7 into trolleys 8 so that the spoke distribution centres simply have to adjust the number of carriers 7 required for each flight . the spoke distribution centre needs to carry out no repackaging or even movement of carriers 7 into different stored units . in an alternative embodiment , the airlines can place orders directly with the hub distribution centres 20 , 21 and 22 . the benefit of the receiving orders from the spoke distribution centres is that the spoke distribution centres can take into account local factors . for example , it may be known that because of a pricing policy , although a number of passengers have booked flights , not all passengers will turn up for those flights . thus although the airline may request food for each passenger , it may not be necessary to supply that number . the order can thus be adjusted accordingly . in another embodiment of the present invention , where meals are provided to passengers on a tray , each tray is assembled into a meal unit within the distribution centre 1 . the tray will comprise the carrier 7 and the trays will be individually loaded into the trolley 8 in the conventional manner . however , in the distribution centre 1 there is provided no food manufacturing capability . food is delivered pre - packaged from a remote food manufacturing centre . in the distribution centre 1 the received packaged food items are assembled onto a tray in order to assemble a meal unit . in this way , there is no handling of food except in packaged form within the distribution centre . in this way specialist food manufacturing centres can be utilised for manufacturing food and the distribution centre merely needs to assemble the food into meal units . this enables restaurants to be used as food manufacturing centres . the distribution centre will simply assemble the restaurant cooked food . the handling of the food within the distribution centre 1 is reduced and so long as careful control of the temperature of the food items and the date of the food items is carefully monitored , the necessary hygiene regulations can be met . although the present invention has been described herein above with reference to specific embodiments , it will be apparent to a skilled personnel in the art that modifications lie within the spirit and scope of the present invention . for example , although the present invention has been described with reference to food items , the present invention is applicable to any food or drink items and particularly to food and drink items which are fragile or subject to hygiene regulations . in the embodiments tags are described for the containers . any suitable tag or unique identifying system can be used which can be electronically read remotely e . g . a microchip or rf tag . although in the embodiments fixed tag detectors are used , the present invention is applicable to any type of tag detector including mobile tag detectors .	6
fig1 schematically illustrates a gas turbine engine 20 . the gas turbine engine 20 is disclosed herein as a two - spool turbofan that generally incorporates a fan section 22 , a compressor section 24 , a combustor section 26 and a turbine section 28 . alternative engines might include an augmentor section ( not shown ) among other systems or features . the fan section 22 drives air along a bypass flowpath b while the compressor section 24 drives air along a core flowpath c for compression and communication into the combustor section 26 then expansion through the turbine section 28 . although depicted as a turbofan gas turbine engine in the disclosed non - limiting embodiment , it should be understood that the concepts described herein are not limited to use with turbofans as the teachings may be applied to other types of turbine engines including three - spool architectures . the engine 20 generally includes a low speed spool 30 and a high speed spool 32 mounted for rotation about an engine central longitudinal axis a relative to an engine static structure 36 via several bearing systems 38 . it should be understood that various bearing systems 38 at various locations may alternatively or additionally be provided . the low speed spool 30 generally includes an inner shaft 40 that interconnects a fan 42 , a low pressure ( or first ) compressor section 44 and a low pressure ( or first ) turbine section 46 . the inner shaft 40 is connected to the fan 42 through a geared architecture 48 to drive the fan 42 at a lower speed than the low speed spool 30 . the high speed spool 32 includes an outer shaft 50 that interconnects a high pressure ( or second ) compressor section 52 and high pressure ( or second ) turbine section 54 . a combustor 56 is arranged between the high pressure compressor 52 and the high pressure turbine 54 . a mid - turbine frame 57 of the engine static structure 36 is arranged generally between the high pressure turbine 54 and the low pressure turbine 46 . the mid - turbine frame 57 supports one or more bearing systems 38 in the turbine section 28 . the inner shaft 40 and the outer shaft 50 are concentric and rotate via bearing systems 38 about the engine central longitudinal axis a , which is collinear with their longitudinal axes . as used herein , a “ high pressure ” compressor or turbine experiences a higher pressure than a corresponding “ low pressure ” compressor or turbine . the core airflow c is compressed by the low pressure compressor 44 then the high pressure compressor 52 , mixed and burned with fuel in the combustor 56 , then expanded over the high pressure turbine 54 and low pressure turbine 46 . the mid - turbine frame 57 includes airfoils 59 which are in the core airflow path . the turbines 46 , 54 rotationally drive the respective low speed spool 30 and high speed spool 32 in response to the expansion . the engine 20 in one example is a high - bypass geared aircraft engine . in a further example , the engine 20 bypass ratio is greater than about six ( 6 ), with an example embodiment being greater than ten ( 10 ), the geared architecture 48 is an epicyclic gear train , such as a star gear system or other gear system , with a gear reduction ratio of greater than about 2 . 3 and the low pressure turbine 46 has a pressure ratio that is greater than about 5 . in one disclosed embodiment , the engine 20 bypass ratio is greater than about ten ( 10 : 1 ), the fan diameter is significantly larger than that of the low pressure compressor 44 , and the low pressure turbine 46 has a pressure ratio that is greater than about 5 : 1 . low pressure turbine 46 pressure ratio is pressure measured prior to inlet of low pressure turbine 46 as related to the pressure at the outlet of the low pressure turbine 46 prior to an exhaust nozzle . it should be understood , however , that the above parameters are only exemplary of one embodiment of a geared architecture engine and that the present invention is applicable to other gas turbine engines including direct drive turbofans . a significant amount of thrust is provided by the bypass flow b due to the high bypass ratio . the fan section 22 of the engine 20 is designed for a particular flight condition — typically cruise at about 0 . 8 mach and about 35 , 000 feet . the flight condition of 0 . 8 mach and 35 , 000 ft , with the engine at its best fuel consumption — also known as “ bucket cruise thrust specific fuel consumption (‘ tsfc ’)”— is the industry standard parameter of lbm of fuel being burned per hour divided by lbf of thrust the engine produces at that minimum point . “ fan pressure ratio ” is the pressure ratio across the fan blade alone , without a fan exit guide vane (“ fegv ”) system . the low fan pressure ratio as disclosed herein according to one non - limiting embodiment is less than about 1 . 45 . “ low corrected fan tip speed ” is the actual fan tip speed in ft / sec divided by an industry standard temperature correction of [( tambient deg r )/ 518 . 7 )̂ 0 . 5 ]. the “ low corrected fan tip speed ” as disclosed herein according to one non - limiting embodiment is less than about 1150 ft / second . referring to fig2 and 3 , a fan blade 27 of the fan 42 includes a root 31 supporting a platform 34 . an airfoil 35 extends from the platform 34 to a tip 39 . the airfoil 35 includes spaced apart leading and trailing edges 39 , 41 . pressure and suction sides 43 , 45 adjoin the leading and trailing edges 39 , 41 to provide a fan blade contour 61 . the fan blade 27 includes a substrate 53 with an edge 49 . a sheath 47 is secured to the substrate 53 over the edge 49 with adhesive 55 . in one example , the sheath 47 and the substrate 53 are constructed from first and second metals that are different from one another . in one example , the substrate 53 is constructed from an aluminum alloy , and the sheath 47 is constructed from a titanium alloy . it should be understood that other metals or materials may be used . the adhesive 55 provides a barrier between the substrate 53 and the sheath 47 to prevent galvanic corrosion . referring to fig4 , the adhesive 55 includes a scrim 62 ( e . g ., a glass scrim ) that carries a resin 64 . examples of the adhesive 55 include a variety of commercially available aerospace - quality metal - bonding adhesives are suitable , including several epoxy - and polyurethane - based adhesive films . in some embodiments , the adhesive 55 is heat - cured via autoclave or other similar means . examples of suitable bonding agents include type ea9628 epoxy adhesive available from henkel corporation , hysol division , bay point , calif . and type af163k epoxy adhesive available from 3m adhesives , coatings & amp ; sealers division , st . paul , minn . in certain embodiments , such as is shown in fig3 , the adhesive 55 is a film , which also contributes a minute amount of thickness of blade 27 proximate the sheath 47 . in one example , a layer of adhesive film is about 0 . 005 - 0 . 010 inch ( 1 . 2 - 2 . 5 mm ) thick . despite the additional thickness , a film - based adhesive allows for generally uniform application , leading to a predictable thickness of airfoil 35 proximate forward airfoil edge 39 . certain adhesives 55 , including the example film - based adhesives above , are compatible with scrim 62 . scrim 62 provides dielectric separation between airfoil 35 and sheath 47 , preventing galvanic corrosion between the two different metal surfaces of airfoil 35 and sheath 47 . the material forming scrim 62 is often determined by its compatibility with adhesive 55 . one example scrim 62 is a flexible nylon - based layer with a thickness between about 0 . 005 inch ( 0 . 12 mm ) and about 0 . 010 inch ( 0 . 25 mm ) thick . other examples of the adhesive 55 and other aspects of the fan blade 27 are set forth in u . s . patent application publication 2011 / 0211967 to the applicant , which is incorporated herein by reference in its entirety . returning to fig3 , the sheath 47 includes first and second flanks 51 , 91 that are arranged on either side of the edge 49 . the adhesive 55 , when cured , flows beyond the sheath edge and creates a fillet 68 bridging an edge 66 of the sheath 47 and a surface 58 of the substrate 53 . in the area of the fillet 68 , the sheath 47 provides spaced apart interior and exterior surfaces 70 , 72 adjoined by the edge 66 . a corner 74 is provided at the intersection of the edge 66 and the exterior surface 72 , which may be provided at a generally right angle relative to one another . the scrim 62 is provided beneath the sheath 47 and arranged inboard of the edge 66 . typically , the fillet 68 is larger than desired and is of variable size , which prevents the desired surface profile of an applied coating 60 over the adhesive 55 , the edge 66 and the surface 58 , as illustrated in fig3 and 6 . the coating 60 , which may be urethane , for example , provides the desired fan blade contour 61 . to reduce the size of the fillet 68 , a tool 76 is used to mechanically remove a portion of the fillet 68 to provide a mechanically worked finished surface 88 . the adhesive 55 may be cured using a vacuum bag and autoclave , which provides a cured exterior surface having visible attributes such as a relatively smooth texture and / or a glossy or matte surface finish . the mechanically worked surface finish 88 , by way of contrast , will have , for example , striations and / or machining marks left by a tool . the structural characteristics and difference between the cured exterior surface and the mechanically worked surface finish 88 may be appreciated based upon a visual inspection of the part . the mechanically worked finished surface 88 is provided at or below the interior surface 70 to sufficiently expose the edge 66 and provide a desired and consistent bonding surface for the coating 60 between the edge 66 and the surface 58 . the tool 76 , which is illustrated in fig5 , includes first , second , third and fourth surfaces 78 , 80 , 82 , 84 . the first and second surfaces 78 , 80 are adjacent to one another and arranged at generally a right angle relative to one another . the first and second surfaces 78 , 80 are respectively configured to follow the exterior surface 72 and the edge 66 . the third surface 82 adjoins the second surface 80 at an obtuse angle . the third surface 82 provides a sharp edge that is configured to scrape the fillet 68 and provide the mechanically worked finished surface 88 . the mechanically worked finished surface 88 includes a scraped contour in the example embodiment . the fourth surface 84 adjoins the third surface 82 and is configured to follow the surface 58 of the substrate 53 without damaging the substrate . tool surfaces 78 and 84 preferably have rounded edges to preclude damaging the sheath substrate ( exterior surface 72 ) or the airfoil substrate ( surface 58 ) during the scraping procedure . in one example , a relief aperture 86 , which may be a generally circular hole in one example , adjoins the first and second surfaces 78 , 80 to one another to accommodate the corner 74 of the sheath 47 . once the mechanically worked finished surface 88 has been provided on the adhesive 55 , the coating 60 , which may be urethane in one example , is applied over the edge 66 , the finished surface 88 and the surface 58 to provide the fan blade contour 61 . as a result of the foregoing fan blade embodiment , the problem in conventional blades ( i . e ., where a corrosion preventative film adhesive layer often left a fillet of adhesive at the sheath edge that inhibited proper urethane coating ) has been resolved . although an example embodiment has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of the claims . for example , other mechanical methods may be used to remove portions of the fillet 68 to expose the edge 66 . for that reason , the following claims should be studied to determine their true scope and content .	5

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.