text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the following is a detailed description of the presently known modes of carrying out the inventions . this description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the inventions . the present invention discloses a driven monitoring device , attached onto a continuous passive motion exercise system , with the functions of measuring the driving force f or torque τ from a driving device d to a mounting device 4 , 8 through force or torque sensors s , calculating joint viscosity and stiffness parameters , and detecting joint muscle active contraction . thus the status changes of muscle stiffness and joint viscosity can be evaluated and the possibility of secondary injury can be reduced during joint rehabilitation periods . the schematic diagram of the present invention applied on a knee join exercise mechanism with continuous passive operation is illustrated in fig1 . the exercise mechanism comprises a mounting device 4 having a flexing and extending mechanism and a fastening device 3 , a driving device d providing a driving force f and a driven monitoring device dmd . the flexing and extending mechanism disposed on a ground 2 contains two levers , a horizontal sliding block 5 , and a hinge set 6 . the two levers are jointed together by one hinge of the hinge set 6 while the other two ends are pivotally jointed to the horizontal sliding block 5 , and the ground 2 , respectively . the horizontal sliding block 5 can slide horizontally and straight with respect to the ground 2 . the driving force f , applied on the horizontal sliding block 5 , can bring the block 5 back and forth to perform straight and horizontal reciprocative movement so as to conduct reciprocative angular displacement motion of the flexing and extending mechanism . through a fasting device 3 on the mounting device 4 , a lower limb 1 of a patient is fastened onto the mounting device 4 . in this embodiment of the present invention , the exercise mechanism , being mounted on a bed or on the ground 2 , therefore , forms a one degree - of - freedom mechanism capable of flexing and extending the knee joint of the lower limb 1 repeatedly . and the driving force f continuously drives the mounting device 4 and the lower limb 1 so as to perform knee - joint continuous passive motion exercise . fig2 illustrates the schematic diagram of the present invention applied on an elbow joint continuous passive motion exercise mechanism . such an exercise mechanism comprises a mounting device 8 , a hinge 10 and a driving device generating driving torque τ . an upper limb 9 of a patient is fastened through a fastening device 7 onto the mounting device 8 . the mounting device 8 contains two levers ; and the two levers are jointed by the hinge 10 . a driving torque τ on the hinge 10 repeatedly rotate one lever with respect to another clockwise and counterclockwise . thus , the exercise mechanism forms a one degree - of - freedom mechanism capable of flexing and extending the elbow joint through the driving torque τ . as the driving torque τ continuously applied on the hinge 10 , the two levers rotate with respect to each other in a clockwise - counterclockwise movement , and the elbow - joint continuous passive motion exercise is performed . patients utilize the continuous passive motion exercise systems shown in fig1 or fig2 to bring joints to motions through an external force or torque , without active contracting his or her own muscles . therefore , not only that the injured muscles are to recover through much needed rest , but the result that the joint tendons and muscles are to be sticky and stiff due to the lack of exercise can also be prevented ; in addition , through twisting and turning of joints , joints are to obtain necessary lubrication and nutrients , thus preventing joints from atrophy . yet when patients are in such rehabilitation therapy sessions , it is the fear , both for pain and for possible secondary injury due to muscle weakness and stiffness , which leads to the angles of joint motions being confined within a small range , or the progress of rehabilitation being slowed down . according to the embodiments of the present invention , a continuous passive motion exercise system comprises a driven monitoring device dmd , having force or torque sensors s corresponding to the exercise mechanism , so as to monitor the driving force f or the driving moment τ needed to perform continuous passive motion exercises , wherein f or τ is a vector with the dimension being identical to that of the degree of freedom of the mounting device 4 , 8 . in one more aspect of the present invention , the driven monitoring device dmd comprises a data recorder dr to record and a data transceiver tr interface to receive from and transmit to external data ed storing and / or analyzing devices m the associated values of the predetermined reciprocative motion pattern , numbers of cycles , said averages , duration of use , and patient &# 39 ; s id , for future analysis and evaluation . the one degree - of - freedom exercise system shown in fig1 is to be utilized for illustrating the rehabilitation system . at first , to model the mechanics system of the bone - muscle system of a joint under passive motion , two kinds of internal forces can be defined ; one is conservative elastic force ( such as spring force with an elastic coefficient k ) from the conservative elastic force member 12 a , and the other non - conservative force ( such as viscosity , friction , etc . with a damping coefficient c ) from the non - conservative force member 12 b as illustrated in fig3 . therefore , the mechanics model of the rehabilitation system shown in fig1 , providing both thigh and leg are fastened on the two levers 13 of the mounting device 4 , can be shown as in fig4 , wherein m t is the equivalent mass of the thigh and the lever whereon the thigh is fastened , m l is the equivalent mass of the leg and the lever whereon the leg is fastened ( a foot is regarded as part of the leg ), θ n and θ h are the angular displacement vector of the knee joint and the hip joint respectively with the assumption of no relative motion between a limb and its mounting device , point a is a reference point fixed in the horizontal sliding block 5 which can only move straightly and horizontally with respect to the ground 2 , x is the displacement vector of point a with respect to the ground 2 , k n is the effective coefficient of elasticity for the total passive conservative elastic force stored in the knee joint muscles and tendons , τ n is the friction moment vector generated on the center of rotation of the knee joint , k h is the effective coefficient of elasticity for the total passive conservative elastic force stored in the hip joint muscles and tendons , and τ h is the friction moment vector generated on the center of rotation of the hip joint . it is assumed that k n is a function of τ n only and k h is a function of θ h only . both k n and k h have nothing to do with the directions and the velocity of their associated joint motions . thus , ( k n θ h + c n ) is the total conservative elastic force when the knee joint muscles and tendons are passively brought to an angular displacement τ n ; wherein c h is a constant . and ( k h τ h + c h ) is the total conservative elastic force when hip joint muscles and tendons are passively brought to an angular displacement θ h , wherein c h is a constant . according to the embodiments of the present invention , during a cycle of passive reciprocative motion , the amount of work ( w f ) done by the horizontal driving force vector f equals to wherein w d represents the work done by the total friction of the mechanism , w n represents the work (∫ τ n · dθ n ) done by the knee joint friction moment vector τ n , w h represents the work (∫ τ h · dθ h ) done by the hip joint friction moment vector τ h , and the total amount of work from the gravitational force and / or other conservative elastic forces in one complete cycle of motion is zero . assuming in each cycle of a passive reciprocative motion , the displacement and velocity patterns of the mounting device are all to be kept the same . then w d in each cycle can be regarded as identical ( assuming the operational environment including temperature and humidity and the mass of the leg portion pose little alteration or impact ). therefore , between two complete cycles of passive reciprocative motions , the difference regarding the amounts of the work done by the horizontal driving force f is as follows : δ w f =− δ ( w d + w n + w h )=− δ ( w n + w h ) ( 2 ) wherein δ is the operand for the difference obtained from the latter value minus the former value . hence , δw f reflexes only the change in the work done by joint friction . since the motion path of two cycles are the same , δw f represents the change in joint friction between two cycles . in the present invention , δw f can be divided by the total displacement distance 2l during one cycle of passive motion , wherein l represents the farthest horizontal distance that the reference point a moves with respect to the ground in one cycle , so as to define the variation of the average joint friction force δf b . therefore , when the joint friction becomes smaller , index δf b shall become positive . a negative value of δf b thus , indicates the increase of the joint friction . therefore , regarding the system of the present invention , when passive reciprocative motions proceed under extremely repeatable speed , the driven monitoring device then measures the driving force f , so as to calculate and monitor the amount of variation of the average joint friction force δf b during the rehabilitation process , and thus obtains the state of variation regarding the joint friction and viscosity . since the joint friction force might be very minute compared to the other force sources involved , to monitor the variation of such joint friction , the present invention averages the w f value of a plurality of cycles ( such as 1000 cycles ) of passive reciprocative motions with identical displacement and velocity patterns and compare these averages recorded the same way in different rehabilitation sessions to observe the state of variation of the agility of joints . in such a way , the possible noise caused by the variations of the rehabilitation system and environment can be reduced . furthermore , the strength of elasticity regarding muscles and tendons at joint is also one of the indices for joint rehabilitation . considering the system shown in fig1 , in half of a complete cycle of passive reciprocative motion such as the flexing motion cycle , based on the principle of work , the equation can be written as w f ( i ) + w jk ( i ) + w mk ( i ) + w mf ( i ) + w gf ( i ) + w jf ( i ) = 0 ; i = 1 , or 2 ( 3 ) where variables with subscript ( 1 ) or ( 2 ), respectively denote their values at the first or the other half cycle of passive reciprocative motion which originates from one end position with zero velocity and ends at the other end position with zero velocity ; and w jk ( i ) , w mk ( i ) , w mf ( i ) , w gf ( i ) , and w jf ( i ) denote the work done by conservative joint elasticity force , conservative machine elasticity force , machine friction force , gravitational force , and knee - and - hip joint friction force respectively in the i - th half cycle . by subtracting w f ( 1 ) from w f ( 2 ) , the following equation is obtained as w f ( 2 − 1 ) =( w jk ( 1 ) − w jk ( 2 ) )+( w mk ( 1 ) − w mk ( 2 ) )+( w mf ( 1 ) − w mf ( 2 ) )+( w gf ( 1 ) − w gf ( 2 ) )+( w jf ( 1 ) − w jf ( 2 ) ) ( 4 ) wherein w f ( 2 − 1 ) is defined as ( w f ( 2 ) − w f ( 1 ) ). as described above , if the displacement and velocity patterns for the motion of the mounting device to be identical and the change in the mechanic characteristics of the machine are maintained to be very small and negligible during each cycle of a reciprocative passive motion , each ( w gf ( 1 ) − w gf ( 2 ) ), ( w mk ( 1 ) − w mk ( 2 ) ), and ( w mf ( 1 ) − w mf ( 2 ) ) value can be regarded as identical in each cycle . therefore , the difference of w f ( 2 − 1 ) between two cycles of motion can be obtained as follows : δ w f ( 2 − 1 ) = δ ( w jk ( 1 ) − w jk ( 2 ) )+ δ ( w jf ( 1 ) − w jf ( 2 ) ) ( 5 ) assuming that the change of a human joint friction with respect to time is independent of the direction of the joint rotation , then the term δ ( w jf ( 1 ) − w jf ( 2 ) ) equals to zero . therefore , the equation can be written as since w jk ( i ) , i = 1 or 2 , is a work done by a conservative force , w jk ( 2 ) is equal to − w jk ( 1 ) . hence , the equation becomes since w jk ( 1 ) is dependent on the initial and the end positions of the first half cycle of a reciprocative passive motion only , if the two positions are chosen so that w jk ( 1 ) is equal to zero , it is possible that the effect of elasticity change in joint will not be shown in the above equation . in such cases , a different initial position or a different end position should be chosen . however , δw jk ( 1 ) along is not enough to determine whether the elastic force is increasing or decreasing , thus the sign of w jk ( 1 ) has to be known to correctly interpret the result . when w jk ( 1 ) is positive , the potential energy due to the conservative elastic force of the joint in the first half cycle is increasing . a positive δw jk ( 1 ) then means that the average elastic force is increasing , hence the average stiffness is increasing , and vice versa . when w jk ( 1 ) is negative , the potential energy due to the conservative elastic force of the joint in the first half cycle of the joint is decreasing . a positive δw jk ( 1 ) means that the average elastic force is decreasing , hence , the stiffness is decreasing , and vice versa . eqn . ( 4 ) can be rewritten as , ( w jk ( 1 ) − w jk ( 2 ) )− w f ( 2 − 1 ) −( w mk ( 1 ) − w mk ( 2 ) )−( w mf ( 1 ) − w mf ( 2 ) )−( w gf ( 1 ) − w gf ( 2 ) )−( w jf ( 1 ) − w jf ( 2 ) ) ( 8 ) by running the same reciprocative motion without any limb mounted onto the machine and assuming the term ( w mf ( 1 ) − w mf ( 2 ) ) is either close to zero or has little to do with or without a limb mounted , the following equation can be obtained w f0 ( 2 − 1 ) = w f0 ( 2 ) − w f0 ( 1 ) =( w mk ( 1 ) − w mk ( 2 ) )+( w mf ( 1 ) − w mf ( 2 ) )+( w gf0 ( 1 ) − w gf0 ( 2 ) ) ( 9 ) where w f0 ( i ) , w gf0 ( i ) ; i = 1 or 2 is the work done by the driving force , and the gravitational force on the machine , respectively without any limb mounted in the i - th half cycle . from eqns . ( 8 ) and ( 9 ) and assuming w jf ( 1 ) = w jf ( 2 ) , the equation can be written as 2 w jk ( 1 ) = w f ( 2 − 1 ) − w f0 ( 2 − 1 ) − 2 w gfb ( 1 ) ; ( 10 ) where w gfb ( 1 ) is the work done by the gravitational force on the limb in the first half cycle and can be calculated from the configurations of the limb at the two end positions in a half cycle of a reciprocated motion . hence , from eqn . ( 10 ), the sign of w jk ( 1 ) can be determined . through combining eqn . ( 7 ) and eqn . ( 10 ), the average change of the joint elastic status between the two cycles can be defined as δ w k = w jk ( 1 ) δw f ( 2 − 1 ) /( 2 ×| w jk ( 1 ) |) ( 11 ) in the embodiments of the present invention , when δw k is positive , the average internal elastic force of the joint is increased . it represents that the degree of rigidity for the joint muscles and tendons is to become larger , and vice versa . therefore , a variation of the agility of joints which can be obtained through the driven monitoring device has developed to better understand the effect of a rehabilitation session . regarding the system of the present invention , δw k can be divided by the length l , the travel distance of point a in the half cycle of passive reciprocative motion , and obtain the amount of variation for the average elastic force f k as follows : δ f k = w jk ( 1 ) δw f ( 2 − 1 ) /( 2 l ×| w jk ( 1 ) |) the driven monitoring device then is capable of comparing the impact during the rehabilitation processes regarding the elasticity of joint muscles in every time or every day by utilizing δf k calculated . the comparative index values regarding agility and elasticity are suitable for the comparison of variation between two cycles of motion with identical displacement , velocity . in overall terms of rehabilitation , the range of motion , the displacement and velocity should be properly adjusted or altered . therefore , when the embodiments of the present invention are to compare the effect of the rehabilitation session from certain periods or the overall process , the user can adjust the displacement and velocity of the exercise mechanism back to the setup that is intended to compare , then the driven monitoring device may proceed to the effect assessment . all the evaluations of the embodiments above presuppose that the joint muscles do not perform active contractions to produce tension . in another embodiment of the present invention , the driven monitoring device further comprises a data recorder capable of storing a sequence of reference values of the driving force f at different sampling positions and orientations during motions . such values are obtained when the joint muscles of patients do not contract actively . the average of all the values at the same sampling position and orientations in different cycles for the first several cycles is used to represent the reference value of the driving force f at the same sampling position and orientation during a continuous passive motion session . an offset is set up in the driven monitoring device , which continuously monitors whether the absolute value of the difference between the driving force f value and the corresponding reference value at the same position and orientation during the cycles of motion is to exceed the offset ; if so , muscles might have actively contracted ( such as muscle contraction due to pain ). joints after surgeries are to be more frail than those under normal conditions , and muscles are also under recovering condition , therefore , excessive pulling or squeezing might cause muscle tear or joint dislocations . the present invention provides an exercise system with the automatic safety control function ( such as stopping the system operations ), thus preventing patients from possible secondary injuries . the system of the present invention can also set up several offsets so that more proper reactions can be performed during rehabilitation sessions ( such as receding back or slowing down the exercise motion .) in addition , since rehabilitation sessions might take tremendous length of time , medical personnel or patients themselves cannot record and monitor the rehabilitation indices at all time , and during the rehabilitation session , large amount of data are needed to be stored , so as to conduct analyses , follow - ups and display . therefore , the system of the present invention has a data recorder , through which detailed measurement and calculated data are to be recorded during the rehabilitation sessions and then transmitted to other devices to be stored , thus enabling medical personnel or patients to perform more precise analyses , long - term follow - ups and statistics . meanwhile , when the system of the present invention is utilized by several patients , the set - ups of the machine can easily be retrieved to fit the need of every patient . by the same token , regarding the present invention and other devices , persons skilled in the art are able to make proper variations based upon the calculation methods disclosed herein so as to obtain the effects and characteristics of the invention . although the present invention has been described in considerable detail with reference to certain preferred embodiments thereof , those skilled in the art can easily understand that all kinds of alterations and changes can be made within the spirit and scope of the appended claims . therefore , the spirit and scope of the appended claims should not be limited to the description of the preferred embodiments contained herein . | 0 |
described herein are methods of preparing collagen films containing therapeutic compounds that readily dissolve upon exposure to normal human body temperature ( 35 - 37 ° c .). these collagen films can be used for the rapid and accurate delivery of compounds to specific tissue sites . for the purposes of this invention , collagen can be collected , solubilized , subjected to modification by mono - reactive , amine - modifying agents , and re - precipitated by any standard technique , e . g ., those provided in devore et al . ( u . s . pat . no . 4 , 713 , 446 ), herein incorporated by reference . the following example is provided as an illustration and is in no way intended to limit the scope of the invention . as a first step toward producing rapidly dissolving films , soluble collagen was prepared by standard procedures . young calf hide was washed thoroughly with reagent alcohol and with deionized , pyrogen - free water , cut into approximately 1 cm 2 sections , and stirred overnight in 40 volumes of 0 . 5 m acetic acid . the mixture was then supplemented with pepsin ( 3 % hide wet weight ) and stirred for 72 hours . the digested , solubilized collagen was filtered through cheesecloth and precipitated by increasing the nacl concentration to 0 . 8 m . the collagen was then cycled twice through steps of redissolution , in 0 . 5 m acetic acid , and reprecipitated . the collagen precipitate was then redissolved in 0 . 1 n acetic acid , dialyzed against 0 . 1 m acetic acid , filtered ( 0 . 45 μm ), and refiltered ( 0 . 22 μm ). the purified , telopeptide - poor collagen was derivatized with glutaric anhydride as previously described ( u . s . pat . nos . 5 , 631 , 243 and 5 , 492 , 135 ). briefly , the collagen solution ( approximately 3 mg / ml ) was adjusted to ph 9 . 0 with 10 n and 1 n naoh . while stirring the solution , glutaric anhydride was added at 10 % ( weight of collagen ). for twenty minutes , the stirring continued , and the ph was maintained . the ph of the solution was adjusted to 4 . 3 with 6 n and 1 n hcl to precipitate the derivatized collagen . the precipitate was centrifuged at 3500 rpm for 30 minutes . the pellet was washed three times in pyrogen - free deionized water and then redissolved in phosphate buffered glycerol ( 2 % glycerol in 0 . 004 m phosphate buffer , ph 7 . 4 ) to achieve a final concentration of approximately 10 mg / ml . to prepare collagen films containing mitomycin , the collagen solution , described above , was heated in a 35 ° c . water bath for 30 minutes to reduce viscosity . mitomycin ( e . g ., mutamycin ®, bristol myers squibb , princeton , n . j . ), also known as mitomicin c , was added to the heated collagen . the collagen solution was then poured into petri dishes in a thin layer and allowed to air dry under a laminar - flow hood . collagen film melting time at 35 ° c . was measured after placing the films in 0 . 8 % saline in a 35 ° c . water bath . pre - heated collagen films melted in approximately one minute . in contrast , collagen films poured into petri dishes without pre - heating melted at 35 ° c . in approximately 30 minutes . mitomycin - containing collagen films had a final mitomycin concentration of 400 μg per 16 mm 2 . 6 mm diameter discs were cut from the film and applied to human subconjunctival fibroblasts derived from tenon &# 39 ; s membrane layered in 96 well plates ( csm supplemented with 10 % fetal bovine serum ). after 72 hours , mitomycin - induced inhibition of cell division was assessed by measuring the reduction in fluorescence intensity ( rfu ) using a fluorogenic calceinam assay ( see , for example , decherchi et al ., j . neurosci . meth . 71 : 205 ( 1997 ); sugita , pflitgers arch . 429 : 555 ( 1995 ); padanilam et al ., ann . ny acad . sci . 720 : 111 ( 1994 ); lichtenfels et al ., j . immunol . meth . 172 : 227 ( 1994 ); and wang et al ., human immunol . 37 : 264 ( 1993 )). the mitomycin - containing collagen films inhibited approximately 91 % of the cell division demonstrated in control cells . mitomycin - containing films may be stored for later use . for example , mitomycin activity in the collagen films described above was maintained for at least 6 weeks after preparation of the films ( stored at 4 ° c .). administration of mitomycin - collagen films , 2 , 4 , and 6 weeks old , demonstrated 91 %, 90 %, and 92 % inhibition of cell division , respectively , compared to mitomycin - free controls . these values were comparable to the % cell death inhibition elicited by administration of a freshly prepared mitomycin solution ( 0 . 4 mg / ml solution , dissolved in usp sterile water ). in contrast to the stability of mitomycin in the collagen film , hplc analysis of the mitomycin solution determined that stability was maintained for only 4 days following storage at ambient temperature and 4 ° c . in the dark . dissolution and storage in 0 . 9 % saline or phosphate buffer ( ph 7 . 4 ) is not recommended due to degradation and precipitation . rapidly dissolving collagen films containing therapeutic compounds are useful for various treatments . for example , the collagen - mitomycin film may be administered to the external opening of the fistula created during glaucoma filtering surgery ( trabeculectomy ). immediately following surgery , a collagen film , e . g ., a 4 × 4 mm patch , containing 100 - 1000 μg mitomycin ( preferably 400 μg ), is directly applied to the external opening of the fistula prior to replacing the scleral flap . administration of the mitomycin increases the duration of fistula patency , increasing filtration from the eye and reducing intraocular pressure . other compounds may also be administered to the trabeculectomy - created fistula to increase filtration during recovery . for example , 5 - fluorouracil - containing films may be administered in the same fashion to deliver a 5 - fluorouracil dose of 25 - 250 μg ( preferably 100 μg ). other alternative compounds that are effective for this treatment are anti - fibrotic , angiostatic , and anti - viral compounds . administration of the rapidly dissolving collagen films containing inhibitors of cell proliferation are also useful for treatment during recovery from other surgical procedures where prevention of wound healing is beneficial . in addition , the collagen films of the invention may be administered to reduce cellular proliferation in specific tissue sites , such as for the localized inhibition of neoplastic or non - neoplastic cell growth . for this application , any chemotherapeutic compound may be dissolved in the collagen matrix in concentrations appropriate for inhibiting cell growth . while the treatment regimens described herein are preferably applied to human patients , they also find use in the treatment of other animals , such as domestic pets or livestock . moreover , while the invention has been described in connection with specific embodiments thereof , it will be understood that it is capable of further modifications and this application is intended to cover any variations , uses , or adaptations of the invention following , in general , the principles of the invention and including such departures from the present disclosure come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth , and follows in the scope of the appended claims . | 0 |
this description , which references and incorporates the above - identified figures , describes one or more specific embodiments of an invention . these embodiments , offered not to limit but only to exemplify and teach the invention , are shown and described in sufficient detail to enable those skilled in the art to implement or practice the invention . thus , where appropriate to avoid obscuring the invention , the description may omit certain information known to those of skill in the art . fig1 shows an exemplary online information - retrieval system 100 . system 100 includes one or more commercial databases 110 , one or more servers 120 , one or more access devices 130 , one or client - side databases 140 , and a case - management system 150 . databases 110 include a set of one or more databases . in the exemplary embodiment , the set includes a caselaw database 111 , a court filings database 112 , a transcripts ( xcripts ) database 113 , a verdict and settlement database 114 , and other databases 115 . caselaw database 111 generally includes electronic text and image copies of judicial opinions for decided cases for one or more local , state , federal , or international jurisdiction . court - filings database 112 includes electronic text and image copies of court filings related to one or more subsets of the judicial opinions caselaw database 111 . exemplary court - filing documents include briefs , motions , complaints , pleadings , discovery matter , and trial exhibits . verdict and settlement database 114 includes electronic text and image copies of documents related to the determined verdict , assessed damages , or negotiated settlement of legal disputes associated with cases within caselaw database 111 . other databases 115 includes one or more other databases containing documents regarding news stories , business and finance , science and technology , medicine and bioinformatics , and intellectual property information . in some embodiments , the logical relationships across documents are determined manually or using automatic discovery processes that leverage information such as litigant identities , dates , jurisdictions , attorney identifies , court dockets , and so forth to determine the existence or likelihood of a relationship between any pair of documents . also , in some embodiments , databases 115 may include user - or firm - specific data repositories ( semantic containers ) that are only accessible by subscribers or subsets of subscribers from a specific law firm . in some instances , these repositories or more generally databases are organized around specific litigation matters of a law firm , providing convenience of central storage for all documents , including case law and related trial court documents for a litigation . in some embodiments , databases 110 generally contain client intake content , such as jury verdicts , asset tracking records , criminal records , business news , lawyer profiles , and people data ; practice insight content , such as jurisdictional proof - of - facts , case law , statutes , causes of action , and court rules ; filings documents , such as court dockets , pleading and practice forms , and federal and local court forms ; and drafting content , such as briefs , alr , and jury instructions . databases 110 , which take the exemplary form of one or more electronic , magnetic , or optical data - storage devices , include or are otherwise associated with respective indices ( not shown ). each of the indices includes terms and / or phrases in association with corresponding document addresses , identifiers , and other information for facilitating the functionality described below . databases 112 , 114 , and 116 are coupled or couplable via a wireless or wireline communications network , such as a local -, wide -, private -, or virtual - private network , to server 120 . server 120 , which is generally representative of one or more servers for serving data in the form of webpages or other markup language forms with associated applets , activex controls , remote - invocation objects , or other related software and data structures to service clients of various “ thicknesses .” more particularly , server 120 includes a processor 121 , a memory 122 , a subscriber database 123 , one or more search engines 124 , an interface module 125 , and a workflow integration module 126 . processor 121 is generally representative of one or more local or distributed processors or virtual machines . in the exemplary embodiment , processor 121 takes any convenient or desirable form . processor 121 is coupled to memory 122 . memory 122 , which takes the exemplary form of one or more electronic , magnetic , or optical data - storage devices , stores subscription database 123 , search engines 124 , litigation module 125 , and workflow integration module 126 . subscription database 123 includes subscriber - related data for controlling , administering , and managing pay - as - you - go - or subscription - based access of databases 110 . subscriber database 123 includes subscriber - related data for controlling , administering , and managing pay - as - you - go or subscription - based access of databases 110 . in the exemplary embodiment , subscriber database 123 includes one or more data structures , of which data structure 1231 is representative . data structure 1231 includes a customer or user identifier portion 1231 a , which is logically associated with data elements or fields , such as fields 1231 b , and 1231 c . field 1231 b includes information identifying one or more user accounts , such as a law firm or corporate account . field 1231 c includes one or more values governing whether litigation documents are charged on a transactional or per - access basis or whether access to these documents is included within a flat - rate or other type of subscription . in some embodiments , this field may also identify , indicate , or represent a specific pricing schedule to be used in assessing access fees for litigation ( pre - decision ) documents . in some embodiment , data structure 123 may also include information regarding a law - firm case - management system associated with the customer , which may be a law firm agent , such as an attorney , paralegal , expert , legal clerk , secretary , or scheduler . search engines 124 provide search capabilities for databases 110 . in the exemplary embodiment , the search engines provide boolean or natural - language search services ; however , other embodiments may provide other types of searching . user interface module 125 includes machine or device executable instructions for performing various tasks , such as defining one or portion of a graphical user interface that helps users define searches for databases 110 . software 125 includes one or more browser - compatible applets , webpage templates , user - interface elements , objects or control features or other programmatic objects or structures . more specifically , software 125 includes a caselaw search interface 1251 and a litigation search interface 1252 , which are described more fully below . workflow integration module 126 includes machine or device executable instructions for performing various tasks , such as integrating search interfaces of user module 125 and / or content from databases 110 into workflows of law firm users . in the exemplary embodiment , these executable instructions includes add - on tools for providing interface features , such as launch points , wizards , and so forth that enable users to launch online searches or document retrievals from the context of client - side applications , such as word processing applications or case - management applications , without repeated entry of sign - on credentials . in some embodiments , workflow integration module 126 itself includes an online case - management system , document - management system , and / or word processing application . other embodiments may also include instructions for storing documents retrieved or accessed by a particular law firm in a law - firm specific repository , which may be maintained within databases 115 or elsewhere within system 100 . ( workflow integration module 126 may also include other instructions or functionally that is implied or specifically expressed herein .) server 120 is communicatively coupled or couplable via a wireless or wireline communications network , such as a local -, wide -, private -, or virtual - private network , to one or more accesses devices , such as access device 130 . access device 130 is not only communicatively coupled or couplable to server 130 , but also generally representative of one or more access devices . in the exemplary embodiment , access device 130 takes the form of a personal computer , workstation , personal digital assistant , mobile telephone , or any other device capable of providing an effective user interface with a server or database . specifically , access device 130 includes one or more processors ( or processing circuits ) 131 , a memory 132 , a display 133 , a keyboard 134 , and a graphical pointer or selector 135 . memory 132 stores code ( machine - readable or executable instructions ) for an operating system 136 , a browser 137 , a graphical user interface ( gui ) 138 , and a word processor application 139 . in the exemplary embodiment , operating system 136 takes the form of a version of the microsoft windows operating system , and browser 137 takes the form of a version of microsoft internet explorer . operating system 136 and browser 137 not only receive inputs from keyboard 134 and selector ( or mouse ) 135 , but also support rendering of gui 138 on display 133 . upon rendering , gui 138 presents data in association with one or more interactive control features ( or user - interface elements ). ( the exemplary embodiment defines one or more portions of interface 138 using applets or other programmatic objects or structures from server 120 .) graphical user interface 138 defines or provides one or more display control or application regions , such as a word processor window 1381 , a query region 1382 , a results region 1383 , a litigation resources region 1384 , and a specialized query region 1385 . each region ( or page in some embodiments ) is respectively defined in memory to display data from databases 110 and / or server 120 in combination with one or more interactive control features ( elements or widgets ). in the exemplary embodiment , some of these control features takes the form of a hyperlink or other browser - compatible command input . although shown as being concurrently displayed in fig1 , various embodiments present one or more portion of interface 138 at different times and within different windows or screens . more specifically , word processing region 1381 includes interactive control features , such as a legal - research launch point launch point , an edit window document doc and a results region results . ( in some embodiments , the launch point is part of a toolbar of the word processor application .) selection of launch point , which in the exemplary embodiment bears a westlaw label , results in automatic performance of a search based specific text within document doc , with the search operation performed using server 120 . ( selection in some embodiments is achieved by a single - or double - click pointer action .) in some embodiments , the specific text may be a user selected name , a case citation , or a legal issue . in some embodiments , document doc is associated with case management data 141 from case management system and the search is conducted based on one or more portions of data 141 , which may identify one or more particular legal activities or document types . results of the search are presented in context of the word processing application as results region 1382 , which shows document selection links doc x and doc y , which in the exemplary embodiment are court - filing documents , such as briefs , pleadings , exhibits , expert reports , trial exhibits , or transcripts , of prior adjudicated cases that are deemed similar based on data 141 to a case associated with the document or portion thereof . for example , if document doc is associated with a document type summary judgment motion and the case management data or text in the document itself indicates the jurisdiction , the judge , and legal issues , the search results may include summary judgment motions from prior cases in the jurisdiction that dealt with similar legal issues before that judge . in some embodiments , the case - management data may include a schedule of events or docket dates which when correlated against the current date indicate or suggest the type of document doc . however , in some embodiments , selection of the launch point input presents the text and / or case management data to server 120 , which causes presentation of query region ( or query wizard ) 1383 based on the received input . region 1383 presents one or more input regions , such as input region , and one or more submit command regions , such as submit region , and a litigation selection region litigation for receiving user input . the form of the wizard and specific screens based on one or more portions of case management data 141 , text in document doc , and / or subsequent inputs to region 1383 . for example , if document doc is associated with a document type summary judgment motion , then the wizard may in some embodiments present questions regarding the nature of the legal issue or other matters that may not be addressed by the case management data . in the exemplary embodiment , legal research launch point launch point s presented as part of a tool bar in an graphical user interface portion of word processing application 139 . selection of control region litigation results in presentation of litigation resources region 1384 . litigation resources region 1384 , which serves as a “ one - stop shop ” online interface , includes an aggregate set of control features which result in display of a version of query region 1385 that helps legal professionals evaluate , investigate , negotiate , prepare , and present trial - case information . in the exemplary embodiment , region 1384 includes command features , such as hyperlinks , for accessing search interfaces for professional profile data ( person ), case - valuation data ( valuation ), court - rules data ( rules ), and other data ( other ). profiler data allows users to initiate a search of available professional directories and / or other sources for biographical and experiential data based on attorney , judge , or expert witness name and / or jurisdiction directly from region 1384 . similarly , case - valuation data is data related to valuation of litigations based on jurisdiction and injury type directly from region 1384 . other embodiments provide these and / or other features . in some embodiments , the specific items listed under litigation resources are based on the case management data . for example , if the case management data indicates that the case is in appeal , the valuation link may be omitted or de - emphasized by placement at a lower position in a list or table . also , in some embodiments , query region 1385 may be populated with inputs based on text in document doc and / or portions of the case management data . in some embodiments , where the text in document doc or the case management data are sufficient , query region 1385 includes a listing of one or more documents from databases 110 . in the exemplary embodiment , one or documents selected by a user from any search results are added to a repository of data , which may for example function as a trial notebook . in some embodiments the repository is maintained as a private part of databases 110 , and in others it is maintained as a part of case management system 140 . case management system 140 may take a variety of forms . in the exemplary embodiment , system 140 takes the form of a case management system from prolaw . fig2 shows a flow chart 200 of one or more exemplary methods of operating an information - management system , such as system 100 . flow chart 200 includes blocks 210 - 240 , which are arranged and described in a serial execution sequence in the exemplary embodiment . however , other embodiments execute two or more blocks in parallel using multiple processors or processor - like devices or a single processor organized as two or more virtual machines or sub processors . other embodiments also alter the process sequence or provide different functional partitions to achieve analogous results . for example , some embodiments may alter the client - server allocation of functions , such that functions shown and described on the server side are implemented in whole or in part on the client side , and vice versa . moreover , still other embodiments implement the blocks as two or more interconnected hardware modules with related control and data signals communicated between and through the modules . thus , the exemplary process flow applies to software , hardware , and firmware implementations . in block 210 , the exemplary method begins with a user launching a word processing application . in the exemplary embodiment , this entails the user logging on to a firm intranet using specific login credentials and gaining access to a portion of a case management system related to a specific litigation matter . the user then invokes an activity icon within the litigation matter , such as draft a summary judgment motion , which via an application program interface , launches a word processing application , such as a microsoft word or corel wordperfect application . successful launch results in opening an edit window having a launch point feature , such as shown in interface 138 in fig1 . launching in this manner allows the case management system to preload an activity - or task - specific document template into the word processing application for use by the user . in some embodiments , the template is populated with specific text , such as party , court names , and case docket numbers that are associated with the matter number within the case management system . in other embodiments , one or more portions of the available case management data are associated with the template or new document as metadata . in other embodiments , the word processor is launched out of context of the case - management system , for example , within the context of a document management system , a browser , or an online research system that interfaces with the case management system . execution then advances to block 220 . block 220 entails determining that a user of a client access device is performing a litigation - related task . in the exemplary embodiment , this entails communicating information associated with the document within the editing window , for example one or more portion of the metadata and / or text within the document to a server , such as server 120 . server can then analyze this information and determine that a particular task is being performed relative to a workflow model . for example , this determination may entail detecting presence of an activity field or code inserted into the metadata for the document or presence of particular text within the title of the template or document . block 230 entails providing , in response to the determination , specific legal materials relevant to the litigation - related task without the user leaving the word - processing application . in the exemplary embodiment , this entails server 120 conducting a search of one or more of databases 110 for relevant trial - court materials based on metadata or text within the document and presenting results of the search , for example , a listing of pleadings , motions , or summary judgment motions on similar issues , to the user via interface 138 . execution continues at block 240 . block 240 entails automatically collecting the provided trial court materials for reuse by one or more other agents of the law firm without additional searching . in the exemplary embodiment , this entails a user selecting one or more of the documents for addition to a firm - specific repository or database . however , in other embodiments , all documents presented to the user are automatically selected for storage in repository . some embodiments place the selected documents in a database associated with a case management system , such as system 140 . fig3 and 4 show respective litigation resource interfaces 300 and 400 , which some embodiments use as an alternative to the litigation - resource region 1384 in fig1 . interface 300 includes control features for accessing content and tools related to evaluation , investigation , negotiation , trial preparation , and trial presentation . more specifically , interface 300 includes a profiler - query portion 302 ; a litigation - valuation - query region 304 ; a listing 306 of links to databases related to jury verdicts ; a listing 308 of case - investigation databases ; a listing 310 of links to jury - instruction database ; a listing 312 of links to databases for briefs , depositions , or transcripts ; a listing 314 of court - docket databases ( or services ); a listing 316 of links to court - rules databases ; a listing 318 of links to databases of practice guides ( or legal treatises ); a listing 320 of databases containing forms and checklists ; a listing 322 of databases related to procedures and evidence ; and a listing 324 of professional directories and newspaper databases . notably , selection of links within listings 306 - 322 invoke display of query input regions for their respective databases . similarly , interface 400 , in fig4 , includes a shortcut portion 410 and a database ( or resource ) listing portion 420 . shortcut portion 410 includes several query input regions , and listing portion 420 includes several clusters of database listings . the embodiments described above are intended only to illustrate and teach one or more ways of practicing or implementing the present invention , not to restrict its breadth or scope . the actual scope of the invention , which embraces all ways of practicing or implementing the teachings of the invention , is defined only by the following claims and their equivalents . | 6 |
the following description is provided to enable any person having ordinary skill in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the embodiments will be readily apparent to those of ordinary skill in the art , and the principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles , features and teachings disclosed herein . fig1 is a depiction of an eye 100 . the eye 100 is approximately 2 . 5 cm wide by 2 . 5 cm deep , with a height of 2 . 3 cm . the outer layer 120 of the eye is called the sclera and the approximately ⅙ of the sclera that is clear and exposed is referred to as the cornea . extraocular muscles are coupled to the sclera and move the eye 100 . the colored region 110 is the pupil of the eye 100 and is located in a second layer ( i . e ., choroid ) of the eye 100 beneath the sclera 120 . the choroid and the sclera 120 include a plurality of blood vessels , such as blood vessel 130 , that supply blood to different regions of the eye . generally , the blood vessels in the sclera 120 are the blood vessels in the body that are the most directly exposed to radiation . accordingly , non - invasive analyte detection via spectrum analysis of blood is most easily and accurately performed using the blood vessels of the eyes . the blood vessels in the sclera 120 generally follow a non - linear path within the sclera and have varying thicknesses . fig2 is a diagram illustrating a device 200 capable of detecting a pattern on the eye 100 and then delivering radiation to the eye 100 that coincides with the pattern . for example , the device 200 can detect the blood vessel 130 and deliver radiation that is coincident with the blood vessel 130 of the eye 100 . in an embodiment of the invention , the device 200 can detect a pattern on any object and then deliver pattern radiation to that object , regardless of whether the object is of biological or non - biological origin . for example , the device 200 can detect the pattern of a grain of wood and then deliver pattern radiation such that the radiation is coincident with that grain of the wood . in an alternative example , the device 200 can detect a stress fracture pattern of an aluminum aircraft wing and deliver pattern radiation to the aluminum skin of the aircraft wing such that it is coincident with the stress fracture pattern . in another embodiment of the invention , the device 200 can deliver radiation that is coincident with an area surrounding or near to the pattern . in an embodiment of the invention , the device 200 can also select a pattern or a set of patterns according to preset parameters if the object has a plurality of patterns . for example , the device 200 can select the blood vessel 130 in the eye 100 based on thickness , length , and / or color ( e . g ., red ). in another embodiment of the invention , the device 200 determines ( e . g ., detects and / or measures ) characteristics of an object by performing a spectrum analysis of radiation radiated by the pattern , using reflective spectroscopy from reflected radiation from radiation incident on the pattern and / or using transmissive spectroscopy from diffuse radiation on an area surrounding or near the pattern . ( hereinafter , the term “ radiated radiation ” will refer to reflected radiation , diffuse radiation , and / or other radiation ). for example , the device 200 can detect the presence of glucose and / or measure glucose concentrations in the blood vessel 130 . it will be appreciated that the device 200 can collect the radiated radiation as either an absorbance spectrum , an interferogram , or any property associated with the exciting source , such as raman scattering , fluorecence , scatter , etc . that would be modified by the presence of the analyte of interest . other techniques for collecting the radiated radiation may also be used . it will also be appreciated that other chemicals ( also referred to as analytes ) besides glucose may be detected and / or measured using the device 200 . the device 200 comprises an electronics section 200 a and a hood 200 b . the electronics section 200 a , as will be discussed further in conjunction with fig3 – fig5 , houses electronics for detecting pattern ( s ) on an object ; selecting a pattern on the object if the object includes more than one pattern ; delivering radiation to the object that is coincident with the detected and selected pattern ( and / or coincident with an area surrounding or near to the object ); and detecting and / or measuring at least one characteristic of the object or of the pattern on the object based the radiated radiation . the electronics section 200 a can also include electronics for coagulating or ablating a detected pattern on an object . the hood 200 b covers the object that radiation is to be applied to . for example , the hood 200 b can cover the eye 100 . the hood 200 b can be made of plastic or other suitable material that is impervious to light . because the hood 200 b is impervious to light , it prevents unwanted light radiation from interfering with the pattern detection and radiation application functions of the device 200 . the hood 200 b can be of a rigid structure or a non - rigid structure . an advantage of using a non - rigid structure is that it enables application to a wide variety of objects having varying dimensions . in an embodiment of the invention , the hood 200 b can be custom made according to facial characteristics of an individual so that the hood 200 b can securely cover the eye 100 and prevent light radiation from interfering with the pattern detection , radiation delivery , and characteristic detection / measurement functions of the device 200 . fig3 is a block diagram of the device 200 . the electronics section 200 a includes controlling electronics 300 ; a radiation emitter 310 ; a digital micro - mirror device 320 or other radiation directing device ; a low level imaging illuminator 330 ; focusing optics 360 ; a ccd imaging detector 370 ; a beam splitter 380 ; and a return radiation detection assembly 390 , such as a pixilated detector . the controlling electronics 300 , as will be discussed in further detail in conjunction with fig4 and fig5 , is communicatively coupled to the radiation emitter 310 ; the digital micro - mirror device 320 ( or other radiation directing device ); the low level imaging illuminator 330 ; the focusing optics 360 ; the ccd imaging detector 370 ; and the return radiation detection assembly 390 . further , the controlling electronics 300 controls the radiation emitter 310 ; the digital micro - mirror device 320 ( or other radiation directing device ); the low level imaging illuminator 330 ; and the focusing optics 360 . in an embodiment of the invention , the controlling electronics 300 detects and / or analyzes at least one characteristic ( e . g ., glucose concentration ) of the object that radiation is being applied to based on radiated radiation received by the return radiation detection assembly 390 . the radiation emitter 310 emits structured radiation 340 that is coincident on a pattern detected on an object , such as the blood vessel 130 on the eye 100 . in an embodiment of the invention , the radiation emitter 310 emits radiation that is coincident with an area surrounding or near to the pattern , thereby enabling the use of transmissive spectroscopy with diffuse radiation surrounding the pattern . in an embodiment of the invention , the radiation emitted is in the near infra - red spectrum , e . g . about 700 nm to about 3 microns , and is used for spectrum analysis . in another embodiment of the invention , the radiation is of a different wavelength , e . g ., about 800 nm , and is used for ablation or coagulation . it will be appreciated that radiation of other wavelengths may be used according to the application . this radiation is reflected by the digital micro - mirror device 320 ( which can be made of or coated with aluminum and / or gold and / or other materials ), which is controlled by the controlling electronics 300 , onto the beam splitter 380 , which in turn reflects the radiation through the focusing optics 360 onto a detected pattern on the object ( and / or an area surrounding or near to the pattern ). it will be appreciated by one of ordinary skill in the art that other techniques may be used for directing radiation emitting by the radiation emitter 310 . in another embodiment of the invention , a different radiation directing device may be used in place of the digital micro - mirror device 320 . for example , a lcd panel may be used to selectively block radiation emitted by the radiation emitter 310 . in another embodiment of the invention , the radiation emitter 310 may itself be the radiation directing device since it can be swivel - mounted to the electronics section 200 a , thereby enabling the radiation emitter 310 to direct the radiation onto an object without the need for a mirror 320 or other device . the low level imaging illuminator 330 emits low level radiation that can be of a different wavelength of the radiation emitted by the radiation emitter 310 . specifically , in an embodiment of the radiation emitted is outside of the critical detection range of the return radiation detection assembly 390 but within the range detectable by the ccd imaging detector 370 . for example , the illuminator 330 may include a low level green or blue light emitting diode ( led ). an example of suitable radiation that the low level imaging illuminator 330 emits is visible radiation have a wavelength of 500 nm . the low level radiation emitted by the illuminator 330 illuminates an object having a pattern on it . the controlling electronics 300 , in conjunction with the ccd imaging detector 370 , use the low level radiation that is reflected from the object to detect a pattern on the object . if there is more than one pattern on the object , the controlling electronics 300 can also select a pattern based on pre - set parameters . based on the detection and selection , the controlling electronics 300 controls movement of the digital micro - mirror device 320 or other radiation directing device such that radiation emitted by the radiation emitter 310 traces the detected selected pattern on the object . in another embodiment of the invention , the controlling electronics directs a radiation directing device such that radiation emitted by the radiation emitter 310 surrounds or is near to the pattern , but substantially not incident on the pattern itself . the beam splitter 380 splits radiated radiation 350 into two separate beams . a first beam impacts the return radiation detection assembly 390 and a second beam impacts the ccd imaging detector 370 . as mentioned above , the controlling electronics 300 in conjunction with the ccd imaging detector 370 , use the reflected radiation to determine the location of the pattern and control the digital micro - mirror device 320 so that radiation emitted by the radiation emitter 310 traces the detected pattern and / or an area surrounding or near to the pattern . the controlling electronics 300 uses the radiation received by the return radiation detection assembly 390 to detect a characteristic and / or analyze characteristics , such as analyte concentration , of the object or pattern on the object using spectrum analysis techniques , as will be discussed in further detail in conjunction with fig6 . in an embodiment of the invention , the return radiation detection assembly 390 includes a pixilated detector , thereby enabling spatially determining from where the radiated radiation is from ( e . g ., which part of the blood vessel radiated the radiation 350 ). fig4 illustrates a block diagram of the controlling electronics 300 in an embodiment of the present invention . while other application - specific alternatives might be utilized , it will be presumed for the sake of clarity that the elements comprising the controlling electronics 300 are implemented in hardware , software or some combination thereof by one or more processing systems consistent therewith , unless otherwise indicated . the controlling electronics includes a central processing unit ( cpu ) 405 ; working memory 410 ; persistent memory 420 ; input / output ( i / o ) interface 430 ; display 440 and input device 450 , all communicatively coupled to each other via system bus 460 . the cpu 405 may include an intel pentium microprocessor , a motorola power pc microprocessor , or any other processor capable to execute software stored in the persistent memory 420 . the working memory 410 may include random access memory ( ram ) or any other type of read / write memory devices or combination of memory devices . the persistent memory 420 may include a hard drive , read only memory ( rom ) or any other type of memory device or combination of memory devices that can retain data after the controlling electronics 300 is shut off . the i / o interface 430 is communicatively coupled , via wired or wireless techniques , to the radiation emitter 310 ; the digital micro - mirror device 320 ; the low level imaging illuminator 330 ; the focusing optics 360 ; the ccd imaging detector 370 ; and the return radiation detection assembly 390 . the display 440 may include a liquid crystal display ( lcd ) or other display device . the input device 450 may include a keypad or other device for inputting data , or a combination of devices for inputting data . in an embodiment of the invention , the controlling electronics 300 also includes a speaker that can emit aural data . the speaker may be in place of or in addition to the display 440 . one skilled in the art will recognize that the controlling electronics 300 may also include additional devices , such as network connections , additional memory , additional processors , lans , input / output lines for transferring information across a hardware channel , the internet or an intranet , etc . one skilled in the art will also recognize that the programs and data may be received by and stored in the controlling electronics 300 in alternative ways . fig5 is a block diagram illustrating the persistent memory 420 . the persistent memory 420 includes a radiation emitter engine 500 ; a radiation directing engine 510 ; an illuminator engine 520 ; an optics engine 530 ; a pattern selection engine 540 ; a pattern selection parameters file 550 ; a feedback engine 560 ; and an analysis engine 570 . the radiation emitter engine 500 controls the radiation emitter 310 including the wavelength of the radiation emitted in an embodiment in which radiation emitter 310 can emit variable wavelength radiation , and the duration of the radiation emission . the radiation directing engine 510 , in conjunction with the feedback engine 560 , controls the positioning of the digital micro - mirror device 320 or other radiation directing device such that radiation emitted by the radiation emitter 310 traces a detected pattern and / or an area surrounding or near to the detected pattern , such as blood vessel 130 , on an object , such as the eye 100 . the illuminator engine 520 controls the functioning of the low level imaging illuminator 330 including the wavelength of the emissions in an embodiment in which the low level imaging illuminator 330 can emit variable wavelengths of radiation , and the duration of the emission . the optics engine 530 controls the focusing optics 360 so that the structured radiation 340 emitted by the radiation emitter 310 is focused on the object , such as the eye 100 . the pattern selection engine 540 selects a pattern illuminated by the low level imaging illuminator 330 and imaged on the ccd imaging detector 370 . the selection is based on parameters stored in the pattern selection parameters file 550 . examples of parameters could include a pattern within a range of thicknesses and within a range of lengths . it will be appreciated that the parameters can include any number of specifications within pre - specified ranges or having no maximums or minimums . the feedback engine 560 determines the position of the selected pattern and sends coordinate information to radiation directing engine 510 so that the radiation directing engine 510 can direct radiation emitted by the radiation emitter 310 onto the pattern and / or an area surrounding or near to the pattern . the feedback engine can perform this determination and sending on a very frequent basis , e . g ., 200 times / second in one embodiment , so that even if the object is moving , the digital micro - mirror device 320 or other radiation directing device can still track the pattern and therefore the radiation emitted by the radiation emitter 310 remains coincident on the pattern and / or an area surrounding or near to the pattern despite the movement . the analysis engine 570 detects and / or calculates at least one characteristic of the selected pattern or object based on the radiated radiation 350 received at the return radiation detection assembly 390 . in an embodiment of the invention , the analysis engine 570 uses spectrum analysis to determine the concentration of an analyte within the selected pattern . for example , the analysis engine 570 can use spectrum analysis to determine glucose concentration within the blood vessel 130 of the eye 100 . the analysis engine 570 can use techniques for spectrum analysis of glucose and other analytes that are described in u . s . pat . no . 6 , 061 , 582 , which is hereby incorporated by reference . other patents that disclose techniques relating to optical detection that analysis engine 570 can use include u . s . pat . nos . 6 , 025 , 597 ; 6 , 026 , 314 ; 6 , 028 , 311 ; 6 , 151 , 522 ; 6 , 181 , 957 ; 6 , 188 , 477 ; 6 , 246 , 893 ; and 6 , 276 , 798 , which are hereby incorporated by reference . other techniques that analysis engine 570 can use are disclosed in various journal articles that are known to one of ordinary skill in the art . for example , the articles “ spectroscopic and clinical aspects of noninvasive glucose measurements ” by omar s . khalil ( clinical chemistry 45 : 2 , 1999 ); “ optical measurement of glucose levels in scattering media ” by gilwon yoon et al . ( proceedings of the 20 th annual international conference of the ieee engineering in medicine and biology society , vol . 20 , no . 4 , 1998 ); and “ multivariate determination of glucose using nir spectra of human blood serum ” by fredric m . ham et al . ( ieee 1994 ), which are hereby incorporated by reference , disclose techniques that the analysis engine 570 may use . fig6 is a flowchart illustrating a method 600 of pattern delivery of radiation and analysis based on reflected radiation . first , low level radiation of a first type is emitted ( 610 ). this radiation can be outside the critical detection range , e . g ., outside the detection range of the return radiation detector assembly 390 , but within the ccd imaging detector 370 detection range . for example , if the return radiation detector assembly 390 detects nir radiation , then the low level radiation can include light emitted by a low level green or blue led . next , the user is advised ( 615 ) to position the device hood 200 b over the object , e . g ., his or her eye . it will be appreciated that the device hood 200 b can be placed over any object having a pattern . further , it will be appreciated that advising ( 615 ) need not be including in method 600 . it will be further appreciated that advising ( 615 ) can be done via aural , visual techniques and / or other techniques ( e . g ., tactile feedback ). after advising ( 615 ), a desired location is examined ( 620 ). for example , the sclera or choroid of an eye 100 can be examined ( 620 ) for one or more blood vessels . next , the desired structure or pattern is identified ( 625 ). if there is a plurality of patterns , the desired pattern can be identified ( 625 ) based on pre - specified parameters , such as thickness , color ( e . g ., red ), and / or length of the pattern . if a pattern is ( 630 ) not identified ( 625 ), then the advising ( 615 ) and examining ( 620 ) is repeated until a suitable pattern is identified ( 625 ). after a suitable pattern is identified ( 625 ), radiation of a second type is emitted ( 635 ) and directed ( 640 ) towards the pattern or structure identified ( 625 ). the radiation may include radiation for testing ( e . g ., spectrum analysis ) and / or ablation and / or coagulation and / or other purposes . if the radiation is for a testing application , then the radiation can include nir radiation . if the radiation is for ablation or coagulation , then the radiation should include higher energy radiation , such as radiation having a wavelength of about 800 nm . the process of examining ( 620 ), identifying ( 625 ) and emitting ( 635 ) is repeated at a frequent rate , such as at 200 times / second such that the radiation tracks any movement of the identified pattern . for example , if eye 100 is moving , the examining ( 620 ), identifying ( 625 ), and emitting ( 635 ) will track the blood vessel 130 and continue to impact radiation onto the blood vessel 130 and / or an area surrounding or near to the blood vessel 130 despite the movement . if ( 640 ) this is a coagulation / ablation process , then emission ( 645 ) is continued for a suitable amount of time according to the application . after emission ( 645 ) is complete , the device 200 is turned ( 650 ) off and method 600 ends . if ( 640 ) this is a testing application , then radiated radiation from the emitting ( 635 ) is collected ( 655 ) and then filtered ( 660 ) to isolate a specific analyte &# 39 ; s spectrum signature . after filtering ( 660 ), a mathematical model is applied ( 665 ) to the filtered data to determine concentration of the analyte . the result is then completed ( 670 ) and output aurally or visually , e . g ., via display 440 . determining analyte concentration , such as glucose concentration , via spectrum analysis is described in u . s . pat . no . 6 , 061 , 582 , which is hereby incorporated by reference . the method 600 then ends . the foregoing description of the illustrated embodiments of the present invention is by way of example only , and other variations and modifications of the above - described embodiments and methods are possible in light of the foregoing teaching . for example , embodiments of the invention can be used for purposes other than glucose monitoring . further , components of this invention may be implemented using a programmed general purpose digital computer , using application specific integrated circuits , or using a network of interconnected conventional components and circuits . connections may be wired , wireless , modem , etc . the embodiments described herein are not intended to be exhaustive or limiting . the present invention is limited only by the following claims . | 0 |
in the broadest aspects , the present invention provides the skilled artisan with the analytical tools and technical know - how sufficient to make and use the disclosed invention . the present invention provides the user with a method and apparatus for oral appliance cleaning and storage . referring to fig1 a through 2 , wherein like elements are indicated by like numerals , an embodiment of the present invention , in its most basic form , is generally indicated by the reference numeral 2 , and comprises storage pouch / cleaning cloth pack packaging , generally indicated by reference numeral 4 , cleaning cloth pack , generally indicated by reference numeral 6 , a storage pouch , generally indicated by reference numeral 8 , and a cleaning cloth , generally indicated by reference numeral 10 . the keep an &# 39 ; clean system is shown in its portable form in fig1 a and in functional form in fig1 b . in further detail , in the preferred embodiment , said keep an &# 39 ; clean system 2 is comprised of storage pouch / cleaning cloth pack packaging 4 , which contains storage pouch 8 and cleaning cloth pack 6 sealed inside . in the preferred embodiment said storage pouch / cleaning cloth pack packaging 4 is approximately two and ½ inches in height and three and ¼ inches in width . other sizes have been contemplated and may be determined by the size of said storage pouch 8 and said cleaning cloth pack 6 and the oral appliance said keep an &# 39 ; clean system is to be used with . said storage pouch / cleaning cloth pack packaging 4 and cleaning cloth pack 6 are made of an airtight waterproof material such as poly - foil . other equivalent substances would also be suitable . identification of equivalents is well within the skill of the ordinary practitioner and would require no more than routine experimentation . in the preferred embodiment , said storage pouch 8 is approximately five inches in width and six inches in height , and is made of polyethylene . other equivalent substances would also be suitable . identification of equivalents is well within the skill of the ordinary practitioner and would require no more than routine experimentation . other sizes have been contemplated and may be determined by the size of the oral appliance said keep an &# 39 ; clean system is to be used with . said storage pouch 8 is sealed on the storage pouch bottom 8 ′ and the storage pouch sides 8 ″. in portable form said storage pouch 8 is folded to be flatly sealed within said storage pouch packaging 4 , as is well known to one of ordinary skill in the art . said storage pouch 8 may be selectively sealable via sealing means as is well known to one of ordinary skill in the art . in the preferred embodiment , said cleaning cloth pack 6 is approximately one and ¾ inches in height and two and ¼ inches in width . cleaning cloth 10 is approximately five inches in height and five inches in width , is made of a non - woven substrate and is moistened with an antiseptic cleaning agent . other equivalent substances would also be suitable . identification of equivalents is well within the skill of the ordinary practitioner and would require no more than routine experimentation . furthermore , it is contemplated in other embodiments of the keep an &# 39 ; clean system and apparatus that said antiseptic cleaning agent includes sanitizing and whiting properties . other sizes have been contemplated and may be determined by the size of the oral appliance said keep an &# 39 ; clean system is to be used with . in portable form said cleaning cloth 10 is folded to be flatly sealed within said cleaning cloth pack 6 , as is well known to one of ordinary skill in the art . fig2 shows a side view of said storage pouch / cleaning cloth pack packaging 4 and said cleaning cloth pack 6 with said storage pouch 8 and said cleaning cloth 10 , respectively , sandwiched between storage pouch / cleaning cloth pack packaging side a 12 and storage pouch / cleaning cloth pack packaging side b 14 , and cleaning cloth pack side a 16 and cleaning cloth pack side b 18 . as previously disclosed , said storage pouch / cleaning cloth pack packaging 4 and said cleaning cloth pack 6 are made of a poly - foil material . other equivalent means would also be suitable . identification of equivalents is well within the skill of the ordinary practitioner and would require no more than routine experimentation . in practice the system works as follows : the user tears open said storage pouch / cleaning cloth pack packaging 4 , removes said cleaning cloth pack 6 and storage pouch 8 , unfolds said storage pouch 8 and places said oral appliance into said storage pouch 8 for storage . when the user is ready to reinsert said oral appliance into the oral cavity , the user tears open said cleaning cloth pack 6 , removes said cleaning cloth 10 , unfolds said cleaning cloth 10 and wipes said oral appliance to clean said oral appliance before reinsertion into the oral cavity . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting of the invention described herein . scope of the invention is thus indicated by the appended claims rather than by the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced herein . | 0 |
the following description is of the best - contemplated mode of carrying out the invention . this description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . fig1 shows an integrated circuit 100 according to an embodiment of the invention . the integrated circuit 100 comprises a plurality of standard cells disposed in a plurality of rows in a semiconductor substrate 110 . in fig1 , the standard cells s 1 - s 11 and the standard cells d 1 - d 3 form a standard cell array 120 , and the standard cells s 1 - s 11 and d 1 - d 3 are arranged in the rows r n - r n + 4 , wherein a n - well 130 is formed in the row r n , a n - well 140 is formed in the row r n + 2 , and a n - well 150 is formed in the row r n + 4 . in one embodiment , the p - wells can be formed in the rows r n + 1 and r n + 3 . specifically , the rows with n - wells ( e . g . r n , r n + 2 or r n + 4 ) and the rows without n - wells ( e . g . r n + 1 or r n + 3 ) are alternately arranged in the semiconductor substrate 110 . furthermore , each of the standard cells s 1 - s 11 is a single height cell having a height sh , and each of the standard cells d 1 - d 3 is a double height cell having a height dh . the height dh is substantially twice the height sh , and the double height cell is capable to provide a high speed operation with high density . furthermore , the double height cell will benefit area and power reduction under low speed application . the layout differences between the single height cell and the double height cell will be described below . fig2 shows an example illustrating a layout diagram of the standard cells s 6 and d 1 of fig1 according to an embodiment of the invention . the standard cell s 6 comprises three pmos transistors mp 61 - mp 63 and three nmos transistors mn 61 - mn 63 . a gate g 61 and a p + doping region pd 6 adjacent to the gate g 61 form the pmos transistor mp 61 , a gate g 62 and the p + doping region pd 6 adjacent to the gate g 62 form the pmos transistor mp 62 , and a gate g 63 and the p + doping region pd 6 adjacent to the gate g 63 form the pmos transistor mp 63 . furthermore , the gate g 61 and an n + doping region nd 6 adjacent to the gate g 61 form the nmos transistor mn 61 , the gate g 62 and the n + doping region nd 6 adjacent to the gate g 62 form the nmos transistor mn 62 , and the gate g 63 and the n + doping region nd 6 adjacent to the gate g 63 form the nmos transistor mn 63 . the standard cell d 1 comprises four pmos transistors mp 11 - mp 14 and two nmos transistors mn 11 - mn 12 . a gate g 11 and a p + doping region pd 1 a adjacent to the gate g 11 form the pmos transistor mp 11 , a gate g 12 and the p + doping region pd 1 a adjacent to the gate g 12 form the pmos transistor mp 12 . the gate g 11 and a p + doping region pd 1 b adjacent to the gate g 11 form the pmos transistor mp 13 , and the gate g 12 and the p + doping region pd 1 b adjacent to the gate g 12 form the pmos transistor mp 14 . it is to be noted that a quantity of the pmos transistors in the p + doping region pd 1 b of the row r n is equal to a quantity of the pmos transistors in the p + doping region pd 1 a of the row r n + 2 . furthermore , the gate g 11 and an n + doping region nd 1 adjacent to the gate g 11 form the nmos transistor mn 11 , and the gate g 12 and the n + doping region nd 1 adjacent to the gate g 12 form the nmos transistor mn 12 . in the rows r n and r n + 2 , the p + doping regions pd 6 , pd 1 a and pd 1 b have the same height ( e . g . w1 ), thus each gate of the pmos transistors in the standard cell s 6 and each gate of the pmos transistors in the standard cell d 1 have the same width w1 . in the row r n + 1 , a height ( e . g . w3 ) of the n + doping region nd 1 is at least twice a height ( e . g . w2 ) of the n + doping region nd 6 , thereby each gate of the nmos transistors in the standard cell d 1 has at least twice width of each gate of the nmos transistors in the standard cell s 6 , i . e . w3 ≧ 2 × w2 . fig3 shows a schematic illustrating a relationship between the track number and the packing density of the double height cell and the single height cell according to an embodiment of the invention , wherein the track number is used to represent a height of a standard cell . in fig3 , curve 310 represents a property of the single height cell , and curve 320 represents a property of the double height cell . if comparison is made with the same packing density ( e . g . pden ), the double height cell has a larger track number than that of the single height cell , i . e . n2 & gt ; n1 . thus , the double height cell is good for power , area and timing optimization . fig4 shows an example illustrating a layout diagram of the standard cells d 1 , d 3 and s 8 of fig1 according to an embodiment of the invention . the standard cell d 1 has be described in fig2 . in the standard cell s 8 , a gate g 81 and a p + doping region pd 8 adjacent to the gate g 81 form a pmos transistor in the row r n + 2 , and the gate g 81 and an n + doping region nd 8 adjacent to the gate g 81 form an nmos transistor in the row r n + 3 . in the row r n + 2 , the p + doping regions pd 1 a and pd 8 have the same height ( e . g . w1 ), thus each gate of the pmos transistors in the standard cell d 1 and the gate of the pmos transistor in the standard cell s 8 have the same width w1 . the height ( e . g . w3 ) of the n + doping region nd 1 in the row r n + 1 is at least twice the height ( e . g . w2 ) of the n + doping region nd 8 in the row r n + 3 , thereby each gate of the nmos transistors in the standard cell d 1 has at least twice width of the gate of the nmos transistor in the standard cell s 8 , i . e . w3 ≧ 2 × w2 . furthermore , in the standard cell d 3 , the gates g 31 - g 34 and the p + doping region pd 3 adjacent to each gate form a plurality of pmos transistor in the row r n + 2 . furthermore , the gates g 31 - g 34 and the n + doping region nd 3 a adjacent to each gate form a plurality of nmos transistors in the row r n + 3 , and the gates g 31 - g 34 and the n + doping region nd 3 b adjacent to each gate form a plurality of nmos transistors in the row r n + 1 . it is to be noted that a quantity of the nmos transistors in the n + doping region nd 3 b of the row r n + 1 is equal to a quantity of the nmos transistors in the n + doping region nd 3 a of the row r n + 3 . in the row r n + 2 , the height ( e . g . w4 ) of the p + doping region pd 3 is at least twice the height ( e . g . w1 ) of the p + doping region pd 8 , thereby each gate of the pmos transistors in the standard cell d 3 has at least twice width of each gate of the pmos transistors in the standard cell d 1 , i . e . w4 ≧ 2 × w1 . in the row r n + 1 , the height ( e . g . w3 ) of the n + doping region nd 1 is at least twice the height ( e . g . w2 ) of the n + doping region nd 3 b , thereby each gate of the nmos transistors in the standard cell d 1 has at least twice width of the gate of the nmos transistor in the standard cell d 3 , i . e . w3 ≧ 2 × w2 . while the invention has been described by way of example and in terms of the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . on the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 7 |
fig1 is a cross - sectional view of a printed circuit board 10 that comprises a carrier part 11 that has a dielectric material 12 having a given dielectric index εr disposed thereon . the illustrated circuit board has , for instance , two mutually parallel conductors 14 embedded in the dielectric material . crosstalk between these conductors is determined by the mutual capacitance 15 ( cm ) between the conductors , and the capacitances 13 ( c ) between respective conductors and the carrier part , which is used as the earth plane . a high capacitance c between respective conductors and the earth plane , and a low capacitance cm between two mutually adjacent conductors are necessary in order to restrict the electromagnetic field to the space between said conductors and the earth plane . fig2 illustrates a first preferred embodiment of an inventive printed circuit board . similar to the circuit board of fig1 the printed circuit board shown in fig2 includes a supportive earth plane 21 on which a layer of dielectric material 22 has been provided . in the illustrated case , two conductors 24 are embedded in the dielectric material . in this embodiment , a high capacitance c is achieved between conductors 24 and the earth plane 21 , by reducing their distance to the earth plane . this is achieved by placing a layer 23 of conductive material directly on the earth plane 21 , in the space beneath the conductors 24 . the layer 23 is provided with a raised surface that extends above the earth plane 21 and across said layer . as shown in fig2 the inventive concept can vary in different alternative embodiments . these alternatives are primarily concerned with the design of the space between the conductors and the design of the conductors themselves . fig3 illustrates an alternative embodiment in which the space between the conductor 34 and the conductor 33 arranged on the earth plane 31 is filled with a dielectric material 35 that has a higher dielectric index εr 2 than the other dielectric material 32 on said earth plane , which has a low dielectric index εr 1 . this results in a further increase in capacitance . the space between the conductors 34 and the conductors 33 arranged on the earth plane can be filled completely with a layer of said high - index dielectric material 35 . however , it is beneficial for this layer 35 to be narrower than the conductors . this enables a major part of the electric field to be tied down to a narrow space beneath each conductor . this is particularly beneficial at high signal frequencies where the currents are mainly led proximal to the outer edges of the conductors . in a preferred embodiment of the invention , the width d of this high - index dielectric material is dimensioned in accordance with the formula d & lt ;( w − 2δ ), wherewith δ signifies the accepted penetration depth for current in a conductor , and w is the width of the conductor . in the fig3 embodiment , the layer 35 of high - index dielectric material has been disposed symmetrically with respect to the symmetry axis ( not shown ) of the conductors . this is the preferred embodiment in the case of conductor carriers that carry a plurality of mutually juxtaposed conductors . fig4 shows as a special case a printed circuit board 40 that has only two conductors 44 . in this regard , a conceivable modification is one in which the coupling between the electric fields of respective right - hand and left - hand conductor pairs 43 / 44 is reduced simply by increasing the distance between the layers 45 of high dielectric material disposed between the aforesaid pairs of conductors 43 / 44 . these layers 45 are displaced slightly , so that the layer beneath the right - hand conductor pair 43 / 44 will be offset slightly to the right and the layer beneath the left - hand conductor pair 43 / 44 offset slightly to the left in respect of the symmetry axes 46 of respective conductor pairs . the design of the conductors 23 arranged directly on the earth plane can also be modified within the scope of the inventive concept . for instance , the conductors 23 may have a rectangular cross - sectional shape or may have the same cross - sectional shape as that of the conductors 24 . in order to tie down the electric field to within , if possible , a narrow space between the conductors 23 / 24 the conductors 23 are arranged directly on the earth plane 21 in the preferred embodiment , such that the thickness of each conductor decreases towards the outer extremities thereof in a direction parallel with the earth plane . this embodiment may also be combined with a high - index dielectric material in the space between the conductors 23 / 24 . the present invention can also be applied to advantage in other applications . fig5 illustrates by way of example the inventive arrangement incorporated in a microstrip conductor 50 . a microstrip conductor has two earth planes 51 and 57 and a first conductor structure 54 embedded in first dielectric material 52 disposed between said earth planes . a second conductor structure 53 is arranged on a first earth plane 51 and a third conductor structure 56 is arranged on the second earth plane 57 in a corresponding manner . these conductor structures 53 and 56 form raised surfaces across respective earth planes which are overlapped by the first conductor structure . thus , a high capacitance c is achieved between the conductors 54 and the earth plane 51 and the earth plane 57 respectively , by reducing the distance between the conductors 54 and respective earth planes 51 and 57 . in order to concentrate the electric field within , if possible , a narrow space beneath the conductors , the conductors 54 and 56 arranged directly on the earth planes 51 and 57 are formed so that the thickness of each conductor decreases towards the outer extremities thereof in a direction parallel with the earth planes . the space between the conductors 54 and the conductors 53 arranged on the earth planes 51 and 57 can be filled with a dielectric material 55 that has a higher dielectric index εr 2 than the remaining dielectric material 52 , which has a low dielectric index εr 1 . this results in a further increase in capacity . fig6 a - 6 c , 7 a - 7 d , 8 a - 8 e and 9 a - 9 f describe four methods of manufacturing a printed circuit board that includes the inventive arrangement . a printed circuit board according to respective fig2 and 3 is produced by means of an offset printing process illustrated in fig6 and 7 . fig8 and 9 demonstrate the manufacturing steps entailed in producing a printed circuit board according to fig3 while using a photosensitive dielectric material . fig6 a - 6 c describe the manufacture of a printed circuit board solely with dielectric material . in a first step ( fig6 a ), a first conductor structure 62 is printed directly on the carrier base part 61 , which functions as a circuit board earth plane . a layer 63 of dielectric material is then printed on the base part 61 and on the conductor structure 62 ( fig6 b ). in a last step ( fig6 ), a second conductor structure 64 is printed onto said dielectric material such that the second conductor structure will overlap the first conductor structure in respect to their cross - directions . thus , the desired increase in capacitance between the conductor 64 and the base part 61 that functions as an earth plane is achieved by reducing the thickness of the dielectric material 63 in the space 65 between the conductors . this is achieved by changing the thickness of the conductors 62 in correspondence with the capacitance that shall be obtained between the conductors 62 and 64 . fig7 a - 7 d describe a method of manufacturing a printed circuit board that includes two different dielectric materials . as described above , the desired conductor structure 72 is printed directly on the carrying base part 71 ( fig7 a ). a layer 73 of one high dielectric material ( fig7 b ) is then printed onto these conductors 72 , whereafter the remaining part of the base part 71 is coated with a layer of another dielectric material , preferably a material that has a low dielectric index εr ( fig7 c ). in last step ( fig7 d ), a second conductor structure 74 is printed on this dielectric material in a manner such that the second conductor structure will overlap the first conductor structure in respect of their cross - directions . fig8 a - 8 e describe a first method of manufacture using photosensitive dielectric material . a first conductor structure 82 ( fig8 a ) is applied to a carrying base part 81 . this is done in a well - known manner , which is not shown explicitly . for example , the base part 81 is covered with a protective layer with the exception of apertures provided therein , these apertures then being filled with a conductive material so that the conductor structure 82 will be obtained when the protective layer is removed . the base part 81 and the conductor structure 82 are then covered with a photosensitive high dielectric varnish 83 ( fig8 b ), whereafter a layer 84 is exposed over said first conductor structure 82 ( fig8 c ) by photolithography . a second conductor structure 85 ( fig8 d ) is then applied on the layer 84 by plating said layer . the complete structure is finally covered with a layer 86 of another dielectric material , preferably a material that has a low dielectric index εr ( fig8 e ). fig9 a - 9 f describe an alternative method of manufacture in which a photosensitive dielectric material is used . the base part 91 and the first conductor structure 92 are first covered with a layer 93 of photosensitive high dielectric varnish ( fig9 b ). this layer 93 is then surface - plated with a copper layer 94 prior to developing the layer 93 ( fig9 c ). the layer 94 is patterned in a following step , so as to obtain a second conductor structure 95 , said second conductor structure 95 overlapping the first conductor structure 93 in the cross - direction of said conductors ( fig9 d ). as opposed to the method described in fig8 this method of manufacture is characterised in that the layer 95 can then be used as a pattern transfer medium for developing the high dielectric material 93 so that said material will then be found solely in the spaces between conductor structure 92 and 95 ( fig9 e ). the resultant structure is finally covered with a layer 97 of another dielectric material , preferably with a material that has a low dielectric index εr ( fig9 f ). fig8 a - 8 e and 9 a - 9 f relate to methods of manufacturing a printed circuit board according to fig3 . it will be readily understood , however , that the arrangement according to fig2 can also be produced by the methods described in these figures . it will also be understood that the invention is not restricted to the aforedescribed and illustrated embodiments thereof , and that modifications can be made within the scope of the accompanying claims . | 7 |
before describing the embodiments of the present invention , the related art and the disadvantages therein will be described with reference to the related figures . fig1 is a view of typical data communication network to which the present invention is preferably applied . in fig1 remote offices ( illustrated at left and right sides of fig1 ) are connected by , for example , a private inter - city line (&# 34 ; transmission . each of the offices has various communication apparatuses , such as data terminal equipment ( te ), a private branch exchange ( pbx ), a facsimile unit ( fax ), a tv camera and a video display ( dsp ) both commonly connected to a switch ( sw ), and the like , as illustrated in fig1 . the variety of data of these communication apparatuses are integrated by a time division multiplexer ( tdm ) so as to commonly use the single transmission line . the tdm , in general , also includes therein a demultiplexing means so as to attain two - way data communication . the present invention relates to the tdm , and more particularly to a system for transferring data between blocks which comprise the tdm . fig2 illustrates a schematic front view of a time division multiplexer . in fig2 the time division multiplexer tdm is formed as a locker having a plurality of shelves sh &# 39 ; s . each shelf sh forms a block . in the figure , n number of blocks 10 - 1 , 10 - 2 through 10 - n are formed . the data in the tdm is transferred between the blocks ( 10 ) via a two - way data bus 13 through respective input / out ( i / o ) ports . at the i / o ports , respective two - way gate circuits 11 - 1 , 11 - 2 through 11 - n are located together with the corresponding transfer controlling units 12 - 1 , 12 - 2 through 12 - n . the two - way gate circuits ( 11 ) are connected to the corresponding circuit cards ( cc ) of the associated block via a corresponding internal bus ( 14 ). the circuit cards cc play various roles as , for example , an interface unit . one of the circuit cards cc in the block 10 - 1 cooperates with , for example , a private transmission line . one of the circuit cards cc in the block 10 - 2 cooperates with , for example , a data terminal equipment ( te ) and one of the circuit cards cc in the block 10 - n cooperates with , for example , a private branch exchange ( pbx ). in the example , a common control unit 15 , formed as a circuit card cc , is located on the bottom shelf sh . incidentally , the card cc may freely be added or removed according to needs or a change of the number of line channels . fig3 is a general block diagram of a time division multiplexer set up with a prior art system for transferring data between the blocks . in fig3 members identical to those explained before are represented by the same reference numerals and characters ( and the same for later figures ). the time division multiplexer ( tdm ) is represented by reference numeral 31 . the tdm 31 is connected with , for example , data terminal equipment ( te ) 32 and a private branch exchange 33 which is provided with telephone sets 34 . these communication apparatuses , e . g ., te 32 , pbx 33 , and the like , and the transmission line are introduced into the tdm 31 via respective peripheral interface units 39 - 2 through 39 - n and a line interface unit 39 - 1 , which are formed as the circuit cards cc . the blocks 10 - 1 , 10 - 2 , through 10 - n , the two - way gate circuits 11 - 1 , 11 - 2 through 11 - n , the transfer control units 12 - 1 , 12 - 2 through 12 - n , the two - way data bus 13 and the common control unit 15 were explained before ; however , the internal buses ( see 14 - 1 , 14 - 2 through 14 - n in fig2 ) are not illustrated in fig3 for brevity . the block 10 - 1 receives data , which is transferred thereto via the two - way data bus 13 from the blocks 10 - 2 through 10 - n , and then multiplexes the same at the two - way gate circuit 11 - 1 . the multiplexed data is output to the transmission line via the line interface unit 39 - 1 . the multiplex operation can be achieved by use of the gate circuit 11 - 1 under suitable gate timing control . therefore , the gate circuit 11 - 1 can also demultiplex the multiplexed data received via the transmission line and the demultiplexed data is then distributed to the blocks 10 - 2 through 10 - n . fig4 is a circuit diagram of prior art gate circuits and the transfer control unit . in fig4 the two - way gate circuit 11 ( 11 is representative of each of 11 - 1 through 11 - n of fig3 ) is comprised of a plurality of bus drivers 41 - 1a to 41 - ka and 41 - 1b to 41 - kb . the transfer control unit 12 ( 12 is representative of each of 12 - 1 through 12 - n of fig3 ) comprises an inverter 42 . the bus drivers 41 - 1a through 41 - ka and bus receivers 41 - 1b through 41 - kb are activated complementarily by the inverter 42 . which side , a or b , is to be activated is determined by a direction control unit 43 which receives an external command (&# 34 ; ext . cmnd &# 34 ;) given from the common control unit (&# 34 ; ccu &# 34 ;) 15 . if the unit 43 produces logic &# 34 ; h &# 34 ;, all the bus drivers 41 - 1a through 41 - kb are activated simultaneously , and the data of k ( refer to reference character k which is , for example , 8 ) bits passes from the data bus 13 to the external bus 14 . contrary to the above , if the unit 43 produces logic &# 34 ; l &# 34 ;, all the bus receivers 41 - 1b through 41 - 1kb are activated simultaneously , and the data of k bits passes from the internal bus 14 to the data bus 13 . the above - explained prior art system ( 41 - 1a through 41 - 1k , 41 - 1b through 41 - kb , 42 and 43 ) produces , however , the previously mentioned three problems . fig5 is a principle circuit diagram of a system for transferring data between the blocks according to the present invention . in general , the system of fig5 is constructed such that the plural ( e . g ., 8 ), parallel bit lines of the two - way data bus 13 can freely be separated for use . that is , the system of fig5 is comprised of : a plurality of the blocks 10 - 1 through 10 - n , each including therein at least one two - way gate circuit ( 11 ) including a plurality of transfer gates ( 51 ), at its input / output port ( fig2 ), and internal circuit cards ( cc in fig2 ); the two - way data bus 13 for transferring data between any two or more of the blocks ( 10 ) via their respective input / output ports ; a plurality of transfer control means ( 52 ), provided for the respective blocks ( 10 ), each transfer control means ( 52 ) being operative in response to an external command ec , to control the transfer gates ( 51 ) independently such that both the number of bits of data , and the direction of the transfer thereof , to be handled at each gate circuit ( 11 ) transfer gates ( 51 ), by the respective are determined individually . that is , thereof , the transfer gates 51 - 11 , 51 - 12 through 51 - 1k of the two - way gate circuit 11 - 1 can be controlled individually by the transfer control means 52 - 1 . for example , some bit lines of the two - way data bus 13 are used for the data transfer between the blocks 10 - 1 and 10 - 2 . at the same time , the remaining bit lines of the data bus 13 are used for the data transfer between the blocks 10 - 1 and 10 - n . in this case , the direction of the data transfer can also be specified , bit by bit , for the respective bit line . the direction may be from the bus 13 to the bus 14 or from the bus 14 to the bus 13 . accordingly , the data bus 13 can be utilized with high efficiency . fig6 shows a wiring diagram between the transfer gates and the transfer control means . the wiring diagram is illustrated with respect to the two - way gate circuit 11 - 1 and the corresponding transfer control means 52 - 1 both in the block 10 - 1 , and as representative of the blocks 10 - 1 through 10 - n . the common control means 65 is commonly connected to the transfer control means 52 - 1 , 52 - 2 through 52 - n and supplies the external commands ec thereto , respectively . the transfer gates 51 - 11 through 51 - 1k are comprised of the bus drivers and bus receivers , 41 - 1a , 41 - 1b , 41 - 2a , 41 - 2b . . . 41 - ka , 41 - kb , respectively . the bus drivers 41 - 1a to 41 - kb and the bus receivers 41 - 1b to 41 - kb are connected in parallel between the two - way data bus 13 comprised of k data bit lines 13 - 1 through 13 - k and the internal bus 14 - 1 , of a corresponding number of data bit lines , and which is distributed in the block 10 - 1 and connected to the internal circuit cards cc , as explained in fig2 . incidentally , reference numeral 66 represents a console . fig7 is a block diagram of an example of the transfer control means . in fig7 the transfer control means 52 - 1 is illustrated , as representative of the identical means 52 - 1 through 52 - n . the transfer control means 52 - 1 is comprised of both a memory 72 and an interface unit 71 . the interface unit 71 is connected to the common control means 65 to receive the external command ec and stores the same in the memory 72 , which has output ports 73 - 1 through 73 - n for producing control signals to be given to the bus drivers and bus receivers 41 - 1a , 1b , 41 - 2a , 2b , . . . 41 - ka , kb individually . the memory 72 is implemented , in the example , by a random access memory ( ram ). the common control means 65 manages the work of the blocks 10 - 1 through 10 - n and , sometimes , receives a time schedule for using a particular communication apparatus , such as a tv camera , from the console 66 given by a system manager . thus , an overall time schedule for operating the blocks is transformed into control signals in the common control means 65 and the control signals are stored in time series in the memory ( ram ) 72 . the control signals specify three gate modes which will be explained below . each of the transfer gates ( 51 ) is operated such that three gate modes are selectively performed , i . e ., in a first gate mode , the bus driver is activated but the bus receiver is not activated , in a second gate mode , the bus receiver is activated but the bus driver is not activated , and in a third gate mode , the bus driver and bus receiver are both not activated . ( i ) in one block ( 10 ), some transfer gates ( 51 ) are operated in the first gate mode by using some bits of the two - way data bus 13 , while in another block some corresponding transfer gates are operated in the second gate mode by using the same bits of the two - way data bus 13 . ( ii ) in paragraph ( i ), the remaining transfer gates ( 51 ) are operated in one of the first , second and third gate modes . ( iii ) in one block ( 10 ), some transfer gates ( 51 ) are operated in the second gate mode in association with some bit lines of the two - way data bus 13 , while in another block , some transfer gates ( 51 ) are operated in the first gate mode , which latter gates are associated with the same bit lines of the two - way data bus 13 . ( iv ) in one block ( 10 ), some transfer gates ( 51 ) are operated in the third gate mode , and the remaining transfer gates ( 51 ) are operated in one of the first , second and third gate modes , and in this first or second gate mode , the remaining transfer gates ( 51 ) are connected with corresponding transfer gates in another block ( 10 ) operating in the second or first gate mode , respectively , and associated with the same , respective bit lines of the two - way data bus 13 . ( v ) in paragraph ( iv ), when all the transfer gates ( 51 ) in one block ( 10 ) are operated in the third gate mode , this block handles data to be transferred , solely , via the internal bus ( 14 ) between the circuit cards cc . fig8 depicts timing charts for explaining the individual control of the transfer gates . note here that , in fig8 only the bus drivers 41 - 1a through 41 - 8a ( fig6 ), assuming that 8 - bit data buses 13 - 1 through 13 - 8 ( k = 8 ) comprise the two - way data bus 13 , are referred to for brevity . in fig8 rows ( 1a ) through ( 8a ), which correspond to the bus drivers 41 - 1a through 41 - 8a , respectively , exhibit control signals from the transfer control means , for example , 52 - 1 ( fig7 ). in fig8 during time t1 , only the bus drivers 41 - 1a through 41 - 4a are activated ( on ), and therefore , 4 - bit parallel data can be output to the data bit lines 13 - 1 through 13 - 4 . during a time t2 , only the bus drivers 41 - 5a through 41 - 8a are activated , and therefore , 4 - bit parallel data can be output to the data bit lines 13 - 5 through 13 - 8 . during a time t3 , the bus drivers 41 - 1a through 41 - 8a are all activated , and therefore , 8 - bit parallel data can be output to the data bus 13 . during a time t4 , the bus drivers 41 - 1a through 41 - 8a are not activated ( off ), and therefore the data bit lines 13 - 1 through 13 - 8 are not occupied by the related block 10 - 1 , but can be requested by another one ( or more ) of the blocks 10 - 2 through 10 - n . during a time t5 , only the bus driver 41 - 1a is activated , and therefore , 1 - bit data is output to the data bit line 13 - 1 . as understood from the above explanation , each transfer gate 51 assumes three on - off combination states c1 , c2 and c3 shown in the following table . ______________________________________transfer gate ( 51 ) c1 c2 c3______________________________________bus driver ( 41 - 1a , . . . - ka ) on off offbus receiver ( 41 - 1b , . . . - kb ) off on off______________________________________ the present invention is featured by the state of column c3 , i e ., off - off ( aforesaid third mode ). incidently , on - on state cannot exist because of the possibility of collision of input ( receiving ) data and output ( sending ) data on the same 1 - bit data bit line . fig9 a and 9b are diagrams of bit allocation on the 8 - bit data buses for schematically explaining an advantage of the present invention . the bit allocation on the left side is based on the prior art technique , while the bit allocation on the right side is based on the present invention . provided that two different 4 - bit parallel data α and β are to be transferred on the data bus , according to the prior art ( left side and fig9 a ), the 4 - bit parallel data α is transferred at a time t j by using the 8 - bit data buses ( bit 1 through bit 8 ), and then the other 4 - bit parallel data β is transferred during a time t j + 1 by using the same bit lines , but in successive time slots . on the other hand , according to the present invention ( right side and fig9 b ), the data α and data β can be transferred during the same time t j by using the upper 4 - bit data bit lines ( bit 1 through bit 4 ) and the lower 4 - bit data bit lines ( bit 5 through bit 8 ), respectively . this means that , during the time t j + 1 , two ( 4 - bit ), or one ( 8 - bit ) parallel data other than the data α and β , can be transferred . thus , the data bus 13 can be utilized with high efficiency . the data α and β are , for example , speech signal elements , each composed of a 4 - bit pcm code . speech data has previously been composed of 8 - bit pcm code . however , due to developments in this field , the number of bits comprising the pcm coded speech signal is halved to 4 - bits . thus , the present invention is advantageous in dealing with such compressed digital data . alternately , the data α and / or β may be low transmission speed digital data , each of which can be composed of a small number of bits less than 8 . fig1 is a block diagram showing an example of the common control means . in fig1 , the common control means 65 ( fig6 ) is constructed in the form of a usual microprocessor system . that is , the common control unit 65 is primarily composed of a microprocessor unit ( mpu ) 81 , a read - only memory ( rom ) 82 and ram 83 . fig1 is a general flow chart of a process handled by the common control means . in fig1 , first , an input is started by the console 66 . also , input of transfer conditions between the cards ( cc ) of one block ( 10 ) and the cards ( cc ) of another block ( 10 ), is effected from the console 66 to the common control means 65 . the cards ( cc ) are the aforesaid circuit cards , such as a card for a multiplexing process , a card for a code conversion process , and the like . the term &# 34 ; transfer conditions &# 34 ; means the aforesaid number of bits of data and a direction of transfer thereof . at step &# 34 ; 1 &# 34 ;, the common control means 65 reads the input of the related request conditions . at step &# 34 ; 2 &# 34 ;, the common control means 65 processes the related input data to be given to each of the transfer control means 52 - 1 , 52 - 2 through 52 - n . to be specific , the common control means 65 determines the aforesaid first through third gate modes in terms of time slots for each transfer gate ( 51 ), in such a manner as to avoid any occurrence of a collision between data on each of data bit lines 13 - 1 through 13 - k . at step &# 34 ; 3 &# 34 ;, the thus determined data are supplied to each transfer control means ( 52 ) and stored in respective memories 72 ( fig7 ). thus , each transfer control means ( 52 ) controls the on - off state of the bus driver and the bus receiver in each transfer gate ( 51 ). it should be understood here that , in actuality , the aforesaid input request conditions are not specified call - by - call , but periodically , for example , day - by - day or hour - by - hour . fig1 a and 12b together comprise a detailed block diagram of an example of a multiplexer to which the present invention can be adapted . in fig1 , the following members have already been explained , i . e ., the blocks 10 - 1 , 10 - 2 , 10 - 3 , the two - way gate circuits 11 - 1 , 11 - 2 , 11 - 3 ( including the transfer gates ( 51 )), the two - way data bus 13 , the internal buses 14 - 1 , 14 - 2 , 14 - 3 , the time division multiplexer 31 , and the transfer control means 52 - 1 , 52 - 2 and 52 - 3 . newly disclosed members are expansion . compression processing units 93 - 1 , 93 - 2 , 93 - 3 , interface units 94 - 11 . . . 94 - 1m , 94 - 21 . . . 94 - 2m , and line interface units 97 - 1 and 97 - 2 . all the members , except for the internal buses ( 14 ), are constructed in the form of circuit cards cc as shown in fig2 . the common control means ( see 65 in fig6 ) is omitted in fig1 . the interface units ( 94 ) are connected to the various communication apparatuses ( refer to te , pbx , fax , tv shown in fig1 ), by way of an exchange ( not shown ). the expansion / compression processing unit ( 93 ) compresses speech data of 64 kbps pcm codes into 32 kbps pcm - code speech data and alternatively expands the speech data of 32 kbps pcm codes into 64 kbps pcm - code speech data . these speech data are transferred between the corresponding interface unit ( 94 ) and the i / o port via the internal bus ( 14 ) and sent to or received from the data bus 13 . in the block 10 - 3 , the data , to be transmitted to the remote office , is transferred , under control of the path setting unit 96 according to call control information , from the i / o port to the corresponding line interface unit ( 97 ) via the internal bus 14 - 3 , and then output to the transmission line . contrary to this , the data transmitted from the remote office , is received at the corresponding line interface unit ( 97 ) and applied , via the internal bus 14 - 3 , to the path setting unit 96 in which the received data is processed according to call control information . the thus processed data is output , via the i / o port , to the two - way data bus 13 and distributed to a related block ( 10 ). in the blocks 10 - 1 and 10 - 2 , the compressed data of 32 kbps are applied to the expansion / compression processing units 93 - 1 , 93 - 2 via the internal buses 14 - 1 , 14 - 2 , respectively . at the units 93 - 1 , 93 - 2 , the received data are expanded into 64 kbps pcm - code data and then applied , via the internal buses 14 - 1 , 14 - 2 , to the interface units ( 94 ). the path setting unit 96 supervises the series of time slots which are cyclicly allotted to the data channels . the signals of respective data channels are inserted or taken out at every specified time slot . this is referred to as a path setting which is not new but common in this field . fig1 depicts an example of a data transfer achieved in fig1 . in fig1 , during a time t2 ( this t2 has nothing to do with t2 in fig8 ), half data lines of the two - way data bus 13 are used for transferring data α1 from the block 10 - 1 . during the same time t2 , the remaining half of the data lines of the bus 13 are used for transferring data β1 from the block 10 - 2 . also during the same time t2 , the block 10 - 3 receives both the data α1 and β1 simultaneously sent from the blocks 10 - 1 and 10 - 2 , respectively . it should be noted here that the directions of the data transfers may be reversed . that is , the block 10 - 3 may transmit the data α1 and β1 , and the blocks 10 - 1 and 10 - 2 may receive the data α1 and β1 , respectively . during a time t3 , all the bits of the data bus 13 are used for transferring data α2 between the blocks 10 - 1 and 10 - 3 . during a time t4 , all the bits of the data bus 13 are used for transferring data β2 between the blocks 10 - 2 and 10 - 3 . as mentioned above , during the time t2 , the transfer gates ( 51 ) in each of the blocks 10 - 1 through 10 - 3 can be individually controlled so that different data can be handled at the same time as depicted in fig9 b . accordingly , it is also possible to insulate the internal bit lines of the respective buses 14 - 1 through 14 - 3 of the blocks 10 - 1 through 10 - 3 from the data bus 13 and thereby to operate these blocks independently of each other ( i . e ., third gate mode ). this produces an advantage in that the throughput of each block is prevented from being reduced even if an internal operation in each block increases due to , for example , frequent data transfer between the circuit cards cc in the same block , via the expansion / compression processing unit ( 93 ). a further advantage is that a high speed data transfer can be achieved by the use of all bits of the data bus 13 , and on the other hand , a low speed data transfer of a plurality kinds of information can be achieved simultaneously by dividing the bits of the data bus 13 . thus , the data bus 13 can be utilized with high efficiency by the blocks 10 - 1 , 10 - 2 and 10 - 3 . as explained above in detail , the present invention makes it possible to control the transfer gates ( 51 ) individually under control of the transfer control means ( 52 ). this enables a variety of data transfer modes with respect to the number of bits of data and the direction of transfer of each data bit to be transferred , and accordingly , highly efficient data transfers between the blocks ( 10 ) can be attained . this means that the present invention is suitable for multiplexers in a multi - media data communication system which deals with high speed and low speed data , for increasing the number of channels to be accommodated therein , as much as possible . | 7 |
one embodiment of the present , invention provides a system and method to remove noise from focal plane arrays ( fpa ). two types of noise are addressed by the embodiments of the present invention : column noise and row noise . column noise is the appearance of vertical streaks in imagery . the vertical streaks occur because the average light intensity level of each column in the array is different . this type of noise may occur in uncooled ir focal plane arrays and other area image detectors . the column intensity offsets of the array vary temporally and are also uncorrelated temporally so that these offsets cannot be removed by a factory calibration but are required to be corrected on the fly independently for each image frame . in order for the fpa to be used for live video , the column noise must be removed in real time and with a small enough processing delay so as not be noticeable by the viewer of the video . in order for the column noise reduction system to be used for portable video cameras , the system must be amenable to a simple implementation on a minimal amount of hardware such as a single ic or fpga . the system of one embodiment , of the present invention shall operate on single image frames . the system , in one embodiment , estimates the column noise offset correction of a column by the difference of the average intensity level of the column compared to the average intensity of its neighboring columns . however , images typically have a smaller number of bright objects within a relatively uniform background . the bright objects will distort the column averages and appear to bleed into the background if the straight forward implementation of column averages were to be applied . embodiments of the claimed invention modify the method of column averages by separating out the background and applying the method only to the parts of columns in the image background . in one embodiment of the claimed invention , the system shall operate on video outputs that are read in raster format , i . e . one row at a time . as a row of video is read , an estimate of the column offset correction will be calculated and a count the number of rows for which valid offsets were calculated . the final column offset correction is the average of the valid offsets for the column being considered . for each row and a particular column , a certain number of columns to the left and right of the particular column are examined . the certain number of columns to be considered , which is a number such as eight on each side of the particular column , depends the noise level of the detector and the amount of averaging that is desired . a column offset estimate wall be calculated only if the difference between the maximum and minimum intensity is below a certain threshold ( to be determined below ). the estimated column offset is the difference between the average of the neighboring column pixels and the particular column being considered . the restriction to only columns whose neighbors and itself are within a certain tolerance is to ensure that only background pixels are used in the column offset estimation . one embodiment of the present invention has a piped - lined implementation suitable for ics or fpgas . a block diagram of the piped - line cnr system is shown in fig1 . the input to the system is raster format video 12 . the system calculates column offsets on one pass 14 and applies the offsets on a next pass of the data 16 . since applying offsets takes a negligible amount of time and can be overlapped with other unrelated processing , the system , in one embodiment delays the imagery by one frame . the video data enters a delay line 18 whose length is one more than the number of neighboring columns to evaluate . from the contents of the delay memory , the maximum , minimum , mean value and the center column intensity are calculated 20 . all of these calculations can be done pipelined with standard processing . an addition delay line 22 is used to hold the accumulated offset estimates and the count of the valid estimates . the size of the memory for this delay line 22 is the number of columns in the video data . when the difference 24 between the maximum and the minimum of the first delay line is under the tolerance , then the difference between the mean and the center column pixel is added to the accumulated offset estimates and further the count of valid estimates for the column is incremented 26 . if the difference between max and rain is out of tolerance , then the accumulated offset estimate and count is left unchanged . after all rows have been processed , then for the columns for which there are a minimum number of counts , the accumulated sum of offsets is divided by the total number of counts and stored in memory 28 . since the divisor is at most the number of rows in a frame , the division by count can be done as a multiply by table lookup . likewise the average column intensities in the first step can be calculated by multiplying by the inverse of the number of neighborhood columns or rows 46 , as illustrated in fig4 with regard to row intensity . alternatively , a power of two number of columns may be used so that the divide to calculate means can be implemented as a shift . the memory requirements for the processing are one frame of data for downstream processing , two row lengths of memory for accumulated offset estimates and the offset to be applied on the next pass and the length of the first delay line of neighboring columns . a tolerance value is used in one embodiment of the present invention to determine when a group of pixels are all background pixels . the tolerance valued used by one embodiment of the present invention is determined from the image histogram . the performance of one embodiment of the present invention depends weakly on the tolerance value used and is slowly varying with time . therefore , the tolerance can be calculated slowly as a background process with minimal computational load and without loss of performance . the first step in calculating the tolerance value is to form a histogram of pixel intensities . the intensity at which the histogram is peak is found . then the tolerance is set to the width of the histogram peak at nominally 50 % of the peak height . the tolerance is not allowed to fall below a minimum threshold level . the ratio of the width level to the peak level is set base on the particular noise characteristics of the fpa for which it is to be used . care must be taken not to confuse single peak with double peaks and set the tolerance excessively high . as illustrated in fig2 , the row noise reduction embodiment uses the same idea as the column noise reduction system but is modified in order that it may be pipelined for raster video input data 12 . the row noise reduction embodiment uses the same tolerance value derived from image histograms that one embodiment of the present invention uses . the system uses a collection of first order low pass filters , one for each column 30 . the low pass filters are initialized to the intensities of the first row . in addition , an array of counts 32 of the number of valid filter updates is initialized to one for all columns . the system proceeds to process the video data one row at a time . a row of video data is input and the difference 34 between the current column filter values and the current column intensity is calculated . for each column , the following processing carried out . if the magnitude of the difference between the current filter output and the current pixel value 36 is under the tolerance value then the filter is updated and the count of valid updates 32 is incremented by one . on the other hand , if the magnitude of the difference between current filter output and current pixel value is above the tolerance , the filter is reset 38 to the current pixel value and the count of valid pixels is reset to one . a count 40 is made of the number of columns for which the number of valid filter updates exceeds a certain value . if in one embodiment , illustrated in fig3 there are number of columns 42 for which the number of valid filter updates exceeds a certain value , for instance 5 columns , then the difference between the pixel values of the current and previous row is averaged for all the columns that have their number of valid filter inputs exceeding the preset value . this average is added to the accumulated sum of previous row differences . if there were too few rows to compute the average difference , then the accumulated sum is left unchanged . the accumulated sum is then subtracted from the pixel values of the row to remove the row noise . the pipelined implementation of the row noise reduction embodiment is shown in fig3 and 4 . the pipelined system requires three rows of memory to hold the previous row of video , the column filter states and the counts of number of valid column filter updates . the row offset can be applied in a single pass because a row of video 12 is stored in memory 52 while the offset is calculated . when the calculation is complete , the offset can be subtracted from the saved row and output with a delay equivalent to the tune to scan a video row . the foregoing description , of the embodiments of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of this disclosure . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto . | 7 |
a workpiece 10 , which may be , for example , an automobile body or the like , is represented here as a rectangular , flat component that is to be welded , at a longitudinal edge 11 , to the longitudinal edge 12 of a further workpiece 13 . the two workpieces 10 and 13 have straight , linear edges 11 and 12 , and , accordingly , they can also be referred to as so - termed ideal workpiece parts . a robot arm , not represented here , travels with a sensor , which may be , for example , a camera , along the lines 11 and 12 and , starting from the start point 14 , makes images at predefined locations 15 , 16 , 17 , 18 and 19 , the signals of which images are stored in a memory . a real workpiece 20 differs from the ideal workpiece 10 in that the edge 21 corresponding to the edge 11 has been altered in comparison with the ideal edge 11 ′, insofar as the real edge 21 has an s shape , which intersects the ideal edge 11 ′ at certain points 11 ″ and 11 ′″. the robot , with the sensor , travels along the curve 11 ′, and images are recorded at the same points 14 ′, 15 ′, 16 ′, 17 ′, 18 ′ and 19 ′ by means of the camera , the signals belonging to the images likewise being stored in a memory . the actual contour 21 deviates from the ideal contour , this being calculated by comparison of the so - termed ideal signals with the real signals , as a result of which there are calculated positional vectors 22 , 23 , 24 , 25 and 26 , by which the contour to be traveled by the robot is displaced from the ideal points to the real points . there is thereby obtained a motional path 30 , as shown by fig3 , the motional path constituting , between the individual measurement points in each case , a straight line that is approximated to the real curve or real contour 21 . a better approximation of the motional path of the robot to the actual contour can be achieved by increasing the number of measurement points . the motional path of the robot according to fig1 can also be referred to as a training pass ; the next step according to fig2 is a measuring pass , in which the real workpiece contour is measured , and the motional path 30 according to fig3 is the corrected path 30 , along which the robot travels in the case of application . the mode of operation of the invention has been described above with reference to a very simple workpiece part . it is represented in fig1 that the two edges of the workpiece parts are close to one another ; in reality , the edges overlap one another , such that spot - welding work can be performed at the corresponding locations and the corresponding contours . a particular case is the sealing of a so - termed concealed seam . for this , reference is to be made to fig4 and 5 . fig4 shows a top view of a door 40 within a body 41 , a gap 44 , which is to be realized to be as narrow as possible , being constituted between the peripheral edge 42 of the door and the inner edge 43 of the body 41 , which inner edge is matched to the outer contour of the door 40 . a sectional view according to the section line v - v is represented in fig5 . the door 40 in this case has an outer plate 45 , which is bent over inwards in an l shape at the end edges 42 , so as to form a u shape 46 having a free limb 47 extending parallelwise in relation to the door surface . the outer plate 45 is complemented to form the door in that there is provided an inner plate 48 , which engages in the u shape 46 , such that the limb 47 overlaps a partial region of the inner plate 48 . the limb 47 may , if necessary , be connected to the inner plate 48 by adhesive bonding or by a spot - welding process . a narrow gap 49 is formed in this case , through which moisture might be able to enter the inner space between the outer plate 45 and the inner plate 48 . for this purpose , it will be necessary to seal the gap 49 , or also the seam 49 , this being effected here by means of an l - shaped tool 45 , provided on the l - shaped limb 51 of which there is a slot , not shown in greater detail , through which sealing material 52 , indicated by arrows , can emerge and cover the seam 49 . the seam 49 in this case is a so - termed concealed seam , which cannot be detected by a sensor . in this case , the contour 42 of the door is detected and acquired at certain measurement points , which are indicated by crosses in fig5 . the start of the acquisition of the contour 42 is the start point 53 , and a certain number of measurement points , the number of which depends on the course of the contour 42 , is acquired by means of a sensor , according to the curved contour 42 , which is opposite the hinge - points 54 and 55 of the door 40 . after the individual measurement points , of which only the measurement points 56 , 57 and the end measurement point 58 are denoted by way of example , have been acquired and the signals , determined by the sensor , have been stored in a memory , the measurement points are displaced computationally in consideration of the positional vectors , see fig2 , that have been acquired in this region , and the motion of the tool 55 is thereby calculated . the tool is then appropriately passed into the gap 44 and arranged as represented in fig5 , such that the limb 51 extends parallelwise in relation to the limb 47 , and the tool 50 , in the gap 44 , travels along the contour 42 according to the newly calculated , real contour , the sealing material 52 being brought to the gap from behind . clearly , the same is also effected for the contour 42 a in the upper region of the door 40 and for the contour 42 b in the lower region of same . | 6 |
by “ gasoline performance additive ” herein is meant any one or more chemicals useful in the present disclosure for dissolving or dispersing in a gasoline fuel . by “ corrosion ” herein is meant any degradation , rusting , weakening , deterioration , softening , and the like of an engine surface or a part or component of an engine or an engine component or part due to exposure to an ethanol - containing fuel . by “ corrosion inhibition ” or “ reducing corrosion ” herein is meant any improvement in minimizing , reducing , eliminating or preventing corrosion . by “ ethanol ” herein is meant ethyl alcohol , the chemical compound c 2 h 5 oh . this can arise in or be provided in many qualities or grades , such a commercial of fuel grade , as well as pure or reagent grade ethanol , and can be derived from any source such as but not limited to petroleum refinery streams , distillation cuts , and bio - derived ( e . g . bioethanol from corn ). by “ corrosion inhibitor ” herein is meant at least the following : succinimide dispersants , succinamide dispersants , amides , mannich base dispersants , and polyetheramine dispersants , phenolics , hindered phenolics , aryl amines , diphenyl amines , monocarboxylic acids , dicarboxylic acids , p - phenylenediamine and dicyclohexylamine , oxylated alkylphenolic resins , formaldehyde polymer with 4 -( 1 , 1 - dimethylethyl ) phenol , methyloxirane and oxirane , octane enhancer materials , monoesters , diesters , ketones , ethers , diethers , polyethers , glycols , glymes , oxiranes , c1 - c8 aliphatic hydrocarbons , butylene oxide , propylene oxide , ethylene oxide , epoxides , butane , pentane , xylene , nitrous oxide , nitromethane , phenates , salicylates , sulfonates , nonylphenol ethoxylates , and fuel - soluble alkali detergents and alkaline earth metal - containing detergents , thus , there is provided herein in one embodiment a method to reduce corrosion in an internal combustion engine , said method comprising combusting in said engine a fuel composition comprising gasoline , ethanol and at least one fuel additive , said additive being selected from the group consisting succinimide dispersants , succinamide dispersants , amides , mannich base dispersants , and polyetheramine dispersants , whereby corrosion is reduced relative to the corrosion when combusting a fuel composition without ethanol . in another embodiment , the fuel additive useful to reduce corrosion can be selected from phenolics , hindered phenolics , aryl amines , diphenyl amines , monocarboxylic acids , dicarboxylic acids , polycarboxylic acids , an oxylated alkylphenolic resin , and formaldehyde polymer with 4 -( 1 , 1 - dimethylethyl ) phenol , methyloxirane and oxirane , octane enhancer materials , monoesters , diesters , ethers , ketones , diethers , polyethers , glymes , glycols , corrosion inhibitor materials , oxiranes , c1 - c8 aliphatic hydrocarbons , butylene oxide , propylene oxide , ethylene oxide , epoxides , butane , pentane , xylene , nitrous oxide , nitromethane , phenates , salicylates , sulfonates , nonylphenol ethoxylates , and fuel - soluble alkali detergents and alkaline earth metal - containing detergents . in another embodiment herein , heterocyclic aromatics for nonferrous metal corrosion protection are useful herein for use with ethanol - containing fuels . these can include , for example and without limitation , p - phenylenediamine and dicyclohexylamine . these are particularly effective in reducing corrosion by neutralizing acidic components that can get into the fuel from the ethanol or bioethanol sources . similarly , acidic additives are useful in reducing corrosion by neutralizing basic materials and contaminants that can enter the fuel blend from the ethanol or bioethanol . in this regard , monocarboxylic acids , dicarboxylic acids , and polycarboxylic acids are particularly effective . rust inhibitors have been used in gasoline fuels not containing ethanol . however , the introduction of e100 fuels and blends such as e85 has created additional problems of rust problems in engines and equipment and components contacting the ethanol fuel . rust inhibitors useful here in preventing corrosion of surfaces exposed to ethanol - containing fuels can include , for example tall oil fatty acids , dodecenyl succinic acid ( ddsa ) and mono carboxylic acids , such as oleic acid . thus , there is provided herein a composition to reduce corrosion in an internal combustion engine combusting an ethanol - containing fuel , said composition comprising gasoline , ethanol , and one or more materials selected from the group consisting of tall oil fatty acids , dodecenyl succinic acid , and oleic acid plus n , n dimethylcyclohexylamine . copper and lead bearing corrosion inhibitors may be used , but are typically not required with the formulation of the present invention . typically such compounds are the thiadiazole polysulfides containing from 5 to 50 carbon atoms , their derivatives and polymers thereof . derivatives of 1 , 3 , 4 thiadiazoles such as those described in u . s . pat . nos . 2 , 719 , 125 ; 2 , 719 , 126 ; and 3 , 087 , 932 ; are typical . other similar materials are described in u . s . pat . nos . 3 , 821 , 236 ; 3 , 904 , 537 ; 4 , 097 , 387 ; 4 , 107 , 059 ; 4 , 136 , 043 ; 4 , 188 , 299 ; and 4 , 193 , 882 . other additives are the thio and polythio sulfenamides of thiadiazoles such as those described in uk patent specification no . 1 , 560 , 830 . benzotriazoles derivatives also fall within this class of additives . when these compounds are included in the fuel composition , they are typically present in an amount not exceeding 0 . 2 wt . % active ingredient . some engines have copper - containing or silver - containing components or devices that can contact the fuel supply . such components can experience corrosion , particularly when the fuel contains , or is , ethanol . in certain instances , the ethanol can carry significant dissolved water which can exacerbate the corrosion problem posed by the ethanol alone . to address corrosion reduction on such components , the present disclosure provides a method to reduce corrosion of copper and / or silver in an engine having copper or silver components and combusting an ethanol - containing fuel by adding to the ethanol or to the fuel at least one additive selected from succinimide dispersants , succinamide dispersants , amides , mannich base dispersants , and polyetheramine dispersants , phenolics , hindered phenolics , aryl amines , diphenyl amines , monocarboxylic acids , dicarboxylic acids , polycarboxylic acids , p - phenylenediamine and dicyclohexylamine , an oxylated alkylphenolic resin , formaldehyde polymer with 4 -( 1 , 1 - dimethylethyl ) phenol , methyloxirane and oxirane , octane enhancer materials , monoesters , diesters , ethers , diethers , polyethers , glycols , glymes , oxiranes , c1 - c8 aliphatic hydrocarbons , butylene oxide , propylene oxide , ethylene oxide , epoxides , butane , pentane , xylene , nitrous oxide , nitromethane , phenates , salicylates , sulfonates , nonylphenol ethoxylates , and fuel - soluble alkali detergents and alkaline earth metal - containing detergents , whereby the copper and / or silver component ( s ) have / has reduced corrosion relative to the corrosion observed when the copper and / or silver component ( s ) are / is exposed to a fuel without ethanol . the following examples further illustrate aspects of the present disclosure but do not limit the present disclosure . to an e85 fuel can be added 1 . 0 percent by weight of dodecenyl succinic acid ( ddsa ) and the fuel formulation can be supplied to and combusted in an internal combustion spark ignited engine . the corrosion exhibited on the engine surfaces exposed to the fuel blend plus ddsa will display less corrosion after 5 , 000 miles than the corrosion exhibited on the engine surfaces after 5 , 000 miles of exposure to the same fuel blend without the ddsa . to an e85 fuel can be added 2 . 0 percent by weight of oleic acid and the fuel formulation can be supplied to and combusted in an internal combustion spark ignited engine . the corrosion exhibited on the engine surfaces exposed to the fuel blend plus oleic acid will display less corrosion after 5 , 000 miles than the corrosion exhibited on the engine surfaces after 5 , 000 miles of exposure to the same fuel blend without the oleic acid . to an e85 fuel can be added 2 . 0 percent by weight of a condensation product of alpha halogenated mono - carboxylic acid with 2 , 5 - dimercapto - 1 , 3 , 4 - thiadiazole and the fuel formulation can be supplied to and combusted in an internal combustion spark ignited engine . the corrosion exhibited on the engine surfaces exposed to the fuel blend plus the thiadiazole derivative will display less corrosion after 5 , 000 miles than the corrosion exhibited on the engine surfaces after 5 , 000 miles of exposure to the same fuel blend without the thiadiazole derivative . to an e85 fuel can be added 1 . 0 percent by weight of the reaction product of oleic acid and 2 , 5 - dimercapto - 1 , 3 , 4 - thiadiazole and the fuel formulation can be supplied to and combusted in an internal combustion spark ignited engine . the corrosion exhibited on the engine surfaces exposed to the fuel blend plus the thiadiazole derivative will display less corrosion after 3 , 000 miles than the corrosion exhibited on the engine surfaces after 3 , 000 miles of exposure to the same fuel blend without the thiadiazole derivative . in addition to examples 1 - 4 above , the benefits and advantages of the present invention will be observed by testing the compositions disclosed herein in astm d665a corrosion test . further confirmation of the present invention is provided by performing the test nace tm 0172 on the compositions disclosed herein and comparing the results to fuel compositions not containing alcohol or not containing the presently disclosed additives . the table below provide illustration of some desired additive combinations for various ethanol - containing fuels whereby corrosion might be controlled or reduced in an engine combusting the ethanol - containing fuel . a = alkylated succinimide dispersant from 950 mw pib and tetraethylenpentamine b = mannich base dispersant from 1250 mw pib and a polyamine f = octane improver selected from mmt , tetraethyl lead , azides , peroxides , alkyl nitrates i = alkaline earth metal phenates , salicylates , sulfonates , nonylphenol ethoxylates , fuel - soluble alkali detergents or alkaline earth metal - containing detergents 2 adm ethanol ( 4 ppm sulfates , 32 ptb octel dci - 11 corrosion inhibitor ) 3 new energy ethanol (& lt ; 1 ppm sulfates , 0 . 9 ptb corrosion inhibitor ) another test to demonstrate the benefit of the present disclosure involved waer scar measurements , shown in table 4 . table 4 shows the results of wear scar testing in which a median wear scar diameter mwsd ) is reported . run 1 was e85 using new energy ethanol and this baseline mwsd was 605 . when hitec ® 4142 ( oleic acid plus n , n dimethylcyclohexylamine ) was added as a corrosion inhibitor , the mwsd was reduced to 445 . changing the corrosion inhibitor in the e85 fuel to ddsa ( 50 % in a150 solvent ) gave a slightly higher value of 540 but still improved over the baseline for e85 . using adm ethanol in the e85 produced even further reduction in the wear scar , probably due to the corrosion inhibitor ( dci - 11 ) in the ethanol . this table shows the benefit in wear scar reduction and hence in reducing wear in an engine achieved by incorporation of dodecenyl succinic acid and / or oleic acid plus n , n dimethylcyclohexylamine into an ethanol - containing gasoline fuel blend . other embodiments of the present disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the disclosure disclosed herein . as used throughout the specification and claims , “ a ” and / or “ an ” may refer to one or more than one . unless otherwise indicated , all numbers expressing quantities of ingredients , properties such as molecular weight , percent , ratio , reaction conditions , and so forth used in the specification and claims are to be understood as being modified in all instances by the term “ about .” accordingly , unless indicated to the contrary , the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present disclosure . at the very least , and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims , each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques . notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations , the numerical values set forth in the specific examples are reported as precisely as possible . any numerical value , however , inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the disclosure being indicated by the following claims . | 2 |
in the following detailed description , reference is made to the accompanying drawings that show , by way of illustration , some examples of embodiments in which the disclosure may be practiced . in this regard , directional terminology , such as “ right ”, “ left ”, “ upwards ”, “ downwards ”, “ vertical ”, “ horizontal ” etc ., are used with reference to the orientation of the figure ( s ) being described . because components or embodiments of the present disclosure can be positioned or operated in a number of different orientations , the directional terminology is used for purposes of illustration and is in no way limiting . it is to be understood that other embodiments may be utilized and structural or logical changes may be made without departing from the scope of the present disclosure . the term “ gel ” as used herein refers to any number of materials that are soft and viscoelastic . the mechanical properties of a “ gel ” as used herein may range from a viscous liquid such as honey or mineral oil to a soft elastic solid , such as gelatin . for example , a “ gel ” may comprise a soft , weakly cross - linked solid that can deform and flow under applied force and may spring back slowly upon removal of the applied force . one example is nusil med - 6346 silicone gel . the “ gels ” of the present disclosure may be homogenous or heterogeneous ( as in slurries , colloids , and emulsions ). the “ gels ” of the present disclosure may be hydrophobic or hydrophilic . heterogeneous gels may include different phases that have different solubility and transport properties ; for example , a hydrophobic , contiguous , soft polymer filled partially with particles of hydrophilic polymers . such a composite material may accrue performance advantages from each material , such as elasticity , chemical resistance , and moisture transport . the “ gels ” of the present disclosure may include any low - shear modulus material based on chemistries such as silicone , polyurethane , polyvinylpyrrolidone , and polyethylene glycol . the “ gels ” of the present disclosure may also include foam materials such as those made of silicone , polyurethane , or the like and / or foam materials impregnated with liquids or gels . additional examples of “ gels ” are further described below in reference to various embodiments . the terms “ operatively connected ,” “ coupled ,” or “ mounted ,” or “ attached ” as used herein , means directly or indirectly coupled , attached , or mounted through one or more intervening components . fig1 shows a cross sectional view of outer ear 30 , middle ear 32 and inner ear 34 ( part ). the outer ear comprises primarily of the pinna 16 and the ear canal 14 . the middle ear is bounded by the tympanic membrane ( ear drum ) 10 on one side , and contains a series of three tiny interconnected bones : the malleus ( hammer ) 18 ; the incus ( anvil ) 20 ; and the stapes ( stirrup ) 22 . collectively , these three bones are known as the ossicles or the ossicular chain . the malleus is attached to the tympanic membrane 10 while the stapes , the last bone in the ossicular chain , is coupled to the cochlea 24 of the inner ear . many hearing instruments or hearing aids include “ ear tips ” that fit inside the external auditory canal or ear canal 14 to deliver sound to the eardrum or tympanic membrane 10 . ear tips are support structures that suspend and retain a sound tube or receiver inside the ear canal . a sound tube , for example , may be a hollow plastic tube that guides sound generated in an external hearing instrument , while a receiver is a miniature speaker that is connected to an external hearing instrument via wires . to minimize occlusion , such ear tips generally provide venting through the ear canal through an opening , channel , or vent along its length . as discussed above , many current ear tips have fixed vent sizes that may limit their effectiveness . another types of hearing instruments , for example , completely - in - canal ( cic ) hearing instruments could also benefit from adjustable venting . as shown in fig1 , a hearing device or ear tip 100 may be placed within the ear canal 14 , for example , between the lateral cartilaginous part and the medial body part . the hearing device 100 may include one or more openings , channels , or vents 110 to allow the ear canal 14 to vent . fig2 a and 2b show the hearing device 100 in place in the ear canal 14 . fig2 a shows the hearing device 100 in a low cross - sectional area , high venting configuration . fig2 b shows the hearing device 100 in a high cross - sectional area , low venting configuration . the hearing device or ear tip 100 may comprise a malleable element or structure 120 , a slider 140 , and an element 160 . the hearing device 100 may also comprise an output transducer 180 . for example , the output transducer 180 may comprise a laser photodiode or other emitter for emitting an optical signal to be received by a device placed on the tympanic membrane 10 such as the contact hearing device available from earlens corporation of menlo park , calif . systems and methods for photo - mechanical hearing transduction are also described in co - assigned u . s . pat . nos . 7 , 668 , 325 , 7 , 867 , 160 , 8 , 396 , 239 , 8 , 696 , 541 , 8 , 715 , 152 , 8 , 824 , 715 , and 8 , 858 , 419 , the full contents of which are incorporated herein by reference . in further examples and embodiments , the output transducer may comprise a miniature speaker or receiver . the malleable element 120 may be conically shaped . the malleable element 120 may have a distal or medial portion adapted or configured to be in contact with and be flush with the inner wall of the ear canal 14 and a tapered proximal or lateral portion . the malleable element 120 in the low cross - sectional area , high venting configuration may be shaped to define one or more channels 110 . in one example shown in fig2 a , the malleable element 120 has a cross - shaped cross - section to define four channels 110 between the outer surface of the malleable element and the inner wall of the ear canal 14 . the cross - shaped cross - section further defines four ear canal wall contacting extensions 114 as shown in fig5 a , 5b . the malleable element 120 may also have other cross - sectional shapes , such be i - shaped , y - shaped , or x - shaped , or have a plurality of channels 110 , to name a few . while the malleable element 120 is shown and described as being configured to be in contact with the inner wall of the ear canal 14 , in some embodiments , the malleable element 120 may be housed , for example , in a shell , housing or other device body that may be molded to fit within the ear canal . fig3 a and 3b show side views of an example of the transition of the ear tip 100 from the low cross - sectional area , high venting configuration , shown by fig3 a , to the high cross - sectional area , low venting configuration , shown by fig3 b . in this example the slider 140 may be advanced toward the malleable element 120 ( or toward the tympanic membrane 10 ) over the element 160 ( for example , a wire or a shaft ) as shown by arrow 141 in fig2 b and 3b . as a result , the material of the malleable element 120 , for example gel , is then urged radially outward to decrease the cross - sectional area of the channels 110 . in particular , relief or “ cut - away ” areas 112 ( shown , for example , in fig4 a and 4b ) which in part define the channels 110 may bulge outwardly . fig5 a and 5b show a perspective view and a front view of the ear tip 100 and the relief or “ cut away ” areas 112 . fig6 shows an alternative embodiment of the malleable element 120 . in this embodiment , the malleable element 120 comprises a gel or fluid 122 surrounded by a thin bladder 124 . in various embodiments , the malleable element 120 may be biased to assume the low cross - sectional area , high venting configuration . the malleable element 120 may be disposed radially over the element 160 . advancing the slider 140 in the distal or medial direction may squeeze the bladder 124 to force the gel 122 radially outward . the slider 140 may be movable continuously toward or away from the malleable element 120 . alternatively or in combination , the slider 140 may be movable between a plurality of discrete locations toward or away from the malleable element 120 to achieve specific size and / or configuration of the channels 110 . the output transducer 180 may be coupled , for example , to distal ends of the element 160 and the malleable element 120 . the element 160 may comprise a shaft , a post , or a wire , to name a few exemplary structures . in some embodiments , the element 160 may be elongated and may comprise a shaft and / or one or more wires to provide power and / or signals to the output transducer 180 . the gel 122 may be comprised of one or more of a silicone gel , a viscous hydrophilic fluid , a viscous hydrophobic material , or a gas , to name a few . examples of silicone gels that may be used as the gel or fluid 122 include nusil med - 6670 , nusil med - 6346 , and nusil med - 6345 , available from nusil technology llc of carpintera , calif ., and polyurethanes , to name a few . examples of viscous hydrophilic fluids that may be used as the gel 122 include glycerol and glycerol thickened with thickening agents such as carbopol , polyvinylprolidone , poly ( ethylene glycol ), etc ., to name a few . examples of viscous hydrophobic materials that may be used as the gel or fluid 122 include petroleum jelly , mineral oil , lanolin , silicone oils , and grease , to name a few . examples of gases which may be used as the gel or fluid 122 include air or nitrogen . examples of other filler materials that may be used as the gel or fluid 122 include viscous fluids and viscoelastic materials ( including thixotropic and dilitant ), to name a few . in some embodiments , the malleable element 120 comprises the gel 122 without the thin bladder 124 . in such embodiments , the gel or 122 may comprise a soft elastic or viscoelastic ( including solid ) material . the thin bladder 124 may have different thickness and / or stiffness in some areas versus others . for example , the relief or “ cut away ” areas 112 , as shown by fig5 a and 5b , may be more elastic than the contact areas 114 which are configured to contact the inner wall of the ear canal 14 . the thin bladder 124 may be comprised of a stiff plastic or an elastomeric material . examples of stiff plastics include parylene , nylon , peba materials ( such as pebax ), and polyurethane , to name a few . examples of elastomeric materials include silicone , polyurethane , peba , and nylon , to name a few . the outer surface of the malleable element 120 , including the outer surface of the thin bladder 124 , may be amenable to sliding , for example , by the exemplary slider 140 . to be amenable to sliding , the outer surface of the malleable element 120 may have medium to low friction and little or no track . in some embodiments , the element 160 may extend laterally or proximally to connect to an external support unit . the external support unit may be a device or an apparatus placed in the ear canal , within the pinna , or behind - the - ear ( bte ). the external support unit may comprise components such as a microphone to capture sound , a signal processor to process the captured sound , a power source such as a battery , a sensor , a receiver and / or transmitter to receive / transmit signals or instructions from another internal device , and / or an actuator to operate the slider 140 . the sensor may comprise an accelerometer to capture movement and directionality , a thermometer to measure temperature , or a humidity sensor , to name a few . such sensors may be in communication with the actuator , such as through a wired or a wireless connection . the actuator may comprise a mechanical and / or electrical actuator to operate the slider 140 and vary the venting provided by the malleable element 120 . the actuator may be a component of the ear tip 100 in at least some embodiments and applications . the slider 140 that is used to deform the malleable element 120 of the ear tip 110 is shown just as an example only , and many other appropriate means and mechanisms for actuating , deforming or changing the shape and configuration of the malleable element to adjust the venting is within the scope of the present disclosure . for example , in some embodiments , an electromechanical actuator may be configured to draw low amounts of power and / or consume low or no power to hold a given position or degree of venting . in some embodiments , the actuator may comprise a ratcheting mechanism with a plunger motion such as a solenoid . the ratcheting mechanism may be linear and / or rotational with a screw drive . in some embodiments , the actuator may comprise a pump to pressurize the fluid or gel 122 ( for example , within the bladder 124 for those embodiments that comprise such bladder ) to change the shape of the malleable element 120 . in some embodiments , an electric field may be used to change the size or shape of the gel 122 , and therefore , the malleable element . the actuator may be manually operated ( such as by the user , the wearer , and / or a medical professional ) or may operate automatically in response to programming , for example , to vary the venting provided based on sensor input . for example , the actuator may be placed in communication with an application loaded on a user - operated mobile computing device such as a smartphone , tablet computer , laptop computer , or the like to operate the slider 140 or any other alternative mechanism . alternatively or in combination , the user may operate the slider 140 or other appropriate mechanism by hand or with a handheld tool . the actuator may be responsive to a variety of cues to vary the venting provided by the malleable element 120 . generally , these cues may be environmental or indicative of feedback which may occur when an excess of ear canal venting is provided . the cue may be provided , for example , from a sensor of the hearing aid or ear tip 100 and / or from a sensor of the external support unit such as a bte unit . for example , the degree of venting provided may be varied in response to the volume of the ambient environment or direction of origin of certain sounds . the degree of venting in a loud ambient environment , for instance , may cause venting to increase to allow the user to hear more unprocessed sound or to decrease to allow the user to hear more processed sound . further non - limiting examples are as follows . feedback may be sensed and the degree of venting provided may be varied to suppress feedback . for example , the ear tip 100 may be in communication with a bte unit . the microphone of the bte unit may be used to detect feedback . feedback may be detected in many ways . feedback may be detected by detecting a sound signature such as a narrow - band , high frequency sound ( e . g ., “ whistling ”) or a loudness greater than the ambient sound level , for example . feedback may be detected based on sound directionality , such as sound detected as emanating from the ear canal . this directionality may be detected based on the phase difference between microphones ( e . g ., between a first microphone placed in the ear canal and a second microphone of the bte unit ) and / or the amplitude or loudness of the sound ( e . g ., absolute amplitude and / or the difference in amplitude detected between different microphones ). feedback may be detected , for example , with a sensor on the ear tip 100 . such sensors may comprise a microphone , an accelerometer to detect vibration associated with high - intensity sound , or a vibrational spectrometer ( e . g ., mems - based ), to name a few . feedback may be detected based on the drive state of internal electronics or circuitry of the ear tip 100 . for example , the internal electronics or circuitry may detect when amplifier output is saturating in a given frequency band , which may indicate overdrive and a possible feedback state . alternatively or in combination , the internal electronics or circuitry may detect when harmonic distortion becomes excessive , which may indicate clipping and feedback . the ambient acoustic environment may be sensed and the degree of venting provided may be varied accordingly . a loud environment may trigger , for example , increased venting so that the wearer can hear more of the unamplified or unprocessed sound directly or decrease venting to attenuate ambient sounds such that the ear tip 100 can deliver “ selective ” sound the user may prefer . such “ selective ” sound may comprise , for example , the streaming of a telephone call or music from an external computing device such as a smart phone , tablet computer , personal computer , music player , media player , or the like . other examples include sound from a directional microphone or a microphone array which may be beam forming . in some embodiments , the “ selective ” sound may be selected using an application loaded onto a computing device . the selection may be based on user settings adjustable in real time or based on chosen profiles that are stored and activated automatically or manually . for example , a profile may be chosen to be more appropriate for quiet environments . this quiet environment profile may trigger increased venting so that the user or wearer of the ear tip 100 may hear more clearly in a one - on - one conversation by taking advantage of the natural directional response of the pinna . sensing of the acoustic environment can be performed in many ways , including without limitation , by local hearing instrument electronics such as of the ear tip 100 or an associated external unit , by a computing device in communication with the former , or by another server device such as a personal computer . according to another aspect of the present disclosure , fig7 a and 7b show an alternative hearing device or ear tip 200 with adjustable venting . the ear tip 200 may comprise a proximal baffle 220 and a distal baffle or tip 240 . the proximal baffle 220 may have one or more openings 225 to provide ear canal venting , and the distal baffle 240 may have one or more openings 245 to provide ear canal venting . the proximal and distal baffles 220 , 240 may be coaxial and , either one or both , may be rotatable relative to one another to vary the alignment of the openings 225 , 245 . as shown in fig7 a and 7b , the openings 225 , 245 are fully aligned to provide the maximum degree of venting . the distal baffle 240 may be elastomeric and flexible to be seated within the ear canal 14 . the proximal and distal baffles 220 , 240 may be disposed over an element 160 . the ear tip 200 may further comprise the output transducer 180 disposed on a distal tip of the distal baffle 240 . fig8 a to 8c show the operation of the ear tip 200 . fig8 a shows the ear tip 200 in a configuration to provide maximum venting by fully aligning the openings 225 , 245 with one another . as shown in fig8 b and 8c , the proximal baffle 220 may be rotated , for example , in a direction indicated by the arrow 250 to misalign the openings 225 , 245 to reduce the degree of venting provided . fig8 b shows the ear tip 200 having the proximal baffle 220 rotated to be in an intermediate configuration with less venting . here , the surfaces of the baffles 220 , 240 partially cover the openings 225 , 245 . fig8 c shows the ear tip 200 having the proximal baffle 240 rotated to be in the completely closed configuration with no venting . here , the surfaces of the baffles 220 , 240 fully cover the openings 225 , 245 . as shown in fig9 a to 9b , the ear tip 200 may alternatively or in combination be configured to vary venting by translation of the baffles 220 , 240 . for example , the distal baffle 240 may have one or more openings 245 while the proximal baffle 220 may have no openings . the proximal baffle 220 may be advanced to contact the distal baffle 220 to close off venting as shown in fig9 a . the proximal baffle 220 may be retracted to allow access to the opening 245 to provide venting as shown in fig9 b . in some embodiments , the element 160 may include screw threads so that rotation of the proximal baffle 220 may translate into medial - lateral movement of the proximal baffle 220 . the ear tip 200 may be operated manually or automatically similarly to the ear tip 100 described above . the degree of venting provided by the ear tip 200 may be varied in response to a variety of cues similarly to the ear tip 100 above . for instance , the ear tip 200 may be coupled to an actuator and / or sensor ( s ), or a processor to vary the degree of venting provided in response to various cues . according to yet another aspect , the present disclosure further provides for alternative improved ear tips that conform to anatomy , as described below . such ear tips may be used in various applications and implementations , for example , to suspend or retain output transducers such as a laser photodiode or other emitter for emitting an optical signal to be received by a device placed on the tympanic membrane 10 . many currently used ear tips are made of a rigid plastic that is generally custom - shaped to the wearer &# 39 ; s ear canal . these ear tips typically fit in the cartilaginous portion of the ear canal and are usually oversized such that the soft tissue in this region can stretch and conform to the ear tip to improve retention and sealing . such soft tissue stretching , however , can cause discomfort in the short term and permanent tissue deformation in the long term . fig1 a and 10b show an example of such known rigid ear tips 300 configured to be placed in the ear canal 14 . the ear tip 300 is typically oversized at the cartilaginous portion 14 a of the ear canal 14 before transitioning into a tapered tip 310 to be positioned at the bony portion 14 b of the ear canal 14 . the transition may be at the isthmus or second bend 14 c of the ear canal 14 . most ear canals 14 will have a narrowing at the isthmus 14 c located just lateral to the beginning of the bony canal 14 b . the ear tip 300 may further comprise an output transducer 180 located at the distal or medial end of the ear tip 300 . in at least some cases , a tympanic membrane receiver 350 to receive power and / or signal from an optical signal , such as the contact hearing device available from earlens corporation of menlo park , calif ., may require the photodiode or other output transducer 180 to be close and well - aligned with the receiver 350 to ensure good power transfer and optimal battery life . for example , the output transducer 180 may be positioned at a distance 360 , for example , of approximately 3 mm away from the receiver 350 as shown in fig1 b . for the photodiode or other output transducer 180 to be positioned at this distance 360 , the photodiode or other output transducer 180 will typically be located on the medial end of the ear tip located in the bony portion 14 b of the ear canal 14 . the tissue in the bony region is very thin ( generally 0 . 1 to 0 . 2 mm ) and sensitive . pressure applied to the thin tissue should be less than about 20 mmhg to prevent capillary collapse and wound generation . the tissue in the bony region cannot conform to a rigid ear tip since it is surrounded by bone . indeed , a rigid ear tip should not touch the tissue at all because of the high risk of generating “ hot spots ,” local regions of high pressure , and wounds , since the soft tissue cannot conform . to address at least this concern , ear tips of the present disclosure may be configured to conform to the anatomy with low wall pressure . fig1 a , 11b , and 11c show ear tips 400 according to the present disclosure . the ear tips 400 are shown as placed in the ear canal 14 at one or more of the cartilaginous portion 14 a or the bony portion 14 b . the ear tips 400 may conform to the deep , bony ear canal 14 b to provide alignment with the receiver 350 and retention while maintaining low wall pressure to support ear health and prevent pressure sores . the ear tips 400 may be referred to as hybrid ear tips as they comprise a hard shell or core 410 and a gel portion 420 disposed over at least the distal or medial tip of the hard shell 410 . as shown in fig1 a and 11b , the hard core 410 may conform to the cartilaginous portion 14 a of the ear canal 14 . the hard shell or core 410 may be substantially rigid and may be longer as in fig1 a , or shorter as in fig1 b . as shown in fig1 c , the hard shell 410 may be entirely housed within the gel portion 420 to be placed within the bony portion 14 b of the ear canal 14 . in some embodiments , an exposed outer surface of the hard core or shell 410 may have a length such that the hard core does not extend past an isthmus of the ear canal when the ear tip apparatus is inserted in the ear canal , as seen , for example , in fig1 a - c . the gel of the gel portion 420 may comprise any of the gels described herein . the gel of the gel portion 420 may flow and conform to the bony portion 14 b of the ear canal . the gel of the gel portion 420 may provide low , uniform hydrostatic pressure to all parts of the canal 14 with little to no “ hot spots ,” or regions of high pressure . the gel portion 420 may provide gentle wall pressure for comfort ( e . g ., less than 20 mmhg ) and ear health . in some embodiments , a membrane or a bladder can be used to surround and retain the gel as described in reference to the malleable element or malleable structure 120 above , particularly in cases where the gel may not be able to retain its own shape . providing a surrounding membrane or bladder may also provide lubricity and / or some restoring force to help a soft gel fill and conform . the ear tips 400 may also provide mechanical retention via the isthmus 14 c . the gel portion 420 of the ear tips 400 may deform to ease the insertion of the ear tips 400 past the narrowing at the isthmus 14 c , and then widen back ( e . g ., return to its pre - biased or natural wider configuration ) to provide gentle retention in the bony portion 14 b of the ear canal . as shown in fig1 a and 11b , the hard shell 410 may be oversized so that only its tapered tip can be advanced past the isthmus 14 c and that the hard shell 410 is well seated in the cartilaginous portion 14 a of the ear canal 14 . the ear tips 400 may comprise the output transducer 180 positioned at the distal end of the hard shell 410 . fig1 a , 12b , and 12c show another example of a hybrid ear tip 450 , which may be also combined and share features from the embodiments of the ear tips 100 and 300 described above . the ear tip 450 may comprise a hard shell 410 housed within a gel portion 420 . the distal end of the hard shell 410 may comprise an output transducer 180 to be aligned with a tympanic membrane receiver 350 . for example , in some embodiments the gel portion 420 may comprise a soft viscoelastic gel with a lubricous coating such as parylene . the hybrid ear tip 450 may be configured to be placed entirely within the ear canal 14 . the hybrid ear tip 450 may be custom sized and shaped for an individual user . alternatively , the hybrid ear tip 450 may be provided in a variety of sizes to fit most potential users . the gel portion 420 may be shaped to define a plurality of channels 110 to provide venting for the ear canal 14 . similarly to the malleable element 120 described above , these channels 110 may be defined between the inner wall of the ear canal 14 and the outer surfaces of the relief or “ cut - away ” portions 452 of the gel portion 410 . the gel portion 420 may be deformed much like the malleable structure or element 120 of the ear tip 100 described above to vary the degree of venting provided by the channels 110 . the gel portion 420 may comprise a cross - shape to align with the major and minor axes of the ear canal 14 . as shown in fig1 c , the gel portion 420 may comprise ridge portions 454 to contact the ear canal 14 along these axes . the ridge portions 454 may also define the relief or “ cut - away ” portions 452 . as shown in fig1 b and 12c , the hard shell or core 410 provides convenience for driving / placing the tip within the ear canal and aligning it along the major canal axis . the hard core 410 may also comprise a proximal or lateral post 412 to facilitate the insertion and placement of the ear tip 450 . the hard core 410 may further comprise one or more light - gauge wires 414 at the proximal or lateral portion . the wires 414 may have a spiral stress relief and may be configured to be operatively coupled with an external unit such as a bte unit . the output transducer 180 may receive signals from the external unit through the wires 414 , for example . as shown in fig1 a and 13b , the ear tip 450 may further comprise a handle 455 coupled to the proximal or lateral portion of the ear tip 450 . the handle 455 may facilitate the insertion and placement of the ear tip 450 . aspects of the present disclosure further provide methods of manufacturing or fabricating the various improved ear tips described herein . the improved ear tips may be fabricated using , for example , a sacrificial mold process . the sacrificially mold made be made in different ways such as direct machining , direct 3d printing or by casting from a rubber master which may be made by 3d printing . an exemplary sacrificial wax mold 14 is shown in fig1 a and 14b . an emitter support 514 a may be placed into the wax mold 514 , and gel material may be injected into the wax mold and cured around the emitter support . the wax is then removed . the wax may be water - soluble and removed by dissolving in water . the sacrificial material may be another type of wax or plastic that can be removed by solvents and / or by heating . the wax mold 514 may be used to form the malleable element 120 or the gel portion 420 of the ear tips 100 , 400 , or 450 described above . the malleable element 120 or the gel portion 420 may be formed over the other components of the ear tips 100 , 400 , or 450 , such as the wires 160 , the output transducer 180 , or the hard shell or core 410 . as shown in fig1 a , 15b , and 15c , the ear tips , such as ear tip 450 , may be provided as a component of a complete ear tip assembly 500 . the inventor has fabricated and tested the complete ear tip assembly 500 shown in fig1 a , 15b , and 15c . the ear tip assembly 500 may comprise the ear tip 450 , the handle 455 , and a cable section 460 extending proximally or laterally outward from the ear tip 450 . when the ear tip 450 is placed in the ear canal , for instance , the cable section 460 may extend out of the ear canal to a “ behind the ear ” or bte unit ( not shown ) that contains microphone , speaker , battery and electronic signal processing capability . the bte unit may convert sound to a useful electrical signal that is delivered by cable section 460 to the output transducer 180 to generate an optical signal to a tympanic membrane receiver 350 , for example . fig1 a and 16b show another embodiment of the ear tips , for example , an ear tip 600 which comprises a thin shell or core . the thin shell may have a thickness of 50 to 500 μm and comprise silicone , for example . the ear tip 600 may comprise a shaft portion 610 and an ear canal contact portion 620 . the thin shell may define several openings for venting the ear canal , a shaft opening 612 of the shaft portion 610 , a central opening 614 defined between the shaft portion 610 and the ear canal contact portion 620 , and a plurality of channels 616 to be defined between the outer surfaces of relief or cut - away portions of the ear canal contact portion 620 and the inner wall of the ear canal . the channels or folds 616 also serve to reduce radial pressure of the tip on the ear canal wall and to increase conformability of the ear tip to different ear - canal cross - section shapes . the folds 616 allow the structure to bend to reduce the radial pressure , circumventing potential generation of larger hoop stresses and pressure that could occur without folds . the ear canal contact portion 620 may be cross - shaped to be aligned with the major and minor axes of the ear canal through ear canal wall contacting extensions 622 which may define the aforementioned relief or cut - away portions disposed between adjacent extensions 622 . the ear tip 600 may be fabricated by injecting material such as silicone or silicone rubber into a simple , 3 - d printed mold . section 610 may be variable in cross section and may hold one or more wires that connect a bte unit to a transducer . 610 may also be curved to follow the shape of the ear canal . a transducer may be located in the tip 612 . the leading ( medial ) edge of the tip may be curved to help facilitate easy insertion in the ear canal . one or more processors may be programmed to perform various steps and methods as described in reference to various embodiments and implementations of the present disclosure . embodiments of the systems of the present application may be comprised of various modules , for example , as discussed below . each of the modules can comprise various sub - routines , procedures and macros . each of the modules may be separately compiled and linked into a single executable program . it will be apparent that the number of steps that are utilized for such methods are not limited to those described above . also , the methods do not require that all the described steps are present . although the methodology described above as discrete steps , one or more steps may be added , combined or even deleted , without departing from the intended functionality of the embodiments . the steps can be performed in a different order , for example . it will also be apparent that the method described above may be performed in a partially or substantially automated fashion . as will be appreciated by those skilled in the art , the methods of the present disclosure may be embodied , at least in part , in software and carried out in a computer system or other data processing system . therefore , in some exemplary embodiments hardware may be used in combination with software instructions to implement the present disclosure . any process descriptions , elements or blocks in the flow diagrams described herein and / or depicted in the attached figures should be understood as potentially representing modules , segments , or portions of code which include one or more executable instructions for implementing specific logical functions or elements in the process . further , the functions described in one or more examples may be implemented in hardware , software , firmware , or any combination of the above . if implemented in software , the functions may be transmitted or stored on as one or more instructions or code on a computer - readable medium , these instructions may be executed by a hardware - based processing unit , such as one or more processors , including general purpose microprocessors , application specific integrated circuits , field programmable logic arrays , or other logic circuitry . while preferred embodiments have been shown and described herein , it will be obvious to those skilled in the art that such embodiments are provided by way of example only . numerous variations , changes , and substitutions will now occur to those skilled in the art without departing from the invention . it should be understood that various alternatives to the embodiments described herein may be employed in practicing the invention . by way of non - limiting example , it will be appreciated by those skilled in the art that particular features or characteristics described in reference to one figure or embodiment may be combined as suitable with features or characteristics described in another figure or embodiment . it is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby . | 7 |
complex logical circuits as considered here comprise several portions where signals are timed according to different clocks . in the following , boundaries between such portions are called clock boundaries . when a signal crosses a clock boundary in the logical circuit it is difficult to capture the signal if the two clocks involved are not in synchronicity . if a signal is comprised of many data bits , when the corresponding data makes transitions from value 1 to value 2 , there will be a finite amount of time where the signal can adopt a value other than value 1 or value 2 at the location of capture ( e . g . in a flip - flop ). for a 4 bit bus , if the data is changing from 0 to 3 the data could progress as 0 - 1 - 3 or as 0 - 2 - 3 depending on the relative timing delays seen on a data bus for each respective bit at the point of capture . fig1 illustrates a section of a circuit diagram having two portions with two clock domains designated d 1 and d 2 , respectively . in fig1 the different clock domains are separated by dashed lines . fig1 illustrates state of the art counter measures to reduce the probability of metastability in a logical circuit due to asynchronous clock domains . fig2 shows jitter elements additionally inserted at the entry portions of the respective clock domains d 1 , d 2 , as taught by the present invention . jitter elements according to the invention comprise delay elements and x generator elements . delay elements j 1 are added to introduce a predetermined timing delay which is exercised to the circuit via random selection . x generator elements j 2 are added to introduce predetermined signal values in the circuit which are generated by a pseudo - random number generator . the additionally introduced jitter elements bring real world effects into an ideal simulation , causing faults more likely to happen . the jitter elements consist of the same building blocks as the building blocks that are used to design the logical circuits themselves . jitter elements typically are inserted at any points where data is handed over different clock domains d 1 , d 2 . the insertion points may be determined by the circuit designer or automatically , e . g ., by the circuit development system . in the example described herein , two clock domains d 1 , d 2 are given . it is clear , that the example of two clock domains herein should not be understood as limiting the present invention . a circuit may comprise many clock domains , and thus many clock boundaries . the invention as described herein can be implemented in digital and / or analogous circuitry , in particular in computer hardware , software , or in combinations thereof . the invention can also be implemented in a computer program embodied in a computer storage device for execution by a programmable processor . method steps according to the invention can be performed by a programmable processor executing a program of instructions to perform functions of the invention by operating on the basis of input data , and by generating output data . the invention may be implemented in one or several computer programs that are executable in a computer system , which includes at least one programmable processor coupled to receive data from , and transmit data to , a storage system , at least one input device , and at least one output device , respectively . computer programs may be implemented in assembly or machine code , and / or in a high - level or object - oriented programming language . the computer program may be a language or code which is to be compiled before being executed by the processor , or be interpreted during execution by the processor . processors may include general and special purpose microprocessors . a processor receives instructions and data from memories , in particular from read - only memories and / or random access memories . a computer may include one or more storage devices for storing data ; such devices may include magnetic disks , such as internal hard disks and removable disks ; magneto - optical disks ; and optical disks . storage devices suitable for tangibly embodying computer program instructions and data include all forms of memory , including e . g . semiconductor memory devices , such as flash memories , eprom , eeprom ; magnetic disks such as hard disks ; magneto - optical disks ; cd - roms , and dvd roms . any of the foregoing can be supplemented by or incorporated in customized application - specific integrated circuits ( asics ). a computer may include a processor , memory coupled to the processor , a hard drive controller , a video controller and an input / output controller coupled to the processor by a processor bus . the hard drive controller is coupled to a hard disk drive suitable for storing executable computer programs , including programs embodying the present technique . the i / o controller is coupled by means of an i / o bus to an i / o interface . the i / o interface receives and transmits in analogue or digital form over at least one communication link . such a communication link may be a serial link , a parallel link , local area network , or wireless link ( e . g . an rf communication link ). a display is coupled to an interface , which is coupled to an i / o bus . a keyboard and pointing device are also coupled to the i / o bus . alternatively , separate buses may be used for the keyboard pointing device and i / o interface . the invention can be implemented on a computer system having a display device such as a crt monitor or lcd screen for displaying information to a user , and a keyboard and a pointing device such as a mouse or a trackball by which the user can provide input to the computer system . the computer system can be programmed to provide a graphical or text user interface through which computer programs interact with users . | 6 |
the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . hereinafter reference will now be made in detail to various exemplary embodiments of the present invention , examples of which are illustrated in the accompanying drawings and described below . while the invention will be described in conjunction with exemplary embodiments , it will be understood that present description is not intended to limit the invention to those exemplary embodiments . on the contrary , the invention is intended to cover not only the exemplary embodiments , but also various alternatives , modifications , equivalents and other embodiments , which may be included within the spirit and scope of the invention as defined by the appended claims . hereinafter , exemplary embodiments of the present invention will be described in detail below with reference to the accompanying drawings . that the term “ density ” as used herein refers to an extent to which the hollow fiber membranes each having a minute diameter come into close contact with each other or is spaced apart from each other . as shown in fig1 to 6 , a housing 101 of a membrane humidifier 100 is provided as a hollow structure , a supply port 102 for introducing a dry air and an outlet 103 for discharging the dry air after humidification are formed on both sides , an inlet 104 for the inflow of the wet air discharged from the fuel cell stack is formed at a first side end portion , and an outlet 105 for the discharge of the wet air with water removed after humidification is formed at a second side which is opposite to the first side . in particular , inside the housing 101 , a plurality of division modules 110 may have any cross - sectional shape among polygonal cross - sectional shapes , while having a structure that may be open in the lateral direction such that a hollow fiber membrane 106 of a bundle may form passes and may be mounted to contact with the wet air . furthermore , in each of the plurality of division modules 110 , sections may be divided by different numbers and may form one module and each division module 110 may be fixedly mounted in an inner space of a wet air inlet 104 side of a housing 101 , in an inner space of a wet air outlet 103 side , and in a space between the wet air inlet 104 and the outlet 105 , respectively . particularly , when dividing the polygon having the same cross - sectional area into several sections more than two sections as compared to the case of dividing it into two sections , since the space in which the hollow fiber membrane bundle provided internally is reduced , the density of the hollow fiber membranes may be diversely distributed according to each divided space . for example , when the division module is divided into two sections , the inner space thereof and the spacing between the hollow fiber membranes may be wide , and thus the density may be low . when the division module is divided into two or more sections , the inner space thereof and the pacing between the hollow fiber membranes may decrease and be less than the division module divided into two sections , and thus the density may increase . as such , by diversely adjusting the density in the length direction of the hollow fiber membranes in this way , changes in the differential pressure and the velocity rate of the wet air flowing around the hollow fiber membrane may be induced for each division module . accordingly , the humidification efficiency of the dry air may be improved by allowing the wet air to uniformly penetrate to the central part of the hollow fiber membrane bundle in each division module . hereafter , a device for adjusting a hollow fiber membrane density for a membrane humidification device of a fuel cell according to the present invention will be described in more detail below through each example . fig1 illustrates an exemplary device for adjusting a hollow fiber membrane density for an exemplary membrane humidification device of a fuel cell according to a first example of the present invention . as illustrated in fig1 , the division module 110 may be constituted by a first division module 111 that may be divided into two sections and may be mounted to the interior of the wet air inlet 104 side of the housing 101 ; a second division module 112 that may be divided into four sections and may be mounted in a space between the wet air inlet 104 and outlet 105 of the housing 101 ; and a third division module 113 that may be divided into six sections and may be mounted to the interior of the wet air outlet 105 side of the housing 101 . particularly , on an inner - diameter surface of the housing 101 , a support stage 120 may be integrally formed to form a joint groove 122 such that a first end portion of the division module 110 may be fitted therein . as such , the first end portion of the division module 110 including the first , second , and third division modules 111 , 112 , and 113 may be fixedly fitted to the joint groove 122 of the support stage 120 inside the housing 101 . moreover , the first , second , and third division modules 111 , 112 , and 113 forming the division module 110 may be provided as a circular hollow case shape , while having a structure that may be open in the lateral direction such that the hollow fiber membranes 106 of the bundle type may pass . further , the first division module 111 may be provided as the hollow case structure having a semi - circular cross - section in which a circle may be laterally bisected ; the second division module 112 may be provided as the hollow case structure in which a circle may be divided into four sections along the vertical direction and may be equally arranged along the lateral direction ; and the third division module 113 may be provided as the hollow case structure in which a circle may be divided into six sections in the vertical circle and may be equally arranged along the lateral direction . wet air induction apertures 114 may be formed through four - side wall surfaces of the first division module 111 and the third division module 113 , such that after the wet air discharged from the fuel cell stack may flow into the wet air inlet 104 of the housing 101 , the wet air easily may flow toward the hollow fiber membrane of the division module . accordingly , since the first division module 111 of two - sections , the second division module 112 of four - sections , and the third division module 113 of six - sections are sequentially mounted from the interior of the wet air inlet 104 side of the housing 101 to the interior of the outlet 105 side , the density of the hollow fiber membranes may gradually increase . as such , since the space in the first division module 111 is divided into two sections and the spacing between the hollow fiber membranes is wide , the density may be low . since the space in the second division module 112 divided into four sections is less than the first division module and the spacing between the hollow fiber membranes is less than the first division module , the density may increase . further , since the space in the third division module 113 is divided into six sections and the spacing between the hollow fiber membranes is less than the second division module 112 , the density may further increase . when the wet air discharged from the fuel cell stack flows into the wet air inlet 104 of the housing 101 and the wet air flows around the hollow fiber membranes 106 of the first to third division modules 111 , 112 , and 113 , due to a change in density as described above , changes in the pressure difference and the velocity of the wet air may occur for each of the first to third division modules 111 , 112 , and 113 , and eventually , and thus , the wet air may uniformly spread around each hollow fiber membrane . in addition , when the dry air flows along the interior of the hollow fiber membrane 106 , the moisture separated from the wet air by capillary action may move to interior of the hollow fiber membranes 106 to humidify the dry air . according to the first example of the present invention , changes in differential pressure and velocity of the wet air flowing around the hollow fiber membranes may be induced for each of the first to third division modules 111 , 112 , and 113 by gradually increasing the density in the length direction of the hollow fiber membranes 106 for each of the first to third division modules 111 , 112 , and 113 . further , the humidification efficiency of the dry air may be improved by allowing the wet air in response to uniformly penetrate to the central part of the hollow fiber membrane bundle in each division module . fig2 illustrates an exemplary device for adjusting a hollow fiber membrane density for an exemplary membrane humidification device of a fuel cell according to a second example of the present invention . as illustrated in fig2 , a division module 110 according to a second example of the present invention may be configured in the same manner as the division module of the above - described first exemplary embodiment ; however , the third division module 113 may be configured to be same as the first division module 111 . accordingly , the division module 110 according to the second exemplary embodiment of the present invention may be constituted by a first division module 111 that may be divided into two sections and may be mounted to the interior of the wet air inlet 104 side of the housing 101 ; a second division module 112 that may be divided into four sections and may be mounted to a space between the wet air inlet 104 and the outlet 105 of the housing 101 ; and a third division module 113 that may be divided into two sections and may be mounted to the interior of the wet air outlet 105 side of the housing 101 . the first division module 111 may be provided as a hollow case structure having a semi - circular cross - section in which a circle may be laterally bisected , the second division module 112 may be provided as a hollow case structure in which a circle may be divided into four sections along the vertical direction and may be equally arranged along the lateral direction , and the third division module 113 may be provided as a hollow case structure having a semi - circular cross - section in which a circle may be laterally bisected in the same manner as the first division module 111 in the second exemplary embodiment . thus , since the first division module 111 of two - sections , the second division module 112 of four - sections , and the third division module 113 of two - sections may be sequentially mounted from the interior of the wet air inlet 104 side of the housing 101 to the interior of the outlet 105 side , the density of the hollow fiber membranes may increase and subsequently decrease . for example , since the space in the first division module 111 is divided into two sections , the spacing between the hollow fiber membranes is wide , the density may be low . in addition , since the space in the second division module 112 is divided into four sections and the spacing between the hollow fiber membranes is less than the first division module , the density may increase . in the third division module 113 , the space is divided into two sections like the first division module 111 , the density may decrease again . according to the second exemplary embodiment of the present invention , changes in differential pressure and velocity of the wet air flowing around the hollow fiber membrane for each of the first to third division modules 111 , 112 , and 113 may be induced by increasing and then decreasing the density in the length direction of the hollow fiber membranes 106 for each of the first to third division modules 111 , 112 , and 113 , and thus , the humidification efficiency of the dry air may be improved by allowing the wet air to uniformly penetrate to the central part of the hollow fiber membrane bundle in each division module . fig3 illustrates an exemplary device for adjusting a hollow fiber membrane density for an exemplary membrane humidification device of a fuel cell according to a third exemplary embodiment of the present invention . as illustrated in fig3 , a division module 110 according to the third example of the present invention may be configured in the same manner as the division module of the first exemplary embodiment as described above , but each division module may be provided as is a hollow case having a rectangular cross - section . the first division module 111 may be provided as a hollow case structure having a square cross - section in which a rectangle may be laterally bisected ; the second division module 112 may be provided as a hollow case structure in which a rectangle may be divided into four sections along the vertical direction and may be equally arranged along the lateral direction ; and the third division module 113 may be provided as a hollow case structure in which a rectangle may be divided into eight sections along the vertical direction and may be equally arranged along the lateral direction . accordingly , since the space in the first division module 111 is divided into two sections and the spacing between the hollow fiber membranes is wide , the density may be low . since the space in the second division module 112 is divided into four sections and the spacing between the hollow fiber membranes is less than the first division module , the density may increase . further , since the space in the third division module 113 is divided into eight sections and the spacing between the hollow fiber membranes is less than the second division module 112 , the density may further increase . according to the third example of the present invention , changes in differential pressure and velocity of the wet air flowing around the hollow fiber membrane for each of the first to third division modules 111 , 112 , and 113 may be induced by gradually increasing the density in the length direction of the hollow fiber membranes 106 for each of the first to third division modules 111 , 112 , and 113 , and thus , the humidification efficiency of the dry air may be improved by allowing the wet air to uniformly penetrate to the central part of the hollow fiber membrane bundle in each division module . fig4 illustrates an exemplary device for adjusting a hollow fiber membrane density for an exemplary membrane humidification device of a fuel cell according to a fourth exemplary embodiment of the present invention . as illustrated in fig4 , a division module 110 according to the fourth example of the present invention may be configured in the same manner as the division module of the above - described third exemplary embodiment , but third division module 113 may be configured to be same as the first division module 111 . the first division module 111 may be provided as a hollow case structure having a square cross - section in which a rectangle may be laterally bisected , the second division module 112 may be provided as a hollow case structure in which a rectangle may be divided into four to eight sections along the vertical direction and may be equally arranged along the vertical and lateral direction , and the third division module 113 may be provided as a hollow case structure having a square cross - section in which a rectangle may be laterally bisected in the same way as the first division module 111 . since the space in the first division module 111 is divided into two sections and the spacing between the hollow fiber membranes is wide , the density may be low . in addition , since the space in the second division module 112 is divided into four or more sections and the spacing between the hollow fiber membranes is less than the first division module , the density may increase . further , since the space in the third division module 113 is divided into two sections as the first division module 111 , the density may decrease again . according to the fourth exemplary embodiment of the present invention , changes in differential pressure and velocity of the wet air flowing around the hollow fiber membrane for each of the first to third division modules 111 , 112 , and 113 may be induced by increasing and then decreasing the density in the length direction of the hollow fiber membranes 106 for each of the first to third division modules 111 , 112 , and 113 , and thus , the humidification efficiency of the dry air may be improved by allowing the wet air to uniformly penetrate to the central part of the hollow fiber membrane bundle in each division module . fig5 illustrates an exemplary device for adjusting a hollow fiber membrane density for an exemplary membrane humidification device of a fuel cell according to a fifth exemplary embodiment of the present invention . a division module 110 according to the fifth example of the present invention may be configured in the same manner as the division module of the above - described first example , but the third division module 113 may be arranged in a direction perpendicular to the first division module 111 . the first division module 111 may be provided as a hollow case structure having a semi - circular cross - section in which a circle may be laterally bisected , the second division module 112 may be provided as a hollow case structure in which a circle may be divided into four sections along the vertical direction and may be equally arranged along the lateral direction , and the third division module 113 may be provided as a hollow case structure in which a circle may be divided into six sections along the lateral direction and may be equally arranged along the vertical direction . since the space in the first division module 111 is divided into two sections and the spacing between the hollow fiber membranes is wide , the density may be low . in addition , since the space in the second division module 112 is divided into four sections and the spacing between the hollow fiber membranes is less than the first division module , the density may increase . further , since the space in the third division module 113 is divided into six sections and the spacing between the hollow fiber membranes is less than the second division module 112 , the density may further increase . as described above , according to the fifth exemplary embodiment of the present invention , changes in differential pressure and velocity of the wet air flowing around the hollow fiber membranes for each of the first to third division module 111 , 112 , and 113 may be induced by gradually increasing the density in the length direction of the hollow fiber membranes 106 for each of the first to third division modules 111 , 112 , and 113 . in particular , since the third division module 113 is arranged in a direction perpendicular to the first and second division modules 111 and 112 , the direction of the flow of the wet air may be induced so as to change in the third division module 113 , and thus , the humidification efficiency of the dry air may be improved by allowing the wet air to uniformly penetrate to the central part of the hollow fiber membrane bundle of each division module . fig6 illustrates an exemplary device for adjusting a hollow fiber membrane density for an exemplary membrane humidification device of a fuel cell according to a sixth exemplary embodiment of the present invention . a division module 110 according to the sixth example of the present invention may be configured in the same manner as the division module of the above - described second example , but the third division module 113 may be arranged in a direction perpendicular the first division module 111 as described in the fifth exemplary embodiment . accordingly , the first division module 111 may be provided as a hollow case structure having a semi - circular cross - section in which a circle may be laterally bisected , the second division module 112 may be provided as a hollow case structure in which a circle may be divided into four sections along the vertical direction and may be equally arranged along the lateral direction , and the third division module 113 may be provided as a hollow case structure having a semi - circular cross - section in which a circle may be vertically bisected . as such , since the space in the first division module 111 is divided into two sections and the spacing between the hollow fiber membranes is wide , the density may be low . in addition , since the space in the second division module 112 is divided into four sections and the spacing between the hollow fiber membranes is less than the first division module , the density may increase . further , since the space in the third division module 113 is divided into two sections and the spacing between the hollow fiber membranes is as wide as the first division module 111 , the density may decrease again . according to the sixth exemplary embodiment of the present invention , changes in differential pressure and velocity of the wet air flowing around the hollow fiber membranes for each of the first to third division modules 111 , 112 , and 113 may be induced by increasing and then decreasing the density in the length direction the hollow fiber membranes 106 for each of the first to third division modules 111 , 112 , and 113 . in particular , since the third division module 113 is arranged in a direction perpendicular to the first and second division modules 111 and 112 , the flow direction of the wet air is induced such that the flow direction in the third division module 113 may change . as consequence , the humidification efficiency of the dry air may be improved by allowing the wet air to uniformly penetrate to the central part of the hollow fiber membrane bundle in each division module . the invention has been described in detail with reference to various exemplary embodiments thereof . however , it will be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the invention , the scope of which is defined in the appended claims and their equivalents . | 7 |
fig1 schematically illustrates a cooling system 20 associated with a controller 22 . in this example , the controller 22 is in electrical communication with a starter / generator 24 , which is mechanically coupled to a gas turbine engine 26 . to start the gas turbine engine 26 , power from the controller 22 is directed to the starter / generator 24 . the starter / generator is mechanically coupled to a shaft of the gas turbine engine 26 , and is configured to rotate the shaft to begin operation the gas turbine engine 26 . after operation begins , the starter / generator 24 acts as a generator , and directs power to the motor controller 22 for distribution throughout an aircraft , for example . while a particular system 20 is illustrated and discussed herein , this disclosure extends to other types of controllers 22 . in particular , this application extends to controllers that are not used with starter / generators . the controller 22 includes a variety of different electronic components . the various electronic components each have different maximum operating temperatures , which are predetermined ( often by the manufacturer of the particular component ) and known . if operating above the maximum operating temperate , the components may fail . at a minimum , performance may suffer . in order to cool the electronic components in the controller 22 , the components are mounted , either directly or indirectly , to a cold plate 28 . the cold plate 28 includes at least one cooling passageway 30 therein . the passageway 30 includes an inlet 32 in fluid communication with a source 33 of cooling fluid f . in this example , the cooling fluid f is fuel that will ultimately be combusted in the gas turbine engine 26 . this disclosure is not limited to embodiments where the cooling fluid f is fuel , although this disclosure may have particular benefits in that instance , as will be appreciated from the below . other example cooling fluids include liquid dielectrics and glycol coolants . the passageway 30 further includes a fluid outlet 34 , which directs the cooling fluid f downstream from the cold plate 28 and , in this example , ultimately to the gas turbine engine 26 for combustion . as the fluid f flows through the cold plate 28 , the fluid f absorbs heat from the electronic components mounted to the cold plate 28 . the increase in the temperature of the fluid f ( by virtue of the fluid f flowing through the passageway 30 ) is desirable and leads to more efficient combustion in the gas turbine engine 26 . in one example , the temperature of the fluid f at the inlet 32 may be about 93 ° c . ( 197 . 6 ° f .). in that example , the temperature of the fluid f at the outlet 34 may be about 101 ° c . ( 213 . 8 ° f .). some of the electronic components in the controller 22 are adequately cooled by the fluid f flowing through the cold plate 28 alone . however , the controller 22 includes some components with a lower maximum operating temperature that require additional , local cooling . the controller 22 includes at least one power module 36 ( there are three power modules 36 a - 36 c in one example , see fig2 ) and at least one magnetic component 38 , each of which are directly mounted to the cold plate 28 . in this example , the power modules 36 and the magnetic components 38 may have maximum operating temperatures of 150 ° c . ( 302 ° f .). thus , these components are adequately cooled by being directly mounted to the cold plate 28 . as illustrated , the power module 36 is directly mounted to an upper surface of the cold plate 28 , and the magnetic component 38 is directly mounted to a lower surface of the cold plate 28 . the terms “ upper ” and “ lower ” are used herein with respect to the orientation of the cold plate 28 in fig1 , and are not intended to otherwise be limiting . further , the term “ directly mounted ” in this disclosure does not preclude an intermediate thermal paste or compound between components . rather , as will be appreciated from the below , “ directly mounted ” means that the components are mounted to the cold plate 28 without an intermediate thermoelectric cooler . the controller 22 further includes a plurality of electronic components that require additional cooling , such as capacitors 40 and printed wire boards 42 ( pwbs ). in this example , the capacitors 40 may have a maximum operating temperature of 65 ° c . ( 149 ° f . ), and the pwbs 42 may have a maximum operating temperature of 100 ° c . ( 212 ° f .). in order to provide additional cooling to the components that are rated substantially near , or below , the temperature of the cooling fluid f , intermediate thermoelectric coolers ( tecs ) 44 , 46 are provided between these components and the cold plate 28 . thus , these components are not “ directly mounted ” to the cold plate . the tecs 44 , 46 , may be known types of thermoelectric coolers . tecs operate by the peltier effect , and include hot nodes 44 h , 46 h , and cold nodes 44 c , 46 c . when current flows through a tec , the current brings heat from the cold nodes 44 c , 46 c of the device to the hot nodes 44 h , 46 h , so that one side gets cooler while the other gets hotter . in some embodiments , multiple coolers can be cascaded together to achieve additional cooling . in the example of fig1 , a first tec 44 is directly mounted to an upper surface of the cold plate 28 . in turn , in order to further insulate the capacitors 40 from the cold plate 28 , a base plate 48 is mounted to the first tec 44 . the capacitors 40 are mounted to a capacitor support plate 50 , which is connected to the base plate 48 by way of a plurality of bus bars 52 . the bus bars 52 provide a buffer ( or , space ) 54 between the base plate 48 and the capacitor support plate 50 . the buffer 54 prevents additional , conductive heat transfer from the base plate 48 and provides an appropriate level of thermal insulation for the capacitors 40 . in this example , a second tec 46 directly contacts a lower surface of the cold plate 28 . the second tec 46 is connected to a first pwb support plate 56 . the pwbs 42 are supported between the first pwb support plate 56 and a second pwb support plate 58 opposite the first pwb support plate 56 . as illustrated , the hot nodes 44 h , 46 h of the first and second tecs 44 , 46 are directly mounted to the cold plate 28 . the cold nodes 44 c , 46 c are opposite the cold plate 28 . thus , the tecs 44 , 46 direct heat away from the electronic components and toward the cooling fluid f . each of the first and second tecs 44 , 46 are in communication with a control unit c . the control unit c is in communication with first and second temperature sensors 60 , 62 , which provide information to the control unit c indicative of the temperature of the capacitors 40 and the pwbs 42 , respectively . the control unit c then provides an appropriate level of current to the first and second tecs 44 , 46 to adjust the cooling of the capacitors 40 and pwbs 42 . while illustrated separately , the control unit c could be incorporated into the controller 22 . fig2 is a top , schematic view of the controller 22 . as illustrated in fig2 , the inlet 32 and outlet 34 of the passageway 30 may be provided on the same side of the cold plate 28 ( while not illustrated that way in fig1 ). additionally , the inlet 32 and outlet 34 may include quick connect fittings . further , in order to thermally insulate the electronic components that require additional cooling , the cold plate 28 includes a cutout 64 substantially extending along the entire width w of the cold plate 28 . the cutout 64 extends through the entire thickness t of the cold plate 28 ( see fig1 ) and essentially separates the cold plate 28 along its length l into a relatively high temperature components side ( e . g ., the left side , relative to fig2 , of the cutout 64 ) and a relatively low temperature components side ( e . g ., the right side of the cutout 64 ). the cutout 64 does not obstruct the flow of cooling fluid f through the cold plate 28 . the cold plate 28 includes narrow portions 66 , 68 that allow a flow of cooling fluid f on opposite ends of the cutout 64 . the heat conducted through the cold plate 28 ( e . g ., from the left side to the right side ) is limited to the relatively narrow portions 66 , 68 , which substantially impedes heat transfer from the relatively high temperature components to the relatively low temperature components on the opposite side of the cutout 64 . the disclosed arrangement of the motor controller 22 allows for higher cooling fluid f inlet temperatures , and a correspondingly higher cooling fluid f outlet temperatures . thus , the disclosed arrangement increases combustion efficiency without compromising the operation of the electric components that require additional cooling . although the different examples have the specific components shown in the illustrations , embodiments of this disclosure are not limited to those particular combinations . it is possible to use some of the components or features from one of the examples in combination with features or components from another one of the examples . one of ordinary skill in this art would understand that the above - described embodiments are exemplary and non - limiting . that is , modifications of this disclosure would come within the scope of the claims . accordingly , the following claims should be studied to determine their true scope and content . | 5 |
before explaining the disclosed embodiments of the present invention in detail it is to be understood that the invention is not limited in its application to the details of the particular arrangement shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . this invention is a continuation - in - part of u . s . application ser . no . 10 / 010 , 534 filed dec . 7 , 2001 , which is incorporated by reference . [ 0075 ] fig2 shows a stylette 50 with an upwardly protruding tip end 56 having a threaded upper surface 57 and upper surface base portion 58 that can be used with the subject invention . stylette 50 can include a longitudinal portion 54 , and a lower end 52 that can be grabbed by the practitioner using the stylette 50 . the stylette 50 can be formed from a semi - rigid wire type material such as but not limited to metal wire , plastic , combinations , thereof , and the like . [ 0076 ] fig3 shows a catheter 60 having exterior slit ( s ) 65 and with head member portion 70 in the upper end 66 of the catheter 60 having downwardly protruding threaded portion and fixed interior ring member 80 having interior threads 83 . [ 0077 ] fig4 shows the stylette 50 of fig2 being inserted into the catheter 60 of fig3 and moved in the direction of arrow i 1 . fig5 shows another view of fig4 with the tip end 56 of the stylette 50 being moved in the direction of arrow i 2 , passing through the ring member 80 of the catheter . fig6 shows another view of fig5 with the tip end 56 of the stylette 50 located between the ring member 80 and the head member 70 passing in the direction of arrow i 3 within the catheter 60 . fig7 shows a cross - section of the stylette 50 , catheter 60 , ring member 80 and head member 70 of fig6 . [ 0078 ] fig8 shows another view of fig6 - 7 with the tip end 56 and threaded portion 57 of the stylette 50 screwing into the downwardly protruding hollow threaded tip end 75 of the head member 70 in the catheter 60 by rotating in a clockwise direction r 1 . [ 0079 ] fig9 shows another view of fig8 with the tip end base portion 58 of the stylette 50 attached to the head member 70 of the catheter 60 , where the base portion 58 having a wider diameter than the outer diameter of the inwardly facing threaded portion 77 that it abuts against the lower portion thereof . fig1 shows a cross - sectional view of fig9 . referring to fig9 - 10 , the head member 70 can include two parts a partially freely rotatable portion 71 , 74 , 77 , and a fixed ring portion 78 the latter of which can be fixably attached ( adhered ) to the inner walls of the upper end 66 of the catheter tube 60 . upper and lower ledges 71 , 77 allow for some rotation of central member 71 , 72 , 74 , and 77 . during use of the novel catheter assembly , the catheter 60 with internal attached stylette 50 can be inserted into a urethra portion of the bladder of a patient that is going to be catheterized ( which will be described in detail in reference to fig1 , 16 a - 16 c ). [ 0081 ] fig1 the head member 70 of fig9 - 10 after being pulled by the base portion 52 of the stylette 50 in the direction of arrow p 1 toward the ring member 80 . fig1 is a cross - sectional view of fig1 . the slits ( 65 , 66 shown in fig3 - 4 ) in the sides of the catheter 60 expand outward and form wing portions 68 [ 0082 ] fig1 is another view of the head member 70 of the stylette 50 of fig1 - 12 being pulled in the direction of arrow p 2 in a final compressed position . fig1 is a cross - sectional view of fig1 . the stylette 50 can be rotated in a counter - clockwise direction as shown by arrow r 2 , allowing the lower external threaded surface 73 of the head member 70 to rotate within the internal threaded walls 83 of ring member 80 , the latter of which is fixably attached to the inside of the catheter tube 60 . after the head member 70 as become lockably attached to ring member 80 , the upper threaded tip portion 57 of the stylette 50 can be further rotated in the direction of arrow r 2 allowing the stylette 50 to become separated from the both the head member 70 and ring member 80 and then pulled in the direction of arrow p 3 out from the opposite end 62 of the catheter tube 60 . [ 0083 ] fig1 shows the novel catheter 60 of preceding figures after being inserted into the urethra portion 14 of a bladder 10 . here , the stylette 50 is part of the catheter 60 . [ 0084 ] fig1 a shows another view of the novel catheter 60 in the bladder of fig1 with the wing portions 68 ′ of the catheter 60 expanded within the bladder . fig1 b is an enlarged view of the expanded wing portions 68 ′ of the catheter 60 of fig1 a . as previously described in reference to fig1 - 14 , the stylette 50 is removed before the catheter tube 60 is used for bladder drainage status . [ 0085 ] fig1 c is a cross - section of the urethra 14 and catheter 60 of fig1 a while the catheter tube 60 is being used in a drainage state . as shown the urethra 14 is temporarily in an open fluid passage state . [ 0086 ] fig1 d is a cross - section of the urethra 14 and catheter tube 60 of fig1 a while the catheter tube 60 ′ is in a collapsed non drainage state within the urethra 14 ′. the catheter tube 60 ′ conforms to a closed passageway 15 ′ of closed urethra 60 ′. referring to fig1 c - 16 d , these views further detail the thinner catheter tube 60 that can be used instead of the thick walled catheter tube ( 5 shown in fig1 b ) of the prior art . the novel catheter tube can have an outer diameter of approximately ¼ of an inch with a wall thickness of approximately 0 . 0055 inches , thus allowing for almost an approximate ¼ inch inner diameter flow through portion for the catheter tube 60 . unlike the thick walled limited drainage passageways , of the prior art , the novel catheter tube 60 more closely approximates the natural diameter size passageway 15 of the urethra 14 . additionally , unlike the prior art , the novel catheter 60 of the subject invention can conform to a closed passageway 15 ′ of a closing state urethra 60 ′. thus , the subject invention does not continuously stretch the urethra , nor cause continuous pain to the catheterized patient , nor cause all the other negative effects by known types of catheters that were described in the background section of the subject invention . [ 0090 ] fig1 is a cross - sectional view of a first embodiment 100 of a magnetic cycling piston valve 130 in a closed position in a catheter 60 for controlling bladder drainage . fig1 a is another view of the valve 130 of fig1 in an open position . fig1 b is a top view of the retainer 132 of the valve 130 of fig1 a along arrow 18 b . referring to fig1 and 18a - 18 b , an upper nonmagnetic ring member 110 such as flexible plastic , and the like , can be fixably attached to an inner wall 61 of the catheter tube 60 , the latter of which can be the catheter tube 60 described in reference to the preceding figures . lower ring 120 can be a flexibly pliable permanent magnetic ring hat is fixably attached to the inner wall 61 of the catheter tube 60 beneath the nonmagnetic ring 110 . the moveably piston 130 can include a thin retainer portion 132 such as a single perpendicular portion having one or two ends which can rest on the top 112 of upper ring 110 . as shown in fig1 b , the retainer 132 is thin enough to allow fluid to pass about the retainer through the openings defined by the ring members 110 , 120 . the ring member 110 , 120 used can have thin wall thicknesses so as not to obstruct the passageway formed by the inner walls 61 of the catheter tube 60 . attached perpendicular to and extending below retainer 132 can be a thin longitudinal shaft 134 such as a flexible plastic strip , and the like . attached beneath shaft 134 can be a stopper 136 formed from a magnetic material that is attracted to lower magnet ring 120 , or a metal material that is attracted to lower magnetic ring 120 , and the like . alternatively , the stopper 136 can be a magnetic material and the lower ring member 120 can be a metal material that are attracted to each other . inwardly slanting sides 137 on the stopper 136 can allow for the stopper 136 to be substantially sealed against the opening in lower ring member 120 . referring to fig1 and 18a - 18 b , in operation fluid flowing in the direction of arrow f 1 can push the stopper 136 in a downward direction as shown by arrow m 1 causing the stopper 137 to separate from the lower ring member 120 . the magnetic attraction of the lower ring member 120 and stopper 132 can be calibrated to be approximately equal to natural bladder drainage pressure flows . for example , approximately 0 . 1 ounces per square feet or approximately 15 cm height of h2o fluid in the catheter tube 60 can be calibrated to be enough to push open the seated stopper 36 of fig1 to the positions shown in fig1 a . [ 0093 ] fig1 is a cross - sectional view of a magnetic cycling embodiment 200 using a funnel / flap valve 201 in a closed position within a catheter 60 for controlling bladder drainage . fig2 is another view of the valve 201 of fig1 in an open position . referring to fig1 - 20 , magnetic valve embodiment 200 can include a pliable thin walled ring member 210 , such as pliable plastic and the like , fixably attached to an inside wall portion 61 of the novel catheter tube 60 . attached to an extending downward from the ring member 210 can be funnel portions 220 , 230 that can be formed from two thin pliable flaps having a lower end portions with small pliable type magnets 225 , 235 attached thereto that be attracted to each other closing off the passageway formed from the opening through ring member 210 which can give the appearance of a funnel shape , and the like . alternatively , the funnel portions 220 , 230 can be single pliable cylindrical chamber such as thin walled plastic , a plastic bag , and the like , that can have a wall thickness of approximately 0 . 001 inches , and the like . although two magnets 125 , 135 are described , the invention can be used with one magnet 125 and a portion 135 having metal attributes and the like . similar to the preceding embodiment , the ring member 210 and funnel portions 220 , 230 can include thin enough walls not to reduce the opening formed by the inner walls 61 of the catheter tube 60 . the magnetic attraction of the portions 225 , 235 of the funnel portions 220 , 230 can be calibrated to be approximately equal to natural bladder drainage pressure flows . for example , approximately 0 . 1 ounces per square feet or approximately 15 cm height of h2o fluid in the catheter tube 60 pushing in the direction of arrow f 2 can be calibrated to be enough to push open the funnel of fig1 to the positions shown in fig2 . [ 0096 ] fig2 is a cross - sectional view of an electret cycling valve embodiment 300 in a closed position within a catheter 60 for controlling bladder drainage . fig2 is another view of the valve 301 of fig2 in an open position . here a pliable thin walled ring member 310 can be fixably attached to an inner wall surface 61 of catheter tube 60 . extending below ring member 310 can be two electret material sheets 320 , 330 such as flexible plastic sheets imbedded with electric charges . for example , sheet 320 can include a positive charge on the inner surface of lower end 322 and sheet 330 can include a negative charge an inner surface of lower end 332 . similar to the preceding embodiment the sheets 320 , 330 can form a funnel shape that can open and close the passageway formed by inner walls 61 of the catheter tube 60 . the electret attraction of the portions 322 , 332 of the funnel portions 320 , 330 can be calibrated to be approximately equal to natural bladder drainage pressure flows . for example , approximately 0 . 1 ounces per square feet or approximately 15 cm height of h2o fluid in the catheter tube 60 pushing in the direction of arrow f 3 can be calibrated to be enough to push open the funnel of fig2 to the position shown in fig2 . [ 0098 ] fig2 shows a top view of a urocycler embodiment 400 for use with the catheter tube 60 of the preceding figures . fig2 a is a side cross - sectional view of the urocycler embodiment 400 of fig2 . fig2 b is a cross - sectional view of the embodiment 400 of fig2 a along arrow 24 b . embodiment 400 can use the urocycler components described in parent u . s . application ser . no . 10 / 010 , 534 filed dec . 7 , 2001 , which is incorporated by reference , and can include inlet barbed connector 402 and outlet barbed connector 404 attached to opposite ends of main nonmagnetic housing 420 , the latter of which can have a male pronged end 424 which snapably and sealingly attaches to a female prong end 422 . a vent hole port 426 can be located on the downstream end of male housing portion 424 . inside the upstream portion 422 of housing 420 can be a fixed valve member 432 being formed of a magnetic member , and the like , fixed in position adjacent to a hollow valve port ring 434 whose center flow passageway can be opened and closed by moveable valve member 438 with resilient valve seat 436 which can move forward and backward in the direction of double arrow mg along inner channel rails 439 so as to open and close the valve in a cycling manner similar to those embodiments previously described . a manual override for the valves can be accomplished by selectively distancing an externally positioned magnetic member 440 from the moveable magnet member 438 . the override gives flexibility of pressure adjustment and provides the opportunity of assuring full drainage when desired by either physician or the patient . this could manifest itself , in the event of excessive discharge of viscous matter or other mode of lumen blockage , as a “ safety ” valve to relieve fluid pressure buildup . this override feature can be used with the previous embodiments by using either an external magnet or an external electret member . this urocycler embodiment can include a novel sampling port 410 formed about a port housing 412 , with an inner port surface having with inwardly protruding steps 415 so that a like sized and fitted elastomer shaped plug member 411 can be mateably attached thereto . port 410 can include an elastomer plug shape that is continuously self - sealing after being punctured by needles and the like . in operation , a practitioner can attach the inlet barbed connector 402 to the exposed lower conical shaped end ( 69 for example in fig1 ) of the catheter tube 60 , and the barbed outlet port 404 of embodiment 400 to a collection bag , and the like . during a urine drainage cycle , the practitioner can swab the outside surface of the elastomeric plug shaped membrane 410 with an antiseptic , and the like . a needle ( cannula ) or syringe or other sampling device can be inserted through the center of the sampling port 410 and a fresh sample of urine can be drawn . after which , the syringe / cannular can be withdrawn , the self - sealing elastomeric plug becomes sealed again , and the sampling port 410 can be swabbed with antiseptic . the catheter can include an anti - microbial surface such as an interior coating and / or outside coating . alternatively , the ant - microbial surface can be caused from an impregnated material which leaches to either or both the inside and / or the outside of the catheter tube . the anti - microbial surface and be an anti - bacterial material , and / or a hydrophyllic material that is compatible with the skin and will not support bacterial growth . materials that can be used include but are not limited to silver alloy , and the like . although the catheter tube 60 is described as being used with the magnetic cyclers of the preceding figures , the novel magnetic cyclers can be used inside other types of catheter tubes such as those described in the background section of the invention . although the invention describes the catheters for use as a suprapubic type by passing through the urethra , the invention can be used with other types of catheter uses such as but not limited to renal catheters , cardiology catheters , and the like . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended . | 0 |
in the inventive method , apparatus and workflow a degree of correspondence between a virtual angiography from a cfd simulation and a real angiography scene is determined and this degree of correspondence is used to purposefully and iteratively optimize the cfd simulation . this degree of correspondence is based on the comparison between a virtual angiography and a real angiography from identical angulation and adjusted recording geometry of the individual patient . the inventive determination of the degree of correspondence in 2 - d is an alternative approach to sun et al . [ 4 ]. output data for this degree of correspondence is dynamic angiography scenes , which show the diffusion or passage of the contrast agent through the corresponding vascular system . the virtual dynamic angiography s * ( the values indicated by * always relate in the following to the data derived from the virtual angiography ) is obtained by means of cfd simulation . the time intensity curves tic i , j and tic * i , j are now obtained from these two scenes s and s * for each pixel ( or combination of several pixels ). in the next step one or also more characteristic variables can be extracted from these time intensity curves , as described in “ parametric color coding of digital subtraction angiography ” by strother et al . [ 5 ]. these can be time values and / or intensity values or intensity values at defined times . fig2 shows by way of example a time intensity curve ( tic ) with drawn - in characteristic variables , in which the blood flow is plotted as intensity i over time t . after a noise - like behavior of the bolus curve 10 the intensity i climbs to the intensity maximum 11 ( i max ), in order then to drop back to a noise level . the bolus curve 10 is furthermore characterized by its half - width 12 ( fwhm — full width at half maximum ), which lies between the mean rise and the mean drop of the bolus curve . the arrival time 13 ( t rise ) is the time that elapses until the occurrence of the contrast agent bolus at the point under examination and thus until the rise in the bolus curve 10 . the mean rise time 14 ( t rise , fwhm ) is the time that elapses until the occurrence of the half - width 12 of the bolus curve 10 , i . e . until the bolus curve 10 has reached half of the intensity maximum 11 ( i max ). the time until the intensity maximum 11 ( i max ) is called the maximum time 15 ( t max ). the rise time 16 or wash - in time ( t wash in ) characterizes the steep rise in the bolus curve 10 . the drop in the bolus curve 10 is characterized by the drop time 17 or wash - out time ( t wash out ). the duration of the occurrence of the contrast agent bolus is characterized by the bolus or maximum time 18 ( t peak ). in the following let t i , j or t * i , j be the extracted variable for each pixel i , j from both angiographies . this produces a degree of correspondence b i , j of both angiographies from a mathematical link between both values t i , j or t * i , j , such as a simple subtraction for example . this degree of correspondence is thus a two - dimensional field , which can be represented for example as an image ( e . g . color - coded ) and permits an evaluation of the correspondence between the virtual and the real angiography . theoretically this degree of correspondence can be determined as in sun et al . [ 4 ] as a mean quadratic error for the entire curves tic i , j and tic * i , j . however , this means it is then subsequently not possible to say anything about the nature of the deviation and thus it cannot be used for purposeful control of the cfd optimization . until now , however , the two angiography scenes have not been synchronized . in this application there are various excellent vascular regions in the angiography images , among which are the vascular regions into which the blood or the contrast agent flows . in an improved embodiment regions of interest ( roi ) in these vascular regions can be defined in both images . in this case one or more roi , or corresponding roi * in the virtual image can be selected such that they cover the vascular inflow regions . in a next step the mean value of the characteristic variable t i , j , or t * i , j under consideration can be determined : mwt i , j , or mwt * i , j . from a comparison of these mean values a normalization is calculated in the following . this can be a difference ( in the case of temporal values ) or a factor e . g . in the case of intensity values , as well as other algorithms . thus the normalized degree of correspondence b i , j of both angiography recordings can be balanced : it is especially advantageous if the contrast inflow curve from the real angiography scene is used for the ( initial ) cfd simulation . if the simulation of the virtual angiography is performed such that the virtual inflow of the contrast agent matches reality , a normalization can be dispensed with however , it can also happen that both curves are delayed in respect of one another at the time of inflow or have different grayscale values . in this case , depending on the question , normalization will bring an improvement . essential for the invention are the definition of a degree of correspondence and the use thereof to assess and optimize the cfd simulation individual to the patient which until now has not been possible in - vivo . in particular the missing information on the local flow , into and out of the vascular segment under consideration , can herewith be adjusted iteratively to the real recorded 2d angiography recordings . this results in an improvement in the cfd results . this is based on the idea of comparing a virtual angiography obtained from the cfd simulation with the real angiography , determining a degree of correspondence , or if there is a difference optimizing the cfd so that the correspondence becomes better . in the case of a patient a 3d subtraction angiography with a c - arm system of the cerebral vessels and one ( or more ) 2d subtraction angiography scenes are recorded . in a first step a 3d surface model is generated in the computer following a segmentation of the relevant vascular section around an aneurysm , which is then used as geometry for the cfd simulation . moreover inflow and outflow regions are established . fig3 shows a vascular segment 20 with an afferent vessel 21 as an example for the definition of the region of interest roi and the associated basic conditions flow q and pressure p , which vessel branches into a first efferent vessel 22 and a second efferent vessel 23 . the vascular segment 20 furthermore has an aneurysm 24 . the inlet to the afferent vessel 21 is formed by an inflow region 25 . the outlet of the first efferent vessel 22 is formed by a first outflow region 26 and the outlet of the second efferent vessel 23 by a second outflow region 27 . a flow q in ( t ) and a pressure p in ( t ) prevail in the region of interest roi in of the inflow region 25 . in the region of interest roi out1 of the first outflow region 26 a flow q out1 ( t ) and a pressure p out1 ( t ) are measured and in the region of interest roi out2 of the second outflow region 27 a flow q out2 ( t ) and a pressure p out 2 ( t ) are measured . the selected volume is adjusted here to the 2d angiography , i . e . an angulation and projection geometry corresponding to the 2d angiography are determined in the 3d angiography . if both recordings originate from an examination which involves no movement of the patient this is simple to calculate , but otherwise a registration must be performed . thus the inflow region 25 and the outflow regions 26 and 27 are now also established in the 2d angiography . in the following cfd simulation the propagation of an injected contrast agent is simulated , among other things . the temporal dynamics of the contrast agent inflow can be adjusted to the averaged time intensity curve from the 2d angiography . after the simulation a virtual 2d angiography is calculated by means of known angulation and projection geometry using forward projection ( drr ), as is described for example in de 10 2007 039 034 a1 . in a next step the normalized degree of correspondence b ′ i , j e . g . for the bolus arrival times of both angiographies ( real and virtual ) is calculated . if for example the typical vascular segment 20 with the afferent vessel 21 , the aneurysm 24 and the two efferent vessels 22 and 23 is considered , a further evaluation for control of an iterative cfd simulation can now take place . to this end the normalized degree of correspondence averaged in the roi of the outflow regions 26 and 27 of the two efferent vessels 22 and 23 is considered . if it lies within a predefined tolerance , the result of the simulation is satisfactory in respect of these parameters , but otherwise this can be interpreted as a too fast or too slow flow in the entire vascular segment 20 . physically this means that the basic condition of pressure difference between inflow region 25 and outflow regions 26 and 27 was selected suboptimally . this can happen , since the vascular resistance distally to the vascular arborization section under consideration is generally not known . the tolerances can for example be predefined by a user . it is thereby determined how closely both angiographies , the virtual and the real angiography , must correspond before the user is satisfied . if the normalized degree of correspondence is positive , the calculated flow is too low and in the subsequent cfd simulation the pressure difference or the pressure conditions must be increased at the outflow regions 26 and 27 ( or variables corresponding thereto such as flow rate at the inflow region 25 ). in the case of a negative value the pressure difference can be reduced correspondingly . if the correspondence in both outflowing vascular segments roi out1 and roi out 2 is different , this can be corrected individually for each segment by the individual selection of the parameters . another example of this is concerned with the vascular walls . in cfd simulations the vascular walls are increasingly treated elastically . a corresponding analysis can orient the regions of interest along the vascular walls . these are segmented to this end . the degree of correspondence is now determined locally for all pixels along the vascular wall and if values are too large the elasticity for the subsequent cfd simulation is adjusted . it is especially advantageous here if real angiographies from several angulations are present . the inventive method is explained in greater detail on the basis of a flow chart shown in fig4 . first comes an acquisition 30 of a 3d angiography image dataset for model generation 31 . in the further method step a recording 32 of a contrast agent propagation is generated by means of dynamic real 2d angiography . then a cfd simulation 33 is performed , wherein it is possible to input 34 blood flow parameters as basic conditions . a virtual 2d angiography 35 from angulation identical to the real angiography 32 and adjusted recording geometry of the individual patient is calculated from this data . then follows a determination 36 of a degree of correspondence based on a comparison between the virtual angiography 35 and the real angiography 32 and then a check 37 to see whether the degree of correspondence is sufficient , i . e . whether the degree of correspondence is within a predefined tolerance . if the degree of correspondence is insufficient , a change 38 in the basic conditions in terms of an optimization is performed . then follows a new optimized cfd simulation 38 , by means of which again a determination 36 is performed , followed by a check 37 on the degree of correspondence . if in contrast the degree of correspondence is sufficient , the degree of correspondence is output 40 , for example as a color - coded image and the end of the examination is initiated . a ( percentage ) figure , if a global correspondence is considered , as well as a local figure can be described , which then itself can be output as a color map ( degree of correspondence ). however , it is also possible to describe other values ( for example the time difference for the maximum grayscale values ). fig5 shows the method sequence or workflow of the inventive method with the following steps in greater detail : s 1 ) 3d imaging for model generation , e . g . by means of 3d rotational angiography . s 2 ) recording a contrast agent propagation by means of dynamic 2d angiography . s 3 ) initial cfd simulation and generation of a virtual 2d angiography . s 4 ) determining a degree of correspondence between real and virtual 2d angiography . s 5 ) if degree of correspondence is sufficient , continue with s 9 ). s 6 ) changing one or more basic conditions of the cfd simulation according to the result of the degree of correspondence . s 7 ) renewed , optimized cfd simulation with basic conditions changed in terms of an optimization . s 8 ) back to s 4 ). s 9 ) done — optimum cfd simulation was achieved . the result is an iterative optimization of cfd simulation results based on the comparison between real and virtual 2 - dsa recordings on the basis of a determination of a degree of correspondence between both recordings . image - based computational simulation of flow dynamics in a giant intracranial aneurysm ; david a . steinman , jaques s . milner , chris j . norley , stephen p . lownie and david w . holdsworth ; american journal of neuroradiology ( 2003 ), number 24 , pages 559 - 566 blood flow in cerebral aneurysm : comparison of phase contrast magnetic resonance and computational fluid dynamics — preliminary results ; c . karmonik , r . klucznik , g . benndorf ; fortschr röntgenstr 2008 ; 180 : 1 - 7 methodologies to assess blood flow in cerebral aneurysm : current state of research and perspectives ; l . augsburger , p . reymond , e . fonck , z . kulcsar , m . farhat , m . ohta , n . stergiopulos , d . a . rüfenacht ; j . neurorad .- 168 : 2009 ; pages 1 - 8 quantitative evaluation of virtual angiography for interventional x - ray acquisitions ; qi sun , alexandra groth , irina waechter , olivier brina , jürgen weese , til aach ; ieee ; 2009 ; pages 895 - 898 parametric color coding of digital subtraction angiography ; c . m . strother , f . bender , y . deuerling - zheng , k . royalty , k . a . pulfer , j . baumgart , m . zellerhoff , b . aagaard - kienitz , d . b . niemann , m . l . lindstrom ; ajnr am j neuroradiol ; 2010 ; www . ajnr . org ; pages 1 - 7 | 0 |
reference will now be made in detail to embodiments of the invention , examples of which are illustrated in the accompanying drawings . whenever possible , the same reference numerals will be used throughout the drawings to refer to the same or like parts . in accordance with the invention , the present disclosure provides a porous cordierite ceramic wall - flow honeycomb filter exhibiting high strength , low pressure drop , high filtration efficiency , and high thermal shock resistance . the filter can be especially suitable for use as soot filter for the exhaust gas of a gasoline direct injection engine . in one set of embodiments , the filter disclosed herein exhibits : ( a ) a cell density , n , a wall thickness , w , a total pore volume fraction , p , and a median pore diameter , d 50 , which satisfy the relationship p c ≦ 4 . 0 , where p c is defined as p c = 0 . 156 ( w )+ 0 . 00632 ( n )+ 2 . 429 ( w )/[( d 50 2 )( p )], and where cell density is in units of cells ( channels ) per square inch , wall thickness is in units of 10 − 3 inches ( mils ), total pore volume fraction is the total % porosity / 100 and is dimensionless , d 50 is in units of microns , and d 50 and % porosity are as measured by mercury porosimetry ; ( b ) a median pore diameter d 50 ≦ 14 μm and a second pore diameter d 90 ≦ 20 μm , where the terms d 50 and d 90 denote the pore diameters , in microns , or micrometers ( 10 − 6 meters ), at which 50 % and 90 % of the total pore volume are of a finer pore diameter , for example , d 90 is the pore diameter at which 90 % ( by volume ) of the pores are of a smaller diameter ( equal to the pore diameter at which the cumulative mercury intrusion volume equals 10 % of the total mercury intrusion volume ), and therefore d 50 & lt ; d 90 ; room - temperature four - point modulus of rupture on an axial specimen of the honeycomb of at least 200 psi and a ratio of mor / cfa of at least 1100 psi , where cfa is the closed frontal area fraction of the face of the honeycomb substrate , defined as cfa =( w / 1000 )[ 2 ( n − 0 . 5 )−( w / 1000 )]( n ); ( c ) an elastic modulus ratio , e ( 900 )/ e ( 25 ), of not more than 0 . 97 , where the value of e ( 900 ) is the elastic modulus at 900 ° c . as measured upon heating , and the value of e ( 25 ) is the elastic modulus as measured near room temperature prior to heating , both as measured on a bar parallel to the axial direction of the honeycomb using a sonic resonance technique ; and ( d ) a thermal shock limit , tsl ( 200 )& gt ; 800 ° c ., defined as tsl ( 200 )= 200 +( mor / e )/[ cte ( 200 - 1000 )] where mor and e are as measured at room temperature and cte ( 200 - 1000 ) is the mean coefficient of thermal expansion from 200 to 1000 ° c . as measured by dilatometry along the axial direction of the honeycomb . in some of these embodiments , p c ≦ 3 . 6 , and in other embodiments p c ≦ 3 . 4 . it was found that when the cell geometry , % porosity , and median pore diameter of the filter are such as to satisfy p c ≦ 3 . 4 , the filter can have an especially low pressure drop in the clean state or under conditions of low soot - loading , such as a pressure drop equal to or even lower than the pressure drop of a conventional flow - through catalytic converter substrate having , for example , a cell geometry of 900 / 2 and with the same external dimensions as the filter and measured under conditions of equivalent exhaust gas flow rates and temperatures . the value of p c is lowest for thin walls , high permeability , and low cell density . in some embodiments , the value of p c is not more than 3 . 2 , in other embodiments not more than 3 . 0 , in other embodiments not more than 2 . 8 , in other embodiments not more than 2 . 6 , and in some embodiments not more than 2 . 4 , to further reduce pressure drop . the cell density , n , is preferably not more than 400 , more preferably not more than 350 , even more preferably not more than 300 , still more preferably not more than 250 , yet more preferably not more than 200 , and in some embodiments n is not more than 150 cells / in 2 . in some embodiments n is at least 80 cells / in 2 . the wall thickness , in mils ( 10 − 3 inch ), is preferably not more than 15 . 0 - 0 . 026 ( n ), and more preferably is not more than 13 . 0 - 0 . 022 ( n ), 11 . 0 - 0 . 0176 ( n ), 10 . 0 - 0 . 0155 ( n ), and even more preferably is not more than 9 . 0 - 0 . 0133 ( n ); in some embodiments , n is at least 8 . 0 - 0 . 0111 ( n ). the closed frontal area fraction , cfa , is preferably not more than 0 . 26 , more preferably not more than 0 . 24 , even more preferably not more than 0 . 22 , still more preferably not more than 0 . 20 , and even still more preferably not more than 0 . 18 , and even more preferably not more than 0 . 16 ; in some embodiments , cfa is at least 0 . 14 . in some embodiments , the % porosity is ≧ 52 %, in other embodiments at least 54 %, in other embodiments at least 56 %, in other embodiments at least 58 %, in other embodiments at least 60 %, in other embodiments at least 62 %, and in other embodiments at least 64 %. higher porosity contributes to a lower pressure drop , higher mor / e ratio , and higher thermal shock resistance . high porosity is also advantageous for applications in which the filter contains a catalyst residing within the pores of the filter wall so that low pressure drop is maintained . high strength can be maintained despite the high porosity due to the low degree of microcracking in the cordierite ceramic body . in other embodiments having an increased emphasis on greater strength , the porosity is preferably ≧ 52 % but is preferably ≦ 60 , in some embodiments ≦ 58 , and in other embodiments ≦ 56 %. the median pore diameter , d 50 , is preferably at least 7 μm , and in some embodiments at least 8 μm , and in other embodiments at least 9 μm , to minimize the pressure drop . the median pore diameter is also preferably not more than 13 μm , and in some embodiments not more than 12 μm , and in other embodiments not more than 11 μm , to maintain high filtration efficiency and high mor . the value of the d 90 pore diameter is preferably not more than 18 μm , in some embodiments not more than 17 μm , in other embodiments not more than 16 μm , in other embodiments not more than 15 μm , in still other embodiments not more than 14 μm , and in some embodiments not more than 13 μm , also to provide high filtration efficiency . to aid in providing a high permeability and low pressure drop , the quantity ( d 50 ) 2 (% porosity / 100 ) is preferably at least 30 μm 2 , and more preferably at least 40 μm 2 , and in some embodiments at least 50 μm 2 , and in other 60 μm 2 , and in other embodiments at least 70 μm 2 , and in still other embodiments at least 80 μm 2 , and in still other embodiments at least 90 μm 2 , as higher values for this parameter correlate with higher permeability and lower pressure drop . preferably , the value of d f , defined as ( d 50 − d 10 )/ d 50 , is not more than 0 . 45 , and more preferably is not more than 0 . 40 , and in some embodiments is not more than 0 . 35 , and in other embodiments is not more than 0 . 30 . a low value of d f minimizes the rate at which pressure drop increases with the accumulation of soot or ash . the value of d b , defined as ( d 90 − d 10 )/ d 50 , is preferably not more than 1 . 40 , and more preferably is not more than 1 . 20 , and in some embodiments is not more than 1 . 00 , and in other embodiments is not more than 0 . 90 , and in still other embodiments is not more than 0 . 80 , and in some embodiments is not more than 0 . 70 . a low value of d b and / or a low value of d f corresponds to a narrow pore size distribution , which is beneficial for strength , filtration efficiency , and mor / e . to further aid in providing a high mor / e , the value of the “ pore connectivity factor ” pcf b =% porosity / d b is preferably at least 45 , in some embodiments at least 60 , in other embodiments at least 70 , in other embodiments at least 80 , and in still other embodiments at least 90 . also to further aid in providing a high mor / e , the value of the “ pore connectivity factor ” pcf f =% porosity / d f is preferably at least 140 , in some embodiments at least 150 , in other embodiments at least 170 , in other embodiments at least 190 , and in still other embodiments at least 200 . preferably the value of mor / cfa is at least 1150 psi , more preferably at least 1200 psi , even more preferably at least 1300 psi , still more preferably at least 1400 psi , yet still more preferably at least 1500 psi , and in some embodiments at least 1600 psi , and in other embodiments at least 1700 psi , and in still other embodiments at least 2000 psi , and in other embodiments at least 2500 psi , and in other embodiments at least 3000 psi , and in other embodiments at least 3500 psi . high values of mor / cfa helps to provide adequate strength to the filter , which is especially important for the thin walls and low cell densities desired to achieved low pressure drop . in some embodiments , the cordierite particulate filter disclosed herein exhibits an elastic modulus ( e ) ratio , e ( 900 )/ e ( 25 ), of not more than 0 . 96 , and in other embodiments not more than 0 . 95 , and in still other embodiments not more than 0 . 94 , and in yet other embodiments not more than 0 . 93 , and in other embodiments not more than even 0 . 92 , as it has been discovered that a lower ratio of e ( 900 )/ e ( 25 ) corresponds to a lower degree of microcracking , a greater strength , a greater strain tolerance ( mor / e ), and a higher predicted thermal shock resistance . preferably the value of the microcrack index , nb 3 , is not more than 0 . 04 , and more preferably not more than 0 . 03 , and in some embodiments not more than 0 . 02 , and in other embodiments not more than 0 . 01 . the microcrack index is derived from the room - temperature and high - temperature elastic modulus measurements as described in united states patent application number 2008 / 0032091 ( a1 ). in some embodiments , the ratio of the modulus of rupture , mor ( 25 ), and room - temperature elastic modulus , e ( 25 ), referred to as the strain tolerance and designated as mor / e , is at least 0 . 120 %, and in other embodiments is at least 0 . 130 %, and in other embodiments is at least 0 . 140 %, and in other embodiments is at least 0 . 150 %, and in other embodiments is at least 0 . 160 %, and in other embodiments is at least 0 . 170 %, and in other embodiments is at least 0 . 180 %, and in other embodiments is at least 0 . 190 %, and in other embodiments is at least 0 . 200 %, and in other embodiments is at least 0 . 210 %, and in other embodiments is at least 0 . 220 %, where “%” signifies and is equivalent to “× 10 − 2 .” the value of the computed thermal shock limit tsl ( 200 ) is at least 800 ° c ., preferably more than 850 ° c ., and is more preferably at least 900 ° c ., even more preferably at least 950 ° c ., still more preferably at least 1000 ° c ., yet more preferably at least 1050 ° c ., even more preferably at least 1100 ° c ., still more preferably at least 1150 ° c ., and in some embodiments at least 1200 ° c ., and in other embodiments at least 1300 ° c . preferably , the value of the computed thermal shock limit tsl ( 500 ), defined as { 500 +( mor / e )/[ cte ( 500 - 900 )]}, is at least 1000 ° c ., and is more preferably at least 1050 ° c ., and even more preferably at least 1100 ° c ., and still more preferably at least 1200 ° c ., and even more preferably at least 1300 ° c ., and yet more preferably at least at least 1400 ° c ., wherein mor / e is defined as above and cte ( 500 - 900 ) is the mean coefficient of thermal expansion during heating from 500 ° c . to 900 ° c . in the axial direction of the honeycomb . the mean cte from 25 to 800 ° c . of a honeycomb body disclosed herein as measured in the axial direction , in units of 10 − 7 /° c ., is preferably at least 13 , and more preferably at least 14 , and even more preferably at least 15 , and in some embodiments at least 16 , as higher values of cte generally correspond to lower microcracking and higher strength . as disclosed herein , a method is provided for making high strength low - microcracked ceramic bodies , and in particular cordierite bodies , such as cordierite honeycomb bodies . the method comprises the following : ( a ) providing an inorganic material mixture resulting from mixing together cordierite - forming raw materials , which include a magnesium - containing raw material , an aluminum - containing raw material , and a silicon - containing raw material , in ratios that are sufficient to form a predominantly cordierite ceramic body upon firing , wherein the inorganic material mixture also contains one or more of : ( i ) at least 15 weight % of a magnesium aluminate spinel powder ( hereafter referred to as “ spinel ”) having a median particle diameter of not more than 10 μm and at least 10 weight % of a kaolin powder ; or ( ii ) at least 0 . 001 weight percent of a pre - reacted cordierite powder or magnesium aluminosilicate glass powder which is capable of crystallizing , at least in part , to cordierite at a temperature below 1150 ° c . ; or ( iii ) sources of one or more metals selected from the group consisting of lithium , sodium , potassium , rubidium , cesium , calcium , strontium , barium , yttrium , a trivalent rare earth element such as lanthanum , and zinc , wherein the total concentration of said metals in the ceramic body is at least 0 . 5 percent by weight as the metal oxides ; ( b ) blending the inorganic material mixture with one or more organic binders , lubricants , plasticizers , or pore - forming materials ( any of which combust , evaporate , or are otherwise eliminated from the body during heating ) or combinations thereof to result in a ceramic forming precursor batch mixture ; ( c ) mixing the ceramic forming precursor batch mixture with a liquid vehicle such as water or other liquid medium to form a plasticized ceramic forming precursor batch mixture ; ( d ) forming the mixture into a shaped body , such as a shaped body having a honeycomb structure . the method can further comprise : ( e ) drying the shaped body and ( f ) subsequently firing the shaped body in a furnace environment at a furnace temperature and for a sufficient time to react the materials in the batch mixture to form a porous cordierite ceramic . the method can further comprise ( g ) cooling the fired shaped body of porous cordierite ceramic to room temperature . in one set of embodiments , the inorganic material mixture contains spinel powder , and the spinel powder in some embodiments comprises at least 17 %, in other embodiments comprises at least 20 %, and in other embodiments comprises at least 23 %, by weight of the inorganic material mixture . also , the spinel powder preferably has a median particle diameter of not more than 8 μm , and in some embodiments not more than 7 μm , in other embodiments not more than 6 μm , and in other embodiments not more than 5 μm . in this set of embodiments , the kaolin preferably comprises at least 12 %, more preferably at least 14 %, and even more preferably at least 16 %, by weight of the inorganic material mixture . in another set of embodiments , the inorganic material mixture contains pre - reacted cordierite powder or cordierite - forming magnesium aluminosilicate glass powder . the pre - reacted cordierite powder or cordierite - forming magnesium aluminosilicate glass powder has a median particle diameter of not more than 10 μm , and preferably not more than 8 μm , and in some embodiments not more than 6 μm , and in some embodiments not more than 5 μm , and in some embodiments not more than 3 μm , and in some embodiments not more than 1 μm . the amount of pre - reacted cordierite powder or cordierite - forming magnesium aluminosilicate glass powder is preferably at least 0 . 01 %, more preferably at least 0 . 10 %, and in some embodiments at least 1 . 0 %, by weight of the inorganic material mixture , but is preferably not more than 10 % by weight of the inorganic material mixture . in another set of embodiments , the inorganic material mixture contains one or more metal sources that contain one or more of the elements calcium , strontium , zinc , yttrium , or a trivalent rare earth element such as lanthanum . the amount ( s ) of metal added to the raw material mixture , expressed as the metal oxide , is preferably at least 0 . 5 weight %, and more preferably at least 1 . 0 weight %, but preferably not more 5 weight % and more preferably not more than 3 weight %, by weight of the inorganic material mixture . the median particle diameter of the metal - containing additive is preferably not more than 10 μm , and more preferably not more than 5 μm , and even more preferably not more than 3 μm , and still more preferably not more than 1 μm . it has been determined that these metal oxides promote the formation of a glass phase which is beneficial in reducing microcracking and increasing strength , mor / e , and thermal shock resistance . as used herein in describing the cordierite - forming raw materials , the term “ magnesium source ” refers to any phase which includes the element magnesium as a necessary constituent of its chemical formula . similarly , an “ aluminum source ” refers to any phase which includes the element aluminum as a necessary constituent of its chemical formula . a “ silicon source ” likewise refers to any phase which includes the element silicon as a necessary constituent of its chemical formula . the term “ magnesium oxide forming source ” shall mean a magnesium source which includes no other metal , except possibly as an impurity , and which , when heated to 1400 ° c . in the absence of other raw materials , would form only the phase magnesium oxide except for possible traces of other phases formed from any impurities . similarly , the term “ aluminum oxide forming source ” shall mean an aluminum source which includes no other metal , except possibly as an impurity , and which , when heated to 1400 ° c . in the absence of other raw materials , would form only the phase aluminum oxide except for possible traces of other phases formed from any impurities . likewise , the term “ silica forming source ” shall mean a silicon source which includes no other metal , except possibly as an impurity , and which , when heated to 1400 ° c . in the absence of other raw materials , would form only the phase silicon dioxide except for possible traces of other phases formed from any impurities . the term “ cordierite forming raw materials ” comprises all raw materials which are magnesium sources , aluminum sources , and silicon sources . the magnesium source is selected from the group consisting of talc , calcined talc , chlorite , calcined chlorite , magnesium aluminate spinel , forsterite , enstatite , sapphirine , or a magnesium oxide forming source such as magnesium hydroxide , magnesium carbonate , or magnesium oxide itself . the aluminum source is selected from the group consisting of pyrophyllite , calcined pyrophyllite , kaolin , calcined kaolin , kyanite , sillimanite , andalusite , mullite , magnesium aluminate spinel , sapphirine , or an aluminum oxide forming source such as diaspore , boehmite , gibbsite , a transition alumina such as gamma - alumina , or alpha - alumina ( corundum ). the silicon source is selected from the group consisting of talc , chlorite , forsterite , enstatite , sapphirine , pyrophyllite , calcined pyrophyllite , kaolin , calcined kaolin , kyanite , sillimanite , andalusite , mullite , and silica forming sources such as fused silica , quartz , cristobalite , tripoli silica , colloidal amorphous silica , diatomaceous silica , etc . preferably , each of the cordierite - forming raw materials has a median particle diameter of not more than 12 μm , and even more preferably not more than 10 μm . also the weighted average of the median particle diameters of the cordierite - forming raw materials , w av ( cfrm ), is preferably not more than 12 μm , even more preferably not more than 10 μm , and still more preferably not more than 8 μm , and further is preferably not less than 4 . 0 μm . the weighted average of the median particle diameters of two or more powders in a group , w av , is computed as w av = σ [( w i )( d 50 , i )]/ e ( w i ), where “ σ ” denotes the sum over all powders within the group ( the group in this case being either the cordierite - forming raw materials or the pore - forming materials ), “ w ,” is the part by weight of each powder in the group , and “ d 50 , i ” is the median particle diameter of each powder in the group , as measured by a laser diffraction technique . preferably , the median particle size of each pore former is not more than 40 μm , and more preferably is not more than 30 μm , and even more preferably is not more than 20 μm , and still more preferably is not more than 15 μm , and yet more preferably is not more than 10 μm . also , the weighted average of the median particle diameters of the pore - forming materials , w av ( pf ), is not preferably more than 35 μm , and more preferably is not more than 30 μm , even more preferably is not more than 20 μm , still more preferably is not more than 15 μm , and in some embodiments is even not more than 10 μm . unless otherwise noted herein , the particle diameters of all powders are measured by a laser diffraction technique , such as by a microtrac particle size analyzer . raw materials used to make the examples are provided in table 1 . the batch compositions for the examples are listed in table 2 . tables 3 and 4 give the various relevant physical properties for the examples . table 5 provides physical properties for eight comparative cordierite filter examples . raw materials , pore formers , and solid and liquid organic additives were weighed in the proportions given in table 2 , mixed with the indicated amounts of distilled water , and worked in a horizontal rotating - plow mixer to provide a plasticized mixture . the material was subsequently loaded into a twin - screw type extruder , de - aired using a vacuum system , and extruded through a die to form 2 - inch diameter honeycomb product . parts were cut to approximately 8 - inch lengths and partially dried in a microwave dryer , followed by complete drying in a convection oven . the dried parts were cut to 6 - inch lengths and fired vertically in an electric furnace . heating rates from 750 to 1000 ° c . were either 20 or 75 ° c ./ hr , followed by 20 ° c ./ hr from 1000 to 1200 ° c ., and 10 ° c ./ hr from 1200 ° c . to maximum temperature . parts were held at a peak temperature of 1340 to 1400 ° c . for 20 hours . specific firing conditions for each sample are indicated in tables 3 and 4 . fired cell geometries are also provided in tables 3 to 5 . porosity was measured by mercury porosimetry , and pore volume , % porosity , and values of the pore diameters at 1 , 2 , 5 , 10 , 25 , 50 , 75 , 90 , 95 , 98 , and 99 % of the pore size distribution , on a volumetric basis , are provided in the tables . also computed from these parameters are d f =( d 50 − d 10 )/ d 50 , d c =( d 90 − d 50 )/ d 50 , d b =( d 90 − d 10 )/ d 50 , a “ pore connectivity factor ” pcf b =(% porosity )/( d b ), a “ pore connectivity factor ” pcf f =(% porosity )/( d f ), and ( d 50 ) 2 (% porosity / 100 ). high values of pcf b and pcf f can be beneficial for low pressure drop and high mor / e . the gas permeability across the thickness of the ceramic wall cut from the honeycomb body was measured for several examples using a capillary flow porometer from porous materials , inc ., and values in units of μm 2 , equal to 10 − 12 m 2 or about 1 . 013 darcys , are given in the tables . filtration efficiency was measured using propane generated carbon soot . upstream soot concentrations were measured with an avl 415s smoke meter , and downstream concentrations were determined by a photo acoustic method using an avl μsootsensor . the flow rate was 250 liters / minute with an upstream soot concentration of 2 . 5 mg / m 3 . filtration efficiency was calculated as the percentage of trapped soot relative to the total soot produced . results are reported at a soot particle size of 60 nm for the examples of the present disclosure and 113 nm for the comparative examples . pressure drops of examples a , b , b 2 , and c of the present disclosure as 2 inch × 6 inch filters were measured as a function of flow rate and soot loading on a test bench using artificial carbon soot . unless otherwise noted herein , coefficients of thermal expansion ( cte ) represent the mean cte &# 39 ; s between the indicated temperatures (° c .) and were measured by dilatometry . as described in united states patent application publication number 2008 / 0032091 which is incorporated herein , transverse and axial i - ratios represent the degree of non - random cordierite crystal orientation in the fired ware . weight percentages of mullite , spinel + sapphirine , and corundum in the fired ceramic ( when present ) were measured by x - ray diffractometry . modulus of rupture ( mor ) was measured in the axial direction using the four - point beam bending method . the value of mor / cfa was computed using the measured mor and cfa was calculated from the cell geometry of the actual fired part . elastic modulus was measured in the axial direction using a sonic resonance technique . the microcrack index , nb 3 , was determined by the method described in united states patent application publication number 2008 / 0032091 . examples a to j of the present disclosure exhibit values of ( d 50 )(% porosity / 100 ) 40 μm 2 , mor / cfa ≧ 1200 psi , e ( 900 )/ e ( 25 )≦ 0 . 95 , 7 . 9 ≦ d 50 ≦ 13 . 5 μm and 11 . 2 ≦ d 90 ≦ 19 . 7 μm , tsl ( 200 )≧ 812 ° c . and tsl ( 500 )≧ 1033 ° c . comparative examples exhibit values of mor / cfa & lt ; 1100 psi , values of e ( 900 )/ e ( 25 )& gt ; 0 . 97 or values of the microcrack index , nb 3 , greater than 0 . 04 , and values of the d 90 pore size & gt ; 20 μm . furthermore , the filtration efficiencies of the three examples of the present disclosure for which they were measured all exceed those of the two known comparative examples , and meet the requirements for filtration of the fine particles in gdi engine exhaust . fig1 is a graphic illustration depicting the clean pressure drop ( kpa ), as measured on 2 - inch diameter , 6 - inch long filters at room temperature and a flow rate of 26 . 25 standard cubic feet of air per minute , plotted against the pc parameter as defined in the present invention , for examples disclosed herein ( filled circles ) and comparative examples ( open circles ). long - dashed curve defines the approximate change of clean pressure drop with the pc parameter , and shows that low values of pc are beneficial for achieving low clean pressure drop . short - dashed horizontal lines indicate the approximate values of clean pressure drop corresponding to certain preferred upper limits for pc shown by solid vertical lines . fig2 is a graphic illustration showing the percent filtration efficiency of wall - flow filters at 0 . 01 g / l soot loading plotted against the d90 pore diameter of the filters for examples disclosed herein ( filled circles ) and comparative examples ( open circles ). the data show the benefit of a d90 ≦ 20 μm in achieving a high filtration efficiency . results of soot - loaded pressure drop measurements for examples a , b , b 2 , and c are shown in fig3 for a flow rate of 26 . 25 scfm . fig3 is a graphic illustration showing the pressure drop versus soot loading for three filters disclosed herein having cell densities of approximately 370 cells / inch 2 and wall thicknesses of about 10 . 5 mils ( 10 − 3 inches ) and for one filter disclosed herein having a cell density of approximately 364 cells / inch 2 and a wall thickness of about 7 . 5 mils . the near linear increase in pressure drop with soot loading demonstrates that minimal soot is entering the wall of the filter and is the result of the well - interconnected porosity of these filters . that is , the near linearity of the curves indicates minimal soot penetration of the walls , further indicating uniform and well - interconnected porosities in these examples . tables 3 and 4 include values of p c and mor computed for the inventive examples at cell geometries of 200 / 8 , 200 / 6 , 300 / 6 , and 400 / 4 , in which 200 , 300 , and 400 are the cell densities ( n ) in units if cells / inch 2 , and 8 , 6 , and 4 are the wall thicknesses ( w ) in units of mils ( 10 − 3 inch ). values of p c were calculated from the relation p c = 0 . 156 ( w )+ 0 . 00632 ( n )+ 2 . 429 ( w )/[( d 50 2 )( p )] as defined previously , and mor was calculated from the relation mor =( mor / cfa ){( w / 1000 )[ 2 ( n − 0 . 5 )−( w / 1000 )]( n )} where ( mor / cfa ) is as tabulated for the example and n and w pertain to the respective values of 200 and 8 , 200 and 6 , 300 and 6 , and 400 and 4 . the computations show an exemplary range of cell geometries which exhibit advantageous properties . fig4 is a graphic illustration showing the modulus of rupture ( mor ) of an axial honeycomb specimen divided by the closed frontal area ( cfa ) of the honeycomb cross section , which is a measure of the strength of the ceramic wall , plotted against the percent porosity of the filter wall , for examples disclosed herein ( filled circles ) and comparative known examples ( open circles ). the data show the high strengths of the examples disclosed herein for a given % porosity . fig5 is a graphic illustration showing the filtration efficiency as a function of soot loading for soot particles having a median particle diameter of 60 nm for examples a , b , and c disclosed herein ( solid curves ) and for soot particles having a median particle diameter of 113 nm for comparative known examples k and l . the curves show that the examples disclosed herein demonstrate much high filtration efficiency at low soot loadings , even for finer particles , than the comparative known commercial filters . fig6 is a backscattered electron image of a polished cross section the honeycomb wall of example a disclosed herein , showing well interconnected porosity . scale bar ( upper left ) is 20 microns . fig7 is a backscattered electron image of the as - fired honeycomb wall surface of example a disclosed herein , showing the high degree of surface porosity which serves to maintain low pressure drop and high filtration efficiency . scale bar ( upper left ) is 20 microns . fig8 is a backscattered electron image of a polished cross section the honeycomb wall of example a disclosed herein at higher magnification , showing the presence of an intergranular yttrium - containing glass phase ( small white features ). scale bar ( upper left ) is 2 microns . in one aspect , a particulate filter is disclosed herein comprising a filter body comprised of a honeycomb structure of porous ceramic , the filter body comprising a cell density , n , and a wall thickness , w , the porous ceramic having a total pore volume fraction , p , and a median pore diameter , d 50 , wherein the filter body is characterized by p c = 0 . 156 ( w )+ 0 . 00632 ( n )+ 2 . 429 ( w )/[( d 50 2 )( p )], n is in units of cells ( channels ) per square inch , w is in units of 10 − 3 inches ( mils ), p is dimensionless and equal to the total porosity in % (% porosity ) divided by 100 , d 50 is in units of microns , and d 50 and % porosity are as measured by mercury porosimetry , and p c ≦ 4 . 0 , and wherein the filter body has a d 50 ≦ 14 μm , a d 90 ≦ 20 μm , a room - temperature four - point modulus of rupture on an axial specimen of the honeycomb structure ( mor ) of at least 200 psi , a ratio of mor / cfa of at least 1100 psi , where cfa is the closed frontal area fraction of the face of the honeycomb substrate , defined as cfa =( w / 1000 )[ 2 ( n − 0 . 5 )−( w / 1000 )]( n ), an elastic modulus ratio , e ( 900 )/ e ( 25 ), of not more than 0 . 97 , where the value of e ( 900 ) is the elastic modulus at 900 ° c . as measured upon heating , and the value of e ( 25 ) is the elastic modulus as measured near room temperature prior to heating , both as measured on a bar parallel to the axial direction of the honeycomb , and a thermal shock limit , tsl ( 200 )& gt ; 800 ° c ., defined as tsl ( 200 )= 200 +( mor / e )/[ cte ( 200 - 1000 )] where mor and e are as measured at room temperature and cte ( 200 - 1000 ) is the mean coefficient of thermal expansion from 200 to 1000 ° c . as measured by dilatometry along the axial direction of the honeycomb . in some embodiments , p c ≦ 3 . 6 ; in some of these embodiments p c ≦ 3 . 4 . in some embodiments , cfa ≦ 0 . 23 ; in some of these embodiments cfa ≦ 0 . 21 , and in some of these embodiments cfa ≦ 0 . 18 . in some embodiments , the % porosity 52 %. in some embodiments , d 50 ≧ 7 μm ; in some of these embodiments , 7 μm d 50 ≦ 14 μm ; in some of these embodiments 8 μm d 50 ≦ 12 μm . in some embodiments , d 90 ≦ 18 μm ; in some of these embodiments , d 90 ≦ 16 μm . in some embodiments , ( d 50 ) 2 (% porosity / 100 )≧ 30 μm 2 ; in some of these embodiments , ( d 50 ) 2 (% porosity / 100 )≧ 50 μm 2 ; in some of these embodiments , ( d 50 ) 2 (% porosity / 100 )≧ 70 μm 2 ; in some of these embodiments , ( d 50 ) 2 (% porosity / 100 )≧ 90 μm 2 . in some embodiments , d f =( d 50 − d 10 )/ d 50 and d f ≦ 0 . 35 . in some embodiments , d b =( d 90 − d 10 )/ d 50 and d b ≦ 1 . 00 . in some embodiments , mor / cfa ≧ 1500 psi ; in some of these embodiments , mor / cfa ≧ 2000 psi . in some embodiments , e ( 900 )/ e ( 25 )≦ 0 . 94 . in some embodiments , the filter body has a microcrack index , nb 3 ≦ 0 . 02 . in some embodiments , mor ( 25 )/ e ( 25 )≧ 0 . 140 %; in some of these embodiments , mor ( 25 )/ e ( 25 )≧ 0 . 160 %; in some of these embodiments , mor ( 25 )/ e ( 25 )≧ 0 . 180 %. in some embodiments , the filter body exhibits a mean cte from 25 to 800 ° c . as measured in the axial direction , in units of 10 − 7 /° c ., of 12 . in some embodiments , the porous ceramic comprises a primary ceramic phase of cordierite . in some embodiments , tsl ( 200 )≧ 1000 ° c ., p c ≦ 3 . 0 , mor ≧ 250 psi , and e ( 900 )/ e ( 25 )≦ 0 . 94 ; in some of these embodiments , d 90 ≦ 16 μm ; in some of these embodiments , tsl ( 200 )≧ 1100 ° c . in some embodiments , tsl ( 200 )≧ 1000 ° c ., p c ≦ 3 . 0 , mor ≧ 250 psi , and nb 3 ≦ 0 . 020 ; in some of these embodiments , d 90 ≦ 16 μm ′; in some of these embodiments , tsl ( 200 )≧ 1100 ° c . in some embodiments , tsl ( 200 )≧ 1150 ° c . and mor ≧ 300 psi ; in some of these embodiments , p c ≦ 2 . 8 . it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit and scope of the invention . thus it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 8 |
the figure shows an ink jet printing assembly 53 . the ink jet printing assembly 53 comprises a support for supporting an image receiving member 52 . the support is shown in the figure as a platen 51 , but alternatively , the support may be a flat surface . the platen 51 , as depicted in the figure , is a rotatable drum , which is rotatable about its axis as indicated by arrow a . the support may be optionally provided with suction holes for holding the image receiving member in a fixed position with respect to the support . the ink jet printing assembly 53 comprises print heads 54 a - 54 d , mounted on a scanning print carriage 55 . the scanning print carriage 55 is guided by a suitable guiding mechanism 56 , 57 to move in reciprocation in the main scanning direction b . each print head 54 a - 54 d comprises an orifice surface 59 , which orifice surface 59 is provided with at least one orifice 58 . the print heads 54 a - 54 d are configured to eject droplets of marking material onto the image receiving member 52 . the print heads 54 a - 54 d may be based on a number of techniques to eject droplets . for example , the print heads 54 a - 54 d may be piezoelectric print heads or they may be thermal print heads , for example . the platen 51 , the carriage 55 and the print heads 54 a - 54 d are controlled by a suitable controller 60 a , 60 b and 60 c , respectively . the image receiving member 52 may be a medium in web or in sheet form and may be composed of , e . g . paper , cardboard , label stock , coated paper , plastic or textile . alternatively , the image receiving member 52 may also be an intermediate member , endless or not . examples of endless members , which may be moved cyclically , are a belt or a drum . the image receiving member 52 is moved in the sub - scanning direction a by the platen 51 along four print heads 54 a - 54 d provided with a fluid marking material . a scanning print carriage 55 carries the four print heads 54 a - 54 d and may be moved in reciprocation in the main scanning direction b parallel to the platen 51 , such as to enable scanning of the image receiving member 52 in the main scanning direction b . only four print heads 54 a - 54 d are depicted for demonstrating the present invention . in practice , an arbitrary number of print heads may be employed . in any case , at least one print head 54 a - 54 d per color of marking material is placed on the scanning print carriage 55 . for example , for a black - and - white printer , at least one print head 54 a - 54 d , usually containing black marking material is present . alternatively , a black - and - white printer may comprise a white marking material , which is to be applied on a black image - receiving member 52 . for a full - color printer , containing multiple colors , at least one print head 54 a - 54 d for each of the colors , usually black , cyan , magenta and yellow is present . often , in a full - color printer , black marking material is used more frequently in comparison to differently colored marking material . therefore , more print heads 54 a - 54 d containing black marking material may be provided on the scanning print carriage 55 compared to print heads 54 a - 54 d containing marking material in any of the other colors . alternatively , the print head 54 a - 54 d containing black marking material may be larger than any of the print heads 54 a - 54 d , containing a differently colored marking material . the carriage 55 is guided by guides 56 , 57 . these guides 56 , 57 may be rods as depicted in the figure at “ b .” the rods may be driven by a suitable driving mechanism ( not shown ). alternatively , the carriage 55 may be guided by another guide , such as an arm being able to move the carriage 55 . another alternative is to move the image receiving material 52 in the main scanning direction b . each print head 54 a - 54 d comprises an orifice surface 59 having at least one orifice 58 , in fluid communication with a pressure chamber containing fluid marking material provided in the print head 54 a - 54 d . on the orifice surface 59 , a number of orifices 58 is arranged in a single linear array parallel to the sub - scanning direction a . eight orifices 58 per print head 54 a - 54 d are depicted in the figure , however obviously in a practical embodiment several hundreds of orifices 58 may be provided per print head 54 a - 54 d , optionally arranged in multiple arrays . as depicted in the figure , the respective print heads 54 a - 54 d are placed parallel to each other such that corresponding orifices 58 of the respective print heads 54 a - 54 d are positioned in - line in the main scanning direction b . this means that a line of image dots in the main scanning direction b may be formed by selectively activating up to four orifices 58 , each of them being part of a different print head 54 a - 54 d . this parallel positioning of the print heads 54 a - 54 d with corresponding in - line placement of the orifices 58 is advantageous to increase productivity and / or improve print quality . alternatively multiple print heads 54 a - 54 d may be placed on the print carriage adjacent to each other such that the orifices 58 of the respective print heads 54 a - 54 d are positioned in a staggered configuration instead of in - line . for instance , this may be done to increase the print resolution or to enlarge the effective print area , which may be addressed in a single scan in the main scanning direction . the image dots are formed by ejecting droplets of marking material from the orifices 58 . upon ejection of the marking material , some marking material may be spilled and stay on the orifice surface 59 of the print head 54 a - 54 d . the ink present on the orifice surface 59 may negatively influence the ejection of droplets and the placement of these droplets on the image receiving member 52 . therefore , it may be advantageous to remove excess of ink from the orifice surface 59 . the excess of ink may be removed for example by wiping with a wiper and / or by application of a suitable anti - wetting property of the surface , e . g . provided by a coating . all chemicals were obtained from sigma - aldrich and used as received . the pigment used was a dispersion of carbon black ( pb 7 ). the t g is determined according to astm e 1356 - 03 with differential scanning calorimetry and measured with a ta instruments q2000 . the prepared sample was heated at a rate of 20 ° c ./ min . the onset of the t g was determined during a second run ( i . e . sample was heated and cooled first before starting the measurement ). the t g is a secondary transition and can be determined by analyzing the deflection point of the dsc curve . the melting points were determined during a first heating run . the crystallization temperatures were determined during a first cooling run . viscosity was measured with a haake rheostress rs 600 rheometer equipped with a haake universal temperature controller using plate - plate geometry sensor system ( pp60 ) at 140 ° c . ( cr method ). the number averaged molecular weight and the weight averaged molecular weight of the copolyester were determined with size exclusion chromatography using a mixed c - column . the m n and m w are determined relative to a polystyrene standard . printing a pattern that corresponds to 8 active nozzles and 24 inactive nozzles at a resolution of 600 × 600 dpi , comprising 32 bars . loading the printed pattern by moving a flat holder having a size of 30 mm * 30 mm and a mass of 455 grams , covered in océ top colour paper satinated ( tcs ) to and fro ten times over the printed pattern in a direction perpendicular to the direction of the printed bars . the smearing is determined by measuring the optical density of the imprint on the tcs and awarding the results with a mark ranging from 0 to 5 . a mark of 0 corresponds to much smearing ( bad result ) and 5 results to no smearing ( good result ). a scratch is made using a normal force of 10 n on a grey area , printed with 150 × 150 dpi . the relative difference in optical density , od , ( measured with a gretag macbeth d19c od meter ) between the surface of the scratch and the area right next to the scratch is measured (( δod / od area right next to the scratch )* 100 %). the relative od difference between the surface of the scratch and the area right next to the scratch is a measure of scratch fastness . a relative od difference of 0 % represents no grey - area smearing and is given the value 5 . a relative od difference of more than 40 % represents high grey area smearing and is given the value 0 . the blocking resistance is determined according to iso 11798 and comprises the following steps : sample preparation : 1 ) cutting printed sample of a receiving material of 7 × 7 cm ; 2 ) cutting unprinted sample of a receiving material of the same size ; 3 ) alternatingly stacking printed parts and unprinted parts , such that unprinted receiving material is in direct contact with a printed part ; and placing a weight of 3 . 34 kg onto the stack , at 50 ° c . ( unless stated otherwise ) and 60 % relative humidity for 3 . 5 days . for a positive judgment of the test result , i . e . no or little blocking , the printed and unprinted samples may not stick to each other and no image transfer from a printed sample to an unprinted sample may have occurred . the test results are given a mark ranging from 5 ( no blocking ) to 0 ( much blocking ). a scratch is made using a normal force of 28 cn with a chisel of polycrystalline diamond with a radius of 0 . 5 mm . the relative difference in optical density , od , ( measured with a gretag macbeth d19c od meter ) between the surface of the scratch and the area right next to the scratch is measured (( δod / od area right next to the scratch )* 100 %) the relative od difference between the surface of the scratch and the area right next to the scratch is a measure for scratch fastness . a relative od difference of 0 % represents perfect scratch fastness and is given the value 5 . a relative od difference of 20 % or more represents very low scratch fastness and is given the value 0 . a printed paper , preferably hello gloss 90 grams , is folded using a kirchner roll . the fold is made perpendicular to the direction of printing . the optical density is measured on a position on the printed paper , where the fold is made ( od fold ) and the optical density is measured on a position on the printed paper next to the fold ( od next to fold ) . based on the measured optical densities , the folding resistance α is calculated , wherein α is defined as : α =( 10 − od ( fold ) − 1 )/( 10 − od ( next to fold ) − 1 ). when α = 1 ( perfect folding resistance ), the results is given the value 5 , when α ≦ 0 . 90 , then the result is given the value 0 . a ballpoint and a metal plate were provided , the point of the ballpoint resting on the metal plate . an object having a mass of 296 g was connected to the ballpoint , such that the object is hanging from the ballpoint . a printed paper and a non - printed paper , the printed side of the printed paper facing the non - printed paper , the printed paper and the non - printed paper comprising the same type of paper are put on top of one another and are moved in between the ballpoint and the metal plate together , such that the ballpoint draws a line on the backside of the printed paper . the printed and the non - printed paper should not move with respect to one another . the results are judged by comparing the results of the test with references and are given a value . a value of 5 corresponds to a very good result , a value of 0 corresponds to a very bad results . 10 . 0 g glycerol ( 0 . 109 mole ; 6 equivalents ), 15 . 6 g cyclohexane - 1 , 2 - dicarboxyllic acid ( 0 . 091 mole ; 5 equivalents ) and 17 . 7 g benzoic acid ( 0 . 145 mole ; 8 equivalents ) was brought under nitrogen atmosphere into a round - bottom flask equipped with a dean - stark trap . 20 ml of xylene was added . the mixture was then heated to 200 ° c . and stirred for 2 days . the conversion was monitored by monitoring the amount of water present in the dean - stark trap . after the reaction was completed , the water was removed from the dean stark trap and the xylene was removed in a rotavap . since xylene forms an azeotropic mixture with water , the last traces of water were also removed upon removal of the xylene . the last traces of xylene as well as unreacted monomer were removed by heating the reaction mixture to 150 ° c . for another 8 hours under vacuum ( i . e . at a pressure of at most 10 − 2 mbar ). the prepared copolyester 30 has a tg of 25 ° c ., a viscosity at 140 ° c . of 354 mpas and a molecular weight ( m w ) of 2064 gram / mole ( see also table 1 ). several other copolyesters in accordance with the present invention ( 31 - 43 ) were synthesized in a similar way as describes above , by combining the desired amounts of the respective building blocks ( a , b , c and optionally c 2 ) into the round - bottom flask equipped with a dean - stark trap , in experiment 2 - 14 , respectively . non - limiting examples of copolyesters in accordance with the present invention are summarized in table 3 . several ink compositions were prepared . ink compositions 20 - 25 comprise a copolyester in accordance with the present invention , whereas ink composition 26 does not comprise a copolyester in accordance with the present invention . 10 grams of the copolyester 30 , 30 grams of the copolyester 31 , and 10 grams of the low melting crystalline component 10 were combined in a vessel , heated to 150 ° c . and mixed . subsequently , 50 grams of the high melting crystalline component 1 , n = 9 , was added under stirring of the mixture . the mixture was stirring until all material was melted . subsequently , 2 . 5 phr of black pigment dispersion was added and the mixture was stirred for another 3 hours . the residual solvent from the dispersion was removed at low pressure . the resulting fluid was filtered over a filter having pores in the range of 0 . 7 - 1 . 2 μm . the filtered ink composition was allowed to cool down to room temperature , after which the ink composition solidified , yielding ink composition 20 . ink composition 20 has a viscosity η of 19 . 3 mpa s at 140 ° c ., a tg of 8 ° c ., melting points at 61 ° c ., 73 ° c ., 93 ° c . and 129 ° c . and crystallization temperatures of 61 ° c . and 109 ° c . ink composition 21 was prepared in a procedure similar to the one described in example 1 , with the difference that 20 grams of the copolyester 31 and 20 grams of the copolyester 41 were used , instead of 10 grams of the copolyester 30 and 30 grams of the copolyester 31 . ink composition 21 has a viscosity η of 17 . 5 mpa s at 140 ° c ., a tg of 5 ° c ., melting points at 61 ° c ., 73 ° c ., 93 ° c . and 128 ° c . and crystallization temperatures of 60 ° c . and 108 ° c . ink composition 22 was prepared in a procedure similar to the one described in example 1 , with the difference that instead of 10 grams of the copolyester 30 , 10 grams of the copolyester 32 were used . ink composition 22 has a viscosity η of 18 . 9 mpa s at 140 ° c ., a tg of 2 ° c ., melting points at 61 ° c ., 74 ° c ., 94 ° c . and 129 ° c . and crystallization temperatures of 60 ° c . and 110 ° c . ink composition 23 was prepared in a procedure similar to the one described in example 1 , with the differences that 10 grams of low melting crystalline component 12 , instead of 10 grams of low melting crystalline component 10 were used , that 40 grams of the copolyester 32 , instead of 10 grams of the copolyester 30 and 30 grams of the copolyester 31 were used and that 50 grams of 9 , n = 4 were used instead of 50 grams of high melting crystalline component 1 , n = 9 ink composition 23 has a viscosity η of 14 . 4 mpa s at 140 ° c ., a tg of 6 ° c ., melting points at 57 ° c . and 110 ° c . and crystallization temperatures of 35 ° c . and 53 ° c . ink composition 24 was prepared by combining 50 grams of the copolyester 42 and 50 grams of the high melting crystalline component 5 , n = 6 in a vessel , heating to 150 ° c . and mixing . subsequently , 2 . 5 phr of black pigment obtained from mikuni , was added and the mixture was stirred for another 3 hours . the resulting fluid was filtered over a filter having pores in the range of 0 . 7 - 1 . 2 μm . the filtered ink composition was allowed to cool down to room temperature , after which the ink composition solidified , yielding ink composition 24 . ink composition 24 has a viscosity η of 8 . 0 mpa s at 140 ° c ., a tg of 15 ° c ., a melting point of 88 ° c . and a crystallization temperature of 61 ° c . ink composition 25 was prepared in a similar way as ink composition 21 , except that component 1 , n = 8 was used as the high melting crystalline component , instead of high melting crystalline material 1 , n = 9 . ink composition 25 has a viscosity η of 18 . 2 mpa s at 140 ° c ., a tg of 4 ° c ., melting points at 58 ° c ., 71 ° c ., 91 ° c . and 128 ° c . and crystallization temperatures of 58 ° c . and 112 ° c . ink composition 26 was prepared by combining 40 grams of a copolyester from di - isopropanolamine , succinic acid and benzoic acid , the copolyester having an of 700 gram / mole and 20 grams of the low melting crystalline component 10 in a vessel , heating to 150 ° c . and mixing . subsequently , 40 grams of the high melting crystalline component 1 , n = 9 , was added under stirring of the mixture . the mixture was stirring until all material was melted . subsequently , 2 . 4 phr of a dye ( valifast black 3820 ), was added and the mixture was stirred for another 3 hours . the resulting fluid was filtered over a filter having pores in the range of 0 . 7 - 1 . 2 μm . the filtered ink composition was allowed to cool down to room temperature , after which the ink composition solidified , yielding ink composition 26 . ink composition 26 has a viscosity η of 12 . 2 mpa s at 140 ° c ., a tg of 4 ° c ., melting points at 58 ° c ., 72 ° c ., 91 ° c . and 123 ° c . and crystallization temperatures of 52 ° c . and 103 ° c . prints were made using an océ - colorwave 600 printer , using the above referenced ink compositions . the ink compositions were supplied to the printer in the solid phase and were melted in the printer . in a first comparison experiment , prints were made using the océ colorwave 600 on hello gloss receiving medium . prints made with ink composition 21 ( example 2 ) were compared to prints made with ink composition 26 ( c1 ) on several aspects of print robustness . the results are summarized in table 4 . prints made with ink composition 21 , comprising a copolyester in accordance with the present invention show better results than the prints made with ink composition 26 on four aspects of print robustness , namely blocking , folding resistance , adhesion and smearing . prints made with ink composition 21 and prints made with ink composition 26 showed similar results regarding the carbon effect . prints made with ink composition 21 showed good and very good results on grey area smearing and scratch fastness , respectively . prints made with ink composition 26 were not tested on these aspects . prints made with ink composition 24 also comprising a copolyester in accordance with the present invention shows better results than the prints made with ink composition 26 on two aspects of print robustness , namely smearing and carbon effect . prints made with ink composition 24 show a similar folding resistance as prints made with ink composition 26 . regarding grey area smearing and scratch fastness , no comparison is possible . prints made with ink composition 26 show better results regarding blocking and adhesion than prints made with ink composition 24 . prints made with ink composition 25 , also comprising a copolyester in accordance with the present invention shows better results than the prints made with ink composition 26 on three aspects of print robustness , namely blocking , adhesion and smearing . prints made with ink composition 25 and prints made with ink composition 26 showed similar results regarding the folding resistance . prints made with ink - compositions 25 and 26 were fused after printing . for prints made with ink composition 21 , only the prints used in the grey - are smearing test were fused after printing . however , the print robustness does normally increase after fusing . therefore , print robustness is expected to improve even further after fusing of the prints . in a second comparison experiment , prints were made using the océ colorwave 600 on hello gloss . prints made with ink composition 21 were compared to prints made with ink composition 26 on several aspects of print robustness . all prints were fused after printing . the results of the tests regarding the print robustness of both the prints made with the ink composition 20 and prints made with the ink composition 26 are summarized in table 5 . prints made with ink composition 20 show better results on four aspects of print - robustness ( blocking , folding resistance , adhesion and scratch fastness ) than prints made with ink composition 26 . prints made with ink composition 20 and 26 show the same result in the test for the carbon effect . only the grey area smearing of prints made with ink composition 20 was tested , therefore , no comparison between prints made with ink composition 26 can be made for that aspect of print robustness . prints made with ink composition 20 do not show worse print robustness than prints made with ink composition 26 in any of the tests performed . in a third comparison experiment , prints made using the océ colorwave 600 on top coated pro gloss . prints made with ink composition 20 - 23 and 26 were compared regarding their scratch fastness . the scratch height used in the test was 3 mm , resp . 4 mm . prints made with ink compositions 20 , 21 and 22 showed hardly any difference in optical density ( od ) between the surface of the scratch and the area right next to the scratch . as a consequence , these prints have a value 5 for scratch fastness . prints made with ink compositions 23 and 26 show worse results in scratch fastness ; both prints were given the value 0 for scratch fastness . however , the relative difference in od for prints made with ink composition 23 was less than the relative difference in od for prints made with ink composition 26 . thus , prints made with ink composition 20 - 23 showed better results than prints made with ink composition 26 . in a fourth comparison experiment , prints made with ink compositions 20 , 21 , 22 and 26 using the océ - colorwave 600 in 1200 × 600 dpi were tested with respect to blocking . prints made with the ink compositions 21 - 22 , comprising a copolyester in accordance with the present invention , showed a lower level of blocking ( higher print robustness ) than ink composition 26 , not comprising a copolyester in accordance with the present invention at a media temperature of 60 ° c . the level of blocking of the prints made with ink compositions 20 - 22 decreased with increasing media temperature . when hot melt ink compositions comprising a copolyester according to the present invention ( example 1 - 6 ) are compared to hot melt ink compositions not comprising a copolyester in accordance with the present invention ( comparative example c1 ), it is clear that such inks provide improved print - robustness . detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention , which can be embodied in various forms . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually and appropriately detailed structure . in particular , features presented and described in separate dependent claims may be applied in combination and any combination of such claims are herewith disclosed . further , the terms and phrases used herein are not intended to be limiting ; but rather , to provide an understandable description of the invention . the terms “ a ” or “ an ”, as used herein , are defined as one or more than one . the term plurality , as used herein , is defined as two or more than two . the term another , as used herein , is defined as at least a second or more . the terms including and / or having , as used herein , are defined as comprising ( i . e ., open language ). the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . | 2 |
the gel in highly hydrated self - supporting film form according to the present invention contains a quantity of between 1 % and 7 . 5 %, and preferably 3 . 5 %, ( all percentages being by weight ) of one or more alkaline alginates , preferably sodium alginate ; a quantity of between 0 . 1 % and 5 %, and preferably 1 %, of an alkaline earth alginate , preferably calcium alginate ; a quantity of between 0 . 1 % and 10 %, and preferably 5 %, of a polyalcohol , preferably glycerol ; and a quantity of between 0 . 05 % and 10 %, and preferably 0 . 5 %, of a natural , synthetic or semisynthetic polymer of hydrophilic character , preferably sodium hyaluronate , plus optionally between about 0 . 01 % and 10 % of one or more medicaments , the remainder being water . other alkaline alginates which can be advantageously used are for example potassium and ammonium alginates . the described film is obtained with the required characteristics according to the invention by starting from an initial fluid gel containing a quantity of between 3 . 5 % and 7 . 5 %, and preferably 3 . 5 %, of one or more alkaline alginates , preferably sodium alginate , a quantity of between 0 . 5 % and 7 . 5 %, and preferably 5 %, of a polyalcohol , preferably glycerol , a quantity of between 0 . 1 % and 10 %, and preferably 0 . 2 %, of a natural , synthetic or semisynthetic polymer of hydrophilic character , preferably sodium hyaluronate , plus optionally a medicament . the initial fluid gel is extruded by pumping through a slit of adjustable width and thickness , and coagulated by passage through between 2 and 4 successive baths , preferably 2 , at controlled temperature , the baths containing one or more soluble calcium salts . the concentration of ca 2 + ions in the various coagulation baths is between 0 . 1 and 10 % and preferably 1 % in the first coagulation bath , and 2 % in the subsequent baths . the coagulation bath temperature is between 15 ° c . and 40 ° c . and preferably 20 ° c . for the first , and 30 ° c . for the subsequent baths . after passage through the last coagulation bath a highly hydrated gel is obtained in the form of a self - supporting thin film having a thickness variable between 0 . 1 and 5 mm , preferably 0 . 4 mm , with a ph of between 5 . 5 and 7 . 5 , preferably between 6 . 5 and 7 . 2 . the final film characteristics , such as its mechanical and hydration characteristics , can be varied according to requirements by varying the initial gel composition and the coagulation bath conditions . in a preferred embodiment of the process according to the invention , the alginate film is prepared by extrusion and coagulation using the device shown in fig1 . the initial fluid gel is placed in a container vessel 1 from which it is drawn by a pump 2 operating at a suitable r . p . m ., then passed through a filter 3 and fed to the filming extruder 4 comprising a slit of suitable variable size immersed in the first coagulation bath . coagulation occurs immediately on leaving the filming extruder , the recovered film being passed below a guide drum 5 immersed in the first coagulation bath . the film then leaves the bath , passes through a dragging roller 6 driven by a motor 7 , enters a second coagulation bath through which it is guided by a second drum 8 , leaves the bath guided by a third drum 9 and is wound onto a winding reel 12 by a calender 10 driven by a motor 11 . the size - setting of the extruder , the pump r . p . m ., the dragging roller speed and the winding roller speed can be varied to define the final characteristics of the film . for example a film according to the present invention with a thickness of 300μ is obtained by using the device of fig1 under the following operating conditions : pump r . p . m . : 15 r . p . m . equivalent to a throughput of 18 cc / min any active principle compatible with the gel composition , such as substances of antiseptic , antibiotic , anti - inflammatory , antihistaminic or other activity , can be incorporated into the gel either alone or in association . the concentration of the active principle incorporated into the gel depends on its pharmacological characteristics , and would represent a quantity such as to make it effective for the purpose of the specific application . the medicament quantity in the compositions of the invention can vary from about 0 . 01 % to 10 % of the weight of the final product . the film obtained in this manner can be easily stored , handled and used advantageously as covering or medication material for cutaneous lesions and / or pathologies such as the treatment of wounds of surgical or traumatic origin , burns or lesions of pathological origin such as stasis ulcers , bedsores and the like . some non - limiting examples of the preparation of self - supporting film according to the invention are described below . 24 . 5 g of sodium alginate are dispersed at ambient temperature in 250 ml of water under continuous stirring . a viscous gel forms , to which are added 1 . 4 g of sodium hyaluronate hyalastine fraction ( european patent ep 0138572 granted on 25 th jul . 1990 ), 35 g of glycerol and 7 g of nacl dissolved in 250 ml of water under stirring , the final solution volume then being adjusted to 700 ml . slow stirring , to avoid incorporating air , is then continued for about 20 hours , after which the viscous solution is filtered through a 20μ mesh filter and degassed under vacuum . the solution is extruded by pumping through a slit of width 12 cm and of set thickness , and is coagulated by passing through two successive baths containing calcium chloride , the first at 20 ° c . with a concentration of 1 % and the next at 30 ° c . with a concentration of 2 %. the film obtained , having a thickness of about 0 . 250 mm , is wound on a suitable spool , washed by immersion in a water bath for 1 hour and finally stored in an aqueous solution containing 5 % glycerol , 0 . 2 % methylparaben , 0 . 02 % propylparaben and 0 . 2 % sodium dehydroacetate . following the procedure described in example 1 , 1 . 4 g of sodium hyaluronate hyalectine fraction ( european patent ep 0138572 granted on 25 th jul . 1990 ) are added in place of the hyalastine fraction , to obtain a film having analogous characteristics to those of the film obtained in example 1 . 50 ml of an aqueous solution containing 0 . 4 g of hyaluronic acid ethyl ester of 75 % esterification ( hyaff 7 p75 european patent application epa 216453 of 7th jul . 1986 ) are added to 150 ml of an aqueous solution containing 7 g of sodium alginate , 10 g of glycerol and 2 g of nacl . after filtration and degassing , the final solution is extruded and coagulated by the procedure described in example 1 to obtain 150 g of film with a thickness of 0 . 250 mm . the film is stored in the solution of glycerol and preservatives described in example 1 . 50 ml of an aqueous solution containing 5 g of polyethyleneglycol 1500 are added to 150 ml of an aqueous solution containing 7 g of sodium elginate , 10 g of glycerol and 2 g of nacl . after filtration and degassing , the final solution is extruded and coagulated by the procedure described in example 1 to obtain 150 g of film with a thickness of 0 . 250 mm . the film is stored in the solution of glycerol and preservatives described in example 1 . 50 ml of an aqueous solution containing 2 . 5 g of p -( aminomethyl ) benzenesulphonamide acetate are added to 150 ml of an aqueous solution containing 7 g of sodium alginate , 10 g of glycerol and 2 g of nacl . after filtration and degassing , the final solution is extruded and coagulated by the procedure described in example 1 to obtain 150 g of film with a thickness of 0 . 250 mm . the film is stored in the solution of glycerol and preservatives described in example 1 . 50 ml of an aqueous solution containing 0 . 1 g of the neomycin salt of hyaluronic acid partly esterified with ethanol ( 75 % of the carboxyl groups esterified with ethanol , 25 % of the carboxyl groups esterified with neomycin in accordance with example 29 of european patent application epa 216453 filed on 7th jul . 1986 ) and 0 . 3 g of the 75 % esterified partial ethyl ester of hyaluronic acid are added to 150 ml of an aqueous solution containing 7 g of sodium alginate , 10 g of glycerol and 2 g of nacl . after filtration and degassing , the final solution is extruded and coagulated by the procedure described in example 1 to obtain 150 g of film with a thickness of 0 . 250 mm . the film is stored in the solution of glycerol and preservatives described in example 1 . the final neomycin content of the film is 0 . 00305 g / 100 g . 50 ml of an aqueous dispersion of 10 g of microbeads obtained from mixed ethyl and hydrocortisone ester of hyaluronic acid ( example 15 of european patent application epa 216453 of 7th jul . 1986 ) are added to 150 ml of an aqueous solution containing 7 g of sodium alginate , 10 g of glycerol and 2 g of nacl . the final dispersion is extruded and coagulated by the procedure described in example 1 to obtain 150 g of film with a thickness of 0 . 250 mm . the film is stored in the solution of glycerol and preservatives described in example 1 . to demonstrate the advantages and activity of the highly hydrated self - supporting film according to the present invention a trial was conducted using 45 male sprague - dawley rats of weight 225 - 250 g . the rats were divided into three groups and were given a heat lesion by a suitable instrument containing a metal prod of known area able to maintain a constant temperature . by applying this instrument to the back of the animal in a region close to the caudal reproducible heat lesions were obtained classifiable as third degree burns . the treatment scheme involved a group of untreated animals , a group of animals treated conventionally with vaseline ® gauze and a third group treated with a film of hydrated gel as described in example 1 of the present patent . the medications were changed every 3 days , 5 animals of each group being sacrificed 9 , 15 and 25 days after the lesion . after a planimetric evaluation of the lesion area add eschar area , biopsies were taken for histological examination . the results of these tests are given in table 1 . table 1______________________________________ day 9 day 15 day 25 nt gg g nt gg g nt gg g______________________________________persistence of + + + + + ± + ± - escharreduction in lesion - - ± - - + - ± ++ areaneoangiogenesis - - + - - ++ - - +++ ______________________________________ nt = not treated ; gg = vaseline ® gauze ; g = gel film - = not apparent ; ± = hardly apparent ; + = apparent ; ++ = very apparent ; +++ = extremely apparent the results summarized in the table show that burns treated with the composition described in example 1 of the present patent have a positive effect on early eschar fall , reduction in lesion area and neovascularization . | 2 |
authentication refers to the technology that ensures that a message , data , control command signal or information that is downloaded or transferred from a one person or device to another declared or intended person or device . encryption refers to a privacy technology that prevents anyone but the intended recipient ( s ) to download , review or read confidential information , signal and / or data . integrity refers to technology that ensures that a message , information , control command signal , and / or data do not alter in any way during transit . non - repudiation refers to the technology that prevents a sender from denying that a message , data , control command signal or information was sent . wireless and wired communication technology refers to all current and future variants , revisions and generations ( e . g . third generation ( 3g ), fourth generation ( 4g ), fifth generation ( 5g ) and all future generations ) of global system for mobile communication ( gsm ), general packet radio service ( gpsr ), code division multiple access ( cdma ), evolution - data optimized ( ev - do ), enhanced data rates for gsm evolution ( edge ), 3gsm , digital enhanced cordless telecommunications ( dect ), digital amps ( is - 136 / tdma , integrated digital enhance network ( iden ), hspa +, wimax , lte , flash - ofdm , hiperman , wifi , iburst , umts , w - cdma , hspda + hsupa , umts - tdd and other formats for utilizing cell phone technology , telephony antenna distributions and / or any combinations thereof and including the use of satellite , microwave technology , the internet , cell tower , telephony and / or public switched telephone network lines . a television computer monitor , desktop or laptop , cell phone , smart phone , tablet , or similar apparatus includes all television with wired or wireless communication technology , remote cellular phones using channel access methods defined above ( with cellular equipment , public switched telephone network lines , satellite , tower and mesh technology ), mobile phones , pdas , tablets ( e . g . refers to all current and future variants , revisions and generations of the apple ipad , samsung galaxy , hp , acer , android , microsoft , nook , google nexus , sony , kindle and all future tablets manufactured by these and other manufactures ), apple ipod touch , or a television , timepiece or computerized watch , computerized glasses and other similar apparatus with wifi and wireless capability , and remote computers and controllers having internet or wireless connectivity . cellular format technology refers to all current and future variants , revisions and generations ( e . g . third generation ( 3g ), fourth generation ( 4g ), fifth generation ( 5g ) and all future generations ) of global system for mobile communication ( gsm ), general packet radio service ( gpsr ), code division multiple access ( cdma ), evolution - data optimized ( ev - do ), enhanced data rates for gsm evolution ( edge ), 3gsm , digital enhanced cordless telecommunications ( dect ), digital amps ( is - 136 / tdma , integrated digital enhance network ( iden ), hspa +, wimax , lte , flash - ofdm , hiperman , wifi , iburst , umts , w - cdma , hspda + hsupa , umts - tdd and other formats for utilizing cell phone technology , telephony antenna distributions and / or any combinations thereof , and including the use of satellite , microwave technology , the internet , cell tower , telephony and / or public switched telephone network lines . now referring to fig1 a , shown is a perspective view of a standard ( or smart ) television or computer monitor or similar device that displays digital signals on a display screen 10 showing streaming video content ( e . g ., a commercial , movie , television show , sponsored material , live or recorded , etc .) 14 . the streaming video content 14 comprises the transmission of dynamic or sometimes static images , generally with accompanying sound , via electric or electromagnetic signals . also shown is a support stand that provides support at the base of a television or computer monitor or similar device . fig1 b is a sectional view of a standard ( or smart ) television or computer monitor or similar device that displays digital signals on a display screen 10 and having a base 12 . shown on the display screen of the television , computer monitor , or similar device , the streaming video content 14 comprises the transmission of dynamic or sometimes static images , generally with accompanying sound , via electric or electromagnetic signals . also shown is streaming video content via a commercial or television computer monitor or similar device 10 with a peer - to - peer communication 20 , 22 being conducted between a caller 24 and a call recipient 26 and displayed on the television screen 10 . a peer - to - peer computer network is one in which each television , computer monitor , or similar device in the network can act as a client or server for the other television , computer monitor , or similar devices in the network , allowing shared access to various resources such as voice over internet protocol ( voip ) without the need for a central server . sometime known as the p2p , these networks can be set up within the home , a business , and are generally conducted over the internet . one of the best examples of voip peer - to - peer communication is skype . skype was first released in 2003 and the computer software code was written by estonian developers ahti , heinla , priit kasesalu and jaan tallinn who had also originally developed kazaa . it evolved into a platform with over 600 million users and was eventually acquired by microsoft corporation in 2011 for $ 8 . 5 billion . the skype service allows users to communicate with peers by voice using a microphone , video by using a webcam , and instant messaging over the internet . phone calls may be placed to recipients on the traditional telephone networks . calls to other users within the skype service are free of charge , while calls to landline telephones and mobile phones are charged via a debit - based user account system . skype has also become popular for its additional features , including file transfer and video conferencing . competitors include sip and h . 323 - based services , such as linphone , google talk , apple ichat , gotomeeting , webinars , podcasts , and the like . unlike most other voip services , skype is a hybrid peer - to - peer and client - server system . it makes use of background processing on computers running skype software . skype &# 39 ; s original proposed name ( sky peer - to - peer ) reflects this fact . fig1 c is a sectional view of a standard television computer monitor or similar device 10 having a base 12 and showing streaming video content on the screen 14 with a peer - to - peer communication 20 , 22 being conducted between a caller 24 and a call recipient 26 . displayed on the screen , represented here as a television or computer , but can also be a cell phone display , or similar device that shows the company &# 39 ; s logo / advertiser &# 39 ; s asset : logo , graphic , watermark , banner , video , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .) 32 displayed in a section 30 of the screen during the peer - to - peer communication 20 , 22 . company logo or advertisement refers to the advertiser &# 39 ; s assets : logo ( s ), graphic ( s ), watermark ( s ) banner ( s ), video ( s ), and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .) that is incorporated in a strategic , non - intrusive and predetermined or designated location within or outside of the video chat foreground ( depending on what setting the user has made ) during a peer - to - peer conversation . this figure is shows the company logo , aka advertiser &# 39 ; s assets : logos , graphics , watermarks , banners , videos , etc . 32 in the lower right corner of the screen ; but , the applicant anticipates that the advertiser &# 39 ; s assets ( as mentioned above ) can be located in different predetermined or designated areas , corners , or other parts of television screen , computer screen , cell phone display or similar device . the company logo or advertiser &# 39 ; s asset 32 is displayed during the peer - to - peer communication 20 , 22 . if the peer - to - peer communication 20 , 22 end while the streaming video content is displayed on the screen , the company logo or advertisement 32 will be removed from the screen in which was playing . if the peer - to - peer communication 20 , 22 continues but the streaming video content displayed on the screen ends , the advertiser &# 39 ; s asset ( company logo ) 32 will remain on the screen until another streaming video content is displayed on the screen . if another vendor &# 39 ; s streaming video content 14 is displayed , the present invention software will recognize the new or different streaming video content ( commercials , movies , television shows , sponsored material , live or recorded , etc .) or programming , and associate a new logo that matches to the respective content being shown . this cycle continues until the peer - to - peer communication 20 , 22 is terminated . now referring to fig2 , shown is a sectional view of a standard television , computer monitor , or similar device 10 having a base 12 and showing streaming video content 14 with a peer - to - peer communication 20 , 22 being conducted between a caller 24 and a call recipient 26 . the streaming video content 14 displayed on the screen also show a company logo / advertiser &# 39 ; s asset 32 displayed in a section 30 of the screen during the peer - to - peer communication 20 , 22 . the company logo refers to the advertiser &# 39 ; s assets : logo , graphic , watermark , banner , video , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc . ), which are incorporated in a strategic , non - intrusive and predetermined or designated location within or outside of the video chat foreground ( depending on what setting the user has designated ) during a peer - to - peer conversation . also shown is a representation view of a standard cable set - top box 40 installed with the present invention software 51 and client logos or advertising database , dai ad server library ( asset library ), 50 . the present invention software as ad server software stacker 51 comprises ten components : a user interface , peer - to - peer protocol software , digital air impressions ad video recognition software , an operation system ( shown as android 2 . 3 . 4 ), custom system on chip ( soc ) drivers , peripheral drivers , linux kernel libraries , abstraction layers , linux 2 . 5 . 34 , entropic shiner soc . also shown is a pstn phone line communication ( public switched telephone network ) 46 . pstn networks are the world &# 39 ; s public circuit - switched telephone networks that are all inter - connected by switching centers , thus allowing any telephone in the world to communicate with any other . it is also anticipated that the incoming peer - to - peer call can use cellular wireless technology as defined herein . the software control 51 consists of : ( 1 ) an id signature ( identity signature is an encrypted database for software that encodes video with a unique identifier that corresponds with the dai ad server library ( asset library )). ( 2 ) dai ad video recognition software that detects and identifies the signature encoded within the streaming video content of a skype or skype - like capable device , such as a set - top box , monitor , television , and so forth . this software recognizes when a skype , facetime , google talk , ichat , and the like session begins while watching or viewing streaming video content on a tv , smart phone , tablet , the internet , and the like . when the signature is detected on the hdmi input , dai sends the id signature to the set - top box , which then initiates a signal to the dai ad server library ( asset library ) to find the corresponding advertiser &# 39 ; s asset logo , graphic , watermark , banner , video , etc ., and incorporates it onto the screen . ( 3 ) dai ad server library ( asset library ) that stores the advertiser &# 39 ; s assets : logos , banners , watermarks , graphics , video , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .). an input means 56 , used to communicate with the standard cable set - top box 40 , is a mso ( multiple system operators ), which refers to operators of multiple cable television systems whereby the majority of system operators run cable systems in more than one community and hence most of them are multiple system operators . the client logos and advertising database , dai ad server library ( asset library ), 50 which houses the advertiser &# 39 ; s assets : logos , graphics , watermarks , banners , videos , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .) of the client , includes the technology and service that places advertisements on the screen and the library is which houses this . ad servicing technology companies provide software to advertisers to serve ads , count them , choose the ads that will make the website or advertiser the most money , and monitor progress of different advertising campaigns . fig3 is a representative view of a proprietary designed cable set - top box 60 incorporating the present invention software , ad server software stacker , 62 and the client logo / advertiser &# 39 ; s assets database , which is the dai ad server library ( asset library ), 50 . as applicable to the modified standard cable set - top box 40 , a pstn phone line communication ( public switched telephone network ) 46 can be incorporated into the proprietary designed cable set - top box 60 . pstn networks are the world &# 39 ; s public circuit - switched telephone networks that are all inter - connected by switching centers , thus allowing any telephone in the world to communicate with any other . it is anticipated that the proprietary designed cable set - top box , the ad server software stacker , 60 can send display signals for incoming peer - to - peer calls that use cellular wireless technology as defined herein . the software control is analogous to the software 51 described in the prior embodiment and consists of ( 1 ) an id signature ( identity signature is an encrypted database for software that encodes video with a unique identifier that corresponds with the dai ad server library ( asset library )), ( 2 ) dai ad video recognition software , detection software that identifies the signature encoded in the streaming video content ( e . g ., commercial , movie , television show , sponsored material , live or recorded , etc .) of a skype - type capable device , such as a set - top box , monitor , television , and so forth . this software recognizes when a skype , facetime , google talk , ichat , and the like session begins while watching or viewing streaming video content on the tv , internet , tablets , smart phones , and the like . when the signature is detected on the hdmi input , dai sends the id signature to the set - top box , which then initiates a signal to the dai ad server library ( asset library ) to find the corresponding advertiser &# 39 ; s asset : logo , graphic , watermark , banner , video , etc ., and incorporates it onto the screen . ( 3 ) and an ad server library ( asset library ) that stores the advertiser &# 39 ; s assets : logos , banners , watermarks , graphics , videos , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .). this proprietary designed cable set - top box 60 also has an input means analogous to 56 that consists of a mso ( multiple system operators ) which refers to operators of multiple cable television systems whereby the majority of system operators run cable systems in more than one community and hence most of them are multiple system operators . the client logos / advertiser &# 39 ; s assets in the dai ad . server library ( asset library ) 50 includes the technology and service that incorporates logos , graphics , watermarks , banners , videos , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .) on the screen and the library which houses this . ad servicing technology companies provide software to advertisers to serve ads , count them , choose the ads that will make the website or advertiser the most money , and monitor progress of different advertising campaigns . fig4 is a representation view of a communication means 72 generated from an antenna means 82 coming from a corporate entity 80 to the internet 70 which generates a signal with a communication means 78 to a computer station 100 , a signal with communication means 76 to a television ( wireless or non ) or a monitor 10 , and / or a signal with communication means 74 cell or smart phone or similar device 90 . the internet generated signal with a communication means 78 that communicates with the computer station 100 that generally delivers internet connectivity via a modem / server system 108 that is either wired with an ethernet system or wireless transferred to the computer 110 . as shown , an operator or individual 104 is sitting on a chair 106 and viewing a computer display means 102 that is showing streaming video content 14 with a peer - to - peer communication 20 , 22 being conducted between a caller 24 and a call recipient 26 . displayed on the computer screen display 102 is also showing a company logo or advertiser &# 39 ; s assets 32 displayed in a section 30 of the computer screen during the peer - to - peer communication 20 , 22 . the internet generated signal with communication means 76 to a wireless television 10 has a base 12 and streaming video content 14 with a peer - to - peer communication . 20 , 22 being conducted between a caller 24 and a call recipient 26 similar to that graphical depicted in fig1 c . the streaming video content 14 displayed in fig1 c on the wireless television screen is the advertiser &# 39 ; s asset : the company &# 39 ; s logo , graphic , watermark , banner , video , and the like with or without static , 3 - d , sound , picture - in - picture , etc .) 32 displayed in a section 30 of the computer screen during the peer - to - peer communication 20 , 22 . the internet generated signal with communication means 74 to a smart phone or similar device 90 with a display screen 94 and showing streaming video content 14 with peer - to - peer communication 20 , 22 being conducted between a caller 24 and a call recipient 26 . shown on the display of a cellular , smart phone display , tablet , or similar device display 94 also showing the advertiser &# 39 ; s assets ( from the dai software ) 32 displayed in a section 30 of the display screen 94 during the peer - to - peer communication 20 , 22 . fig5 a is flowchart demonstrating the software logic sequence that is used in either the standard set - top box 40 including the ad server software stacker 51 or proprietary designed cable set - top box 60 with the ad server software stacker 51 . the flowchart shows that the ad server software stacker 51 constantly monitors the video feed 120 . when a peer - to - peer communication is recognized 122 , the software proceeds to identify commercials and sponsored content 124 . the identification process continues as the software 51 determines if the streaming video content is a dai registered paying client 126 . if it determined that the streaming video content is not a registered paying client , the software 51 logic loops back to monitoring the video feed 130 . if it is determined that the streaming video content is a registered paying client , then the software 51 proceeds to step 136 where the software 51 monitors consistently monitors streaming video content and searches the database . the software 51 then determines what video material to insert into the video feed 138 . if the software 51 recognizes streaming video content , a commercial here for example , it then identifies the particular advertiser &# 39 ; s asset to link - up to the commercial ( via an identity signature ) 142 . if the software 51 recognizes sponsor content , then it identifies the product lines and feeds the associated logo , sponsored content , or sponsor directed advertising 144 . fig5 b is a continuation of the flowchart demonstrating the software logic sequence . the software 51 continues along the sequence 141 and links the appropriate advertiser &# 39 ; s asset : logo , graphic , watermark , banner , video , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .) to the streaming video content ( commercial , movie , television show , sponsored material , live or recorded , etc .) 146 . the software displays the logo in a strategic , nonintrusive and predetermined or designated location of the canvas the computer , television , smart phone , or similar device screen 148 . the software 51 monitors for the end of the streaming video content ( e . g ., commercial , movie , television show , sponsored content , live or recorded , etc .) 150 and if or streaming video content has not ended and is continuing , then the software 51 logic loops back 147 . when the streaming video content ( commercial , movie , television show , sponsored content , live or recorded , etc .) has ended and the end is detected 152 by the software 51 , then the sequence continues to step 154 where the software 51 removes the advertiser &# 39 ; s asset : logo , graphic , watermark , banner , video , etc . from the computer , television , or smart phone or similar device screen . the software 51 continues to monitor during the peer - to - peer call and if new streaming video content is detected 156 , the software 51 loops back to step 120 ( shown of fig5 a ). if no new streaming video content is detected 157 or the peer - to - peer communication ends 158 , the entire software sequence ends . now referred to fig6 which provide a more detailed description of the standard proprietary designed cable set - top box components . there are several components that either are directly or indirectly necessary to carry out the method of the present invention . the digital air impressions ad recognition software and system 51 consisting of ( 1 ) an id signature ( identity signature is an encrypted database for software that encodes video with a unique identifier that corresponds with the dai ad server library ). ( 2 ) detection software that identifies the signature encoded in the video content of a skype - type capable device , such as a set - top box , monitor , television , and so forth . this software recognizes when a skype , facetime , google talk , ichat , and the like session begins while watching or viewing video content on the tv , internet , tablets , smart phones , and the like . when the signature is detected on the hdmi input , dai sends the id signature to the set - top box , which then initiates a signal to the dai ad server library to find the corresponding overlay ( logo , etc .) and places it onto the screen . ( 3 ) and an ad server library that stores the logos / banners / graphics and / or video / audio ( with or without static , 3 - d , sound , etc .). shown on fig6 is a front panel that is part of the set - top box that usually faces the user . the rf4ce 162 , display 164 , and ir 166 are included in it . the rf4ce 162 solution enables design of advanced remote control devices for more intuitive and enjoyable remote control user experiences . such as delivering remote controls with mouse - like pointing and keyboard functionality , as well as gesture and touch - based input controls . display 164 part of the set - top box that lights up with numbers and / or letters in a designed graphical format and typically faces the user . infrared signal 166 has two emitters ( also called “ ir blasters ”) at one end , is used to send signals from the dvr to your cable or satellite box or digital adapter ( dta ). these signals allow the dvr to change the channels on any of these set top boxes . the mcu ( micro controller unit ) 168 also known as a microcontroller , it is a single chip that contains the processor ( cpu ), non - volatile memory for the program ( rom or flash ), volatile memory for input and output ( ram ), a clock and an i / o control unit . the microcontroller can be used for managing the interface with the remote control and other user interface peripherals . the keypad buttons 170 consists of a device with a set of buttons arranged in a block or “ pad ” which usually bear digits , symbols and usually a complete set of alphabetical letters . soc ( system on chip ) 172 included inside are : ad server software stacker , hdmitx , video dac , spdif , audioproac + dac , and usb 2 . 0 . the soc sets new standards of performance , security , and integration while retaining backward compatibility . it supports higher rgb16 graphics specification and the chip &# 39 ; s integrated st20 cpu operates at speeds up to 180 mhz . audio options include mp3 decoding , dolby digital and pro logic decoding ; support is also provided for srs trusurround virtual surround sound . the ic ( integrated circuit ) also integrates a multi - channel dma engine , making it suitable for use in graphic applications , such as dvb - mhp , browser - based middle wares , and iptv . other features of the soc include a 16 - bit , 133 - mhz shared - memory interface with support for 64 - and 128 - bit configurations , an external memory interface supporting six configurable banks of sram , flash and dram , a mpeg - 2 decoder , and a graphics / display unit with five display planes . ad server software stacker 173 , which is contained inside the soc 172 consists of 10 components : ( 1 ) user interface ( ui ), which includes connectivity to the remote control via an irda or low - power wireless device residing in the unit itself as well as on the remote control unit ; most stbs now utilizes an rf ( radio frequency ) remote control using rf4ce ( 2 ) face - to - face protocol software ; ( 3 ) digital air impressions software ; ( 4 ) android 2 . 3 . 4 ; ( 5 ) custom soc drivers ; ( 6 ) peripheral drivers ; ( 7 ) linux kernal libraries , ( 8 ) abstraction layers ; ( 9 ) linux 2 . 6 . 34 ; and ( 10 ) entropic &# 39 ; s shiner soc . the hdmi tx ( transmitter ) 174 which is also contained within the soc 172 , provides the necessary logic to implement and verify designs for various consumer electronic applications , which includes a suite of configurable digital controllers and high - speed , mixed - signal phi ip ( allowing designers to integrate a hi - speed usb 2 . 0 host or devise into set - top boxes and consumer electronics ). this functions extremely low in power and area . it is comprised of three line drivers for data transmission and an additional line driver for clock transmission . it is designed to perform the serialization and transmission of video data and control information through an hdmi interface ; the hdmi tx 174 hard - macro interfaces with the hdmi link controller through a common graphic controller interface , supporting up to 30 bit data transfer with data enable , while the clock line driver is used for reference clock transmission . it is targeted for digital video / audio transmission for high - resolution display applications , supporting major display formats up to 3d formats , 4k × 2k resolution and 1080i / p in dtv applications and qxga in graphic display applications , with true - color or deep - color resolutions . at maximum pixel rate , the hdmi channel bit rate is 3 . 4 gbps , allowing a maximum effective throughput of 8 . 16 gbps . the video dac 176 also contained with the soc 172 , includes a small amount of logic inside the video current . data enters the video dac 176 on the input data signals and then is latched using the rising edge of the clock signal . once the data is latched , it is then routed to a decode logic circuit , whose function is to convert the dac data into individual signals that will drive the dac current source switches in the output stages of the d / as . for a 10 - bit dac , this would mean decoding the 10 bits into 1024 individual signals . these individual signals are in turn , routed to a second set of latches . these latches are sometimes referred to as “ local ” latches since each latch is located near its corresponding set of switches in the output stage of the dac . the spdif ( sony / philips digital interconnect format ) 178 , located within the soc 172 , is an audio spdif input / output interface requiring a digital audio transceiver that is a type of digital audio interconnect cable used in consumer audio equipment to output audio over reasonably short distances . the audioproc + dac 180 , also contained within the soc 172 . the audioproc is a high - quality , expert - level audio dynamics processor for winamp that utilizes the same multiband compression / expansion limiting technology that expensive professional broadcast hardware is based upon . music is enhanced to provide more loudness , punch and consistency in volume and spectral balance . dull or quiet material will be livened up , and excessively edgy or loud material will be softened and tamed . the result is a warm and bright , non - fatiguing , properly balanced and artifact - free sound that resembles the competitive “ on the air ” sound signature of major market fm radio stations and fully configurable . a digital - to - analog converter ( dac ) is a semiconductor device that is used to convert a digital code ( usually binary ) into an analog signal , such as electric charge , current , or voltage . a dac is the principal means by which computer and digitally - based systems translate digital data into real - world signals . an audio - quality dac has specifications tuned for audio applications such as a high dynamic range with low to no distortion ( i . e ., it can supply amplification for reproduction of audio and / or video signals through speakers or television ) also shown in fig6 is an esd ( electrostatic discharge ) 182 hdmi / dvi interface . since usb is a hot insertion and removal system , usb components are subject to electrostatic discharge ( esd ). however , usb esd protection is not yet a specific requirement of the usb specification . state - of - the - art usb ics are manufactured on high integration cmos processes making them extremely sensitive to damage from the high static voltages associated with an esd event . a video amplifier / filter 184 consists of a video output amp . the video interfaces ( output ) include hdmi and component and / or composite video . these outputs often require high - performance video filters / amplifiers to enhance the video output from the soc ( system on chip ). additionally these outputs often require esd protection . newer stb platforms provide rd ( high . definition ) as well as full rd at 1080p resolution and 3d . audio tx / rx 186 is an optional digital audio transceiver with analog conversion capabilities . the digital audio transceiver ( tx / rx ) is used for audio products are a subset of analog analog & amp ; mixed - signal solutions . the audio amplifier / line driver ( audio line out ) 188 takes audio output from the soc ( system on chip ) is made available via the stereo output jack and headphones . with such features as high snr ( signal - to - noise ratio ) and analog low - pass filtering , a high - quality audio output is required as well as an audio line driver . additionally there may be an audio spdif ( sony / philips digital interconnect format ) input / output interface requiring a digital audio transceiver . hdmi 200 refers to a high definition multimedia interface . component video output 202 is a video signal split into two or more component channels . the video interfaces ( output ) include hdmi and component and / or composite video . these outputs often require high performance video filters / amplifiers 184 to enhance the video output from the soc ( system on chip ). additionally , these outputs often require esd protection . newer stb platforms provide hd ( high definition ) as well as full ed at 1080p resolution and 3d . ypbpr is a color space used in video electronics , in particular in reference to component video cables . ypbpr is the analog version of the ycbcr color space ; the two are numerically equivalent , but ypbpr is designed for use in analog systems whereas ycbcr is intended for digital video . ypbpr is converted from the rgb video signal , which is split into three components : y , pb , and pr . pr 204 is the analog video signal carried by component video cable in consumer electronics . pr carries the difference between red and luma ( r − y ). in consumer electronics , pr is the red cable . pb 206 carries the difference between blue and luma ( b − y ). in consumer electronics , pb is the blue component video cable . y 208 carries luma ( brightness or luminance ) and synchronization of information . y = 0 . 2126 r + 0 . 7152 g + 0 . 0722 b . before the advent of color television , the y axis on an oscilloscope display of a video waveform represented the intensity of the scan line . with color , y still represents intensity but it is a composite of the component colors . in consumer electronics , y is the green component video cable . the ac - dc module 210 is a digital audio interface with audio output from the soc ( system on chip ) is made available via the stereo output jack and headphones . with such features as high snr ( signal - to - noise ratio ) and analog low - pass filtering , a high - quality audio output is required as well as an audio line driver . additionally there may be an audio spdif ( sony / philips digital interconnect format ) input / output interface requiring a digital audio transceiver . power management 212 includes ldos , a fet load switch , and dc - dc switching regulators . the ac - to - dc conversion ( adjacent to power management ) creates the main power for the unit itself , the functional blocks in the stb that require powering . the power architecture for the stb will vary by platform depending upon the core soc ( system on chip ), memory , analog front - end , analog signal chain components and interfaces used in the specific platform . high efficiency single and multi - output switching regulators and low current ldos are required , mosfet load switches can be used for sequencing of the power rails . ti offers all the necessary power solutions to meet stringent energy conservation mandates . dc - dc switching regulators 216 , associated with the power management 212 , is a voltage regulator that uses a switching element to transform the supply into an alternating current , which is then converted to a different voltage using capacitors , inductors , and other elements , then converted back to dc . fet load switch 15 , also associated with the power management 212 above ) is a field - effect transistor ( fet ) load switches can be used for sequencing of the power rails . the field - effect transistor operates in depletion mode within a circuit . the channel between the source and drain junctions is normally open , with the current meeting no resistance as it travels over the channel . as voltage is applied to the gate junction , it affects the resistance that the current encounters across the channel , increasing or decreasing it . the result is a variable resistor that can be controlled within the circuit by varying the voltage to the gate . 220 ldos 220 , also inside power management 212 above , is linear regulators and low dropout regulators ( ldos ) feature low quiescent current that increases efficiency in a variety of applications . ldos are a simple , inexpensive way to regulate an output voltage powered from a higher voltage input . ddr memory 214 is a double data rate memory is used for memory chips . also , a set - top box is comprised by modules that access an external memory sharing the same bus . thus , it is necessary for a multichannel ddr memory controller to schedule accesses . the smart card / cable card 222 contains the customer &# 39 ; s account information as well as the channel assignments and decryption algorithms used by the cable provider . the sata driver 224 serial advanced technology attachment , often abbreviated sata or s - ata , is a serial link — a single cable with a minimum of four wires creating a point - to - point connection between devices . usb 2 . 0 225 , located inside the soc 172 , is sometimes referred to as hi - speed usb , this is a new standard ( from the previous , slower transfer speeds of usb 1 . 1 ) that supports data rates of up to 480 mbps . the usb 2 . 0 is designed to be fully compatible with earlier versions of usb ( e . g . 1 . 1 ). 226 is an optional hard drive to contain information that can be downloaded remotely to update features of the present invention . having an wi - fi module 228 inside of the set - top box allows the connection to the home wi - fi network for internet access and for streaming audio to transmit and receive . a temp sensor 230 can be incorporated into the present invention that controls the temperature within the set - top box so it does not exceed a certain point as to overheat . fan control 232 controls the fan to turn on when the temperature reaches a certain set point so it can regulate itself . pan 234 is a thermal management strategy that includes actively removing heat from the enclosure with one or more fans . esd ( electronic software distribution ) 236 is a hot insertion and removal system for usb components that are subject to electrostatic discharge ( esd ). however , usb esd protection is not yet a specific requirement of the usb specification . state - of - the - art usb ics are manufactured on high integration cmos processes making them extremely sensitive to damage from the high static voltages associated with an esd event . usb load switch 238 is designed for high - side power switching applications to cover a wide range of port protection applications , such as usb . port protection switches provide inrush current limiting , short - circuit and over - temperature protection , in addition to input control level shifting and fault flags . usb ( universal serial bus ) 240 is an external bus port that can support data transfer of up to 12 mbps . usb ports can be used to connect various peripherals including mice , keyboards , external hard drives , cameras , modems , etc . a usb input to the stb requires current - limit esd ( electrostatic discharge ) protection . the ethernet 242 represents the global standard for cabling computers together in a network . almost every reference to “ network ,” “ network ready ,” “ lan ,” “ lan connection ” or “ network card ” implies ethernet . one or more ethernet inputs may be present for providing media content over the ethernet . ethernet switches / phy 243 , is an ethernet network that is controlled by a switch instead of a shared hub . the switch cross connects all clients , servers and network devices , giving each sending - receiving pair the full rated transmission speed . moca controller 244 , known as the multimedia over coax alliance , is a standards organization that supports a technology to provide the backbone for home digital entertainment networks . for the end - consumer , a moca solution includes a set - top box solution that works where your tv works , and enables you to link entertainment devices in multiple rooms using existing wiring . mca supports streaming media , including audio , sdtv and hdtv and provides a clean dedicated shielded medium . it coexists with catv and terrestrial services and also supports content protection . tuner 246 is used as the second diplexer is attached via coaxial cable to the back of a dual - tuner receiver . moca rf ( multimedia over coax alliance ) 248 utilizes 1 . 0 - 2 . 0 standard uses rp ( radio frequency ) signals with an operating frequency range of 500 to 1650 mhz . the diplexer 250 provides the chief advantage in that it allows two different devices to share a common communications channel ; typically the shared channel is a long piece of coaxial cable . rather than run two separate cables , a single cable with diplexers at each end is used . it joins , for example , a satellite dish feed and a tv antenna together into a single coaxial cable , and at a convenient point , a second diplexer would split the two signals apart ; one signal would go to the tv set and the other to the set - top box . cable 252 refers to the standard cable system that provides content to televisions and internet service to computers and the like . surge tvs 254 is a surge protector for the stb to protect the electrical circuitry from damage . the low noise block 258 includes a lna , tuner , and lnb boost regulator . a low - noise block ( lnb ) control device is capable of controlling modulation of an alternating waveform on a direct current ( dc ) voltage from a dc power supply to an lnb amplifier . the lnb control device includes a power supply control module , an lnb signaling module and a switch . in response to a power supply feedback signal received from the dc power supply , the power supply control module sends a control signal to the dc power supply . in addition , the lnb signaling module provides a switch control signal and a modulating waveform to the switch . under the control of switch control signal , the switch selectively sends the modulating waveform to a summing circuit that is located external to the lnb control device . within the summing circuit , the modulating waveform is added to the dc voltage from the dc power supply . the job of the lnb is to take a wide block ( or band ) of relatively high frequencies , amplify and convert them to similar signals carried at a much lower frequency ( i . e ., intermediate frequency or if ). these lower frequencies travel through cables with much less attenuation of the signal , so there is much more signal left on the satellite receiver end of the cable . an important performance parameter of the lnb is its noise factor ; the lower the noise factor , the better the picture quality . the satellite connectivity 260 refers to an active antenna to get the signals needed and by using low noise engineering techniques , the sound and picture of satellite tv are higher quality . the signals received by the dish antenna are transferred to a frequency converter called the lnc ( low noise converter - aka lnb , low noise block ), which is placed in the focal point of the dish antenna . the tuner 262 located within the low noise block 258 provides selection of signals that come in to the satellite tuner via the lnb . usually before the signal is sent to the tuner , the lnb needs to convert the incoming signal to a lower frequency in the area between 950 and 2150 mhz , and then amplify the signal . for good reception and image results , the quality of the lnb and the satellite tuner are of vital importance . normal tv tuners can only handle signals between 47 to 870 mhz , whereas satellite transmission takes place between 950 and 2150 mhz . tv sets cannot generate specific lnb control signals , nor handle polarization switching . furthermore , tv tuners cannot process the audio signals from the satellite . some tv sets and vcrs have satellite tuners built . the lna 264 located inside the low noise block 258 , is a low noise amplifier , which is a special type of electronic amplifier or amplify weak signals captured by an antenna or satellite . the lnb boost regulator 266 , also located within the low noise block 258 boost the signal and provides a clean and quiet power source that will not contaminate the low noise rf ( radio frequency ) signal down converted to the receiver . the following is a description of the operational features of the present invention . the system starts with off - line media processing . normal mpeg2 or other content is post - processed to embed dai enabling content identifying “ metadata ” packets and in - line graphics images . next , when the content is played , this dai enabled content is streamed to the set - top box . within the stb the dai client engine detects the embedded graphic images that are recovered and saved in the dai ad server library . finally , when the stb is in peer - to - peer communication mode , the embedded content id metadata packets “ arm ” the dai client engine . when the streaming video content is placed in the background by the peer - to - peer communication , the client &# 39 ; s logo , graphic , watermark , banner , video , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .) is incorporated in a strategic , non - intrusive and pre - determined or designated location on the screen , also known as the background canvas . the end - to - end system is depicted in the following figure showing content pre - processing , streaming , and client elements : ( see off - line diagram ) supports standard definition and hd content integrates a content management and ingest station with audit trace history is integrated with stb as a dai client engine sdk . is extensible for future audio support is adaptable to localization and internationalization this following section describes the main functional subsystems and their interfaces : this database driven system stores catalogs raw mpeg2 files , pop - up graphics assets ( bitmaps , jpegs , etc ), and dai - enabled files . contents are related by identifiers , for example graphics content is associated with one or more mpeg2 spot clips by spot id . this is primarily a workflow oriented system that processes incoming mpeg2 media and inserts graphics and dai metadata packets into the mpeg2 transport files . job information ( such as ingest state pending and completed , content asset inventory updates ) is exchanged with the content manager . dai enabled output files are saved and available for play to air . a stream - to - air server inputs the dai enabled mpeg2 content and transmits to dat enabled stb , etc . streamed content includes mpeg2 video and audio packets , dai metadata packets , and graphics image packets . the dai system should require no changes to established video system infrastructure . the dai ( client engine ) ad server software stacker is integrated in the set - top box . it monitors active mpeg2 streams to detect the presence of dai graphics and content id packets . embedded dai packets are called back to the client engine . during normal viewing , graphics and the like are suppressed ; but during peer - to - peer communication , the dai software searches stored images for a match with dai &# 39 ; s clients . their advertiser assets could be logos , graphics , watermarks , banners , videos , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .). when an image is matched , it is , incorporated in a strategic , non - intrusive and pre - determined or designated location over the streaming video content . as the “ peer - to - peer ” is resumed to its normal function , the graphic image disappears . in peer - to - peer mode , the logo , graphic , watermark , etc . must be available in its entirety so it can be rendered and incorporated over the streaming video content . images are then transmitted together with the client &# 39 ; s streaming video content by multiplexing in the mpeg 2 transport stream . when the content is received and recognized by the set - top box it can be saved , as an example , locally in the stb ram as a jpeg or similar file , so that streaming video content can be matched to an available graphic file within the dai ad server library / asset library . graphic content will include an expiration date so that it can be automatically deleted in the future ; the client engine will delete a graphic image when it reaches its said expiration date . for housekeeping purposes , the client engine can receive content metadata packets with control codes . this can be used to delete graphics files on demand to prevent it from accidently resurfacing . the client engine software will need to be field upgradable for bug repairs and feature enhancements . this can be bundled into the system operators stb software refresh cycle . the content may be saved in the archive for weeks at a time before it is deleted . by managing the clients advertiser &# 39 ; s assets : logos , graphics , watermarks , banners , videos , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .) as separate files , dai is quickly able to revise or update the clients advertiser &# 39 ; s assets as needed . for example , a streaming video content clip could have a refreshed graphic downloaded each day , week , or month at a time . by referencing existing streaming video content , the new advertiser &# 39 ; s asset : logo , graphic , watermark , banner , video , and the like ( with or without static , 3 - d , sound , picture - in - picture , etc .) can be repurposed seamlessly over existing content for whatever end goal the client has in mind at that time . the possibility of a graphics carousel can also be considered so a graphic rotation could be applied to a dai enabled spot . further creative uses of the advertiser &# 39 ; s assets could include sweepstakes entries , coupons , and so forth . the general dai concept as described is content - push , from server to stb . with a tcp / ip capable stb , it is possible the dai client engine can also implement “ out - of - band ” pull features to download graphic images , software patches , report skipped spots , and so on . though the dai concept is currently oriented to static logos , graphics , watermarks , banners , videos , and the like , it is soon anticipated that extensions will also be with 3 - d , sound , picture - in - picture , flash , or other motion graphic , along with audio tracks integrated , into a future dai audio subsystem . the dai ad server software stacker ( client engine ) will be designed as a software development kit ( sdk ) and can be licensed commercially for integration into various client stb systems . | 7 |
embodiments of the invention will be described with reference to the accompanying drawing figures wherein like numbers represent like elements throughout . further , it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . the terms “ mounted ,” “ connected ,” and “ coupled ” are used broadly and encompass both direct and indirect mounting , connecting , and coupling . further , “ connected ” and “ coupled ” are not restricted to physical or mechanical connections or couplings . the invention is an apparatus and method for uniformly mixing together at least two fluids , or reagents , in viscous or gaseous phases , either miscible or immiscible , in a porous medium . the invention may be used for any application that requires uniformly mixing fluids . shown in fig1 is a mixer 101 for combining reagents introduced into a porous media 103 . the mixer 101 comprises at least one porous medium 103 , such as a porous ceramic used for oxidizing toxic waste , a fluidized bed with catalyst or palladium - coated metal membranes for generating hydrogen , a silica - alumina membrane for dehydrating isopropyl alcohol or synthesizing dimethyl carbonate from carbon dioxide and methanol , a symmetrical hydrophobic nylon 66 membrane for adsorbing enzymes , and other media , contained in a rigid vessel 105 . the vessel may be made from materials that transmit acoustic waves and are compatible with the fluids to be mixed , such as but not limited to stainless steel , ceramics , plastics and others . the exemplary embodiment is shown as a cubic volume , however , other vessel shapes and configurations may be used according to the mixer application and teachings of the invention . the preferred embodiment has two inlets 107 , 109 for admitting reagents a and b to mix together as they interact with the porous media 103 . two outlets 108 , 110 are provided and may be positioned perpendicular to the inlets 107 , 109 . in the exemplary embodiment , the inlets 107 , 109 and outlets 108 , 110 are located on opposing sides of the vessel 105 . however , the inlets 107 , 109 and outlets 108 , 110 may be located on adjacent sides , or on the same side of the vessel 105 , or in any other suitable arrangement . located on opposite sides of the vessel are actuators 111 , 113 that translate a linear motion from at least one linear motor , such as a piezoelectric transducer 115 , 117 into a controlled compression / expansion wave to effect mixing in the porous media 103 . the piezoelectric transducer ( s ) 115 , 117 may be , for example , interdigitated electroded actuators , oriented multilayer - multifilament stacked piezoelectric composites , piezoelectric wafer actuators , or others . in embodiments , the transducers 115 , 117 produce a deformation , or linear excursion in a range of from about 1 to 20 % of the porous layer width , which may be in a range from about 0 . 1 microns to 1 . 0 cm dependent on the technological task when excited by a variable magnitude control signal . the vessel internal volume may contain one mono - layer , a sandwich of more than one type of porous media , or may be completely filled with more than one type of porous media . when a control signal of fixed or variable frequency is impressed , the transducer may vibrate from audible to ultrasonic frequencies . the frequency range may be in a range of from about 10 khz to 100 mhz . the piezoelectric transducers 115 , 117 may be electrically coupled to a variable frequency oscillator for excitation ( not shown ). deformation of a piezoelectric transducer plate generally corresponds to a motion along the axis normal to the plate . for interdigitated electroded actuators , which are typically rectangular , the excursion is in the longitudinal direction . the embodiment shown in fig1 uses interdigitated electroded actuators . since the porous medium 103 is flexible in three dimensions , at least two sidewalls 119 , 121 of the vessel 105 exhibit an acoustical impedance that allow for a controlled waveform to be impressed into the porous medium 103 . in the preferred embodiment , the transducers 115 , 117 are coupled to a stationary support and to the actuators 111 , 113 . a transducer 115 , 117 excursion is transferred to a respective actuator 111 , 113 which may be hinged in / by / at a hinge 118 , 120 allowing for reciprocal movement about a hinge axis 122 , 124 . shown in fig2 is a view of the mixer 101 with two transducers 115 , 117 where a compression wave 203 is applied to one half of the porous media and a reciprocal expansion wave 201 to the other half of the porous media . fig3 shows the alternating nature of the applied force when the transducers 115 , 117 are at a positive excursion . each actuator 111 , 113 alternately imparts a compression 203 / expansion 201 wave . each transducer 115 , 117 excitation is in unison with each other . the actuators 111 , 113 transfer the linear excursion from the transducers 115 , 117 into a compression 203 / expansion 201 wave indirectly to the porous media 103 via the sidewalls 119 , 121 . each actuator employs at least two acoustic coupling points 205 , 207 , 209 , 211 separated by a predefined distance corresponding to the actuator 111 , 113 . the points 205 , 207 , 209 , 211 provide and act as the point source of acoustical energy from the transducers 115 , 117 to the porous media 103 . shown in fig4 is a plot of initial reactant location within the mixer 101 . the initial concentrations of reactants a and b are located at their respective inlet 107 , 109 sides of the mixer . the plot shows gradual diffusion at the vessel 105 midpoint with no vibration . they slowly diffuse inwards toward the middle of the porous media . the reactant a slowly diffuses into the volume occupied by the reactant b and vise versa such that the concentrations of a and b reach equilibrium values about ½ way uniformly across the vessel . the dimensions of the mixer are as required to achieve the desired productivity . the plot of fig5 shows gradual diffusion at the vessel 105 midpoint with no vibration . the fluids slowly diffuse inwards toward the middle of the porous media . the reactant a slowly diffuses into the volume occupied by the reactant b and vise versa such that the concentrations of a and b reach equilibrium values about ½ way uniformly across the vessel 105 . the dimensions of the mixer are as required to achieve the desired productivity . shown in fig6 is a plot showing the same reactant concentrations as in fig5 , with the compression / expansion wave applied by the invention 101 frozen in time . the transducers 115 , 117 are excited using a frequency of 10 mhz . the plot shows enhanced mixing of the reactants when the compression / expansion wave is applied , with no additional mechanical manipulation . the parameters of the porous medium 103 shown in fig5 and 6 are those of torrey paper . torrey paper is a porous material used in fuel cell applications . porosity is a non - dimensional quantity being the ratio of free space to the total volume of the material . the concentration change toward equilibration in the porous media 103 is calculated as 1 . 8 * 10 − 7 per one period of vibration . the value indicates that during the time equal to one vibration period , the concentration in non - dimensional units ( the ratio of the volume occupied by a or b to the total volume ) has changed by 1 . 8 * 10 − 7 . the value 0 . 00000018 is small , however , the period , where v is the frequency and t is the period , of a 10 mhz vibration is very short and substantial changes in concentration may be reached in the short time for frequencies of 10 mhz and higher . fig6 shows the concentration change toward equilibrium in the porous media 103 when using the mixer 101 as 0 . 4 * 10 − 5 per one period of vibration . with this invention , mixing acceleration is approximately 22 times greater for a chosen porous media using a 10 mhz excitation having an amplitude equal to 0 . 1 of the sample width . in other words , by applying a 10 mhz vibration with an amplitude equal to 1 / 10 of the vessel thickness , the concentration change towards equilibrium is approximately 22 times faster than without the vibration ( ratio of 0 . 4 * 10 − 5 to 1 . 8 * 10 − 7 ). the acoustic perturbation of the porous material 103 using the compression / expansion wave of the invention accelerates the mixing of the reactants to more than 20 times that of natural diffusion . multiphase flow in the porous medium 103 when subjected to the compression / expansion wave show dramatic enhancement of mixing compared to natural diffusion of the two reacting fluids inside the porous sample . the exemplary embodiment shown in fig1 is one instance of the general approach to accelerating and controlling the mixing of at least two reactants inside at least one porous medium . shown in fig7 is an alternate embodiment of the invention 701 . the alternative embodiment employs 4 pairs of transducer / actuators 705 , 707 , 709 , 711 , 713 , 715 , 717 , 719 . the wave imparted by the transducer / actuators 705 , 707 , 709 , 711 , 713 , 715 , 717 , 719 exert force on two opposing surfaces of at least one porous medium 721 containing , at an initial stage , separate liquids a through i introduced through a micro - channel plenum ( not shown ). the motion of the invention is synchronized such that each transducer excursion is in unison . transducer / actuators 705 , 709 , 713 , 717 and 707 , 711 , 715 , 719 may be a lower and an upper part of the same transducer assembly , respectively . this means that the transducers that exert force synchronously may be designed as one entity , as n / 2 , rather than requiring n separate transducers ( one transducer for each actuator ), such that one source of ultrasonic energy is divided and channeled to the required point sources of application by which synchronization is achieved . modifications to the acoustic perturbation wave shape applied to the porous medium and to the frequency may be used to optimize the rate of mixing in any porous medium structure geometry . moreover , hybridization of the transducer syncing may further optimize mixing efficiency , where each pair of transducer / actuators 705 / 707 , 709 / 711 , 713 / 715 , 717 / 719 may not be in complete synchronicity , or phase , with other pairs , but with each operating at a predetermined phase shift from other pairs . in other representative and exemplary applications , various embodiments of the invention may be employed , for example , to mix methanol and water in a reformed hydrogen fuel cell and / or a direct methanol fuel cell . additionally , various embodiments of the invention have demonstrated the capability to mix a variety of fluids including , for example , gases , liquids , gas - liquid mixtures , etc . other representative applications may include the mixing of fuels supplying a micro - reactor and / or micro - combustion chamber . one or more embodiments of the present invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are within the scope of the following claims . | 1 |
while referring to fig1 to 6 , a detailed explanation will now be given for a serial scan ink jet printer that is an image forming apparatus according to the preferred embodiment of the present invention . however , the present invention is not limited to this embodiment , and can be variously altered or modified within the concept of the present invention cited in the claims . therefore , the present invention can also be applied for another technique that encompasses the spirit of the present invention . the schematic configuration of the ink jet printer for the embodiment is shown in a partially cutaway diagram in fig1 . in the embodiment , an ink jet printer 10 comprises a paper feeding unit 11 for feeding a paper sheet as a printing medium , a carriage driver 13 for scanning a head cartridge 12 , a head recovery unit 14 for optimizing the state for the ejection of ink from orifices or openings formed in print heads , a display unit 15 for displaying the state of the ink jet printer 10 , and a power source for supplying power to the paper feeding unit 11 , the head cartridge 12 , the carriage driver 13 , the head recovery unit 14 and the display unit 15 . the head recovery unit 14 also includes a function for , in the non - printing state , protecting the openings that are formed in the print heads of the head cartridge 12 . the print heads are provided to the head cartridge 12 , the print heads will be described later . the head cartridge 12 is detachably mounted on a carriage 16 that is a constituent of the carriage driver 13 . the head cartridge 12 is an assembly , consisting of a plurality of ink tanks in which inks , in a plurality of different colors ( four colors in the embodiment , black , yellow , magenta and cyan ), are contained , and a plurality of print heads to which ink from the ink tanks is supplied . the individual print heads include a plurality of openings arranged at predetermined intervals , and a plurality of ink paths that communicate with the openings . ejection energy generators ( not shown ) are located along the ink paths , and include electrothermal converters for boiling ink present in the ink paths and for ejecting ink droplets from the openings . the paper feeding unit 11 comprises a supply unit for pulling the paper sheets out , one by one , a conveying unit for conveying the paper sheets to a printing position , and a discharge unit for discharging the paper sheets from the printing position . the supply unit includes a paper hopper 17 into which a plurality of paper sheets are inserted , and a supply roller ( not shown ) for pulling out at a time one sheet of the paper sheets stacked on the paper hopper 17 . the conveying unit includes a feed roller 19 for intermittently conveying a paper sheet extracted from the paper hopper 17 to a platen 18 , and a pinch roller 20 for sandwiching a paper sheet with the feed roller 19 . in this embodiment , the platen 18 consists of a flat plate that is located at the printing position . the discharge unit includes a discharge tray ( not shown ) which accepts a printed sheet , a discharge roller ( not shown ) for discharging the printed sheet to the discharge tray , and a press roller shaped like a spur ( not shown ) for sandwiching a sheet with the discharge roller . the supply roller and the feed roller 19 are rotated by a feed motor 21 through a power transmission mechanism employing gears and a chain ( none of them shown ). the carriage driver 13 , for ejecting ink onto the surface of a paper sheet conveyed onto the platen 18 , has as a function the scanning the head cartridge 12 , together with the carriage 16 , in a direction perpendicular to the sheet conveying direction , i . e ., in the widthwise direction of the paper sheet . the carriage driver 13 includes the carriage 16 on which the head cartridge 12 is detachably mounted , a guide rod 22 which the carriage 16 is slidably passes through , an endless timing belt 23 which extends along the guide rod 22 and is connected to the carriage 16 , and a carriage scanning motor 24 which drives the timing belt 23 . the guide rod 22 is extended parallel to the rotational axis of the feed roller 19 and in the widthwise direction of the paper along the platen 18 . when the carriage scanning motor 24 is rotated forward or backward , the carriage 26 , together with the head cartridge 12 , is moved through the timing belt 23 along the guide rod 22 immediately above the platen 18 . with this arrangement , together with the operation of the paper feeding unit 11 , an image can be formed at a desired position on the paper . when the head cartridge 12 is in the waiting state , i . e ., when the ink jet printer 10 is not performing printing , the carriage 16 is located at the home position designated at one end of the guide rod 22 ( right end in fig1 ), and the head recovery unit 14 is also located at the home position . in the embodiment , the head recovery unit 14 includes a plurality of cap members 26 which are located opposite opening surfaces 25 of the head cartridge 12 mounted on the carriage 16 , and which cover the openings in the individual print heads , a water supply mechanism 27 for humidifying the cap members 26 that currently cover the opening surfaces 25 , and a cap member elevating device 29 in which a cap moving motor 28 is assembled . the cap moving motor 28 moves the cap members 26 in the direction opposite the opening surfaces 25 on the head cartridge 12 located at the home position . when print data are transmitted to a head driver ( not shown ), so that the print heads can print a paper sheet , the cap member moving unit 29 is operated to retract the cap members 26 from the head cartridge 12 located at the home position . then , the head cartridge 12 is moved to the printing position , and printing for the paper sheet is initiated . when supply of print data to the head driver has been completed , the head cartridge 12 , together with the carriage 16 , is returned to the home position and the cap member elevating device 29 brings the cap member 26 into contact with the opening surfaces 25 on the head cartridge 12 . thereafter , water is supplied to the cap members 26 and a saturated water vapor is maintained inside , to suppress the drying or sticking of ink in the openings and the nearby ink paths . according to the embodiment , a circuit is also provided for the ink jet printer 10 to control the paper feeding unit 11 , the carriage driver 13 , the head recovery unit 14 and the display unit 15 . this driving system is shown in fig2 . in the embodiment , a fuel cell 33 is employed as the main power source for the ink jet printer 10 . a voltage output by the fuel cell 33 is converted , by an ac / dc converter 30 , into a motor drive voltage vm , a print head drive voltage vh , or a voltage vc for a controller 36 that controls the overall operation of the ink jet printer 10 . the motor drive voltage vm is applied to the paper feeding motor 21 , the carriage scanning motor 24 and the cap moving motor 28 . the controller 26 includes , for example , a cpu , an asic for receiving an instruction from the cpu and outputting operating signals for the motors 21 , 24 and 28 and the print heads , a rom used to store programs executed by the cpu and parameters , and a work ram used by the cpu . in the embodiment , the fuel cell 33 is employed as the main power source , however , a rechargeable battery may be used as the main power source while the fuel cell 33 is used as an auxiliary power source for the main power source . a driving system according to another embodiment of the present invention is shown in fig3 . the same reference numerals as are used for the above embodiment are also employed to denote corresponding components , and no further explanation for them will be given . in this embodiment , a circuit is also provided , wherein a voltage comparator 23 compares , with the voltage of a lithium ion battery 31 , a dc voltage that is obtained by the ac / dc converter 30 , through the conversion of an ac voltage , and that is to be applied to the cap moving motor 28 . that is , when the dc voltage obtained from the ac power source is lower than the internal battery voltage , the operation of the cap members 26 can be completely performed in accordance with the state of a switch ( not shown ) for monitoring whether the opening surfaces 25 are fully covered with the cap members 26 . it should be noted that a voltage is also applied by the ac / dc converter 30 to the controller 36 that controls the ink jet printer 10 . in this embodiment , the power supplied by the lithium ion battery 31 is employed as a backup power source . with this arrangement , when due to a specific cause the ac power source for the ink jet printer 10 is suddenly turned off , power supplied by the lithium ion battery 31 can be employed to properly cover the circumferences of the openings with the cap members 26 . the power source unit for this embodiment includes a commercially available ac outlet for supplying power for home use , the lithium ion battery 31 that serves as the rechargeable battery for this invention , and the fuel cell 33 for charging the lithium ion battery 31 . in this embodiment , a solid polymer film is employed as an electrolyte for the fuel cell 33 . more specifically , when oxygen or air containing oxygen is supplied to an anode ( air pole ) and hydrogen is supplied to a cathode ( fuel pole ), hydrogen is ionized on the surface of the electrolyte of the cathode and electric charges are generated , while oxygen on the anode reacts with the hydrogen ionized at the cathode and water is generated . the controller 36 , which has a switch circuit , is incorporated in the fuel cell 33 . when a voltage monitoring device 24 detects that a dc voltage , obtained by converting the power supplied by the ac power source , is reduced and is less the internal battery voltage , and that the internal battery voltage has become equal to or is less than a rated voltage , or when in a water tank 35 , which will be described later , the water level is reduced , the switch circuit of the controller 36 automatically starts the generation of electricity . the concept of the water supply mechanism 27 in this embodiment is shown in fig4 . the water supply mechanism 27 includes the water tank 35 in which water generated as the fuel cell 33 produces electricity is temporarily stored , a water level sensor 37 which is provided at the bottom of the water tank 35 to determine whether a predetermined amount of water is stored in the water tank 35 , flexible water pipes 38 which are in liquid connection with the water tank 35 and the cap members 26 , a tube pump 39 which supplies water from the water tank 35 along the water pipes 38 to the cap members 26 , pressure sensors 40 which are attached to the cap members 26 to detect the internal pressure , and a flow control element 41 for transmitting gas and interrupting liquid . the flow control element 41 constitutes part of the cap members 26 , and has gas permeability and liquid impermeability . a detection signal obtained by the water level sensor 37 is transmitted to the controller 36 , and when it is determined that no water is present in the water tank 35 , the controller 36 operates the fuel cell 33 to generate and store water in the water tank 35 . the tube pump 39 has a rotor 43 whereon rollers 42 are arranged along the outer edge at the same intervals . when the rotor 43 is rotated , the water pipes 38 that are held in an arched shape by a cover 44 are squeezed by the rollers 42 , so that water under pressure can be sequentially supplied along the water pipes 38 to the cap members 26 . since the liquid control element 41 are air transmitting , the air in the cap members 26 can be discharged until the elements 41 are covered with water supplied to the cap members 26 . a detection signal obtained by the pressure sensor 40 is also transmitted to the controller 36 . when the internal pressure of the cap members 26 reaches a predefined pressure , the controller 36 halts the operation of the tube pump 39 . with this arrangement , a predetermined amount of water can be constantly maintained in the cap member 26 without moistening the opening surfaces 25 with water , while a saturated water vapor pressure is applied to the opening surfaces 25 . when water exceeding the capacity of the water tank 35 is produced by the generation of electricity by the fuel cell 33 , the water tank 35 may employ a double structure , and the outer tank may be employed as an overflow tank . in this case , it is preferable that water in the overflow tank be supplied first to the cap members 26 . in this embodiment , the tube pump 39 is employed to supply water from the water tank 35 to the cap members 26 . however , a pressure head difference between the water tank 35 and the cap members 26 may be employed to supply water from the water tank 35 to the cap members 26 . with this arrangement , the pressure sensor 40 and the tube pump 39 , for which electricity is required , are not needed . a water supply mechanism 27 according to another embodiment is specifically shown in fig5 . the same reference numerals as used for the previous embodiment are used to denote corresponding components , and no further explanation for them will be given . in this embodiment , a water tank 35 is located higher than cap members 26 with a horizontal face as a reference . that is , the water tank 35 has a pressure head difference h relative to the cap members 26 . therefore , by its own weight , water in the water tank 35 is automatically supplied to the cap members 26 . at this time , when the cap members 26 are located at a retracted position where the capping operation is not performed , water pipes 38 are automatically closed . in this embodiment , since the liquid control element 41 are also provided for the cap members 26 , the supply of an excessive amount of water to the cap members 26 can be avoided . in this embodiment , the pressure difference h between the water tank 35 and the cap members 26 is used to supply water from the water tank 35 to the cap members 26 . in accordance with the layout for the mechanism in the ink jet printer 10 , it may be difficult to provide such a pressure head difference h . in this case , the capillary action of the water pipe 38 can be used to supply water from the water tank 35 to the cap members 26 . a water supply mechanism according to an additional embodiment is specifically shown in fig6 . the same reference numerals as used for the previous embodiments are also used to denote corresponding components , and no further explanation for them will be given . in this embodiment , capillary action in water pipes 38 is used to supply water from a water tank 35 to cap members 26 . therefore , so long as water is reserved in the water tank 35 , water in the water tank 35 is supplied into the cap members 26 automatically by capillary action in the water pipes 38 . a fabric member may be provided in the water pipes 38 to induce the capillary action , or the inner diameters of the water pipes 38 may be so small the capillary action occurs normally . in this embodiment , since the liquid control element 41 are also provided for the cap members 26 , the supply of an excessive amount of water to the cap members 26 can be avoided . as in the above embodiment , the pressure sensor 40 and the tube pump 39 , for which electricity is required , can be eliminated , and the costs for parts can be reduced . the present invention has been described in detail with respect to preferred embodiments , and it will now be apparent from the foregoing to those skilled in the art that changes and modifications may be made without departing from the present invention in its broader aspect , and it is the intention , therefore , in the apparent claims to cover all such changes and modifications as fall within the true spirit of the present invention . this application claims priority from japanese patent application nos . 2003 - 371087 filed oct . 30 , 2003 , 2004 - 292933 filed oct . 5 , 2004 and 2004 - 303457 filed oct . 18 , 2004 , which are hereby incorporated by reference herein . | 1 |
with any surveillance system shadows can distort images so that the system does not properly detect the presence of human intruders . the effectiveness of any video - based intelligence surveillance system is measured by its ability to detect the presence of unwanted intruders and send appropriate alarms . this method and apparatus uses several different features to detect intruders in a secure zone by eliminating the presence of shadows . the end result is to have increased true detection rates and a decreased false alarm rate for the surveillance system . one of the central hardware components of this system is the video capture equipment ( not depicted ), probably cameras that should operate in low levels of light and also include infrared capability . software is incorporated into the system and will process the information so that the presence of a human intruder can be detected . the software will distinguish between the presence of a car , train car or other inanimate object and a human person . the software will capture the images and then forward to a remote location for appropriate remedial action . the presence of soft shadows , which are shadows created by the object itself , present one of the more challenging issues to computer vision solutions , specifically in the case of intelligent video surveillance where one of the goals is to detect any unauthorized intruders and soft shadows mask some of the best detectible features , typically of the human form . some of these best detectible features include height and aspect ratio i . e . the relationship of the human height to human width . in order to be able to detect intruders with acceptable sensitivity , most video surveillance systems decrease the detecting thresholds . however , a byproduct of decreasing the detecting threshold is that the false alarm rate is increased . the invention in this document eliminates the effective soft shadows , resulting in a better true detection rate without an increased false alarm rate . one of the prime objectives of any video surveillance system is to detect unauthorized intruders . humans or intruders , by their very nature , have several defining features , which include motion history , motion saliency , typical size , and aspect ratio . this system captures images and places them in a boundary box 6 . the boundary box will be framed so the image will be placed in a rectangular box with defined sides . software that is incorporated into the system will then adjust the height and width of the image within the boundary box to eliminate any self cast shadows to determine if the form of a human has been captured . if a human form has been detected , the system will permit the image to be tracked in the facility and will also allow an alarm to be sent to a remote location , if desired . a soft shadow 8 will change the image of the dimensions that is captured within a typical boundary box 6 such as depicted in fig1 and 2 . the presence of a soft shadow and the resultant dimension changes would render the surveillance useless by altering the size and aspect ratio features to a point of insignificance . fig1 depicts the initially captured image that is framed in the boundary box 6 and also depicts the new image of the human that is created by the software and framed in the edited boundary box 5 . the edited boundary box 5 is the altered box whereas the boundary box 6 is the image of the human person that also includes the shadow . when the image is initially captured the image is placed in a rectangular boundary box 6 which has a defined top line 15 , a defined bottom line 16 and defined vertical line 17 . when the system operates to eliminate the shadow the system places a vertical line for the edited boundary box 18 to replace the initial vertical line 17 . in fig1 , the soft shadows 8 , which are included in the boundary box 6 , will change both the width and the height of the potential intruder candidate 1 . this boundary box 6 must be adjusted in two distinct steps to render the system effective and result in the creation of the edited boundary box 5 such as depicted in fig1 . once the image with the shadow is captured , the first step is to trim the width of the boundary box 6 using drop histograms 30 . the first step is to capture the contour of the potential intruder candidate 1 as depicted in fig1 and 2 and then adjust the width of the boundary box 6 in order to produce usable information . the algorithm of the width adjustment is described in the following steps . the first step is to start with the contour of the image 10 that includes both the image of the human 1 as well as the shadow 8 such as depicted in fig2 . boundaries of fig2 are created by the software . several points along the top line 15 of the boundary box are then intersected with the first point on the contour or image in the vertical direction such as depicted in fig3 . a series of vectors 12 are then formed and these vectors are collectively called the drop histogram 30 . a series of vectors with lengths of these lines are called the drop histogram 30 . the software that is included will detect a steep drop in the consecutive pixels compared to the peak 40 in the histogram , which would indicate the beginning of a shadow . for instance , in fig3 , the distance depicted in a , b , and c indicates the presence of a human intruder based on preset values for the human form that will determine the typical height of the human , whereas the distance measured by line d would detect the beginning of a shadow because of the steep drop in consecutive pixels . the pixels that are a part of the shadow are then removed , and the width is recalculated and becomes the adjusted width to reconfigure the edited boundary box 5 with a new edited vertical line 18 . once the width has been reconfigured , the height of the bounding box must then be recalculated . the height then , however , must be adjusted , and this is depicted in fig4 . based on the estimated shadow width from the width adjustment procedure , such as depicted in foregoing steps and demonstrated by fig3 , the angle of the shadow is now calculated . the angle of the shadow is calculated as the average gradient angle based on the edge map of a point estimated to be in the shadow . a vertical line 20 is placed in the center of the new width , such as depicted in fig4 . this vertical line should be in the approximate center of the human form that is detected by the software . an angle is then created by the software by producing a horizontal line 35 that will intersect at the bottom of the image and the vertical line 20 . another line is produced that will intersect the approximate center of the shadow 8 and form the appropriate angle 25 . the intersection of lines 20 and 35 produce the bottom line of the edited boundary box . the top line of the edited boundary box 15 is the same as the boundary box top line . once it has been determined that a human intruder has been detected the software is capable of tracking the image in the facility . depending of preset configurations , the software will also produce an alarm based on the presets to alert individuals of the presence of an intruder . the alarm may be audible throughout the facility or audible only at the remote location . the system is capable of sending the video images as well as the alarm to a remote location for appropriate action . due to its reconfiguration of the initially captured image the software surveillance system that is described is a more intelligent analysis of possible human intruders . while the embodiments of the invention have been disclosed , certain modifications may be made by those skilled in the art to modify the invention without departing from the spirit of the invention . | 6 |
the present invention will be expalined in reference to the embodiments shown in the attached drawings . a thread cutting device 11 of the sewing machine in accordance with the invention comprises , as shown in fig2 a cutter 12 and a thread guiding member 13 . the cutter 12 is formed with a cutting edge 12a . the thread guiding member 13 is u - shaped , and the cutter 12 is fixed by such means as welding between opposing walls 14 and 15 of member 13 such that the cutting edge 12a faces upwardly . the thread guiding member 13 is formed with a recess or opening 13b , a cover 13c , a groove 13d of narrow width , and an opening 13e having a funnel shape . recess 13b is formed such that the cutting edge 12a of the cutter 12 is partially exposed and a thread guiding face 13a of member 13 crosses the cutting edge 12a at an acute angle ( θ = 20 ° to 30 °). the cover 13c shield the cutting edge 12a . the groove 13d is formed between the cover 13c and the thread guiding face 13a , and the opening 13e is formed at the upper portion of member 13 for guiding the thread . the cutter device 11 is , as shown in fig3 to 7 , adapted to be attached to desired parts of the sewing machine , respectively . that is , the cutter 11 is attached to a face plate 18 as shown in fig3 to a presser bar 2 as shown in fig4 to a thread winding part 19 as shown in fig5 to a presser foot 20 as shown in fig6 and to a presser foot 22 of an overlock sewing machine 21 . fig8 and 9 show another embodiment of the invention , in which the crossing point between a thread guiding face 23a of the thread guiding member 23 and a cutting edge 24a of a cutter may be adjusted . the thread guiding member 23 is of u - shape and is fixed to a base ( not shown ) via a pivot 26 , on which the cutter 24 is mounted in a space formed between the portions of the u - shape thread guiding member 23 . the cutter 24 is biased to rotate as shown by arrow a around the pivot 26 by means of a spring 28 secured on the screw 27 . the cutter 24 is adjusted in rotation by means of a pin 30 mounted on the thread guiding member 23 . since the functional relationship between the thread guiding face 23a , recess 23b and cover 23c , and also between the grooves 23d , the opening 23e and the cutting edge 24a of the cutter 24 are similar to those of the embodiment shown in fig2 detailed explanation of the function of the device of fig8 and 9 will be omitted . fig1 shows a further embodiment according to the invention , in which a thread guiding member 33 is u - shaped and is fixed to a base ( not shown ) via a pivot 35 , on which a cutter 36 is mounted between the portion of the thread guiding member 33 . the cutter 36 is adjustably secured within the thread guiding member 33 by means of a screw 37 within an oblong hole 36a formed at one end thereof . since the functional relationship between the thread guiding face 33a of the thread guiding member 33 and the recess 33b and the cover 33c , and between the groove 33d , the opening 33e and the cutting edge 36b of the cutter 36 are similar to those of embodiment shown in fig2 a detailed explanation of these relations will be omitted . the present device is structured as described above , and a reference will be made to the function of the thread cutting device shown in fig1 . the cutter 40 having a sharp cutting edge 40a is secured between the thread guiding members 41 and 42 , and the cutting edge 40a crosses the thread guiding faces 41a , 42a of the thread guiding members 41 , 42 at an acute angle . while thread 3 is drawn from the thread supply ( not shown ) a slight thread tension is given to thread 3 by the drawing resistance . the specific feature of the present invention resides in the structure of the thread cutting device which is safe and may be mounted at any place of the sewing machine , and which has the blade safeguarded and effectively utilized to cut the thread . as can seen from fig2 and 11 , if the thread 3 is inserted into the opening 13e and moved along the guide path toward the edge 12a of the blade 12 as extended across the groove 13d , the thread 3 is tensioned between the guide edges 13a , 13a of the cover plate 13 , 14 . as the tensioned part of the thread 3 is directly pressed against the edge 12a of the blade 12 which intersects the groove 13d at a predetermined angle , the thread is easily cut off . thus the blade 12 is safeguarded and is very effectively utilized to cut off the thread in combination with the thread guide defined by the edges 13a , 13a of the cover plates 13 , 14 . in the embodiment of fig8 and 9 , the blade 24 is turnable on the cover 23 about the pivot 26 and is normally pressed against the pin 30 by the spring 28 which is anchored at one end thereof to the screw 27 . therefore , in case the edge 24a of the blade 24 becomes blunt due to a repeated use for thread cutting operations for a long period of time , the blade 24 is turned against the action of the spring 28 by pressure of the tensed thread to provide a new part of the edge 24a as the thread is pressed against the edge 24a . thus this edge is extensively and effectively utilized . in the embodiment of fig1 , the blade 36 may be turned about the pivot 35 relative to the cover 33 by loosening the positioning screw 37 , to thereby adjust the angular position of the blade 36 with respect to the guide edges 33a , 33a of the cover 33 when the edge 36b is blunt . in the present device described above , the thread can be cut with a slight tension effected when the thread is pulled from the thread supply . the cutting edge of the cutter is shielded with the cover of the thread guiding member for securing safety of the operator . further it is possible to adjust the crossing position between the thread guiding face of the thread guiding member and the cutting edge of the cutter . | 3 |
the embodiments of the present invention provide a semiconductor structure and a manufacturing method of the same , which solve the problem that the process of utsoi is demanding and difficult to get good yields and can effectively suppress the sce . fig2 is a schematic view of the structure of a semiconductor structure 200 according to an embodiment of the present invention . as shown in fig2 , the semiconductor 200 includes a silicon substrate 201 , one or more large bandgap semiconductor layers 202 formed on the silicon substrate , and a silicon layer 203 formed on the one or more large bandgap semiconductor layers 202 . the thickness of the one or more large bandgap semiconductor layers 202 is preferably 5 ˜ 50 nm , and the thickness of the silicon layer 203 is preferably 5 ˜ 20 nm . the top silicon layer 203 is also referred to as a top silicon . fig3 shows the relationship between the energy gap and the lattice constant of the commonly - used semiconductor materials . the lattice constant of silicon is 5 . 43 å , and the bandgap of silicon is 1 . 1 ev . materials , such as gap , gaas , alas , and any combination thereof , which have lattice constants close to that of silicon and an energy gap larger than that of silicon , can be selected to form the large bandgap semiconductor layer 202 . in an embodiment of the present invention , the intermediate large bandgap semiconductor layer is formed of gap . gap has a lattice constant that is very close to that of si and has a very large energy gap . typically , a semiconductor material having an energy gap larger than 1 . 5 ev is deemed as a large bandgap semiconductor material . preferably , the difference between the lattice constant of the large bandgap semiconductor material and that of the si is not larger than 2 %. for example , the lattice constant of silicon is 5 . 43 å , and the lattice constant of the selected large bandgap semiconductor material is preferably between 5 . 3 å ˜ 5 . 5 å , in order to effectively avoid lattice defects induced in epitaxial growth . the lattice constant of the semiconductor material to be selected also depends on the thicknesses of the large bandgap semiconductor layer and the top silicon to be formed . in general , if the difference between the lattice constant of the large bandgap semiconductor material and that of the si is large , the large bandgap semiconductor layer and the top silicon should not be too thick , in order to avoid lattice defects . the embodiment of the present invention replaces the oxide layer in the soi with the large bandgap semiconductor material in the substrate for manufacturing the semiconductor device , such that the ultra thin silicon channel formed in the device limits the depths of the source region and the drain region . as a consequence , the capability of the gate in controlling the channel is improved and the sce of the semiconductor device is suppressed . furthermore , since the lattice constant of the large bandgap semiconductor material used in the embodiment of the present invention is very close to that of silicon , a good lattice structure on the interface can be ensured . although the drawing only shows one large bandgap semiconductor layer 202 , one or more large bandgap semiconductor layers 202 can be provided , each of which is formed of the above - mentioned large bandgap semiconductor material or any combination thereof . the large bandgap semiconductor material has a crystalline structure , so it is commensurately strained and can match the lattice structure of the semiconductor substrate material . in the semiconductor structure formed according to the embodiment of the present invention , the large bandgap semiconductor layer has a crystalline structure and can better facilitate the epitaxial growth of the source / drain region of the semiconductor than the amorphous oxide layer in the utsoi . the embodiment of the present invention is not limited thereto . for example , multiple large bandgap semiconductor layers can be formed , each of which is formed of a different material . the material forming each layer can be gap , gaas , alas , etc ., or any combination thereof . the semiconductor device can have a small leakage current by using the semiconductor material with a large energy gap as a part of the substrate of the semiconductor device . fig4 shows a flow chart for manufacturing the semiconductor structure according to an embodiment of the present invention . in step s 401 , a gap layer 202 is grown on a silicon substrate 201 by epitaxial growth . those skilled in the art will understand that besides the gap layer , other large bandgap semiconductor layers can also be grown , such as large bandgap semiconductor layers formed of gaas , alas , etc ., or any combination thereof . the large bandgap semiconductor layers can also be grown by other technologies , such as the deposition technique well known to those skilled in the art , etc . one or more large bandgap semiconductor layers can be grown . in case of one large bandgap semiconductor layer , the thickness of the large bandgap semiconductor layer is preferably 5 ˜ 50 nm . in case of multiple bandgap semiconductor layers , the total thickness of the multiple bandgap semiconductor layers is preferably 5 ˜ 50 nm . in case of growing multiple bandgap semiconductor layers , a different material selected from gap , gaas , aias , etc ., or any combination thereof , can be grown in each layer . alternatively , a same material can be grown in the multiple layers . according to the method of the embodiment of the present invention , the thickness of the large bandgap semiconductor layer can easily be controlled and adjusted as required , such that the sce of the device can be well suppressed . next , in step s 402 , a silicon layer 203 with the thickness of 5 ˜ 20 nm is grown on the gap layer 202 . likewise , the silicon layer can be grown by epitaxial growth or deposition technique . the thickness of the top silicon in the utsoi is typically less than 30 nm and the uniformity of the top silicon is difficult to control . the thickness of the top silicon can be better controlled by means of growing the top silicon by epitaxial growth or deposition than by wafer bonding technique , and the uniformity of the top silicon layer is better . growing the large bandgap semiconductor layer on the silicon substrate , growing other large bandgap semiconductor layers on one large bandgap semiconductor layer , and growing the silicon layer on the large bandgap semiconductor layer by epitaxial growth or deposition is well known to those skilled in the art . therefore , the detailed description on epitaxial growth or deposition is omitted , in order to avoid unnecessarily obscuring the subject matter of the present invention . the manufacturing method of the semiconductor structure according to the embodiment of the present invention avoids the massive lattice defects on the interface due to atom compression in the wafer bonding technique . the embodiment of the present invention forms the large bandgap semiconductor layer and the top silicon by means of epitaxial growth or deposition , such that the thickness of the large bandgap semiconductor layer and the top silicon can be well controlled . the manufacturing method of the semiconductor structure according to the present invention does not need wafer bonding , but only needs the inexpensive and simple epitaxial growth or deposition , and consequently can substantially reduce the process complexity and cost . the thickness of the top silicon can be precisely controlled and has a better uniformity than the top silicon formed by polish . meanwhile , the silicon layer grown by epitaxial growth has a more regular lattice structure and facilitates the subsequent growth of the source and drain regions . further , compared with the box in the utsoi , the large bandgap semiconductor layer grown by epitaxial growth can be very thin , and thus can further suppress the sce . the present invention has been described in conjunction with the embodiments thereof . however , those skilled in the art will understand that other modifications or variations are possible without departing from the scope defined by the appended claims , and all of such modifications and variations are within the protection scope of the present invention . | 7 |
first and second embodiments of the present invention are illustrated in fig1 - 12 and fig1 - 19 , respectively . the first and second embodiments have common features ; however , a primary difference between the embodiments is that the first embodiment is specifically directed to a package including only a single blister card ; whereas , the second embodiment is directed to a similar package able to include a plurality of separate blister cards . for simplicity and illustrative purposes , the principles of the embodiments are described by referring mainly to examples thereof . in the following description , numerous specific details are set forth in order to provide a thorough understanding of the embodiments . it will be apparent however , to one of ordinary skill in the art , that the embodiments may be practiced without limitation to at least some of the specific details . with respect to the first embodiment , a fully assembled package 10 according to the present invention is illustrated in fig1 . the package 10 has a compact box - like shape that can be generally thin and elongate and that can be held in a person &# 39 ; s hand . a relatively - rigid outer sleeve 12 of a generally rectangular configuration houses a separately - manufactured blister card 14 or the like that has a set of individual blister compartments 16 . each blister compartment initially contains a pill , tablet and / or like separate small item ( not shown ) which can be stored within the package 10 and dispensed therefrom . in fig1 , the blister card 14 is shown in a storage position in which the blister card 14 is housed and protected within the sleeve 12 . in this condition , the pills , tablets and / or like separate small items within the blister compartments 16 cannot be accessed , dispensed , or otherwise separated from the blister card 14 . accordingly , a young child cannot access the tablets or the like , or the blister compartments 16 , when the blister card 14 is retained in the storage position . for purposes of dispensing a pill , tablet and / or like separate small item from the package 10 , the blister card 14 can be slid relative to the outer sleeve 12 through an open end 18 of the sleeve 12 to a dispensing position under certain conditions . a dispensing position of the blister card 14 is shown , for instance , in fig1 . in this position , one or more blister compartments 16 can be accessed external of the sleeve 12 for dispensing a pill , tablet and / or like separate small item from the blister card 14 . for instance , pressure can be readily exerted downward upon one of the exposed blister compartments 16 to force the tablet or the like to break through a backing layer 18 on the underside of the blister card 14 . a feature of the package 10 of the present invention is that it includes a resilient - locking and squeeze - release mechanism that provides child - resistant properties with respect to sliding the blister card 14 from the storage position to a dispensing position . when the blister card 14 is fully inserted into the outer sleeve 12 ( i . e ., in the storage position as shown in fig1 ), the blister card 14 becomes automatically locked and engaged to the sleeve 12 and cannot be removed from the outer sleeve 12 without a user simultaneously accomplishing multiple tasks that would be considered difficult for a young child to accomplish . for example , specific locations of opposite outer edges of the outer sleeve 12 are required to be simultaneously squeezed inward in opposite directions toward each other while at the same time a small exposed leading edge 20 of the blister card 14 is gripped and pulled through the open dispensing end 22 of the outer sleeve 12 . thus , a user must simultaneously perform both the squeezing and pulling actions for the blister card 14 to be freed from the storage position . these simultaneous actions are considered difficult for a young child to accomplish for the following reasons . the width “ w ” of the package 10 can be provided such that a young child &# 39 ; s hand is not expected to be sufficiently large as to be able to span and grasp about the width “ w ” which is otherwise required to squeeze the package 10 with a single hand . also , the simultaneous actions of squeezing the package 10 , for instance at one end 24 of the package 10 , and pulling the blister card 14 forward at the opposite open end 22 of the package 10 requires a certain level of dexterity also not expected of a young child . however , it should be noted that an adult , including a senior citizen , should readily be able to operate the package 10 . one hand of the adult should be able to readily grip and squeeze the package 10 adjacent the non - dispensing end 24 and the other hand of the adult should be able to grip and pull the exposed leading edge 20 of the blister card 14 at the opposite open dispensing end 22 of the package 10 . after the blister card 14 is partially or fully extended from the package 10 in a dispensing position , force can be exerted on one of the blister compartments 16 to break the contained item through a foil or like backing layer 18 on the underside of the blister card 14 that seals the item within the blister compartment 16 . thereafter , the blister card 14 can be pushed to slide back into the sleeve 12 to return the blister card 14 to the storage position . when this occurs , the locking mechanism is automatically actuated and the blister card 14 is once again locked within the outer sleeve 12 as discussed above . in the first illustrated embodiment of the present invention , the outer sleeve 12 is molded of a material such that it is hollow and made of one - piece . for example , the sleeve 12 can be made of plastic formed into shape by injection molding , blow molding , or like molding technique . a benefit of molding the sleeve as an integral single piece is that the amount of plastic required to make the sleeve can be significantly reduced while maintaining a desired degree of strength and rigidity needed for providing a functional child resistant package . also , the process of assembling the package is greatly simplified since very little is required relative to preparing the sleeve . the material used to make the sleeve 12 can be a plastic material , a recycled plastic material , a thermoplastic material such as polypropylene , or any other material ( metal , composite , paperboard , etc .) that can be formed into a sleeve - shape container that is preferably of one - piece construction . in the first illustrated embodiment , the sleeve 12 includes a substantially - rectangular , relatively - large upper wall panel 26 , a substantially - rectangular , relatively - large lower wall panel 28 , an opposed pair of side edges 30 and 32 , the open dispensing end 22 , and the opposite end 24 . the opposite end 24 may be a non - dispensing end and may be provided in a closed condition . as discussed below in greater detail , the end 24 may be used to initially load a blister card 14 into the sleeve 12 before the end 24 is closed . this enables the open dispensing end 22 to be provided with a smaller opening which can be specifically designed to prevent complete separation of the blister card 14 from the sleeve 12 when the blister card 14 is positioned in a full dispensing position and extends from the sleeve 12 via the dispensing end 22 . the upper and lower wall panels 26 and 28 are required to extend over and parallel to the upper and lower faces of the blister card 14 ; thus , the upper and lower panels 26 and 28 merely need to be of a size that is slightly greater than the size of the blister card 14 or at least the area of the blister card 14 on which the blister compartments 16 are located . the upper and lower wall panels 26 and 28 can be generally solid ; however , as illustrated , they can include slot or other shaped openings 34 for aesthetic purposes and / or for purposes of reducing the amount of plastic required to make the sleeve . although the openings 34 exist in the panels 26 and 28 , their pattern , location and size are such that they prevent unwanted access and dispensing of the contained items from the blister compartments 16 and such that they do not greatly reduce the desired strength or rigidity of the package 10 . the panels 26 and 28 can also include an optional window - type opening 36 for aesthetic purposes or for providing space for a label ( not shown ) or the like on the blister card 14 to be readable through one or both panels 26 and 28 of the sleeve 12 when the blister card 14 is in the storage position . finally , the panels 26 and 28 can include a small cut - out section 38 adjacent the open dispensing end 22 of the sleeve 12 for purposes of exposing the leading edge 20 of the blister card 14 thereby enabling ready gripping of the leading edge 20 when the blister card is to be slid / pulled through the open dispensing end 22 of the package 10 . the side edges 30 and 32 of the sleeve 12 define the thickness “ t ” of the package 10 and therefore the spacing between the wall panels 26 and 28 . this spacing need only be slightly greater than the height of the blister compartments 16 as best shown in fig9 . a pair of openings , flexible recesses , or the like 40 are formed in the opposite side edges 30 and 32 of the sleeve 12 . these openings form part of the locking mechanism of the package 10 which secures a blister card 14 in the storage position . preferably , the openings or recesses 40 are located remote from the open dispensing end 22 of the package 10 and adjacent the functionally closed end 24 of the package 10 . alternatively , the openings or recesses 40 can be located anywhere along the side edges 30 and 32 . in addition , the openings or recesses 40 can be located directly across from one another as shown in fig1 , or they can be offset or staggered from one another along the side edges 30 and 32 . for purposes of maximizing child - resistance of the package , the spacing “ w ” between the opposite openings 40 in the side edges 30 and 32 of the sleeve 12 can be selected such that the spacing “ w ” is relatively large in comparison to the size of young child &# 39 ; s hand , yet is readily engage - able between the thumb and finger of one hand of an adult . for example , the spacing “ w ” can be 2 inches , 3 inches , or greater . of course , the spacing “ w ” can also be 1 inch or greater . the non - dispensing end 24 of the sleeve 12 can include an end wall 42 . for instance , the end wall 42 can be secured in place ( snapped , held by friction , bonded , glued , taped , etc .) to close the otherwise open end 24 of the sleeve 12 after the blister card 14 is loaded into the sleeve 12 through , for instance , the non - dispensing end 24 . see fig3 . as best illustrated in fig4 , 5 and 9 , the end wall 42 can be formed integral with one of the wall panels 26 or 28 via a live hinge 44 and can be bent or folded into position to close the end 24 of the sleeve 12 . alternatively , the end wall 42 can be separate of the sleeve 12 and be secured in place on the end 24 of the sleeve 12 . yet another alternative is to utilize tape , a post , a flange or the like to provide a stop adjacent the end 24 of the sleeve 12 merely for the purpose of preventing the blister card 14 from passing through the end 24 of the sleeve 12 . turning to the structure of the blister card 14 , it is best illustrated in fig6 . the illustrated blister card 14 includes an elongate , generally - planar base strip of material 46 from which a plurality of laterally spaced - apart raised blister compartments 16 project . for example , the strip 46 can be made of thermoformable transparent plastic material and the blister compartments 16 can be provided as depressions / projections molded into a face thereof . other configurations are also possible . a tablet or like small item can be placed in each hollow open ended compartment 16 and a foil backing or the like 18 can be secured ( via adhesion or the like ) to a rear face of the strip 46 to seal the tablets or like small items within the blister compartments 16 . in the first illustrated embodiment , the blister card 14 includes a tail end section 48 opposite from its leading edge 20 . the tail end section 48 can be formed as an integral continuation of the base strip 46 , or alternatively , can be formed separate of the base strip 46 and simply be secured to one end thereof . the purpose of the tail end section 48 is to cooperate with the side edges 30 and 32 of the sleeve 12 to form the locking / release mechanism . the tail end section 48 can also be used to carry a label or other information which is viewable through the window - like opening 36 of the sleeve 12 discussed above . further , the tail end section 48 can include ribs 50 or other formations for purposes of strengthening or rigidifying the tail end section 48 of the blister card 14 . in the illustrated first embodiment , the tail end section 48 , as manufactured , includes a pair of lateral extensions or wings 52 in which tabs or like projections 54 are formed and / or attached . in the illustrated embodiment , the tabs 54 are formed as a thermoformed hollow projection or depression from the base strip material 46 and extend from the base strip material 46 in an opposite direction relative to the blister compartments 16 . the tabs 54 function as latches of the locking mechanism of the package 10 and are cooperatively receivable in the openings or recesses 40 in the side edges 30 and 32 of the sleeve 12 . preferably , the wings 52 interconnect to the tail end section via resilient live hinges 56 which permit the wings 52 to be resiliently bent , flexed , folded , or pivoted relative to the remainder of the tail end section 48 . this enables the wings 52 to be positioned generally perpendicular to the base strip material 46 to enable initial insertion of the blister card 14 into the sleeve 12 . in this position , the tabs or latches 54 extend laterally of the blister card 14 in opposite directions such they can register with and extend within and / or through the openings 40 in the side edges 30 and 32 of the sleeve 12 . the interconnection between the wings 52 and the remainder of the tail end section 48 is such that a resilient force is constantly exerted on the tabs 54 in a direction into engagement with the openings or recesses 40 of the side edges 30 and 32 of the sleeve 12 . this force results in the wings 52 attempting to pivot about the live hinges 56 to return to a flattened , as manufactured , condition . thus , when the tabs 54 register with the openings 40 , they resiliently pivot into the openings 40 and become trapped or locked therein . undesired dislodging of the tabs 54 from the openings 40 is avoided due to this constant resilient force created by the interconnection of the wings 52 to the tail end section 48 . accordingly , the separately - manufactured blister card 14 can be inserted into the sleeve 12 by sliding the leading edge 18 of the blister card 14 into the rear end 24 of the sleeve 12 . see fig3 . the wings 52 of the tail end section 48 of the blister card 14 shown in fig3 are folded upward to permit the wings 52 to be received within the sleeve 12 . as best shown in fig1 , the tabs or latches 54 engage the solid side edges 30 and 32 of the sleeve 12 until they register with the openings 40 . when this occurs , the tabs 54 resiliently extend into the openings 40 due to the wings 52 resiliently pivoting about the live hinges 56 . see fig7 . thereafter , the end wall 42 or the like can be secured in place across the rear end 24 of the sleeve 12 to provide a stop thereby preventing withdraw of the blister card 14 through the rear end . when a user desires to dispense a tablet or the like from the package 10 , the user squeezes the opposite tabs or latches 54 , such as between a thumb and finger of one hand , to simultaneously position the tabs or latches 54 inward as best shown in fig8 . in this condition , the user can grip the leading front edge 18 of the blister card 14 adjacent the open dispensing end 22 of the sleeve ( see fig1 ) and pull the blister card 14 through the open dispensing end 22 via a sliding motion . as the blister card 14 is slid through the sleeve 12 , the tabs 54 engage and slide along the solid sections of the side edges 30 and 32 as best illustrated in fig1 . however , the sleeve 12 includes a pair of stops 58 adjacent the open dispensing end 22 of the sleeve 12 which engage the wings 52 and prevent the tail end section 48 from passing through the open dispensing end 22 . for example , see fig9 - 12 . the stops can be provided as wall sections , flanges or posts that permit the section of the blister card 14 having the blister compartments 16 to readily pass through the open dispensing end 22 of the sleeve 12 , yet limit the tail end section 48 from passing therethrough . accordingly , the blister card 14 is effectively tethered to the sleeve 12 and cannot be completely separated therefrom during the useful life of the package 10 . a second contemplated embodiment of the present invention is illustrated in fig1 - 19 . in this embodiment , a package 60 includes a one - piece molded sleeve 62 for housing a pair of separate blister cards , 64 and 66 , back - to - back therein . similar to the package 10 discussed above , the package 60 includes a resilient - locking and squeeze - release mechanism that provides child - resistant properties with respect to sliding the blister cards , 64 and 66 , from a storage position to a dispensing position . when the blister cards , 64 and 66 , are fully inserted into the outer sleeve 62 ( i . e ., in the storage position as shown in fig1 ), the blister cards 64 and 66 , each independently become automatically locked within the sleeve 62 and cannot be withdrawn from the outer sleeve 62 without a user simultaneously accomplishing multiple manipulations of the package 60 . for example , specific locations of opposite outer edges of the outer sleeve 62 are required to be squeezed inward in opposite directions simultaneously while a small exposed leading edge 68 of the respective blister card , 64 or 66 , is gripped and pulled through an open dispensing end 70 of the outer sleeve 62 . thus , a user must simultaneously perform both the squeezing and pulling actions with respect to one of the blister cards , 64 or 66 , for that particular blister card to be freed to advance it from the storage position . the outer sleeve 62 , as illustrated , is molded of a material such that it is hollow and made of one - piece . for example , the sleeve 62 can be made of plastic formed into shape by injection molding , blow molding , or like technique . a benefit of molding the sleeve as an integral single piece is that the amount of plastic required to make the sleeve can be significantly reduced while maintaining a desired degree of strength and rigidity needed for providing a functional child resistant package . also , the process of assembling the package is also greatly simplified . the material used to make the sleeve 62 can be a plastic material , a recycled plastic material , a thermoplastic material such as polypropylene , or any other material ( metal , composite , paperboard , etc .) than can be formed into a sleeve - shape container that is preferably of one - piece construction . similar to sleeve 12 , the sleeve 62 includes a substantially - rectangular , relatively - large upper wall panel 72 , a substantially - rectangular , relatively - large lower wall panel 74 , an opposed pair of side edges 76 and 78 , the open dispensing end 70 , and the opposite end 80 which may or may not be closed and which may or may not be used for initially loading the blister cards , 64 and 66 , into the sleeve 62 . the upper and lower wall panels 72 and 74 extend in substantially - parallel relation to the faces of the blister cards , 64 and 66 . thus , the upper and lower panels 72 and 74 are of a size that is slightly greater than the size of the blister cards , 64 and 66 , or at least the area of the blister cards , 64 and 66 , on which blister compartments 82 are located . the upper and lower wall panels 72 and 74 can be generally solid ; however , as illustrated , they can include slot or other shaped openings 84 for aesthetic purposes and / or for purposes of reducing the amount of plastic required to make the sleeve 62 . although the openings 84 exist in the panels 72 and 74 , their pattern , location and size are such that they prevent unwanted access and dispensing of the contained items from the blister compartments 82 and such that they do not greatly reduce the desired strength or rigidity of the package 60 . the panels 72 and 74 can also include an optional window - type opening 86 for aesthetic purposes or for providing space for a label ( not shown ) or the like on the blister cards , 64 and 66 , to be readable through one or both panels 72 and 74 when at least one of the blister cards , 64 and 66 , is in the storage position . the panels 72 and 74 can each include a small cut - out section 88 adjacent the open dispensing end 70 of the sleeve 62 for purposes of exposing the leading edges 68 of the blister cards , 64 and 66 , thereby enabling ready gripping of either of the leading edges 68 when one of the blister cards , 64 and 66 , is to be slid / pulled through the open dispensing end 70 of the package 60 . these cut - out sections 88 can be offset to one another to enable easier selection between one of the two cards , 64 and 66 . the side edges 76 and 78 of the sleeve 62 define the thickness “ t ” of the package 60 and therefore the spacing between wall panels 72 and 74 . as an example , this spacing need only be slightly greater than twice the height of the blister compartments 82 as best shown in fig1 , assuming the blister compartments 82 are of a uniform height on each card , 64 and 66 . two sets of openings , flexible recesses , or the like , 90 and 92 , are formed in the opposite side edges 76 and 78 of the sleeve 12 . these sets of openings , 90 and 92 , form part of the locking mechanism of the package 60 which independently secure each blister card , 64 and 66 , in the storage position . preferably , the sets of openings or recesses , 90 and 92 , are located remote from the open dispensing end 70 of the package 60 adjacent the functionally closed end 80 of the package 60 . alternatively , the openings or recesses , 90 and 92 , can be located anywhere along the side edges 76 and 78 . in addition , the openings or recesses , 90 and 92 , can be located directly across from one another , or they can be offset or staggered from one another along the side edges 76 and 78 as best illustrated in fig1 and 17 . the non - dispensing end 80 of the sleeve 62 can include an end wall 94 . for instance , the end wall 94 can be secured in place ( snapped , held by friction , bonded , glued , taped , etc .) to close the otherwise open end 80 of the sleeve 62 after the blister cards , 64 and 66 , are initially loaded into the sleeve 62 through , for instance , the non - dispensing end 80 . as best illustrated in fig1 , the end wall 94 can be formed integral with one of the wall panels 72 or 74 of the sleeve 62 via a live hinge 96 and can be bent or folded into position to close the end 80 of the sleeve 62 , or alternatively , the end wall 94 can be separate of the sleeve 62 and be secured in place on the end 80 of the sleeve 62 . yet another alternative is to utilize tape , a post , a flange or the like to provide a stop adjacent the end 80 of the sleeve 62 merely for the purpose of preventing the blister cards , 64 and 66 , from undesirably passing in a reverse direction through the non - dispensing end 80 of the sleeve 62 . turning to the structure of the blister cards , 64 and 66 , each can be essentially identical . this greatly simplifies assembly of the package 60 since any two blister cards can be selected for insertion into a one - piece sleeve 62 . alternatively , the blister cards , 64 and 66 , can be different . in the illustrated embodiment , each blister card , 64 and 66 , includes an elongate , generally - planar base strip of material 98 from which a plurality of laterally spaced - apart raised blister compartments 82 project . for example , the strip 98 can be made of thermoformable transparent plastic material and the blister compartments 82 can be provided as depressions / projections molded into a face thereof . other configurations are also possible . a tablet or like small item can be placed in each hollow open ended compartment 82 and a foil backing or the like 100 can be secured ( via adhesion or the like ) to a rear face of the strip 98 to seal the tablets or like small items within the blister compartments 82 . the leading edge 68 of each blister card , 64 and 66 , can include a grip tab 102 and an adjacent recess ( not shown ). accordingly , when the blister cards , 64 and 66 , are stacked together , back - to - back , the grip tab 102 of one blister card registers with the recess of the other blister card and vice versa . this makes it easier for the user to grip the leading edge 68 of one of the blister cards without gripping the leading edge 68 of the other of the blister cards . each of the blister cards , 64 and 66 , includes a tail end section 106 opposite from its leading edge 68 . the tail end section 68 can be formed as an integral continuation of the base strip 98 , or alternatively , can be formed separate of the base strip 98 and simply be secured to one end thereof . the purpose of the tail end section 106 is to cooperate with the side edges 76 and 78 of the sleeve 62 to form the locking / release mechanism . the tail end section 106 can also be used to carry a label or other information which is viewable through the window - like opening 86 of the sleeve 62 discussed above . the tail end section 106 , as manufactured , includes a pair of lateral extensions or wings 108 in which tabs or like projections 110 are formed and / or attached . in the illustrated embodiment , the tabs 110 are formed as a thermoformed hollow projection or depression from the base strip material 98 and extend from the base strip material 98 in an opposite direction relative to the blister compartments 82 . the tabs 110 function as latches of the locking mechanism of the package 60 and are cooperatively receivable in the openings or recesses , 90 or 92 , in the side edges 76 and 78 of the sleeve 62 . in the illustrated embodiment , the tabs 110 of each blister card are offset relative to one another . thus , when identical cards , 64 and 66 , are positioned back - to - back within the sleeve 62 , the opposite tabs 110 of each blister card are offset in each side edge . thus , the locations of the openings , 90 and 92 , in each side edge , 76 and 78 , can be offset thereby increasing the strength of the sleeve 62 . of course , other tab locations are possible , particularly if the blister cards are not required to be identical . each of the wings 108 interconnect to the tail end section 106 via a resilient live hinge 112 that enables the wings 108 to be resiliently bent , flexed , folded , or pivoted relative to the remainder of the tail end section 98 . thus , the wings 108 can be pivoted into a position that is generally perpendicular to the base strip material 98 to enable initial insertion of the blister cards , 64 and 66 , into the sleeve 62 . in this position , the tabs or latches 110 extend laterally of the blister cards , 64 and 66 , in opposite directions such that they register with and extend within and / or through the openings , 90 and 92 , in the side edges 76 and 78 of the sleeve 62 . the interconnection between each wing 108 and the remainder of the tail end section 106 is such that a resilient force is exerted on the tabs 110 in a direction into engagement with the openings or recesses , 90 and 92 , of the side edges 76 and 78 of the sleeve 62 . this force results in the wings 108 attempting to pivot about the live hinges 112 to return to a flattened , as manufactured , condition . thus , when the tabs 110 register with the openings , 90 and 92 , they resiliently pivot into the openings , 90 and 92 , and become trapped or locked therein . undesired dislodging of the tabs 110 from the openings , 90 and 92 , is avoided due to this constant resilient force created by the interconnection of the wings 108 to the tail end section 106 . accordingly , the separately - manufactured blister cards , 64 and 66 , can be inserted separately or simultaneously into the sleeve 62 by sliding the leading edges 68 of the blister cards , 64 and 66 , into the non - dispensing end 80 of the sleeve 62 . the wings 108 of the tail end sections 106 of the blister cards , 64 and 66 , are folded upward to permit the wings 108 to be received within the sleeve 62 . the tabs or latches 110 engage the solid side edges , 76 and 78 , of the sleeve 62 until they register with the openings , 90 and 92 . when this occurs , the tabs 110 resiliently snap into the openings , 90 and 92 , due to the resilient nature of the live hinges 112 . thereafter , the end wall 94 or the like can be secured in place across the end 80 of the sleeve 62 to provide a stop thereby preventing withdraw of either blister card , 64 and 66 , through the end 80 . when a user desires to dispense a tablet or the like from one of the blister cards , 64 and 66 , from the package 60 , the user squeezes both tabs 110 in one of the sets of openings , 90 or 92 , corresponding to one of the blister cards , 64 or 66 , between a thumb and finger of one hand , to simultaneously position the tabs 110 inward within the sleeve 62 . in this condition , the user can grip the appropriate leading front edge 68 of the blister card , 64 or 66 , adjacent the open dispensing end 70 of the sleeve 62 and pull the blister card , 64 or 66 , through the open dispensing end 70 via a sliding motion . as the selected blister card , 64 or 66 , is slid through the sleeve 62 , the tabs 110 of that blister card engage and slide along the solid sections of the side edges , 76 and 78 . however , the sleeve 62 includes a pair of stops 114 adjacent the open dispensing end 70 of the sleeve 62 which engage the wings 108 and prevent the tail end section 106 from passing through the open dispensing end 70 . the stops 114 can be provided as wall sections , flanges or posts that permit the sections of the blister cards , 64 and 66 , having the blister compartments 82 to readily pass through the open dispensing end 70 of the sleeve 62 , yet limit the tail end section 106 from passing therethrough . accordingly , each blister card , 64 and 66 , is effectively tethered to the sleeve 62 and cannot be completely separated therefrom during the useful life of the package 60 and each can be slid to a dispensing position independent of the other . various modifications to the packages 10 and 60 and their method of assembly can be made . for instance , the number , shape and configuration of the various panels and openings of the sleeves , 12 and 62 , can be altered . the openings in the side edges can be replaced with flexible tabs or the like that have a recess for receiving the latch of the blister cards . alternatively , these structures can be reversed so that the side edges include a latch and the wings include a recess or like opening . further , the shape , size and / or pattern of the cutouts , ribs , and the like can be changed as well as the size , shape , number and positioning of the blister compartments . also , instead of having a pair of locking tabs on each blister card , a single locking tab could be used . while preferred packages and methods of assembly have been described in detail , various modifications , alterations , and changes may be made without departing from the spirit and scope of the package and method according to the present invention as defined in the appended claims . | 1 |
l - lactic acid in the amount of 1 , 000 kg , having a lactic acid monomer altered concentration of 90 . 0 % and an optical purity of 98 . 6 % e . e ., was supplied to a reaction tank with a condenser of a capacity of 1 . 2 m 3 and capable of distilling under a reduced pressure . l - lactic acid was heated at a temperature of 130 ° c . for two hours under an atmospheric pressure to distill off 96 kg of a condensed liquid containing lactic acid . next , the liquid temperature and pressure were gradually changed from 130 ° c . to 150 ° c . and from the atmospheric pressure to 5 torr for 6 hours to distill off 186 kg of the condensed liquid containing lactic acid and obtain lactic acid oligomer . in the process , 3 kg of an exhaust liquid of a vacuum pump containing lactic acid was obtained . lactic acid oligomer had a weight average molecular weight of 3 , 100 . further , 15 . 0 kg of tin octylate was added to the reaction tank , and the reaction tank was heated at a temperature of 190 ° c . under a pressure of 5 torr for three hours to distill off 712 kg of crude lactide . in the process , 12 kg of a residue was obtained in the reaction tank . toluene in the amount of 399 kg and tetrahydrofuran in the amount of 171 kg were added to the crude lactide and heated at a temperature of 65 ° c . to dissolve the same . then , the solution was cooled down to 5 ° c . to separate crystals of lactide through filtration . further , the filtrated crystals were washed by a mixture of 399 kg of toluene and 171 kg of tetrahydrofuran at 5 ° c ., and dried under a reduced pressure to obtain 603 kg of refined lactide . the refined lactide had an optical purity of 99 . 7 % e . e . in the process , also , 1 , 249 kg of a waste mother liquid and a waste washing liquid was obtained . the waste mother liquid and waste washing liquid were condensed in an evaporator to obtain 103 kg of a residue . a mixture of the above obtained condensed liquid , the vacuum pump exhaust liquid and the residue was supplied to a reaction tank with a condenser in a capacity of 0 . 6 m 3 and capable of distilling under a reduced pressure , and heated at 130 ° c . for two hours under an atmospheric pressure to dissolve the contents in the tank and distill off the condensed liquid to obtain a concentration of 90 . 1 % in a lactic acid altered concentration . next , the liquid temperature and pressure were gradually changed from 130 ° c . to 160 ° c . and from the atmospheric pressure to 5 torr for three hours to distill off the condensed liquid . further , the reaction tank was heated for eight hours at a temperature of 230 ° c . under an atmospheric pressure to obtain lactic acid oligomer having substantially optical inactivity , i . e . optical purity of 0 . 4 % e . e ., and a weight average molecular weight of 3 , 440 . then , 3 . 0 kg of tin octylate was added to the reaction tank and heated for one hour at a temperature of 200 ° c . under a pressure of 5 torr to distill off 110 kg of crude lactide . next , 61 . 6 kg of toluene and 26 . 4 kg of tetrahydrofuran were added to the above obtained crude lactide , and heated at 65 ° c . to dissolve . then , the solution was cooled down to 5 ° c . to separate crystals of lactide through filtration . further , the filtrated crystals were washed with a mixture of 61 . 6 kg of toluene and 26 . 4 kg of tetrahydrofuran at 5 ° c ., and dried under a reduced pressure to obtain 71 kg of refined lactide . the refined lactide had an optical purity of 0 . 0 % e . e . a yield of the above obtained total refined lactide relative to a theoretical yield was 93 . 6 %. the above refined lactides having optical purities of 99 . 7 % e . e . and 0 . 0 % e . e . were mixed at a weight ratio of 85 . 3 : 14 . 7 . the mixture was continuously supplied to a biaxial extruder together with 0 . 10 parts by weight of tin octylate relative to the lactides , for heating and mixing to obtain polylactic acid . thus obtained polylactic acid had an optical purity of 84 . 6 % e . e . ; a weight average molecular weight of 183 , 000 ; a glass transition point of 59 . 7 ° c . ; a tensile strength of 6 , 270 psi ; a tensile elastic modulus of 490 kpsi ; and a tensile ductility of 6 . 2 %, which is suitable as a film material . incidentally , a concentration of lactic acid was measured by a liquid chromatography using a column , wherein silica gel modified by an octadecyl group after hydrolysis was used as a filler . the optical purity was measured by a liquid chromatography using an optical resolution column , wherein silica gel modified by an l - amino acid derivative after hydrolysis was used as a filler . molecular weight of lactic acid prepolymer was obtained by measuring a weight average molecular weight of gpc , wherein polystyrene was used as a reference material . l - lactic acid in the amount of 1 , 000 kg , having a lactic acid monomer altered concentration of 90 . 2 % and an optical purity of 98 . 5 % e . e ., was supplied to a reaction tank with a condenser of a capacity of 1 . 2 m 3 and capable of distilling under a reduced pressure . l - lactic acid was heated at temperature of 130 ° c . for two hours under an atmospheric pressure to distill off 95 kg of a condensed liquid containing lactic acid . next , the temperature and pressure were gradually changed from 130 ° c . to 150 ° c . and from the atmospheric pressure to 5 torr for 6 hours to distill off 187 kg of a condensed liquid containing lactic acid to thereby obtain lactic acid oligomer . in the process , 3 kg of an exhaust liquid from a vacuum pump was obtained . lactic acid oligomer had a weight average molecular weight of 3 , 200 . further , 15 . 0 kg of tin octylate was added to the reaction tank , and the reaction tank was heated at a temperature of 190 ° c . under a pressure of 5 torr for three hours to distill off 713 kg of crude lactide . in the process , 12 kg of a residue was obtained in the reaction tank . next , 399 kg of toluene and 171 kg of tetrahydrofuran were added to the crude lactide and heated at a temperature of 65 ° c . to dissolve the same . then , the solution was cooled down to 5 ° c . to separate crystals of lactide through filtration . further , the filtrated crystals were washed by a mixture of 399 kg of toluene and 171 kg of tetrahydrofuran at 5 ° c ., and dried under a reduced pressure to obtain 604 kg of refined lactide . refined lactide had an optical purity of 99 . 6 % e . e . in the process , 1 , 247 kg of a waste mother liquid and a waste washing liquid was obtained . the waste mother liquid and waste washing liquid were condensed in an evaporator to obtain 104 kg of a residue . a mixture of the above obtained condensed liquid , the vacuum pump exhaust liquid , the residue and 20 kg of waste strand of polylactic acid having a weight average molecular weight of 193 , 000 was supplied to a reaction tank with a condenser of 0 . 6 m 3 and capable of distilling under a reduced pressure , and heated at 130 ° c . for two hours under an atmospheric pressure to dissolve the contents in the reaction tank and distill the condensed liquid to obtain a concentration of 90 . 0 % in a lactic acid altered concentration . next , the temperature and pressure were gradually changed for three hours from 130 ° c . to 160 ° c . and from the atmospheric pressure to 5 torr to distill off the condensed liquid . further , 3 . 0 kg of tin octylate was added to the reaction tank , and heated for eight hours at a temperature of 230 ° c . under the atmospheric pressure to obtain lactic acid oligomer having substantially optical inactivity , i . e . optical purity of 0 . 3 % e . e ., and a weight average molecular weight of 3 , 570 . then , the reaction tank was heated for one hour at a temperature of 200 ° c . under a pressure of 5 torr to distill off 132 kg of crude lactide . toluene in the amount of 73 . 9 kg and tetrahydrofuran in the amount of 31 . 7 kg were added to the above obtained crude lactide , and heated at 65 ° c . to solve the same . then , the solution was cooled down to 5 ° c . to crystalize lactide and separate the crystallized lactide through filtration . further , the filtrated crystals were washed with a mixture of 73 . 9 kg of toluene and 31 . 7 kg of tetrahydrofuran at 5 ° c ., and dried under a reduced pressure to obtain 85 kg of refined lactide . refined lactide had an optical purity of 0 . 0 % e . e . the above refined lactides having the optical purities of 99 . 6 % e . e . and 0 . 0 % e . e . were mixed at a weight ratio of 94 . 4 : 5 . 6 . the mixture was continuously supplied to a biaxial extruder together with 0 . 10 parts by weight of tin octylate relative to the lactides to heat and mix together to thereby obtain polylactic acid . thus obtained polylactic acid had an optical purity of 93 . 7 % e . e . ; a weight average molecular weight of 146 , 000 ; a glass transition point of 59 . 7 ° c . ; a melting point of 161 . 6 ° c . ; a tensile strength of 7 , 720 psi ; a tensile elastic modulus of 510 kpsi ; and a tensile ductility of 4 . 3 %, which is suitable as a material for injection molding products . l - lactic acid in the amount of 1 , 000 kg , having a lactic acid monomer altered concentration of 90 . 0 % and an optical purity of 98 . 6 % e . e ., was supplied to a reaction tank with a condenser of a capacity of 1 . 2 m 3 and capable of distilling under a reduced pressure . l - lactic acid was heated at temperature of 130 ° c . for two hours under an atmospheric pressure to distill off 96 kg of a condensed liquid containing lactic acid . next , the temperature and pressure were changed gradually from 130 ° c . to 150 ° c . and from the atmospheric pressure to a pressure of 5 torr for 6 hours to distill off 186 kg of a condensed liquid containing lactic acid and obtain lactic acid oligomer . lactic acid oligomer had a weight average molecular weight of 3 , 100 . further , 15 . 0 kg of tin octylate was added to the reaction tank , and the reaction tank was heated at a temperature of 190 ° c . under a pressure of 5 torr for three hours to distill off 712 kg of crude lactide . toluene in the amount of 399 kg and tetrahydrofuran in the amount of 171 kg were added to the crude lactide , and the mixture was heated to a temperature of 65 ° c . to dissolve the same . then , the solution was cooled down to 5 ° c . to separate crystallized lactide through filtration . further , the filtrated crystals were washed by a mixture of 399 kg of toluene and 171 kg of tetrahydrofuran at 5 ° c ., and dried under a reduced pressure to obtain 603 kg of refined lactide . refined lactide had an optical purity of 99 . 7 % e . e . a yield of the above obtained refined lactide relative to a theoretical yield is 83 . 8 %. according to the method of the present invention , lactic acid can be obtained by reproducing the by - products formed in a production process of lactic acid based compositions . also , lactide and polylactic acid having a desired optical purity can be obtained by using reproduced lactic acid . while the invention has been explained with reference to the specific examples of the invention , the explanation is illustrative , and the invention is limited only by the appended claims . | 2 |
one embodiment of the present invention provides stacking a plurality of rigid and / or flex substrates , each with components mounted on one or both sides of the individual boards . these stacked substrates may be identical in size or vary in size , shape or composition . in an embodiment of the present invention , modules used in mobile phones may use two substrates stacked on top of each other , however it is understood that there is no theoretical limit to the number of substrates that may be stacked . substrate stacking allows multiple substrates to be attached in the z direction and thus reduce the need for valuable space in the x and y direction on the motherboard . in an embodiment of the present invention , a multilayer strip with 3 arrays and multiple modules in each array may be utilized — although the present invention is not limited in this respect . each module in the array may be populated with surface mount components , which may be used in place of , or in addition to the solder balls for connection to and separation from the plurality of substrates . in the event of large or multiple ( two or more ) substrate stacking , the surface mount components may act as pillars and to control solder bal collapse . after population of the strip with surface mounted devices ( smds ) and solder reflow , die attaching and wire bonding of semiconductor chips , solder ball placement and reflow may define the substrate stacking . solder balls and or surface mount components may be used to inter connect mechanically and electrically multiple substrates . while in the populated strip configuration , the solder ball or the top portion of the surface mount components may be coated with solder and connect to metal pads located on the bottom side of a separate substrate , which may be individually picked and placed or as another inverted entire strip . a fixture may be used to help in the aligning process for the top to the bottom substrate . one end of a 50 ohm line of top substrate (# 1 ) may connected through a via to a metal pad on bottom side of substrate # 1 ( it is understood that any particular values are for illustrative purposes only and should not be considered to limit the present invention ). the top metal layer of substrate # 2 may also be a 50 ohm line . on each end of the line , one side of surface mount capacitors may be soldered . to maintain stability and flatness of the substrates , additional surface mount components may be soldered on metal pads located on the sides of substrate # 2 which may run in parallel direction to the 50 ohm line . solder ball pads to accept solder balls may also be provided on top layer of substrate # 2 and the bottom layer of substrate # 1 . further , diagonal through holes on both substrates will help towards alignment of substrate # 1 and substrate # 2 using a jig for the reflow of solder balls and or the solder coated terminations of the surface mount components . when reflowed , the 50 ohm line on substrate # 1 will be mechanically and electrically connected to the 50 ohm line on substrate # 2 . if desired , the stacked substrates may then be attached to a test board for evaluation . to facilitate evaluation of the present invention , the structure may be under filled with glob top epoxy , temperature cycled and retested if individual / cingulated substrates are picked and placed on the strip and reflowed , standard molding will under fill and over mold the stacked substrates on the strip . the strip then may be sawed and cingulated into a 3d stacked module structure . if two strips are connected together as described earlier , strategically located openings in the strip format will help to under fill between the substrates and over the strip . although not limited to any particular interconnect options , examples include solder balls , 0402s etc . to provide for a larger gap between a plurality of substrates , larger size surface mount components may be used . embodiments of the present invention provide many benefits to the current state of the art , including : a . it is an enabling miniaturization technology using standard and multilayer and multi dimensional substrates ; b . it allows for single side and double side circuit population with flip chip or wire bonded die and may include the attachment of surface mount components in a lga technology ; c . it can use bga or the surface mount components as the means of vertically interconnecting multiple substrates ; d . it allows for trouble shooting and fine tuning of each individual substrate during the engineering and product development phases ; e . it allows for the integration / stacking of multiple thicknesses and metal layers of substrate materials ; f . as tuning up of circuits is commonly required for products under development , this type of 3d structure is the only one that allows for simple and direct access to components for purposes of tuning ( changing value or position ) circuits , either on the individual boards before they are stacked ( sub - assemblies ) or in final configuration once they have been stacked ; g . it allows for the stackable integration of other known good fully molded packages or lga , bga , μbga packages ; if there is an issue of stacking two rigid circuit boards like bt , fr4 or ceramic / ltcc , one or both of the stacked boards can be made of flex materials . this is typically a more costly material , but it offers better feature resolution ( conductive traces , vias , and spacings ), and is compliant in the event there are issues with flatness / planarity when stacking , or if three is a need for more flexibility in the material to survive temperature cycle / shock ( the dissimilar materials between the boards and plastic encapsulate over - mold may have large enough differences in temperature coefficient of expansion ( tce ) that it may de - laminate over temp .) an embodiment of the present invention addresses the creation of more surface area to mount components . traditional circuits for multi - chip - modules ( mcms ) mount components all on one side , so there is a 1 to 1 ratio between area for components and area the chip consumes when mounted in a customer &# 39 ; s product ( eg mobile phone mother board ). and the ratio is typically actually less than one since the top layer is often partially used to route lines . an embodiment of the present invention provides the components our capable of being mounted on the top of both boards , for a 2 × improvement in area available for components within our mcm without growing the area of the mcm itself . further , it is even possible to mount components on 3 or all 4 sides of the boards giving as much as 4 × improvement for 2 stacked boards in a 3d package — although the present invention is not limited in this respect . more than 2 substrates may be stacked if desired for specific applications . an embodiment of the present invention leverages mature high volume processes and manufacturing infrastructure already in place globally . this reduces risk and cost , and enables simplified paths to second - sourcing , often requested by customers to lower supply chain risks . all components and lines printed on the top surface of the top stacked board can easily be “ tuned ” to adjust circuit performance and facilitating quicker product development . in order to do this , no plastic overmold is used during engineering development , allowing max flexibility and access during development , but very representative rf - wise of how it will behave when fully assembled with overmold ( since the dielectric constant of the overmold is so low ). z - axis interconnects between the boards may be accomplished by using : 1 ) conventional 0201 ( or other size like 0402 or 01005 smd components )— some could be components already needed by the circuit , thus being “ free ” in terms of space and cost . smds may be conductive on all four sides of both terminations , so the solder will easily wet on both boards to form a z - axis interconnect ; 2 ) solder balls on one ( or both ) boards , with the other board having a land grid array ( lga to marry up to the balls ; 3 ) custom component in at least 3 locations ( to make a 3 - legged table ) with multiple connections in the z - axis . this can be as simple as a very small (˜ 0 . 5 × 0 . 5 mm ) board ( rigid or flex ) with 4 pads on the top , 4 on the bottom , and 4 via holes connecting the pads in the z - direction . for cost savings , the vias may be placed in the streets so that when the boards are cut and cingulated , the vias / pads create castillations for better soldering , smaller size , and lower cost ( ½ as many vias may thus be needed to make the same number of i / os ). traditional boards / packaging have to compromise on thickness and dielectric constants . thin boards are wanted because they are better thermally and smaller height is desired as well as better rf grounding of some rf components . thick boards are desired to create higher impedance inductors and transmission lines . low dielectric is wanted for the same reason ( high impedance ). high dielectric is desired for more sensitive parts of the circuit where coupling is of concern , or you want to print capacitors . with the stacked 3d approach of the present invention , it is possible to mix and match the best of both worlds to eliminate these compromises . although not limited to this , for example , two high dielectric boards may be used , that are very thin , with a reasonably thick (˜ 0 . 6 mm ) air gap are provided in an embodiment of the present invention . sensitive low impedance parts and parts needing good rf or thermal ground may be be placed on the lower substrate . components , transmission lines and inductors wanting to see high impedance may be , although is not required to be , placed on the upper substrate . even though the upper substrate may be high dielectric , due to the air gap between these components and ground ( typically bottom of the 3d package , but ground can be brought to any of the 4 metal levels ), the effective dielectric of the entire sandwiched structure may be low . the top substrate does not have to be the exact same size or shape of the lower board , so if 1½ boards are needed to fit all the components , or you want access to some of the lower components , a smaller upper board may be used . a conventional package may have a 4 - layer bt substrate with blind and buried vias ; however , in an embodiment of the present invention using the 3d package approach , it is possible to have the exact same amount of metal layers without compromise , but would use two 2 - layer bt substrates with just through hole vias which are much less expensive , potentially saving more than the additional z - access interconnect and process costs , giving a net savings in manufacturing . turning now to the figures , fig1 , shown generally as 100 , provides a stacked substrates of one embodiment of the present invention . top board 105 is shown distanced from bottom board 110 and using vision , fiducials and or fixcturing , hybrid circuits can be stacked on top of one another utilizing ball grid arrays ( bgas ), or surface mount devices ( smds ) as stand offs for electrical and mechanical connectivity to create a 3d package structure . top board 105 may include individual upper substrate 140 and stress relief and openings for under molding 115 as well us upper stip 120 . bottom boards 110 may include individual lower substrate 135 and an array of multiple circuit substrates 130 and lower stip 125 . openings in the substrate will enable molding over and between the circuit structures fig2 at 200 , illustrates a stacked single substrate of one embodiment of the present invention . top board 205 include an array of individual upper substrates of a 3d stacked page structure 215 and bottom board 210 include an array of individual lower substrates of a 3d stacked page structure 220 . fig3 at 300 is shown individual upper substrate of a 3d stacking package structure 310 and individual lower susbstrate of a 3d stacked package structure 315 compressed together . lower stip is shown at 305 . fig4 , shown generally as 400 , pictorially shows a top view of the lower substrate 405 of an embodiment of the present invention . circuitry 420 , solder balls 410 and connecting vias 415 are shown on substrate 405 . fig5 at 500 is a side pictorial representation of the stacked substrates of an embodiment of the present invention . solder balls ( two of which are represented as 505 and 510 ) connect and separate top substrate 520 and lower substrate 525 . metal layer 515 is shown on top substrate 520 . fig6 at 600 is an expanded view depicting the use of surface mounting devices 610 that may be used to connect and separate substrates in an embodiment of the present invention . fig7 , at 700 , depicts a multilayer strip 705 with 3 arrays and multiple modules in each array . a cross section of the multilayer strip 705 is shown at 710 . while the present invention has been described in terms of what are at present believed to be its preferred embodiments , those skilled in the art will recognize that various modifications to the disclose embodiments can be made without departing from the scope of the invention as defined by the following claims . further , although a specific scanning antenna utilizing dielectric material is being described in the preferred embodiment , it is understood that any scanning antenna can be used with any type of reader any type of tag and not fall outside of the scope of the present invention . | 7 |
referring now to the drawings , embodiments of the present invention are described below . fig3 is a sectional view of one of the embodiments , and fig4 is a left side elevation of the ball valve shown in fig3 . a valve body 21 having a circular exterior is manufactured by cutting a tubular body of straight cylindrical form . in a cylindrical passage 23 provided in the valve body 21 are assembled a valve member 24 and sealing members 26a , 26b provided at opposite sides of member 24 . internal threads 22a , 22b are machined at both ends in the axial direction of the valve body 21 . fitting grooves 27a , 27b are formed at opposite axial ends of the cylindrical passage 23 . circlips 28 , 29 are resiliently fitted in these fitting grooves 27a , 27b , respectively . fig5 is a front view of the circlip 28 , fig6 is a section along line vi -- vi of the circlip in fig5 and fig7 is an enlarged sectional view of area vii in fig6 . the circlip 28 is manufactured of an approximately circular steel plate notched in the circumferential direction . at both ends of the circlip 28 are formed engaging holes 50 , 51 for convenience of mounting the circlip . in this embodiment , an inner part or circumferential portion 52 of the circlip 28 is displaced axially in the thicknesswise direction ( in the vertical direction of fig6 and 7 , or in the direction vertical to the plane of in fig5 ) with respect to outer part or circumferential portion 53 . in the illustrated embodiment the inner part 52 is plastically deformed in a direction upward in fig6 and 7 . a notch 54 is formed in the inner portion 52 at a position displaced 180 degrees from the ends of the circlip . at this notch 54 , the inner part portion 52 is removed . by the axial or thicknesswise displacement of the inner part 52 with respect to the outer part 53 , a spring force is exhibited in the axial or thicknesswise direction of the circlip 28 . by the formation of the notch 54 , the outside diameter of the circlip 28 may be easily reduced by bringing the engaging holes 50 , 51 closer to each other by means of a tool or jig engaged therein . also by means of a tool or jig , the outside diameter of the circlip 28 may be easily expanded resiliently by applying external forces to the engaging holes 50 , 51 in directions away from each other . when the circlip 28 , with its outside diameter reduced , is fitted into the fitting groove 27a , and then released , it is retained therein firmly by an outward resilient force in the radial direction . the inner part 52 of the circlip 28 is resiliently projected toward the sealing member 26a , and the sealing member 26a is pressed against the outer circumference of the valve member 24 . the other circlip 29 is similarly constituted , and its inner part is resiliently projected toward the sealing member 26b , and the sealing member 26b is pressed against the outer circumference of the valve member 24 . thus , the tolerances between the valve member 24 and the sealing members 26a , 26b are absorbed , and a desired degree of tightness may be obtained . the forces acting on the sealing members 26a , 26b by means of the circlips 28 and 29 are smaller than the natural strength of the sealing members 26a , 26b , so that the sealing members 26a , 26b will not be forced into excessively tight contact with the outer circumferential surface of the valve member 24 , and such forces also are smaller than the pressure of the pressure fluid with which the value is used . one end of a drive shaft 30 is fitted to the head of the valve member 24 . a handle 32 is fitted to the other end of this drive shaft 30 by way of nut 31 . fig8 is an enlarged sectional view in the vicinity of the drive shaft 30 . the section of shaft 30 extending at a right angle to the axis of the drive shaft 30 is polygonally formed , and the handle 32 has formed therein an engaging hole 33 into which is inserted drive shaft 30 . thus , turning torque is transmitted from the handle 32 to the shaft 30 . a ring - shaped seal piece 35 is fitted in a concave recess 34 of the valve body 21 , and a washer 36 fits over this seal piece 35 . a belleville spring 37 is present between a nut 31 and handle 32 , and another belleville spring 38 is present between the handle 32 and washer 36 . the outer parts of the belleville springs 37 , 38 project to the sides of handle 32 . thus , the handle 32 may be inclined to the position 39 indicated by phantom lines . fig9 is a plan of the base area of the handle 32 . fig1 is a section along line x -- x of fig9 . concave recesses 41 , 42 are formed in the valve body 21 , and a stopper 43 which may be selectively fitted into concave recesses 41 or 42 is formed on the handle 32 , to project outwardly therefrom . when the stopper 43 is seated in the concave recess 41 , the valve member 24 is in the position shown in fig3 and the valve is open . when the stopper 43 is removed from the concave recess 41 by displacing the handle 32 against the spring force of belleville springs 37 , 38 to position 39 , the ball valve may be closed by turning the handle 32 in the direction of arrow 44 . when the handle 32 is released , the stopper 43 is fitted into the concave recess 42 . thus , the fully closed position of the ball valve is established . when the stopper 43 is inserted in the concave recesses 41 or 42 , the handle 32 will not be rotated if an undesired external force is applied to it , so that the fully closed position or fully open position of the valve is maintained . planar surfaces 46 , 47 ( see fig4 ) are formed on the outer wall of the valve body 21 , whereby a spanner or the like is applied during threading to internal threads 22a , 22b of threaded pipe ends . the valve body 21 is formed by machining a straight cylindrical tube , and this machining is easier than formation of the prior art exterior shown in fig2 . not only is there a saving of materials , but also productivity may be increased by this machining process . the circlip thus formed by displacing axially the inner circumferential portion relative to the outer circumferential portion may be applied not only to ball valves , but also to other technical fields . fig1 is a sectional view of a ball valve according to another embodiment of the present invention . in this embodiment , the parts similar and corresponding to those used in the previous embodiment are denoted by the same reference numerals . what is of particular note is circlips 58 , 59 , which are , unlike the previous circlips 28 , 29 , conventional and are not deformed in the thicknesswise direction . therefore , the force to press the sealing member 26a against the outer circumference of the valve member 24 is achieved by a belleville spring 57 positioned between the sealing member 26a and circlip 58 . thus , tolerances of the valve member 24 and sealing members 26a , 26b are absorbed , and a desired degree of tightness may be achieved . in the aforesaid embodiment , the belleville spring 57 was provided only on one side in the axial direction of the valve body 21 , that is , between the sealing member 26a and circlip 58 . however , belleville springs may be provided on both sides in the axial direction of the valve body 21 , that is , between sealing members 26a , 26b , and circlips 58 , 59 . in a ball valve of such construction for medium to low pressure service , it is preferable that the sealing members 26a , 26b be in line contact with the valve member 24 a radially inner part thereof , so that the air tightness between the valve disc 24 and sealing members 26a , 26b may be improved . the ball valve conforming to the present invention may be used only with medium to low pressure fluid of such a degree that the circlip will not be broken by shearing stresses acting on the circlip . however , by increasing the thickness of the circlip , it also may be used with high pressure fluid . referring next to fig1 , the manufacturing process of the valve member 24 is described below . first a thin disc - shaped steel plate 60 having a desired thickness , as shown in fig1 ( 1 ), is pressed or drawn to a bell - shaped semifinished product 61 as shown in fig1 ( 2 ). the opening end 60a made by the drawing process is cut off to the form shown in fig1 ( 3 ). then , as shown in fig1 ( 4 ), the curved part of the semifinished product 61 is partly blanked to form a fluid passage hole 62 having diameter dl . next , as shown in fig1 ( 5 ), the free ends of the semifinished product 61 are encased in upper and lower cup - shaped molds 64 , 65 , and the entire body is formed spherically . at this time , a fluid passage hole 63 is formed oppositely to the fluid passage hole 62 . the length l of the semifinished product 61 in the axial direction , the vertical direction in fig1 ( 2 ), is determined so that the diameter d2 of the fluid passage hole 63 will be equal to the diameter d1 of the fluid passage hole 62 as shown in fig1 ( 4 ). finally , by machining the fluid passage holes 62 , 63 and valve stem groove 66 and polishing the spherical surface 67 , a seamless valve member 24 is completed as shown in fig1 ( 6 ). in other method , a thin - wall pipe material may be cut to a length of one valve construction , and the valve disc may be manufactured by plastically processing with upper and lower cup - shaped molds . in this embodiment , there is no seam , and although the thickness is small , the strength is high because of the principle of the internal force of hooping . what is more , since rolling material is used , the molecular density of material is high , so that a wear - resistant valve member free of pinholes or cracks may be obtained . fig1 is a sectional view of another embodiment of valve member 24 conforming to the present invention , fig1 is an oblique view of a cylindrical body , and fig1 is an enlarged sectional view showing area xv in fig1 . in this embodiment , a cylindrical body 68 is placed on the valve member 24 . the cylindrical body 68 is curved structure of a single thin steel sheet , and stepped surfaces 69 are formed on the periphery of each opposite end thereof . the stepped surfaces 69 abut against the inner surface of the fluid passage holes 62 , 63 in the valve member 24 due to radially outward resiliency of body 68 , thereby preventing the cylindrical body 68 from slipping off the valve member 24 in axial directions . when the cylindrical body 68 is placed on the valve member 24 , the end - to - end clearance 70 of the cylindrical body 68 should be as small as possible , for example 0 . 1 to 0 . 3 mm . in this embodiment , the ball valve may be applied to fluids of relatively high viscosity or high flow velocity . | 5 |
fig1 is a perspective view of a planar motherboard 20 mounted onto a frame or chassis 22 of a computer using at least one mounting spacer 24 configured in accordance with one embodiment of the invention . as discussed in detail below , an installer may use the mounting spacers 24 to easily and securely mount the motherboard 20 to the chassis 22 without the use of mounting screws . the motherboard 20 is also easily removed from the chassis 22 and the mounting spacers 24 , during repair , upgrade , or maintenance . although described herein in the context of a motherboard 20 and computer chassis 22 , it will be appreciated that the mounting spacer 24 may be used to mount a motherboard 20 , or any other planar object , to any of a wide variety of structures having mounting slots . as shown in fig1 at least one mounting spacer 24 is used to attach the motherboard 20 to the chassis 22 . in particular , a top end 26 of the mounting spacer 24 mates or couples with a mounting hole 30 that extends through the motherboard 20 . the opposite or bottom end 32 ( shown in phantom lines ) of the spacer mates or coupled with a corresponding mounting slot 34 ( fig5 ) in the computer chassis 22 so that the motherboard 20 is separated from the chassis 22 by a distance equal to the height of the mounting spacer 24 . the mounting holes 30 in the motherboard 20 are arranged so that they may be aligned with the mounting slots 34 on the chassis 22 . the motherboard 20 and chassis 22 may be equipped with any number of mounting holes 30 and slots 34 , respectively . as shown in fig1 a grounding pad 36 is positioned around the periphery of each of the mounting holes 30 in the motherboard 20 . the top end 26 of the mounting spacer 24 contacts the grounding pad 36 . the grounding pad 36 functions as an electrical ground for the motherboard 20 in a manner well known to those skilled in the art . toward this end , one embodiment of the mounting spacer 24 is manufactured of an electrically - conductive material to provide an electrical ground connection between the mother board 20 and the chassis 22 . fig2 , and 4 are side , front , and top views , respectively , of one embodiment of the mounting spacer 24 of the invention . as shown , the mounting spacer 24 includes a spacer portion 40 comprising a wall that defines a substantially cylindrical shape and defines a hollow space 42 ( fig4 ) therein . the height and diameter of the spacer portion 40 may be varied to provide various spacing distances between the motherboard 20 and chassis 22 . as best shown in fig2 the mounting spacer 24 further comprises a thin and elongated clip member 44 having a central portion 46 ( shown in phantom ) that extends through the hollow space 42 within the spacer portion 40 . in the illustrated embodiment , the central portion 46 extends substantially parallel to the axis of the spacer portion 40 and is aligned slightly offset from the center axis of the spacer portion 40 . as shown in fig4 one end of the spacer portion 40 curves or coils into the hollow space 42 and integrally forms into the central portion 46 of the clip member . the coiled configuration reduces the likelihood of the mounting spacer 24 twisting during use . with reference to fig2 the clip member 44 further includes an upper clamp or fastener 50 that extends upward from the upper edge of the central portion 46 so as to protrude from the top of the spacer portion 40 . the upper fastener 50 is configured to removably clamp the mounting spacer 24 to the motherboard 20 , as described more fully below . as best shown in fig2 the upper fastener 50 includes a first bend 52 which defines a first arm 54 of the upper fastener 50 that is oriented at an angle θ relative to the central portion 46 . the upper fastener 50 further includes a second bend 56 that defines a second arm 60 that extends downwardly toward the spacer portion 40 substantially parallel to the central portion 46 . the second arm 60 has a lower tip 62 that is positioned flush against the peripheral upper edge of the spacer portion 40 . in one embodiment , the upper fastener 50 is biased or spring loaded so that the lower tip 62 of the second arm 60 is urged to press against the upper edge of the spacer portion 40 . in the illustrated embodiment , the second arm 60 is also bent at the lower tip 62 to provide the lower tip 62 with a rounded edge . as shown in fig2 the clip member 44 further includes a lower clamp or fastener 64 that extends downwardly from the bottom edge of the central portion 46 . the lower fastener 64 is configured to removably clamp the mounting spacer 24 to the computer chassis 22 , as described more fully below . the lower fastener 64 includes a first bend 66 which forms a first arm 70 that terminates at a tip 72 extending beyond the periphery of the spacer portion 40 . the first arm 70 of the lower fastener 64 is oriented at an angle α relative to the central portion 46 . the first arm 70 is biased or spring loaded toward the spacer portion 40 . thus , when the first arm 70 is pulled away from the spacer portion 40 , it automatically springs back toward the spacer portion 40 and assumes its natural orientation , as shown in fig2 . as shown in fig3 the width of the upper fastener 50 is slightly less than the width of the lower fastener 64 . however , it will be appreciated that the sizes of the upper and lower fasteners 50 and 64 , respectively , may be varied to fit within various mounting holes 30 and mounting slots 34 in a motherboard 20 and in a computer chassis 22 . in one embodiment , the mounting slots 34 slots have dimensions of 0 . 03 ″× 0 . 19 ″. exemplary dimensions of one embodiment of the mounting spacer 24 are as follows . the width of the lower fastener 64 is approximately 0 . 17 inches and the width of the upper fastener 50 is approximately 0 . 08 inches . referring to fig2 the first bend 52 of the upper fastener 50 is spaced approximately 0 . 07 inches from the upper edge of the spacer portion 40 . the angle θ of the first arm 54 of the upper fastener 50 is approximately 42 °. additionally , the length of the first arm 54 of the upper fastener 50 is approximately 0 . 22 inches and the length of the second arm 56 of the upper fastener 50 is approximately 0 . 20 inches . regarding the lower fastener 64 , the angle a is approximately 68 °. the first bend 66 in the lower fastener 64 is spaced approximately 0 . 10 inches from the lower edge of the spacer portion 40 . the length of the first arm 70 of the lower fastener 64 is approximately 0 . 26 inches . the foregoing dimensions have been found to provide secure fastening characteristics when the mounting spacer 24 is attached to a computer chassis 22 and motherboard 20 . however , it will be appreciated that the foregoing dimensions are merely exemplary and that the dimensions of the mounting spacer 24 may be varied based upon the circumstances . fig5 - 9 illustrate the manner in which the mounting spacer 24 is used to mount the motherboard 20 to the chassis 22 . as shown in fig5 an installer first pulls the first arm 70 of the lower fastener 64 away from the spacer portion 40 and then inserts the first arm 70 of the lower fastener 64 through the mounting slot 34 in the chassis 22 . as shown , the mounting spacer 24 is positioned at an angle relative to the plane of the chassis 22 . as shown in fig6 the bias in the first arm 70 forces the mounting spacer 24 to pivot such that it orients substantially vertical relative to the chassis 22 . in this position , the chassis 22 is compressed between the lower fastener 64 and the lower edge of the spacer portion 40 . the mounting spacer 24 is thus secured to the chassis 22 via the lower fastener 64 . it will be appreciated that an installer may easily remove the mounting spacer 24 from the chassis 22 by pulling the lower fastener 64 out of the mounting slot 34 in the chassis 22 . as shown in fig7 the installer may then mount the motherboard 20 to the mounting spacer 24 . the installer first inserts the second bend 56 of the upper fastener 50 into the mounting hole 30 of the motherboard 20 . as shown in fig8 the installer then presses the motherboard 20 downward onto the mounting spacer 24 so that the first and second arms 54 and 60 of the upper fastener 50 are compressed toward each other . when so pressed , the first and second arms 54 and 60 are oriented such that the lower tip 62 of the second arm 60 rises relative to the spacer portion 40 , thereby creating a gap 74 between the lower tip 62 of the second arm 60 and the upper edge of the spacer portion 40 . as shown in fig9 the installer then continues to push the motherboard 20 downward until the lower tip 62 of the second arm 60 exits the mounting hole 30 . at this point the second arm 60 springs to its natural orientation and the motherboard 20 is positioned within the gap 74 . the motherboard 20 is thus compressed between the lower tip 62 of the upper fastener 50 and the mounting spacer 24 . in this manner , the mounting spacer 24 securely retains the motherboard 20 in connection with the computer chassis 22 . the motherboard 20 may be easily and quickly removed by reversing the previously - described steps . fig1 shows a flat material blank 76 that may be used to form the mounting spacer 24 . the material blank 76 includes a main section 80 and two protrusions 82 . prior to use , the main section 80 is rolled into the shape of a cylinder to form the spacer portion 40 of the mounting spacer 24 . the protrusions 82 are then folded at the broken fold lines to form the upper and lower fasteners 50 and 64 . the mounting spacer 24 is preferably manufactured of an electrically - conductive material so that the mounting spacer 24 may be used as an electrical ground . the mounting spacer 24 may thus be used to easily and securely mount a motherboard 20 to a computer chassis 22 . the mounting spacer 24 eliminates the need for screws and also provides an electrical ground interface for the motherboard 20 . it will be appreciated that the mounting spacer 24 may be used with an existing motherboard and computer chassis without the need for modifications to the motherboard or chassis . hence , although the foregoing description of the invention has shown , described , and pointed out fundamental novel features of the invention , it will be understood that various omissions , substitutions , and changes in the form of the detail of the apparatus and method as illustrated as well as the uses thereof , may be made by those skilled in the art without departing from the spirit of the invention . consequently , the scope of the invention should not be limited to the foregoing discussion , but should be defined by the appended claims . | 8 |
the adobe flash system includes a visual development environment that saves and works with flash programs in their “ source code ” format , which is a proprietary binary - formatted fla file . when a flash movie or game is distributed to end users , the flash development environment “ publishes ” the service into an executable form . this executable form of flash service is a proprietary binary - formatted swf file containing bytecode instructions and data that completely specify the execution of the service . the flash player is the run - time environment that is responsible for interpreting and executing the bytecode and data in the swf file . swf files contain a series of tags that describe the visual elements and sounds used in the game , along with their movements and transformations . in addition to these tags , the developer of the game can include logic written in the actionscript scripting language . during the publishing process , this actionscript logic is transformed from its textual representation to a bytecode representation in the swf file . while not a completely reversible process , it is possible however to re - interpret this bytecode representation such that the original actionscript that produced it is approximated sufficiently to allow its modification using a service or advertisement insertion tool . to demonstrate the operation of a representative embodiment , a set of commercially available online swf game files from well known game development studios were used . these swf game files were obtained either directly from the game development studio itself or from a publisher of the game . in all cases , the games were the standard issue as would be given to any and all publishers of the game . fig1 is a flow diagram illustrating operations performed by an advertising delivery system in accordance with a representative embodiment . additional , fewer , or different operations may be performed in alternative embodiments . in a representative embodiment , the delivery system allows for the insertion of a service that causes a presentation of advertisements within a flash program . in an alternative embodiment , the inserted service may cause a presentation of other content such as a survey or information regarding rival players or may cause an extraction of player achievement data . in an operation 10 , a service insertion tool loads a swf program file such as a swf file for a game . in an operation 12 , the service insertion tool modifies each function within the swf game file by inserting a small portion of bytecode at the beginning of each function body . a function includes logic designated to cause the execution of various tasks by the flash program . the functions can be defined by specific flash bytecode instructions such as definefunction , definefunction2 for actionscript 2 . 0 , or abcmethod table for actionscript 3 . 0 . the inserted bytecode creates a run - time output of a string that uniquely identifies the respective function within the swf game file . in an operation 14 , the game is played and the service insertion tool collects the run - time string outputs as the game is played . the service insertion tool uses the run - time string outputs to map the use of the functions throughout execution of the swf game file . in this way , the service insertion tool can identify what functions are being utilized at varying points in the game . in an operation 16 , the service insertion tool receives an input from a technician indicating that the next action or input from the technician is to be a trigger for an advertisement or other type of content . in an operation 18 , the service insertion tool receives a second input from the technician designating a frame or spot within the game where an advertisement or other content is to be triggered . such a frame or spot may include the end of a level , the end of the game , or another spot within the game where the game is inactive and awaiting a user input . in an illustrative embodiment , the input may be a selection of a next level button or start new game button by the technician . in an operation 20 , the service insertion tool identifies the first function executed in the swf game file as a result of the input received from the technician designating the advertisement trigger . the service insertion tool identifies the first function based on the run - time string outputs and the mapped function use of the swf file . the first function is a handler for the flash object that represents the input received from the technician indicating the advertisement trigger . for example , the first function may be the handler for the flash object representing a “ next level ” or “ play again ” button selected by the technician as the advertisement trigger . this handler function contains flash bytecode that causes execution of the game to resume at an appropriate point , such as when a user selects the “ next level ” or “ play again ” button . in an operation 22 , the bytecode of the first function is modified to include additional logic that when executed causes a selected advertisement or other content to be presented in response to an occurrence of the designated advertisement trigger . at the conclusion of the advertisement , the handler function executes its original bytecode logic so that the game is resumed again at the appropriate point after termination of the advertisement . in an operation 24 , the original swf game file is transformed into a new enhanced swf game file . as such , the modified bytecode of the functions used to cause the presentation of the advertisements is inserted into a new enhanced swf game file along with the remaining unchanged portions of the original swf game file . in an operation 26 , the service insertion tool plays the game again allowing the technician to verify that the advertisement or other content is triggered and displayed as expected and that the game otherwise functions properly . the service insertion tool allows a technician without specialized skill or knowledge in flash programming or other types of programming to easily and efficiently insert a service that causes content such as advertisements to be presented in a flash game . the service insertion tool also allows the enhanced swf game file to be easily and quickly re - configured if and when the service insertion tool and original swf game file are updated . according to a representative embodiment , when the transformation is applied , only those elements of the game swf that have modified functions are transformed in any way . the remaining elements of the swf file are not modified . when the enhanced game swf file is produced , those non - transformed elements of the swf file are written to the enhanced game swf file with exactly the same byte sequence as in the original game swf file . thus , any elements of the swf file that are not involved in the transformation are guaranteed immutable and not subject to faulty interpretation and modification in the enhanced game swf . later , when the game is played by a game player content may be presented in response to an occurrence of the selected content triggers based on an established service policy . a service policy may be downloaded at the start of the game from a service policy server or may be alternatively communicated to the enhanced game swf file . the service policy contains instructions as to what content will be presented , when the content will be presented , and how the content will be presented . the following further describes the service insertion tool and process used to transform a swf - based game into a new enhanced swf file that contains additional logic to display content such as video advertisements at appropriate points during game play as well as triggering events containing player achievement information that can be used by the hosting container ( e . g . a website ) to enable community based features . fig2 illustrates components in a representative service insertion tool 28 . service insertion tool 28 includes a gui - based viewer 32 and a processor 34 . an original swf file 30 is inputted into service insertion tool 28 . original swf file 30 includes all logic necessary to execute the corresponding flash program or game . original swf file 30 is loaded into service insertion tool 28 . viewer 32 displays the running flash program or game and presents a user interface that allows a technician to interact with the game . viewer 32 is further configured to receive inputs from the technician . processor 34 is programmed to analyze the bytecode instructions contained in original swf file 30 , process inputs received from the technician , and implement modifications to the original swf file 30 to cause content such as advertisements to be presented . processor 34 may implement modifications by inserting pre - defined blocks of logic that handle initialization of data structures and execution of a service that causes content such as preroll and interstitial advertisements to be presented . service insertion tool 28 produces an enhanced swf file 36 . enhanced swf file 36 includes the logic modified to insert a service that causes content and advertisements to be presented and any original logic that was unmodified during the service insertion process . fig3 illustrates a representative gui ( graphical user interface ) 40 . gui 40 includes sections 42 , 44 , 46 , and 48 . section 42 includes a panel showing the game running in an instance of the flash player . the flash game in section 42 is interactive and can be played . within section 42 is an ad insertion button 43 . selection of ad insertion button 43 indicates that the next action or input from the technician is to designate a trigger for an advertisement or other type of content . section 44 provides a visual representation of the properties in the header of the flash program at the top and below a hierarchical representation of all the bytecode contained in the file . the bytecode is divided into a series of frames , each containing a hierarchical set of tags . while the game is being played , the frame number that is active may be highlighted in section 44 . section 46 may include the function currently be executed as the game is played as well as a list of past functions that were previously executed . modifications to the swf file can cause presentation of a pre - roll advertisement ( e . g ., a video ad displayed during the initialization sequence for the game ), presentation of an interstitial advertisement ( e . g ., a recurring video advertisement displayed during a natural breaking point in the game , such as between levels ), and , at various points during game play , extraction of the user &# 39 ; s score and generation of an event that is passed out from the flash game to a website . to play an advertisement , the technician identifies a point where the flash game playback can be paused while a video advertisement is shown . after a selection of ad insertion button 43 , the next action or input from the technician received by the tool signifies a trigger for an advertisement . the service insertion tool determines the first function executed after this action or input from the technician and modifies this function to play an advertisement prior to resuming the game . fig4 shows a representative graphical user interface after selection of a trigger . in an embodiment , after the action or input from the technician identifying the trigger , the service insertion tool may present a window 50 providing several possible functions to serve as triggers for the advertisement . as such , the service insertion tool may receive a selection of the precise function to serve as the trigger from the technician . fig5 shows a representative graphical user interface prior to selection of a function that starts a new game . an appropriate place to show a preroll advertisement is immediately before invoking this function . therefore , the technician can select this as the point to insert the preroll advertisement and a pre - defined block of logic that plays an advertisement is inserted prior to this function by the service insertion tool . the function is modified such that logic to play an advertisement is inserted ahead this function call . when the advertisement is done , the advertisement playing logic invokes the function that starts the next level . similarly , the technician may identify a point in game play that occurs at a natural breaking point , such as between levels of a game . fig6 shows a representative graphical user interface after completion of a level of the game . the technician may submit an input designating a trigger for the advertisement ( i . e ., selection of a next level button ). the service insertion tool identifies a block of logic within the game swf file that is executed at each of these break points , and selects a function ahead of which the logic for displaying an advertisement is inserted . for extracting and exposing player achievement information , the service insertion tool identifies the variable ( s ) within the swf game logic that store the player &# 39 ; s score , current level , and other items of interest . once these variables are identified , the service insertion tool inserts logic into the game swf to trigger an event that passes the value of this variable out to the container that is hosting the game swf . in most cases , this event is exposed to the javascript in the web page that is hosting the flash player object . at the end of the process described above , the technician and service insertion tool have produced an enhanced game swf file . the output of the service insertion tool is the enhanced game swf file in which the user experience of the game remains identical to the original with the exception of the addition of a service that may cause video advertisements to be presented at specific points during game play . this enhanced game swf file is saved and can be packaged and distributed in the same manner as the original game . because the advertisement display logic is built right into the swf game file itself , even if unauthorized websites obtain and host this modified game , they will also display advertisements and the advertisement revenue will flow to the company that originally hosted the enhanced game swf . this scenario is in contrast to the traditional model of generating advertising revenue for hosted flash games in which the swf game file itself contains no advertisement display logic . in this case , advertisements are displayed by the html page that surrounds the flash player object that is executing the game . in this case , any unauthorized capture and hosting of the game swf file will enable an unauthorized website to host the game without any advertising revenue going to the company that originally hosted the game swf . in another representative embodiment , a pre - roll advertisement is added automatically without involvement of a technician . automatic addition of a pre - roll advertisement includes the addition of preroll advertisement delivery bytecode logic at the beginning of a computer program , such as a game , prior to any of the game bytecode being executed . in some cases , adding a bytecode requires the creation of a new frame on the main flash timeline . in other cases , such an addition requires reordering of existing frames on the timeline and / or scanning all the bytecode within the file to adjust any references within the bytecode to absolute frame numbers , which are changed as a result of the addition of a new frame for the preroll advertisement at the beginning of the swf . in yet another representative embodiment , a beaconing service is included with the flash game that does not require a technician to examine the game and define the transformation operation . fig7 illustrates a beaconing operation in which a message is sent from a computer 72 on which the game is played to a server 74 via a network 76 . the message provides information regarding the game session durations while the game is being played . as such , the server 74 can receive information on the length of each game play session . without such messaging , an operator of a flash gaming website cannot determine how long each game play session lasts because after the game swf is loaded onto the webpage and starts executing , it typically no longer makes any contact with the server . without the beacon messages , the website operator does not know at what point the user closes the browser window or navigates away from the page hosting the game swf to another page . with the beaconing messages added to the game , the website operator knows , subject to the frequency of the messages , how long the user &# 39 ; s game session lasts . it is important to understand that any of the embodiments described herein may be implemented as computer - readable instructions stored on a computer - readable medium . upon execution by a processor , the computer - readable instructions can cause a computing device to perform operations to implement any of the embodiments described herein . for example , in an embodiment , the service insertion tool may be stored on a memory of a computer as a computer - readable medium . the memory may be operatively connected to a cpu which may process the computer - readable medium thereby running the service insertion tool . in addition , the cpu and the memory may be connected to a display which is configured to present visual representations of the service insertion tool . the foregoing description has been presented for purposes of illustration and of description . it is not intended to be exhaustive or limiting with respect to the precise form disclosed , and modifications and variations are possible in light of the above teachings or may be acquired from practice of the disclosed embodiments . | 0 |
fig1 is a schematic illustration of a vehicle steering apparatus of construction according to a first embodiment of the invention . fig2 is a top plane view of a housing according to this embodiment , and fig3 is a sectional view depicting mounting of the housing according to this embodiment . the steering apparatus of this embodiment employs a steer - by - wire system . as shown in fig1 – 3 , the apparatus comprises a housing 1 having mounting portions 12 – 15 of which the fastener portions at two out of four locations are fastened to a body 9 via rubber mounts 5 , 5 ( including rubber elastic bodies 53 ); a steering shaft 2 one end of which is rotatably retained within the housing 1 ; an operating member which is a steering wheel 3 fastened to the other end of the steering shaft 2 that projects from the housing 1 ; and a control portion 4 electrically connected to a sensor 41 that senses a manipulated variable of the steering wheel 3 , for controlling steering of the wheels ( not shown ) in response to operation of the steering wheel 3 . the housing 1 is of cylindrical shape closed at both ends , by means of a lid or the like ( not specifically illustrated ), and is provided in the center portion of its wall at one end by a circular hole 11 through which the steering shaft 2 is passed . on the wall at the other end of the housing 1 are integrally formed four mounting portions 12 - 15 that project diametrically outward from the outer peripheral face . for reasons related to mounting location on the body 9 , the two mounting portions 12 , 13 situated at the upper side of the housing 1 are formed so as to be longer than the two mounting portions 14 , 15 disposed on the lower side , and are somewhat lower in rigidity than the two mounting portions 14 , 15 . the locations on the body 9 at which the two mounting portions 12 , 13 are fastened are somewhat lower in rigidity than the locations on the body 9 at which the other two mounting portions 14 , 15 are fastened . at the distal ends of the longer mounting portions 12 , 12 are disposed mounting holes 12 a , 13 a perforating them in the thickness direction ( axial direction of housing 1 ), with the rubber mounts 5 , 5 being installed press - fit into these mounting holes 12 a , 13 a . the rubber mounts 5 , 5 have round cylindrical rubber elastic bodies 53 , 53 interposed between inner cylinder fittings 51 , 52 and outer cylinder fittings 52 , 52 in such a way as to integrally link the two fittings 51 , 52 . as shown in fig3 , the mounting portions 12 , 13 are each fixed by fitting the bore of the inner cylinder fitting 51 of the rubber mount 5 onto a bolt shaft 91 projecting from a predetermined area of the body 9 , and then clamping the two end faces of the inner cylinder fitting 51 , 51 with a nut 92 threaded onto the distal end of the bolt shaft 91 . at the distal ends of the mounting portions 14 , 15 , on the other hand , there are disposed through - holes 14 a , 15 a through which a mounting bolt 93 is passed . however , no rubber mounts or the like are installed in these through - holes 14 a , 15 a . thus , the mounting portions 12 , 13 are each fixed by fitting a metal seating 95 onto a bolt shaft 93 projecting from a predetermined area of the body 9 , then fitting on the through - hole 14 a , 15 a , and clamping the two faces of the mounting portion 14 , 15 with a nut 94 threaded onto the distal end of the bolt shaft 93 . the steering shaft 2 is disposed in a generally coaxial arrangement with the housing 1 , with one end thereof rotatably retained by a bearing 21 disposed within the housing 1 . the other end of the steering shaft 2 projects to the exterior of the housing 1 through the circular hole 11 . the steering wheel 3 has a boss portion ( not shown ) situated in the center , and an annular grip portion 31 linked to the boss portion by a number of spokes ( not shown ) extending radially outward from the boss portion . this steering wheel 3 is connected by means of fastening the boss portion to the other end of the steering shaft 2 which projects out from the housing 1 , with the turning axes of the steering wheel 3 and the steering shaft 2 being coaxial . with this arrangement , it is possible to turn the steering wheel 3 together with the steering shaft 2 , about the turning axis of the steering shaft 2 . the control portion 4 incorporates an electronic control unit ( ecu ) installed on - board the vehicle . this control portion is electrically connected by means of wiring to a sensor 41 ( e . g . a sensor for detecting turning of the steering wheel ) installed within the housing 1 and to an actuator 42 ( e . g ., a reaction actuator for generating reactive force in order to impart reactive force in response to turning of the steering wheel 3 ). this control portion 4 is also electrically connected by means of wiring to an actuator 45 that steers the wheels ( e . g . a steering actuator that generates steering force in order to steer the wheels ) and to a sensor 46 for sensing steering of the wheels . by means of this arrangement the control portion 4 sends control signals to the actuators 42 , 45 on the basis of sensor signals sent to it by the sensors 41 , 46 , and controls steering of the wheels in correspondence with turning of the steering wheel 3 . the steering apparatus of this embodiment with the arrangement described above is elastically supported with the fastener portions of two mounting portions 12 , 13 of the housing 1 fastened onto the body 9 via rubber mounts 5 , 5 ( rubber elastic bodies 53 , 53 ), whereby transmission of unpleasant noise and vibratoin from the body 9 side to the steering wheel 3 via the mounting portions 12 , 13 of the housing 1 can be effectively reduced . also , in this embodiment , of the four mounting portions 12 – 15 , the rubber mounts 5 , 5 are installed selectively on the two mounting portions 12 , 13 having greater length and lower rigidity , and those rubber mounts 5 , 5 are selectively situated at areas that , of the areas of the body 9 where the mounting portions 12 – 15 are fastened , have the lowest rigidity , whereby transmission of unpleasant noise vibration from the body 9 side to the steering wheel 3 can be effectively reduced . referring next to fig4 , there is schematically illustrated a vehicle steering apparatus of construction according to a second embodiment of the invention . fig5 is a plan view of the housing according to the embodiment . fig6 is a sectional of the rubber mount according to the embodiment . fig7 is a sectional view depicting mounting of the housing according to the embodiment . the steering apparatus of this embodiment employs a steer - by - wire system . as shown in fig4 , the apparatus comprises a housing 7 having mounting portions 72 – 75 whose fastener portions at all four locations are fastened to the body 9 via rubber mounts ( including rubber elastic bodies ) 8 . a steering shaft 2 one end of which is rotatably retained within the housing 7 , an operating member which is a steering wheel 3 fastened to the other end of the steering shaft 2 that projects from the housing 1 , and a control portion 4 electrically connected to a sensor 41 that senses a manipulated variable of the steering wheel 3 , for controlling steering of the wheels ( not shown ) in response to operation of the steering wheel 3 . the apparatus of this embodiment differs from the apparatus of embodiment 1 in terms of the arrangement and installation method of the mounting portions 72 – 75 of the housing 7 , but the basic arrangement of the steering shaft 2 , steering wheel 3 , and control portion 4 are the same . accordingly , components in common with the apparatus of the first embodiment are assigned identical symbols and will not be described in detail , focusing instead on the points of differences in the following description . the housing 7 is of cylindrical shape closed at both ends by means of a lid or the like ( not specifically illustrated ), and is provided in the center portion of its wall at one end by a circular hole 71 through which the steering shaft 2 is passed . on the wall at the other end of the housing 7 are integrally formed four mounting portions 72 – 75 that project diametrically outward from the outer peripheral face . the mounting portions 72 – 75 are of the same size and same length . at the distal ends of the mounting portions 72 – 75 are disposed mounting holes 72 a – 75 a perforating them in the thickness direction ( axial direction of housing 7 ), with rubber mounts 8 being installed press - fit into these mounting holes 72 a – 75 a . as shown in fig6 , the rubber mount 8 has an inner cylinder fitting 81 , an outer cylinder fitting 82 disposed coaxially to the outside of the inner cylinder fitting 81 , a rubber elastic body 83 interposed between the inner cylinder fitting 81 and the outer cylinder fitting 82 integrally linking the two fittings 81 , 82 , and a pair of constraining fittings 84 , 84 embedded in the rubber elastic body 83 . at axis - symmetric locations to either side of the inner cylinder fitting 81 of the rubber elastic body 83 are formed a pair of through - holes 83 a , 83 a of generally arcuate cross section penetrating through in the axial direction , whereby the spring constant in the direction of opposition of the pair of through - holes 83 a , 83 a ( direction indicated by arrow b in fig6 ) is adjusted to a lower level . the pair of constraining fittings 84 , 84 are embedded at locations phase - shifted by 90 ° from the pair of through - holes 83 a , 83 a of the rubber elastic body 83 , whereby the spring constant in the direction of opposition of the pair of constraining fittings 84 , 84 ( direction indicated by arrow a in fig6 ) is adjusted to a higher level , in comparison with the direction as shown in fig5 , the rubber mounts 8 are installed in the mounting holes 72 a – 75 a such that the pair of constraining fittings 84 , 84 are positioned along the direction of turning of the steering wheel 3 ( direction indicated by arrow a ), whereby each mounting is imparted with high spring constant in the direction of turning of the steering wheel 3 . that is , the rubber mounts 8 will exhibit an overall spring constant in the turning direction of the steering wheel 3 that is highest among overall spring constants in every axis - perpendicular directions of the turning axis of the steering wheel 3 . in this embodiment , with the mounting portions 72 - 75 installed on the body 9 , spring constant in the vertical direction of each rubber elastic body 83 or an overall spring constant of the rubber elastic bodies 83 in the vertical direction of the vehicle , is about one - half or less the spring constant in the direction of turning of the steering wheel 3 . in this way , as shown in fig7 , the mounting portions 72 – 75 having the rubber mounts 8 installed therein are fastened to the body 9 by fitting the bore of the inner cylinder fitting 81 of the rubber mount 8 onto a bolt shaft 91 projecting from a predetermined area of the body 9 , and then clamping the two end faces of the inner cylinder fitting 81 with a nut 92 threaded onto the distal end of the bolt shaft 91 . with this arrangement , as shown in fig8 , the fastener portions of the mounting portions 72 – 75 ( based on the center location of each rubber mount 8 ) are situated within ranges of 20 °– 70 ° and 110 °– 160 ° ( the hatched portions in fig8 ) from a horizontal axis p in the clockwise direction about the turning axis o of the steering wheel 3 . the fastener portions of the mounting portions 72 – 75 ( based on the center location of each rubber mount 8 ) are also situated outwardly from the circle of rotation described by the grip portion 31 during turning of the steering wheel 3 , with respect the axis of turning of the steering wheel 3 ( see fig4 ). in this embodiment , since the mounting portions 72 – 75 are formed with identical size and identical length , the fastener portions of the mounting portions 72 – 75 are situated equidistant from the turning axis o of the steering wheel 3 . additionally , since the rubber mounts 8 installed in the mounting holes 72 a – 75 a of the mounting portions 72 – 75 employ the same arrangement , the rubber elastic bodies 83 have the same spring constant in the direction of turning of the steering wheel 3 . the steering apparatus of this embodiment with the arrangement described above is elastically supported with the fastener portions at all locations of the mounting portions 72 – 75 of the housing 7 fastened onto the body 9 via the rubber mounts 8 , and the rubber mounts 8 are disposed such that spring constant is high in the direction of turning of the steering wheel 3 . thus , the driver is afforded good operating feel , and transmission of unpleasant noise vibration from the body 9 side to the steering wheel 3 via the mounting portions 72 – 75 of the housing 7 can be effectively reduced . in particular , in this embodiment , since the rubber mounts 8 are arranged such that the spring constant in the vertical direction of the vehicle is about one - half or less the spring constant in the direction of turning of the steering wheel 3 , good operating feel and good reduction of noise vibration can be assured . additionally , in this embodiment , since the fastener portions of the mounting portions 72 – 75 are situated outwardly from the circle of rotation described by the grip portion 31 during turning of the steering wheel 3 , with respect the axis of turning of the steering wheel 3 , higher rigidity in the direction of turning of the steering wheel 3 can be readily assured . further , since the fastener portions of the mounting portions 72 – 75 are situated within ranges of 20 °– 70 ° and 110 °– 160 ° from a horizontal axis p in the clockwise direction about the turning axis o of the steering wheel 3 , stiffer rigidity is provided in the direction of turning of the steering wheel 3 and operating feel is improved , as well as providing softer rigidity in the vehicle vertical direction and lateral direction so as to be able to better reduce noise vibration . yet further , since the fastener portions of the mounting portions 72 – 75 are situated equidistant from the turning axis o of the steering wheel 3 , and the rubber elastic bodies 83 have the same spring constant in the direction of turning of the steering wheel 3 , the occurrence of translational motion of the steering wheel 3 ( steering apparatus ), which can bring discomfort to the driver , can be prevented consistently . it is also to be understood that the present invention may be embodied with various other changes , modifications and improvements , which may occur to those skilled in the art , without departing from the spirit and scope of the invention defined in the following claims . | 1 |
a synchronous semiconductor memory device embodying the invention will now be described with reference to the attached drawings , in which like elements are indicated by like reference characters . elements not relevant to the invention are omitted from the drawings . signals and the signal lines on which they are carried will be identified by the same reference numerals . referring to fig4 , like the conventional synchronous semiconductor memory device 500 , the invented synchronous semiconductor memory device 10 operates in accordance with a clock signal 102 , a read signal 108 , and a column address signal 110 . the clock signal 102 is supplied from an external source , and is used to synchronize all operations of the synchronous semiconductor memory device 10 . the read signal 108 , which is high during read operations and low during write operations , is typically generated from external command input signals . the column address signal 110 is generated from an external address input signal . the synchronous semiconductor memory device 10 has a timing control delay circuit 12 and a column control clock generator 14 that receive the clock signal 102 and generate a column control clock signal 106 . a column address predecoder 16 and a column address decoder 18 decode the column address signal 110 to select a column in a memory cell array 22 . a column selection line driver 20 in the column address decoder 18 drives a pair of column selection signals 114 , 116 to connect the selected column to a pair of read data bus lines ( rdb , rdbb ) and a pair of write data bus lines ( wdb , wdbb ). data bus lines rdbb and wdbb carry data complementary to the data on data bus lines rdb and wdb . a data bus equalization controller 24 , a read data bus equalizer 26 , and a write data bus equalizer 28 equalize the bus lines . a read amplifier controller 30 and read amplifier 32 amplify data read onto the read data bus lines . the read data bus equalizer 26 and read amplifier 32 are interconnected through a buffer 34 . a write driver controller 36 and a write driver 38 write data into the memory cell array 22 through the write data bus lines . a particular feature of this embodiment is that the column control clock generator 14 receives the read amplifier control signal 126 output by the read amplifier controller 30 . another feature is that the read amplifier outputs an amplification completion signal 128 , and the read data bus equalizer 26 receives this signal through the buffer 34 . there is a separate pair of column selection signals 114 , 116 for each column in the memory cell array 22 , there may be a plurality of pairs of read data bus lines rdb , rdbb and write data bus lines wdb , wdbb , and the memory cell array 22 may be divided into a plurality of banks , but for simplicity , only one pair of column selection signals 114 and 116 , one pair of read data bus lines , one pair of write data bus lines , and one memory bank are shown in fig4 . the circuit blocks in fig4 will now be described in more detail . the timing adjustment delay circuit 12 delays the clock signal 102 for a certain time to generate a delayed clock signal 104 . the timing adjustment delay circuit 12 may comprise , for example , a delay locked loop or a phase locked loop . the column control clock generator 14 generates the column control clock signal 106 in response to the clock signal 102 , the delayed clock signal 104 , and the read amplifier control signal 126 . the column control clock signal 106 is supplied to the column address decoder 18 , the data bus equalization controller 24 , the read amplifier controller 30 , and the write driver controller 36 . as shown in fig5 , in the column control clock generator 14 , the delayed clock signal 104 is processed by a timing adjustment delay circuit 202 and a one - shot pulse generator 204 , the clock signal 102 by a timing adjustment delay circuit 206 and a one - shot pulse generator 208 , and the read amplifier control signal 126 by a timing adjustment delay circuit 210 and a one - shot pulse generator 212 . the timing adjustment delay circuits 202 , 206 , and 210 adjust the delayed clock signal 104 , clock signal 102 , and read amplifier control signal 126 to desired timings and output the adjusted signals to the one - shot pulse generators 204 , 208 , and 212 . triggered by the rising edges of the adjusted signals , the one - shot pulse generators 204 , 208 , and 212 output one - shot low - going pulse signals to a set - reset ( rs ) flip - flop 214 . the rs flip - flop 214 operates in response to these one - shot pulse signals to generate the column control clock signal 106 , which is output through a cascaded pair of inverters 216 , 218 . one - shot pulse generator 204 comprises a buffer 220 , an inverter 222 , and a two - input nand gate 224 ; one - shot pulse generator 208 comprises a buffer 226 , an inverter 228 , and a two - input nand gate 230 ; one - shot pulse generator 212 comprises a buffer 232 , an inverter 234 , and a two - input nand gate 236 . the rs flip - flop 214 comprises a two - input nand gate 238 cross - coupled with a three - input nand gate 240 . the column control clock signal 106 is obtained from the two - input nand gate 238 . the low - going pulse signal output by one - shot pulse generator 204 is supplied to an input terminal of this nand gate 238 to set the rs flip - flop 214 ; the pulse signals output by one - shot pulse generators 208 and 212 are supplied to input terminals of the three - input nand gate 240 to reset the rs flip - flop 214 . each rising edge of the delayed clock signal 104 drives the column control clock signal 106 from the low logic level to the high logic level . each rising edge of the clock signal 102 and the read amplifier control signal 126 drives the column control clock signal 106 from the high logic level to the low logic level . referring again to fig4 , the column address predecoder 16 decodes the column address signal 110 to generate a predecoded address signal 112 for the column address decoder 18 . the predecoded address signal 112 may include separate address signals for separate columns in the memory cell array 22 . the column address decoder 18 decodes the predecoded address signal 112 and the read signal 108 in synchronization with the column control clock signal 106 to generate column selection signals for selecting the memory cells in the memory cell array 22 . more specifically , the column address decoder 18 generates a read column selection signal 114 by delaying the column control clock signal 106 when the read signal 108 is high , and a write column selection signal 116 by delaying the column control clock signal 106 when the read signal 108 is low . the column selection line driver 20 outputs the column selection signals on the selected read and write column selection lines 114 , 116 . the memory cell array 22 comprises a plurality ( a large number , in general ) of memory cells 40 that store data . for simplicity , only one memory cell is shown in fig4 . the memory cell 40 is connected through a pair of bit lines 118 , 120 to a sense amplifier 42 . the bit lines 118 , 120 are connected through a read column selection gate 44 comprising a pair of n - channel transistors to the read data bus lines rdb , rdbb , and through a write column selection gate 46 comprising another pair of n - channel transistors to the write data bus lines wdb , wdbb . the read column selection gate 44 is controlled by the signal on the read column selection line 114 . when turned on , the read column selection gate 44 sends data read from the memory cell 40 and amplified by the sense amplifier 42 to the pair of read data bus lines rdb , rdbb . the write column selection gate 46 is controlled by the signal on the write column selection line 116 . when turned on , the write column selection gate 46 sends data from the pair of write data bus lines wdb , wdbb to the selected memory cell 40 . the data bus equalization controller 24 generates a read equalization signal 122 and a write equalization signal 124 in delayed synchronization with the column control clock signal 106 and according to the logic level of the read signal 108 . the read equalization signal 122 controls the read data bus equalizer 26 ; the write equalization signal 124 controls the write data bus equalizer 28 . the read data bus equalizer 26 equalizes the potentials on the pair of read data bus lines rdb , rdbb in response to the read equalization signal 122 and an amplification completion signal 130 received from the buffer 34 . equalization starts when both of these signals 122 , 130 are active and continues until the read equalization signal 122 becomes inactive . internal details of the read data bus equalizer 26 will be described later . the write data bus equalizer 28 equalizes the potentials on the pair of write data bus lines wdb , wdbb . equalization starts when the write equalization signal 124 becomes active and ends when the write equalization signal 124 becomes inactive . the read amplifier controller 30 generates the read amplifier control signal 126 in synchronization with the column control clock signal 106 and according to the logic level of the read signal 108 , to control the read amplifier 32 . when the read signal 108 is low , the read amplifier controller 30 leaves the read amplifier control signal 126 at the inactive ( low ) level . when the read signal 108 is high , the read amplifier controller 30 drives the read amplifier control signal 126 to the active ( high ) level at a timing delayed from the rise of the column control clock signal 106 by an amount sufficient to allow the potentials on the read data bus lines rdb and rdbb to diverge , holds the read amplifier control signal 126 at the active level long enough to allow the read amplifier 32 to operate , and then returns the read amplifier control signal 126 to the inactive level . the read amplifier controller 30 also sends the read amplifier control signal 126 to the column control clock generator 14 . the read amplifier 32 amplifies the data ( i . e ., the potential difference ) on the read data bus lines rdb and rdbb , and outputs a pair of amplified read data signals rsaout , rsaoutb . the read amplifier 32 also generates an amplification completion signal 128 that goes high when amplification has proceeded far enough that input of the data from the read data bus lines is no longer required . amplification takes place when the read amplifier control signal 126 is active . referring to fig6 , the read amplifier 32 includes a read sense amplifier 302 , an n - channel transistor 304 , a two - input nand gate 306 , and an inverter 308 . the read sense amplifier 302 detects and amplifies the potential difference between the read data bus lines rdb and rdbb , and outputs the amplified read data signals rsaout , rsaoutb . the read sense amplifier 302 also receives the amplification completion signal 128 , which controls a pair of n - channel transistors ( not shown ) that disconnect the read sense amplifier 302 from the read data bus lines rdb , rdbb when the amplification completion signal 128 is active ( low ). the n - channel transistor 304 receives the read amplifier control signal 126 at its gate terminal . the drain terminal of the n - channel transistor 304 is connected to the read sense amplifier 302 ; the source terminal of the read sense amplifier 302 is connected to ground . the n - channel transistor 304 turns off when the read amplifier control signal 126 is inactive ( low ) and turns on , permitting amplification to proceed in the read sense amplifier 302 , when the read amplifier control signal 126 is active ( high ). the two - input nand gate 306 carries out a nand operation on the pair of amplified output signals , rsaout , rsaoutb . these signals rsaout , rsaoutb are equalized to the power supply level at the start of each read cycle , by an equalization circuit not shown in the drawings , causing the output of the nand gate 306 to go low . when the read sense amplifier 302 detects a potential difference on the read data bus lines rdb , rdbb , one of the output signals rsaout , rsaoutb begins to fall . when this output signal reaches the switching point of the nand gate 306 , the output of the nand gate 306 goes high . the inverter 308 inverts the output of the nand gate 306 to generate the amplification completion signal 128 . the amplification completion signal 128 thus becomes active ( goes low ), disconnecting the read sense amplifier 302 from the read data bus rdb , rdbb , when the amplification process has proceeded to the switching point of nand gate 306 , and returns to the inactive ( high ) level when the output signals rsaout and rsaoutb are equalized at the start of the next read or write cycle . the amplification completion signal 128 is also supplied to the buffer 34 , and is output from the buffer 34 as the amplification completion signal 130 . the amplification completion signal 130 thus becomes active ( low ) when the potentials of the amplified read data signals rsaout , rsaoutb have diverged sufficiently , and remains active until the end of the read cycle . the read data bus equalizer 26 comprises an rs flip - flop 310 , an inverter 312 , and an equalization circuit 314 . the rs flip - flop 310 , which comprises a cross - coupled pair of nand gates 320 , 322 , generates a control signal that controls the equalization circuit 314 . nand gate 320 receives the read equalization signal 122 and outputs the control signal ; nand gate 322 receives the amplification completion signal 130 and a power approbation signal 350 . the power approbation signal 350 is initially low when the power of the synchronous semiconductor memory device 10 is turned on , and goes high when all the power levels in the synchronous semiconductor memory device 10 become stable . accordingly , provided the power levels in the synchronous semiconductor memory device 10 are stable , the rs flip - flop 310 provides the equalization circuit 314 with a control signal that goes low when the read equalization signal 122 is high and the read data have been sufficiently amplified , and goes high when the read equalization signal 122 goes low . the inverter 312 inverts the control signal output from the rs flip - flop 310 to generate a complementary control signal . the equalization circuit 314 comprises p - channel transistors 330 , 332 , 334 controlled by the control signal and n - channel transistors 336 , 338 , 340 controlled by the complementary control signal . the equalization circuit 314 is connected to the power supply potential vcc and equalizes the potential on the read data bus lines rdb and rdbb to the vcc level while the control signal output by the rs flip - flop 310 is low . referring again to fig4 , the write driver controller 36 generates a write driver control signal 132 that controls the write driver 38 in delayed synchronization with the column control clock signal 106 and in response to the logic level of the read signal 108 . the write driver controller 36 holds the write driver control signal 132 at the inactive ( low ) level when the read signal 108 is high . when the read signal 108 is low , the write driver controller 36 drives the write driver control signal 132 to the active ( high ) level at a predetermined delay from each high - to - low transition of the column control clock signal 106 , and to the inactive ( low ) level at a similar delay from each low - to - high transition of the column control clock signal 106 . the write driver 38 sends write data via the pair of write data bus lines wdb , wdbb to the memory cell array 22 . the write driver 38 drives the voltages of the write data bus lines to complementary logic levels to write data in a memory cell 40 when the write driver control signal 132 is in the active ( high ) state . next , the operation of the synchronous semiconductor memory device 10 will be described with reference to the timing diagram in fig7 . the operation is synchronized with the clock signal 102 , which has a cycle time designated t cyc and is driven from low to high at times t1 , t2 , t3 , and t4 . the low - to - high transition of the clock signal 102 at time t1 resets the column control clock signal 106 to the low logic level . the read signal 108 is low , so the synchronous semiconductor memory device 10 begins a write cycle . the column control clock signal 106 and the low read signal 108 are input to the column address decoder 18 , data bus equalization controller 24 and write driver controller 36 , which respond to the fall of the column control clock signal 106 with a predetermined delay as follows at time t5 : the column selection line driver 20 in the column address decoder 18 deactivates the write column selection signal 116 ; the read amplifier 32 deactivates the write driver control signal 132 ; the data bus equalization controller 24 activates the write equalization signal 124 . equalization of the pair of write data bus lines wdb , wdbb now begins . the timing control delay circuit 12 drives the delayed clock signal 104 to the high logic level with a predetermined delay ( dif1 ) from the rise of the clock signal 102 . in the drawing , this delay dif1 coincidentally has a length that causes the delayed clock signal 104 to go high at time t5 , together with the transitions of the write column selection signal 116 , write equalization signal 124 , and write driver control signal 132 . the delayed clock signal 104 has the same cycle time t cyc as the clock signal 102 , and is driven low with the same delay ( dif1 ) from the fall of the clock signal 102 . in the column control clock generator 14 , the rise of delayed clock signal 104 at time t5 sets rs flip - flop 214 , causing the column control clock signal 106 to go high after a slight delay , at time t6 . since the read signal 108 is low , the column address decoder 18 responds to the rise of the column control clock signal 106 at time t6 by selecting a column in the memory cell array 22 and driving the corresponding write column selection signal 116 to the high logic level with the predetermined delay , at time t7 . the high write column selection signal 116 turns on the transistors in the write column selection gate 46 , connecting the pair of write data bus lines wdb , wdbb to a memory cell in the selected column . similarly , the data bus equalization controller 24 reacts to the rise of the column control clock signal 106 at time t6 by dropping the write equalization signal 124 to the low logic level at time t7 , ending the equalization of the write data bus lines wdb , wdbb , and the write driver controller 36 reacts to the rise of the column control clock signal 106 at time t6 by raising the write driver control signal 132 to the high logic level at time t7 . the write driver 38 now drives the pair of write data bus lines wdb , wdbb to complementary logic levels , to write data into the connected memory cell . the clock signal 102 and delayed clock signal 104 go low during this write operation . when the clock signal 102 next goes high at time t2 , the rs flip - flop 214 in the column control clock generator 14 is reset and drives the column control clock signal 106 to the low logic level at time t8 . shortly thereafter , the read signal 108 goes high at time t9 , in response to external command signal input and the rise of the clock signal 102 at time t2 . at time t10 , in response to the fall of the column control clock signal 106 at time t8 , the column address decoder 18 deactivates the write column selection signal 116 , the write driver controller 36 deactivates the write driver control signal 132 , and the data bus equalization controller 24 activates write equalization signal 124 . as a result , the transistors in the write column selection gate 46 are turned off , disconnecting the write data bus lines wdb , wdbb from the memory cell array 22 , the write driver 38 stops driving the write data bus lines , and the write data bus equalizer 28 starts equalizing the write data bus lines . these operations terminate the write cycle . since the read signal 108 is now high , a read cycle begins . the delayed clock signal 104 goes high in response to the rise of the clock signal 102 at time t2 . the rise of the delayed clock signal 104 sets the rs flip - flop 214 in the column control clock generator 14 , so the column control clock signal 106 goes high at time t11 . since the read signal 108 is now high , the column address decoder 18 , data bus equalization controller 24 , and read amplifier controller 30 respond to the rise of the column control clock signal 106 as follows . the column address decoder 18 selects a column in the memory cell array 22 , and the column selection line driver 20 drives the corresponding read column selection signal 114 to the high logic level after a predetermined delay , at time t12 . the high read column selection signal 114 turns on the transistors in the read column selection gate 44 , connecting the read data bus lines rdb , rdbb to a memory cell in the selected column . the data bus equalization controller 24 drives the read equalization signal 122 to the low logic level after the same predetermined delay , at time t12 , ending equalization of the read data bus lines rdb , rdbb . the data stored in the selected memory cell create a slight potential difference on the bit lines 118 , 120 . this potential difference is amplified by the sense amplifier 42 and transferred to the read data bus lines rdb , rdbb . shortly after time t12 the potentials on the read data bus lines rdb , rdbb start to diverge , the potential on one read data bus line remaining high while the potential on the other read data bus line begins to fall , as shown in the drawing . the read amplifier controller 30 drives the read amplifier control signal 126 to the high logic level after a longer predetermined delay , at time t13 . this delay is long enough to allow the potentials on the read data bus lines rdb , rdbb to diverge to levels that can be reliably detected by the read amplifier 32 . the high read amplifier control signal 126 turns on n - channel transistor 304 in the read amplifier 32 , allowing amplification of the read data by the read amplifier 32 to begin . shortly thereafter , the potentials of the amplified output signals rsaout , rsaoutb begin to diverge . since the potentials on the read data bus lines rdb , rdbb have already diverged to a certain extent , the output potentials rsaout , rsaoutb diverge comparatively quickly . the rise of the read amplifier control signal 126 at time t13 also resets the rs flip - flop 214 in the column control clock generator 14 . after a slight delay , the column control clock signal 106 goes low at time t14 . the fall of the column control clock signal 106 at time t14 causes the column address decoder 18 to return the read column selection signal 114 to the low logic level at time t15 , and the data bus equalization controller 24 to drive the read equalization signal 122 to the high logic level at the same time t15 . the delay from time t14 to time t15 is similar to the delay from time t11 to time t12 . the transistors in the read column selection gate 44 are now turned off , disconnecting the read data bus lines rdb , rdbb from the memory cell array 22 . when the potentials of the amplified output signals rsaout , rsaoutb have diverged to the switching point of the two - input nand gate 306 in the read amplifier 32 , the amplification completion signal 128 goes low , disconnecting the read data bus lines rdb , rdbb from the read sense amplifier 302 in the read amplifier 32 , and the amplification completion signal 130 goes low , resetting the rs flip - flop 310 in the read data bus equalizer 26 . in the drawing the high - to - low transition of the amplification completion signal 130 coincidentally occurs at time t15 , together with the transitions of the read column selection signal 114 and read equalization signal 122 , although in practice the high - to - low transition of the read amplifier controller 30 may either precede or follow time t15 . for example , the high - to - low transition of the read amplifier controller 30 might occur at time t16 . in any case , once the read equalization signal 122 is high and the amplification completion signal 130 is low , the read data bus equalizer 26 starts equalizing the read data bus lines rdb , rdbb , which are disconnected from both the memory cell array 22 and the read sense amplifier 302 in the read amplifier 32 . amplification of the read output signals rsaout , rsaoutb continues while the read data bus lines rdb , rdbb are being equalized , one of the output signals rsaout , rsaoutb remaining at the high logic level while the other is brought to the low logic level . output of these logic levels is maintained until the read cycle ends at time t3 . shortly after time t3 , the read output signal lines rsaout , rsaoutb are equalized , and the amplification completion signal 130 returns to the high logic level at time t17 . since the read signal 108 remains high , another read cycle now begins . as equalization of the read data bus lines rdb , rdbb began at time t15 or t16 , well before time t3 , the read data bus equalizer 26 has ample time in which to return both read data bus lines to the high level before the next read cycle begins . the margin m from the time at which the potential difference on the read data bus lines rdb , rdbb is reduced to zero preceding time t3 to the time at which the read column selection signal 114 rises following time t3 should be compared with the non - existent margin at time n in fig3 . the desirable read data bus equalization margin m in fig7 is moreover provided without shortening the interval from time t7 to time t10 during which the write data bus lines are driven . the reason is that whereas the column control clock signal 106 goes high in response to the rise of the delayed clock signal 104 during both read and write cycles , the column control clock signal 106 goes low in response to the rise of the clock signal 102 at the end of a write cycle , but goes low in response to the rise of the read amplifier control signal 126 before the end of a read cycle . this feature enables the present invention to generate a column control clock signal 106 that is suitable for both read and write operations , remaining high for a comparatively long time during write cycles , and a comparatively short time during read cycles . another feature of the embodiment described above is that the amplification completion signals 128 , 130 enable the read amplifier 32 to disconnect itself from the read data bus lines rdb , rdbb as soon as amplification of the output signals rsaout , rsaoutb is completed ( more precisely , as soon as the amplification process becomes reliably self - sustaining ), and enables the equalization of the read data bus lines rdb , rdbb to start as soon as the read data bus is disconnected from both the read amplifier 32 and the memory cell array 22 . this features maximizes the equalization time and provides the largest possible equalization margin m while assuring an adequate amplification time as well . in a variation of the above embodiment , illustrated in fig8 , the amplification completion signal 130 output by the buffer 34 is routed to the data bus equalization controller 24 instead of the read data bus equalizer 26 , and the data bus equalization controller 24 holds the read equalization signal 122 at the inactive level until the amplification completion signal 130 goes low . the structure of the read data bus equalizer 26 can then be simplified by use of a two - input nand gate instead of the three - input nand gate 322 . the power approbation signal 350 may also be input to the data bus equalization controller 24 , enabling a further simplification of the structure of the read data bus equalizer 26 . in another variation , illustrated in fig9 , the read amplifier 32 does not generate an amplification completion signal 128 , the buffer 34 is eliminated , and neither the read data bus equalizer 26 nor the data bus equalization controller 24 receives an amplification completion signal 130 . the read data bus equalizer 26 starts equalizing the read data bus lines rdb , rdbb when the read equalization signal 122 goes high ; equalization ends when the read equalization signal 122 goes low . the read equalization signal 122 may be inverted by an inverter 48 and input to the read amplifier 32 in place of the amplification completion signal 128 , to disconnect the read sense amplifier 302 from the read data bus lines while equalization is in progress . the structure of the read data bus equalizer 26 and read amplifier 32 can then be simplified , but the delay of the rise of the read equalization signal 122 from the fall of the column control clock signal 106 may need to be lengthened to ensure that equalization does not begin until the potential difference on the read data bus lines has been sufficiently amplified . those skilled in the art will recognize that further variations are possible within the scope of the invention , which is defined in the appended claims . | 6 |
embodiments of the cable arm described herein are preferably molded from plastic materials . in this context , “ plastic ” materials include any resinous , thermoset , or thermoplastic materials , including materials that are reinforced or otherwise altered , and which are formed by molding . thus , in one embodiment , nylon with short glass fibers is used to make strong , stiff , and environmentally - resistant rack arms . in the present context , short glass fibers intends glass fibers from about ⅛ ″ ( about 3 mm ) long to about ¼ ″ ( about 6 mm ) long . long glass fibers , from about 3 / 16 ″ ( about 5 mm ) to about ⅜ ″ ( about 10 mm ) may be used instead . other embodiments may use less costly materials , such as polyethylene or polypropylene , for applications in which not as much strength is required . the plastic materials may also include particulate fillers , such as aluminum oxide or calcium carbonate , or any other filler useful in plastics molding . glass fibers with diameters from about 0 . 009 mm ( 0 . 00035 in ) to about 0 . 011 mm ( 0 . 00043 in ) may be used for reinforcement . fibers with other diameters may also be used . in addition to cable arms , the stanchions may also be molded from non - metallic materials . stanchions may be injection molded , thermoformed , transfer molded , compression molded , or even pultruded . typical polymers or resins include polyester , such as standard polyester , fire - retardant polyester , vinyl ester and fire - retardant vinyl ester . in addition to a thermoplastic or thermoset resin , the stanchions may include a reinforcement , such as glass fibers . parts that are discretely molded , one at a time , may include chopped or short glass fibers , as mentioned above . these parts or parts that are pultruded may also be made with unidirectional fiberglass roving , continuous strand multidirectional glass fiber mat and stitched woven fiberglass roving . the reinforcements add longitudinal and transverse strength and stiffness . an outer surface veil mat may also be used to add uv resistance and hand - friendliness to the resin - rich surface . if greater strength or stiffness is desired , carbon fiber reinforcement may also be used in addition to or in lieu of glass . in one embodiment , pultruded c - channels are made with about from about 30 to about 40 weight %, e . g ., 33 %, unidirectional fiberglass roving and about 10 to about 25 weight %, e . g ., 17 %, continuous multidirectional glass fiber mat . higher or lower loadings of reinforcement may be used . the mat is believed to especially increase the strength and stiffness of the corners of the pultrusion . in other embodiments , unidirectional roving is stitched together with transverse glass or cotton fibers to form a stitched woven fiberglass roving . the stitching helps to orient and control the roving and make it easier to pull into the tooling . the proportion of the reinforcements may vary within reasonable limits consistent with the desired strength and stiffness , e . g ., from about 35 % to 65 %, or even higher . in other embodiments , only the continuous multidirectional glass fiber mat may be used . in still other embodiments , other forms and orientations of reinforcement may be used . all are intended to be within the scope of the present disclosure . a few specific embodiments are discussed below with reference to fig1 - 21a . the pins used to mount the cable rack arms to stanchions may also be molded from plastic materials . the pins are desirably injection molded , but they may also be compression molded , pultruded and / or machined . it will be clear to those with ordinary skill in the art that the pins support a shear load caused by the cable rack arm and the cables loaded onto the arm . accordingly , reinforcements , such as glass fibers , that are longitudinally oriented will be helpful in supporting the load and resisting deformation . this may be achieved by using glass - reinforced plastic materials . the desired orientation may also be achieved by using wider gates in injection molding the pins . it has also been found during experiments that molding the pin with a reservoir , attached to the end of the pin opposite the gate with a small orifice , causes additional plastic flow and helps to orient the fibers during the injection molding process . underground cable racks face several constraints for successful service . one of these constraints is that the stanchions or posts generally include penetrations in both the stanchions and the arms so that the stanchions or posts may be attached to the walls or surfaces of the manholes or other underground installations in which they are placed . if cable rack arms are not integral with the stanchions , there are then more penetrations so that the rack arms may be installed , to hold cables for power or communications . each such penetration may be considered as a stress concentrator , a point in the structure at which stresses will be more likely to cause failure . in molded posts or stanchions , the effects of the stress concentrators may at least be minimized by molding in the penetrations or holes , so that the well - known “ skin - effect ” of plastic materials will apply , lessening the effect of the stress concentration . the skin - effect of as - molded plastics means simply that there is a barrier layer of resin on the surface , resistant to infiltration of water and other contaminants . embodiments of the present invention mold in a number of important features to take advantage of the skin effect and to make the stanchions as useful as possible . embodiments are depicted in fig1 , which depicts an underground cable installation 10 with two stanchions 12 , 14 secured to concrete wall 18 via bolts 16 ( not all bolts visible in fig1 ). the stanchions may be existing metallic stanchions , such as single flange steel stanchion 12 . alternatively , the stanchions may be non - metallic , such as non - metallic c - channel stanchion 14 . in this instance , stanchion 12 is used to mount two cable rack arms 20 and three cable rack arms 30 . cable rack arms 20 have two position places or saddles on the top portion of the rack arm for mounting power or communications cables 19 . cable rack arms 30 each have three position places or saddles on top for mounting the cables . of course , other embodiments may have only a single mount or may have additional mounts , such as an arm with four or five mounts or saddles . further , some applications may require that the top surface of the arm be flat . one advantage of the embodiments depicted herein is that the mounts or saddles are formed integrally with the rack arms themselves . thus , no adapters or additional parts need to be assembled before installing and using the rack arms . as noted , the pins 21 may also be made of plastic material . as also shown in fig1 , stanchion 14 is used to mount two cable rack arms 20 and three cable rack arms 30 . the cable rack arms 20 , 30 used for stanchion 12 are the same cable rack arms 20 , 30 used for stanchion 14 . the cable rack arms are adapted for use with both types of stanchions because they include an interface or mounting adapter portion designed for such multi - stanchion mounting . thus , the cable racks arms described herein are suitable for use in existing facilities with single flange steel stanchions . the single flange steel stanchions have a protruding plane of material that fits into a hollow or interface of the cable rack arm . the cable rack arms are also suitable for use with c - channel - type stanchions , which do not have a flange that protrudes into the cable rack arm . the cable rack arms in these applications mount between the channel flanges , which provide mounting holes for the pins that support the arms . the stanchions may be metallic , e . g ., steel , or may be made from newer , non - metallic materials . the cable rack arms are mounted with pins 21 that are secured with cotter pins 23 . a closer perspective view of the installation is depicted in fig2 , showing cable rack arms 30 . rack arm 30 , on the left , mounted to wall 18 via double - flanged stanchion 12 and wall mount portions 13 , which wall mount portions include holes ( not shown ) for mounting bolts 16 and washers 17 . stanchion 12 itself protrudes into a slot in the back or interface portion of the rack arm , as explained below . an identical rack arm 30 , shown on the right portion of fig2 , is mounted to channel stanchion 14 , which is also bolted to wall 18 in a manner similar to stanchion 12 . channel stanchion 14 has a c - shaped cross section formed by web 14 a and flanges 14 b on either side of web 14 a . rack arm 30 on the right is mounted to channel stanchion 14 via mounting pin 21 , secured with cotter pin 23 . the back or interface portion of both rack arms 30 include mounting holes or orifices for mounting pin 21 so the pin can secure the rack arms to the either of stanchions 12 or 14 . the exploded view of fig3 provides details of the configuration of identical mount arms 30 , enabling mounting to two very different stanchions . cable rack arms 30 each have an upper portion 32 and a lower portion 38 , the upper and lower portions acting as flanges that are connected via central web 31 . the cable rack arm thus has a cross section with a web and flanges , akin to an i - beam or an h - beam , and has increased section modulus and strength . this increased stiffness or strength makes cable installations more stable and reliable . upper portion 32 in this embodiment includes three cable rack saddles or mounts 34 , the mounts separated by upper flat surfaces 36 . lower portion 38 , further described below , is mounted at an acute angle a , less than 90 °, and desirably less than 60 °, to upper portion 32 . the imaginary apex of the angle will be to the left of the mount arms , as also shown in fig3 . in practice , angle a may range from about 10 degrees to about 50 degrees , and desirably from about 15 degrees to about 47 degrees . fig3 also depicts the proximal portion 35 of the rack arms , the proximal portion being the end for use near the stanchion . the distal portion 40 is the end of the arm away from the stanchion . the proximal portion includes a rear surface 37 , a portion of which is flat and may be formed at an obtuse angle b to flats on the top portion , an obtuse angle being an angle greater than 90 °. the obtuse angle of these flats on the rear or proximal surface prevents downward rotation of arm 30 past the point where the material of the rear surface meets the inner surface of the channel 14 . the obtuse angle b in one embodiment is about 91 . 5 degrees and may range from about 90 . 5 degrees to about 95 degrees in practice , although other angles may be used , such as a right angle or an acute angle . having angle b at 91 . 5 ° results in the flats 36 and the saddles 34 having an upward tilt of 1 . 5 °. this upward tilt compensates for the deformation of the arm when it is under load by very heavy power and communication cables . thus , rack arm 30 will be biased to some extent for upward tilting of the rack arm on its distal end , near angle a . in other embodiments , it may be desirable for the rack arm top surface 36 and saddles 34 to be at a nominal angle different from horizontal ( 90 °). thus , other embodiments may include cable rack arms designed for an orientation of 30 °, 45 °, 60 ° or other angle from horizontal . these angles may be useful for maintenance of the cable after installation . proximal portion 35 also includes slot 41 , separating the proximal portion into two halves . slot 41 provides space that allows cable rack arm 30 to accommodate double - flanged stanchion 12 for easy mounting . the halves on either side of slot 41 each includes a mounting hole 39 . the holes thus allow insertion of a pin , such as pin 21 , and its securing cotter pin 23 , through mounting holes 25 of the stanchions 12 , 14 , as well as the cable rack arm 30 itself . horizontal mounting holes 39 in this embodiment are below the top surface of the rack arm 30 . in other embodiments , the mounting holes 39 of interface 35 may be molded above the top surface 36 . in yet other embodiments , mounting holes 39 may be molded such that the center of the horizontal orifices 39 are above the top surface 36 of upper portion 32 . the mounting holes 39 are used in all types of stanchions , while the slot 41 is needed only in a double - flange steel stanchion , a tee - bar stanchion , an l - angle stanchion and an e - channel stanchion , but not a c - channel stanchion . the e - channel stanchion , tee - bar stanchion and l - angle stanchion are shown in fig1 , 17 and 18 respectively and are described in more detail below . the single flange steel stanchion 12 is well - established in the industry , and the cable rack arms depicted herein include a slot 41 , thus enabling retrofit of the cable rack arms depicted herein to replace older cable rack arms . the cable rack arm embodiments described herein can be used for existing single flange steel stanchions as described and may also be used for new non - metallic c - channel , l - angle , tee - bar or e - channel stanchions . each slot 41 or interface also includes a void or relief 49 , the relief in the shape of about a 45 degree angle to the top of the rack arm . thus , in one embodiment , the interface includes contiguous mounting holes 39 , slot 41 and relief 49 . when the arm 30 is attached to a single flanged stanchion , a tee - angle stanchion , an l - angle stanchion , or an e - channel stanchion , relief 49 allows upward rotation of the rack arms from their deployed horizontal position as depicted in fig2 - 3 . in other embodiments , the angle between the top surface and the rear or side may be close to 90 °, that is , a right angle . in these embodiments , the cable rack arm may be viewed as a three - dimensional right triangle , with the long side or hypotenuse being the angled side on the bottom , that is , the bottom or lower portion . the top or longer portion is the major cathetus of the triangle and the side or shorter portion forms the minor cathetus of the triangle . the sides of the triangle may be connected by a web , a web with ribs , or a gusset . in this patent , the terms major cathetus and minor cathetus intend the top and side of a cable rack arm , whether or not the angle between them is a right angle . a closer , bottom view of the cable rack arm 30 is depicted in fig4 . cable rack arm 30 and lower portion 38 includes a proximal portion 35 , for placement nearer the mounting stanchion and a distal portion 40 , for placement away from the stanchion . as noted above , slot 41 separates the proximal portion 35 and rear surface 37 into left and right halves 37 a , 37 b and allows insertion of the rectangular bar portion of a single flange stanchion into the slot . in fig4 , rhomboid sections 37 c and 37 d may be molded flat to fit snugly against c - channel , tee bar , l - angle and e - channel stanchions on which the cable arm is mounted . these are the flat sections discussed above that may be oriented from about 90 . 5 to 95 degrees to the plane of the top surface of the cable arm . in addition , the cable arm may include two bottom flat portions 37 e and 37 f that are about 91 ° from surfaces 37 c , 37 d . flats 37 e , 37 f may be oriented at about 1 ° more than a right angle from surfaces 37 c , 37 d as a convenience in removal of the arm from the mold used for manufacturing . 1 ° is a conventional draft angle . further , since surfaces 37 e , 37 f have 1 ° taper it is possible to mold rounds 37 h on the same core pull as slot 41 . other functions that surfaces 37 e , 37 f permit include reducing the arm profile , resulting in less part weight . slot 41 is extended on both sides by additional side reliefs 43 a , 43 b adjacent the left and right halves . side reliefs 43 a , 43 b allow use of the adjustable cable rack arms in existing single flange stanchions having substantial weld formations that would otherwise interfere with their installation . the lower or bottom portion 38 of the cable rack arm is narrower than upper portion 32 , especially near the distal end 40 . downward rotation of the arm 30 is stopped by surfaces 37 c , 37 d , heel stops , when the arm is attached to a c - channel stanchion . when arm 30 is attached to a single flange stanchion , downward rotation is stopped when surface 37 g , a slot stop , contacts the front - most face of the single flange stanchion . consider now the l - angle , tee - bar and e - channel stanchions . the l - angle , tee - bar , or e - channel stanchion may have no nearby bolt heads and washers for attaching the stanchion to the concrete wall , and thus there may be no bolt heads or washers between the arm and the stanchion . in this case , either or both surfaces 37 c , 37 d , heel stops , as well as surface 37 g , the slot stop , may be used to stop downward arm rotation . of course , in the case of the l - angle stanchion , either or both 37 c and 37 g , or 37 d and 37 g , could be used to stop the downward rotation of the arm since there is only one leg on the l - angle stanchion for surface 37 c or 37 d to contact . if the l - angle , tee - bar or e - channel stanchion has a nearby bolt head and washer for attaching the stanchion to the wall , then only slot stop 37 g is used to stop downward rotation of the arm . on a side note , there are two types of single flange steel stanchions in wide use . one is fabricated by welding two flanges to a perpendicular bar as shown in fig7 . the second single flange stanchion is made from a single bar and flanges are formed by twisting 90 ° approximately the last 3 ″ on both ends of the bar . the single flange stanchion is in wide use and is only made from steel . the l - angle , tee - bar , e - channel and c - channel stanchions described herein are only nonmetallic and only made using the pultrusion process . these could possibly be made by transfer molding or compression molding or even the rim molding process , but this has not been done to our knowledge . to date there has been limited deployment of l - angle and tee - bar nonmetallic stanchions . the assignee of the present patent has just started to manufacture c - channel nonmetallic stanchions . there is no prior art of any kind for the e - channel nonmetallic stanchion . this stanchion has advantages of increased stability and support from the extra , middle flange . those having skill in the art will recognize that the upper portion 32 , with one or more cable mounts or saddles 34 , needs to be somewhat wider in order to mount the cables . the load is supported by the web 31 and ribs 33 and is transferred to the stanchion . bottom 38 portion needs only to transfer a part of the load through its length to the stanchion and does not need to be wide , it simply must be thick enough to resist buckling . as better seen in fig1 - 3 , ribs 33 need not be perpendicular to the top or bottom portion , although they may be . in these embodiments , the ribs are from about 30 ° to about 60 ° to the top or bottom portions . it will be recognized that the web 31 acts more or less as a gusset , that is , as a reinforcement supporting the top portion and transferring the load on top to the side portion and then to the stanchion . thus , a gusset , even a plain gusset without ribs , may be used with a top portion , a side portion and an interface to support cables in other embodiments . in some embodiments , a flanged gusset is used . fig5 and 5a depict the deployed or horizontal position of the cable rack arm mounted to a stanchion . in the partial cross - sectional view of fig5 , 3 - saddle cable rack arm 30 has been pinned to a single flange stanchion 12 with pin 21 through the orifices described above . stanchion 12 is mounted to concrete wall 18 via wall mounts 13 , anchors 28 and bolts 16 . cable - tie orifices or holes 45 are visible in cable rack arm 30 in this cross - sectional view . in fig5 , top relief 49 is visible as an angled gap between the metal of stanchion 12 and the top of the cable rack arm . the close - up perspective view of fig5 a depicts , as a user would see it , gap or relief 49 in the top of the cable rack arm 30 . the partial cross - sectional view of fig6 depicts the elements of fig5 with the cable arm 30 rotated upward . as seen in close - up perspective view fig6 a , arm 30 has rotated sufficiently to close the gap , and the top of the arm 30 is now in contact with stanchion 12 , preventing further upward rotation . prior art cable rack arms do not have such a relief and do not allow upward rotation . upward rotation is desirable for two reasons . in particular when retrofitting , it is advantageous to have moveable arms since older cables may have become relatively inflexible over time . such rotation allows an extra degree of freedom for construction and power company personnel wrestling heavy cables onto new arms in very limited , cramped , humid space in manholes . upwardly - rotatable cable rack arms also accommodate faults in power lines . for example , when a short occurs even at a long distance in a power line , the cable will actually “ jump ,” or try to jump , as much as several inches . in older cable arms , such faults may break the arm in the area between the mounting orifices and the top of the arm . a broken arm cannot support the cables , placing additional loading on the adjacent arms and leading to additional failures . allowing some rotation as in the embodiments described herein , typically from about 40 degrees to about 50 degrees , relieves the stress without breaking the arm . fig7 depicts a closer view of a single flange stanchion 12 , supported by wall mounts 13 . stanchion 12 itself has an orifice 25 for mounting a cable rack arm . wall mounts 13 have slots 27 so that the structure can be bolted to a support wall . stanchion 12 has been formed by welding the central portion to wall mounts or end portions 13 , with resulting weld build - up 29 on both the top and bottom of the stanchion . in other embodiments , a single flange stanchion may be made in one piece by twisting the ends 90 ° instead of welding on additional end mount 13 . as mentioned above , one advantage of the adjustable cable rack arms described herein is that they may be used to retrofit existing stanchions , such as stanchion 12 . however , the retrofit will not go smoothly if the new arm does not include space to accommodate the weld build - up in situations where the stanchion is a welded assembly . accordingly , as shown in the bottom view of fig8 and the closer , partial cross - sectional view of fig9 , the adjustable cable rack arm 30 slot 41 includes side reliefs 43 a , 43 to accommodate weld build - up 29 . this makes the retrofit easier and prevents additional damage to the new arms 30 which do not have to be forced into place . fig1 depicts c - channel stanchion 51 bolted to wall 50 with bolts 59 and washers 61 . the stanchion is made from glass - reinforced plastic , such as glass - reinforced nylon or pultruded glass fiber and polyester or vinyl ester resin . stanchion 51 includes a central web 55 with side flanges 57 formed at about 90 ° to the central web . flanges 57 include orifices 53 for pins for mounting cable rack arms to the stanchion . fig1 depicts a two - position rack arm 20 and two three - position rack arms 30 mounted to stanchion 51 with pins 21 . in this type of installation , relief 49 is not used but is available if the cable rack arms are used with the older - type , double - flange steel stanchions . fig1 and 11 depict the multiple orifices or pin holes 53 in the flanges 57 for cable rack arms . c - channel stanchion mounts to wall 50 via multiple bolts 59 through multiple orifices or holes ( not shown ) in web 55 . using multiple mounting bolts improves stanchion load capacity , but the additional bolts pose a problem in that the heel or backside of the arm may interfere with a bolt head when the arm is installed and tilted into place . side reliefs 43 a , 43 b , also shown in fig1 and 15 , overcome this problem by providing space in the arm to accommodate the bolt heads . fig1 depicts a partial cross - sectional view of the embodiment of fig1 . this view includes concrete wall 50 , anchor 28 , bolt 59 , web slot orifice 60 , c - channel stanchion 51 with web 55 , flanges 57 and orifices 53 . fig1 also depicts arm 30 with cable tie orifices 45 and top relief 49 . in the closer view of fig1 , which is also a partial cross - sectional view , washer 61 is visible under the head of bolt 59 . in addition , side relief 43 a is also visible between the bolt 59 and the rear material of arm 30 . thus , side reliefs 43 a , 43 b are useful in c - channel stanchions to provide clearance for mounting bolts . as noted above , side reliefs 43 a , 43 b are also useful in double - flange stanchions , allowing clearance of the cable rack arm around weldments . fig1 depicts a partial bottom cross - sectional view of fig1 , with a closer view in fig1 . cable arm 30 is pinned to stanchion 51 with pin 21 and cotter pin 23 . the stanchion is bolted to concrete wall 50 with bolt 59 through slot orifice 60 and anchor 28 . washer 61 is visible in closer view fig1 , which also depicts how side reliefs 43 a , 43 b allow clearance of the head 63 of bolt 59 . fig1 - 18 depict installation of three additional and different non - metallic stanchions as described herein . fig1 depicts an e - channel stanchion installation 70 , with a non - metallic e - channel stanchion 71 . e - channel stanchion 71 includes a central web 73 with two outer flanges 75 and an inner , central flange 77 , the flanges perpendicular or about 90 ° to the web . a plurality of pin - mounting orifices 79 are provided on each of the inner and outer flanges . in addition , the central web 73 has a plurality of orifices ( not shown ) for bolts to mount the stanchion 71 to a concrete wall 18 . in this installation , two two - saddle arms 20 and two three - saddle arms 30 are mounted to stanchion 71 . note that in fig1 , the flanges 75 , 77 of e - channel stanchion 70 face in the same direction as cable rack arms 20 , 30 , in the same manner as cable rack arm 30 and flanges 14 b of c - channel stanchion 14 in fig2 . this configuration saves space in the installation while preserving the higher section modulus and strength of the e - channel and c - channel stanchions . fig1 depicts a stanchion installation 80 with a tee - bar non - metallic stanchion 81 having a cross section in the shape of a t . tee - bar stanchion 81 includes a central web 83 and a flange 85 formed at a right angle to web 83 . pin - mounting orifices 89 are provided on flange 85 . in addition , the central web 83 has a plurality of orifices ( not shown ) for bolts to mount the stanchion 81 to a concrete wall 18 . in this installation , two two - saddle arms 20 and one three - saddle arm 30 are mounted to stanchion 81 . fig1 depicts a stanchion installation 90 with an l - angle non - metallic stanchion 91 having a cross section in the shape of an l . angled stanchion 91 includes a web 93 and a flange 95 formed at a right angle to web 93 . pin - mounting orifices 99 are provided on flange 95 . in addition , web 93 has a plurality of orifices ( not shown ) for bolts to mount the stanchion 91 to a concrete wall 18 . in this installation , three two - saddle arms 20 are mounted to stanchion 91 . as discussed above , a useful embodiment disclosed herein is a nonmetallic stanchion that is pultruded with a cross section in the general shape of a capital “ c .” fig2 - 21a depict a cross - sectional view of the “ c ” channel stanchion . this embodiment of the “ c ” channel stanchion is nonmetallic . after the basic “ c ” channel has been pultruded , it is sawed to length and the holes for mounting it to a wall and the holes for attaching the arms are machine routed and / or drilled as required . in one embodiment , the nonmetallic material used in fabricating the “ c ” channel , by weight , is 44 . 5 % polyester resin and 55 . 5 % glass fiber . the glass fiber includes 33 % unidirectional fiberglass roving ( roving ), 17 % continuous filament glass fiber mat ( cfm ), 5 % fiberglass cross layered knitted apertured mat ( clkm ) and 0 . 5 % synthetic surfacing veil ( veil ). the type of glass filament used in the roving , cfm , and clkm is commonly known as e - glass . other proportions may be used . the cfm is similar to a spun - bonded , non - woven reinforcement . in other embodiments , a standard woven ( warp and weft ) reinforcement mat may be used . during the pultrusion operation , the roving , cfm , clkm , and veil are completely wetted and saturated with the polyester resin . the polyester resin is the component that binds the fiberglass together forming a strong nonmetallic reinforced composite “ c ” channel stanchion . it is understood that other resins and other reinforcement fibers may be used . the roving is similar to owens corning fiberglas product number 399 - 113 yield and the cfm is similar to owens corning product number m - 8643 - 2 oz / sq . ft and m - 8643 - 3 oz / sq . ft . from owens corning , granville , ohio , u . s . a . the veil is similar to “ nexus ” veil from precision fabrics group , inc ., greensboro , n . c ., u . s . a . the roving contributes longitudinal tensile strength and flexural strength . the cfm contributes strength in both the longitudinal and transverse directions . the veil provides a resin - rich surface for uv resistance and hand - friendliness . the polyester , roving , cfm , and veil components described above have been used to pultrude and deploy a relatively small quantity of nonmetallic tee - bar and “ l ” stanchions in recent years . these stanchions had insufficient strength and during the course of the work described herein , it was determined that a stanchion with higher load capacity was needed . in particular it was noted that the distribution of the roving and the mat throughout the resulting structure was not well controlled . accordingly , the inventor developed a fiberglass cross - layered polyester yarn knitted apertured mat ( clkm ) for placement in the stanchion during the pultrusion operation . since the mat is cross - layered , one layer is oriented in the direction of the pultrusion , while the opposite layer is oriented transverse , about 90 °, to the direction of pultrusion . in other embodiments , the transverse layer may be oriented up to plus or minus 15 degrees to the transverse direction . fig1 is the top view of a swatch of clkm fabric 100 . the clkm fabric has 6 . 5 longitudinal tows 101 of fiberglass per inch and 6 . 5 transverse tows 102 of fiberglass per inch . the tows 101 , 102 are knitted together with polyester yarn 103 . fig1 , 19 a , 20 and 20 a reveal in detail that the transverse tows 102 form one layer and the longitudinal tows 101 form a distinct second layer . each tow 101 , 102 is an untwisted bundle of 2 , 000 each ( 450 yield ) 0 . 0166 mm ( 0 . 000654 in ) diameter continuous glass filaments . the open channels 104 between the longitudinal tows and the open channels 105 between the transverse tows combined with the apertures 106 that penetrate through the clkm fabric permit the polyester resin to wet - out and flow through the clkm fabric . the clkm fabric is pulled through the pultrusion die in the direction shown by the arrow 107 . while not being bound by any particular theory , it is believed that the layered structure allows greater penetration of the resin between layers and between and within tows in each layer , as well as within the discrete “ windows ” or apertures of the knitted reinforcement between each tow of each layer . a cross - section of the “ c ” channel stanchion showing the reinforced polyester composite after it exits the pultrusion die is shown in fig2 and 21a . in one embodiment , the structure is as follows . two overlapping veils 108 , 109 cover the outer surface . two pieces of cfm 111 , 112 are placed immediately inside the veil . one piece of clkm 114 is placed at the center of the “ c ” channel thickness . one piece of cfm 115 , 116 is placed on each side of the “ c ” channel thickness half way between an outer surface of the clkm 114 and inner surface of the outer cfm 111 , 112 . in one embodiment , the tows of roving , respectively 62 ea , 65 ea , 67 ea and 70 ea tows , are evenly distributed in compartments 117 , 118 , 119 and 120 respectively . as stated previously the veil 108 , 109 constitutes 0 . 5 % by weight of the “ c ” channel composite , the cfm 111 , 112 , 115 , 116 is 17 %, the clkm is 5 % and the roving is 33 %. the 44 . 5 % balance is the polyester resin which completely wets - out , saturates and adheres to all surfaces of the veil , cfm , clkm , and roving . the fiberglass - reinforced polyester composite pultrusion thus fabricated has increased transverse strength in the corners 121 , 122 because the knitted yarn controls the distribution of the glass fiber tows . while the above has been described for a c - channel stanchion , other pultruded structures with this configuration will also have increased strength , whether they have the form of a tee , an “ l ” or an “ e ” shaped cross section . a non - metallic cable rack arm made with the described corner reinforcements will have increased rigidity and strength , and because the position of the glass reinforcement is controlled , will also have a more reliable strength and stiffness . one novel feature in the above described pultrusions that results in the increased transverse strength of the cable arm support stanchion is the inclusion of at least one fiberglass cross layered knitted apertured mat ( clkm ) in which the tows and layers are restrained by a knit mesh . clkm is the preferred fabric . the fiber or yarn used for the knit mesh may be polyester , cotton or other fiber . while a knitted holding structure is useful , other forms may be used , such as a stitched , purled , or even a woven form , so long as the additional fibers constrain the individual tows and layers into an integral structure . other variations of the clkm may also be used , in which the fiberglass fabric itself is woven , knitted or stitched . the “ c ” channel stanchion described in detail above and the “ e ” channel stanchion are new innovations in underground cable support and have advantages in their strength and rigidity . the tee - bar stanchion and l - angle stanchion have been previously deployed as nonmetallic structures . the tee - bar and l - angle stanchions cost less but also have less strength and stiffness , particularly when it is desired to use fewer mounting bolts , which is usually the situation . there are many possible embodiments of the present invention , of which only a few have been described herein . it is intended that the foregoing detailed description be regarded as illustrative rather than limiting , and that it be understood that it is the following claims , including all equivalents , that are intended to define the spirit and scope of this invention . | 8 |
the invention is directed to an adaptive equalization system and method that provides optimum level of equalization . the invention detects when an equalizer is trapped in a failure state and allows an equalizer to recover from the failure state . in one embodiment of the invention , a 1 - bit quantizer compares an equalized signal &# 39 ; s tail settling voltage to the common mode voltage derived from the equalized signal . the 1 - bit quantizer is a sampled comparator that compares two voltages synchronous with a sampling clock . the sampling clock ensures that the 1 - bit quantizer compares the equalized signal &# 39 ; s tail settling voltage to the common mode voltage . the 1 - bit quantizer outputs 1 or 0 . the common mode voltage derived from the equalized signal is the mid voltage between a peak detector &# 39 ; s most positive and most negative voltage , which corresponds to the signal &# 39 ; s highest and lowest voltage . in one embodiment of the invention , a positive to zero , ( i . e ., a “ 10 ”) transition pattern of the signal first is searched before a determination is made whether the signal is over equalized or under equalized . otherwise , the signal &# 39 ; s settling voltage will be corrupted by the inter symbol interference ( isi ) of the next signal transition , which will cause the adaptive algorithm to fail . the isi is caused by the cable loss effect , which causes the high frequency content of the signal to be attenuated , causing the signal energy from one data symbol to leak beyond its symbol period and corrupt adjacent data patterns . in contrast , if a “ 11 ” transition pattern is searched , the tail settling waveform of a previous symbol will be corrupted by the next symbol and the voltage tail will not settle . once the “ 10 ” transition is found , an algorithm is used to determine if the signal is under equalized or over equalized . as will be explained in detail later , based on the output of the 1 - bit quantizer and the transition of the signal , an internal counter is incremented or decremented . the internal counter is incremented by 1 if the signal is under equalized and is decremented by 1 if the signal is over equalized . if the counter overflows , the equalizer coefficient is incremented by 1 , and if the counter underflows , the equalizer coefficient is decremented by 1 . the output t of the 1 - bit quantizer , which is 1 or 0 , indicates how well the signal is equalized . the 1 - bit quantizer is sampled by a clock derived from a cdr . the sampling edge is x1 time away from the falling edge of the data transition . the x1 time away from the falling edge of the data transmission is the time that is optimized for observing the settling behavior of the waveform after equalization . if x1 is too small , the waveform is still in transition and settling behavior cannot be observed easily . if x1 is too large , the waveform has mostly settled and the 1 - bit quantizer can easily be influenced by noise and other channel non - ideal characteristics . in one embodiment , x1 is set at ⅛ of a symbol period . fig9 ( a ) and 9 ( b ) illustrate the algorithm for determining whether the signal is over or under equalized in accordance with one embodiment of the invention . fig9 ( a ) illustrates a scenario where the signal transitions from positive to zero and there is no other transition in the next symbol period . if the signal transitions from positive to zero and the output of the 1 - bit quantizer = 1 , the signal is under equalized . if the signal transitions from positive to zero and the output of the 1 - bit quantizer = 0 , the signal is over equalized . fig9 ( b ) illustrates a scenario where the signal transitions from negative to zero , and there is no other transition in the next symbol period . if the signal transitions from negative to zero and the 1 - bit quantizer output = 1 , the signal is over equalized . if the signal transitions from negative to zero , and the 1 - bit quantizer output = 0 , the signal is under equalized . as discussed before , a counter is incremented by 1 if the signal is under equalized and decremented by 1 if the signal is over equalized . when the internal counter overflows , the equalizer coefficient is incremented by 1 . when the internal counter underflows , the equalizer coefficient is decremented by 1 . thus , the algorithm waits until the counter overflows or underflows before adjusting the equalizer &# 39 ; s coefficient value . the equalizer is not adjusted until the counter overflows or underflows in order to ensure that the signal is indeed under equalized or over equalized and also to prevent adjusting the equalizer &# 39 ; s coefficient value because of random noise or interference . fig1 ( a ) and 10 ( b ) are functional block diagrams of components used to determine whether the signal is under equalized or over equalized . the components shown in fig1 ( a ) and 10 ( b ) are incorporated in a conventional receiver to implement the invention . as shown in fig1 ( a ), an equalized signal is received at a peak detector 1004 and a valley detector 1008 . the peak detector 1004 detects the most positive , i . e ., highest , voltage level of the incoming signal , and the valley detector 1008 detects the most negative , i . e ., lowest , voltage level of the incoming signal . the output of the peak detector 1004 and the output of the valley detector 1008 are provided to a reference generator 1012 . the reference generator 1012 generates three output signals , refp , refmid and refn . a slicer 1016 ( also referred to as slicer_p ) compares the refp signal to the equalized signal and outputs a signal p . a slicer 1020 ( also referred to as slicer_n ) compares the refn signal to the equalized signal and outputs a signal n . slicer_p and slicer_n are continuous time comparators that compare the equalized signal to the respective reference signal . slicer_p recognizes its input as ‘ 1 ’ if the signal amplitude is greater than refp . slicer_n recognizes its input as ‘ 1 ’ if the signal amplitude is less than refn . the signals p and n are used to determine the transitions of the incoming signal . the signals p and n can have values of 1 or 0 . in one embodiment , two samples of p and n are used to determine the transition of the incoming data or signal . if in a first sample if p = 1 and n = 0 , the incoming data is considered to be 1 . if in a second sample if p = 0 and n = 0 , the incoming data is considered to be 0 . at that time , a “ 1 0 ” transition has occurred . if in a first sample p = 0 and n = 1 , the incoming data is considered to be − 1 . if in a second sample , p = 0 and n = 0 , the incoming data is considered to be 0 . at that time , a “− 1 0 ” transition has occurred . refmid is the mid point between the most positive and the most negative voltages . the refmid is the common mode reference of the input signal . the refmid is provided to a 1 - bit quantizer 1024 . the 1 - bit quantizer 1024 also receives the equalized signal and a clock signal clk from the cdr . the 1 - bit quantizer is a sampled comparator , which compares the refmid signal to the equalized signal &# 39 ; s tail settling voltage . the output t of the 1 - bit quantizer is either 1 or 0 . the signals p , n and t are provided to a counter 1028 shown in fig1 ( b ). the counter 1028 is incremented according to the algorithm described before . when the counter 1028 underflows or overflows , the equalizer &# 39 ; s coefficient value is incremented or decremented according to the algorithm described before . one problem associated with the adaptive equalization scheme is its nonlinear behavior . the nonlinear behavior is caused by the equalizer loop &# 39 ; s mixed signal content . the equalizer loop is formed by the equalizer , the pd , the slicer , the cdr and the aec . the adaptive equalizer loop includes an analog signal path . as discussed before , the equalizer receives the output from the vga and equalizes the signal to compensate for the frequency dependent losses . the output signals of the vga and the equalizer are analog signals thus forming the analog signal path . the adaptive equalizer loop also includes a digital feedback control path comprising the automatic equalizer control . the output of the automatic equalizer control is a digital signal that is used to adjust the equalizer coefficient . also , the cdr is a mixed signal block that includes analog and digital signals . thus , the analog and digital signals in the adaptive equalizer loop cause its nonlinear behavior . the consequence of the nonlinear behavior is that the adaptive equalizer loop &# 39 ; s settling behavior is dependent on the initial state . if the loop is initialized with an erroneous state , it may be trapped in the erroneous or failure state and not be able to recover from it . in one embodiment of the invention , when the receiver is initially powered up , the aoc loop converges at time 3 * taoc , taoc being the loop time constant of the aoc . in an embodiment of the invention , the taoc is approximately 125 us . the agc loop settles at time 3 * tagc , tagc being the loop time constant of the automatic gain control loop . in one embodiment , the tagc is 335 us . at a time period equal to 3 * taoc + 3 * tagc , the vga gain is latched in and the equalizer is initialized . in an embodiment of the invention , the time period 3 * taoc + 3 * tagc is approximately 1 . 5 ms . the equalizer is initialized using a common criteria such as , for example , a small signal amplitude corresponds to a heavily attenuated signal over a long distance . the higher the vga &# 39 ; s gain ( which corresponds to a smaller input signal amplitude ), the higher the equalizer initial value . a longer cable causes more attenuation and thus the incoming signal will have a smaller amplitude . thus , a longer cable causes the vga to have a higher gain and correspondingly a higher equalizer initial value . next , the cdr requires a time tpll , which is the loop time constant of the filter inside the pll , to lock onto the data . in one embodiment of the invention , the tpll is 300 us . if during tpll period the cdr is able to lock onto the data , then the automatic equalizer controller is allowed to adaptively change the equalizer coefficients . thus the equalizer is provided with an initial value and is then monitored during the tpll to determine if the initial value is correct or not . if within tpll the cdr is able to lock onto the data , it is determined that the initial value is correct , and the equalizer is subsequently controlled by the aec . if the cdr is unable to lock onto the data during tpll , the equalizer coefficient range is searched for an initial value that will allow the cdr to lock onto the signal , i . e ., the cdr converges . in general , the equalizer coefficient range has n bits . in one embodiment , the equalizer coefficient range has n = 8 bits , which corresponds to a range of 0 to 255 . the search for an initial value ends if a proper initial equalizer coefficient is found . if a proper initial equalizer coefficient is not found after searching the equalizer coefficient range , a failure is declared . if a failure is declared , the cdr is said to have not converged . at that time , the receiver channel is reset and the process restarts . in one embodiment of the invention , if the cdr converges within an initial period of 3 * taoc + 3 * tagc1 . 5 ms )+ tpll ( 300 us )= 1 . 8 ms , the cdr output is still monitored . if a cdr failure is declared , the search algorithm is restarted . this scheme is robust , allowing the receiver channel to recover from a catastrophic failure such as a user unplugging the cable on the fly or changing to another cable of a different length . as discussed before , the algorithm waits for tpll for the cdr to lock onto the incoming signal . the tpll wait period is due to the fact that the equalizer relies on the extracted clock to sample the tail settling voltage of a “ 1 ” to “ 0 ” or “− 1 ” to “ 0 ” transition . however , the cdr also relies on the equalizer to correctly restore the signal so that the cdr can extract the correct timing . thus the cdr and the equalizer are mutually dependent and rely on each other to function properly . since the cdr and the equalizer are mutually dependent and rely on each other to perform properly , a non - linear closed loop system is created . the receiver channel can easily be locked up in a failure state because of the nonlinear closed loop system , and the receiver channel may be unable to recover from the failure state . for example , an incorrect initial state will cause the cdr to fail to lock onto the incoming signal and instead cause the cdr to lock onto a failure state . if the cdr is locked onto to a failure state , the cdr will extract an invalid clock signal from the incoming signal . the invalid clock signal will cause error in the 1 - bit quantizer &# 39 ; s output , causing the adaptive algorithm to fail . according to one embodiment of the invention , the adaptive equalization loop is initialized according to the vga &# 39 ; s gain code after the analog gain control loop settles . a large vga gain corresponds to a small input signal , which means large attenuation by the cable . if there is a large cable attenuation , the equalizer is initialized to a high value . it is to be understood that even though various embodiments and advantages of the present invention have been set forth in the foregoing description , the above disclosure is illustrative only , and changes may be made in detail , and yet remain within the broad principles of the invention . for example , the components shown in fig1 ( a ) and 10 ( b ) can be substituted by other circuitry to perform the operations of fig9 ( a ) and 9 ( b ). therefore , the present invention is to be limited only by the appended claims . | 7 |
car 2 ( fig1 ) comprises a safety system according to the invention . window breaker 700 is positioned close to a window 4 of car 2 such that it can break window 4 . in this exemplary embodiment car 2 comprises a window breaker 700 integrated into the door . the safety system moreover comprises a water sensor in a housing , which can for instance be provided at positions 8 , 10 , 11 or 12 . in a presently preferred embodiment the water sensor is situated under the bonnet , at position 11 . signalling means , i . e . buzzer 500 and led 400 , are provided in the dashboard of car 2 ( fig2 ). further situated in the dashboard is manual operating means 902 , 904 with which the safety system can be deactivated ( deactivation knob 902 ) or manually ( re ) activated ( activation knob 904 ). it is for instance also possible to embody the safety system without activation knob 904 or to combine activation knob 904 and deactivation knob 902 and embody them as one knob . an exemplary embodiment of the electrical circuit diagram of a safety system ( fig3 ) comprises detection means 100 , including water sensors 102 , 104 . water sensors 102 , 104 of detection circuit 100 are connected to water detection circuit 200 . this circuit comprises resistors 202 , 204 , transistor 206 , connection 208 and earth contact 210 . water detection circuit 200 is connected to relay circuit 800 . this circuit comprises connections 802 and 804 . if the water detection circuit 200 determines on the basis of electrical signals from detecting means 100 that water has been detected , relay circuit 800 switches and time delay circuit 600 is activated . circuit 600 comprises diodes 606 , 608 , 610 , 612 , 618 , 656 , resistors 621 , 624 , 646 , 648 , 634 , 637 , 660 , 664 , 668 , 670 , polarized capacitors 614 , 620 , capacitors 622 , 636 , 662 , transistors 632 , 644 , integrated circuits 626 , 628 , led 652 and relay 658 . circuit 600 activates window breaker 700 with a time delay . pulsing circuit 300 is switched on without time delay . pulsing circuit 300 comprises resistors 302 , 304 , 306 , 308 , variable resistors 312 , 314 , led 310 , transistors 320 , 382 , and polarized capacitors 316 , 318 . circuit 300 controls buzzer 500 and led 400 . immediately after water has been detected by means of circuit 200 a buzzer 500 hereby sounds and a flashing light 400 can be seen . after a time delay window breaker 700 will then be activated by circuit 600 in order to break the window . the values and types of diverse elements of fig3 are shown in the table below . element value / type resistor 202 10 kohm resistor 204 479 kohm transistor 206 bc517 element value / type resistor 302 1 kohm resistor 304 10 kohm resistor 306 10 kohm resistor 308 1 kohm variable resistor 312 250 kohm variable resistor 314 250 kohm capacitor 316 10 uf capacitor 318 10 uf transistor 320 bc547b transistor 322 bc547b the operation of the circuit diagram ( fig3 ) is assumed known to the skilled person . fig4 shows housing 18 . housing 18 comprises water sensor 14 . housing 18 is provided with openings 16 . water sensor 14 is disposed in housing 18 such that it is clear of the side walls . window breaker 700 according to the embodiment shown in fig5 comprises an electric motor 703 and a hard pin 720 with tip 722 . window breaker 700 is situated close to a window 702 such that tip 722 of hard pin 720 can strike the window in order to break it . electric motor 703 drives toothed wheel 706 by means of worm wheel 704 . a hollow cam 708 is situated on toothed wheel 706 . hollow cam 708 comprises an edge surface 705 on which rests a rod 710 . edge surface 705 rises from a first height 709 to a second height 711 and then falls away sharply to the first height 709 . in the shown embodiment the hollow cam has two highest points 711 and two lowest points 709 . the rod 710 resting on edge surface 705 of hollow cam 708 is connected to hard pin 720 . a spring 712 is arranged around pin 720 . toothed wheel 706 , hollow cam 708 , rod 710 and spring 712 are enclosed by a u - shaped plate 713 . situated on the upper side of plate 713 is a second cam 714 in which a channel 718 is arranged for receiving the rod 716 which is fixed to pin 720 . rod 716 prevents rotation of the pin in that rod 716 can only move vertically through cam 714 by means of recess 718 . there are various stages during the striking movement of the pin ( fig6 a - d ). rod 710 is initially situated at the lowest point 709 of cam 708 . in this position hard pin 720 rests against window 702 ( fig6 a ). toothed wheel 706 is driven by electric motor 703 via worm wheel 704 . cam 708 rotates as a result . rod 710 is displaced upward under the influence of edge surface 705 and thereby pushes hard pin 720 upward ( fig6 b ). spring 712 is herein compressed . tip 722 of hard pin 720 moves clear of window 702 . the vertical movement of pin 720 is continued until rod 710 reaches the highest point 712 of cam 708 ( fig6 c ). rod 712 then moves abruptly over the highest point 711 and sharply downward to the lowest point 709 due to the force of spring 712 ( fig6 d ). tip 722 of hard pin 720 strikes here against window 702 , which thereby breaks . this movement is repeated as long as electric motor 703 is activated and thereby guarantees that window 702 is broken . alternatively , a window breaker is used in which the drive comprises an explosive charge . when the car falls into water , this is detected by means of circuits 100 and 200 . buzzer 500 and led 400 alert the passengers by means of sound and light . the system can be deactivated before the windows are broken by pressing knob 902 . after a predetermined time delay , realized by circuit 600 , the window breaker will be activated and pin 720 will break window 4 so that the passengers can escape from the vehicle . the present invention is by no means limited to the above described preferred embodiments thereof . the rights sought are defined by the following claims , within the scope of which many modifications can be envisaged . | 1 |
fig1 is a block diagram showing material portions of an example video waveform monitor according to embodiments of the invention . as illustrated in fig1 , a waveform monitor 20 is coupled to and receives input from a camera 12 that is pointed at a subject 14 . the camera 12 may produce still or moving images . the camera 12 typically includes adjustments for focus and the depth of the field of focus ( dof ) that may be controlled by a camera operator , or the adjustments may be automatically controlled . the camera 12 output is input to the waveform monitor 20 . the output from the camera 12 may be gamma corrected , or log corrected , y ′ cr ′ cb or r ′ g ′ b ′ components . this correction may occur in the camera 12 , modifying signals from a linear function of the camera &# 39 ; s light input , to a non - linear transfer function to obtain adequate dynamic range or bit - size of the output signals . commonly used gamma transfer functions have been used in television and computer images for many years and coincidently approximate the non - linear human vision lightness function . the human vision lightness function is often approximated as a cube - root ( exponent of ⅓ ) power - law function and many of these common gamma - correction functions ( srgb , rec - 601 , rec709 , etc .) also follow power - laws with exponents in the range of 1 / 2 . 2 to 1 / 2 . 6 . therefore , when gamma correction is applied to the signals , the prime notation is used . as mentioned above , this correction is usually performed in the camera 12 and the camera output signal is typically r ′, g ′, b ′ or y ′, cb ′, cr ′. newer cameras may have both a gamma corrected proxy output as well as a high dynamic range output with log processing for recording to further compress the newer imagers high dynamic range light sensitivity . embodiments of the invention work with any of these outputs . in the wave form monitor 20 , the camera 12 output is first processed by an input processor 30 to isolate a digital luminance , y ′, of the image . the digital luminance y ′ is then passed to a fine mixer 40 as well as a coarse mixer 50 , before being passed to a first low - pass - filter 60 and a second low - pass - filter 70 , respectively . the fine mixer 40 includes a multiplexer 42 controlled by , for example , a square - wave input having a frequency of fs / 2 , where fs is the y ′ sample - rate . the coarse mixer 50 includes a multiplexer 52 controlled by , for example , a square - wave input having a frequency of fs / 4 . the path through the fine mixer 40 and low - pass - filter 60 is the fine or sharp focus path , while the path through the coarse mixer 50 and low - pass - filter 70 is the coarse focus or depth - of - field ( dof ) path . the signals driving the multiplexers 42 , 52 are preferably square wave signals so the mixing processes are implemented as digital multiplexers selecting between y ′ and minus y ′ at the local oscillation rate ( i . e ., fs / 2 or fs / 4 , depending on the focus path ) thereby multiplying y ′ by plus and minus one by multipliers 44 , 54 , respectively . with digital processing , the function of the multipliers 44 , 54 to multiply unsigned input data by − 1 is merely a negative sign representation of the unsigned input data , which simplifies processing . the spectrum of each mixer output with the low pass filter ( lpf ) filter response overlaid is illustrated in fig2 . the signed mixer output from the fine mixer 40 is filtered with a low pass filter 60 , and then an absolute value of the filter output is taken in abs element 62 . similarly , the signed mixer output from the coarse mixer 50 is filtered with a low pass filter 70 , and then an absolute value of the filter output is taken in abs element 72 . each unsigned absolute value signal is then compared with separate thresholds in comparators 64 , 74 , respectively , to develop a first binary gate to mark the image area of fine focus as well as a second binary gate signal to mark the image area of coarse or wide focus ( dof ). in the example of fig1 , the original output signal from the camera 12 is optionally converted to monochrome ( black and white ) in a luma converter 80 , and then delayed in a delay element 82 to match the processing delay of the mixer + lpf paths . this monochrome signal is then applied to switches or multiplexers 90 , 96 which allows a gate signal output from the respective comparator 64 or 74 to select a different false color for each gate signal . for example , as illustrated in fig1 , a red color is used for the fine focus indication on the image and yellow for the coarse focus . alternatively , other colors or visible patterns such as crosshatch or zebra stripes could also be selected by the gate signals . the yellow switch 90 and / or red switch 96 then insert either a respective yellow or red color overlying the original portions of the monochrome image that indicate on the image a depth of focus ( yellow ), and areas of highest frequency of the image , which indicates the areas of tightest focus of the image . the remaining pixels , i . e ., those pixels having focus levels outside of the specified focus threshold values from the original image , may be shown on the display 98 without change . if the luma conversion block 80 is present and active , then the un - modified portions of the original image will be presented as black and white . otherwise , the un - modified portions of the original image will be in the same form as received from the camera 12 . the combined highlighted image is then sent to the display 98 for viewing . in some embodiments the display 98 may be a monitor or display that is separate from the wave form monitor 20 . for example , with reference to fig4 a and 4b , the original , non - modified monochrome image is illustrated in fig4 a . this is the image created from the output of the luma converter 80 in fig1 . inspection of fig4 b shows that the dof is overlaid or highlighted on the monochrome image in yellow , while the areas of sharpest focus are overlaid or highlighted on the monochrome image in red . the red areas ( finest focus ) are typically surrounded by yellow areas ( coarse focus ), but may have a common edge . of course , the colors or patterns substituted for the dof and the areas of sharpest focus are user selectable . with reference back to fig1 , the area in fig4 b illustrated in yellow originates from the yellow value input to the yellow switch 90 , while the area in fig4 b illustrated in red originates with the red value input to the red switch 96 . different colors or patterns could be implemented by providing desired colors or patterns at the color inputs to the yellow and red switches 90 , 96 . assuming that the indicated red and yellow values are used , the red and yellow marker colors can either have a fixed saturation and brightness , or may instead be proportional to the input signal luminance , or could be a combination of both , before being applied to the gated switches or multiplexers 90 , 96 . in other embodiments , the wave form monitor 20 may include more than two focus zones for highlighting . for example , by including additional focus paths such as those set forth in fig1 in a wave form monitor , a user may control three , four , or any desired number of separate focus zones , each producing an individual color marker . in operation , a user may use a user interface 22 to control several parameters of the wave form monitor 20 . for instance filter parameters of the low pass filters 60 , 70 may be user selectable . additionally , a fine focus threshold input to the comparator 64 allows the user to select which areas of the image are indicated by the fine focus indicator . in some embodiments users may set the fine focus threshold so high that only the dof is indicated on the resulting color - marked image . users may also use the user interface 22 to select color inputs for the fine and course markers . as described above , fig1 shows these marker colors as red and yellow , but any color or pattern may be used to indicate the areas of focus . fig3 is a block diagram of central components of another example video waveform monitor including picture markers according to embodiments of the invention . in general , the components of fig3 add another set of filters to each of the course and fine paths to allow for both horizontal and vertical focus detection , as described below . the components of fig3 may operate with the remaining components in fig1 . for example , the y ′ input in fig3 may be the output from the input processor 30 of fig1 . the gate outputs from the or gates 140 and 180 may be used to respectively control the red switch 96 and yellow switch 90 of fig1 , for example . the components of fig3 scan the image in both the horizontal and vertical directions , while the components of fig1 scan the image in only the horizontal direction . scanning in both the horizontal and vertical directions allows for increased fidelity in the focus markings . instead of including a single low pass filter 60 for the fine focus detection of fig1 , the components of fig3 include a fine horizontal low pass filter 120 as well as a vertical low pass filter 130 . the horizontal and vertical low pass filters 120 , 130 may be coupled in parallel , or the vertical low pass filter 130 may optionally be coupled to the output of the horizontal low pass filter 120 , which makes the system more sensitive to horizontal edges rather than vertical edges . a multiplexer 110 is driven by the output of an xor gate 112 , which preferably has square - wave inputs having frequencies of fs / 2 and fh / 2 . as above , the fs / 2 is one - half the frequency of the frequency of the y ′ signal , while fh / 2 is one - half the line rate for the particular video format being analyzed . driving the xor gate 112 with the two signals fs / 2 and fh / 2 creates a similar output to having two separate multiplexers . in the illustrated embodiment , each of the low pass filters 120 , 130 is passed to a respective absolute value processor 122 , 132 , which functions as described above . in addition to the fine focus path including two low pass filters , the coarse focus path also includes a horizontal low pass filter 160 and a vertical low pass filter 170 respectively coupled to absolute value processors 162 , 172 . the differences between the fine and coarse focus paths include the signals driving the xor gates 112 , 152 and the threshold settings to the comparators 124 , 134 , 164 , and 174 . an or gate 140 generates the red gate signal , i . e ., the control signal for adding red color , when either the frequency information of the horizontal edge or vertical edge of the image being analyzed triggered the fine focus threshold . an or gate 180 generates the yellow gate signal when either the horizontal edge or vertical edge exceeded the coarse focus threshold . in each case the vertical and horizontal thresholds for both the fine and course focus paths are user settable , for example by using the user interface 22 ( fig1 ). the waveform monitor 20 , or any parts of it , may be embodied in firmware , such as an fpga , specifically designed circuitry such as an asic , or may be implemented by one or more software process running on one or more processors . in other embodiments the waveform monitor 20 may include may include a combination of components or operations running on firmware , asics , fpgas , and software , for example . although specific embodiments of the invention have been illustrated and described for purposes if illustration , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . | 7 |
fig1 shows a combined low - pressure volume amplified and rapid high - pressure but minimal volume inflator 1 with and without the valve means that allows regulated flow and shut off capacity as required for inflating multiple bladders . the upper drawing is of a low - pressure high - volume valve - regulated inflator 23 in which the co2 cylinder is inserted into threaded cylinder receiver 33 . the co2 cylinder is advanced by cylinder complementary threads 6 towards an over sized nylon thread section 7 of receiver 33 . the increased resistance of the nylon threads 7 alerts the user to the location of the cylinder within the inflator 1 . upon reaching the nylon threads the user provides one last full twist to advance the cylinder into the locking nylon thread section which prevents the cylinder from vibrating out of position . the last full turn of the cylinder also places the cylinder against the primary low - durometer outer gasket seal 3 . on intent to inflate the life jacket the cylinder is twisted into the inflator receiver 33 of fig1 further compressing the soft primary o - ring 3 which creates a secure pneumatic seal with the environment . continued turning of the cylinder leads to compression of the secondary high - durometer central gasket seal 4 against rigid support 48 . the secondary seal 4 is an integrated valve allowing intermittent operation of the volume - amplified inflator . as the operator continues to advance the cylinder into seal 4 the cylinder impales itself upon the micro - pierce means 5 which is embedded in a threaded mount 36 . the threaded mount 36 supports the micro - pierce means 5 , the primary o - ring 3 and secondary valve seal 4 . once the cylinder seats against seal 4 backed by rigid support 48 and can no longer be advanced , the cylinder is then backed away from the secondary valve seal 4 and compressed gas flows through fenestration 8 in the seal - then - pierce valve 2 into the conduit 46 through jet 34 as seen in the lower drawing of fig1 . the compressed gas is consolidated as it passes through the jet orifice 9 . the diameter of jet orifice 9 in part determines the volume of the high - speed compressed jet stream focused on the center of the venturi 35 . the particular volume of the jet stream is actively regulated by the seal - then - pierce valve 2 . the jet stream then passes through the throat of venturi 35 . the performance of a particular venturi is a balance of the venturi throat diameter 26 , throat angle 47 , distance from jet orifice to throat 25 , exit angle 26 and exit length 27 . restriction of venturi length 27 to reduce the overall size of inflator 1 increases user compliance . venturi design parameters are optimized for either quick inflation of a personal flotation device or optimized to achieve maximum volume amplification as is required in order to inflate a life raft from a very small cylinder . alternatively , valve 2 allows quick adjustment between rapid inflation and high - volume of inflation . with a fixed venturi design the inclusion of a valve such as the seal - then - pierce valve 2 of fig1 , or a quarter turn needle valve 101 of fig3 or a threaded spool valve such as 111 of fig3 allows the operator to start , stop and vary the flow rate through the volume amplified inflator 1 . that is the operator can optimize rate over volume to quickly fill the life jacket . once the life jacket is inflated the valve can reduce flow rate to now optimize inflator 23 for increased volume over rate as needed to fill a voluminous life raft . the top drawing in fig1 of inflator 23 has longitudinal air intake vent cover 11 in the locked open position 21 so that the ambient air intake 10 is open to the environment . a rear quarter turn lock 14 holds cover 11 back against spring 12 . on release cover 11 is pushed forward through quarter turn track 30 as spring 44 expands . the advance of cover 11 is arrested by stop 13 . the vent cover 11 creates a seal by compressing rear o - ring 15 and front o - ring 17 . cover 11 rides up on forward support shelf 18 and abuts against forward stop 19 under spring tension 22 as seen in the lower drawing of fig1 . in the lower drawing of fig1 access to ambient air is blocked by vent cover 11 being in the forward or locked closed position 20 . with the air intake 10 closed the inflator is now a high - pressure low volume inflator 24 . inflator 24 does not include a valve so upon micro - piercing of the cylinder , which is sealed from the ambient environment by single gasket 43 , inflator 24 discharges continuously until the cylinder is spent . such an economical inflator might be dedicated to the inflation of a life raft where the entire volume could be consumed by a single bladder . in the lower drawing the pierce means and fenestrations 45 are side by side . the primary flow rate of volume amplified inflators is limited by the micro - pierce means 5 as seen in the upper drawing and lower insert drawing . this micro - pierce regulation leaves a nearly invisible perforation in the co2 cylinder making the re - installation of a spent cylinder even more likely . consequently the receiver of inflator 24 has integrated non - complementary cutting threads 38 and hardened burring gouge 39 to destroy and deform the threads on the used cylinder . the upper drawing depicts the traditional use of a beveled entrance 42 to guide the cylinder into the receiver and to help start the threads . in the lower drawing the bevel has been eliminated and the first threads are at the upper limit of size so that only very clean threads are allowed to enter receiver 33 . both inflators in fig1 are assembled from two pieces ; the single piece cylinder receiver and jet - orifice 51 are threaded at 32 onto venturi 35 . when the inflator vent cover 11 is closed 20 the inflator functions as a high - pressure low - volume inflator 24 requiring that the joint between the jet - orifice and venturi be sealed by o - ring 31 to sustain the elevated pressures generated when inflator 1 functions as a high - pressure inflator . in fig2 the upper drawing is of a very economical continuous discharge low - pressure volume amplified inflator 50 . the intake vents are continuously open 52 . a tubular pierce means 53 is press fit 54 into the single piece cylinder receiver - jet 51 . the cylinder receiver - jet 51 is permanently attached to the vented inflator housing 55 . the continuously vented inflator housing 55 creates simple injector volume amplification 57 . the center drawing of fig2 is an another simple continuous discharge volume - amplified inflator that can function as a low - pressure or high - pressure inflator 70 due to inclusion of an intake vent cover 72 . the economy of inflator 70 is that the receiver and inflator are made from a single piece 74 . the pierce and jet means 73 are threaded into the receiver - inflator body 74 . in the middle drawing the rotating barrel vent cover 72 is in the open position 75 . the simple volume amplified inflator 70 draws in ambient air through intake 10 and through orifice 81 in the barrel cover 72 . even without incorporation of a venturi the high - pressure air stream from the jet orifice draws in sufficient ambient air to allow a small cylinder to fully inflate a single large bladder pfd . the lower drawing is of an inflator with venturi amplification 35 , and an on / off / variable flow valve 2 with barrel vent cover 72 capable of converting the inflator between high or low - pressure operation . this combination of features creates a 1 to 1 high - pressure direct inflation or a venturi amplified volume inflated , variable - pressure , variable discharge duration and rate , variable displacement , compressed gas inflator 80 depicted in the vent closed position 76 . in the insert to the right the rotating barrel vent 72 is in the closed position 76 in which gasket 71 seals the cover 72 to inflator body allowing high - pressure operation . in the sealed closed position the inflator functions as a traditional high - pressure low - volume inflator in which the final displacement is strictly limited to the amount of compressed gas available to expand once released from the cylinder . in the lower drawing the inflator 80 is constructed from a single piece 51 threaded cylinder receiver 33 and jet 34 which is permanently attached such as by press fit or ultrasonic weld 82 to the venturi component 35 . fig3 illustrates a range of valving mechanisms which add a level of complexity to manufacture and cost but allow the inflator to conserve the compressed gas resources of a single cylinder to inflate a series of bladders . seal - then - pierce valve 2 , needle valve 101 or spool valve 111 not only act as on - off valves allowing inflation of multiple bladders but the incorporation of a valve also allows regulation of flow rate which is inversely proportional to the final displacement generated per gram of co2 . the upper left hand drawing of fig3 is of a nested orifice , venturi amplified volume , variable - pressure , variable discharge duration and rate , variable displacement compressed gas inflator 90 . compressed gas passes through fenestration 8 into passageway 94 between the pair of nested jets 91 . the diameter of passageway 94 can be varied by threaded adjustment 92 . the passageway 94 can be reduced until orifice shut off plug 93 prevents any pressurized gas from exiting the jet . the nested jet inflator is comprised of three parts , the venturi end piece 96 , the outer jet piece 97 and the cylinder - receiver piece 98 . in the upper left hand drawing of fig3 an oscillating means 99 is directed in towards the jet orifice such that if the downstream bladder is full the ambient air intake 10 is now converted to a pressurized air egress . as the gas moves from a zone of high pressure to ambient pressure an oscillating membrane 99 alerts the operator to convert the inflator 90 into a high pressure inflator by closing ambient air intake 10 with vent cover 11 . alternatively the operator can shut off the inflator by twisting the cylinder into the seal then pierce / stp valve 2 or twist the nested jets 91 to shut off and thereby conserve the remaining pressurized gas for other survival devices such as distress markers , life rafts or air horns . the upper right hand drawing of fig3 is of a volume amplified inflator 100 , specifically a venturi amplified volume , variable - pressure , variable discharge duration and rate , variable displacement compressed gas inflator with in - line shut off and flow adjustment valve . needle valve 101 turns to align eccentric orifice 102 allowing regulated release of the compressed gas . the eccentric orifice allows for a very gradual release of 800 psi compressed co2 . the needle valve 101 is sealed by needle valve o - rings 103 . the valve is held into the inflator body by valve retainer clip 104 . the lower right hand drawing of fig3 is of a thread advanced spool valve , venturi amplified volume , variable - pressure , variable discharge duration and rate , variable displacement compressed gas inflator 110 . as the spool valve 111 is turned threads 112 very gradually advance the spool valve passageway 113 past / off the spool valve on / off o - ring 115 allowing compressed gas to flow into the jet conduit 46 and out the jet orifice 9 toward the venturi end piece 96 . an outer o - ring 114 seals the high - pressure portions of the valve from the environment . in threaded spool valve inflator 110 the single piece threaded cylinder receiver and jet 51 houses the thread advanced valve and includes oversized finger grips 116 to facilitate mounting the cylinder and regulating the inflator without straining the connection to the fabric bladder . fig4 is a pair of water activated or manually activated venturi amplified volume , variable - pressure , and variable displacement compressed gas inflators 130 . in the inflator the water sensitive bobbin 131 is exposed or protected from access to water by sliding cover 134 which is sealed by o - ring means 135 . in the left hand drawing the cover is down exposing the fenestrations 133 to the environment and the inflator is set to function as a water or manually activated inflator 140 . when cover 134 is in the up position as seen in the inflator on the right , the fenestrations 133 are sealed away from the environment and the inflator is in the manual - only activation mode 141 . in both inflators the moveable pierce means 136 is sealed by pierce means o - ring 137 to prevent loss of high pressure compressed gas . in both inflators the lower portion of the inflator 144 threads together with upper portion 145 at thread 138 . during threading water sensitive bobbin 131 pushes driver 147 which is an extension of driver plate 146 which compresses spring 139 . the water sensitive bobbin 131 holds spring 139 in a state of compression . if the fenestrations 133 are exposed to water the bobbin 131 deteriorates and the driver 146 advances through bobbin 131 driving pierce means 136 through the co2 cylinder seal . the water - activated inflator on the right includes a threaded spool valve 111 that allows the compressed gas jet stream to be turned off and on to allow inflation of multiple bladders . the ability to regulate rate of flow allows rapid inflation of the life jacket and then slower volume - amplified inflation as required to inflate a high volume bladder such as a personal life raft . during storage the fenestration cover 134 is in the closed position as seen in the right hand drawing of fig4 . during storage which can be typically 95 % to 99 % of the time for recreational life jackets , the silica gel bobbin 132 protects the water sensitive bobbin 131 from humidity extending the shelf life of the water sensitive inflator mechanism . on the right side of fig4 at the receiver end of inflator 141 a spring positioned cam 142 allows the hardened thread cutter - degrader 143 to move out of way during installation of the co2 cylinder . however as the cylinder is being removed the cutter 143 is forced into the exiting threads destroying the threads so that the micro - pierced spent cylinder cannot pass back over the low tolerance entrance threads 40 . in the left hand drawing in fig5 a full bore externally mounted radio frequency welded , coupler 150 slides over a standard rf weldable right angle connector 152 . specifically full bore fitting 151 slides over connector until dual function connector stop and valve seat 155 prevents further progress of coupler 151 over connector 152 . coupler 151 is a dual position externally mounted coupler that allows inflator integrated full bore check valve 153 to be operable in one position 154 then be compressed without twisting into a locked closed valve 163 . a high flow check valve such as 153 is very soft and will fold upon itself if turned while contacting a surface . however a supple low resistance check valve such as 153 can be sealed by direct compression . the inflator - coupler - check valve 157 integrates the check valve 153 at the end of the inflator . the inflator 157 includes quarter turn pin 28 that slides along the dual - position dual - locking quarter turn grooves 158 and high pressure seal is achieved by check valve o - ring 156 . in the middle drawing of fig5 the custom molded coupler 161 is integrated into the manufacture of the tubing connector 160 . the coupler - connector is fused 162 during manufacture . in the second drawing the check valve is compressed 163 against seat 155 . in the right hand drawing of fig5 an independent full bore inflate / deflate / check valve - coupler 170 includes finger grips 171 . the coupler can be used separately as an oral inflate valve , removed to be a wide bore deflate valve or locked closed by compression against stop / valve seat 155 . the mushroom flapper valve 153 mounts by way of mushroom valve post 159 onto coupler 170 . in the lower left hand corner of fig5 inflator 157 is connected via inflator mount means 28 to a combined oral / compressed gas air horn 172 and quarter turn mount means 177 on the air horn 172 . the air horn 172 is self orienting due to inclusion and positioning of ballast moment 173 and buoyant moment 174 . valve 101 provides flow / volume control for air horn 172 . nano - pierce orifice 176 further reduces the flow rate from volume amplified inflators . compressed gas cylinders such as o2 or co2 supply the pressure that is coupled through inflator 157 and valve 101 to air horn 172 . an oral check valve 175 allows oral use of the air horn 172 if there is no remaining compressed gas . either oral or cylinder compressed gas vibrates membrane 178 producing a piercing audible alarm . in the lower right hand insert of fig5 shows a detail of the dual - position quarter turn safety lock coupler or valve - coupler 180 . the quarter turn entrance 182 leads to the quarter turn right angle groove 186 . at the end of the quarter turn groove the inflator 157 or coupler 170 is pulled back over locking ridge 181 into the check valve operating position 185 or pushed forward over locking ridge into a continuously tensioned compressed - closed position 184 . the locking ridge applies continuous pressure against the valve and seat converting the check valve into a secure shut off valve . two locking ridges 181 create friction locks to secure the full bore amplified volume inflator check valve 157 or the full bore valve coupler 170 in either the locked open position 185 or locked closed 184 . in either the locked open 185 or locked closed 186 position the side safety lock 183 prevents the inflator or coupler from turning left or right . in fig6 the micro - pierced cylinder 202 when re - installed contributes to the high rate of failure of fielded inflatable products . the most economical solution is to degrade the threads 200 on installation or removal so that the micro - pierced cylinder cannot be installed a second time yet the volume amplified inflator can be reliably and economically operated with off the shelf co2 cylinders . in the top row the full co2 cylinder 201 is capped with a brilliant green cap which is removed before or during installation . under the green coating can be a normal cylinder 202 or red anodized threads further visually indicating a cylinder &# 39 ; s used status . in the lower row on the left of fig6 is a full cylinder which has been dipped in a bi - refringent coating 204 . upon release of the approximately 800 psi of gas the cylinder diameter reduces sufficiently to create a change in the iridescent coating signaling a spent cylinder 205 . alternatively a plastic collar 206 is removed during installation helping visually impaired or nocturnal re - arming . in fig7 mob 249 is manually orienting the cylinder 230 . mob 249 is responsible for keeping the pierced cylinder vertical 231 regardless of the size of the direction of size of the waves 234 . simultaneously the mob 249 is converting the default mode of operation , high - pressure low - volume , into a high - volume low - pressure inflator by manually holding the venturi cover 11 in the open position 232 , thereby exposing the ambient air intake 10 . the operator is responsible for assuring that air rather than water is entrained during inflation of raft 236 . by holding the cylinder vertical 231 , the remaining liquid compressed co2 stays at the bottom of the cylinder 248 at the opposite end from the pierced orifice in the cylinder seal . in fig7 the mob 249 is wearing a double chambered inflatable pfd such as a solas pfd 241 . the solas pfd is required to have two chambers in this case an upper chamber 244 which is automatically inflated upon contact with the water . an existing ul approved water activated inflator 242 has been retrofitted with a valve and venturi so that if the operator so chooses the upper chamber can be slowly inflated utilizing the venturi conserving the vast majority of the compressed liquid co2 233 for use in inflating other devices or operating an air horn . of note the optional venturi operation requires the operator to keep the cylinder vertical and free of water while the ambient air intake is held open . in addition a pivoting co2 manifold 246 allows the cylinder to be positioned vertically so that only gas and not compress liquid gas can be passed through the inflator . a middle gas retentive layer 243 divides the upper chamber 244 from the lower chamber 245 . since the upper chamber 244 and lower chamber 245 share a common wall 243 this dual chamber design can only benefit from inflation of a single chamber . given reliable operation of the water activated inflation system and chamber , the redundant manual inflator 237 can be removed from the lower chamber 245 and used to inflate raft 236 . the ul listed manual inflator 237 is retrofitted with a simple continuous discharge , single use , low - pressure volume amplified inflator 240 . this volume amplifying add on is similar to item 50 in fig2 . that is once the ul listed inflator is jerked to pierce the cylinder the entire contents will be passed through the inflator and retrofit venturi until spent . raft 236 provides 300 lb of displacement yet can be fully inflated by a volume amplified 38 gm co2 . of note the same 38 gin co2 when used in the default or traditional rapid , high - pressure , low - volume mode of operation it only generates approximately 35 lbs of displacement . if the mob 249 elects to manually inflate the lower chamber 245 of his pfd 241 and then manually inflates the majority of his raft , use of the upper inflator which includes an on - off valve a small portion of high pressure gas to be used to top of the raft to approximately 2 . 5 psi . once the raft is rigid the operator can turn off the gas with inflator 242 preserving the residual gas 233 for operation of the air horn 172 as seen in fig5 . once the raft 236 is inflated in fig7 , the regulated venturi retrofit inflator 242 is disconnected by quick disconnect means 28 from the bladder mount quick disconnect means 235 and cap 238 used to provide secure pneumatic seal . the remaining compressed gas is then available for operating other safety gear . fig8 is lateral view of ul listed inflators that have been retrofitted with venturi amplification . a ul listed water activated inflator 260 is seen in the lower drawing of fig8 . after puncture of the cylinder the compresses gas enters the venturi through the usual orifice 265 in inflator 260 . it passes through valve 101 then through jet orifice 9 . the stream of high speed gas pulls in ambient air through intake 10 that is open because the rotating barrel cover 75 which is aligned to the orifice in the barrel cover 81 is aligned over the ambient air intake orifice 10 in the venturi . a releasable pneumatic coupler sleeve 269 is o - ring sealed 271 to quick release coupler and valve which is welded 267 to bladder 266 . a mushroom check valve 153 is mounted on post 159 . the quick release sleeve 269 is locked onto the bladder valve by keeping the locking balls 270 tight with groove 268 in the manifold stem 275 . the locking sleeve 269 allows the inflator to pivot about the manifold stem 275 by the weight of the cylinder and gas 239 . in the upper corner of fig8 ul listed manual inflator 261 is mounted onto a threaded chamber 264 that receives the compressed gas . ul listed nut 263 secures the retrofitted simple venturi 240 in place on the existing manual inflator 261 . quick disconnect means 28 allows the retrofitted manual inflator to mount onto a pivoting coupler 274 with an integrated check valve . the connection is sealed with o - ring 273 a permanent snap lock cover 272 allows for pivoting of the venturi inflator about bladder check valve . quarter turn entrance groove 182 receives quick disconnect mounting means 28 built into the end of the venturi inflator . once the raft is inflated a sealing cap 238 can be mounted and sealed by o - ring 273 to prevent slow leaks through mushroom valve 153 as identified in the lower drawing . in fig9 an co2 inflator of any type with cylinder thread degrader / eraser with cylinder position indicator 290 has a drive pin 291 that is pushed up as the cylinder is threaded in . the force is turned about a pivot 292 to force a die cutter 293 along a cam 296 into a position tight about the neck of the cylinder . the die cutter has a transition thread section 294 which changes into the new thread section 295 . a the force applied during threading the cylinder into the inflator 290 is re - directed into relocating the cutter tie . a locking cog 297 keeps the cutting die 293 in place as the cylinder is removed . a release 298 is operable only after the spent cylinder is free of the inflator 290 . after removal of the spent cylinder with degraded threads the inflator the cylinder will fall away being unable to engage with the fine threads 40 . as the same drive pin 291 advances a red color 299 indicating the cylinder is out of position converts to green 300 . an indicator window 301 allows the user to quickly determine if the inflator has a good cylinder in the correct position . in fig1 insert valve 321 is found inside oral inflation tube 322 . the valve is in the normally closed position 323 . insert valve 321 has been modified to include quarter turn track 30 allowing the inflator mounting means 28 to hold the venturi nozzle 325 in place which concurrently holds the valve in the open position 324 so that the least resistance possible opposes the low pressure ambient air entrained inflation . 70 simple continuous discharge high - pressure constant volume or low - pressure amplified volume inflator 74 single piece threaded cylinder receiver and vented inflator housing 75 rotating barrel vent cover in the air intake open position 76 rotating barrel vent cover in the air intake closed position 80 venturi amplified volume , variable - pressure , variable discharge duration and rate , variable displacement compressed gas inflator 90 nested orifice , venturi amplified volume , variable - pressure , variable discharge duration and rate , variable displacement compressed gas inflator 100 venturi amplified volume , variable - pressure , variable discharge duration and rate , variable displacement compressed gas inflator with in - line shut off and flow adjustment valve 110 thread advanced spool valve venturi amplified volume , variable - pressure , variable discharge duration and rate , variable displacement compressed gas inflator 130 water activated or manual activated venturi amplified volume , variable - pressure , variable displacement compressed gas inflator 136 manual or spring driven cylinder seal moveable pierce means 180 dual position quarter turn safety lock coupler or valve - coupler 237 ul listed manual co2 inflator retrofitted with volume amplification means 239 weight of cylinder and gas allow establishment and maintenance of the vertical operational orientation . 240 retrofit simple continuous discharge , single use , low - pressure volume amplified inflator ( see 50 ) 241 safety of life at sea / solas class dual chambered 35 lb life jacket 242 ul listed water activated / manual inflator retrofitted with valve regulation and volume amplification venturi 247 venturi inflator / pivoting manifold placed high on pfd positioning it out of the water 248 operator responsible for keeping liquid co2 at bottom of cylinder , away from pierced orifice in cylinder seal 270 locking balls held in position by spring loaded cover 274 pivoting venturi coupler with integrated low resistance wide - bore check valve coupler 290 generic inflator with cylinder thread degrader / eraser and cylinder position indicator the instant invention has been shown and described herein in what is considered to be the most practical and preferred embodiment . it is recognized , however , that departures may be made therefrom within the scope of the invention and that obvious modifications will occur to a person skilled in the art . | 1 |
an aspect of the invention will be described hereinafter with reference to the accompanying drawings . fig1 is a vertical cross - sectional view showing the inside configuration of a laser printer 1 . as shown in fig1 , a sheet feed cassette 3 is mounted in a lower portion of a casing 2 . the casing 2 covers the main body of the laser printer 1 from the outer circumference . the sheet feed cassette 3 can be drawn out in a front direction of the laser printer 1 ( i . e . the front when the laser printer 1 is set ; the left side in fig1 ). a supporting plate 5 pushed up by a spring 6 is provided inside the sheet feed cassette 3 . a sheet feed roller 9 is disposed above a front end of the supporting plate 5 . the sheet feed roller 9 separates a pile of sheets p as recording media disposed on the supporting plate 5 and sends it one - by - one to an image forming portion 7 . a guide 11 that reverses a sheet p conveyed by the sheet feed roller 9 , conveying rollers 12 and 12 that subsequently convey the sheet p , and a pair of registration rollers 14 and 15 that stop a leading end of the sheet p and corrects the skew of the sheet p are sequentially disposed on a conveying path of the sheet p from the sheet feed roller 9 to the image forming portion 7 . the image forming portion 7 includes a photosensitive drum 21 that serves as an image carrier and disposed inside a photosensitive cartridge 20 that serves as an image carrier cartridge . the image forming portion 7 further includes a transfer roller 22 that serves as a processing device and transfer unit . the transfer roller 22 is disposed to oppose the photosensitive drum 21 . the photosensitive drum 21 is a well - known drum formed by applying an organic photo conductor ( opc ) on the surface of a grounded metal body . a sheet p with an image formed by toner ( described below ) by passing between the photosensitive drum 21 and transfer roller 22 is sent to a fixing portion 31 . the toner image formed on the sheet p is nipped between a heating roller 33 and a pressing roller 35 and fixed by heat at the fixing portion 31 . the sheet p with the fixed image is then conveyed by a pair of conveying rollers 36 and 36 . the sheet p conveyed by the conveying rollers 36 is guided to an upper portion of the casing 2 by a guide 37 and then discharged though a pair of sheet discharge rollers 38 and 38 onto a sheet discharge tray 39 provided on the top of the casing 2 . a scanner unit 90 , which exposes the photosensitive drum 21 to laser light l , is disposed between the sheet discharge tray 39 and the photosensitive cartridge 20 . the scanner unit 90 forms an electrostatic latent image by exposing the surface of the photosensitive drum 21 to the laser light l . the scanner unit 90 includes a laser light source , a polygon mirror , an fθ lens , and a reflecting mirror , etc ( all not shown ). the configuration of the image forming portion 7 will be described hereafter in detail . the photosensitive cartridge 20 has the rotatable photosensitive drum 21 , the transfer roller 22 and a scorotron charger 23 that uniformly charges the surfaces of the photosensitive drum 21 . by the laser light l irradiated by the scanner unit 90 , an electrostatic latent image is formed on the surface of the photosensitive drum 21 charged by the scorotron charger 23 . a developing roller 41 ( a developing unit ), which is provided in a developing cartridge 40 ( to be described below ), applies toner onto the surface of the photosensitive drum 21 and the electrostatic latent image is subsequently developed . the toner stuck to the photosensitive drum 21 is transferred onto a sheet p passing between the photosensitive drum 21 and the transfer roller 22 . thus , the image is formed on the sheet p through the above - described operations . the developing roller 41 is rotatably supported in the developing cartridge 40 and rotates while contacting with the photosensitive drum 21 . the developing cartridge 40 also includes a toner accommodating portion 42 accommodating toner , an agitator 43 agitating the toner in the toner accommodating portion 42 , a feed roller 44 applying toner discharged from the toner accommodating portion 42 by the agitator 43 to the developing roller 41 , a developing blade 45 frictionally charging the toner stuck on the surface of the developing roller 41 and forming a thin layer of the toner , etc . fig2 a is a side view of the developing cartridge 40 and fig2 b is a vertical cross - sectional view of the photosensitive cartridge 20 . as shown in fig2 b , the developing cartridge 40 and photosensitive cartridge 20 that compose a process cartridge indicated by a solid line are detachable from the laser printer 1 . the developing cartridge 40 is detachably mounted in the photosensitive cartridge 20 by fitting a rotational shaft 41 a of the developing roller 41 into guide grooves 20 a formed at both sides of the photosensitive cartridge 20 . the developing cartridge 40 is provided with an electrode 51 having one end 51 a protruding downward from the developing roller 41 in a direction perpendicular to the rotational shaft 41 a and the other end 51 b protruding from the right side ( this side in a direction perpendicular to the sheet of fig1 a and 2 b ) of the toner accommodating portion 42 in the direction of the rotational shaft 41 a . when the process cartridge is mounted in the main body of the laser printer 1 , the end 51 b of the electrode 51 contacts with a leaf spring - shaped electrode 53 provided in the main body of the laser printer 1 , as shown in fig3 a . as shown in a side view and rear view of fig3 a and 3b , the end 51 a of the electrode 51 is formed in a plate shape that is perpendicular to the rotational shaft 41 a of the developing roller 41 . the lower surface of the developing cartridge 40 functions as a guiding surface that guides a sheet p between the photosensitive drum 21 and the transfer roller 22 . a plurality of ribs 40 a for guiding is provided along the conveying direction of the sheet p . as shown in fig3 b , the largest width wa for sticking toner on the photosensitive drum 21 using the developing roller 41 and the largest sheet width wb that is available to the laser printer 1 are shown for reference . as shown in fig3 b , the end 51 a of the electrode 51 is disposed outside the largest available sheet width wb and protrudes downward from the guiding surface . fig4 is a partial view of a part of the photosensitive cartridge 20 lower than the photosensitive drum 21 . as shown in fig4 , the upper surface of the photosensitive cartridge 20 is also used as a guiding surface guiding a sheet p between the photosensitive drum 21 and the transfer roller 22 and has guiding ribs 20 b that face the above - mentioned ribs 40 a . an end 61 a of an electrode 61 is disposed to face the end 51 a of the electrode 51 . the end 61 a branches into two parts to interpose the end 51 a of the electrode 51 between them and they hold the end 51 a tight in an axial direction of the rotational shaft 41 a using resin elasticity . on the other hand , the other end 61 b of the electrode 61 is in contact with a metallic rotational shaft 22 a of the transfer roller 22 . the end 61 b is formed into a leaf spring , and in contact with the rotational shaft 22 a , by pressing the end of the rotational shaft 22 a in the axial direction . accordingly , when the developing cartridge 40 is mounted in the photosensitive cartridge 20 as shown in fig2 b , the end 51 a of the electrode 51 is interposed between the two parts of the end 61 a of the electrode 61 and they are electrically connected . since the end 51 a of the electrode 51 is interposed between the two parts of the end 61 a of the electrode 61 , the developing cartridge 40 is positioned in the axial direction of the developing roller 41 with respect to the photosensitive cartridge 20 . when the photosensitive cartridge 20 and the developing cartridge 40 that are combined into a unit ( a process cartridge ) are mounted in the main body of the laser printer 1 , the end 51 b of the electrode 51 is brought into contact with the electrode 53 and bias voltage is applied from the main body to the transfer roller 22 through the path of the electrode 53 → the electrode 51 → the electrode 61 → the rotational shaft 22 a . the bias voltage is constant - current - controlled by a control circuit ( not shown ). as described above , toner stuck on the photosensitive drum 21 is transferred onto a sheet passing between the photosensitive drum 21 and the transfer roller 22 by electrostatic attractive force . as the developing cartridge 40 is positioned , the photosensitive drum 21 and developing roller 41 are appropriately positioned with respect to each other . as a result , the electrostatic latent image formed on the photosensitive drum 21 is developed by toner excellently . when the developing cartridge 40 is separated from the photosensitive cartridge 20 , the electrodes 51 and 61 are electrically disconnected . accordingly , when only the photosensitive cartridge 20 is mounted in the main body of the laser printer 1 , bias voltage is not applied to the transfer roller 22 . therefore , bias voltage is prevented from being applied to the transfer roller 22 when the developing cartridge 40 is not mounted in the printer , thus effectively preventing damage to the photosensitive drum 21 . the both ends 51 a and 61 a are disposed outside the sheet conveying path formed by the guiding surfaces where ribs 40 a and 20 b are formed . accordingly , when the ribs 20 b and 40 a are not normally positioned and a sheet p is not guided between the photosensitive drum 21 and transfer roller 22 , the ends 51 a and 61 a are disconnected , and bias voltage is not applied to the transfer roller 22 . therefore , bias voltage is prevented from being applied to the transfer roller 22 when a sheet p cannot be guided between the photosensitive drum 21 and transfer roller 22 . as a result , damage to the photosensitive drum 21 is surely prevented . although the aspect of the present invention has been described in connection with the detailed aspects of the present invention , it will be apparent that various modifications and changes may be made thereto without departing from the scope and spirit of the invention . for example , the image carrier may not be formed in a drum shape , but may be a belt shape of a photosensitive belt , and may be detachably provided in the main body of the laser printer 1 . the transfer unit may not be limited to the roller , but may be a transfer belt or a transfer charger . the processing device may not be limited to the transfer unit , but may be other processing devices such as a conventional charging device that uniformly charges the surface of the photosensitive drum , or a conventional cleaning device that removes the toner or dusts from the surface of the photosensitive drum . as was described , according to the above configuration , when the developing cartridge is mounted with respect to the image carrier , the electrodes provided at the processing device and the developing cartridge , respectively , are connected with each other and an electric current flows into the processing device . accordingly , voltage is applied between the processing device and image carrier and an image is formed on a recording medium . further , when the developing cartridge is mounted with respect to the image carrier , the developing cartridge is positioned in the axial direction of the developing roller by connection of the pair of electrodes . therefore , an image is excellently formed on a recording medium . because the above - mentioned axial arrangement does not require severe precision , the electrodes are enough for the arrangement and other control members may not be required . when the image carrier is separated from the developing cartridge , electric current cannot flow into the processing device in view of the structure because the electrodes are separated . accordingly , when toner cannot be applied onto the image cartridge due to the separation of the developing cartridge , voltage is not applied between the image carrier and processing device . therefore , it is possible to prevent damage to the image carrier . although the configuration of the electrodes is not limited , the developing cartridge may be configured so as to be detachable in a direction perpendicular to the axial direction of the developing roller and may be positioned by pinching one electrode of the developing cartridge or processing device by the other electrode in the axial direction . a variety of processing device are considered , but the processing device may be a transfer unit to which bias voltage acting between the image carrier and the transfer unit is applied and that transfers the toner stuck on the surface of the image carrier onto the recording medium . in general , a transfer unit is constant - current - controlled for maintaining predetermined charged amount of a recording medium . in this configuration , when the developing cartridge is separated and the transfer unit is constant - current - controlled , excessive voltage may be applied to the image carrier . however , when the processing device is the transfer unit , voltage is not excessively applied to the image carrier . accordingly , damage to the image carrier is effectively prevented . | 6 |
it will be noted that the structure of the power drive unit of fig2 is similar to that of fig1 and like components bear the same reference numerals in both drawings . it can be seen therefore that the arrangement of the motor 16 together with its output shaft 17 and brake 18 is unchanged as is the roller assembly 14 and the gear train 24 , 43 , 44 , 45 transmitting drive from the shaft 25 and pinion wheel 24 to the rollers 15 a . furthermore , the second gear train which transmits rotation of the shaft 26 through the gears 29 , 31 , 33 , 34 , 35 , and 36 to the cam shaft 37 to move the cams 38 angularly is also unchanged . however significant changes have been made in the arrangement whereby drive from the shaft 25 ( driven by the shaft 17 of the motor 16 ) is transmitted to the shaft 26 . it can be seen in fig2 that the shaft 25 carries , at its end remote from the motor 16 the input member 72 of an electro - magnetic clutch 71 . an output member 73 of the clutch 71 is positioned co - axial with the input member 72 and is coupled to a shaft arrangement 74 separate from , but having its axis co - extensive with , the shaft 25 . the shaft 74 is secured to the input of a torque limiting arrangement 75 of known form which may be similar in its structure and operation to the torque limiting device 27 of the arrangement described with reference to fig1 . a detailed understanding of the operation of the torque limiting device is not necessary to an understanding of the invention , and it is sufficient to recognise that rotation of the shaft 74 will be transmitted through the torque limiting device 75 to a further shaft 76 separate from , but having its axis co - extensive with the shaft 74 , provided that the torque to be transmitted does not exceed a pre - determined value . if the shaft 76 is held against rotation while the shaft 74 rotates then a point will be reached at which the torque applied to the device 75 exceeds the set value of the device 75 whereupon the device will slip so that the shaft 74 rotates relative to the shaft 76 . the shaft 76 at the output of the torque limiting device 75 is an integral extension of the shaft 26 and has rotatable therewith a brake element 78 of an electro - magnetically operable brake 77 . a fixed brake element 79 secured to the frame 11 co - acts with the rotatable brake element 78 so that when the electro - magnetically operable brake is energised the elements 78 and 79 are held against relative rotation and thus the shaft 26 is held against rotation relative to the frame 11 . as illustrated diagrammatically in fig4 of the drawings the pdu includes an electronic control system 80 effecting control over energisation of the motor 16 , operation of the brake 18 , operation of the clutch 71 , and operation of the brake 77 . with the pdu of fig2 in its rest position , that is to say with the frame collapsed so that the periphery of rollers 15 a is below the load carrying plane of the cargo deck , a control input in the form of a “ raise ” command given by an operator by means of switches or the like is accepted by the control system 80 which then energises the electric motor 16 and de - energises the brake 18 so that the brake 18 is released . simultaneously the clutch 71 is energised and the brake 77 is de - energised so that rotation of the output shaft 17 of the motor is transmitted from the shaft 25 through the clutch 71 , the torque limiting device 75 , and the shaft 26 to the second gear train connecting the shaft 26 to the shaft 37 of the cam arrangement . at the same time drive is transmitted from the drive pinion 24 of the shaft 25 through the first gear train to the rollers 15 a to rotate the rollers . rotation of the shaft 37 in the frame is accompanied by movement of the cams 38 relative to their respective cam followers and thus the frame 11 is pivoted about the axis 13 to raise the rollers 15 a through the aperture in the deck panel of the cargo compartment . the speed of operation of the motor 16 is pre - determined , and thus the time taken for the frame 11 to be raised from its rest position to its fully operative position is known . the control system 80 includes a timing arrangement 80 a which , at the lapse of a pre - determined period of time from energisation of the motor 16 , signals the control system 80 to energise the brake 77 and de - energise the clutch 71 . the period of time set by the timer 80 a is in excess of the amount of time calculated for the motor 16 and cams 38 to raise the frame 11 from its rest position to its fully raised position . thus as the frame reaches its fully raised position the cams 38 will engage the stops associated with the cam followers and further rotation of the shaft 37 will be prevented . the shaft 26 will thus cease to rotate and as the shaft 25 is continuing to rotate the torque limiting device 75 will slip permitting rotation of the motor 16 to continue , driving the rollers 15 a , even though the shaft 37 can rotate no further . the control system 80 energises the brake 77 to lock the shaft 26 against rotation in either direction , fractionally before de - energising the clutch 71 ; this of course does not have any impact on the operation of the pdu since the shaft 26 was already stationary , and the device 75 was slipping . however disengagement of the clutch 71 disconnects the shaft 25 , and therefore the motor 16 , from the shaft 26 and shaft 37 . the brake 77 in preventing rotation of the shaft 26 in either direction , locks the frame in its fully raised position by locking the cams 38 against movement . however , transmission of drive to the rollers 15 a is not affected and no power is now being dissipated in the torque limiting device 75 since disengagement of the clutch 71 has disconnected the torque limiting device from the shaft 26 and thus no drive is applied to the torque limiting device . it will be understood that in the pdu illustrated in fig2 should it become necessary to reverse the direction of rotation of the rollers 15 a then the polarity of the motor 16 can be reversed , if necessary using the brake 18 momentarily to arrest rotation of the shaft 17 of the motor , the first gear train , and the rollers 15 a , to reverse the drive to the rollers 15 a . as the clutch 71 is disengaged the reversal of rotation of the motor 16 has no effect whatsoever on the shaft 37 and the cams 38 and thus the frame 11 remains in its raised position throughout the change in drive rotation to the rollers 15 a . clearly , by comparison with the arrangement shown in fig1 there are two immediate and very significant advantages . firstly , during normal operation power is dissipated in the torque limiting device 75 for a brief period only . thereafter the clutch 71 is de - energised and no further power dissipation in the device 75 is required while the frame is maintained in its raised position . secondly , when drive reversal to the rollers 15 a is required , such drive reversal can be achieve extremely quickly , and does not require the “ lift lower lift ” sequence necessitated by the mechanical arrangement of fig1 as the disengagement of the clutch 71 has disconnected the raising mechanism from the motor drive to the rollers . where it is necessary to apply a braking action to a uld or the like the motor 16 can be de - energised and the brake 18 can be applied so that rotation of the rollers 15 a is braked . again this has no bearing on the operation of the lifting and lowering cam mechanism of the frame 11 since the clutch 71 is disengaged . when the operator wishes to lower the rollers 15 a to their rest position a “ lower ” signal given to the control system 80 causes the control system 80 to de - energise the brake 77 so that the brake element 78 is free to rotate relative to the brake element 79 and thus the cam shaft 37 and the cams 38 can be rotated back to their rest position , to allow lowering of the frame 11 about the axis 13 , under the action of the return springs 41 acting on the shaft 37 . as the cams 38 rotate back towards their rest position the frame 11 pivots back to its rest position under gravity . a possible area of difficulty noted with the mechanism of fig2 is that when the clutch 71 is disengaged and the brake 77 is engaged then the position of the frame 11 is locked . thus in the event that raising movement of the frame 11 is impeded , for example by the rollers 15 a engaging a downwardly protruding of part of a uld or the like , then raising movement of the frame will be obstructed at a point before the fully raised position is achieved . before the obstruction is cleared the torque limiting device 75 will be slipping , and the timer of the control system 80 may well have signalled the application of the brake 77 and the disengagement of the clutch 71 . thereafter , should the obstruction to full raising of the frame 11 be removed the frame will not achieve its fully erected position since the clutch 71 will be disengaged and the brake 77 will be preventing any further movement of the shaft 37 and cams 38 . thus irrespective of removal of the obstruction frame 11 will not be fully raised . an associated problem has also been noted in the situation where the frame 11 is fully raised , and is impacted by a “ low - point ” on an uneven uld , or is impacted by a uld or the like being overweight or dropped onto the rollers 15 a . because the shaft 37 and cams 38 are locked by the brake 77 the only way in which such sudden shock loadings on the rollers 15 a can be accommodated is by flexure of the rubber tyres of the rollers , and this may not be sufficient to prevent damage to the pdu in all circumstances . accordingly , in order to overcome these disadvantages noted in the construction of fig2 the manner in which the frame 11 is supported from the fixed support structure of the deck is arranged to include resiliently compliant couplings . a preferred arrangement of such a coupling is illustrated with reference to fig3 which shows one of a pair of chassis members 81 by means of which the frame 11 is secured to the rigid support structure 82 of the deck of the cargo area . each chassis member 81 extends beneath the deck panel of the deck of the cargo area and is apertured at one end 83 to receive a pivot pin extending through a respective mounting 12 of the frame 11 . thus the pivot pins pivotally secure the frame 11 to the two chassis members 81 for pivotal movement about the axis 13 . the chassis members 81 extend beneath the frame 11 in use and each has an upstanding cam follower 84 engageable by a respective cam 38 of the frame 11 . at its end remote from the pivot axis 13 each chassis member 81 is bolted to an adaptor rail 85 which in turn is secured to the structure 82 through a resiliently compliant coupling 86 . it will however be understood that in some embodiments it will be appropriate to manufacture the chassis members 81 with the adaptor rails as integral parts of the members 81 . each coupling 86 includes a spring arrangement which may be a coil spring or , as shown in the drawings , a stack of “ bellville ” spring washers 87 , one end of the stack engaging the support structure 82 , and the opposite end of the stack acting through a load washer 88 against the head 91 of an elongate bolt 89 . the shank of the bolt 89 extends through pack 87 and through a clearance aperture in the structure 82 into screw threaded engagement with a part - spherical nut 92 on the respective adaptor rail 85 . normally the pre - stressing of the spring washers of the pack 87 holds the adaptor rail 85 in facial contact with a surface of the support structure 82 . however , a load applied to the chassis member 81 sufficient to overcome the pre - stressing of the spring pack 87 will cause the chassis member 81 and its associated rail 85 to deflect relative to the support structure 82 further compressing the spring pack 87 . it will be recognised that where the load on the chassis member 81 is removed then the restoring action of the spring pack 87 will return the chassis member 81 and the associated rail 85 to appropriate alignment with the structural member 82 . in operation therefore when the frame 11 is being raised relative to the chassis members 81 , should the raising movement of the frame 11 be obstructed then sufficient torque can be applied by way of the torque limiting device 75 to deflect the or each chassis member 81 relative to the support structure 82 so permitting the frame 11 to reach its fully raised position relative to the chassis members 81 . thereafter the brake 77 will lock the frame 11 in its fully raised position relative to the chassis members 81 and when the obstruction to raising movement of the frame 11 is removed the spring packs 87 will restore the alignment of the chassis members 81 and the structural supports 82 thus lifting the frame 11 to occupy the fully raised position relative to the deck panel . similarly , should the rollers 15 a be subjected to impact loadings having a vector in the direction of lowering the frame 11 then the resiliently compliant mountings 86 will deflect to allow deflection of the frame 11 and rollers 15 a rather than the mechanism being subject to the risk of damage . the chassis members 81 and frame 11 will be restored to their original positions upon removal of the impact loading by the restoring action of the spring packs 87 . it will be understood therefore that although the pdu described in relation to fig2 can be used without the resiliently compliant mountings , the mountings are used in a preferred embodiment to enhance the performance of the pdu . in a modification of the pdu described above a sensor 90 of any convenient form monitors rotation of the shaft 37 and so can signal the control system 80 when the lift cams 38 are in a fully operational position . such a signal can be used by the control system 80 to initiate operation of the brake 77 to lock the frame 11 in the fully raised position and to disengage the clutch 71 . if desired the sensor 90 can replace the timer 80 a as the “ lock ” signal generator , but desirably the sensor is used in conjunction with the timer , the signal from the sensor 90 being gated by the control system 80 with the signal from the timer 80 a to ensure that locking of the frame in the raised position occurs in response to receipt of the first of the two signals . if desired the gating can ensure that locking occurs only on receipt of both signals . | 1 |
referring to the drawings , the invention is shown in fig1 as part of a well known xerographic copy machine comprising a xerographic plate including a photoconductive layer of a light receiving surface on a conductive backing and formed in the shape of a drum , generally numerically designated 10 which is journaled in the frame of the machine by means of shaft 11 . the xerographic plate is rotated in the direction indicated in fig1 to cause the drum surface to pass sequentially through a plurality of xerographic processing stations . for the purpose of the present disclosure the several xerographic processing stations in the path of movement of the drum surface may be described functionally as follows a charging station a , in which a uniform electrostatic charge is deposited on the photoconductive layer of the xerographic drum ; an exposure station b wherein a light or radiation pattern of an original document to be reproduced is projected onto the drum surface to dissipate the charge found thereon in the exposed areas to form a latent electrostatic image ; a development station c , at which a xerographic developing material having toner particles possessing an electrostatic charge opposite to the charge found on the drum surface in the latent images are cascaded over the moving drum surface whereby the toner particles adhere to the electrostatic latent image to make visible the image in the configuration of the original document to be reproduced ; a transfer station d , in which the xerographic powder image is electrostatically transferred from the drum surface to a final support material ; and a drum cleaning and toner collecting station e , wherein the drum surface is first charged and then wiped with a doctor blade to remove residual toner particles remaining thereon after image transfer and wherein the removed toner is collected for reuse in the xerographic process and in which the drum surface is exposed to an incadescent panel to effect substantially complete discharge of any residual electrostatic charge remaining thereon . detailed descriptions of the operation and construction of the various processing stations is well known in the art , as exemplified by u . s . pat . nos . 3 , 678 , 896 and 3 , 752 , 576 . for this reason , only a description of those portions of the system pertinent to the invention will be presented in more detail . the invention is incorporated into the cleaning station of the type shown in fig1 which operates to remove substantially all residual toner particles remaining on the xerographic drum surface after image transfer and recovers the residual toner as removed for reuse in the automatic reproducing apparatus in a manner to be described below . the cleaning station comprises a rectangular shaped flexible blade 47 to remove residual toner from the moving drum surface . the blade is mounted in blade holder 51 forming one wall of cleaning and collection apparatus 40 ( fig1 ). the blade normally rests transversely in pressure contact with the photoconductive layer on the drum surface . the blade is positioned so that the contacting edge cuts or chissels toner material from the drum surface . because of the blade &# 39 ; s novel cleaning action , the toner particles are cut cleanly from the plate surface and are allowed to fall freely into the collecting trough provided . as a result , the toner particles substantially retain their initial integrity throughout the cleaning process and are therefore in a condition to be immediately re - used in the xerographic process without recourse to further treatment or processing thereof . suitable materials out of which the blade may be constructed are described in the aforementioned patents . by positioning the doctor blade 47 slightly below the horizontal center line of the drum surface and providing the blade with a slight back rack , the removed residual toner material is forced to fall to the backside of the blade , that is , to the side away from the photoconductive drum surface and into an open sided channel 53 , fig2 adjacent to and running longitudinally along the drum surface . a screw type conveyor 55 comprising a shaft 54 which carries a spiral thread 56 is supported for rotation in the channel 53 in substantially parallel relation to the doctor blade . the open sided channel 53 is closed at one end ( not shown ) while the opposite end of the channel communicated with a toner filter arrangement 100 , fig2 according to the invention . the conveyor 55 and the channel 53 cooperate to convey the toner particles removed from the drum surface towards and into the toner filter arrangement 100 . the filter arrangement 100 includes a housing 101 generally cylindrical in shape and having an opening 102 near the bottom thereof which communicates with a toner return tube 103 . the tube 103 operates to direct reclaimed toner exiting the housing 101 onto the bead chain conveyor 60 for return to the developer housing , as will be described in greater detail hereinafter . another opening 104 is provided in the housing 101 which communicates with the open sided channel 53 , fig2 . the shaft 54 is provided with an extension 107 which passes centrally through the housing 101 and is supported for rotation in a suitable bearing 110 in the end plate 111 of the housing 101 opposite the conveyor 55 . the extension 107 has wound thereon a stiff fibered brush 108 in the form of a helix or spiral . a cylindrical open mesh or wire screen 105 is supported coaxially with respect to the housing 101 and brush 108 spaced from both the housing 101 and outer bristles of the brush 108 . the brush 108 may be made of any one of a variety of materials and a commercially available polypropylene brush was found to perform satisfactorily . brushes having a relatively stiff fiber ( high denier ) and a low fiber density were found to perform more efficiently . high fiber density is to be avoided since it results in a large percentage of foreign matter and toner becoming lodged in the spaces between the brush fibers . in addition , the high density materials create a fine powder cloud in operation which may pose a problem if allowed to circulate inside the machine . low density material has the advantage of causing the toner particles to be forced through the screen with a pulsating sifting action and with a sufficient initial velocity so as not to block the drop tube 103 . a 20 mesh wire screen ( 0 . 030 inch square openings ) was found to be the minimum sized screen for obtaining satisfactory operation although the exact size of the screen depends in part on the characteristics of the toner material used in the xerographic process and the velocity required by the toner particles to adequately propel them onto the bead chain 60 . the mesh 105 may be supported in grooves in opposite end walls of the housing 101 . spacing the mesh 105 from the brush prevents fraying and breaking of the brush fibers which further contaminate the reclaimed toner . a clearance of approximately one sixteenth of an inch between the fiber tips and the screen has been found to operate satisfactorily . in order to permit cleaning of the screen 105 the end plate 111 includes snap type fasteners of any suitable ( not shown ) shape to permit easily coupling and uncoupling thereof to the housing 101 . removal of the end plate in this manner provide access to the screen 105 and brush 108 which may be periodically cleaned . in operation , toner material removed at the cleaning station is collected in channel 53 and moved by the conveyor 55 toward the filter housing 101 . the reclaimed toner is deposited by the conveyor 55 to the interior of the screen 105 and initially collects by gravity at the bottom of the screen adjacent the inlet opening . continuous rotation of the spiral brush 108 has the effect of distributing the collected toner along the entire lowermost surface of the screen . rotation of the brush causes a sifting action whereby toner is forced through the screen and drops by gravity via the tube 103 into a reservoir 57 above the bead chain 60 . since the openings in the screen are selected to be slightly larger than the toner particles they pass readily therethrough while foreign matter which is larger in size than toner , collects on the inside lowermost surface of the screen to be later removed . the bead chain conveyor is described in detail in the aforementioned patents and only a brief description of its operation will be presented . a bead chain drive sprocket 63 is rotatably mounted on shaft 82 which is journaled for rotation in a drive housing 61 . the drive sprocket 63 is driven directly from the main machine drive through screw conveyor shaft ( not shown ). passing over the rim of the drive sprocket 63 is an endless bead chain 60 . the drive sprocket is arranged to engage and guide the bead and like members of the chain to move the chain in the direction indicated . in the present invention , the residual toner which passes through the filter housing 101 is directed onto the chain 60 and is transported back to the developer housing 80 , fig1 by means of a conveyor system made up of supply and return tubing 66 , 67 ; developer housing connector 70 ; and toner metering and return loop 72 . the various parts making up the conveyor system are mated together so that a continuous substantially closed circuit conduit 50 having a uniform inside diameter runs from reservoir area 57 across the width of the developer housing and returns once again to said reservoir . an alternative embodiment of the filter housing 101 is shown in fig3 which increases the effective area of the screen 105 involved in the filtering operation . as seen in fig3 the housing 101 has been re - shaped to be semi - cylindrical in shape . more specifically , the lowermost quarter of the housing has been formed into a hopper having side walls 120 converting to direct toner flowing from a larger surface area of the screen 105 into the return tube 103 . this arrangement eliminates the packing of toner in areas of the housing running along the length of the filter housing but displaced to each side of the drop tube opening 102 . the design in fig3 permits the toner to slide more easily by gravity into the drop tube by increasing the angle between the lips of the housing adjacent the drop tube and the vertical . while the invention has been described with reference to its preferred embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents substituted for elements thereof without departing from the spirit and scope of the invention . | 6 |
the invention is a method of treating obesity in which gastric emptying is slowed by narrowing the pyloric sphincter or pylorus , thus narrowing the lumen of the pylorus through which food must pass from the stomach into the small intestine . the invention comprises narrowing of the pyloric sphincter or pyloric area of the stomach sufficiently to narrow the lumen of the pylorus and slow gastric emptying . by narrowing the pyloric opening of the stomach , the stomach will fill more quickly and empty more slowly as a patient eats . the clinical effect of this treatment will be to increase the time the patient feels satiated after eating , therefore decreasing the need and desire to eat and reducing the caloric intake of the patient . in accordance with the present invention , the pylorus can be caused to narrow by several means , used either alone or in combination . these means are all minimally invasive in that they are performed through an endoscope inserted through the upper digestive tract into the lumen of the stomach . one embodiment of the invention includes the injection of a bio - compatible bulking or stiffening material into the mucosal , submucosal or muscular area around the pylorus . such an injection can be accomplished by a two step process wherein an endoscopy is performed to locate the pylorus and a needle is placed through the biopsy channel of the endoscope in order to inject the bulking material . such an injection will increase the bulk and / or stiffness of the pylorus and thus narrow the gastric outlet from the stomach to the start of the small intestine . the bio - compatible bulking materials suitable for the present invention include but are not limited to collagen , fibrin and elastin as well as other naturally occurring and synthetically derived bio - compatible polymers . certain polymers such as collagen , fibrin glue , and plastic polymers have been demonstrated to be well tolerated when injected into lumen in humans . in addition , such materials are commercially available . for instance , collagen may be purchased from fribrogen , inc ., cohesion technologies , inc ., hydromer , inc ., and bard , inc ., and fibrin glue may be purchased from abbott laboratories , inc . suitable plastic polymers include enteryx ™, a flexible liquid polymer composition which may be purchased from enteric medical technologies . various other similar products for injection include , but are not limited to , contigen ® ( contigen is a registered trademark of the collagen corporation and is a protein composition for medical implants for relief of urinary tract disorders ), zyderm ® ( zyderm is a registered trademark of the collagen corporation and is a protein composition for dermal implantation ), zyplast ® ( zyplast is a registered trademark of the collagen corporation and is a collagen implant used for soft tissue augmentation ), rh collagen , dermalogen ® ( dermalogen is a registered trademark of collagenesis , inc . and is injectable human tissue for treating wrinkles and scars ), autologen ® ( autologen is a registered trademark of autogenesis technologies , inc . and is processed collagen for implantation ), and autologous fat . collagen for use in the present invention can be from several sources including porcine , bovine , or human . it can be either fibrillar or nonfibrillar . collagen can be administered in aqueous solution form or in the denatured state as gelatin . in addition , it can be administered in either a crosslinked or a non - crosslinked form . although collagen is the most commonly used bulking material , other materials can be used and may have equal or better efficacy . for instance , teflon paste , synthetic polymeric hydrogels , glycoaminoglycans , proteoglycans , silicone microimplants , durasphere ® ( durasphere is a registered trademark of advanced uroscience , inc . and consists of biocompatible , implantable microspheres for local tissue augmentation ), enteryx ™ from enteric medical technologies , and microbeads suspended in biological fluid lubricants such as dextran have been demonstrated to be tolerated when injected into human tissue . the amount of bio - compatible bulking material injected into the pyloric area of the stomach will be dependent of a variety of factors . for instance , the size of the individual , the severity of the individual &# 39 ; s obesity , and the shape and distension of the pylorus will all be determinative in calculating the amount of bulking material injected . it is estimated that the opening of the pyloric sphincter can be reduced at least 10 % and up to 90 % by the instant invention . the injection of collagen or fibrin glue into the pylorus is expected to last for 3 to 12 months . if the body absorbs the bio - compatible bulking material , it can be re - injected by a repeat of the method described . however , a number of plastic polymer injectables may be permanent . if the narrowing of the pylorus is found to be too great , the opening can be increased by the use of a balloon , which can be inserted into the pylorus and inflated to increase the opening . this flexibility in adjusting the pyloric opening to accommodate specific patent requirements provides a unique advantage over present surgical procedures . while the injection of the bio - compatible bulking material into the pyloric area will control obesity , the invention may encompass additional procedures for narrowing the pylorus . for instance , the pyloric area can also be narrowed by intentionally scarring the pyloric area with either a laser or a thermal device , such as a radio frequency probe , a monopolar electrocautery , or a bipolar electrocautery . in such an embodiment of the invention , a laser or heating device could be placed through the biopsy channel of the endoscope and used to cauterize an area of the pylorus . such an embodiment may be used as an adjunct in addition to injection of a bio - compatible bulking material or may itself be used to narrow the lumen of the pylorus and thus narrow the gastric outlet from the stomach to the mall intestine . thus , in another aspect the invention includes a method of treating obesity comprising cauterizing the pyloric area of the stomach sufficiently to cause the lumen of pylorus to narrow and slow gastric emptying . in another embodiment of the invention , a sewing device can be placed through the biopsy channel of the endoscope or attached to an endoscope and used to sew the pylorus and narrow the opening of the pyloric sphincter . this may be accomplished by placing sutures anchored on opposing sides of the pylorus , in the pyloric muscle , mucosa or sub - mucosa , then drawing the sides together and securing the sutures with a desired degree of tension or at a desired length , suitably with a movable tensioning / retaining member this method has the advantage of providing excellent control over the degree of narrowing of the pyloric outlet of the stomach , enables the practitioner to adjust the sutures as needed to accommodate individual needs and variations , and may be used alone or in combination with the injection of a bio - compatible bulking material . thus , this aspect of the invention includes a method of treating obesity comprising suturing the pyloric area of the stomach sufficiently to cause the lumen of pylorus to narrow and slow gastric emptying . in yet another aspect of the invention , gastric emptying can be further delayed by inducing a flaccid paralysis of the of the stomach . botulinum toxin will cause a paralysis of the stomach if it is strategically injected into either the muscles of the fundus or the antrum of the stomach . paralyzing the stomach in this way will prolong satiety by further delaying gastric emptying . the effects of botulinum toxin is expected to last for a period of 9 to 18 months . this aspect of the invention may be utilized in combination with any of the above identified embodiments as desired . | 0 |
referring to the drawing , there is shown therein an optical communication system having two switching units 1 and 2 , each of which could comprise an optical add / drop multiplexer or a cross - connect switch 3 , 4 . the switching units 1 and 2 are linked by two light guides which take the form of optical fibres 5 and 6 , and in practice the units 1 and 2 may be many kilometers apart . instead , however , a repeater or simple add / drop unit may be positioned at one or both ends of the link shown . the units 1 and 2 form part of a larger network which in practice , will contain many routing nodes , each of which may comprise a switching unit or an add / drop unit . the switch 3 generates , by means of an optical multiplexer not separately shown , a number of separate optical channels at different optical carrier wavelengths each of which carries voice and / or data traffic . these channels are sent along a common light fibre 7 in wavelength division multiplex ( wdm ) format to an optical amplifier 8 which amplifies the optical signals by means of high power lasers to a high power level for transmission to the distant switching unit 2 via the optical fibre 5 . a relatively low power supervisory channel signal is generated at a supervisory insert unit 9 which includes a laser source and is added to the fibre 5 by optical coupler 30 , the supervisory signal having a different carrier wavelength to each of the traffic - carrying optical channels . the supervisory channel has a much lower optical power than each of the traffic - carrying optical channels . in normal operation , the supervisory channel carries relatively low frequency ( eg . 2 mbit ) path and routing information , and frame alignment signals , and only travels from one node to the next where it is regenerated , whereas the traffic - carrying channels carry high frequency signals , and may pass through several nodes before the data traffic is regenerated . at the switching unit 2 , the supervisory channel is extracted by optical coupler 31 and passed to extract unit 10 , whilst the traffic - carrying optical channels are passed to an amplifier 11 which compensates for any reduction of optical signal level due to attenuation by the fibre 5 . the amplified signal is passed to switch 4 , which is similar to switch 3 , where the optical channels are demultiplexed , switched and routed as necessary . the optical coupler 31 is frequency selective and is operative to direct the supervisory optical channel to the extract unit 10 . the fibre 5 carries a unidirectional signal from switching unit 1 to switching unit 2 . the similar optical fibre 6 carries a unidirectional signal from switching unit 2 to switching unit 1 , and it has associated with it an amplifier 15 , supervisory insert unit 16 , optical couplers 32 and 33 , supervisory extract unit 17 and amplifier 18 in an analogous manner . the light signals generated by amplifiers 8 and 15 are very intense laser beams , and care must be taken so that they do not harm personnel . in the event of a break 20 or other malfunction in fibre 5 due to local damage , a loss of signal is detected at the laser control unit 22 . at the same time laser control unit 22 detects a loss of frame condition from the supervisory extract unit 10 and when both the loss of signal condition and loss of frame condition are detected at the laser control unit 22 , this unit shuts down the high power laser beams from amplifier . 15 and shuts down the laser in the supervisory insert unit 16 . laser control unit 21 detects that amplifier 15 has been shut down by detecting its loss of signal at amplifier 18 , and detects that supervisory unit 16 has been shut down by detecting the loss of frame condition , and in response shuts down amplifier 8 and the laser in the supervisory insert unit 9 . the break in the fibres 5 , 6 and any damage to them can be safely repaired by personnel . during the repair period , the amplifiers 8 and 15 are inhibited but the supervisory channel continues to be transmitted at its low level , and it is transmitted in a pulsed manner , so that its mean power level is further substantially reduced . typically the supervisory channel is pulsed on for about two seconds each minute , as such a pulse has sufficient duration to permit frame alignment to be recovered when its signal is received at the far end of a link . typically a frame period in a communication system is 125 μs , but a frame alignment signal must be present for many frame periods to enable signal lock and synchronization between receiver and transmitter to be achieved . the effect of this is that the frame alignment signal transmitted from switching unit 1 will be received at the far end of the link when the fibre is repaired and this is used by laser control unit 22 to turn on the supervisory insert unit 16 . when laser control unit 21 receives the supervisory channel , it acts to enable supervisory insert unit 9 . in response to correct completion of the supervisory channel loop , the amplifiers 8 and 15 are enabled , and operation of the communication system recommences . the couplers 30 and 32 are located downstream of the amplifiers 8 and 15 and as close to the output ports of switching units 1 and 2 as possible , so that even if a fault occurs in the switching units , particularly in the high power amplifiers , the supervisory channel is maintained . thus , the supervisory insert unit includes a modulated laser whose output is coupled directly without further amplification onto the respective optical fibre at the output ports of the switching unit 1 or 2 . in an optical communication system which uses a single optical fibre to carry bidirectional traffic , the above system requires modification , since a break in or damage to the fibre will result in some reflection of the transmitted signal back into a receive circuit . thus , the receive circuit would continue to receive a signal even in the event of a break . this difficulty is overcome by transmitting over the supervisory channel an identifier signal which uniquely identifies a particular transmitter . in the event of damage to or a break in the fibre , receipt of an identifier signal which differs from that expected under normal operation will cause the laser amplifiers to be shut down . as before , the supervisory channel generates pulsed signals which are used to detect repair of the fibre , and to enable the high power optical amplifiers to be reset and enabled . | 7 |
referring to fig1 one embodiment of a tension - leg platform according to the present invention is shown . the tension - leg platform ( tlp ) comprises a monopod configuration . the portion of the tlp 9 which extends above the water surface 11 comprises the monopod 10 and the platform 12 . the portion of the tlp 9 that extends below the water surface 11 comprises a main buoyancy structure 13 , pontoons 14 , and a float 15 . the main buoyancy structure 13 is cylindrical in shape with its longitudinal axis oriented in a vertical position when the tension - leg platform 9 is arranged in an operational configuration . the pontoons 14 are attached to the bottom of the main buoyancy structure 13 and extend horizontally outward from the central axis of the main buoyancy structure 13 . the float 15 is configured so that it encircles the main buoyancy structure 13 . further , float 15 may be moved from a position near the top of the main buoyancy structure 13 to a position at the bottom of main buoyancy structure 13 near pontoons 14 . the float 15 comprises a generator of a stabilizing moment because it serves to return the vertical central axis of the tlp to a vertical position upon deflection by wave , wind , etc . which act on the tlp . as shown in fig1 b , the generator of a stabilizing moment may also comprise a structure with at least three extensions 51 which extend radially out from the central axis of the tlp . displacers of seawater 52 are attached at the ends of the extensions 51 . also , as shown in fig1 c , the displacers of seawater 52 may be merged to a single structure . this structure may assume any geometric shape so long as it displaces uniform volumes of seawater symmetrically . referring to fig2 and 3a - 3g , a flow chart is shown for the construction of a tension leg platform and drawings depicting each step of the process , respectively . first , the main buoyancy structure 13 is constructed 201 with the monopod 10 attached . also , portions of the pontoons 14 are also attached to the main buoyancy structure 13 . further , the float 15 is constructed 201 separately . the main buoyancy structure 13 and float 15 are then launched 202 into the water . at this point , the float 15 lays flat upon the surface of the water while main buoyancy structure 13 is oriented horizontally . the remaining sections of pontoons 14 are attached 202 to the sections which had originally been attached to main buoyancy structure 13 . the pontoons are attached in two sections at a time because of the difficulty in transporting main buoyancy structure 13 across a surface when pontoons 14 are too lengthy . thus , main buoyancy structure 13 is rolled in the water to expose each pontoon in sequence so that an additional section may be added to each . next , the float 15 is ballasted 203 so that its central axis is oriented in a horizontal direction . the main buoyancy structure 13 is also ballasted 203 so that its central axis is also in a horizontal direction . with the pieces of the tension leg platform in the horizontal orientation , the pieces can be easily assembled . float 15 is slipped 204 over the monopod 10 and onto the main buoyancy structure 13 . it is then attached to the main buoyancy structure 13 at the end closest to the monopod 10 . next , the tension - leg platform is ballasted 205 so that it is oriented with the longitudinal axis of the main buoyancy structure 13 in a vertical direction . the float 15 also has its central axis in a vertical direction and resides just below the surface of the water 11 . thus , the main buoyancy structure 13 and the pontoons 14 extend below the surface of the water while the monopod 10 extends above the surface of the water 11 . note that in this orientation , the tension - leg platform may be transported 206 to the site for operation , although it may also be towed disassembled and assembled on site . upon reaching the site , the tension - leg platform is ballasted 207 so that the entire tension - leg platform sinks deeper into the water so as to expose only a portion of the monopod 10 . a barge 16 is used to transport a platform 12 to the operation site . the barge 16 has a notch 17 which is large enough to encircle the monopod 10 . thus , with the tension - leg platform in a lowered position , the barge 16 may position the platform 12 above the monopod 10 . the platform 12 is then assembled 208 to the monopod 10 . finally , the assembled tlp is deballasted 209 . the tension - leg platform is now fully assembled and may now be attached to the ocean floor for operation . referring to fig4 a , 5b , 5c and 6 , steps for the process of attaching the tension leg platform to the sea floor and drawings disclosing the process are shown . first , a tension leg platform 9 and a support vessel 18 are both positioned 401 over the mooring site . a tendon 19 and a remotely operated vehicle ( rov ) are attached 402 to an anchor 20 . the anchor 20 is lowered from the support vessel 18 by the tendon 19 . as the suction anchor and rov are lowered towards the sea floor 23 , the tendon 19 is unspooled from the support vessel 18 . an umbilical cord 24 for the rov and suction anchor is attached to the rov and is also unspooled as the suction anchor is lowered . after the anchor 20 is placed on the sea floor 23 , an auxiliary wire 70 is extended 403 from the tlp 9 to retrieve the free end of the tendon 19 as it is released from the support vessel 18 . alternatively , the free end of the tendon 19 may be transferred before the anchor 20 reaches the sea floor 23 by the auxiliary wire 70 and a hook wire 22 . the weight of the anchor and tendon would then be supported by the auxiliary wire 70 and hook wire 22 during the transfer . the weight of the tendon 19 and suction anchor 20 is then assumed 404 by the tlp and the rov is used 404 to place the anchor 20 in the desired location . this is done because the tension leg platform 19 is much more stable than the support vessel 18 so as to provide more stability when placing the suction anchor 20 upon the sea floor 23 . the rov 21 is operated 404 to place the suction anchor 20 in the desired location while the tendon 19 lowers the suction anchor 20 to the sea floor 23 . the suction anchor 20 is then attached 405 to the sea floor 23 and the rov is removed 405 . this procedure is more fully described below . a winch or there pulling device is then used to pull 406 on the free end of the tendon 19 until the desired tension is obtained . finally , the tendon 19 is secured 406 to the tlp . this attachment step 406 is more fully described below . upon deposit of the suction anchor 20 on the sea floor , the rov 21 and hook wire 22 are returned 405 to the support vessel 18 where they are again attached 407 to a second suction anchor 25 . a second tendon 27 is also attached 407 to the anchor 25 . additionally , a tether 26 is attached 408 from the anchor 25 to the tendon 19 which is already secured to the sea floor 23 . again , the tendon 27 is used to lower 409 the anchor 25 to the sea floor 23 . the free end of the tendon 27 is transferred to the tlp and the rov 21 is used to pull the anchor 25 horizontally away from anchor 20 so that tether 26 is fully extended . tendon 27 then lowers anchor 25 to the sea floor 23 where it is attached . the process is then repeated for subsequent anchors until all anchors are placed on the sea floor 23 in their proper positions . referring to fig7 one embodiment of the suction anchor is shown . first of all , the tendon 19 is attached to one end of a chain 28 . a spinner 63 is used to make the connection so that the tendon 19 may rotate relative to the chain 28 . the other end of the chain 28 is inserted into a funnel 29 located near the top of the anchor 20 . inside the funnel 29 , the chain 28 is engaged by a chain stopper 30 which locks it into place . excess links of the chain 28 are stored in a chain locker 31 below the funnel 29 . in one embodiment , for a tlp weighing about 6000 tons , the chain 28 may comprise 4 inch , oil - rig - quality chain . the tendon may comprise spiral strand wire having a 110 mm diameter . further , the suction anchor 20 may be made of single steel cylinders with a wall thickness of 20 mm . the total weight of the anchor may range from about 25 tons ( 3 . 5 m diameter and 7 . 5 m long ) to about 40 tons ( 5 m diameter and 11 m long ). see j - l . colliat , p . boisard , k . andersen and k . schroeder , caisson foundations as alternative anchors for permanent mooring of a process barge offshore congo , offshore technology conference proceeding , vol . 2 , pgs . 919 - 929 ( may 1995 ); e . c . clukey , m . j . morrison , j . garnier and j . f . corte , the response of suction caissons in normally consolidated clays to cyclic tlp loading conditions , offshore technology conference proceeding , vol . 2 , pgs 909 - 918 ( may 1995 ), both incorporated herein by reference . the rov 21 is attached to a rov pod 32 . the rov pod 32 in turn engages the anchor 20 . as shown in fig8 a , the rov pod 32 comprises a series of rings 33 . the anchor 20 also has a series of rings 34 . the devices are connected by bringing the rov pod 32 in close proximity with the anchor 20 so that rings 33 are placed adjacent to rings 34 . as shown in fig8 b , with the rings juxtaposed , a dowel 35 may be inserted into the rings 33 and 34 to connect the rov pod 32 to the anchor 20 . referring again to fig7 the anchor 20 also comprises a series of chambers 36 . each of these chambers are closed on all sides with the exception of the bottom side which is adjacent to the sea floor 23 . the anchor is attached to the sea floor 23 by pumping air into the chambers 36 with air supplied by umbilicals 24 . water is pushed out from the chambers by the air through one - way valves between the chambers and the exterior of the anchor . once the chambers are filled with air , the air is immediately evacuated to create low pressure inside the chambers . this creates a suction which causes the anchor to adhere to the sea floor 23 . the air may be evacuated by pumps or by allowing the air in the anchor to be exposed to atmospheric pressure at the sea surface via a hose . when the anchor is to be released from the sea floor , air is pumped back into the chambers to increase the pressure . multiple chambers 36 provide redundancy to prevent the entire anchor from becoming detached should one of the chambers fail . referring to fig9 a , an embodiment is shown for attachment of the tendon 19 to the tension - leg platform 9 . the tendon 19 is attached to a chain 37 with a spinner 63 in between . the spinner 63 allows the tendon 19 to rotate relative to the chain 37 . the chain 37 enters the tension leg platform 9 through one of the pontoons 14 . the chain 37 is then directed through the pontoon 14 and up through the main buoyancy structure 13 of the tension - leg platform 9 . a deflector 38 is located at the point where the chain enters pontoon 14 so as to deflect the direction of the chain . the chain enters the pontoon in a vertical direction and is deflected by a fairlead or deflector 38 toward the central axis of the buoyancy structure 13 . toward the interior of the main buoyancy structure 13 , the chain is again deflected by a second fairlead or deflector 39 which directs the chain vertically toward the monopod 10 . these deflectors may comprise pulleys , sliding material , or any other device known . fig9 b , shows a side view of sliding deflector embodiment . the chain 37 slides within a groove 71 in the deflector 38 which conforms to the shape of the chain . alternatively , as shown in fig9 c , a cable 73 may by deflected by the deflector 38 in which case the groove 71 conforms to the shape of the cable 73 . monoloy material , produced by smith - berger of vancouver , wash ., is a suitable sliding material . referring again to fig9 a , a wire 41 is attached to the free end of the chain 37 . the wire 41 is engaged by a handling winch 42 which pulls the free end of the chain 37 vertically so that the chain 37 and the tendon 19 become tight . when a desired tension is obtained , the chain 37 is locked into place by a stopper 40 which is located in the monopod 10 . a stopper 40 may comprise two protrusions which straddle a link of the chain so as to catch the next subsequent link in the chain . however , automatic stopping system , known in the art , may also be used . this stopper 40 may comprise a series of stoppers which engage the chain 37 at various positions . multiple stoppers are used to provide redundancy should one of the stoppers fail . it should be understood that the stoppers may be located anywhere inside the tension leg platform 9 , however , placement inside the monopod makes them easily accessible . further , a similar chain configuration is used for each of the tendons 19 which are used to secure the tension leg platform 9 to the sea floor 23 . the winch 42 and wire 41 are used to induce tension in each of the tendons 19 , 27 , etc ., sequentially . referring to fig1 a and 10b , embodiments of the present invention are shown . in fig1 a , configuration of the float 15 is such that it is affixed towards the upper end of main buoyancy structure 13 . in this configuration , the float 15 provides stability to the tension leg platform 9 because of the increased water displacement at the surface of the water . thus , in this configuration , the tension - leg platform 9 has increased stability which is important during the attachment of the tendons 27 to the sea floor 23 and to the tension - leg platform 9 . however , as soon as the tendons 27 are securely in place , the water displacement at the surface is no longer needed . in fact , once the tension - leg platform 9 is secured to the sea floor , increased surface area of the tension leg platform 9 at the surface of the water 11 is detrimental . as the waves act on the large surface area of the float 15 ( see fig1 a ( 1 ) and 1a ( 2 )), they induce resonance in the tension - leg platform 9 until the amplitude of the resonance is such that the tendons 27 begin to break . therefore , as shown in fig1 b , once the tendon leg platform 9 has secured to the sea floor , the float 15 is moved by a mover so that it is lowered until it abuts against the pontoons 14 . the mover of the float 15 may comprise ballast , a pulley cable system , a hydraulic system , or any other system known . the float 15 is then attached to the pontoons 14 and to the main buoyancy structure 13 and the ballast is removed . thus , the float 15 provides buoyancy to the tension leg platform 9 below the wave zone of the sea . in this configuration , the tension - leg platform 9 has a smaller cross section upon which the waves at the surface act . additionally , with the float secured to the tension leg platform 9 , the added buoyancy allows the tension leg platform to support several risers ( not shown ) which will be brought from the sea floor . in this regard , the float 15 comprises a reducer of the size of the tlp in the wave zone because once the float 15 is submerged to where it no longer pierces the surface of the sea , it does not displace seawater in the wave zone . the reducer of the size of the tlp in the wave zone may also comprise a device which removes or reconfigures tlp structural elements so that less water is displaced in the wave zone . for example , a crane may be used to remove members which support the tlp during transportation and assembly , but which are not required when the tlp is secured to the sea floor . referring to fig1 a ( 1 ) and 11a ( 2 ), an attacher of the float to the tlp is shown . the generator of a stabilizing moment ( float 15 ) comprises a generator thread 55 which allows float 15 to be twisted first onto the tlp thread 56 and second onto tlp thread 57 . as shown in fig1 b ( 1 ) and 11b ( 2 ), the attacher may comprise dowels 58 which extend between the tlp and the generator of a stabilizing moment ( float 15 ) through dowel holes 59 . in fig1 c , the attacher is shown to comprise generator teeth 60 and tlp teeth 61 . the tlp teeth 61 are tracks of teeth which extend parallel to the tlp central axis on the outside of the main buoyancy structure 13 . the generator teeth 60 are gears mounted on the generator of a stabilizing moment 15 for engagement with the tlp teeth 61 . it is to be noted that the above described embodiments illustrate only typical embodiments of the invention and are therefore not to be considered a limitation of the scope of the invention which includes other equally effective embodiments . | 1 |
the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments thereof are shown . fig2 is an exploded perspective view showing an embodiment of the present invention , fig3 is a perspective view showing the assembled state of fig2 , fig4 is a longitudinal cross - sectional view showing the assembled state of fig2 , and fig5 is a longitudinal cross - sectional view showing another embodiment of the present invention . as shown in fig2 to 4 , in the bone infuser for an osseous tissue implanting syringe of the invention , a protrusion 22 is formed on the leading end of a tube 20 of a syringe 10 . the protrusion 22 has the form of a cone , and the tube 20 has the form of a cylinder . a piston 40 , which linearly reciprocates when pressing a bone graft 30 toward the protrusion 22 , is fitted in the tube 20 . in addition , a first infuser 50 is open at one end and is closed at the other end . the first infuser 50 has an introduction groove 52 therein so that the bone graft 30 that is ejected through a nozzle 24 inside the protrusion 22 is introduced through the introduction groove 52 . the first infuser 50 has defined a spiral groove 54 in the inner surface on one end thereof . the protrusion 22 is forcibly coupled to spiral groove 54 in the fitted state during the implantation of the bone graft 30 . in the inner surface on the other end of the first infuser 50 , a curved portion 56 having the form of an arc is formed . the curved portion 56 serves to properly guide the bone graft 30 that is ejected through the nozzle 24 of the protrusion 22 . a spiral hole 58 is formed on the lower portion of the other end of the first infuser 50 . in addition , a second bone infuser 60 is open at one end and is closed at the other end . the second bone infuser 60 has defined a spiral groove 62 in the outer circumference on one end . the spiral groove 62 is spirally coupled to the spiral hole 58 of the first infuser 50 . an introduction groove 64 is formed inside the second bone infuser 60 . the bone graft 30 that has passed through the first bone infuser 50 is introduced into the introduction groove 64 . a plurality of nozzles 66 is formed along the circumference of the other end of the second bone infuser 60 , and serves to radially eject the bone graft 30 . as shown in fig5 , another embodiment of the second infuser 60 , which is open at both ends , can be used to implant the bone graft 30 . the second infuser 60 has defined a spiral groove 62 in the outer circumference of one end thereof . the spiral groove 62 is spirally coupled to the spiral hole 58 of the first bone infuser 50 . the second bone infuser 50 does not have the multiple nozzles 66 , which are intended to radially eject the bone graft 30 , in the circumference thereof , but has defined a nozzle 68 extending through the inside thereof . in the present invention as configured above , as shown in fig2 to 4 , when intending to implant the bone graft in a region into which an artificial dental root is to be implanted , for example , in an upper molar or the like that requires much labor , during dental implantation surgery , the first infuser 50 , which is open at one end and is closed at the other end , and the second bone infuser 60 , which is open at one end and is closed at the other end , are coupled to each other by rotation in the state in which the spiral groove 62 on the outer circumference of one end of the second infuser 60 is fitted into the spiral hole 58 in the lower portion of the other end of the first infuser 50 . afterwards , the tube 20 filled with a predetermined amount of the bone graft 30 is integrally coupled to the first and second bone infusers 50 and 60 by forcibly pressing the conical protrusion 22 , which is formed at the leading end of tube 20 , into the open introduction groove 52 on one end of the first infuser 50 in the state in which the protrusion 22 is fitted into the introduction groove 52 . then , the other end of the second infuser 60 is fitted into a hole that is formed in a region into which implantation is to be performed . in this state , it is possible to conveniently implant the bone graft 30 by pressing the piston 40 , which is fitted into the tube 20 , so that the bone graft 30 is ejected through the nozzle 24 of the conical protrusion 22 at the leading end of the tube 20 into the first bone infuser 50 , and then through the multiple nozzles 66 in the circumference of the other end of the second bone infuser 60 into the hole of the implanting region . in the event of implanting the bone graft 30 , the second bone infuser 60 can be substituted , if necessary , by the second bone infuser 60 having the form shown in fig5 . in a typical surgery , the implantation operation is performed using the second bone infuser 60 shown in fig5 . in the event of implanting a large amount of the bone graft 30 , the second bone infuser 60 having the multiple nozzles 66 in the circumference of the other end thereof , as shown in fig4 , is used to implant the bone graft 30 around the implanting region , and then the second bone infuser 60 having the nozzle 68 configured to extend through the inside thereof , as shown in fig5 , is used to proceed the implantation operation . in addition , since the other end of the second bone infuser 60 is fitted into a minute hole into which an artificial dental root is to be implanted , its thickness and length correspond to those of the hole that are determined according to the laryngeal width . the second bone infuser 60 can be fabricated by dividing it into regular and wide types depending on the thickness , if necessary , and into several types depending on the length , so that the bone graft 30 can be ejected at a sufficient depth without leaking out . in addition , the spiral groove 54 formed in the inner surface of one end of the first infuser 50 has the following effect : after the tube 20 made of a synthetic resin is forcibly coupled to the first infuser 50 by rotation in the state in which the protrusion 22 of the tube 20 is fitted to the spiral groove 54 of the first infuser 50 , when the piston 40 is pressed in order to implant the bone graft 30 , the bone graft 30 can be easily inserted into the first and second infusers 50 and 60 without pushing the piston 40 backward . in addition , since the curved portion 54 having the form of an arc is formed in the inner surface of the other end of the introduction groove 52 of the first infuser 50 , the bone graft 30 that is ejected through the nozzle 26 of the protrusion 22 can be guided along the curved portion 54 , thereby easily entering into the second bone infuser 60 . furthermore , since the multiple nozzles 66 are formed in the circumference of the other end of the second bone infuser 60 , the bone graft 30 can be ejected by being radially diverged without being ejected in one direction . as a result , the bone graft 30 can be rapidly ejected so that it is uniformly distributed . moreover , the first and second bone infusers 50 and 60 can be separately fabricated in a detachable type so that they can be reused after being sterilized . alternatively , the first and second infusers 50 and 60 can be used by being integrally fabricated . while the present invention has been shown and described with reference to the certain exemplary embodiments thereof and the accompanying drawings , the present invention is by no means limited thereto . it will be understood that various modifications can be made therein without departing from the spirit of the present invention and within the scope of the appended claims . | 0 |
a multi - cavity injection molding system made in accordance with the present invention is shown in the figures generally at m . referring to fig2 , a portion of injection molding system m is shown . a melt passage 10 extends from a common recessed inlet 12 in a manifold extension 14 to an elongated manifold 16 where it branches out to a number of outlets 18 . as can be seen , each branch 20 of melt passage 10 extends through steel nozzle 22 , having a central melt bore 24 in communication with melt passage outlet 18 from manifold 16 to a gate 26 leading to each cavity 28 . nozzle 22 is a heated nozzle having a heater 30 according to a preferred embodiment of the invention , as described in greater detail below . manifold 16 is heated by a heating element 32 , which may be integrally brazed into it . manifold 16 is held in place by a central locating ring 34 and insulating pressure pads 36 . locating ring 34 bridges an insulative air space 38 between manifold 16 and a cooled spacer plate 40 . pressure pads 36 provide another insulative air space 42 between manifold 16 and a cooled clamp plate 44 . spacer plate 40 , clamp plate 44 and cavity plate 46 are cooled by pumping cooling water through a plurality of cooling conduits 48 . clamp plate 44 and spacer plate 40 are secured in place by bolts 50 which extend into cavity plate 46 . manifold extension 14 is held in place by screws 52 and a locating collar 54 which is secured to the clamp plate 44 by screws 56 . each nozzle 22 is seated in a well 58 in spacer plate 40 . an insulative air space 64 is provided between heated nozzle 22 and the surrounding cooled spacer plate 40 . referring to fig2 and 3 , nozzle 22 has a body 68 having a steel central core portion 70 , an outer surface 72 , and a tip 74 , which is seated in gate 26 . tip 74 has a flow channel 76 which is aligned with central melt bore 24 . nozzle 22 is seated and secured in manifold 16 by a threaded portion 78 . heater assembly 39 has an electrical resistive wire heating element 80 , having cold pin connections 82 for connecting wire element 80 to a power supply ( not shown ). heater assembly 30 also has a first insulating layer 84 and a second insulating layer 86 disposed on either side of wire element 80 , so as to “ sandwich ” element 80 therebetween . first layer 84 is positioned on core 70 , with wire element 80 wrapped therearound , and second layer 86 positioned thereover . an outer steel layer 8 is provided to finish nozzle 22 . these layers are provided in a manner as will be described in more detail below . wire element 80 is a simple , bare , electrically and thermally uninsulated wire , preferably of thirty ( 30 ) gauge chromium nickel , though any wire material having resistive heating characteristics may be employed . wire element 80 is preferably wrapped around nozzle 22 , and may be provided in any arrangement which provides the temperature distribution desired for a particular application . for example , in the embodiment of fig3 , successive windings of wire element 80 are closer together at the ends of nozzle 22 , where more heat is typically required , with a more spaced distribution occurring in the central portion of nozzle 22 . according to the present invention , first layer 84 and second layer 86 are dielectric materials which can be applied in a “ finished ” ( i . e . “ non - green ”) state to the nozzle body . in other words , the dielectric material does not require additional heat treating steps once it is applied to the nozzle assembly , and thus has a chemical composition which does not change after it is applied to the apparatus and the material does not require heat treating of sintering to achieve its “ finished ” state . in addition to this constraint , first layer 84 is also preferably a dielectric material which can withstand the high operating temperatures and heater wattages experienced in hot runner injection molding . as one skilled in the art will understand , the dielectric is preferably a good thermal conductor with low heat capacity , a combination which encourages rapid heating ( and cooling ) with maximum efficiency . the dielectric should also be a good electrical insulator , since wire element is otherwise uninsulated from nozzle 22 . the choice of material depends also on the temperature target for the molten material which will flow through the melt channel of the nozzle . illustrative of the dielectric materials which can be used in the practice of this invention are : aluminum oxide ; magnesium oxide ; mica coatings ; vespel ™ ( trade mark of e . i . du pont de nemour & amp ; company ), graphite ; alumina ; alumina - silica ; zirconia - based materials , such as tetragonal zirconia polycrystals ( tzp ) partially stabilized zirconia ( psz ), fully stabilized zirconia ( fsz ), transformation toughened ceramics ( ttc ), zirconia toughened alumina ( zta ) and transformation toughened zirconia ( ttz ); cerama - dip ™ 538n ( trade mark of aremco products inc . ), a zirconium silicate - filled water - based high temperature dielectric coating for use in insulating high - power resistors , coils and heaters ; and ceramacoat ™ 538n ( trade mark of aremco products inc .) is a silica based , high temperature dielectric coating for use in insulating induction heating coils . aluminum oxide is a preferred material because of its relatively high thermal conductivity . second layer 86 is provided to protect wire element 80 from the deleterious effects of the atmosphere , such as oxidation and corrosion , and to insulate the exterior of nozzle 22 electrically and thermally , so as to direct the output of heater assembly 30 towards the melt in flow channel 76 . second layer 86 may be made from the same dielectric material as first layer 84 or a different material . in some applications , it may be desirable to use different materials . for example , the first layer 84 may be fabricated from a material having good electric insulating properties but high heat conductive characteristic , while the second layer 86 is of a material having high electric insulating properties and high heat insulating properties , so that the heat is directed to the central melt bore 24 within body 68 , while outer layer 88 remains cooler . the use of the same material , preferably aluminum oxide , for first layer 84 and second layer 86 is preferred . first layer 84 and second layer 86 may be provided as particles or a liquid sprayed onto the nozzle apparatus , as a liquid “ painted ” onto the apparatus or as a solid , pre - fabricated , self - supporting sleeve , as described in more detail below . the layers may be provided in thicknesses as desired to suit a particular application . thicknesses of the layers can range from 0 . 1 mm to 3 mm , and thicker , depending on the amount of insulating , overall nozzle diameter and method of fabrication desired , as will be described further below . thicknesses in the range of 0 . 1 mm to 0 . 5 mm are preferred . outer layer 88 may be applied by spraying or by shrink - fitting a sleeve on second layer 86 . outer layer 88 may have any desired thickness , though a thickness of about 1 . 5 mm is preferred . referring to fig4 – 7 , other embodiments of a nozzle heater according to the present invention are shown . in the embodiment of fig5 , a secondary wire element 90 is provided around second layer 86 , protected by a third insulating layer 92 . in this three - layer embodiment , second layer 86 is preferably a good heat conductor and electrical insulator while third layer 92 is a dielectric having good thermal insulating characteristics . third layer 92 can be chosen from the same set of materials as described above for layers 84 and 86 . this embodiment permits a higher wattage heater to be obtained , at the obvious expense of a slightly larger nozzle diameter . alternatively , secondary wire element 90 can provide redundancy for operational use if and when the primary wire element fails . fig6 shows a configuration similar to fig4 , but with integral sensors or thermocouple wire 94 and 96 positioned between first layer 84 and second layer 86 , wound spirally around nozzle 22 adjacent wire element 80 . inclusion of thermocouples 94 and 96 allows for exacting temperature control in nozzle 22 , as will be understood by one skilled in the art . the thermocouples may be disposed immediately adjacent wire element 80 , as shown in fig6 , or may be provided between second layer 86 and third insulating layer 92 , as depicted in fig7 . in this embodiment , second layer 86 and third layer 92 preferably have similar characteristics as described above for the fig5 embodiment . referring to fig8 , in a further alternate embodiment , a metal surface layer 98 is provided on outer surface 72 , between nozzle core 70 and first layer 84 . surface layer 98 is a layer of a metal having a higher thermal conductivity than steel nozzle body 68 , such as copper and alloys of copper . surface layer 98 thus promotes a more even distribution of heat from heater assembly 30 to the pressurized melt in central melt bore 24 . surface layer 98 may be applied by spraying or by shrink - fitting a sleeve on core 70 . surface layer 98 may have a thickness of between 0 . 1 mm to 0 . 5 mm , or greater if desired . referring to fig9 , in an alternate embodiment of the present invention , nozzle 22 ′ has a core 70 ′, a surface layer 98 ′ and a heater assembly 30 ′, which is composed of a first layer 84 ′, a wire element 80 ′, a second layer 86 ′ and an outer layer 88 ′. in this embodiment , surface layer 98 ′, first layer 84 ′, second layer 86 ′ and outer layer 88 ′ in fact , self - supporting , substantially rigid , annular telescoping sleeve components 98 a , 84 a , 86 a , and 88 a , respectively , which are pre - fabricated , prior to assembly of nozzle 22 ′, according to a method of the present invention , described below . this sleeve construction permits a heater assembly 30 ′ configuration which is selectively removable in part or in whole , depending on the design , from nozzle 22 ′ for periodic inspection , repair and / or replacement . also , this sleeve construction permits the nozzle body to expand independently from the insulating layers , by virtue of the separate and self - supporting nature of the heater sleeves . thus , when thermal expansion occurs in the nozzle , nozzle body 68 is free to grow longitudinally while the insulating sleeves and wire , which typically have lower thermal expansion characteristics , will not be subject to a mechanical stress induced by this nozzle body expansion . this feature has beneficial implications for increased heater durability . the self - supporting annular sleeves of this embodiment may be made of any suitable dielectric material , as described above , that can be machined , molded or extruded into a thin - walled tube . as with the previous embodiments , it is desirable that the coefficient of thermal transfer to be higher for inner sleeve than the outer sleeve . both sleeves are preferably made of the same materials . further , as one skilled in the art will appreciate , the various layers of a particular heater need not all be applied in an identical manner but rather a combination of layer types may be employed . one will further appreciate that the removability benefit of the sleeve embodiment requires that only at least one of the layers be a self - supporting sleeve , to permit it to be slidably removed from the nozzle assembly . for example , if first layer 84 ′ is provided as a self - supporting sleeve , second layer 86 may be applied directly to first layer 84 ( and over wire element 80 , as well ) by spraying or other coating method , as described further below . conversely , in a particular application , it may be desirable to spray or otherwise coat a first layer 84 onto the nozzle body , and provide second layer 86 in a sleeve format in such a configuration , wire element 80 ′ may be integrally provided on the interior of the second layer sleeve element , so as to be removable therewith . other combinations of layer construction are equally possible , as described below . referring to fig1 , in an alternate nozzle embodiment , heater assembly 30 ″ is disposed centrally within nozzle 22 ″. heater 30 ″ has a core 70 ″, first layer 84 ″, wire element 80 ″, second layer 86 ″ and outer layer 88 ″. a removable nozzle tip 74 ″ is provided to permit heater assembly 30 ″ to be removed from nozzle 22 ″ for inspection , repair or replacement , as described above . the present invention may be employed in any known injection molding nozzle design . referring to fig1 , a two - part nozzle configuration according to the present invention is shown . a forward nozzle 100 has a heater assembly 102 according to the present invention , as described above , and a rearward nozzle 104 has a heater 106 according to the prior art , such as , for example , as is described in u . s . pat . no . 5 , 051 , 086 to gellert , incorporated herein by reference . heater assembly 102 has a wire element 110 , a first insulating layer 112 and second insulating layer 114 , similar to that described above . it will be apparent to one skilled in the art at the present invention can be employed using a straight wire 120 , as shown in fig1 a , as element 80 to be wound spirally around the nozzle body , as described above . equally , however element 80 may be a coiled wire 122 , as shown in fig1 b , spirally wound around the nozzle . “ coiled ” in this application means helical or spring - like in nature , as illustrated in fig1 b . coiled wire heating elements are well - known in the heating art as allowing for a reduction in heater power for a given operating temperature . similarly , referring to fig1 a , it will be appreciated that the length of element 80 can be effectively doubled by folding over the wire element , and optionally twisted , to create a unitary element 124 . element 124 , as expected , has twice the length of wire for a given element 80 length , and is twice as thick . referring to fig1 b , a coiled and doubled element 126 can equally be provided . referring again to fig3 , in use wire element 80 is energized by a power source ( not shown ). as current flows through wire element 80 , resistance to the electrical flow causes the wire to heat , as is well understood in the art . heat generated by the element is preferably channelled and expelled substantially inwardly , by the presence first insulating layer 84 and second layer 86 , to heat the pressurized melt in central melt bore 76 . first layer 84 and second layer 86 also provide electrical insulation to electrically isolate wire element 80 from the surrounding metal components of the nozzle . the uninsulated resistive wire heating element according to the present invention permits a cheaper heater to be obtained while permitting more exacting temperature distribution and control through more precise and flexible positioning of the element . unlike the prior art , complex machining of the nozzle body and the need for integrally brazing the heating element to the nozzle body are removed , permitting savings in cost and time in fabricating the nozzle . likewise , special and complex film printing techniques , materials and machinery are not required . further , and perhaps most importantly , the present invention permits smaller diameter heated nozzle designs to be more easily achieved and more reliably operated than is possible with the prior art . the heated nozzles of the present invention may be fabricated according to the method of the present invention . in a first embodiment of this method , steel nozzle body 68 is provided as the substrate for spraying first layer 84 thereon . first layer 84 may be provided by spraying , “ painting ” or otherwise coating in a thickness of between 0 . 1 mm and 0 . 5 mm . while greater thicknesses are possible , little benefit is attained by providing a thickness greater than 0 . 5 mm and , since it is generally desirable to minimize nozzle diameter , greater thicknesses are not typically preferred . first layer 84 is provided on outer surface 72 of nozzle body 68 so as to substantially cover , and preferably completely cover , outer surface 72 over the region where wire element 80 is to be located . after layer 84 is dry , wire element 80 is then positioned around first layer 84 , preferably by winding wire element 80 spirally around the exterior of the nozzle . although any wire pattern is possible , winding is typically preferred because , among other things , it requires the simplest operation in automated production . with wire element 80 around first layer 84 , second layer 86 is then provided so as to substantially cover , and preferably completely cover , wire element 80 and thereby sandwich and encase wire element 80 between first layer 84 and second layer 86 . second layer 86 is preferably applied by spraying , “ painting ” or otherwise coating to a thickness of between 0 . 1 mm and 0 . 5 mm ( for reasons described above ), though any other method of applying second layer 86 may be employed , including providing a sleeve as described below . once second layer 86 is dry , metal outer layer 88 is provided . metal outer layer 88 may be applied in any known manner , such as by spraying or by shrink - fitting a sleeve , with spraying being preferred in this embodiment to minimize the overall diameter of the nozzle . with the outer layer applied , the assembly is then typically swaged to compact the assembly and bring the overall nozzle diameter to within desired dimensional tolerances . this embodiment of the method permits smaller diameter and more durable nozzles to be obtained than is possible with the prior art . further , the method is advantageous over the prior art since no additional heat treating step is required , thereby simplifying manufacture . in an alternate embodiment of the method of the present invention , first layer 84 is provided as a pre - fabricated , self - supporting , substantially rigid , annular sleeve component which is telescopically , slidably positioned concentrically over core 70 . the sleeveless element may be cast , machined , molded or extruded into a thin - walled tube , and may be provided in any desired thickness , though thicknesses in the range of 1 . 5 mm to 2 mm are preferred to optimize thickness and durability of the sleeve component . the inside diameter of the first layer sleeve is preferably as small as possible while still permitting a sliding installation over core 70 , so as to minimize any air space between the two components . the next step is to position wire element 80 around the first layer sleeve and , as one skilled in the art will understand , it is not important whether the wire element is positioned around the first layer sleeve prior or subsequent to the sleeve &# 39 ; s installation on the nozzle body . in fact , an advantage of the method of this embodiment is that the wire element can be pre - wired on the first layer sleeve prior to installation , which can offer flexibility and simplification in manufacturing . once wire element 80 has been provided around the first layer sleeve , second layer 86 is then applied to substantially cover , and preferably completely cover , wire element 80 so as to sandwich and encase wire element 80 between the first layer sleeve and second layer 86 . second layer 86 may be applied as a sleeve or by spraying , with the sleeve form being preferred in this embodiment . again , it is not important whether second layer 86 is applied prior or subsequent to the installation of the first layer sleeve on the nozzle body . second layer 86 , if applied in sleeve format , is sized to fit as closely as possible over wire element 80 on the first layer sleeve to minimize the air space between the first and second layers . a metal outer layer 88 is then applied to the outside of second layer 86 and may be applied by any known means , such as by spraying or by shrink - fitting a sleeve , with shrink - fitting a sleeve being preferred in this embodiment . again , as will be understood by one skilled in the art , if a second layer sleeve is used , the outer layer may be applied to the second layer sleeve either pre - or post - installation of the second layer sleeve on the first layer sleeve or the nozzle assembly . with the outer layer applied , the assembly is then typically swaged to compact the assembly and bring the overall nozzle diameter to within desired dimensional tolerances . the assembly is then finished as required . such finishing steps may include providing removable nozzle tip 74 to the nozzle assembly , if necessary in the particular application . this embodiment of the method permits a removable heater assembly to be achieved . the first layer sleeve and / or second layer sleeve can be selectively removed from the nozzle body for inspection and / or replacement , if the heater is damaged or worn , without the need to replace the entire nozzle . further , the independent nature of the sleeve elements permits the order of assembly to be varied as necessary , for example , by allowing the wire element to be provided on the first layer sleeve prior to installation on the nozzle body . similarly , the second layer may be provided on first sleeve , over the installed wire , prior to installation of the first layer sleeve on the nozzle body . this advantage offers not only flexibility in manufacture but also permits the wire element to be more precisely placed on the first layer sleeve . for example , laying the wire over the sleeve and then spinning the sleeve so as to wind the wire onto the sleeve permits a precisely controlled pitch and pitch variation . a further advantage of the method is that no additional heat treating step is required , thereby simplifying manufacture . it will be understood in the previous embodiment that , if desired , wire element 80 can equally be pre - installed in the interior of a second layer sleeve , rather than the outside of first layer sleeve . in both of the above embodiments of the method of the present invention , a metal surface layer 98 of copper or other highly thermally conductive metal may be applied with advantage to the nozzle body prior to providing the first insulating layer , as described above with respect to the apparatus . in one aspect , the surface layer is applied by spraying . in another aspect , the surface layer is provided by shrink - fitting a sleeve onto core 70 of nozzle body 68 . as described above , the surface layer promotes thermal transfer between heater 30 and nozzle body 68 . while the above description constitutes the preferred embodiment , it will be appreciated that the present invention is susceptible to modification and change without parting from the fair meaning of the proper scope of the accompanying claims . | 1 |
in the following description , specific details are set forth such as specific quantities , sizes , etc . to provide a thorough understanding of the present invention . however , it will be obvious to those skilled in the art that the present invention may be practiced without such specific details . in many cases , details concerning such considerations and the like have been omitted inasmuch as such details are not necessary to obtain a complete understanding of the present invention and are within the skills of persons of ordinary skill in the relevant art . described herein is an approach to damascene processing that is based on step - and - flash imprint lithography ( sfil ). typically , such imprint damascene processes require less than half as many steps as would a standard photolithographic dual damascene approach . for example , by using an imprint template with two levels of patterning , a single imprint lithography step can replace two separate photolithography steps . in addition to directly reducing the total number of processing steps , patterning two levels simultaneously removes some of the most difficult aspects of the current dual damascene approaches , such as performing a second photolithography step over the topography generated by a first photolithography step . also , alignment of the via and upper wiring level is performed at the template fabrication stage , so only a single alignment step is required during the device manufacturing stage . when the imprinted material is a functional dielectric , the sfil approach requires roughly one - third as many steps as standard dual damascene approaches . there are essentially four requirements for using sfil in direct patterning of dielectric materials for a dual damascene process : ( 1 ) an sfil tool with overlay and alignment , ( 2 ) multi - tier imprint templates with damascene test structures , ( 3 ) photocurable dielectrics or dielectric precursors , and ( 4 ) an integration of sfil patterned wafers into a copper process flow . sfil - capable tools are commercially available ( mcmackin , i . ; choi , j . ; schumaker , p . ; nguyen , v . ; xu , f . ; thompson , e . ; babbs , d . ; sreenivasan , s . v . ; watts , m . ; schumaker , n ., proc . spie - int . soc . opt eng . 2004 , 5374 , 222 - 231 ; mcmackin , i . ; schumaker , p . ; babbs , d . ; choi , j . ; collison , w . ; sreenivasan , s . v . ; schumaker , n . e . ; watts , m . p . c . ; voisin , r . d ., proc . spie - int . soc . opt . eng . 2003 , 5037 , 178 - 186 ) and multi - tier templates have been previously demonstrated ( johnson , s . ; resnick , d . j . ; mancini , d . ; nordquist , k . ; dauksher , w . j . ; gehoski , k . ; baker , j h . ; dues , l . ; hooper , a . ; bailey , t . c . ; sreenivasan , s . v . ; ekerdt , j . g . ; willson , c . g ., microelectron . eng . 2003 , 67 - 68 , 221 - 228 ; resnick , d . j . ; dauksher , w . j . ; mancini , d . ; nordquist , k . j . ; bailey , t . c . ; johnson , s . ; stacey , n . ; ekerdt , j . g . ; willson , c . g . ; sreenivasan , s . v . ; schumaker , n ., j . vac . sci . technol . b , 2003 , 21 , 2624 ). while certain aspects of using imprint lithography with a damascene patterning approach have been previously reported ( s . kondo , y . anzai , m . terao , d . ryuzaki , d . kodama , t . furusawa . “ an imprint - damascene process for cu / low - k interconnects ,” proceedings of ulsi , 2003 , 17 , 537 - 542 ), the use of sfil with multi - tier templates in a combined damascene process has not been described previously . in sfil processes , a low viscosity , photocurable solution is dispensed onto a substrate . a rigid , transparent template is then brought into close proximity with the substrate allowing the solution to fill the space between the substrate and the mold . when the solution , comprising low molecular weight monomer and photoinitiator molecules , is exposed to ultraviolet ( uv ) light , it polymerizes and hardens in the topographic mold . the mold can then be removed leaving a patterned ( inverse ) replica on the substrate . advantages of the sfil process over traditional nanoimprinting include an ability of sfil to print at room temperature using low pressures (& lt ; 1 atm ), making it easier to achieve overlay and alignment while also printing with high throughput . in the case of the present invention , the dispensed liquid is a dielectric precursor and not an imprint resist in the formal sense . a schematic of a representative sfil - dual damascene process , in accordance with some embodiments of the present invention , is shown in fig1 . referring to fig1 , such an above - described process generally comprises the steps of : ( step ( a )) dispensing a quantity of dielectric precursor liquid ( 101 ) onto a substrate ( e . g ., m1 patterned wafer , 102 ), wherein the substrate has been treated with an adhesion promoter ; ( step ( b )) pressing a multi - tiered template ( 103 ) into the dielectric precursor liquid as it resides on the substrate , wherein the multi - tiered template is lithographically - generated , and wherein the multi - tiered template has been treated with a fill / release agent ; ( step ( c )) photo - curing ( first curing process ) the dielectric precursor liquid as it resides between the substrate and the multi - tiered template to form a template - bound multi - tiered patterned dielectric material ( 104 ); ( step ( d )) removing the multi - tiered template from the multi - tiered patterned dielectric material to yield a multi - tiered patterned dielectric structure on the substrate ; ( step ( e )) clearing residual material from the multi - tiered patterned dielectric structure , wherein such material otherwise prevents contact with the underlying substrate ; ( step ( f )) thermally curing / baking ( second curing process ) the multi - tiered patterned dielectric structure ; ( step ( g )) depositing copper ( 105 ) in the multi - tiered patterned dielectric structure to form a filled multi - tiered patterned dielectric structure with a copper overfill layer ; and ( step ( h )) removing the copper overlayer with chemical mechanical planarization ( cmp ). note , however , that in some embodiments , step ( f ) could be done prior to step ( e ). generally , the dielectric precursor liquid can be of any composition of suitable viscosity that can be cured through a combination of photo - and thermal - curing so as to form a multi - tiered patterned dielectric material . in some embodiments , such materials are generally a low viscosity liquid prior to polymerization , i . e ., in their precursor state . the liquid can be dispensed onto a substrate in droplets of controlled volume and position . the liquid typically vitrifies by polymerization when exposed to electromagnetic radiation ( first curing step ). shrinkage of the liquid precursor during exposure and imprinting should typically be less than about 10 %. mechanical properties of the polymer film allow for selective separation of the template from the imprinted polymer film . after the photo - induced polymerization , a thermally - induced crosslinking reaction is used to further improve material properties of the polymer film ( second curing step ). thermal processing is generally performed at temperatures between 100 ° c . and 450 ° c . thermal crosslinking causes minimal densification or shrinkage of the polymer film . final properties of the film typically include : high thermal stability ( e . g ., 400 ° c . ), low dielectric constant (& lt ; 4 ), good mechanical properties , low coefficient of thermal expansion , and low water absorption . generally , such above - described dielectric precursors comprise polymerizable / crosslinkable functional groups . in some embodiments , the polymerizable / crosslinkable functional groups may be pendent to a monomer building block . in some or other embodiments , one or more functional groups may be appended to each monomer building block . the structure of the monomer building block , if incorporated , includes , but is not limited to , species selected from the group consisting of polyhedral oligomeric silsesquioxanes ( poss ), alkoxysilanes , oligomeric alkoxysilane prepolymers , and combinations thereof . additionally , the dielectric precursor material generally comprises photosensitive functional groups including , but not limited to , acrylates , methacrylates , thiol - ene systems , epoxies , oxiranes , vinyl systems , and maleimides . the photo - polymerization of the material may be initiated by a photoactive compound including , but not limited to photo - acid generators , photo - base generators , and free radical generators . the material must also contain some thermally initiated polymerizable functionality . these functional groups include , but are not limited to benzocyclobutane , alkoxysilanes , silanes , maleimides , and nadic imides . an exemplary dielectric precursor liquid formulation is as follows : polyhedral oligomeric silsesquioxane ( poss ) octahedral cage functionalized with benzocyclobutane and methacrylate units with an averaged 5 : 3 ratio . this formulation includes up to 10 percent ( by weight ) uv free radical generator such as 2 - hydroxy - 2 - methyl - 1 - phenyl - propan - 1 - one ( ciba - geigy , darocure 1173 ). while the substrate material is not specifically limited , the substrate is generally compatible with both standard fabrication techniques and sfil techniques . suitable substrates include , but are not limited to , those based on silicon wafers , and such substrates generally comprise an adhesion promoter . the adhesion promoter functions to facilitate adhesion of the patterned multi - tiered dielectric structure to the substrate . an exemplary such adhesion promoter is aminopropylsilane . suitable templates are generally multi - tiered versions of standard sfil templates described previously . in general , such templates must be transmissive of uv radiation so as to permit uv curing of the functional dielectric precursor material , and such templates generally may be coated with a fill / release agent . the fill / release agent serves to facilitate release of the template from the uv - cured functional dielectric material , such that a patterned multi - tiered dielectric structure remains on the substrate after release . examples of such multi - tiered templates are described in example 1 . photo - curing is typically carried out using uv radiation , but other regions of the electromagnetic ( em ) spectrum could additionally or alternatively be employed . in some embodiments , such curing is generally carried out so as only to partially cure the dielectric precursor material such that it can be sufficiently separated from the multi - tiered template ( first curing step ). the clearing of residual dielectric material generally comprises a plasma etch . the specifics of such an etch are dependent on the type of dielectric material employed . for silicon - based dielectrics , such an etch is typically a fluorine - based plasma etch . in this latter case , the etch products are volatile ( e . g ., sif 4 ) and easily removed . thermally curing / baking ( second curing step ) is highly materially - dependent . generally , the curing / baking temperature is close to , but nevertheless below the thermal decomposition temperature of the functional dielectric material . typically , such curing / baking temperatures are between about 100 ° c . and about 450 ° c . the deposition of copper plating seed is typically done via a physical vapor deposition ( pvd ) means . the main portion of the copper is deposited by electroplating from solution . an example of such deposition is provided in example 4 . removing the copper overlayer is typically done using standard cmp methods well - known to those of skill in the art . this process is also described in example 4 . there are many different versions of imprint lithography and each has advantages and disadvantages , but sfil was designed from the beginning with microelectronic device manufacturing in mind . by virtue of simplicity , any nanoimprint technique is likely to be less expensive and more flexible than extreme uv ( euv ) lithography . one of the chief concerns with nanonimprint lithography is the availability and expense of 1x templates ( masks ), but this should be less of an issue in back - end - of - line ( beol ) processing as the highest resolution patterning technology required to pattern gate levels and first contacts are not required for every level . as a rough guideline , each wiring level increases the feature size of the previous level by one factor , such that at the 90 nm node the third wiring level would have minimum features around 270 nm . this is in the range achievable with fast mask writing technologies which should keep template costs low . when template making processes improve , imprint will become competitive for even the most demanding levels . also favoring the development of imprint for beol processing is that the materials constraints for higher metal levels are less rigorous . this lessens the difficultly of the initial development of useful imprintable dielectrics , but with a dual curing imprintable dielectric , there is no reason that the materials properties of imprintable dielectrics should not approach the requirements for all levels . the following examples , drawn from an initial feasibility demonstration , are included to demonstrate particular embodiments of the present invention . it should be appreciated by those of skill in the art that the methods disclosed in the examples that follow merely represent exemplary embodiments of the present invention . however , those of skill in the art should , in light of the present disclosure , appreciate that many changes can be made in the specific embodiments described and still obtain a like or similar result without departing from the spirit and scope of the present invention . this example describes the source and manufacture of multi - tier sfil templates , in accordance with some embodiments of the present invention . multi - tier templates were obtained from three separate sources . motorola labs produced templates with features down to 100 nm on both tiers . this template was mainly for multi - tier resolution demonstration and the pattern was not designed for electrical testing . templates from lawrence berkeley national labs ( lbnl ) were , like the motorola templates , patterned with electron beam , but with much larger features . larger features were chosen to simplify initial process development and eventual electrical testing . the pattern of the lbnl templates contained electrical testing structures like serpentines , inter - digitated combs , and vias connected to probe pads . templates purchased from dupont photomasks , inc . ( dpi ) were patterned with a laser mask writer . the design of the dpi template is based on standard dual damascene test vehicle designs used at sematech . minimum features were targeted at 500 nm . electrical test structures include via chains , serpentines , combs , and “ kelvin ” structures . along with the multi - tier template , a single tier template with the corresponding first level pattern was purchased . scanning electron microscopy ( sem ) images of the multi - tier templates , suitable for use in some embodiments of the present invention , are shown in fig2 a - 2c , where ( a ) depicts a motorola - fabricated template with 100 nm diameter vias on 100 nm lines ; ( b ) depicts a lbnl - fabricated template with 1000 nm square vias on 2000 nm lines ( left ) and 250 nm via post with aspect ratio exceeding 2 : 1 ( right ); and ( c ) depicts a dpi - fabricated template with 500 nm diameter vias on a 500 nm tall tier ( left ) and a via chain structure with 500 nm vias on a 1000 nm × 2000 nm base ; and where each tier is nominally 500 nm tall . this example serves to illustrate types of photo - curable functional dielectric precursor materials , in accordance with some embodiments of the present invention . the standard sfil imprint resist ( usually referred to as etch barrier material ) is based on photo - induced free radical polymerization . the components of the imprint resist frequently include an organic acrylate , an organic crosslinker , and a silicon containing acrylate monomer , along with an appropriate photoinitiator . for an initial demonstration of direct imprinting of functional dielectrics , a version of standard etch barrier formulation without a silicon - containing component was used as the dielectric precursor . this material functions as an insulator material , but generally lacks thermal stability and device longevity . other suitable materials offering great potential are based on silsesquioxane chemistry and include , but are not limited to , epoxy - functionalized silsesquioxane cage structures ( zhang , c . ; laine , r . m ., j am . chem . soc ., 2000 , 122 , 6979 - 6988 ; seung , j . c . ; kim , g . ; laine , r . m ., macromolecules , 2004 , 37 , 99 - 109 ). such epoxy - functionalized silsesquioxane material can cure with photo - generated acid . this example serves to illustrate the imprinting of functional dielectric materials in accordance with some embodiments of the present invention . as a demonstration , imprinting was conducted using several molecular imprints , inc . imprio 55 and imprio 100 tools . certain imprints used for template evaluation and imprint process development were performed on double polished , barc - coated ( brewer science , duv - 30j ) wafers . full process demonstration wafers were double - side polished wafers on which copper had been plated on one side to a thickness between 500 nm and 2000 nm . a copper diffusion barrier of silicon - carbonitride approximately 50 nm thick was coated over the plated copper . before printing , these copper wafers were surface treated using standard techniques to improve adhesion of the imprinted dielectric . this example serves to illustrate post - imprint processing , in accordance with some embodiments of the present invention . herein , multi - tier template fabrication has been further improved to include very intricate circuit designs and very small features and , as a demonstration , a photo - curing dielectric precursor material was used . this initial precursor material is similar to previously - reported sfil resist formulations . for a start - to - finish demonstration , adtf , inc ( austin , tex .) integrated the sfil - printed wafers into their 200 mm copper fabrication line . certain modifications to their standard copper fabrication process were required in order to accommodate the lower thermal stability of the dielectric precursor material used in the demonstration . for example , standard temperatures used for metal deposition and annealing were reduced to accommodate the materials constraints . a low down force chemical - mechanical planarization ( cmp ) process was also used because the polishing performance of the dielectric was heretofore unknown . with these adjustments , multi - tier sfil printed wafers were processed through the entire copper dual damascene fabrication process . after imprinting , the residual layer was cleared and the copper diffusion barrier ( sicn ) breached with reactive ion plasma etches . the residual layers are often thin enough that only a short fluorine plasma etch step is required for the residual and barrier layer breakthrough . after breakthrough etching , the wafer was degassed at 200 ° c . physical vapor deposition ( pvd ) was used to deposit 25 nm of tantalum and 130 nm of copper ( no argon sputter was done prior to pvd ). after the seed layer was deposited , 1200 nm of copper was electroplated to overfill the imprinted features . for these initial samples , a 3 - day , room temperature copper “ self anneal ” was used rather than a quicker high temperature anneal . after annealing , a “ low down force ” cmp process was used to remove the copper overfill and the tantalum overcoat . in this example , electron and optical micrographs are provided to further illustrate the embodiments described in examples 3 and 4 . several examples of multi - tier imprints are shown in fig3 and 5 . fig3 a and 3b are sem images depicting imprints of the motorola - fabricated template with 100 nm features . fig4 a and 4b are sem images depicting imprints of a lbnl - fabricated template . fig5 a - 5c are sem images depicting imprints of a via chain structure on a dpi - fabricated template , where ( a ) is a tilt overview , ( b ) is a cross - sectional view , and ( c ) is a close - up individual via chain feature . a general feature seen in these multi - tier imprints has been the thinness of residual layer beneath the via points . the structure of the template likely aids the formation of thin residual layers . on the template , vias are raised posts or pins , which cover only a small percentage of the pattern surface . the pin - like protrusions of the template act to concentrate imprint forces and aid monomer flow . thin residual layers keep the overall loss of dielectric material low during the breakthrough etch steps . after imprinting , wafers were taken to atdf to complete the rest of the processing steps . following breakthrough etch steps , the wafers were coated with tantalum and a copper seed layer . features were filled with electroplated copper and then polished with low down force cmp process . fig6 a and 6b are sem images depicting copper - filled features prior to chemical mechanical planarization ( cmp ), where ( a ) is a cross - section of an upper level serpentine structure , and where ( b ) is a cross - section of multi - level feature ( via chain ) indicating that the copper diffusion barrier was not breached prior to plating . optical micrographs of post - cmp wafers are shown in fig7 a and 7b are optical micrographs of post - cmp wafers , where ( a ) is a serpentine structure and ( b ) is a kelvin - like structure , and where a tiling pattern is customary “ dummy metal ” fill used to maintain constant pattern density over the entire die . referring to fig8 a and 8b , an sem cross - section of a post - cmp interconnect structure is presented in fig8 a . roughness on the metal 2 level results from the rough template , shown in fig8 b , used in the initial imprint process . the cross - section of fig8 a is a complete demonstration of multi - tier sfil dual damascene process . fig7 and 8 clearly demonstrates that the metal topology required for interconnect structures is present . this example serves to illustrate additional suitable functional dielectric materials , in accordance with embodiments of the present invention . there are several potential routes to photocurable dielectric material . one promising route is through variations of polyhedral oligomeric silsesquioxane ( poss ) type materials . poss - type materials already find use as dielectric materials in semiconductor manufacturing . silsesquioxane polymer materials are generally too viscous for efficient sfil processing , but by imprinting precursors and generating polymers in situ during the imprint step , a way around this problem can be found . a functionalized silsesquioxane cage structure has been imprinted ( fig9 c ) as a demonstration . fig9 a and 9b are sem images depicting imprints of cured epoxy - functionalized silsesquioxane structure ( t 8 ), the chemical structure of which is depicted in fig9 c . this formulation uses a photoacid generator to initiate curing rather than a free radical generator as it polymerizes through an epoxy reactive group . the material appears to lack the mechanical strength and hardness required for the dual damascene process steps . to improve the properties of this basic poss material , poss structures can be “ dual functionalized ” with different types of reactive groups such as in the scheme shown in fig1 for dual - functionalized silsesquioxane cage structures suitable for use as imprint materials , in accordance with some embodiments of the present invention . appending acrylate functional groups on to the cage structure allows curing by free radical initiated polymerization . appending groups such as maleimide and benzocyclobutane , which cure thermally , gives a path to improved mechanical properties by post - imprint processing and allows a final material with minimal cure - induced shrinkage . the initial photo - curing step could be brief with just enough photoinduced polymerization to provide image stability and allow mold removal . post - imprint wafers could then be baked to fully harden the material , giving improved thermal and mechanical stability as well as enhanced electrical properties . this two - step curing process allows imprint tool throughput to remain high while still ultimately meeting the required material properties . the thermally curing groups can be chosen such that they produce very little extra shrinkage on curing . ring - opening functional groups provide low shrinkage curing reactions to produce a highly crosslinked material while inducing very little internal stress . the thermal cure process would also be compatible with the eventual incorporation of a porogen , thus providing straightforward route to an imprintable , porous low - k dielectric material . all publications referenced herein are hereby incorporated by reference to the extent not inconsistent herewith . it will be understood that certain of the above - described structures , functions , and operations of the above - described embodiments are not necessary to practice the present invention and are included in the description simply for completeness of an exemplary embodiment or embodiments . in addition , it will be understood that specific structures , functions , and operations set forth in the above - described referenced patents and publications can be practiced in conjunction with the present invention , but they are not essential to its practice . it is therefore to be understood that the invention may be practiced otherwise than as specifically described without actually departing from the spirit and scope of the present invention as defined by the appended claims . | 7 |
the elevating storage apparatus 10 illustrated in fig1 to 4 utilises a pair of opposed compound drawer slide assemblies 11 and 12 to support the opposite sides of an article supporting tray 14 whereby it may be withdrawn from a stowed position 15 above an elevated surface 16 , as illustrated in fig1 , to a fully withdrawn position 17 , as illustrated in fig2 , from which the tray 14 may be lowered to a more accessible position . both compound drawer slide assemblies 11 and 12 have an outer slide support 18 fixed to the elevated surface 15 , an inner slide assembly 19 connected to a respective opposite side of the article supporting tray 14 and a floating intermediate slide support 20 which enables the inner slide assembly 19 and the article support tray 14 carried thereby to be withdrawn past the front edge 22 of the mounting surface 15 on which the outer slide supports 18 are secured . in this embodiment each inner slide assembly 19 carries three fixed upright carriers 23 which extend upwardly from the inner slide assembly 19 and within which complementary support members 24 fixed to the opposite sides 25 and 26 of the article support tray 14 are reciprocably supported . as illustrated in fig4 , each upright carrier 23 and complementary support member 24 , which are shown partially cut away , are rectangular hollow - section members whereby an internal energy storage means or powered drive means may be supported as illustrated at 30 with its upper end fixed to the upright carrier 23 and its lower end secured within the support member 24 for raising and lowering the tray 14 . some or each of these telescoping members 23 and 24 together with their drive means 30 , if desired , may be constituted by a linear drive such as a powered hydraulic or pneumatic cylinder , a worm drive or a rack and pinion drive connected between the inner rail assemblies and the support tray 14 . a handle ( not shown ) for manipulating the support tray 14 may be secured to the front of the tray 14 where it will not interfere with free movement of the tray 14 . alternatively a handle provided on a supported article may be used to manipulate the movement of the support tray and the article supported thereon . also if desired the support tray may be provided with depressions or other location means for accommodating and / or securing the feet of an article intended to be supported thereby . in a typical application , the elevating storage apparatus 10 is provided for stowing a small refrigerator in an elevated position in the back of a four wheel drive vehicle whereby when parked , the refrigerator may be withdrawn from its stowed elevated position outwardly to a fully withdrawn position at which a slide latch 33 automatically locks the slide assemblies in their extended position and a lowering latch 31 together with the energy storage means 30 in the carriers 23 support the weight of a refrigerator and its contents in known manner . a user may then release the lowering latch 31 , grasp a handle provided on the supporting tray or a handle provided on the refrigerator and urge the refrigerator to a lower position where it may rest on a bench or be supported by the support means 24 which are prevented from retracting from their respective carriers 23 by internal stops which may be constituted by the energy storage means being moved to their fully extended positions . the latch 31 has a spring loaded pawl mounted on one carrier 23 which extends through an opening 37 in the carrier 23 to engage with an aperture 35 or 36 in the complementary support strut 24 . this latch will engage a lower aperture 36 to hold the tray 14 elevated and an upper aperture 35 to maintain the refrigerator in its lowered accessible position . the lower positioning of the refrigerator assists with accessing top opening fridges and it is also useful for providing better access to front opening refrigerators and other cupboards which may be supported by the elevating stowage apparatus 10 . when it is desired to move the refrigerator back to its stowed position the operator simply releases the strut latch 31 , which could be associated with a handle mounted on the support tray 14 or form the handle for the support tray , so that the refrigerator can be elevated by the support tray utilising either the accumulated energy in the energy storage means alone or with assisted effort from the user . when fully elevated the latch 24 will engage with the indentation 36 in the complementary support strut 24 to secure the support tray 14 in its elevated position . thereafter the slide latch 33 which automatically locks the slide assemblies in their extended position is disengaged to allow the article support tray and the refrigerator supported thereby to be pushed backwardly to its stowed position where the slide latch 33 again locks the slide assembly in its retracted position to secure the article support tray in its stowed position . an advantage of this embodiment is that the overall width of the supporting tray is very close to the distance between the inner slide assemblies so that the overall dimensions of the elevating storage apparatus 10 compared to the overall dimensions of the supporting tray can be minimised . furthermore any number of guide members and complementary support struts may be utilised to provide support for different weight articles and in addition the upwardly extending guide members provide side support which may prevent toppling of a heavy article supported by the article support tray . the further illustrated embodiments utilise similar components as is described for the above embodiment except for the linkages which interconnect the inner slide assemblies and the article supporting tray . for the sake of brevity , in the description of the following embodiments numbers utilised for similar components will be repeated and only the variations will be illustrated and / or described in detail . the elevating support apparatus 40 illustrated in fig5 to 9 utilises forward pivoting support assemblies 41 , pivotally connected to the inner slide assemblies 19 and the support tray 14 , to raise the article support tray 14 from its lowered position , as illustrated in fig5 to its withdrawn position , as illustrated in fig9 from which it may be slid rearwardly to its stowed position as illustrated in fig6 . the use of support assemblies 41 which pivot forwardly would significantly increase the overhang of the supporting tray 14 beyond the front edge 22 and thus substantially increase the load imposed on the compound drawer slide assemblies 11 and 12 . in this embodiment this overhang is minimised by forming each support assembly 41 as a telescopic assembly , having an upper carrier portion 44 pivotally connected to the respective inner slide assembly 19 at 42 which receive lower telescoping portions 43 pivotally connected to the respective sides of the support tray 14 at 46 . with this arrangement the initial raising of the tray 14 is achieved by retracting the telescopic support assemblies 41 so as to position the tray 14 close to its uppermost position , as illustrated in fig7 , whereafter the telescopic support assemblies 41 are pivoted forward about their mounting pivots 42 , as illustrated in fig8 , until the telescopic support assemblies 41 lie alongside their respective inner slide assemblies 19 . the elevated supporting tray 14 may then be pushed rearwardly to its stowed position as illustrated in fig6 . as in the previous embodiment the telescopic support assemblies 41 accommodate energy storage means to assist in lowering and raising a relatively heavy article supported on the tray 14 . an advantage of this embodiment is that the rear pair of telescopic support assemblies 41 are disposed close to the centre of the support tray 14 so that they will support most of the weight of an article supported on the tray . as a result any energy storage means may be supported only within the rear pair of support assemblies 41 . furthermore , this placement enables relatively long top portions 44 to be utilised which accommodate the lower telescoping members 43 when they are retracted . in addition the telescopic support assemblies 41 could be constituted , if desired , by linear drive means as for the previously described embodiment . the embodiment 50 illustrated in fig1 to 14 utilises laterally spaced scissor mechanism 51 interconnecting the inner slide assemblies 19 to opposite sides of the support tray 14 . for this purpose each scissor mechanism 51 includes a pair of links 52 and 53 connected together by a central pivot 54 . the front ends of both links 52 and 53 are pivotally connected to a respective one of the inner slide assemblies 19 and sides of the supporting tray 14 at locations which are vertically aligned with one another . the opposite ends of the links 52 and 53 are pivotally connected to slide members 55 accommodated in respective slide carriers 56 so that they may move longitudinally with respect to the inner slide assemblies 19 and the support tray 14 as the latter is raised or lowered between its lower accessible position , as illustrated in fig1 and its raised position . fig1 illustrates the tray 14 in a partially raised attitude so that the relative movement between the components can be illustrated . it will be seen that the links 52 , which connect pivotally at 57 to the outer ends of the inner slide assemblies 19 , extend beyond their pivotal connection 57 to a further pivotal connection 58 which supports a respective leg 59 of a u - shaped handle assembly 60 . the inner ends of these legs 59 extend inwardly beyond their pivotal connection to support a laterally extending abutment 61 which engages beneath the links 52 so that when the handle assembly 60 is pivoted down to a position at which its legs 59 are substantially aligned with the links 52 , these abutments 61 prevent further pivoting of the handle assembly 60 without correspondingly pivoting the links 52 and as a consequence , raising the support tray 14 . this is illustrated in fig1 in which the legs and the end of the links 52 are shown in a lifting position and in a folding position . in this embodiment the energy storage means is suitably connected between the adjacent upper ends or lower ends of the links 52 and 53 in one or both the scissor mechanisms 51 . in this embodiment , operatively locking the handle legs 59 to the links 52 in a substantially aligned attitude has the advantage that when the handle assembly 60 is pushed to move the support tray rearwardly to its stowed position there is little or no tendency for the handle to pivot upwardly as illustrated by the arrow 64 in fig1 which could cause a user to overbalance . at the same time the handle assembly 60 may be easily pivoted to a stowed position when lowered or stowed either adjacent the outer end of a supported article or across the top of a supported article . if desired the legs 59 could be cranked outwardly from their pivotal connection to increase the over centre action preventing accidental upward pivoting of the handle assembly 60 . the links 52 and 53 are pivotally connected together adjacent their mid points to form scissor mechanisms which are capable of maintaining the tray 14 parallel to the inner slide assemblies 19 during raising and lowering . if desired the point of interconnection of the links could be varied from this position to cause the tray 14 to tilt as it is moved between its extended position and its accessible position . in the embodiment illustrated in fig1 an 16 , which illustrate only the scissors mechanisms 51 and the supported tray 14 of the fig1 embodiment , each inner end 70 of the handle assembly 71 is terminated by a sliding connection 72 to a respective link 52 , 53 which have respective opposed sliding connections 74 at their outer ends to the handle assembly 71 whereby the handle assembly 71 may be pushed inwardly to a stowed position , at which it lies alongside opposed pair of links 52 in fig1 embodiment and links 53 in fig1 embodiment , or retracted to an operative position extending from those links 52 , 53 . at all times the handle assembly 71 is maintained in substantial alignment with the respective pairs of opposed links 52 or 53 whereby up or down pressure on the handle will apply a rotational force to these opposed pairs of links for lowering or raising the article support assembly . the amount and or direction of the applied force can be selectively varied by utilising energy storage means able to support the weight of an article on the tray 14 in its elevated position or energy storage means able to only partially support the weight of an article on the tray 14 in its elevated position . this applied pressure may also actuate drive means for raising or lowering the tray 14 . the embodiment illustrated in fig1 could be utilised for accessing the handle where the stowed position is relatively high , such as on a car roof and if desired the legs 75 of the handles could also be telescopic to provide a longer extension of the handle . of course the links 52 or 53 could be dogleg type links to position the handle assembly 71 in a desired attitude when stowed or when in use . a retractable handle , either sliding , such as described above or telescopic or of other suitable form , could also be attached to the tray of any of the earlier embodiments of this invention as the control means . the elevating storage apparatus of various embodiments of this invention could be used in or on vehicles , such as cars , commercial vehicles and caravans or in fixed structures for supporting any article which has to be moved to an elevated stored position above an obstacle preventing direct lowering of the article from its stowed position to its accessible position . it is to be understood that the above has been given by way of illustration of aspects of this invention and that all such modifications and variations thereto as would be apparent to persons skilled in the art are deemed to fall within the broad scope and ambit of this invention as is defined the appended claims . | 1 |
referring now to the figures and more particularly to fig1 , a top view of a trench grate assembly 10 as assembled over a drainage trench 12 is shown . the trench grate assembly 10 generally comprises a frame 14 and a plurality of grate sections 16 . the frame 14 extends along and adjacent the sides of the drainage trench 12 , and is embedded in the pavement 21 surrounding the trench 12 . the grate sections 16 are aligned end to end over the drainage trench 12 in the frame 14 , and each include a plurality of apertures 20 , which receive fasteners 18 for retaining the grate sections 16 on the frame 14 , as described more fully below . preferably , as shown here , an aperture 20 is provided adjacent each corner of the grate section 16 . various other methods of securing the grate sections to the frame , including coupling and locking devices , fasteners , and other devices could also be used . the pavement 21 is typically concrete , although various other types of paving materials can also be used , as will be apparent to those of skill in the art . referring now to fig2 , a top view of the trench grate assembly 10 is shown before it is embedded in the pavement 21 . the frame 14 comprises a plurality of frame sections 15 that are sized and dimensioned to be aligned along the sides of the drainage trench 12 , end to end . each frame section 15 includes a grate support member 22 , a reinforcement member 24 that is parallel to a length of the grate support member 22 , and a plurality of spaced rib members 26 . the rib members 26 are substantially perpendicular to the length of each of the grate support member 22 and the reinforcement member 24 , and connect the grate support member 22 and the reinforcement member 24 together . referring now also to fig3 , from a top view , it can be seen that a space 17 is formed between the support member 22 , reinforcement member 24 , and adjacent rib member 26 . referring now also to fig6 , the rib members 26 provided at opposing ends of the grate support member 22 can include one or more aperture 30 for receiving fasteners 32 for coupling adjacent frame sections 15 together . although apertures and threaded fasteners are shown here , it will be apparent that various other coupling or locking devices could also be used to join the adjacent frame sections 15 . referring now also to fig3 - 6 , a top view of a frame section 15 and cutaway side views taken through the frame section 15 are shown , illustrating the cross sectional construction of the frame section 15 when embedded in pavement 21 surrounding a trench 12 . referring first specifically to fig4 , a cutaway view taken along the line 4 - 4 in fig3 is shown , illustrating a cross section of both the grate support member 22 and the reinforcement member 24 . in cross section , the grate support member 22 includes a substantially vertical member 25 , including an inner sidewall 23 and an outer sidewall 27 that extend from a top surface 38 that is substantially aligned with the surface of the pavement 21 , to a lower surface 40 embedded in pavement 21 in a position adjacent the trench 12 . the width of the vertical member 25 between the inner and outer sidewalls 23 and 27 is relatively narrow at the upper surface 38 , widens through a center portion of the member 25 and then tapers inward toward the lower surface 40 . referring still to fig4 , a substantially horizontally - extending flange 28 extends from the vertical member 25 , in a direction substantially perpendicular to the vertical member 25 , into the interior of the trench 12 , and inwardly beyond the trench sidewall to that the space below flange 28 is open . the flange 28 is positioned a distance below the upper surface 38 of the support member 25 selected to be substantially equivalent to the height of a grate section 16 to be received in the frame 14 , such that the grate section 16 is aligned with the upper surface 38 of the frame 14 and the surface of the pavement 21 when positioned on the flange 28 . the horizontal flange 28 can be , as shown here , substantially centered between the upper surface 38 and lower surface 40 of the vertical member 25 . the upper surface 46 of the flange 28 is preferably flat , and generally perpendicular to the sidewall 23 of the vertical member 25 , although , as shown here , the sidewall 23 may be angled slightly inward as it approaches the upper surface of the trench 12 to provide a widened opening for receipt of a grate section 16 on the flange 28 . the lower surface 48 of the flange 28 includes a substantially horizontal portion and a rounded corner 49 where the flange 28 connects to the vertical support 25 , to reinforce the connection between the vertical support 25 and the horizontal flange 28 . referring now also to fig7 , the flange 28 provides a cantilevered seat for a corresponding grate section 16 . apertures 19 can be provided in the flange 28 to mate with apertures 20 provided in the grate sections 16 , and to receive threaded fasteners 18 or other coupling devices for retaining the grate sections 16 in the frame 14 . referring still to fig4 , in cross - section , the reinforcement member 24 is also vertically oriented , but is substantially lower in height than the support member 22 , and is entirely embedded in the pavement 21 . as shown here , the reinforcement member 24 is about one third as tall as the support member 22 . the lower surface 34 of the reinforcement member 24 is aligned with the and substantially parallel to the lower surface 40 of the support member 22 . referring again to fig3 and also to fig5 , a cross sectional view taken through a rib member 26 is shown . as described above , rib members 26 are spaced along the frame section 15 , and extend between the reinforcement member 24 and grate support member 22 , joining the reinforcement member 24 to the grate support member 22 . the rib members 26 include an angled upper surface 42 that extends between the upper surface 32 of the reinforcement member 24 , and the outer sidewall 27 of the vertical support 25 of the grate support member 22 , where the rib member 26 is coupled to the grate support member 22 at a position near the upper surface 38 . the lower surface 44 of the rib member 26 extends continuously between the lower surface 40 of the grate support member 22 and the lower surface 34 of the reinforcement member 24 , such that the rib member 26 substantially encloses the space between the reinforcement member 24 and grate support member 22 , providing a solid reinforcement and back structure for reinforcing the frame 14 and supporting the grate sections 16 in the frame 14 . in one embodiment of the invention , the upper surface 42 of the rib member 26 is angled at an angle of substantially one hundred and thirty five degrees with respect to the upper surface 32 of the reinforcement member 24 . this angle , however , is not critical to the invention and various other angles could also be used . as described above , the support member 22 , the reinforcement member 24 , and the rib members 26 define generally rectangular spaces between them . concrete or other pavement materials 21 can flow into these spaces and set , thereby securely anchoring the frame 14 in the pavement . referring again to fig2 , to construct a drainage trench 12 including a frame 14 and trench grate assembly 10 as described above , a wood frame for forming trench 12 in the pavement 21 is typically provided ( not shown ). the frame 14 is then assembled along the edge of the wood framing by aligning a plurality of frame sections 15 end to end along a side of the trench 12 . the frame sections 15 can then be coupled together by inserting threaded fasteners 32 through apertures 30 in adjacent frame sections 15 . rebar or other reinforcement devices can be threaded through the space between the support member 22 and the reinforcement member 24 and coupled to framing or other elements for constructing the trench 12 . for example , u - shaped rebar components can be provided over the sections of the reinforcement member 24 between adjacent rib members 26 . after the frame 14 is assembled , pavement 21 such as concrete or other suitable material is poured around the frame 14 and associated framing members , providing a trench 12 with the frame 14 embedded as shown in fig4 and 5 . as described above , the pavement 21 can flow through the space between the support member 22 and reinforcement member 24 between rib members 26 to encase the frame 14 within the pavement , providing a frame with substantial structural integrity . after the trench 21 and frame 14 are constructed , grate members 16 are inserted into the frame 14 . the apertures 20 in the grate members 16 are aligned with mating apertures in the horizontal flange 28 , and threaded fasteners 18 or other coupling devices are inserted through the aligned apertures to couple the grate members 16 to the frame 14 . the reinforcement member 24 and rib members 26 provide a back structure for supporting the weight of the grate 16 in the frame without the need for a concrete ledge as required in prior art devices . because the flange 28 is cantilevered over the trench , the area immediately below the flange 28 is open , rather than enclosed with concrete . therefore , the trench has a larger surface area than prior art trenches . furthermore , because the area immediately below the flange 28 is open , dirt and debris falls through the apertures 19 in the frame 14 , rather than collecting in the apertures , as in the prior art . because the apertures remain open , the insertion of fasteners into the apertures is easier than in prior art devices , and is not impeded by dirt and debris collected in the frame . additionally , because the frame structure is substantially embedded in concrete , and easily anchored with rebar components , a frame of substantially greater structural integrity can be achieved . this structure integrity is further increased through the use of fastening elements , such as the threaded fasteners 32 which connect adjacent frame sections . although a preferred embodiment of the invention has been described in considerable detail above , many modifications and variations to the preferred embodiment described , however , will be apparent to a person of ordinary skill in the art . in order to apprise the public of the various embodiments that may fall within the scope of the invention , the following claims are made . | 4 |
illustrative embodiments of the invention are described below . while the invention is susceptible to various modifications and alternative forms , specific embodiments thereof have been shown by way of example in the drawings and are herein described in detail . it should be understood , however , that the description herein of specific embodiments is not intended to limit the invention to the particular forms disclosed , but on the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as defined by the appended claims . it will , of course , be appreciated that in the development of any such actual embodiment , numerous implementation - specific decisions must be made to achieve the developer &# 39 ; s specific goals , such as , compliance with system - related and business - related constraints , which will vary from one implementation to another . moreover , it will be appreciated that such a development effort might be complex and time - consuming , but would , nevertheless , be a routine undertaking for those of ordinary skill in the art having the benefit of this disclosure . fig3 depicts an illustrative embodiment of process 300 according to the present invention . process 300 includes a first separator 310 , a second separator 312 , a first pressure increasing device 320 , a second pressure increasing device 323 , a first expander 315 , a second expander 318 , a first heat transfer device 331 , a second heat transfer device 332 , a first pressure reducing device 326 , a second pressure reducing device 314 , and a collective heat transfer device , which is indicated generally as 329 in fig3 . flue gas from the oxycombustion power plant is available at essentially atmospheric pressure and relatively warm temperature . after cooling to about ambient temperature , the flue gas is then compressed , the compression heat is removed in the compressor &# 39 ; s cooler , the compressed flue gas stream is then dried in dryer 330 . examples of such drying methods may include , but are not limited to , desiccant dehumidification system , adsorption system by activated alumina or molecular sieves , permeation dryers or solvent scrubber / dryers . the flue gas also contains some other impurities , mainly the by - products of the coal combustion , such as traces of acid , no x ( like nitrogen oxide no and nitric oxide no 2 ), so x ( like sulfur dioxide so 2 , sulfur trioxide so 3 ) etc . in some circumstances , it is preferable to remove some of these impurities in a scrubber system prior to cryogenic treatment . for example , no 2 can react with water and so 2 in the scrubber to yield sulfuric acid or , in the absence of so 2 or if so 2 is depleted , can react with water to yield nitric acid . with sufficient residence time , no can react with oxygen to form no 2 , which , is then converted to the acids , as described . the acids in the water can be neutralized with a hydroxide solution or some other chemical means . the choice of front - end removal of those impurities depends upon the final use of co 2 and the economics of wet treatment of flue gas . indeed , the no 2 and so 2 being heavier than co 2 would concentrate in the co 2 product . the presence of so 2 , no 2 , and sometimes o 2 and no , in the co 2 can be objectionable for sequestration or eor applications . in this situation , these impurities can be removed in the front - end treatment so that co 2 will not contain significant level of those impurities . once the compressed flue gas stream is cooled and dried , and its impurities optionally removed , to form compressed dry flue gas stream 301 , it is further cooled 302 and sent to a first separator 310 . the compressed dry flue gas stream 301 may be at a pressure of about 30 bar , its temperature can be between about 5 ° c . and about 35 ° c . it is possible to perform the drying of the flue gas at a lower pressure followed by further compressing the dry flue gas to the required pressure for cryogenic treatment . the further cooled flue gas stream 302 will be at least partially condensed . within the first separator 310 , this further cooled flue gas stream 302 is separated into a first vapor stream 303 and a first liquid stream 311 . this first liquid stream 311 may be comprised of at least 90 % carbon dioxide . the first vapor stream 303 is further cooled and at least partially condensed 304 , and sent to a second separator 312 . the at least partially condensed stream 304 may have a temperature of about − 52 ° c . within the second separator 312 , this further cooled first vapor stream 304 is separated into a second vapor stream 305 and a second liquid stream 313 . this second liquid stream 313 may be comprised of at least 90 % carbon dioxide . the second liquid stream 313 is warmed and vaporized 307 . this warmed and vaporized stream 307 may have a pressure of about 9 bar and a temperature as low as of about − 40 ° c . the colder temperature lowers the compression power of the carbon dioxide compressor . the temperature is preferably warmer than the dew point of the gas , so sending liquid droplets into the compressor inlet can be avoided . the − 40 ° c . minimum temperature allows the use of lower cost carbon steel and not higher cost stainless steel for piping and compression equipment . the second liquid stream 313 may pass through a second pressure - reducing device 314 . after passing through the second pressure - reducing device 314 , the second liquid steam 313 may have a pressure of about 9 bar . the vaporized second liquid stream 307 is compressed in a first pressure - increasing device 320 , thereby , creating a higher - pressure stream 321 . a portion of the second liquid stream 313 may remain a liquid 334 . the first liquid stream 311 may pass through a first pressure - reducing device 326 . after passing through the first pressure reducing device 326 the first liquid stream may have a pressure of about 19 bar and may have a temperature of about − 6 ° c . the at least a portion of the first liquid stream 311 is warmed and vaporized 308 , at which point it combines with stream 321 to produce a combined stream 322 . a portion of the first liquid stream 311 may remain a liquid 333 . combined stream 322 is further compressed in a second pressure - increasing device 323 , thereby , creating a high - pressure stream 309 . the second vapor stream 305 is warmed in exchanger 329 and further warmed in first heat transfer device 331 to a temperature higher than that of the flue gas 301 , thereby , resulting in a warm third vapor stream 324 . this warm third vapor stream 324 may have a temperature that is between about 35 ° c . and about 80 ° c . this warm third vapor stream 324 is then expanded in a first expander 315 , thereby , resulting in a cool fourth vapor stream 316 . this cool fourth vapor stream 316 may have a pressure of about 6 . 6 bar . this cool fourth vapor stream 316 is then warmed in exchanger 329 and further warmed in exchanger 332 to a temperature higher than that of the flue gas 301 , thereby , resulting in a warm fifth vapor stream 317 . this warm fifth vapor stream 317 may have a temperature that is between about 35 ° c . and about 80 ° c . this warm fifth vapor stream 317 is then expanded to about atmospheric pressure in a second expander 318 , thereby , resulting in a cool sixth vapor stream 319 . this cool sixth vapor stream 319 is then warmed and vented . power generated by first expander 315 or second expander 318 can be used to drive electric generators to produce electricity , or can be used to partially drive the boost compressor ( not shown ) for the feed gas 301 , or carbon dioxide product ( first or second pressure increasing devices 320 or 323 ). the external heat exchanger used to heat the off - gas ( first and second heat transfer devices 331 and 332 ) may be a heat recovery exchanger , wherein the hot compressed feed gas or hot compressed carbon dioxide exchanges heat with the off - gas to provide the necessary heat . these heat exchangers can be an intercooler , or aftercooler of the flue gas compressor , or carbon dioxide product compressors ( first or second pressure increasing devices 320 or 323 ). in most isothermal compressors , the gas exiting a compressor stage is usually about 90 ° c . to about 120 ° c ., and it can be used as heating medium , therefore , heating to the level of about 50 ° c . can suit very well for the isothermal compressor , which is favorable for any power saving scheme . thanks to the refrigeration supplied by the first and second expanders 315 and 318 , the carbon dioxide fractions 311 and 313 can be produced at low temperature , ranging from about − 40 ° c . to about 3 ° c . furthermore , this additional refrigeration also allows extracting the co 2 streams 307 and 308 at higher pressures to save more compression power . since the triple point of carbon dioxide is − 56 . 6 ° c ., it is preferable to limit the outlet temperature of the first and second expanders 315 and 318 to about − 54 ° c . to avoid the risk of carbon dioxide freezing at the cold end of the exchanger . this constraint can be met by using the first and second expanders 315 and 318 , with inlet temperature about 35 ° c . to about 70 ° c . and to expand from about 30 bar to about atmospheric pressure as proposed in the present application . a single expander would yield an outlet temperature that was too cold , and would require a higher expander inlet temperature , which is more difficult to achieve , as in the case of the hot gas expander . without heating to about 35 ° c . to about 70 ° c ., it is also feasible to obtain similar performance of the 2 expanders by using 3 expanders in series with inlet temperatures of about 10 ° c . to about 20 ° c . however , not only is there an additional cost for the third expander , also the heat exchanger would cost higher due to an additional passage for the third expander flow . in some situations , it is desirable to produce a co 2 product essentially free of oxygen like in applications for enhanced oil recovery ( eor ). fig4 depicts an illustrative embodiment of process 400 for oxygen removal according to the present invention . process 400 includes a first separator 414 , a second separator 453 , a stripping column 440 , a first pressure increasing device 420 , a second pressure increasing device 422 , a third pressure increasing device 432 , a fourth pressure increasing device 437 , a fifth pressure increasing device 418 , first expander 425 , a second expander 428 , a first heat transfer device 451 , a second heat transfer device 452 , a first pressure reducing device 417 , a second pressure reducing device 430 , and a collective heat transfer device , which is indicated generally as 441 in fig3 . once the compressed flue gas stream 401 is cooled and dried , a portion 404 is sent to a stripping column 440 reboiler wherein it serves as the reboiler inlet stream 404 . the stripping column 440 may operate at about 10 bar . the stripping column 440 may operate at between about 10 bar and about 25 bar . this flue gas stream 404 reboils the stripping column 440 by condensing at least a portion of the flue gas stream 404 in the reboiler . this reboiler inlet stream 404 then exits the stripping column &# 39 ; s reboiler as the reboiler outlet stream 405 . stream 405 is sent to a second separator 453 , where it is separated into the reboiler outlet vapor stream 455 and reboiler outlet liquid stream 456 . reboiler outlet liquid stream 456 feeds the stripping column . reboiler outlet vapor stream 455 is then further cooled , and will be at least partially condensed , thereby , resulting in separator inlet stream 457 . the remaining portion 403 of the flue gas is cooled , partially condensed to yield stream 406 . within the first separator 414 , streams 406 and 457 are separated into a first vapor stream 415 and a first liquid stream 416 . this first liquid stream 416 is then sent to a first pressure - reducing device 417 , thereby , resulting in a stripping feed stream 413 . this stripping feed stream 413 is then sent to the stripping 440 . the stripping overhead stream 407 is warmed 402 , and then sent to a fifth pressure - increasing device 418 , thereby , creating a recycle steam 419 . of course , the warmed stripping overhead stream can feed to a stage of the flue gas compressor thus simplifying the machine arrangement at the expense of a slightly larger drying unit . the warmed and vaporized stripping column overhead stream 402 may have a temperature that is between about 35 ° c . and about 40 ° c . this recycle stream 419 is then combined with flue gas stream 401 . a portion of the stripping column bottom stream 408 is sent to a first pressure increasing device 420 , which results in a first medium pressure liquid stream 421 . the stripping column bottom stream 408 contains less than 10 ppmv of oxygen . this first medium pressure liquid stream 421 is then warmed and vaporized , then sent to a second pressure increasing device 422 , thereby , resulting in a high pressure stream 423 . this high - pressure stream 423 is then sent to the end - user . the first vapor stream 415 is warmed in exchanger 441 to about ambient temperature and further warmed in exchanger 451 to a temperature higher than that of the flue gas 401 , thereby , resulting in a first warm vapor stream 424 . this first warm vapor stream 424 may have a temperature that is between about 35 ° c . and about 80 ° c . this first warm vapor stream 424 is then expanded in a first expander 425 , thereby , resulting in a cool second vapor stream 426 . this cool second vapor stream 426 is then warmed in exchanger 441 to about ambient temperature and further warmed in exchanger 452 to a temperature higher than that of the flue gas 401 , thereby , resulting in a second warm vapor stream 427 . this second warm vapor stream 427 may have a temperature that is between about 35 ° c . and about 80 ° c . this second warm vapor stream 427 is then expanded in a second expander 428 , thereby , resulting in a cool third vapor stream 429 . this cool third vapor stream 429 is then warmed and vented . in another embodiment , as illustrated in both fig4 and fig4 a , a portion of the stripping column bottom stream 408 is removed prior to the first pressure - increasing device 420 . this removed portion is sent to a second pressure reducing device 430 , and warmed and vaporized , thereby , creating a low - pressure stream 431 . this low - pressure stream 431 is then compressed in a third pressure increasing device 432 , thereby , creating a second medium pressure stream 433 . in another embodiment , as illustrated in both fig4 and fig4 a , a portion of the stripping column bottom stream 408 is removed after the first pressure - increasing device 420 . this removed portion is sent to a third pressure reducing device 434 , and warmed and vaporized , thereby , creating an intermediate - pressure stream 454 . this intermediate - pressure stream 454 is then compressed in a fourth pressure increasing device 437 , thereby , creating a second medium - pressure stream 439 . this second - medium pressure stream 439 is then combined with the first medium - pressure stream 421 , prior to admission into the second pressure increasing device 422 . power generated by first expander 425 or second expander 428 can be used to drive electric generators to produce electricity , or can be used to partially drive the boost compressor for the feed gas 401 , or carbon dioxide product 432 , 437 , or 422 . the external heat exchanger used to heat the off - gas 451 and 452 may be a heat recovery exchanger wherein the hot compressed feed gas or hot compressed carbon dioxide exchanges heat with the off - gas to provide the necessary heat . these heat exchangers can be an intercooler or aftercooler of the flue gas 401 or carbon dioxide product compressors 431 , 437 , or 422 . in most isothermal compressors , the gas exiting a compressor stage is usually about 90 ° c . to about 120 ° c ., and it can be used as heating medium , therefore , heating to the level of about 50 ° c . can suit very well for the isothermal compressor , which is favorable for any power saving scheme . thanks to the refrigeration supplied by the 2 expanders 425 and 428 , the carbon dioxide fractions can be extracted at low temperature , ranging from about − 40 ° c . to about 3 ° c . this additional refrigeration also allows extracting the co 2 product streams at higher pressures to save more compression power . since the triple point of carbon dioxide is − 56 . 6 ° c ., it is preferable to limit the outlet temperature of the expanders 425 and 428 to about − 54 ° c . to avoid the risk of carbon dioxide freezing at the cold end of the exchanger . this constraint can be met by using 2 expanders 425 and 428 with inlet temperature about 35 ° c . to about 70 ° c . and to expand from about 30 bar to about atmospheric pressure as proposed in the present application . a single expander would yield an outlet temperature that was too cold , and would require a higher expander inlet temperature which is more difficult to achieve as in the case of the hot gas expander . without heating to about 35 ° c . to about 70 ° c ., it is also feasible to obtain similar performance of the 2 expanders by using 3 expanders in series with inlet temperatures of about 10 ° c . to about 20 ° c . however , not only is there an additional cost for the third expander , also , the heat exchanger would cost higher due to an additional passage for the third expander flow . in another embodiment , as illustrated in fig5 , the compressed dry flue gas 560 is sent to a distillation column 580 to remove the so 2 and no 2 impurities . a bottom stream 570 containing the captured so 2 and no 2 impurities is recovered and sent to the so 2 and no 2 treatment units . a vapor stream 565 exiting the top of the distillation column is essentially free of so 2 and no 2 and is further cooled and partially condensed . the vapor and liquid fractions of the partial condensation steps then follow the similar paths as in fig3 . this type of process arrangement can be used when the co 2 product can contain some oxygen , but only traces of so 2 or no 2 . the embodiment of fig6 is similar to fig5 , a distillation column 680 for so 2 and no 2 removal is provided near the warm end of the heat exchanger 641 . the top vapor 665 , essentially free of so 2 and no 2 , is cooled and partially condensed in the similar paths as in fig4 . this type of process arrangement can be used when the co 2 product contains only traces of oxygen , so 2 , and no 2 . in another embodiment , as illustrated in fig7 , a first portion of the compressed dry flue gas 701 is sent to a first phase separation device 703 , wherein it is separated into a first vapor stream 704 and a first liquid stream 705 . a second portion of the compressed dry flue gas 702 is cooled in the condenser of a stripping column 706 , then sent to a second phase separation device 710 , wherein it is separated into a second vapor stream 711 and a second liquid stream 712 . second liquid stream 712 is sent to stripping column 706 , wherein it is separated into a third vapor stream 707 and a third liquid stream 708 . third vapor stream 707 is then cooled and recirculated back to the incoming flue gas line . third liquid stream 708 , is warmed and vaporized , then compressed and sent to an end user 709 . first liquid stream 705 is heated and sent to stripping column 706 . first vapor stream 704 is warmed in exchanger 713 to a temperature higher than that of the flue gas , thereby , resulting in a warm fourth vapor stream 714 . this warm fourth vapor stream 714 may have a temperature that is between about 35 ° c . and about 80 ° c . this warm fourth vapor stream 714 is then expanded in a first expander 715 , thereby , resulting in a cool fifth vapor stream 716 . this cool fifth vapor stream 716 may have a pressure of about 6 . 6 bar . this cool fifth vapor stream 716 is then warmed in exchanger 717 to a temperature higher than that of the flue gas , thereby , resulting in a warm sixth vapor stream 718 . this warm sixth vapor stream 718 may have a temperature that is between about 35 ° c . and about 80 ° c . this warm sixth vapor stream 718 is then expanded to about atmospheric pressure in a second expander 719 , thereby , resulting in a cool seventh vapor stream 720 . this cool seventh vapor stream 720 is then warmed and vented . | 5 |
referring to fig1 and 1 a , one embodiment of the improved breaker panel 100 of the present invention is shown . the breaker panel 100 includes a plurality of shields and partitions that protect against accidental or unintended contact with the live electrical wires contained within . the main breaker shield 104 covers the area occupied by the main breaker 116 . the circuit breaker partition 102 divides the area within the breaker panel 100 into two distinct areas , more particularly the main breaker area 105 and the circuit breaker area 107 . the main breaker area 105 is the area occupied by the main breaker 122 and the circuit breaker area 107 is the area occupied by the circuit breakers , and other items , such as the bus bars 112 . the circuit breaker area 107 also includes a bus bar shield 110 . the bus bar shield 110 serves to separate the bus bar 112 from the other items within the circuit breaker area 107 , such as the circuit breakers 108 and any other devices . in operation , the breaker panel 100 includes a multitude of wires entering and exiting the panel , and connected to the circuit breakers 108 or other devices , and bus bars 112 contained within . wires that are not neatly routed throughout the breaker panel are difficult to trace , and create a dangerous environment for operators providing service or maintenance . an embodiment of the present invention may also include one or more bending posts 114 . the bending posts 114 are attached to the back panel and provide a guide or means of routing the wires contained within the breaker panel 100 . the bending posts 114 allow an operator to easily install or trace wires and minimize the chances of wires becoming tangled and reduces the chances of misidentification of wires . referring to fig2 , the main breaker shield 104 of the present is shown . the main breaker shield 104 substantially encloses the area where the main power enters the breaker panel 100 , as well as the main breaker 116 . the main breaker shield 104 is attached to the wall 124 of the breaker panel 100 by a plurality of standoffs 122 . while the illustrated embodiment utilizes sheet metal screws attached through preformed holes in the main breaker shield 104 and the standoffs 122 , other methods of attaching the main breaker shield 104 to the breaker panel are within the scope of the invention . the main breaker shield 104 shown in the illustrated embodiment may be constructed of clear material to allow views of the components contained within . it is understood that the main breaker shield 104 and other shields utilized in the present invention may be constructed of non - metal or any other suitable material that may serve as a barrier or wall to guard against unintended contact with the electrical wires or components contained within . it is a further feature of the present invention to allow an operator to actuate the main breaker 116 as needed , while protecting him from inadvertently contacting the live wires attached thereto . a switch opening 120 is formed in the main breaker shield to allow access to the switch 118 of the main breaker 116 . referring once again to fig1 , the circuit breaker shield 102 is substantially perpendicular to the back plate 128 . the circuit breaker shield 102 serves to separate the interior of the breaker panel into two compartments . the first compartment , as discussed above , includes the main breaker 116 , and the second compartment includes circuit breakers 108 , other devices , and bus bars 112 . the circuit breaker shield 106 may include one or more passageways to allow wires or junctions to communicate between components contained within the main breaker area 105 and components contained within the circuit breaker area 107 . the circuit breaker shield 106 may be constructed of a non - metal or any suitable material for use within a breaker panel . referring now to fig3 , the improved bus bar configuration 126 of the present invention is shown . the proximity of the ground bar 130 to the neutral bar 132 is convenient for making connections to the bus bars 126 . the bus bars 126 are substantially rectangular elongated bars , constructed from a conductive material , having a plurality of fastening screws 135 . the fastening screws are configured to hold the conductor of a wire in electrical communication with the bus bar . the bus bars 126 are offset , such as by situating the neutral bus bar 132 in a higher position than the ground bus bar 130 . this configuration makes it more difficult for a person to accidentally connect the neutral bus bar 132 directly to the ground bus bar 130 and makes it easier to install ground and neutral conductors without overcrowding such conductors or connecting conductors to the wrong bus . the ground bar 130 and the neutral bar 132 are each mounted to a pair of standoffs 131 and 133 respectively . the standoffs may be constructed from any material that supports the bus bar , and serves to isolate or connect the bus bar from the mounting point as desired , in this particular embodiment the back plate 128 . a bus bar shield 110 is provided , separating the bus bars 126 from the other items within the circuit breaker area 107 , such as the circuit breakers 108 and other devices . this bus bar shield 110 serves to safeguard against inadvertent contact between the ground or neutral bus bar and a power source connected to the circuit breakers or other devices . referring now to fig5 , the bus bar shield 110 is substantially perpendicular to the back plate 128 and attaches to the breaker panel 100 via to a pair of standoffs 111 . the bus bar shield 110 includes a pair of holes adapted to receive a pair of screws 113 protruding from standoffs 111 . while the illustrated embodiment utilizes screws 113 attached through preformed holes in the bus bar shield 110 and the standoffs 111 , other methods of attaching the bus bar shield 110 to the back plate 128 are within the scope of the invention . the bus bar shield 110 shown in the illustrated embodiment may be constructed of clear material to allow views of the components contained within . it is understood that the bus bar shield 110 and other shields utilized in the present invention may be constructed of a non - metal material or any other suitable material that may serve as a barrier or wall to guard against unintended contact with the electrical wires or components . in use , the breaker panel 100 will include a multitude of wires entering and exiting the panel , and connected to the circuit breakers 108 , fuses , and bus bars 112 contained within . to assure that these wires are neatly guided throughout the breaker panel one or more bending posts 114 are provided . referring now to fig4 and once again to fig1 a , the bending posts of the present invention are shown . the bending posts 114 are attached to the back panel and provide a guide or means of guiding the wire 115 . the bending post 114 used in the illustrated embodiment of the invention include a base 136 , a spool segment 137 and cap 138 . the bending post 114 attaches to the back panel via the base 136 . the base segment 136 includes a threaded recess adapted to receive a screw to fixedly attach the bending post to the base plate . additional methods of attaching the base 136 of the bending post 114 to the back panel are possible . above the base 136 , the spool segment 137 is substantially cylindrical , and communicates with the wires guided with the bending post 114 . the binding post terminates at the cap 138 , which serves to prohibit the wires from sliding off of the spool segment 137 . while the bending post in the illustrated embodiment is configured as described above , other bending post configurations are contemplated such as clips , combs , hooks , slotted partitions , or perforated devices . in the illustrated embodiment , the wire 115 , enters the breaker panel 100 and connects to breaker . 108 . the bending posts 114 serve to guide the wire about the interior perimeter of the breaker panel 100 . this configuration prevents the wires from crossing over the circuit breakers 108 , bus bars 126 , or other components contained within the breaker panel 100 . while the illustrated embodiment shows a particular number of bending posts 114 , it is understood that the number of bending posts used , as well as positions of the posts can vary . while this invention has been described as having particular embodiments , the present invention can be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the present invention using the general principles disclosed herein . | 7 |
fig1 - 5 illustrate a preferred embodiment of the invention . these illustrations are provided as an example of the invention , but are in no way intended to limit the scope of the invention . many design features and applications for the invention will occur to one of ordinary skill in the art after a review of these illustrations . similar numbering has been used across all drawing figures where like components are shown , to simplify description and review of the preferred embodiment . the position sensor is designated generally by the numeral 100 . sensor 100 is shown in an &# 34 ; as manufactured &# 34 ; condition prior to installation in fig1 - 3 . o - ring 180 is not illustrated for exemplary purposes . sensor 100 includes mounting ears 102 with holes 104 therethrough . holes 104 are used by attachment devices ( not shown ) such as bolts to pass through and attach to a throttle body ( not shown ). ears 102 provide easy access , particularly where a hex head type bolt is used . a rim 108 is provided generally at the outer periphery of sensor 100 . adjacent rim 108 is a groove 109 . rim 108 and groove 109 provide a relatively stiff periphery to sensor 100 , much as an i - beam would , while not consuming an excess of material in the manufacture . a dome 105 rises from rim 108 and groove 109 , forming a wall of the sensor chamber . a second dome 106 rises from dome 105 , forming an outer wall of the rotor chamber . sensor 100 at a bottom thereof includes an electrical connector wall 110 of generally cylindrical configuration , with a protrusion 112 extending therefrom . protrusion 112 forms a polarizing key to ensure a mating electrical connector ( not shown ) is inserted properly . additionally , protrusion 112 forms a positive mechanical latch to help retain the mating connector in an engaged position . in fig2 and 3 several features are visible which were not visible in fig1 . adjacent to electrical connector wall 110 is locating pin 118 . this pin 118 establishes part orientation upon the throttle body . as described in the copending application entitled &# 34 ; pin locator for factory zero set sensors &# 34 ; and incorporated herein by reference , pin 118 may also serve additional purposes . at the time of installation , an installer will likely be viewing the sensor 100 from an orientation similar to that shown in fig1 which is referenced herein as &# 34 ; top &# 34 ; for convenience purposes . the part will be mounted against a throttle body , with the &# 34 ; bottom &# 34 ; or side opposite that of fig1 pressed or abutted aid with the throttle body . locating pin 118 would insert into a mating hole , while fasteners would extend through ears 102 in holes 104 and be fastened to some structure upon the throttle body . assuming the fasteners to be bolts , the bolts would then be tightened down against ears 102 , bringing sensor 100 tight against the throttle body . to assist with initial alignment of the many mating features , sensor 100 further includes tapered guides 116 on the outer circumference of lip 114 . electrical connector wall 110 partially encloses electrical connector terminals 122 , 124 and 126 . while male blades are illustrated , there are a wide variety of known types of suitable electrical connectors . surface 120 may be formed integrally with the housing around the electrical connector terminals 122 , 124 and 126 , preferably in a sealed way to exclude dirt and other contaminants . fig4 and 5 illustrate the sensor 100 with alterations for viewing purposes that make these parts different from the &# 34 ; as manufactured &# 34 ; views of fig1 - 3 . in fig4 cover 170 ( visible in fig5 ) is removed to allow a complete view of the internal components . fig5 shows a cutaway view of sensor 100 taken along section line 5 &# 39 ; of fig4 . to avoid duplication , like numbering has been used as in fig1 - 3 , so already discussed components will not be repeated herein . the view in fig4 is from the &# 34 ; bottom &# 34 ; side , or the side that will be mounted against the throttle body . as noted , cover 170 is removed to allow a view of each of the internal components . central in fig4 is rotor structure 200 carrying thereon contactor structure 300 . the details of each of these structures will be discussed elsewhere . on a periphery of rotor 200 are two small protrusions 210 and 212 . these protrusions 210 and 212 at the time of manufacture are engaged with indentations 134 and 136 , respectively of arms 130 and 132 , respectively . at the time of installation , a throttle shaft ( not shown ) will be inserted into throttle shaft opening 202 . the sensor 100 will then be rotated just a few degrees , thereby releasing rotor structure 200 from any contact with arms 130 and 132 . the sensor 100 is then pressed towards the throttle body , using locating pin 118 and tapered guides 116 to help align sensor 100 to the throttle body . as long as protrusions 210 and 212 mate with indentations 134 and 136 outside the operating range of the sensor , no obstructions are present during sensor operation . additionally , once rotor 200 is released from arms 130 and 132 , rotor 200 is supported entirely upon the throttle shaft . having a rotor supported entirely by the throttle shaft creates several advantages , but not without issues that need addressed . a significant advantage is the lack of need for a return spring or bearing within the sensor package . this eliminates wear debris , reduces rotational torque , and does not impact adversely upon the return spring of the throttle shaft -- which provides the feel of the accelerator to the engine operator . however , the bearing in the prior art formed one part of an enclosed package that allowed the prior art sensors to be free - standing and environmentally protected . in the preferred embodiment , this issue is addressed in part by o - ring channel 182 and o - ring 180 , both which are most visible in fig5 . o - ring 180 is deformed and retained between sensor 100 and the throttle body ( not shown ) at the time of installation . this o - ring provides a seal between the throttle body and sensor 100 , thereby protecting the internal portions of sensor 100 from the remainder of the engine compartment . o - ring channel 182 , groove 109 and rim 108 form an i - beam type construction , providing sufficient structural integrity to ensure good compression of o - ring 180 . the resistive element 150 is typically formed by screen printing conductive polymers upon a kapton tm film , though the materials that make up element 150 are not the essential features of this invention . the driscoll and other similar patents adequately illustrate the features of this type of element construction . resistive element 150 is inserted into the housing , generally within and against dome 105 . one end of element 150 is captured in a pocket 142 comprised generally by u - shaped wall 140 on a first end of pocket 142 and two guide pieces 144 and 146 on an opposite end of pocket 142 . in practice , element 150 would typically be inserted into pocket 142 first at u - shaped wall 140 and then slid down between guide pieces 144 and 146 . pocket 142 serves to guide the insertion of element 150 during assembly and also serves as a positive method for positioning the terminal end of element 150 . positioning is important since element 150 must be connected through relatively small terminations to connector terminals 122 , 124 and 126 . once element 150 is inserted into pocket 142 , pressure wedge 400 is pressed into pocket 142 , forcing element 150 against the exposed portions of connector terminals 122 , 124 and 126 . by virtue of this compression , sound electrical contact resistant to vibration is ensured . the specific geometry of guides 144 and 146 is significant in ensuring correct deformation of element 150 while preventing element 150 from sagging into the region where wedge 400 will be inserted . too sharp a bend in element 150 could result in destruction of the resistive and conductive coatings patterned thereupon , while an insufficient bend will result in element 150 curving within pocket 142 , exposing element 150 to the possibility of being crushed upon insertion of wedge 400 . fig5 shows by cross - section view the inside of sensor 100 . many of the elements have already been described and will not be repeated here . however , cover 170 is shown in the installed position . from the drawing it is apparent that the interior opening of cover 170 , closest to rotor 200 , has a diameter somewhat larger than required for rotor 200 . this provides a small amount of radial tolerance to the throttle shaft axial center . this is in case the rotor 200 center is , prior to installation , not in exact axial alignment with the throttle shaft . opening 168 also limits radial motion of rotor 200 prior to throttle body installation , thereby preventing damage . also visible in fig5 are the chambers 192 and 194 formed by domes 105 and 106 , respectively . within chamber 192 is element 150 , contactor 300 , and , in most cases , an amount of lubricant ( not shown ) upon element 150 . during installation , the sensor 100 is pressed towards a throttle shaft . the throttle shaft should pass through throttle shaft opening 202 , but in order to do so , rotor structure 200 must be forced towards the throttle shaft . this force may be applied by axially moving the throttle shaft towards dome 106 . the force is then transmitted through the inner portion of dome 106 to rotor 200 , causing dome 106 and rotor 200 to be in contact as illustrated in fig5 . after installation the throttle shaft will be returned to a natural axial position , causing rotor structure 200 to move away from dome 106 . ideally , rotor 200 will then be separated from any direct contact with dome 106 . while throttle shafts typically suffer very little from radial motion ( which would result in rotor 200 being moved closer to one part or another of cover 170 ), the shaft will typically have a fair amount of axial motion . this axial motion will be translated into the contactor being moved transversely across the resistor tracks , which will not result in any change in output position sensing . this is as it should be . to maintain this integrity , resistors and conductors upon element 150 should be patterned to be wide enough so that axial motion of the throttle shaft will not cause contactor 300 to move off of the conductive patterns . fig6 - 8 illustrate the cover from side , end and bottom views , respectively . cover 170 has therein a large center hole 168 of slightly larger diameter than the part of rotor structure 200 fitting therethrough . additionally , cover 170 has curved tabs 172 with spaces 174 and 176 interspersed between each tab 172 . tabs 172 form a flexible one - way engaging mechanism to engage the inner circumference of lip 114 . during installation , cover 170 is pressed into lip 114 and tabs 172 resiliently flex towards the center of cover 170 . however , removal of cover 170 is prevented by tabs 172 biting into lip 114 . cover 170 could be made from a variety of materials , although a slightly resilient metal is preferable . rotor structure 200 is illustrated in fig9 - 12 . rotor structure 200 includes a throttle shaft opening 202 . at a first end of opening 202 is a tapered surface 204 which serves to facilitate alignment of throttle shaft with rotor structure 200 . at an end of opening 202 opposite tapered surface 204 is a slight extension 240 . extension 240 provides a bearing surface of less than full circle through which force may be applied to force rotor structure 200 onto a throttle shaft . extension 240 extends beyond end 242 of opening 202 so that if there is undesired drag between rotor structure 200 and dome 106 , that this be minimized . additionally , extending axially with opening 202 are two long grooves 206 and 208 , and a compression wedge 207 . compression wedge 207 engages a flat upon the throttle shaft to ensure exact alignment between the rotor structure and the throttle shaft . compression wedge 207 restricts opening 202 to a size just smaller than the shaft size , forcing rotor structure 202 to flex slightly to allow the throttle shaft to pass through . grooves 206 and 208 provide lines of flexure while ensuring that compression wedge 207 is retained tightly against the flat of the throttle shaft . extending on an exterior circumference of rotor structure 200 are two arms 222 which join to form a contactor support block 220 . contactor support block 220 includes contactor support surfaces 230 for supporting a contactor such as contactor 300 , with contactor alignment edge 224 and alignment stubs 226 . in production , contactor 300 is set against surfaces 230 and is heat staked in place by thermally deforming small heat stake protrusion 228 , edge 224 and stubs 226 . this structure serves to support contactor 300 and ensures tracking between contactor 300 and the throttle shaft . fig1 illustrates contactor 300 in further detail and fig1 illustrates rotor structure 200 interconnected to contactor 300 . contactor 300 is shown with brushes 306 protruding away from opposite edge 308 , although it will be immediately apparent to those skilled in the art that brushes are but one of many choices available from contactor structures . other configurations include paddles , spoons , rakes , multi - fingered contacts , blades , and others . there are four small tabs 304 that engage with and partially surround on three sides alignment stubs 226 . the center of contactor 300 has a small hole 302 through which fits heat stake protrusion 228 . in assembly , edge 308 of contactor 300 is abutted with alignment edge 224 . hole 302 is aligned with heat stake protrusion 228 , while alignment stubs 226 are centered between tabs 304 . the contactor 300 is then pressed down against surfaces 230 and heat stake protrusion 228 , edge 224 and stubs 226 are formed down to retain contactor 300 in place against surfaces 230 . fig1 - 18 illustrate the pressure wedge 400 in more detail . wedge 400 is formed from a resilient material with high spring retention . such materials might include beryllium copper , phosphor bronze , spring steel and other similar materials . plastics might also be used , although a sufficient spring force must be generated to ensure sound electrical contact through temperature extremes . wedge 400 has several protrusions 402 extending therefrom . protrusions 402 act as force concentrators and so are designed to press particularly against the resistive element 150 only in those places where element 150 is to make sound electrical contact with electrical connector terminals 122 , 124 and 126 . in an uncompressed state , wedge 400 takes on a v - shape form side view , as illustrated in fig1 . the base 404 of the wedge is joined and forms approximately a 30 degree included angle . since there are three electrical connector terminals 122 , 124 and 126 in the preferred embodiment , there are six legs extending from base 404 . while only two legs would be necessary at a minimum ( one for each side of the &# 34 ; y &# 34 ; shape adding a leg for each protrusion 402 provides resilience for each contact point independent of each other . this is of value in increasing the tolerance for slight differences in each termination . while strictly speaking , this still only accounts for a total of four legs , by adding six and making the wedge fully symmetrical , there is no need for special orientation of the wedge upon insertion . this eases the assembly operations required to insert wedge 400 into sensor 100 . fig1 illustrates the wedge 400 as it would appear inserted into pocket 142 . the wedge in this compressed state takes on a more &# 34 ; u &# 34 ; shaped geometry , with protrusions 402 extending oppositely therefrom . while the foregoing details what is felt to be the preferred embodiment of the invention , no material limitations to the scope of the claimed invention is intended . further , features and design alternatives that would be obvious to one of ordinary skill in the art are considered to be incorporated herein . the scope of the invention is set forth and particularly described in the claims hereinbelow . | 6 |
in referring to the drawings , it can be seen that in its simplest form , each castrating head comprises a case 1 , presenting on its front side 2 an opening 3 , and enclosing a severing device in the form of a blade 4 mounted on a shaft 5 whose axis extends to the plane of the row to be treated approximately perpendicular to the stems of the corn seedlings m . blade 4 is bent in a right angle at its ends to form two knives 6 . its axis extends onto the plane of the row to be treated approximately perpendicular to the stems of corn . the vertical edges of opening 3 each present a shutter in two parts 7a and 7b , each of which is substantially planar . part 7b is fastened onto 7a which can pivot on an approximately vertical axis 26 and can be immobilized at the required angle by mechanism 27 as shown in fig1 and 2 . shutter 7b which is approximately shaped like a triangle is arranged so that one of its sides is approximately vertical and is journalled about a substantially vertical axis at element 28 toward the lower end of this side on shutter 7a . in this manner , the two other sides 8 and 9 form two adjustable upper and lower ramps respectively . the function of ramps 8 is to straighten panicle p to be cut as well as the leaf in which it is located in order to facilitate their introduction into case 1 . on the other hand , the function of ramps 9 is to bend down the underlying leaves so that they will not enter the case . it is thus possible to cut off the panicles comprising the male elements without altering in an undesirable manner the greenery of the corn seedling . according to an embodiment particularly applicable to machines carried by a tractor equipped with a slope correction system , the heads are affixed on bars 10 joined by journalled links 11 between them . each one of bars 10 is supported by the end of a pair of arms 12 journalled by its other end on an upright 13 affixed to the tractor vehicle ( not shown ) and which is able to pivot on an approximately vertical plane because of the action of jack 14 . each one of bars 10 can pivot by the interposition of a shaft 15 on a plane perpendicular to that formed by arm 12 and corresponding upright 13 . therefore , as shown in fig5 if the rows of corn to be treated are located on a slope , it is possible , by careful adjustment of the angle of arms 12 , to keep all castrating heads approximately equidistant from the ground . as shown in fig4 and 7 , a movable parallelogram linkage connecting assembly is formed by a pair of arms 12 , a respective upright 13 , and a relatively short arm 12a which is movable , while remaining substantially perpendicular to the ground . the rotary driving of blades 4 is achieved by the interposition of a hydraulic motor 16 mounted at the end of one of shafts 5 . the movement is transmitted to the other blades by belts , such as 17 ( fig4 ). each one of cases 1 is linked to guides 18 each supported by a shank 19 that can slide and be immobilized in a catch of holder 20 affixed to the case . the function of these guides is to straighten the seedling , which would have pushed obliquely in its row on a transversal plane . this makes it possible to guarantee that it will be possible to introduce its panicle into slot 3 of the corresponding head . although the supporting rods 10 can be bent horizontally , it is essential that slots 3 of the heads remain vertical . for this purpose , a further linkage assembly is provided . each one of cases 1 can freely pivot around the axis of shaft 5 by the driving of the blade by the interposition of link 21 , journalled at one of its ends onto the end of a clamp 22 of case 1 , and at the other onto axis 23 parallel to shaft 5 and affixed to mobile side 12a of the deformable parallelogram comprising corresponding arms 12 . fig8 is an example of a way to link case 1 to bar 10 . thus , shaft 5 extends through bearing 24 externally comprising a shoulder on which the rear side of case 1 is engaged , which is held by plate 25 . the present invention is , of course , not limited to the embodiment described and shown , but rather extends to all varying shapes and sizes . | 0 |
while this invention is susceptible of embodiment in many different forms , there is shown in the drawings and will herein be described in detail , two specific embodiments , with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the invention to the embodiments illustrated . fig1 , and 3 of the drawings represent the construction and , finally , the application of the first embodiment of the present invention . the first embodiment itself emcompasses the use and installation of a loop body appendage which makes it possible to attach the loop body to a button , where the button cannot be prefabricated with the loop body as an integral part . in fig1 and 2 , a flexible link such as elastic loop 12 is wound around flat disk spool 10 having center 13 . the loop body is gathered as it comes off the spool by a metal crimp 11 . the gathering crimp at this location retains one end of the loop body on the cylindrical spool while permanently shaping the looped orifice described by the remainder of the flexible cord for fastening onto a button . the phantom outline of the flexible cord 34 describes the position of the cord while it is sandwiched in by the flanges of the cylindrical spool . in fig3 a demonstration of application is illustrated showing the entire appendage assembly 10 , 11 , 12 , 13 , and 34 in an exploded view behind sample button 15 before button 15 is inserted into button hole 16 . final assembly of the appendage to the button includes the anchoring of the loop body appendage and button by means of sewing , riveting , or pinning , to fabric 33 . while both appendage and button 15 can be anchored along side one another without acutal fusing , our particular embodiment recommends fabrication of the loop appendage to the button before attachment to the fabric . once the button and appendage are connected and finally attached to fabric 33 , the entire assembly is ready for buttoning onto a second fabric through the means of button hole 16 . fig4 illustrates an example of the second embodiment set forth in the specification . in this particular embodiment , the elastic loop body is made an integral part of the button itself during itself during fabrication of the button and thus , does not require an actual appendage which must be attached to the back of the button before use of the present invention . fabricated button 17 is shown with elastic loop 19 that has been anchored within it upon fabrication . means 18 for attaching said button 17 to a fabric are similarly shown . another example of a button possessing the loop body from fabrication is shown in fig5 . here button 22 displays loop body 21 protruding from its underside at point 20 . sewing hook 23 is shown as means for attaching the button to the first article of fabric . fig6 through 8 illustrate in a schematic series the actual usage of the button loop body which would be typical . in fig6 fabric 24 shown in phantom and fabric 25 will be joined by the usual means of buttoning . in this application , button 26 has not yet been inserted through button hole 27 on fabric 25 . in fig7 button 26 has been inserted through button hole 27 on fabric 25 and elastic loop body 28 is shown protruding from fabric 24 underneath fabric 25 awaiting installation . fig8 demonstrates final usage of protruding elastic loop 28 as it is drawn down over and finally inserted under button 26 . at this point , button 26 is locked in , not only by button hole 27 , but also by loop body 28 , and fabric 25 is protected from involuntary opening or release from fabric 24 . fig9 illustrates another use of the button lock loop on what is commonly referred to as a &# 34 ; flap &# 34 ; pocket . here button 31 has been buttoned through the button hole of flap 30 . at this point , loop body 32 has been extended over the button and locked behind it thus securing the flap pocket from involuntary opening or separation from pocket 29 shown in phantom . the foregoing description and drawings merely explain and illustrate the invention and the invention is not limited thereto , except in so far as the appended claims are so limited , as those skilled in the art who have the disclosure before them will be able to make modifications and variations therein without departing from the scope of the invention . | 8 |
referring now to the drawings in which like reference numerals designate like or corresponding parts throughout the several views , there is shown in fig1 through 5 , a rotary union for transferring pressurized fluid according to the present invention which is designated generally by the reference numeral 10 . rotary union 10 is comprised of a support housing 12 , a stator housing 14 , a stator 16 and a rotor 18 . rotary union 10 is shown for exemplary purposes being secured to an apparatus 20 . apparatus 20 includes a stationary member 22 and a rotating shaft 24 having an axis of rotation 26 . rotary union 10 is designed to be an original equipment component which is secured to apparatus 20 . support housing 12 includes a generally cylindrical body 28 having an annular flange 30 extending radially outward from one end to facilitate the mounting of union 10 to stationary member 22 of apparatus 20 . housing 12 is secured to member 22 using a plurality of bolts 32 and a plurality of dowel pins 34 both of which extends through flange 30 and into member 22 . housing 12 defines an axis 36 which is the functional axis for union 10 . bolts 32 and dowel pins 34 are incorporated into apparatus 20 to mount housing 12 such that axis 36 is aligned with axis 26 of rotating shaft 24 . cylindrical body 28 defines a bore 38 which extends through body 28 to provide a chamber 40 for housing the sealing surfaces of rotary union 10 . a drain port 42 extends through cylindrical body 28 into chamber 40 to drain any fluid which may flow between the sealing surfaces of union 10 back to a sump or tank ( not shown ) which supplies the pump ( not shown ) for providing pressurized fluid to rotary union 10 . a labyrinth 43 insures that the fluid which flows from between the sealing surfaces will be directed towards drain port 42 . cylindrical body 28 is adapted at the end of body 28 opposite to flange 30 for mounting stator housing 14 . stator housing 14 includes a generally cylindrical body 44 having an annular flange 46 extending radially outward from the exterior surface of body 44 to facilitate the mounting of housing 14 to housing 12 . housing 14 is secured to housing 12 using a plurality of bolts 48 which extend through flange 46 and into housing 12 . cylindrical body 44 defines a bore 50 which extends through housing 14 to provide for the locating of stator 16 . the end of housing 14 opposite to support housing 12 defines a threaded bore 52 to which the stationary fluid supply source is attached . bore 50 of housing 14 includes an inwardly extending annular flange 54 for mounting a seal 56 which seals the interface between housing 14 and stator 16 . stator 16 includes a generally cylindrical body 58 having an annular flange 60 extending radially outward from the exterior surface of body 58 . stator 16 includes a through bore 62 for transporting the pressurized fluid through union 10 . stator 16 is disposed within bore 50 of stator housing 14 such that stator 16 is capable of axial movement along axis 36 . the outside diameter of flange 60 is designed to be slidingly received within bore 50 and flange 60 defines a plurality of sills 64 which extend through flange 60 for the passing of pressurized fluid . a plurality dowel pins 66 extend through the wall of body 44 of stator housing 14 and into a respective slot 64 to prohibit the rotation of stator 16 with respect to housing 14 while still allowing the axial movement of stator 16 along axis 36 . the end of body 58 extending from flange 60 away from housing 12 defines a first external diameter 68 which mates with annular flange 54 and seal 56 of stator housing 14 to define an inlet pressure chamber 70 and a retraction pressure chamber 72 . a retraction port 74 extends through flange 46 of stator housing 14 into chamber 72 to provide access to chamber 72 by an external source of pressurized fluid ( not shown ). a coil spring 76 is disposed within chamber 72 between flanges 54 and 60 in order to urge stator 16 to the left as shown in fig2 or into sealing engagement with rotor 18 . the end of body 58 extending from flange 60 towards housing 12 defines a second external diameter 78 which is smaller than diameter 68 to provide for the selective pressurized unloading or retraction of the sealing faces as will be discussed later herein . annular ring 80 extends between external diameter 78 and bore 50 . annular ring 80 is provided with an internal seal 82 which seals between ring 80 and stator 16 and an external seal 84 which seals between ring 80 and stator housing 14 . retraction chamber 72 is thus isolated from bore 62 , inlet pressure chamber 70 and the external environment by seals 56 , 82 and 84 . annular ring 80 is retained within bore 50 by a snap ring 86 which extends into cylindrical body 44 . stator 16 defines a sealing surface 88 which mates with a sealing surface 90 located on rotor 18 . rotor 18 includes a generally cylindrical body 92 defining a through bore 94 for transporting the pressurized fluid through union 10 . rotor 18 is adapted at one end to rotatably engage shaft 24 . as illustrated in fig3 rotor 18 includes an external thread 96 which threadingly engages an internal thread 98 disposed within a fluid passage 100 of shaft 24 . a seal 102 disposed between rotor 18 and shaft 24 maintains a fluid seal for bore 94 and passage 100 . the end of rotor 18 opposite to splines 96 defines sealing surface 90 which sealingly mates with sealing surface 88 on stator 16 to complete the route for pressurized fluid to flow through union 10 . sealing surfaces 88 and 90 are normally micro - lapped such that rotor 18 rotates smoothly and easily with respect to stator 16 while insuring a sealing interface between stator 16 and rotor 18 . with the incorporation of labyrinth 43 and drain port 42 which transport any fluid passing between sealing surfaces 88 and 90 back to the tank or sump , sealing surfaces 88 and 90 can be supplied with micro - lapped grooves 104 which transport a minute portion of the pressurized fluid moving through union 10 to the interface between sealing surfaces 88 and 90 . the fluid which is transported between sealing surfaces 88 and 90 by micro - lapped grooves 104 will lubricate the interface between sealing surfaces 88 and 90 thus reducing friction and wear between the sealimg surfaces as well as reducing the torque required to rotate union 10 . the fluid which is transported by micro - lapped grooves 104 will eventually leak from between sealing surfaces 88 and 90 and be returned to the tank or sump by labyrinth 43 and drain port 42 . the operation of rotary union 10 begins with union 10 being mounted to apparatus 20 as shown in fig2 . a source of fluid ( not shown ) is provided to threaded bore 52 of stator housing 14 . when the fluid being supplied to bore 52 is not under pressure , coil spring 76 urges stator 16 against rotor 18 thus engaging sealing surfaces 88 and 90 . the load applied between sealing surfaces 88 and 90 will only be dependant upon the design of coil spring 76 . retraction port 74 is provided in order to allow pressurized fluid to be supplied to reaction pressure chamber 72 totally independant of inlet pressure chamber 70 . pressurized fluid supplied to chamber 72 reacts against both surfaces of flange 60 due to the plurality of slots 64 extending through flange 60 . the pressurized fluid within chamber 72 will act against stator 16 and urge stator 16 to the right as shown in fig2 against the load of coil spring 76 thus eliminating the load applied between sealing surfaces 88 and 90 by separating sealing surfaces 88 and 90 . this urging of stator 16 to the right is due to the fact that diameter 78 of stator 16 is smaller than diameter 68 of stator 16 thus providing a larger surface area on the left side of flange 60 than on the right side of flange 60 as shown in fig4 . the load applied between sealing surfaces 88 and 90 can be totally eliminated by knowing the strength of coil spring 76 , the difference in areas between the sides of flange 60 and then applying a specified pressure to retraction port 74 . when the fluid being supplied to threaded bore 52 is under pressure , coil spring 76 urges stator 16 against rotor 18 and the pressurized fluid within inlet pressure chamber 70 reacts against the end of stator 16 to increase the load by which stator 16 is urged against rotor 18 engaging sealing surfaces 88 and 90 . the load applied between sealing surfaces 88 and 90 can be controlled by knowing the strength of coil spring 76 , the pressure of the fluid within inlet pressure chamber 70 and the surface area exposed to inlet pressure chamber 70 . when pressurized fluid is being supplied to bore 52 , pressurized fluid is not being supplied to port 74 . retraction port 74 is totally independant from threaded bore 52 . when connecting the pressurized fluid to threaded bore 52 , a valve 106 can be included which selectively supplies the pressurized fluid to either threaded bore 52 or retraction port 74 . this allows an operator to switch valve 106 such that pressurized fluid is being supplied to threaded bore 52 when apparatus 20 requires the flow of pressurized fluid . sealing surfaces 88 and 90 are urged together due to the load exerted by coil spring 76 and the load exerted by the fluid pressure acting on the area of stator 16 exposed to the fluid pressure . when apparatus 20 does not require the flow of pressurized fluid , valve 106 can be switched to supply pressurized fluid to retraction port 74 , thus separating sealing surfaces 88 and 90 in order to eliminate any wear or friction between surfaces 88 and 90 . fig6 through 8 show a rotary union 110 according to another embodiment of the present invention . rotary union 110 is similar to rotary union 10 with the exception that support housing 12 of union 10 has been replaced by support housing 112 in union 110 . support housing 112 is similar to support housing 12 except for the elimination of flange 30 . support housing 112 is secured in an axially aligned position with shaft 24 &# 39 ; by an l - shaped bracket 120 rather than by flange 30 . rotary union 110 is designed to be incorporated into an apparatus 20 &# 39 ; as an after market retro - fit instead of the original equipment manufacture design of rotary union 10 . l - shaped bracket 120 provides of the adjustment of axis 36 &# 39 ; of housing 112 , in relationship to axis 26 &# 39 ; of shaft 24 &# 39 ;. axis 36 &# 39 ; is the functional axis for union 110 while axis 26 &# 39 ; is the axis of rotation for shaft 24 &# 39 ;. support housing 112 is mounted to a stationary member 122 by utilization of l - shaped bracket 120 and a plurality of bolts 124 . stationary member 122 can be a portion of apparatus 20 or member 122 can be a separate component . a partially tubular support frame 126 is fixedly secured to bracket 120 and bracket 120 is positioned to locate frame 126 generally coaxial with shaft 24 of apparatus 20 . a plurality of threaded adjustment screws 128 extend through frame 126 and support housing 112 within frame 126 . thus , by adjusting the individual screws 128 , axis 36 &# 39 ; of housing 112 can be perfectly aligned with axis 26 &# 39 ; of shaft 24 &# 39 ; in order to insure the proper interfacing of sealing faces 88 and 90 . the remainder on union 110 including the function and operation are identical to those shown and described for rotary union 10 . fig8 illustrates the adjustment procedures of adjusting screws 128 in order to align axis 36 &# 39 ; of housing 112 with axis 26 &# 39 ; of shaft 24 &# 39 ;. l - shaped bracket 120 is first fixedly secured to member 122 using the plurality of bolts 124 with frame 126 generally co - axial with axis 26 &# 39 ;. an installation plug 140 is fixedly secured to housing 112 by the plurality of bolts 48 . adjusting plug 140 has an exterior surface 142 which mates with an internal surface 144 on housing 112 to co - axially locate housing 112 relative to plug 140 . with adjusting screws 128 being loosened or removed , the assembly of installation plug 140 and housing 112 is threaded into shaft 24 &# 39 ; and tightened using an integral hex drive 146 . adjusting screws 128 are then tightened against housing 112 to positively secure housing 112 to frame 126 of bracket 120 . once adjusting screws 128 are tightened , axis 36 &# 39 ; which is defined by housing 112 , is aligned with axil 26 &# 39 ; of shaft 24 &# 39 ; due to plug 140 being threadingly received within shaft 24 &# 39 ; and the mating of surfaces 142 and 144 . once housing 112 has been secured by screws 128 , bolts 48 and plug 140 are removed and the remainder of the internal components of rotary union 110 are assembled into housing 112 . stator housing 14 includes an external surface 148 which is also designed to mate with surface 144 to insure that stator housing 14 will be located coaxial with axis 36 &# 39 ;. while the above detailed description describes the preferred embodiment of the present invention , it should be understood that the present invention is susceptible to modification , variation and alteration without deviating from the scope and fair meaning of the subjoined claims . | 8 |
the following description of this invention is intended to be illustrative only and not limiting . antifuses used in typical integrated circuit applications such as in memories , microprocessors , and field programmable gate arrays are typically organized into one or more arrays or orderly addressable arrangements . in either case , antifuses are selected for programming by a select circuit or other decoders of well known design . during programming , a programming voltage is selectively and sequentially applied across each antifuse designated to be programmed . non - designated antifuses are protected from the programming voltage to prevent unintentional programming . typically a variable voltage source is coupled to an external programming pin which is coupled to a node of the antifuse being programmed to assist in establishing the programming voltage . in accordance with this invention , the reliability of individual antifuse cells is increased by providing a second , redundant antifuse in each antifuse cell . the programming voltage is applied across both antifuses in one cell simultaneously thereby incurring no additional programming time delays relative to programming a single antifuse . after programming , the antifuse redundancy circuit conveys accurate information to an inquiring sense circuit when at least one of the antifuses is programmed . additionally , if one of the antifuses is unintentionally deprogrammed after both antifuses in the cell have been programmed , the antifuse redundancy circuit continues to retain correct information corresponding to the state of a programmed antifuse . if one or both of the antifuses in the antifuse redundancy circuit are unintentionally programmed , the antifuse redundancy circuit produces an inaccurate output . however , the probability of one of the antifuses in a cell becoming unintentionally programmed is no greater than the probability of unintentionally programming the single antifuse in a typical antifuse cell . referring to fig1 when antifuse redundancy circuit 100 is selected for programming , a select circuit ( not shown ) applies a low programming voltage signal such as zero volts ( 0 v ) to pgm node (&# 34 ; pgm &# 34 ;) and a high voltage signal such as five volts (+ 5 v ) to read node (&# 34 ; read &# 34 ;). during programming vpp is established at a below system ground voltage such as minus five volts (- 5 v ). the low voltage signal on pgm is applied to the gates of p - channel mos transistors q1 and q2 , and vdd (+ 5 v ) is applied to the sources of transistors q1 and q2 thereby causing transistors q1 and q2 to conduct . initially , the high impedance of unprogrammed antifuse 102 allows little if any programming current to flow through antifuse 102 , and a programming voltage of vdd minus vpp , less the slight drain - to - source voltage drop ( vds ) across transistor q1 , is applied across antifuse 102 for a selected time . in response to this voltage , the resistance of antifuse 102 decreases to a few hundred ohms or less during programming . during programming , vds across transistor q1 increases as the resistance of antifuse 102 decreases . the non - linear relationship of vds versus drain current ( id ) for transistor q1 causes the programming current id to saturate for some value of vds . simultaneously , diode - coupled n - channel mos transistors q7 and q8 and transistor q2 establish a positive bias voltage on the gate of n - channel mos transistor q6 causing transistor q6 to conduct . antifuse 104 is programmed identically to antifuse 102 with transistor q6 limiting the programming current to antifuse 104 in the same manner as transistor q1 does for antifuse 102 . during programming , transistor q1 initially charges the gate of n - channel mos transistor q4 to approximately vdd causing transistor q4 to conduct . conducting transistor q4 pulls the gate of n - channel mos transistor q5 to approximately vpp which prevents transistor q5 from conducting . as the resistance of antifuse 102 decreases , the gate - to - source voltage of transistor q4 decreases below the threshold voltage (&# 34 ; vth &# 34 ;) of transistor q4 to turn q4 &# 34 ; off &# 34 ; thereby allowing q5 to turn on as the voltage on the gate of q5 rises . the voltage on the gate of q5 rises toward vdd as antifuse 104 is programmed . q5 turns on and pulls the voltage on node 106 to vpp . following the simultaneous programming of antifuses 102 and 104 , a high voltage such as + 5 v is applied to pgm which prevents transistors q1 and q2 from conducting . high impedance n - channel mos transistor q10 always conducts during normal operation . when transistor q2 is turned &# 34 ; off &# 34 ;, by pgm going high , transistor q10 discharges the gate of transistor q6 to v ref thereby turning off q6 and thus eliminating any voltage drop across antifuse 104 during non - programming conditions . v ref is preferably coupled to a voltage that allows transistor q10 to conduct such as ground . an antifuse may become defective due to a variety of reasons . however , if either antifuse 102 or antifuse 104 fail to program during the programming operation or one of them is unintentionally deprogrammed after both have been programmed , antifuse redundancy circuit 100 will continue to provide accurate information during a read operation as explained below . during a read operation , read output node 106 transfers a logic &# 34 ; 1 &# 34 ; ( 3 - 5 v ) to fuse -- out node (&# 34 ; fuse -- out &# 34 ;) if both antifuses 102 and 104 are unprogrammed . if either or both antifuses 102 and 104 are programmed , read output node 106 transfers a logic &# 34 ; 0 &# 34 ; ( 0 - 2 v ) to fuse -- out , otherwise read output node 106 transfers a logic &# 34 ; 1 &# 34 ; to fuse -- out . the read operation is initiated by a select circuit ( not shown ) applying a read voltage of 0 v to read , switching vpp to system ground , and applying + 5 v to pgm . the read voltage is applied to the gates of p - channel mos transistors q9 and q3 causing q9 and q3 to conduct . the + 5 v on pgm turns transistors q1 and q2 &# 34 ; off &# 34 ;. during the read operation , if both antifuses 102 and 104 are unprogrammed and thus non - conductive , read output node 106 charges to approximately a logic &# 34 ; 1 &# 34 ; through transistor q3 . the logic &# 34 ; 1 &# 34 ; on read output node 106 applied to the gate of transistor q4 causes transistor q4 to conduct . vpp ( corresponding to system ground ) is applied to the gate of transistor q5 through transistor q4 which prevents transistor q5 from conducting . thus , read output node 106 remains at logic &# 34 ; 1 &# 34 ;. p - channel mos pass transistor q9 transfers the logic &# 34 ; 1 &# 34 ; on read output node 106 to fuse -- out . during the read operation , if both antifuses 102 and 104 are programmed , the resistance of programmed antifuse 102 is sufficiently low to cause a relatively large vds drop across conducting transistor q3 causing read output node 106 to assume a logic &# 34 ; 0 &# 34 ;. the logic &# 34 ; 0 &# 34 ; on read output node 106 prevents transistor q4 from conducting . a negligible voltage drop occurs across programmed antifuse 104 causing transistor q5 to conduct . conducting transistor q5 pulls read output node 106 to an even lower voltage , approximately ground on vpp . pass transistor q9 transfers the logic &# 34 ; 0 &# 34 ; on read output node 106 to fuse -- out . if antifuse 102 is intentionally programmed and antifuse 104 is defective and cannot be programmed or has been unintentionally deprogrammed , antifuse redundancy circuit 100 continues to provide the correct logic &# 34 ; 0 &# 34 ; output to fuse -- out during the read operation . as discussed above , the programmed antifuse 102 causes read output node 106 to assume a logic &# 34 ; 0 &# 34 ;. nonconducting transistor q4 and unprogrammed antifuse 104 eliminate any discharge or charging paths for the gate of transistor q5 causing the gate of transistor q5 to &# 34 ; float &# 34 ;. if the gate voltage of transistor q5 is below the threshold voltage , vth of transistor q5 , transistor q5 is &# 34 ; off &# 34 ;, and pass transistor q9 transfers the logic &# 34 ; 0 &# 34 ; on read output node 106 to fuse -- out . if the gate - to - source voltage of transistor q5 exceeds vth of transistor q5 , transistor q5 conducts and brings read output node 106 to an even lower voltage corresponding to ground on vpp . pass transistor q9 transfers the correct logic &# 34 ; 0 &# 34 ; on read output node 106 to fuse -- out . if antifuse 104 is intentionally programmed and antifuse 102 is defective and cannot be programmed or has been unintentionally deprogrammed , antifuse redundancy circuit 100 continues to provide the correct logic &# 34 ; 0 &# 34 ; output to fuse -- out during the read operation . when antifuse 102 is not programmed , read output node 106 initially charges to approximately vdd causing transistor q4 to conduct . conducting antifuse 104 causes transistor q5 to conduct . transistor q5 is sized to have a lower impedance and a higher conductance than transistor q3 . thus transistor q5 discharges read output node 106 to a logic &# 34 ; 0 &# 34 ;. pass transistor q9 transfers the logic &# 34 ; 0 &# 34 ; on read output node 106 to fuse -- out . it will be appreciated by those skilled in the art after reading this description that although n - channel and p - channel mos transistors are described other switches may be utilized to implement the antifuse redundancy circuit . accordingly , various other embodiments and modifications and improvements not described herein may be within the spirit and scope of the present invention , as defined by the following claims . | 6 |
fig1 illustrates a preferred embodiment of an energy source according to the present invention . the dual mode resonant cavity source 20 receives electrical input from a waveform generator 22 , which is amplified by a power amplifier 24 . the waveform generator 22 and power amplifier 24 are located usually at or near the earth &# 39 ; s surface , distant from the resonant cavity source 20 . the waveform generator 22 and the power amplifier 24 are known in the art , and their selection is not crucial to practicing the invention . for example , the waveform generator 22 may be a 20 / 20 frequency synthesizer manufactured by analogic . the power amplifier 24 may be a linear amplifier , such as one manufactured by instruments , inc . the resonant cavity source is suspended by a wire - line 25 , which serves to suspend the resonant cavity source 20 within the borehole 28 , and to house two leads which bring the electrical pulse or signal from the power amplifier 24 to the resonant cavity source 20 . a coupling head 26 provides electrical connection between the wire - line 25 and the resonant cavity source 20 . the coupling head 26 is also known in the art and , therefore , its selection is not crucial to practicing the invention . for example , the single conductor go head manufactured by applied electronics can be used . the source 20 has an upper end 29a and a lower end 29b . exo - skeleton sections 30 define a portion of the outer surface of the source 20 . when the source is operational , acoustic waves generated by the active piezoceramic elements contained within the exo - skeleton 30 pass through elongated apertures 32 . it will be appreciated that the invention may include multiple exo - skeleton sections 30 , or a single exo - skeleton section 30 . the exo - skeleton 30 of the preferred embodiment has a inner diameter of approximately 35 / 8 inches , and is about 1 / 2 inch thick . the selected diameter is suitable for use in most production oil and gas wells which are cased with 51 / 2 inch o . d . steel casing . for other applications the tool and its internal components can be scaled in size to increase or decrease output power levels . the length of the exo - skeleton 30 will vary according to the desired operational frequencies of the resonant cavity source 20 . the resonant cavity source 20 has a bellows housing 34 located distal to and connected to the exo - skeleton 30 . the bellows housing 34 contains sealed bellows that allow a low velocity liquid within the source 20 to expand and contract as a result of elevated temperatures within the borehole 28 and the differential expansion between the fluid inside the source and the fluid inside the borehole . nose cone 36 is located at the lower end 29b of the source 20 . conductor crossover 58 is located at the upper end 29a of the source 20 . fig2 is an exploded assembly view of the resonant cavity source 20 . bellows 42 is located within bellows housing 34 when the source 20 is assembled . nose cone 36 is fastened to lower end of bellows housing 34 with set screws . bellows bulkhead 44 has an internal channel ( shown in fig1 ) that receives a nipple 43 located on the upper end of the bellows 42 . o - rings 45 are located on the upper end of bulkhead 44 . bulkhead 44 is attached to the upper portion of bellows housing 34 , and the lower portion of exo - skeleton 30 by means of set screws received by two sets of recesses within the bellows bulkhead 34 ( depicted in fig1 ). o - rings 45 located on the upper portion of the bellows bulkhead 34 sealingly engage the lower portion of a cavity bladder seal ring 46 . the upper portion of cavity seal ring 46 fits within metallic bladder 48 , and is connected to the bladder 48 , for example , by means of a weld . when the source 20 is completely assembled , metallic bladder 48 is located within exo - skeleton 30 . piezoceramic crystal cavity 49 is housed within bladder 48 . bladder 48 is connected to coupler bulkhead 54 by means of another cavity bladder seal ring 46 . coupler bulkhead 54 has two sets of recesses about its circumference ( shown in fig1 ). these recesses receive set screws to secure adjacent exo - skeletons 30 . it will be appreciated that while the embodiment depicted in the drawings depicts only two crystal cavities 49 , with two corresponding exo - skeletons 30 , the design may be expanded to include multiple crystal cavities 49 by adding additional coupler bulkheads 54 . bulkhead upper adapter 56 ( more particularly shown in fig1 ) seals cavity metallic bladder 48 with a cavity bladder seal ring 46 in the same way that bellows bulkhead 44 engages the lower metallic bladder 46 . conductor crossover 58 attaches to threads on the upper portion of bulkhead upper adapter 56 , which has internal contact points which allow for transmission of an electrical signal , while maintaining a pressure tight seal in the remainder of the tool . when the entire source 20 is assembled , a pressure tight connection is formed between bellows 42 , the internal bulkheads 44 and 54 , the metallic cavity bladders 48 and the upper bulkhead 56 . internal passages or bores along the longitudinal axes of the bulkheads 44 and 54 provide fluid communication , and allow for electrical wires to be passed along all of the sealed components . when the entire source 20 is assembled , the pressure tight cavity is filled with an appropriate low velocity fluid , such as flouranert ™, a perfluorinated fluid manufactured by the minnesota mining & amp ; manufacturing co . ( 3m ). these synthetic , highly engineered fluids are characterized in that they are substantially incompressible and are able to withstand rigorous field conditions . it is understood , however , that the selection of fluid is not crucial to practicing the invention . when the internal components of the energy source 20 are assembled , they form a completely sealed unit . the internal components are filled with a low velocity liquid ( not shown ). the internal components are in fluid communication . bellows 42 allows the volume of the sealed chamber to expand and contract in response to external changes in temperature within the borehole . the axial bore resulting from the assembly of the internal components allows for electrical leads to pass from the upper to lower ends of the source 20 . fig3 depicts an assembled piezoceramic crystal cavity 49 . individual piezoceramic crystals 50 are assembled into a long cylindrical shape having a longitudinal axis . the individual crystals 50 are separated by isolation rings 62 . mounting struts 64 run along the length of the cavity 49 parallel to its longitudinal axis . the mounting struts ( shown in fig7 ) have multiple circular openings for receiving a set screw . the mounting strut 64 secures the crystals 50 by engaging corresponding recesses within isolation rings 62 . cavity mounting isolators 52 are located at opposing ends of the cavity 49 . positive leads 68 and negative leads 70 transmit electrical signals from the amplifier 24 to the individual crystals 50 . fig4 depicts an individual crystal 50 of the crystal cavity 49 . crystal 50 has multiple longitudinal stripes 66 . each crystal 50 has a positive lead 68 and a negative lead 70 . leads 68 and 70 are mounted in loops along the interior surface of crystal 50 . when the crystals 50 are assembled into an cavity 49 , the leads 68 and 70 are connected in parallel . fig5 depicts one cavity mounting isolator 52 . the cavity mounting isolator 52 has a chamfered upper portion 76 and a plurality of longitudinal recesses 72 . the lower portion of mounting isolator 52 has a lip 74 and a corresponding cylindrical sleeve 75 . when assembled into an cavity 49 as depicted in fig3 sleeve 75 fits within the upper portion of the interior of one piezoceramic crystal 50 . leads 68 and 70 pass through cavity mounting 52 to the interior of the assembled cavity 49 . fig6 and 6a depict an isolation ring 62 . the isolation ring 62 has a plurality of recesses 78 . when the cavity 49 is assembled , the recesses 78 accept set screws through the recesses 80 in the mounting struts 64 ( shown in fig7 ). fig8 depicts the cavity metallic bladder 48 . the metallic bladder 48 is a hollow cylinder , preferably constructed of corrosion - resistant stainless steel . although selection of the stainless steel is not crucial to the invention , one example of an acceptable stainless steel source is inconel ™. the metallic bladder 48 of the preferred embodiment has a wall thickness of approximately 0 . 04 inches . fig9 shows the bladder seal ring 46 . seal ring 46 has a thinner sleeve portion 82 and a thicker cylinder 86 . sleeve 82 fits within bladder 48 , where it is secured with a weld . cylinder 86 is adapted to mate with the various o - rings of coupler bulkheads 44 , 54 or 56 . chamber 84 along the upper portion of cylinder 86 allows the seal ring 46 to be easily engaged during assembly . fig1 depicts the connection of bladder 48 to bladder seal ring 46 , for example by means of a weld . fig1 is an elevation of the nose cone 36 . the nose cone 36 has an upper cylindrical portion 88 that when assembled , fits within the lower portion of bellows housing 34 . the plurality of recesses 90 within cylindrical portion 88 allow the nose cone 36 to be secured to bellows housing by screws passed through the lower recesses 94a ( shown in fig1 ) of the bellows housing 34 . turning now to fig1 , bellows housing 34 has longitudinal apertures 92 . upper recesses 94b of bellows housing 34 correspond to recesses 96 in bellows bulkhead 44 ( shown in fig1 ) allowing screws to secure bellows housing 34 to bellows bulkhead 44 . internal channel 98 passes through the interior of bellows bulkhead 44 , and receive the nipple 43 of the bellows 42 . channel 98 allows for fluid communication between the bellows 42 and the sealed interior of the energy source 20 . recesses 100 within bellows bulkhead 44 allow exo - skeleton 30 to be secured to bulkhead 44 by screws that pass through the corresponding openings 102 within exo - skeleton 30 ( shown in fig1 ). coupler bulkhead 54 ( depicted in fig1 ) is used to couple adjoining assembled cavities 49 . internal passage 102 allows for fluid communication between attached cavities 49 , and also allows for leads 68 and 70 to pass through from one cavity 49 to the next . two sets of recesses 108 , 110 correspond to openings 102 and 104 of adjacent exo - skeletons 30 allowing them to be connected by , for example , a screw . it will be appreciated that where a single crystal cavity 49 is desirable for a given application , coupler bulkhead 54 would be unnecessary . fig1 depicts the bulkhead upper adapter 56 . bulkhead upper adapter 56 has a plurality of recesses 112 which allow exo - skeleton 30 to be secured to it by screws through corresponding openings 104 on exo - skeleton 30 . internal passage 114 extends longitudinally into bulkhead upper adapter 56 , and external ports 115 , which allow for the addition and release of fluid from the sealed chamber . a threaded portion 116 is located on the upperportion of bulkhead 56 . the threaded portion 116 of bulkhead upper adapter 56 threadably engages the threaded portion 118 of coupler crossover 58 . the smooth inner walls 120 of coupler crossover 58 slidably engage and seal against the o - rings 45 located at the upper portion of bulkhead upper adapter 56 . fig1 a depicts internal leads 121 , which extend through upper adapter , and make electrical contact with internal leads 68 and 70 . internal leads 121 receive the electrical signal from coupler crossover 58 , which receives the signal from waveform generator 22 and power amplifier 24 through wire - line 25 and head 26 . fig1 is a plot of the source 20 output , with output power measured as a function of frequency . in operation , the waveform generator 22 is set to produce a frequency sweep from 200 to 4 , 000 hz . the frequency sweep signal is amplified in the power amplifier 24 to produce a signal in the wireline cable 25 . the signal is received at the conductor crossover 58 , where it passes through leads 68 and 70 , into the crystal cavity ( s ) 49 . the signal 122 produced as a result of exciting both cavities of a configuration with two coupled cavities 49 is shown . the resulting signal for either of the two cavities 49 individually are depicted by waveforms 124 and 126 . in operation , several relatively low - frequency elements are used to provide resonance peaks at lower frequencies in the longitudinal resonant mode . the summation of the higher frequency plateau energy from the hoop mode of each element provides adequate broad band high frequency energy to replace the high frequency elements in conventional multiple element designs . each of the elongated cavities 49 in the half - wave mode has a known associated resonant frequency , according to the equation : where of = cavity resonant frequency , v = velocity of sound in the internal fluid , and l = the length of the cavity . assembling one or more cavities of desired resonant frequencies provides enhanced power output at the resonant frequency . the outwardly presented surfaces of the piezoceramic cylinders that make up the cavity 49 provide a broadband source of energy at frequencies above the resonant frequency of the cavity 49 . it will be appreciated that alternative embodiments can be practiced without departing from the present invention . for example , the cavities 49 can easily be assembled to produce the quarter wave , full wave or other fractional mode resonances . thus , the preferred embodiment employs cylindrical shells of active piezoceramic material as the active resonant element of the energy source . these individual piezoceramic cylindrical shells are arranged into an elongated cylinder ( cavity ), and sealed within metallic bladders . the bladders contain an appropriate low acoustic velocity liquid that facilitates the propagation of seismic waves into the borehole and the surrounding area . the stacked piezoceramic elements are energized by a waveform generator and an associated power amplifier , which can be located in the source housing , but usually is located remotely , outside the borehole . the waveform generator and associated power amplifier send the electrical signal to the crystals through a wireline cable and leads attached to the surface of each individual crystal . the elongated piezoceramic cylinder , or cavity , when operated in a fluid of known acoustic velocity inside the bladders has an associated resonant frequency of = v / 2l in the half - wave mode , where l is the length of the cavity and v is the velocity of sound in the fluid . both ends of the cavity are open to produce the half - wave resonance . a quarter - wave resonance is produced by closing one end and opening the other , producing a resonant frequency of = v / 4l . the same length cavity can produce a lower frequency resonance in the quarter - wave mode than in the half - wave mode . at the resonant frequency , the displacement of the cylinder ( cavity ) when operated , and therefore , the power output , can be many times greater than the output if resonance was not present . therefore , resonant frequencies at lower frequencies below 700 to 1 , 000 hz can overcome the lack of low - frequency power output in previous piezoceramic designs . the resonant frequencies of 250 to 400 hz can add one to two octaves of output to the broadband response of a piezoceramic source . in one such resonant cavity source , a large number of resonant cavities could be used so that the sum of their outputs would cover a broad frequency range , e . g ., 250 hz to 2 , 000 hz . in such a design , 10 to 40 cavities of varying lengths could be used . however , the resulting design would have a length of 30 or more feet , violating the underlying point source assumption for the frequencies of interest in borehole seismic logging . alternatively , the cavities could be lengthened using non - piezoceramic materials for part of the cavity , thereby lowering the resonant frequency and sharpening the resonance peak . accordingly , stimulation with electrical signals having frequencies above the resonant frequency of the cavity is employed . the outwardly presented surfaces of the piezoceramic cylinders comprising the cavity operate in the hoop mode as a non - resonant , broadband source of energy . this phenomenon is present at all frequencies above the resonant frequency of the cavity . a plateau of energy above the resonance frequency is thereby created . the present invention thus teaches an apparatus that acts as a dual mode energy source , utilizing both the resonance frequency of the piezoceramic cavity ( s ) for higher output at lower frequencies , and the hoop mode for broadband output at higher frequencies . a borehole energy source that uses both resonance and the hoop mode of the piezoceramic to replace the high frequency elements in conventional multiple element designs and produce a relatively short source with higher output at lower frequencies is thus disclosed . the signal generated at the earth &# 39 ; s surface and sent to the tool is a frequency sweep signal , where the frequency of the input electric signal is swept over a desired frequency range ( for example 250 hz to 2 khz ). the dual mode energy source of the present invention is able to use the resonant frequency of the piezoceramic cavity , as well as the hoop mode at frequencies above resonance to produce a plateau of energy above the resonance frequency . this arrangement reduces the number of piezoceramic cavities necessary to produce seismic waves over the desired band of frequencies . this allows for a simpler design , less components , and a smaller energy source . the piezoceramic crystals of the present invention are housed within a metallic bladder . this metallic bladder is able to withstand the corrosive environment of the borehole , without adversely impacting the ability of the energy source to transmit seismic waves into the borehole . the invention therefore provides a dual mode multiple - element resonant cavity piezoceramic borehole energy source . the foregoing detailed description described the preferred embodiment of the invention . it is clear , however , that the preferred embodiment may be variously modified . therefore , to particularly point out and distinctly claim the subject matter regarded as invention , the following claims conclude the specification . | 8 |
referring to fig1 , machine 100 , shown as a pneumatic compactor , includes a frame 102 having a front frame end 104 and a back frame end 106 . an operator control station 108 is coupled to frame 102 between front frame end 104 and back frame end 106 in a conventional manner . machine 100 further includes a front compaction module 110 and a rear compaction module 112 . both front compaction module 110 and rear compaction module 112 are rotatably coupled to frame 102 . in the embodiment shown in fig1 , both front compaction module 110 and rear compaction module 112 are each made up of four compacting members 220 . in the exemplary embodiment , compacting member 220 is a pneumatic tire . one of skill in the art will appreciate that machine 100 could be any type of compactor employing compacting member 220 . and while front compaction module 110 and rear compaction module 112 are described as having four compacting members 220 , front compaction module 110 and rear compaction module 112 could have any number of compacting members 220 , and front compaction module 110 may have a different number of compacting members 220 than are present in rear compaction module 112 . machine 100 further includes a system 200 for adjusting pressure and temperature of compacting member 220 as illustrated in fig2 . machine 100 has an engine 201 with an exhaust system 202 . exhaust system 202 carries away heated engine exhaust air . the heated exhaust air being removed from engine 201 is significantly higher than the temperature of the ambient air , and can be anywhere from 350 - 450 ° c . ( 662 - 842 ° f .). exhaust system 202 is coupled to air system 204 . air system 204 is coupled to compacting member 220 . air system 204 includes an air compressor 206 , a valve 208 , and an intake 210 . intake 210 allows ambient air to enter the air system . valve 208 allows either heated exhaust air from engine 201 or ambient air from intake 210 to travel to air compressor 206 and ultimately to compacting member 220 . air compressor 206 has a compressor intake 240 and a compressor outlet 250 . in an exemplary embodiment , valve 208 would be an electronic mixing valve to allow ambient air , exhaust air , or a mixture of the two to enter the intake of air compressor 206 to create the required temperature in compacting member 220 . the pressure reached within compacting member 220 using air system 204 would range from 2 - 10 bar ( 29 - 145 psi ). compacting member 220 is equipped with a pressure sensor 222 and a temperature sensor 224 . pressure sensor 222 monitors and measures the pressure of compacting member 220 . temperature sensor 224 monitors and measures the temperature of compacting member 220 . pressure sensor 222 and temperature sensor 224 are known in the art . pressure sensor 222 and temperature sensor 224 are coupled to compacting member 220 in a way to ensure that each is taking accurate measurements of pressure and temperature representative of compacting member 220 . the system for adjusting pressure and temperature of compacting member 220 also includes a controller 230 . controller 230 is in communication with compressor 206 , valve 208 , pressure sensor 222 , and temperature sensor 224 through either wired or wireless technologies known in the art . controller 230 is a standard electronic control module known in the art . in general , the present disclosure may prove particularly useful for pneumatic compactor machines . it may also be useful for other industrial machines , including but not limited to certain loaders and various work machines used in construction , agriculture , and industrial environments . system 200 is for controlling the pressure and the temperature of compacting member 220 . while the present disclosure has described system 200 with respect to a single compacting member 220 , the present disclosure anticipates that system 200 may be used with multiple compacting members 220 . for example , in a standard pneumatic compactor having four front tires and four rear tires , system 220 would have eight compacting members 220 . air compressor 206 is capable of directing either heated exhaust air , ambient air , or both heated exhaust air and ambient air to individual compacting members 220 . the pressure and temperature of compacting member 220 are altered by changes in either pressure , temperature , or both . so the addition of heated exhaust air or ambient air can affect both the pressure and temperature of compacting member 220 . it will be appreciated by those skilled in the art that actual performance of machine 100 will vary as a function of the inflation pressure of compacting member 220 and the softness or hardness of the surface being compacted . thus , low inflation pressure of compacting member 220 will generally improve traction and durability of a compactor machine on softer ground , for example , while higher inflation pressure of compacting member 220 will provide more efficient results on firmer surfaces . to the extent that the compaction surface may be softer and of lower density in early stages of the compaction process , the surface will generally become increasingly denser and hence more firm after several passes of machine 100 over the surface . as such , it may be advantageous to vary the compacting member 220 inflation pressure as a function of real - time density of the compaction surface . changes in temperature will cause corresponding changes to pressure of compacting member 220 . accordingly , with the present disclosure , operators of machine 100 would be able to automatically control the temperature of compacting member 220 as well as the pressure of compacting member 220 to prevent paving material from sticking to compacting member 220 and maintaining compacting member 220 at the proper pressure to accomplish machine 100 &# 39 ; s task . the present description is for illustrative purposes only , and should not be construed to narrow the breadth of the present disclosure in any way . thus , those skilled in the art will appreciate that various modifications might be made to the presently disclosed embodiments without departing from the full and fair scope and spirit of the present disclosure . other aspects , features and advantages will be apparent upon an examination of the attached drawings and appended claims . | 8 |
fig1 shows an embodiment of a reaming tool provided with two helical flutes 1 and with high hardness cutting elements 2 , 3 , 4 , 5 , 6 provided in different reaming steps as part of the reaming tool . in the embodiment shown , the reaming tool — apart from the helical flutes 1 and the high hardness cutting elements 2 , 3 , 4 , 5 , 6 — is provided with so - called guide pads 7 , 8 , and with so - called swarf channels 9 , 10 . the embodiment of the reaming tool is also provided with coolant holes for providing cooling liquid to the reaming process . the high hardness cutting elements are divided into a cutting element 2 in an initial reaming step and additionally high hardness cutting elements 3 , 4 , 5 , 6 for reaming in a work - piece ( see fig7 a - 7b ) of secondary holes with larger diameters and provided in extension of a primary hole having the smallest diameter in the work - piece . such secondary holes may be holes provided in the work - piece for insertion of bearings and / or seals for any axle or rod extending through the primary hole , e . g . an axle in a gearbox or a rod in a gear shift mechanism . the high hardness cutting elements 2 , 3 , 4 , 5 , 6 are inserted into a base material of a base body 12 of the reaming tool . the insertion is established by soldering or brazing . the high hardness cutting elements 2 , 3 , 4 , 5 , 6 are manufactured separately from the manufacture of the base body 12 of the reaming tool , and the high hardness cutting elements 2 , 3 , 4 , 5 , 6 are inserted subsequently into the helical flutes 1 , which are provided in the base body 12 . thus , the high hardness cutting elements 2 , 3 , 4 , 5 , 6 are manufactured by use of manufacturing equipment especially suited for manufacture of high hardness cutting elements , and the base body 12 , which is preferably made of hard metal having a hardness being limited in comparison to the hardness of the high hardness elements , is manufactured by use of manufacturing equipment especially suited for the manufacture of such base bodies . only subsequently to the individual manufacture of the high hardness cutting elements 2 , 3 , 4 , 5 , 6 and the individual manufacture of the base body 12 with helical flutes 1 , are the base body 12 and the high hardness cutting elements 2 , 3 , 4 , 5 , 6 , mutually attached . perhaps a final shaping of the high hardness cutting elements 2 , 3 , 4 , 5 , 6 are provided in order to assure a smooth transition from the substantially linear extension of the surface of the high hardness cutting elements 2 , 3 , 4 , 5 , 6 towards the course of the helical flute 1 . the cross - section of the helical flutes 1 may be either one of the following cross - sections : semicircular flutes , v - shaped flutes and right - angled flutes . preferably , the helical flutes 1 are v - shaped or right - angled so that chips being cut are better directed along the flutes . fig2 shows the angular direction v of the high hardness cutting element 2 . the high hardness cutting element 2 has a substantially linear extension , in contrast to the helical extension of the helical flutes . however , the high hardness cutting elements 2 are inserted into the helical flutes 1 so as to establish a near - most helical extension of the cutting element 2 . this is achieved by adjusting the angular direction v ( see fig2 ) of the cutting element 2 so that the linear extension of the cutting element 2 at some point is directed substantially tangentially to the helical course of the helical flute 1 . after adjusting the angular direction v ( see fig1 ) of the cutting element 2 during insertion of the cutting element 2 into the helical flute 1 , a final shaping of the high hardness cutting element may be provided so as to establish a smooth transition between the high hardness cutting element 2 and the part of the helical flute 1 just following the element . using a positively or negatively angled helical flute , i . e . a right - hand twist or left - hand twist , together with the high hardness cutting element extending tangentially to the helical twist produces less radial and axial thrust forces on the work - piece when being machined . thus , a better bore hole roundness is obtained . also , less radial and axial thrust forces on the work - piece when being machined leads to a more stable machining process and vibrations are reduced to a minimum . furthermore , increased tool durability is obtained compared to conventional tools having high hardness cutting elements . the helical flutes 1 and the high hardness cutting elements 2 may exhibit a positive angle or a negative angle , i . e . a right - hand twist or a left - hand twist . a positive angle of the high hardness cutting elements 2 creates a shear , which together with a corresponding positive angle of the helical flutes 1 , directs the chips out of the bore hole in the work - piece towards the head of the reaming tool , opposite a longitudinal machining direction d of the reaming tool . a negative angle of the high hardness cutting elements creates a shear , which together with a corresponding negative angle of the helical flutes in the reamer shaft , directs the chips out of the bore hole forwards towards the tip of the reamer , in the machining direction of the reaming tool . such an embodiment is possible if the bore hole is through - going . the angle , whether positive or negative , may have a value between 10 ° and 45 °, preferably between 5 ° and 20 °. fig3 a - 3c especially show a close - up view of the guide pads 7 , 8 provided at circumferential surfaces 13 , 14 of the shaft of the reaming tool . the guide pads 7 , 8 are provided along circumferential surfaces 13 , 14 situated between opposing helical flutes 2 . three guide pads 7 , 8 are provided on each of the two individual circumferential surfaces 13 , 14 . other numbers from one to perhaps four guide pads or more may be provided on each of the two individual circumferential surfaces . each of the guide pads 7 , 8 on each of the circumferential surfaces 13 , 14 extends helically with the same helical twist as a helical twist of the helical flutes 1 . the guide pads 7 , 8 are preferably made in a solid carbide surface of the shaft of the reaming tool . the guide pads 7 , 8 are provided for scraping off , from the inner circumference of the bore hole , particles other than the chips formed by the high hardness cutting elements , such chips being directed along the helical flutes . each of the guide pads 7 , 8 has an outlet 17 , 18 leading to a swarf channel 9 , 10 ( see later sections of the description ). however , different courses than a helical twist may be envisaged , and the helical twist may be different than the helical twist of the helical flutes . such different embodiments may cause the guide pads to not leading to the swarf channels ( if swarf channels are present at all ), but instead leading to one of the helical flutes at any point along the extension of the helical flutes . the function of the guide pads are still the same of such different embodiments of the guide pads , i . e . scraping off particles from the inner circumference of the circumference of the bore hole . the guide pads 7 , 8 are provided by recesses ground into the base materiel of the base body of the shaft of the reaming tool , and the guide pads 7 , 8 have a saw - tooth shaped cross - section . the up - right side 15 of the recesses is directed in the rotational direction r of the reaming tool , and the sloping side 16 of the recesses is directed away from the rotational direction of the reaming tool , i . e . the up - right side 15 is the leading side of the recesses , and the sloping side 16 is the trailing side of the recesses . thus , the up - right side 15 has a scraping effect on the inner circumference of the bore hole during the reaming process , scraping off coolant liquid and any particles other than chips , such coolant liquid and possible particles not being directed out of the bore hole along the helical flutes . the guide pads promote better chip flow towards the helical flutes . thus , a minimum of contaminants will be flowing along the guide pads , thereby promoting longer tool durability and higher quality of the bore hold of the work - piece . also , the helical guide pads add stability during the machining process and thus reduce the risk of generating chatter marks or elliptical cutting patterns on the internal circumference of the bore hole . in the embodiment shown , the initial reaming step with the high hardness cutting element 2 is considered the initial reaming step . apart from the cutting element 2 , this reaming step is also provided with guide pads 7 and swarf channels 9 . the embodiment also shows additional reaming steps , among those the immediate subsequent reaming step with the high hardness cutting element 3 . also this reaming step is provided with guide pads 8 and swarf channels 10 . however , different embodiments could be envisaged . if the bore hole itself , already from a previous manufacturing process , has the correct dimension and fulfils the necessary tolerances , the reaming step with the cutting element 2 may be dispensed with . instead , the reaming step with the cutting element 3 becomes the initial reaming step , preferably , but not necessarily , provided with guide pads and perhaps also swarf channels . even additional reaming steps may be provided also . thus , in such an embodiment , the foremost end of the reamer is intended for aligning the reaming tool in the bore hole , but the foremost end of the reaming tool does not have any cutting means and thus does not provide any cutting of the bore hole . the reaming step with the cutting element 3 is then , as already described , used for reaming a bore hole with an enlarged diameter compared to the bore hole having the smallest diameter . fig4 a - 4d show close - up views of the longitudinal linear extension l and of the thickness of the high hardness cutting element . the longitudinal extension l is between 1 mm and 20 mm , depending on the geometry of the work - piece to be machined by the reaming tool . the thickness t of the high hardness cutting element 2 is between 0 . 3 mm and 5 . 0 mm depending on the diameter of the reaming tool , the step length and the expected cutting force the tool will be exposed to . also , the material of the work - piece to be machined influences the choice of thickness of the high hardness cutting element . both the length l of the high hardness cutting element 2 and the thickness t of the high hardness cutting element 2 are also influenced by the choice of high hardness cutting material , such as the high hardness cutting material being poly - crystalline diamond ( pcd ) or cubic boron nitride ( cbn ). fig5 a - 5b show an embodiment of a swarf channel 9 . as previously mentioned , the swarf channels 9 , 10 are positioned at outlets 17 , 18 of the guide pads 7 , 8 . the swarf channels 9 , 10 are intended for directing the coolant liquid and any particles , which are scraped off by the guide pads 7 , 8 from the inner circumference of the bore hole , further on to the helical flutes 1 . in the embodiment shown , the swarf channels 9 , 10 are provided on each of the circumferential surfaces 13 , 14 . the swarf channels 9 , 10 extend slightly helical , almost linearly , from one helical flute to the other helical flute . any coolant liquid and / or particles being passed from the outlets 17 , 18 of the guide pads 7 , 8 , will be passed further on by the swarf channels 9 , 10 to the helical flute 1 onto which the swarf channels lead . the swarf channels 9 , 10 may exhibit a positive angle or a negative angle . a positive angle of the swarf channels directs the coolant liquid and the particles from the guide pads 7 , 8 to the trailing helical flute 2 , i . e . the helical flute “ following ” the guide pads when viewed in the circumferential machining direction r of the reaming tool . a negative angle of the swarf channels 9 , 10 directs the coolant liquid and the particles from the guide pads 7 , 8 to the leading helical flute 2 , i . e . the helical flute “ in advance of ” the guide pads when viewed in the circumferential machining direction r of the reaming tool . the angle , whether positive or negative , may have a value between 1 ° and 89 °, preferably between 1 ° and 20 °. the width of the swarf channels 9 , 10 measured at the bottom of the swarf channels may be between 1 mm and 15 mm . the cross - section of the swarf channels may be rectangular , semicircular or trapezoidal as shown in the embodiment of fig5 b . the choice of cross - section depends on the material of the work - piece to be machined and depends on the coolant liquid being used during machining . the swarf channels together with the guide pads promote flow of coolant liquid along the guide pads and thus reduce friction . also , the swarf channels together with the guide pads promote clearing of chips from the helical flutes and promote clearing of particles from the guide pads . if the swarf channels are not present , the guide pads may exhibit a higher risk of packing with chips , particles and contaminants , which may cause tool failure . fig6 a - 6d show close - up views of the tip of a reaming tool during machining a work - piece 20 . the work - piece 20 may be a part for a gearbox , possibly made of aluminium . the work - piece 20 is provided with a bore hole 21 . the chips 22 being machined are cut by the high hardness cutting elements 2 and are directed along the helical flutes 1 in a direction opposite to a longitudinal machining direction d of the reaming tool , when the reaming tool is rotated in the circumferential machining direction r shown . the direction of the chips opposite to the longitudinal machining direction d is established due to the right - hand twist of the helical flutes 1 . if the helical flutes had a left - hand twist , the chips would be directed in the same direction as the longitudinal machining direction d . apart from the chips , any other particles 23 such as impurities in the material of the work - piece together with coolant liquid and any impurities in the coolant liquid are scraped off the inner circumference c of the bore hole 21 by means of the guide pads 7 , 8 . in the embodiment shown , the guide pads 7 , 8 are directed along the same helical twist as the helical flutes 1 . thus , the direction of the particles 23 is also opposite to the longitudinal machining direction d due to the right - hand twist of the guide pads 7 , 8 . if the guide pads had a left - hand twist , the particles would be directed in the same direction as the longitudinal machining direction d . fig7 a - 7d show close - up views of the shaft of a reaming tool during machining a work - piece 20 and at the position of one of the swarf channels 9 . the chips 22 from the work - piece being machined are cut by the high hardness cutting elements 2 at the tip of the reaming tool ( see fig6 a - 6d ). the other particles 23 such as impurities in the material of the work - piece together with coolant liquid and any impurities in the coolant liquid are scraped off the inner circumference c of the bore hole 21 by means of the guide pads 7 , 8 and are directed along the guide pads 7 , 8 to an outlet 17 , 18 of the guide pads . the outlets 17 , 18 of the guide pads 7 , 8 lead to the swarf channels 9 , 10 , and the particles 23 being passed from the guide pads 7 , 8 to the swarf channels 9 , 10 are passed further on to the trailing helical flute 1 , i . e . the helical flute “ following ” the guide pads when viewed in the circumferential machining direction r of the reaming tool . in the embodiment shown , the swarf channels 9 , 10 are directed along a right - hand twist similar to the right - hand twist of the helical flutes 1 and of the guide pads 7 , 8 . thus , the direction of the particles 23 is also opposite to the longitudinal machining direction d due to the right - hand twist of the swarf channels 9 , 10 . if the swarf channels had a left - hand twist , the particles would be directed in the same direction as the longitudinal machining direction d and would be passed further on to the leading helical flute , i . e . the helical flute “ in advance of ” the guide pads when viewed in the circumferential machining direction r of the reaming tool . in the embodiments shown , the reaming tool is provided with additional reaming steps having a larger diameter than the initial reaming step having the smallest diameter . the additional reaming steps are also provided with high hardness cutting elements 3 , 4 , 5 , 6 soldered or brazed to the base body 12 of the reaming tool . the helical flutes 1 provided in the reaming tool extend all the way along the different reaming steps of the reaming tool . thus , the helical flutes 1 are common to all the reaming steps of the reaming tool . additional guide pads 8 ( see fig2 ) are provided along at least one additional circumferential surface 14 ( see fig2 ) between the initial reaming step and a subsequent additional reaming step , said additional circumferential surface having an enlarged diameter compared to the diameter of the circumferential surface along the initial reaming step of the reaming tool . the additional guide pads 8 have outlets 18 leading to an additional swarf channel 10 provided at the end of the additional reaming step . in the embodiment shown , the even additional reaming steps having even larger diameters and the corresponding circumferential surface are neither provided with guide pads nor provided with swarf channels . however , depending on the influence to the machining process of the even additional reaming steps having even larger diameters , it may be possible to provide one or more of the even additional reaming steps with guide pads and possibly also with swarf channels . in contrast to such an approach of providing even additional guide pads and even additional swarf channels , it may be possible to omit both guide pads and swarf channels along the circumferential surface of the first additional reaming step . also , the guide pads and the swarf channels along the initial reaming step may possibly be omitted depending on the one or more of the following parameters , the material of the work - piece being machined , the diameter of the bore hole , the forces which the reaming tool is subjected to and possible other parameters influencing the reaming process . thus , the one feature of soldering or brazing a previously manufactured high hardness cutting element to a previously manufactured body part of the reaming tool may be the essential feature . however , preferably , the provision of guide pads and possibly also swarf channels may also be seen as essential features of the invention . insertions of high hardness cutting elements angled to follow the helical flutes and combined with the guide pads result in a very fine surface quality of the bore hole . the scraping function of the guide pads cleans the inner circumference of the bore hole during the machining process and promotes the creation of a so - called “ mirror ” surface . insertions of high hardness cutting elements angled to follow the helical flutes optimise chip flow along the helical flutes . it has been experienced that an increase of up to 50 % in cutting parameters may be obtained when compared to conventional cutting tools having high hardness cutting elements . even with an increase in cutting parameters , better surface quality , better hole roundness and tighter tolerances can be obtained compared to conventional cutting tools having high hardness cutting elements . | 1 |
referring to the drawings , fig1 - 9 show one form of the invention , a faucet 10 having a self - closing assembly 12 for either hot or cold water , and fig1 and 11 show lavatory mixing valves of the center set and spread set types , 10 &# 39 ;, 10 &# 34 ; respectively , which house self - closing valve assemblies 12 , of the type shown in fig4 - 9 , to control both hot and cold water use . fig1 - 3 illustrate a self - closing faucet 10 which is adapted to be connected to either the hot or cold water feed conduits , not shown . faucet 10 includes a handle 14 , self - closing valve assembly 12 , shown in detail in fig4 - 9 , spout 18 , and an aerator assembly 20 . self - closing valve assembly 12 includes upper housing 17 which has operably mounted therein , timing assembly 40 and lower housing 23 which has valve means 24 axially mounted therein and reciprocates between closed position , fig4 and opened position , fig6 . o - ring 84 , located in groove 85 of lower housing 23 , forms an airtight seal between upper housing 17 and lower housing 23 . valve means 24 includes an elongated stem 25 which is positioned in axial bores 22 , 38 and boss 48 of lower housing 23 . o - ring 27 is positioned in bore 26 , and forms a seal to prevent water passing into air metering chamber 54 . cap 28 , the displaceable valve seat , is mounted to lower end 29 of valve stem 25 . elastomeric member 30 , a flat resilient washer , and metal washer 34 are mounted in recess 32 of lower housing 23 . stem 25 passes through axial bore 31 &# 39 ;, 31 of resilient washer 30 and metal washer 34 respectively . when self - closing valve assembly 12 is in its closed position , cap 28 seats against resilient washer 30 to prevent water flow through water discharge passage 19 and spout 18 , shown in fig4 . upper end 45 of valve stem 25 enters into axial passage 44 of timing assembly 40 . spring 46 is telescopically positioned on valve stem 25 ; its lower end 47 is seated over boss 28 which is threaded into lower housing 23 . spring keeper assembly 50 includes a washer 51 which seats against upper end 49 of spring 46 and is held in place by retaining clip 51 , which is locked in place on valve stem 25 by a complimentary groove formed around end 45 of valve stem 25 . timing assembly 40 , shown in detail in fig7 b , includes air filter assembly 59 , a cylindrical cartridge , having an enlarged radially extending outer wall section 82 on its periphery which fits into a complimentary recess 83 of hollow , cylindrical member 67 . member 67 is threadedly coupled in complimentary threaded opening 53 of disc 43 . circumferential groove 41 formed in disc 43 contains o - ring 39 , which forms an airtight seal between disc 43 and upper housing 17 . filter assembly 59 , preferably a molded plastic material , is in the form of a hollow tube 86 ; its upper end 55 is closed to provide a flat outer surface which forms camming surface 56 . ports 68 , positioned adjacent to camming surface 56 , are provided to permit atmospheric air to enter into chamber 69 of filter assembly 59 . a first air filter 58 , which may be in the form of a porous plastic material , is pressed into air chamber 69 . orifice assembly 72 includes a tube or sleeve 76 and a jeweled member 73 , i . e . a ruby , which is mounted at one end thereof . jeweled member 73 is formed having orifice 75 which permits a predetermined volume of air to flow therethrough for a predetermined period of time . it has been found that for the type of self - closing faucet described and shown herein , orifice 75 is sized to permit a flow rate of about 0 . 6 cc of air per second . metering chamber 54 of valve 12 has an air volume of about 8 . 5 cc . therefore , a complete operational cycle of faucet 10 is about 14 seconds . also , air filters 58 , 74 have a pore size smaller than the diameter of orifice 75 to prevent its clogging from entrained particles carried by the intake air . the operational cycle may be reduced by raising adjusting screw 78 , shown in fig4 which limits the volume of air displaced from chamber 54 when handle 14 is depressed , thus shortening the operational cycle . a second air filter 74 is pressed into chamber 69 of filter cartridge 59 to prevent any foreign matter , such as valve lubricants , expelled from metering chamber 54 from entering orifice 75 . extending from ports 68 are vertical channels 79 which form a cavity between filter assembly 59 and the inner wall of cylindrical member 67 . these cavities act as receptacles for entrained particles that are removed from the air before entering chamber 69 . an annular recess 64 is formed on filter assembly 59 below elongated channels 79 and houses o - ring 65 to provide an airtight seal . on - way valve means 60 is most clearly illustrated in fig4 a . lower housing 23 is formed having a circumferential groove 61 which is connected to metering chamber 54 through one or more passages 63 . an o - ring 62 is seated in groove 61 and covers the outlet opening 70 of passages 63 . the width of groove 61 is larger than the diameter of o - ring 62 . to insure a positive seal of passage openings 70 , a &# 34 ; v &# 34 ;- shaped recess 86 &# 39 ; is formed in both the base of groove 61 and outlet openings 70 of passages 63 . the low pressure difference that exists between passage 63 and atmospheric chamber 81 during the closing cycle of valve 10 , shown in fig7 a , seats o - ring 62 over openings 70 of passages 63 . in fig4 - 7 , faucet 10 is shown in its various modes of operation . the following is a description of a typical operation cycle . faucet 10 is opened when handle 14 is pressed in the direction of the arrow shown in fig5 . cam 15 is integrally formed with handle 14 and rolls along on camming surface 56 of air filter assembly 59 of timing assembly 40 . disc 43 compresses the air in metering chamber 54 as it travels downward along inner surface 16 of upper housing 17 . the compressed air forces one - way valve means 60 , comprised of o - ring 62 , to unseat from groove 61 , allowing air to flow through openings 70 of passages 63 and past o - ring 62 , through passage 80 into atmospheric chamber 81 , as shown in fig5 . at the same time , valve means 24 opens to allow water to flow through discharge passage 19 when timing assembly 40 shifts axial valve stem 25 and compresses spring 46 , see fig5 and 6 . when handle 14 is released , spring 46 is released and pushes against spring keeper assembly 50 , forcing valve stem 25 and timing assembly 40 upward , forming a vacuum in metering chamber 54 , see fig7 a . a differential pressure forms across disc 43 equal to the difference between the higher atmospheric pressure located in atmospheric chamber 66 and the lower vacuum pressure present in metering chamber 54 , and provides a positive seal of one - way valve means 60 . the force provided by the differential pressure acts on timing assembly 40 to counterbalance the force of spring 46 in its movement towards its rest position in fig4 . because of the vacuum pressure present in metering chamber 54 and the movement of timing assembly 40 toward its rest position , air flows through timing assembly 40 into metering chamber 54 . shown in fig7 b , air enters timing assembly 40 through ports 68 into chamber 69 and through filter 58 into air chamber 71 . orifice assembly 72 has a small port or orifice 75 sized to control the flow of air through timing assembly 40 . after passing through orifice 75 , the air enters chamber 77 and flows through filter 74 into chamber 44 , past spring keeper assembly 50 and into air metering chamber 54 , see fig7 a . filters 58 and 74 keep foreign matter entrained in the air from entering chambers 71 and 77 to prevent possible clogging of timing orifice 75 . as the incoming air enters air chamber 54 , its pressure increases , which reduces the differential pressure across timing assembly 40 , allowing it to shift towards its rest or closed position . the closing cycle of valve 12 continues until stem end cap 28 and resilient washer 30 touch , closing valve 24 , stopping the flow of water and completing the valve cycle , fig4 . when valve 12 reaches its closed position , fig4 the pressure in air chamber 54 is equal to the pressure in chamber 66 , i . e . atmospheric pressure . it is obvious that the self - closing valve assembly , as described hereinabove , can be modified to be incorporated in drinking fountains , eye wash fountains , flushing toilets , urinals or the like . | 5 |
fig1 shows a single rack assembly of the instant invention which is used in conjunction with a tooth forming machine . referring particularly to fig5 a forming machine 10 includes a lower tool assembly 12 and an upper tool assembly 14 which are shown in an initial tangential gripping relationship with respect to a cylindrical workpiece 16 . the tooth forming machine includes relatively heavy and rigid frame members comprising a lower bed plate 18 , an upper bed plate 20 , a pair of end walls 22 and a pair of side frames 24 , only one of each of these pairs being shown . the cylindrical workpiece is rotatably supported on stationary locating centers or suitable cradles ( not shown ) which are adjustably mounted on the side frames 24 of the tooth forming machine . as shown also in fig6 and 7 , a pair of l - shaped upper keeper bars 26 with their legs inwardly disposed are secured to the elongated upper bed plate 20 through a plurality of upwardly - extended bolts 28 . in a similar manner , a pair of l - shaped lower keeper bars 30 are secured to the lower bed plate 18 through a plurality of elongated retaining bolts 32 . each pair of keeper bars and corresponding bed plates defines a similar , but oppositely oriented , t - shaped cavity shown generally by reference numeral 34 , only the upper one of which will be hereinafter described in detail . as shown in fig6 the upper bed plate 20 has a depending land 36 having a bottom guide surface 38 and side surface 40 . the keeper bars 26 have inwardly disposed upper side surfaces 42 in contact with the surface 40 on the bed plate and a pair of inwardly disposed lower side surfaces 44 . a pair of upper ledge or guide surfaces 46 on the keeper bars 26 cooperate with the surfaces 42 , 44 and the surface 38 of the bed plate to define the upper t - shaped cavity 34 . the upper tool assembly 14 includes a tooth forming die or rack assembly 50 , a powered slide member 52 , and a bearing plate 54 which is removably secured to a top surface 56 of the slide member by a plurality of bolts 58 . the bolts 58 are countersunk into a ledge surface 60 of the slide member , and the slide bearing 54 has an upper surface 62 which is in facing , sliding engagement with the surface 38 of the upper bed plate . the powered slide member 52 which may weigh as much as approximately 1 , 500 lbs . for some of the larger spline rolling applications , rests on the upper ledge surfaces 46 of the keeper bars 26 through a plurality of intermediate bearing plates or shoes 64 having a lower surface 66 . as noted in both fig6 and 7 , each of the bearing shoes 64 is disposed in a downwardly facing pocket 68 and is biased by a plurality of coil springs 70 contained within a corresponding plurality of depending cylindrical cavities 72 in the slide member . while a full transverse section of the lower tool assembly 12 is not shown , it includes lower keeper bars 30 and a lower slide member 74 which are similar to the upper section . the lower tool assembly is different , however , in that it is movable on only a lower slide bearing 76 with respect to an upper surface 78 of the bed plate 18 , as shown in fig5 . the lower slide bearing is removably secured to the underside of the lower slide member by a plurality of retaining bolts 79 . the bearing shoes 64 and the upper and lower slide bearings 54 and 76 are preferably of bronze to withstand the high unit loading encountered . additionally , a lubrication system ( not shown ) introduces lubricant into the stationary member of the machine , such as at the upper bed plate 20 and the upper keeper bars 26 , so that the associated guide surfaces 38 and 46 are lubricated to minimize relative wear between the sliding surfaces . the lower tool assembly 12 , including a lower tooth forming die or rack assembly 80 and a lower slide member 74 , is transversely and tangentially moved with respect to the workpiece 16 by an actuating cylinder system shown generally at 82 and having a cylinder portion 84 and an extendible piston rod 86 secured to a bracket 88 . the bracket 88 and a counterpart bracket 90 at the rightward end of the rack are removably secured to the lower slide member by a plurality of bolts 92 , 94 , respectively . the brackets 88 and 90 further serve to longitudinally retain the lower tooth forming rack in a longitudinal groove 96 defined within an upper surface 98 of the slide member 74 as shown also in fig6 . the upper tool assembly 14 also includes an actuating cylinder system ( not shown ) connected thereto in a similar manner . these powered actuating cylinder systems are effective to move the upper and lower tool assemblies simultaneously in opposite directions as is described , for example , in the above - mentioned u . s . pat . no . 3 , 015 , 243 to j . c . drader . both the rack assemblies 50 and 80 of the subject invention have a discreet series of orderly steps in the tooth configuration . a first roughing section of the rack assembly die 80 is shown generally at 100 . the first roughing section 100 has a length equivalent to half of the rolling circumference of the workpiece 16 , or a whole multiple thereof . a second roughing section of the rack die 80 , indicated generally by the reference numeral 106 , has a length similar to that of the first roughing section 100 . the second roughing section includes a plurality of teeth 108 providing an additional penetration into the workpiece of approximately 25 %, for example , or a cumulative penetration of 75 %. while both the tips and roots of the teeth 108 exhibit substantially increased curvature , the amount of additional penetration has been appreciably reduced . a third roughing section , indicated generally by the reference numeral 110 , has a plurality of teeth 112 providing an additional penetration into the workpiece of approximately 12 . 5 % or a cumulative penetration of approximately 87 . 5 %. a fourth roughing section , indicated generally by the reference numeral 114 , includes a plurality of teeth 16 providing an additional penetration of the order of 10 . 5 % of the total finish tooth penetration . the amount of penetration for each roughing section and the number of roughing sections may be varied to accomodate the depth of finished tooth form desired and to further increase the fatigue life of the present invention . lastly , a finishing section indicated generally by the reference numeral 118 , and including a plurality of teeth 120 , serves to substantially complete the total penetration by an additional finishing penetration of approximately 2 %. finishing section 118 has a length preferably two times or more in even multiples of half the rolling circumference of the workpiece so that a relatively smooth , or coining type finish can be applied to the final teeth formed on the workpiece . the relatively straight - sided teeth 120 provide a finished involute type of spline on the periphery of the workpiece through a generated deformation action . it is to be understood that while this disclosure talks in terms of a particular number of sections , the actual number depends upon their penetration rate and the workpiece to be used . the upper tooth forming rack assembly or die 50 is identical in profile to the lower rack assembly or die 80 so that the workpiece teeth are diametrically and simultaneously formed by similar stepped teeth by both dies . with both racks , the curvature of the tooth tips and tooth roots should be set such as to produce the desired tooth form on the workpiece . the quantity of teeth in each insert section should be set as a minimum equal to one - half the number of teeth to be formed on the workpiece . the tooth spacing of the inserts should be compatible to the tooth spacing of the workpiece at the rolling pitch diameter . the length of the insert sections should be such that its ends are precisely on the centerline of the tooth space so that the tooth spacing will remain consistent throughout the rack assembly and produce the desired spacing on the resultant workpiece . as seen in fig1 the rack assembly 80 is comprised of a generally elongated insert holder 121 , having a planar bond surface 122 . extending from opposite ends of insert member 121 are flanges 124 , 126 , the purpose of which is to enable mounting of the rack assembly in the tooth forming machine . as seen in fig2 the generally planar top surface 128 of the insert holder 121 is bordered on the lateral sides , either one or both , thereof by ridges 130 , 132 for the purpose of lateral retention of the inserts under the forces of the tooth forming machine . as may be seen in fig1 the insert members are each releasably retained on the insert holder 121 by means of a pair of cap screws threadably secured through the bottom of the insert holder into the bottom of the insert . for example , in fig1 inserts 110 through 118 are releasably retained to insert holder 121 by means of a plurality of cap screws 134 passing through bores 136 leading from counterbores 138 . fig3 and 4 show an alternate embodiment wherein the cap screws , rather than being threaded into threaded bores in the inserts , are threaded into bores in a t - shaped retainer 140 . the t - shaped retainer , in turn , is contained within a longitudinal slot 142 having a pair of tapered surfaces 144 , 146 . retainer 140 has a corresponding pair of tapered surfaces for contacting tapered surfaces 144 , 146 . with the alternate embodiment , only a single lateral side ridge 132 &# 39 ; is used for lateral retention . it is to be understood that the foregoing description is merely illustrative of the preferred embodiment of the invention and that the scope of the invention is not to be limited thereto , but is to be determined by the scope of the appended claims . | 1 |
referring to fig1 and 2 of the drawings , a collapsible vehicle 10 is illustrated in fig1 in its erected position while fig2 has the same vehicle 10 in its collapsed position for storage , transportation , or shipping . the vehicle 10 has four wheels 11 having balloon tires thereon , and has a body 12 having a foldable hood 13 over the front portion thereof which has headlights 14 mounted therein . the body also includes an engine compartment cover 15 located behind a pair of bucket sets 16 . a windshield frame 17 has safety window glass 18 mounted therein and a roll bar 20 is mounted to protect the occupants of the seats 16 . the window 18 has a windshield wiper 21 and a steering wheel 22 mounted thereon . in the folded position of fig2 the backs of the seats 16 have been folded down and the windshield frame 17 and attached steering wheel 22 have been folded over the seats which thereby drops the hood 13 . the roll bar 20 is folded forward on hinge pins 25 which pins rotatably attach the roll bar 20 to the chassis of the vehicle . the folding of the roll bar causes the wheels 11 to be raised relative to the vehicle body and chassis into the tire wells 24 . the folding of the vehicle is rapidly accomplished from that illustrated in fig1 to that illustrated in fig2 so that a compact folded vehicle of fig2 can fit into a storage or shipping container . the vehicle , as illustrated , is approximately 7 feet long , weighs approximately 600 pounds and is forty - four inches in height when erected and 18 inches high when collapsed . a hinged bar 29 is attached to the roll bar 20 by a hinge and is removably attached to the windshield frame 17 with a wingnut or the like . this provides additional support to the unfolded vehicle while holding the windshield in place and is easily swung out of the way when folded . turning now to fig3 a and 3c , the collapsing , storing and transporting of the vehicle of fig1 and 2 is illustrated . in fig3 a , the erected vehicle 10 is being pushed towards vehicle container 26 , which container has four feet 27 attached to a bottom 28 and a plurality of sides 30 . a hinged side 31 folds down as illustrated in fig3 a to allow the vehicle 10 to be rolled thereinto on its wheels 11 . a plurality of wheel guides 32 positions the wheels 11 of the vehicle 10 in place in the container 26 and four hooks 33 are rotatably attached to brackets 34 attached to the floor 28 of the container 26 . the hooks 33 are adapted for latching and locking into openings 99 ( fig7 and 8 ) in the chassis or onto the front axle and rear frame of the vehicle 10 for holding the vehicle in the container 26 . an alternative attachment for attaching the folded vehicle in container 26 is to bolt a bar across the container 26 over the folded vehicle . thus , the vehicle 10 may be rolled into the storage container 26 , then collapsed , as illustrated in fig2 and 3b , and locked with the hooks 33 to the container 26 . hinged side 31 may be lifted and latched to complete the positioning of the vehicle in the container . the container 26 has a pair of arms 35 held by pins 36 to support brackets 37 which are attached to a motor home 38 to allow the container 26 to be rotated on pins 36 . a pair of hydraulic actuated cylinders 40 are attached to motor home 38 by brackets 41 with pins 42 . hydraulic cylinders 40 are shown open to more clearly illustrate the invention , but would normally be covered by container 26 or shrouds attached thereto to enhance its aesthetic appeal . the power rods 43 of the hydraulic cylinders 40 are attached with pins 44 to the brackets 45 which are rigidly attached to the corners of the container 26 . actuation of the hydraulic cylinders 40 will raise and lower the container 26 adjacent the motor home 38 as illustrated in fig3 c . thus , the vehicle 10 is driven in the container in fig3 a , collapsed with side 31 closed in fig3 b , and raised onto the back of the motor home 38 as illustrated in fig3 c for storage and transportation . a pair of latch hooks 19 are attached to the motor home 38 and can catch onto latching studs 39 to provide safety locks . the cylinders 40 can also hold the container 26 in place and other locking devices can be used to secure the container 26 without departing from the scope of the invention . an interesting variation of the container 26 can be achieved by making the container 26 into a disconnectable container which can act as a small boat , or alternatively , the container can be designed for a small boat to fit over the collapsed vehicle 10 inside the container so that both may be carried on the back of a motor home for the use by the owner as he moves from town to town . turning now to fig4 through 8 , which is a cut - away through the center of the car , the mechanism for collapsing the vehicle is more clearly illustrated with the body removed from the vehicle 10 which shows the chassis 46 having wheels 11 attached thereto along with the window frame 17 which is shown pinned by the pin 47 to a bracket 48 which is attached to the chassis 46 . the chassis 46 has the roll bar 20 rotatably attached thereto by pins 25 . the seats 16 are attached to bottom frame members 50 . hood 13 ( fig1 and 2 ) has a support framework 51 which is attached to the frame 46 through arm 57 and window frame 17 for collapsing to its closed position and bracing member 53 is movably connected by pin 54 to the window frame at one end and has a bracket 55 at its other end . bracket 55 is connected by pin 56 to linkage arm 57 which in turn is pinned to a bracket 58 . this allows hood 13 and support 53 to collapse when the window frame 17 is folded down and to be locked in its upright position when the window frame is erected . hinged bar 29 is hinged to roll bar 20 and attached to the window frame 17 to hold the window frame in position , even though arm 57 can also be latched . the steering wheel labeled 22 in fig1 is supported on steering wheel support box 61 which is fixedly attached to the window frame 17 and thereby folds with the window frame into the passenger compartment of the vehicle from the position shown in fig4 to the position shown in fig5 . the motion of the steering wheel is transmitted to the arm 75 through a rack and pinion system in box 61 and flexible push - pull cables 49 . at this point , it can be seen that the seats 16 can be folded forward and the window frame 17 folded thereover taking the steering wheel 60 with it and also collapsing the hood and hood supports 51 and 53 . fig4 a illustrates the steering mechanism located in steering box 61 having a steering column 59 passing thereto and attached to a pinion gear 79 . pinion gear 79 rotates gear racks 69 responsive to rotation of the steering column 59 allowing racks 69 to slide in tracks 89 moving flexible cables 49 to push - pull arm 75 and steer the vehicle . the rack and pinion box 61 is mounted to the window frame and the flexible cables 49 accomodate the folding action thereof . this arrangement also obviates the need for a collapsing or energy absorbing steering column . the raising of the wheels 11 is accomplished by disconnecting the support for 29 , and folding the roll bar 20 forward over the seats and windshield . roll bar 20 has a horizontally extending portion 62 having a pair of front tie rods 63 and a pair of rear tie rods 64 attached at pre - determined positions so that the rods 62 and 63 are pulled or pushed by folding or erecting the roll bar . a mechanical advantage is gained by the roll bar acting as a lever . the roll bar 20 is secured in its erected position by double acting safety catches on both sides but , as will be illustrated , the vehicle would not collapse even in the absence of such safety catches . tie rod 63 is connected to a bell crank axle hanger 66 with arm 65 and has a plurality of resilient rubber spheres 67 having passageways therethrough slid over the end of the rod 63 and bolted with a bolt and washer 68 . these resilient members 67 act as a spring suspension for the vehicle in damping wheel and axle vibrations and exhibit a uniquely varying spring rate such that ride characteristics remain constant regardless of the load . this feature is important since the passenger load is a significant fraction of the total suspended mass . the rubber spheres will provide damping as a result of its hysteresis . the bell crank front axle hangers 66 are physically connected to the front axle which supports the wheels 11 . thus , when the wheels and axles are riding on a rough surface they are driven against the resilient rubber spheres 67 adjacent the arm 65 to provide both spring and shock absorber action for the front wheels . the front axle hangers 66 are mounted with a heavy pin 70 to a bracket 71 welded to the chassis 46 . in addition , a counterbalancing spring 72 is connected at one end to the arm 65 and at the other end to a frame member 73 . this eases the load required to raise and lower the wheel by the movement of roll bar 20 . the front wheels include a steering linkage movably mounting the front wheels 11 to the axle to allow the front wheels to be steered in response to movement of the steering wheel 60 as illustrated in fig4 a . the wheels are mounted in bearings 74 having a steering arm 75 extended therefrom for each wheel with a steering tie rod connecting the arms 75 between the wheels . similarly , the rear tie rod 64 is connected to a rear axle hanger 76 connected by heavy pins 77 to the lower chassis member 50 and supporting the rear wheels with hanger brackets 78 . the rear suspension of the vehicle has a plurality of resilient rubber spheres 80 placed on the tie rod 64 and held by a nut and washer 81 , like the front suspension , so that movement of the axle suspension member 76 by the movement of the rear wheels 11 will push the axle supporting members 76 against the rubber spheres 80 to act as spring and shock absorbers for the rear wheels . collapsing and raising the wheels is accomplished by pushing the roll bar 20 forward , which by its lever action , releases the tie rods 63 and 64 thereby allowing the axle hanging members 76 and 66 to raise the front axle and front wheels relative to the chassis , as well as raising the rear wheels simultaneously . this mechanism for raising and lowering the wheels of the vehicle not only performs the simultaneous function of raising all four wheels , but incorporates the suspension system for the vehicle and includes counterbalancing for ease of operation . this mechanism forms a toggle mechanism which will hold the wheels in the erected position even when the roll bar 20 is not latched even though the roll bar 20 will have double acting safety latches on each side of the roll bar 20 . it will , of course , be clear that the operation of the mechanism is identical on both sides of the vehicle even though only one side has been illustrated . in fig6 , and 8 , the engine 83 is illustrated mounted with bolts 84 to frame members 85 on the rear of the vehicle . the vehicle 10 has the chassis 46 which can be made of channel iron surrounding the occupant &# 39 ; s compartment to form a safety cage to protect the occupants of the vehicle . the chassis 46 has the front axle hangers 66 attached to the front axle 86 and being rotatably mounted to pins 70 supported on the chassis 46 . the front wheels 11 are mounted in bearings 74 which have steering arms 75 attached thereto and are connected by tie rod 87 so that movement of the tie rod will move both front wheels simultaneously . the rear wheels 11 have hubs mounted directly to rear wheel hangers 76 . rear wheel hangers 76 are rotatably pinned with pins 77 to a cross bar 88 of the chassis 46 . the rear wheels 11 are driven by hydraulic motors 91 , each connected to a single or dual hydraulic pump with valving for transmission or an automatic hydrostatic transmission 92 which in turn is driven by a belt 93 in pulleys driven by engine 83 . it will , of course , be clear that any type of engine desired can be utilized without departing from the spirit and scope of the invention , but in its present configuration a two - cylinder , two - cycle internal combustion engine with an electric starter can be utilized to operate the transmission 92 to drive the vehicle . transmission 92 is a conventional hydrostatic transmission having a pump for controlling the motors 90 and 91 or a gear pump with valving to provide forward , neutral and reverse . the engine 83 and transmission 92 are each supported on frame member 85 by bolts 84 . it should be clear at this point , that a foldable or collapsible vehicle has been disclosed which can be rapidly folded by lowering the front seats then unlatching and folding the windshield which folds the hood and steering wheel , then folding the roll bar forward to raise the wheels to collapse the vehicle . it should also be clear that other embodiments are contemplated as being within the scope of the invention . for instance , different body designs can be utilized for the vehicle and different container shapes for storing and transporting the vehicle which can be transported on top of a second vehicle as well as on the back or the front as desired . likewise , the wheels may be mounted from arms , as in fig4 through 8 , but the arms may be pivoted in many different fashions so as to accomplish the same result . for example , an independent front suspension could be accomplished by splitting the front axle 86 in the center and providing a second pivot point near the front center of the chassis 46 such that the wheels 11 would move in an arc about the line connecting the new pivot and the present pivot pin 70 ( which would be rotated to permit the discreet springing action ). furthermore , the wheels could be rotated about an axis lying in the horizontal plane and parallel to the length of the vehicle to provide a lower silhouette when folded . likewise , a mechanical drive system using belts , chain , gears or the like could be used to propel the vehicle in place of the fluid transmission shown . accordingly , the present invention should not be construed as limited to the particular forms disclosed herein since these are to be regarded as illustrative rather than restrictive . | 1 |
the basic structure of an exemplified pixel 50 of a device according to the invention is illustrated in fig1 . the pixel 50 comprises , e . g ., two light - sensitive photo sites 51 . 1 , 51 . 2 . a first photo site 51 . 1 has a first photo gate 52 . 1 for the phase angle 0 ° and a second photo gate 52 . 2 for the phase angle 180 °; a second photo site 51 . 2 has a third photo gate 52 . 3 for the phase angle 90 ° and a fourth photo gate 52 . 4 for the phase angle 270 °. between the two photo gates 52 . 1 , 52 . 2 ( or 52 . 3 , 52 . 4 , respectively ) in each photo site 51 . 1 ( or 51 . 2 ), there is a middle photo gate 53 . 1 ( or 53 . 2 ) which is preferably kept at a fixed potential . the pixel 50 further comprises light - protected storage gates 54 . 1 – 54 . 4 , each of which is associated to a photo gate 52 . 1 – 52 . 4 . a first storage gate 54 . 1 is for storing signals with phase angle 0 °, a second storage gate 54 . 2 for storing signals with phase angle 180 °, a third storage gate 54 . 3 for storing signals with phase angle 90 °, and a fourth storage gate 54 . 4 for storing signals with phase angle 270 °. the second storage gate 54 . 2 and the third storage gate 54 . 3 are isolated by a separation gate 55 . all gates within one pixel 50 can be controlled separately . in fig4 – 7 , which show various embodiments of the invention and are discussed further below , analogous elements are designated by the same reference signs as in fig1 and will not be explained again . the device according to the invention , as schematically shown in fig2 , preferably comprises a standard objective 2 for imaging a scene 1 , thus generating an imaged scene 3 . the device further comprises a microlens array 4 and an optical application - specific integrated circuit ( asic ) 5 . the details of a pixel 40 of the microlens array 4 and a pixel 50 of the opto asic 5 are shown in fig3 . each pixel 40 of the microlens array comprises an optical microstructure 41 , which can be realized , e . g ., as a microlens or a plurality of microlenses , as a diffractive element , or a plurality of diffractive elements , etc . the optical microstructure 41 aims at equally distributing the averaged light intensity of an imaged - scene pixel 30 onto the two optically identical photo sites 51 . 1 , 51 . 2 of the asic pixel 50 . this is schematically illustrated in fig3 by choosing an example where the area 30 of the scene allocated to the pixel 50 is partially white and partially black , and where the areas 31 . 1 , 31 . 2 on the photo sites 51 . 1 , 51 . 2 corresponding to this area 30 are equally gray , represented by a cross - hatching . in the schematic representation of fig3 , the optical microstructure 41 consists of two sub - structures 42 . 1 , 42 . 2 . a first sub - structure 42 . 1 is for averaging the intensity , and a second substructure 42 . 2 is for distributing the averaged intensity onto the two photo sites 51 . 1 , 51 . 2 . the device according to the invention can preferably be realized in two different technologies : an embodiment realized in a pure ccd process is shown in fig4 . one pixel 50 . 1 ( 50 . 2 , . . . ) consists of two light sensitive areas 51 . 1 , 51 . 2 . each of these areas 51 . 1 ( or 51 . 2 , respectively ) is divided into two or three light sensitive modulation gates 52 . 1 , 52 . 2 ( or 52 . 3 , 52 . 4 ); here a 3 - gate realization is shown with a middle photo gate 53 . 1 ( or 53 . 2 ). during demodulation / integration operation , the middle gate 53 . 1 ( or 53 . 2 )— if present — is kept at a fixed potential and the outer modulation gates 52 . 1 , 52 . 2 ( or 52 . 3 , 52 . 4 ) are modulated in a balanced manner . optically generated charge carriers are then distributed to the neighboring storage gates 54 . 1 , 54 . 2 ( or 54 . 3 , 54 . 4 ), depending on the actual potential gradient under the modulation gates 52 . 1 , 52 . 2 ( or 52 . 3 , 52 . 4 ). the storage gates 54 . 1 , 54 . 2 ( or 54 . 3 , 54 . 4 ) are isolated from each other by an additional transportation gate 55 . the two modulation - gate pairs 52 . 1 , 52 . 2 and 52 . 3 , 52 . 4 within one pixel 50 . 1 are operated with a 90 ° phase difference with respect to each other , so that the one pair 52 . 1 , 52 . 2 integrates - the in - phase component and the other pair 52 . 3 , 52 . 4 integrates the quadrature - phase component . each gate within the pixel 50 . 1 can be controlled individually and all pixels 50 . 1 , 50 . 2 , . . . are operated in parallel . the sensor is realized as a frame transfer ccd . a first , partly light - sensitive area 56 accessible to light serves as a lock - in ccd array for integration , and a second , light - protected area 57 serves as a memory ccd array for storage . the pixel gates are therefore operated like a 3 - phase ccd to transfer the image into the storage ccd 57 . it can then be read out protected from further optical signal distortion . during readout , the next image can be integrated . during the image transfer from the first area 56 into the second area 57 , smearing may take place . this , however , does not seriously influence the measured phase result , since all sampling points belonging to one pixel 50 . 1 ( 50 . 2 , . . . ) integrate the same parasitic offset charge . additionally , the use of a monochromatic light source or a light source with limited spectral bandwidth in combination with narrow band - filters can efficiently reduce background illumination and , hence , smearing effects . ( the active illumination can be switched “ off ” during the picture shift into the storage ccd 57 .) like in conventional ccds , anti - blooming structures can be integrated in order to prevent charge carriers of an overexposed pixel to disturb neighboring pixel information . additionally , a charge - dump diffusion 58 on top of the first area 56 enables to get rid of parasitic charge . the dimensions of the ccd gates are preferentially chosen such that one gets square pixels 50 . 1 , 50 . 2 , . . . ( i . e ., the gates are about 12 times wider than long ). the proposed structure is an advantageous combination of the established frame - transfer - ccd principle with the new demodulation - pixel principle . the pixel can also be realized in cmos / ccd technology with the active - pixel concept . the cmos - aps / ccd realization seems to be more advantageous than a pure ccd realization , since each pixel can be addressed and read out individually , and blooming problems or smearing problems do not appear . three different embodiments realized in the cmos - aps / ccd technology are shown in fig5 – 7 . fig5 shows an embodiment that has only one readout stage per pixel 50 . the single sampling points can then be transferred to a readout node sequentially by operating the ccd gates like a conventional ccd line . care has to be taken that no additional charge is optically generated during this transfer . the pixel 50 comprises a dump gate 59 and a dump diffusion 60 for resetting , and an out gate 61 and a sense diffusion 62 for reading out . the pixel 50 additionally comprises an addressable in - pixel aps readout circuitry 70 . fig6 and fig7 show embodiments with two readout stages 70 . 1 , 70 . 2 per pixel 50 . here , two sense diffusions 62 . 1 , 62 . 2 ( or 62 . 3 , 62 . 4 , respectively ) are short - circuited to one sense node 63 . 1 ( or 63 . 2 ), which can be accessed from two sides . this enables the readout of two sampling points per readout stage without moving the sampled values through the light - sensitive ccd gates . it is true that the sense diffusion 62 . 1 – 62 . 4 will get a larger capacitance ( less than a factor two ) and , hence , a worse conversion factor ( voltage increase per electron ); however , this drawback can be tolerated . it is important to mention that fixed - pattern noise due to the use of two readout stages 70 . 1 , 70 . 2 per pixel 50 is not a problem . this is because of the subtraction of the balanced - mode sampling points in the evaluation algorithm of eq . ( 3 ). fixed - pattern noise mainly adds an offset component to the pixel values . this offset disappears after the subtraction . we call this “ pair - wise offset - free charge integration ”. in the following , various methods for operating a tof distance - measurement system are discussed . fig8 and 9 illustrate the operation principle of a tof distance measurement system according to the state of the art . a modulated light source ( or transmitter ) 101 is normally located near a detector ( or receiver ) 103 . since the optical power density on an illuminated object or target 102 decreases with the square of the distance l between the illumination source 101 and the target 102 , the received intensity i rec on the detector 103 also decreases with the square of the target distance l . with the transmission of a light pulse 104 , a switch 105 in the receiver 103 opens . the switch 105 closes with the end of the light pulse 104 . the amount of light integrated in the receiver 103 depends on the overlap of the time window 107 defined by the on time of the switch 105 and the delayed time window 106 of on time of the received light pulse 104 . both on time of the switch 105 and pulse width are chosen to have the same length t . thus , targets 102 with zero distance ( l = 0 ) receive the full amount of the light pulse 104 , the complete light pulse 104 is integrated . targets 102 farther away from the light source 101 only integrate a fraction of the light pulse 104 . only distances l & lt ; l max within the propagation range of the light pulse 104 , defined by half the product of the pulse width t and the light velocity c , can be measured . the amount of received light i rec decreases with the square of the target distance l to the emitting active illumination source 101 , as illustrated in fig9 . the prior - art shutter operation leads to an additional distance - dependent attenuation of the integrated received signal . a first mode of operation according to one aspect of the invention is illustrated in fig1 and 11 . according to this method , which can be called the “ inverse shutter operation ”, the switch 105 is started at the end of the light - pulse transmission or even later . targets 102 farther away from the range camera integrate a longer period of the light pulse 104 than targets 102 near the range camera . together with the attenuation of the back - scattered light from a diffusely reflecting target 102 , which is proportional to the square of the distance l ( assuming a lambert - reflecting target ), the resulting integrated signal share of the light pulse now only decreases linearly with the distance l of the target 102 ( cf . fig1 ). fig1 and 13 show a second mode of operation according to one aspect of the invention . this method uses a falling - ramp pulse 104 instead of a square pulse and combines this operation with the “ inverse shutter operation ” explained with respect to fig1 and 11 . this results in an integrated signal that does not depend on the target &# 39 ; s distance l , only on its remission coefficient , if the target 102 is a lambert reflector . | 6 |
referring to the drawings wherein like numerals indicate like elements , there is shown in fig1 an apparatus 10 for making an absorbent composite from a continuous tow . the absorbent composite discussed herein is for use in manufacture of absorbent garments . absorbent garments include , for example , diapers or training pants , adult incontinence products , and feminine hygiene products . the absorbent composites disclosed herein are particularly useful in the absorbent cores and garments disclosed in u . s . patent publications nos . 2003 / 0105442 ; 2003 / 0114814 ; 2003 / 0135177 ; and 2003 / 0135178 , each is incorporated herein by reference . tow is a large strand of continuous manufactured fiber filaments without definite twist , collected in a loose , band - or rope - like form , usually held together by crimp . suitable tows materials include , but are not limited to , polyolefins , polyesters , polyamides , cellulosics , and mixtures thereof . of these , cellulosic fibers are preferred . cellulosic fibers include rayon , acetate ( cellulose acetate ), and triacetate ( cellulose triacetate ) fibers . acetate tow is most preferred . for example , an acetate tow may consist of about 2 , 500 to about 25 , 000 fibers having an individual denier of from about 1 to about 15 , preferably from 2 to 10 , and most preferably 3 to 8 . the total denier of a single acetate tow band may range from about 2 , 500 to about 125 , 000 , preferably 15 , 000 to 75 , 000 , and most preferably 20 , 000 to 40 , 000 . the tow is preferably crimped , with about 5 to about 40 crimps per inch ( 2 to 16 crimps per cm ), preferably , 25 to 30 crimps per inch ( 10 to 12 crimps per cm ). the fibers of the tow may have any cross - sectional shape , including ‘ y ,’ ‘ x ,’ round , crenulated , dog bone or combinations thereof . the tow may include a finish , the finish comprising about 0 . 3 % to about 5 % by weight of the tow , preferably , 0 . 5 to 2 . 0 %. the tow &# 39 ; s cross - sectional dimensions may range from about 25 mm to 100 mm in width , preferably , 40 to 60 mm , and about 1 to 10 mm in height , preferably 2 to 5 mm . tows are commercially available and are delivered in compressed bales . in fig1 and 2 , there is shown an apparatus 10 for making absorbent composites from a continuous tow . apparatus 10 generally comprises : apparatus 13 for spreading the tow , i . e ., increasing its width from its compressed state in the bale ; a de - registering apparatus 40 for de - registering the crimped fibers of the tow ; a tow shaping apparatus 54 for forming the tow into its desired cross - sectional shape ; a particle distribution apparatus 56 whereby particulate matter , e . g ., sap , may be delivered to the shaped tow , and a wind - up station 60 where the particulate laden , shaped tow is sandwiched between strata and then wound - up . wind - up may be eliminated and the absorbent composite may be run directly into a subsequent machine for formation into the ultimate absorbent garment ( for example , see : u . s . patent publications nos . 2003 / 0105442 ; 2003 / 0114814 ; 2003 / 0134559 ; 2003 / 0135177 ; 2003 / 0135178 ; 2003 / 0150551 , each is incorporated herein by reference ). bale 12 is preferably located at a right angle to the travel of the tow through the de - registering apparatus 40 , tow shaping apparatus 54 , and particulate distribution apparatus 56 . the bale may be located at any location , including a position inline with the foregoing apparatus . however , location at the right angle is preferred to allow easy access to the bale for changing out depleted bales and to allow easier visual inspection of the tow by an operator . tow 14 is delivered to spreading apparatus 13 from bale 12 . apparatus 13 guides between two locations and spreads the tow . spreading apparatus 13 preferably has at least two banding jets . these banding jets work to spread and stabilize the tow as it moves through the rest of apparatus 10 . tow 14 is drawn from bale 12 and guided through rings 16 to a first banding jet 18 . banding jet 18 is a device that is used to spread ( i . e ., increase the width ) and stabilize the tow 14 . banding jet 18 , see fig1 a , generally comprises a plate 20 having a channel 22 with an air nozzle 24 located within channel 22 . any conventional banding jet may be used , for example see u . s . pat . no . 3 , 226 , 773 or u . s . patent application ser . no . 09 / 219 , 818 filed dec . 23 , 1998 , both are incorporated herein by reference . air nozzle 24 is shown as a chevron , however , other shapes or patterns are permissible , for example , slots can be replaced by holes . the chevron may have a width of 50 – 140 mm . compressed air is blown through air nozzle 24 and partially spreads the tow . the pressure of the compressed air may range from 0 . 5 to 5 . 0 psig , preferably , 2 . 5 – 3 . 0 psig . the width of channel 22 is referred to as w 1 . tow carrier structure 26 carries tow 14 leaving banding jet 18 over the distance from jet 18 to the rest of apparatus 10 . guide roller 28 , located at the distal end of carrier 26 , re - orients the tow for entry into the rest of the apparatus 10 . second banding jet 30 receives tow 14 from guide roller 28 . the second banding jet 30 , fig1 b , comprises a plate 32 having a channel 34 with an air nozzle 36 . any conventional banding jet may be used , for example see u . s . pat . no . 3 , 226 , 773 or u . s . patent application ser . no . 09 / 219 , 818 filed dec . 23 , 1998 , both are incorporated herein by reference . air nozzle 36 is shown as a chevron , however , other shapes or patterns are permissible , for example , slots can be replaced by holes . the chevron may have a width of 70 – 155 mm . compressed air is blown through air nozzle 36 and partially spreads the tow . the pressure of the compressed air may range from 0 . 5 to 5 . 0 psig , preferably , 3 . 0 – 3 . 5 psig . channel 34 has a width w 2 . preferably , w 1 is less than w 2 . cabinet 38 ( shown in phantom ) contains de - registering apparatus 40 that receives tow 14 from spreading apparatus 13 . cabinet 38 acts as a shielding device to prevent contaminates such as adhesives from gumming up or fouling the roll surfaces of the de - registering apparatus 40 and as a safety device . while cabinet 38 is preferred , other means can be used to accomplish the shielding function , such as , for example , curtains , air curtains , wire cages . cabinet 38 will be discussed in greater detail below . de - registering apparatus 40 , which is preferably contained within cabinet 38 , has at least two pairs of rollers 42 and 48 . in de - registration , the individual crimped filaments of the tow are de - registered ( or opened ) and prepared for shaping . roller pair 42 has a metal - faced roller 44 and a rubber - faced roller 46 ( rubber - faced refers to any elastic polymer ). roller pair 48 also has a metal - faced roller 50 and a rubber - faced roller 52 ( rubber - faced refers to any elastic polymer ). the metal - faced rollers are driven and have diameters of 160 mm . the rubber - faced rollers have diameters of 250 mm . the pair of rollers 42 and 48 may be vertically oriented ( as shown ), horizontally oriented , or at some angle therebetween . metal - faced rollers 48 and 50 may be smooth , grooved , threaded , textured , or combinations thereof . when grooved or threaded , the ratio of open surface to flat surface may nominally range from 90 : 10 to 10 : 90 , preferably with 25 : 75 ; 50 : 50 ; and 75 : 25 , and most preferred , 75 : 25 . the rubber - faced rollers are preferably placed opposite one another in the pairing as shown , but they may be disposed on the same side , preferably on the side closest to apparatus 54 , so that fibers in the tow do not foul in the open surface of the metal rollers . the nip pressure between each roller pairs 42 and 48 is two ( 2 ) bars with a 70 mm diameter pressure cylinder . the roller pair 48 has greater surface speed than roller pair 42 . when cellulose acetate tow is used , the ratio of roller speed for pair 48 ( s 48 ) to pair 42 ( s 42 ) may range from 1 ≦ s 48 / s 42 ≦ 2 , and s 48 / s 42 is preferably 1 . 1 – 1 . 7 , and most preferred 1 . 3 – 1 . 4 . optionally , a liquid application station 53 located after de - registration apparatus 40 may be used . such liquids may be used to , for example , facilitate binding of fibers in the tow or particulate to the tow , or deodorize or scent the absorbent composite , or add an anti - microbial agent to the composite , or alter the hydrophilicity of the tow . such liquids include water , hydrophilic liquids ( such as alcohols , glycols , dimethyl sulfide , ketones , ethers and the like ), plasticizers ( such as triacetin ), surfactants , and solutions containing plasticizers , surfactants and the like . liquid application station 53 may include spray nozzles , disk applicators , rotating brush applicators , wick contact rolls , and the like , as is known in the art . tow shaping apparatus 54 receives the tow 14 from de - registering apparatus 40 . tow shaping apparatus 54 is used to shape the opened tow into a predetermined cross - sectional shape , preferably a generally rectangular cross - section , for use in the absorbent garment . other cross - sectional shapes are also possible , they include : circular , oval , square , channeled , and grooved . a preferred tow shaping apparatus 54 is illustrated in , for example , u . s . pat . no . 6 , 253 , 431 , incorporated herein by reference . another tow shaping apparatus 54 is illustrated in u . s . pat . no . 5 , 331 , 976 , incorporated herein by reference . when tow - shaping apparatus 54 has a 70 mm width , banding jet 18 has a width ( w 1 ) of 62 . 5 mm and banding jet 30 has a width ( w 2 ) of 65 mm . when apparatus 54 has a width of 110 , w 1 is 82 . 5 mm and w 2 is 108 mm . when apparatus 54 has a width of 120 , w 1 is 102 . 5 mm and w 2 is 118 mm . additionally , apparatus 54 includes a dancer ( not shown ) that controls the thickness of the shaped tow as it exits apparatus 54 . the dancer is preferably a plate pivotally mounted within apparatus 54 and adapted to have bearing engagement with the tow along the tow &# 39 ; s width . the dancer controls the thickness of the tow to ensure uniform thickness of the tow and to enable the line speeds disclosed hereinafter . the dancer is also illustrated in u . s . patent publications 2003 / 0130638 ; 2003 / 0135176 ; 2003 / 0143324 , each is incorporated herein by reference . particulate distribution apparatus 56 is located at the distal end of tow shaping apparatus 54 . particulate distribution apparatus 56 is used to distribute particulate in a predetermined manner onto and / or into the opened , shaped tow and will be discussed in greater detail below . particulate particularly includes sap , but also includes other solid materials , such as adhesives , fragrances , wood pulp , deodorizers , anti - microbial agents , and the like . particulate distribution apparatus 56 is further described in u . s . patent publications nos . 2003 / 0130638 ; 2003 / 0132762 ; 2003 / 0135176 ; and 2003 / 0143324 , each is incorporated herein by reference . wind - up apparatus 60 is used to sandwich the particulate laden , shaped tow between strata ( for example , tissues , nonwovens , and permeable and non permeable films ). apparatus 60 is conventional and driven . strata 100 from unwind apparatus 62 is fed through a plurality of guide rollers 106 and passed by an adhesive applicator 64 to a vacuum apparatus 58 . adhesive applicator 64 may be any adhesive applicator , but preferably is a hot melt adhesive applicator . vacuum applicator 58 is coupled to a vacuum source 104 ( see fig4 ) and may be any suitable vacuum apparatus , such as a vacuum drum or vacuum table ( also see : u . s . patent publication no . 2003 / 0134559 , incorporated herein by reference ). vacuum pressures range from 3 – 6 inches of water , preferably 5 inches of water . the vacuum drum or vacuum table is , preferably , driven . strata 102 from unwind apparatus 66 is fed through a plurality of guide rollers 108 and passed by another adhesive applicator 64 to vacuum apparatus 58 . at vacuum apparatus 58 , stratum 100 and 102 sandwich the particulate laden , shaped tow . strata 102 is pressed into the other layers by a lay on roller 110 . lay on roller 110 may include a cavity of channel 114 ( see fig5 ) to shape the absorbent composite 112 into a predetermined shape ( e . g ., hour glass , rectangular , etc .) and / or press stratum together for sealing . thereafter , absorbent composite 112 may be wound - up on wind - up apparatus 60 or fed directly to a machine for making an absorbent garment . the line speed , as measured at the vacuum drum 58 , is preferably greater than 190 m / min , preferably greater than 225 m / min , and most preferably greater than 250 m / min . the maximum line speed is about 300 m / min . the ratio of tow speed exiting from cabinet 38 to the line speed at the vacuum drum 58 is greater than 1 and less than 3 , preferably between 1 . 8 to 3 . 0 , and most preferably about 2 . 4 . this allows accumulation of the tow in the tow shaping apparatus 54 . additionally , line speed can be used to control particulate distribution apparatus 56 . coupling line speed to apparatus 56 minimizes particulate ( e . g ., sap ) loss during ramp up and ramp down of apparatus 10 . additionally , static elimination devices ( not shown ) may be placed in apparatus 10 adjacent the tow band to decrease static charges that may accumulate on the tow band . placement of those devices is within the skill of the art . further , the driven rollers are preferably coupled or controlled ( not shown ) in a conventional manner to facilitate start - up , shutdown , and vary line speeds during operation . in fig3 , cabinet 38 is shown in greater detail . tow 14 prior to entering cabinet 38 engages guide rollers 76 . guide rollers 76 may be opened and closed via an opening mechanism 78 . guide rollers 76 have a diameter of 50 mm and exert a nip pressure ranging from 0 . 5 – 5 bar , preferably 2 – 2 . 5 bar ( using a 1 . 0625 inch cylinder ). cabinet 38 includes a door 70 that is fastened to the rest of the cabinet via hinges 72 and may be fastened shut by latch 74 . cabinet 38 encloses de - registering apparatus 40 and prevents contaminants , such as adhesives from adhesive applicator 64 from fouling the surface of the rollers . fouling of the surfaces can cause adhesion of the tow to the rolls . cabinet 38 is supplied with an air nozzle 80 that is used to provide positive pressure within cabinet 38 so that contaminants cannot enter . the positive pressure may range from 0 . 1 – 1 . 0 psig , preferably 0 . 25 – 0 . 5 psig . referring to fig4 , 5 , and 6 , the operation of the particulate distribution apparatus 56 is illustrated in greater detail . particulate distribution apparatus 56 is preferably a vibratory feeder . at the bottom of a hopper is a clean out valve 90 and a motor 92 drives the feeder . particulate is vibrated through an orifice defined , in part , by a trough 94 where it is deposited onto opened tow 98 . particulate , when sap , may be fed at rates of 1 – 25 kg / min , preferably 5 – 13 . 5 kg / min , assuming garment formation of 500 – 900 / min with 10 – 15 g / garment . particulate 96 and shaped tow 98 are held in place by the vacuum apparatus 58 ( a rotary vacuum drum is shown ), while stratum 100 and 102 are applied thereto . stratum 100 and 102 are guided to vacuum apparatus 58 by rollers 106 and 108 , respectively . adhesive from applicators 64 is preferably applied to the stratum prior to arrival at the vacuum apparatus 58 . when the stratum sandwich the particulate laden , shaped tow , on vacuum apparatus 58 , the lay on roller 110 squeezes the composite to seal it shut , preferably with the lateral edges of the stratum being sealed together . thereafter , absorbent composite 112 is wound - up or directed on into a subsequent absorbent garment making operation . the distribution of the particulate is controlled , in part , by an orifice 118 , fig6 . orifice 118 is defined by trough 94 and plate 116 that may be moved to open and close the orifice . in fig6 , four possible configurations of orifice 118 are illustrated . orifice 118 ′, fig6 a , illustrates a rectangular shaped orifice . orifice 118 ″, fig6 b , illustrates a triangularly shaped orifice . orifice 118 ′″, fig6 c , illustrates an arcuate shaped orifice . orifice 118 ″″, fig6 d , illustrates a serrated or toothed shaped orifice . of course , other configurations for the orifice would be obvious to those of ordinary skill in the art . the present invention may be embodied in other forms without departing from the spirit and the essential attributes thereof , and , accordingly , reference should be made to the appended claims , rather than to the foregoing specification , as indicated the scope of the invention . | 3 |
it can be noted , first of all , that the assembly which permits the feeding of cord and the removal of a length 40 operates in accordance with the same principle and is identified by reference numerals starting with the number 8 in all embodiments . when it is used with textile cord , it is used with a pneumatic propulsion which is described in detail further below , identified in fig2 , 5 and 6 by reference numerals commencing with the number 9 . when it is used with metal wire , it is not necessary to employ pneumatic propulsion . on the other hand , it is advisable for the metal wire to have undergone a prior treatment enabling it to adhere well to the raw rubber . an example of such a treatment is found in u . s . pat . no . 4 , 592 , 259 . two types of folders are described below . in fig1 to 6 , there can be noted a folder formed of a tappet 50 mounted on a belt 54 engaged on two pulleys 52 , 53 , which make it possible to bring the core more particularly into the region of the beads of the future tire . fig7 and 9 show a rotary folder which makes it possible to move the core more particularly into the region of the shoulder of the future tire . the circular movement which it describes is tangent to the shoulder zone . the frame of the machine illustrated in fig1 to 3 appears in part and is designated by the reference numeral 1 . the core 2 is covered with a layer of rubber on which the reinforcement cord 4 is to be deposited in order to form a radial carcass . the machine is fed with cord 4 from a reel 4b . in order to assure the unwinding , the cord 4 is clamped between two rollers 80 , 81 which are covered by an anti - skid covering . the roller 81 is driven . one can therefore constantly know the precise measure of the amount of cord fed from a knowledge of the number of turns of the drive and the step - down ratio installed . any type of cord can be supplied and measured in this way . all of the movements of the machine , except for the rotation of the core 2 , are controlled synchronously by the motor m , of known angular speed , while the rotation of the core 2 is driven by another motor , not shown , the speed of which is related to that of the motor m . the core 2 is driven in rotation by another motor at a speed proportional to that of the motor m and dependent , furthermore , on the laying pitch of the lengths 40 of cord 4 . the natural or synthetic textile cords must necessarily be maintained taut by pneumatic propulsion . the principle of this pneumatic propulsion is illustrated in fig4 . the pneumatic propulsion is obtained within a tee 960 having a central branch 961 and two aligned branches 962 and 963 . the central branch 961 receives a compressed air feed channel 96 . it is seen that the compressed air is passed through the branch 963 . the cord 4 is introduced through the branch 962 and , as soon as it leaves the branch 962 , the compressed air tends to expel the cord 4 continuously out of said branch 963 . in fig2 the channel 96 can be seen which conducts the compressed air to three places on the path of the cord 4 . first of all , upstream of the unwinding rollers 80 , 81 , a reverse pneumatic propulsion 960i tends continuously to withdraw the cord 4 rearward so that , in case of stoppage or reverse operation of the machine during , for instance , adjustment phases upon starting , the cord 4 always remains taut and does not accumulate between the receiving flared tube 85 for the cord 4 and the unwinding rollers 80 , 81 . downstream of the latter , there is a first propulsion 960a in forward direction , located at the start of the tube 82 conducting the cord 4 towards the barrel 83 . finally , a second propulsion in forward direction 960a is located at the start of the connection piece 95 which conducts the cord towards the device for presentation to the core . coming back upstream , the cord has been introduced into a connection piece 82 the reinforced end of which constitutes a barrel 83 supporting the cord 4 while it is cut by the rotary knife 84 . the lengths 40 of cord 4 to be placed on the core in order to constitute the carcass reinforcement are thus individualized . each length 40 of cord 4 which has thus been isolated is then subjected to the action of the presentation unit for the lengths 40 of cord , which unit comprises two clamps 31 , 32 movable with respect to the core 2 and mounted on a clamp - holder belt 34 , in its turn engaged on two pulleys 35 . each clamp 31 , 32 grips a length 40 downstream of the device 8 for the feeding of cord and removal of lengths and drives it linearly above the core 2 and beyond the latter . the folders are designated in general by the reference numeral 5 . a folder comprises a tappet 50 fastened on a folder belt 54 engaged on two pulleys 52 and 53 . the tappet 50 is shaped , and fastened on the folder belt 54 , in such a manner that it is perpendicular to the direction of movement of the belt . it acts in the manner of a finger around which the cord 4 is partially wound , as will be better seen below . the clamp - holder belt 34 with its clamps 31 , 32 and the folders 5 are all firmly attached to each other and possibly movable with respect to the core 2 so as to adjust the angle at which it is desired to lay the reinforcement cords . in the embodiment of the invention illustrating this description , the machine is designed to deposit only cords at 90 °, forming the radial carcass ply . the presenting of a length of cord is effected by the action of a clamp 31 or 32 . the two clamps 31 , 32 act in succession , only one of them serving for the presenting of a length of cord 4 at a given moment . each clamp 31 or 32 is naturally closed . in order to grasp the cord 4 , its two jaws are moved apart , passing on opposite sides of the end 950 of the connection piece 95 ( see fig1 c ). as soon as a clamp leaves this end 950 ( towards the right in fig1 c ), it closes on the length 40 of the cord which appears at the outlet of the end 950 . the clamps 31 , 32 are spaced apart on the belt 34 by a distance slightly greater than the length of the longest of the lengths 40 which it is desired to place , and therefore the length of a carcass cord in the tire . thereupon , as soon as a clamp has released the cord under the action of the folders , which action is explained below , the following clamp , which has already grasped the cord , is ready to drive it again with respect to the core . the length of the belt 34 is selected accordingly . by a suitable step - down gear , the clamp 31 or 32 drives the cord 4 at a speed about 10 % greater than that imposed by the rollers 80 , 81 . when the cord 4 appears at the end 950 of the connection piece 95 , the knife 84 has not yet released the future individual length 40 of cord . no sliding of the cord 4 is possible with respect to the rollers 80 , 81 . at this precise moment , the cord 4 is grasped by the clamp 31 ( or , . alternatively , 32 ) which slides slightly on it . the knife 84 then cuts the cord 4 , and the clamp 31 or 32 drives the length 40 which has just been individualized . the pulleys 53 of the folders 5 are arranged in the immediate vicinity of the bottom of the core 2 . their diameter is preferably selected so as to correspond substantially to the radius of curvature of the core in a meridian plane at the height of the bead of the future tire . the pulleys 52 are arranged at the height of the crown of the core 2 , or else even higher and more distant from the core . the pulleys 52 and 53 carry a belt 54 on which there are mounted two tappets 50 and 51 which act in succession , that is to say , one on one length and the following one on the following length . the pulleys 52 and 53 are radially oriented , the pulley 52 being furthermore so positioned with respect to the core that the tappet 50 or 51 can strike the length of cord 40 between the perpendicular to the cord 2 and the edge of the length 40 , preferably rather close to the end of the length 40 . when the rate of placing is high , the tappet 50 drives the thread radially downward sufficiently fast so that there is a sliding of the cord on the tappet 50 , the length 40 being immobilized by adherence in its center on the core 2 , which is covered by a layer of rubber . friction tracks 26 are preferably arranged on both sides of the core in order slightly to support the cord when it is taken over by the tappet 50 . by its rapid movement , the tappet 50 therefore drives the cord radially downward and applies it against the core 2 , where it adheres everywhere on the layer of rubber without presenting undulations or other irregularities in path . in order to center the length 40 well on the tappet 50 , the latter has a small groove , which can be noted from fig1 a . the unit cycle of the machine has just been described . the repetition of this cycle as many times as there are lengths 40 of cord permits the manufacture of the so - called carcass reinforcement . it is still necessary to effect a firm anchoring of all of these cords in order to form the bead of the tire . a carcass reinforcement constituted in this manner can be anchored on a bead wire , being careful to see to it that each length is sufficiently long to constitute a turn - up around the bead wire . this turn - up is effected by any suitable means , as well known to the person skilled in the art , for instance an inflatable turn - up bladder . or else a tire bead can be constituted of the type described in u . s . pat . no . 3 , 072 , 171 in fig4 and 5 , by circumferentially winding other cords . in order to be able to insert and extract the core 2 , the shaft of the pulleys 53 pivots around the shaft of the pulleys 52 so as to increase as much as desired the distance between the pulleys 53 while maintaining the belts 54 taut on their respective pulleys 52 and 53 . fig5 and 6 illustrate a second machine which also permits the manufacture of radial carcass reinforcements , in which the cords are arranged on the core 2 in a meridian plane . in order to assure the unwinding thereof , the cord 4 is also clamped there between two rollers 80 , 81 which are covered by an anti - skid covering . the rollers 80 , 81 are both driven at the same speed , which permits the feeding of cord 4 and the precise measurement of the quantity fed , as explained above . the cord 4 is then introduced into a tube 82 the reinforced end of which constitutes a barrel 83 which supports the cord 4 when it is cut by the rotary knife 84 . it will be noted that , in order to clarify the drawings , fig5 comprises a partial folding . the rotary knife 84 , the barrel 83 and the connection piece 60 of the presentation device 6 are shown therein in the plane of the drawing , while their actual position is that shown in fig6 . each length 40 of cord 4 which has thus been individualized is then subjected to the action of a laying head 3 in rotation in a meridian plane , at a radius just greater than the maximum radius of the core 2 . the rotary knife 84 therefore acts downstream of the unwinding rollers 80 , 81 and upstream of a presentation device 6 , the role of which is to orient the cord 4 , more precisely each length 40 of cord 4 , in a meridian plane and to present it properly to the laying head 3 so that the latter can lay it both on the core 2 and on intermediate rollers 25 which are arranged on opposite sides of the core 2 , centered with respect to the plane containing the path of the laying head 3 . a roller 300 , mounted at the end of the arm 30 , is the part which applies the cord 4 onto the core 2 . the role of the presentation device 6 is therefore to feed the cord 4 centered well with respect to the roller , bring it between the roller 300 and the intermediate roller 25 , and also contribute to holding the cord 4 centered with respect to the roller 300 while the latter applies the cord 4 on the core 2 . of course , the field of action of the laying head 3 must remain free . therefore , the space necessary for the displacement of the laying head 3 between the presentation device 6 and the intermediate roller 25 is left free . in order to bring the end of the length 40 of cord 4 in front of the roller 300 both precisely and reliably , a chute 302 is fastened to the arm 30 of the laying head 3 . the chute is shaped in such a manner as to obtain a receiving surface having the shape of a v . this chute 302 can receive the end 42 of the length 40 of cord 4 , which makes it possible to tolerate a large margin of inaccuracy for the position thereof . the end 61 of the presentation device 6 ( actually a simple connection piece 60 in which the cord 4 is engaged ) is so directed that the end 42 of the cord 4 falls rather too far forward with respect to the roller 300 so as to be certain that it never falls on top of this roller 300 or in the upper half thereof . the end of this chute forms a buttonhole through which the cord penetrates . contrary to metal wires , textile threads must necessarily be maintained taut by pneumatic propulsion since they do not have any resistance to compression . there can be noted the channel 96 which conducts the compressed air to four places on the path of the cord 4 . first of all , upstream of the unwinding rollers 80 , 81 , reverse pneumatic propulsion 960i tends continuously to pull the thread 4 rearward so that , in case of stoppage or reverse operation of the machine during , for instance , adjustment phases upon starting , the thread 4 always remains taut and does not accumulate between the flared tube 85 for the receiving of the cord 4 and the unwinding rollers 80 , 81 . downstream of the latter , there is a first forward propulsion 960a located at the start of the tube 82 conducting the thread 4 towards the barrel 83 . it is desirable to create losses in head by means of holes drilled through the tube 82 so as to obtain a good driving force for the thread 4 . a second propulsion in forward direction 960a is located at the start of the connection piece 60 , which also has holes creating losses in head at about the middle thereof . finally , a nozzle 62 sends a jet of air just in front of the outlet channel 61 of the presentation device 6 . this outlet channel 61 is located at the end of the connection piece 60 and is slightly curved towards the core 2 so that the end 42 of the cord 4 strikes against the bottom of the chute 302 with an angle of incidence of about 40 °. in this way , said end 42 is always properly presented between the intermediate roller 25 and the roller 300 . the roller 300 applies each of the lengths 40 of cord onto each of the intermediate rollers 25 and onto the top of the core 2 . the rotation of the intermediate rollers 25 is sufficiently slowed down so that they do not turn upon the application of the cord thereon . furthermore , the surface of said rollers and the cord 4 have sufficient self - adhesive properties so that the cord adheres to the intermediate rollers 25 when it is placed thereon , but sufficiently slight so that the cord is subsequently easily released , the possible rotation of the intermediate rollers facilitating said release . for example , the intermediate rollers 25 are covered with a layer of vulcanized rubber . the intermediate rollers 25 are spaced apart from each other by an amount which is a function of the length of the lengths 40 to be laid and are so located that they are within the path of the laying head 3 , which in the present case is a circle . subsequently , the action of the tappets 50 takes place precisely as explained above and the cycle can start again . here also , a friction path 26 is preferably provided on both sides of the core 2 , as shown in fig6 . the third embodiment is specifically designed to lay metal wire in order to form a crown reinforcement . the presentation device 6 of this embodiment is formed by a linear groove arranged perpendicular to a radius included in the median plane , joining the axis of rotation of the core 2 and said linear groove and forming the said desired angle with respect to this median plane , the groove being open towards the core 2 . in the case shown , the apparatus is designed specifically to produce crown reinforcements with an angle varying between 15 ° and 90 °. in fig7 it is seen that the feeding of a metal wire 4 is effected by an assembly of rollers 80 , 81 entirely similar to what has been described above . the driving of the rollers 80 , 81 permits the continuous measurement of the length of cord 4 fed . each length 40 of cord is individualized by a rotary knife 84 passing flush with a barrel 83 below which the cord is propelled by the rollers 80 , 81 . in fig9 it is seen that the presentation device 6 comprises a first channel 67 open towards the core 2 ( having walls on the transverse sides and on top ), and then a groove 64 forming a linear channel arranged facing the final place of the length 40 on the core 2 and open towards the core . the groove 64 is formed by two cheeks 63 defining it transversely and , on top , by a magnetic ramp with small magnets 66 which , placed on top , can be noted . a chamber receives the end of the length 40 . this chamber comprises essentially an end support 68 above which the length comes to rest and two cheeks 680 defining the further trajectory of the length , as well as the cheeks 63 , namely a radial flat trajectory . between the barrel 83 and the first channel 67 , there is the space just necessary for the passage of the knife 84 . between this first channel 67 and the groove 64 , there is the space just necessary for the passage of the tappet 70 of one of the folders 7 . between the groove 64 and the chamber containing the end support 68 , there is the space necessary for the passage of the tappet 70 of the other folder 7 . the cord 4 of magnetic steel is held at the bottom of the groove 64 by magnetic attraction due to the small magnets 66 placed on top of this ramp , in its turn made of non - magnetic material . these magnets develop a force of attraction on the cord 4 sufficient to grasp it in flight upon emergence from the barrel 83 and sufficiently slight so that the cord 4 can be easily detached when it is struck by the folders 7 . the barrel 67 , the groove 64 and the end chamber are oriented with respect to the core 2 in such a manner that their radial projection on the core 2 forms the desired angle for the crown reinforcement cord , namely about 25 ° in the example considered . the taking of a length 40 of cord 4 is effected as already described by a knife 84 which cuts the cord 4 flush with the barrel 83 when a predetermined length has been introduced into the ramp 64 . each folder 7 is formed by a tappet 70 similar to the tappet 50 of the folder of the preceding variant and describes a circular movement approximately tangent to the core 2 . the discontinuous circles represent , in fig9 the trajectory of the tappets 70 and the dash - line axis circle to the right of fig9 represents the path of the knife 84 . the knife 84 is fastened on a disk which forms , in the drawing , a circle of a diameter slightly greater than the diameter of the dashed - line axis circle . the tappet 70 on the left - hand side of fig9 that is to say the one acting on the front of the length 40 referred to its direction of introduction into the presentation device , preferably acts on the length 40 slightly after the other tappet . furthermore , in order to improve the projecting of the : length , this same folder ( left side of fig9 right side of fig8 ) is provided with a v - clamp 71 between the branches of which the cord can slide . this clamp forms a v in the plane of fig8 where the reference number 71 points to one of the branches of the v . this v is closed by the action of the immovable cam 72 just after having grasped the cord . the cam acts only on one side of the clamp 71 , just sufficiently to hold the cord slightly , but the clamp 71 can slide on the cord during the folding movement since the latter is already held on the core 2 on the other side and at the center of the core by the slightly prior action of the other folder . this arrangement gives assurance that the cord is properly laid straight . | 1 |
compounds of the formula i may be prepared according to the following reaction schemes and discussion . unless otherwise indicated s , r 1 and r 2 and structural formula i ( and ia , ib and ic ) in the reaction schemes and discussion that follow are as defined above . scheme 1 refers to the preparation of compounds of the formula i in two steps from compounds of formula ill . referring to scheme 1 compounds of the formula iii , wherein l is a suitable leaving group such as fluoro , bromo , chloro or mesyl ( meso 2 ), preferably bromo or chloro , are converted to the corresponding compound of formula ii by reaction with hydrazine to form a hydrazino - pyridine , followed by reaction with an acylating reagent . the reaction of a compound of formula iii with hydrazine is conducted in a polar solvent such as pyridine , ethanol or tert - butanol , or in neat hydrazine , preferably in neat hydrazine . the hydrazine reaction is conducted at a temperature between about 40 ° c . to about 80 ° c ., preferably about 70 ° c . for about 10 minutes to about 60 minutes , preferably about 15 minutes . acylation of the resulting hydrazino - pyridine to give compounds of the formula ii is conducted with an acid chloride in the presence of a base such as triethylamine in a solvent such as dichloromethane , tetrahydrofuran , n , n - dimethylformamide , preferably dichloromethane , for a time period between about 10 minutes to about 120 minutes , preferably about 30 minutes , at a temperature of about 0 ° c . to about 22 ° c ., preferably at about 0 ° c . alternatively , the hydrazino - pyridine can be acylated with a carboxylic acid to give compounds of the formula ii using amide coupling agents in a manner well known to one skilled in the art . the compound of formula ii can be converted to a compound of formula i using a suitable dehydrating agent or under conditions that promote cyclo - dehydration . suitable dehydrating agents for the conversion of compounds of formula ii to compounds of formula i include phosphorous oxychloride and dichlorotriphenylphosphorane , preferably phosphorous oxychloride . reactions using phosphorous oxychloride are conducted in neat phosphorous oxychloride at a temperature between about 60 ° c . to about 110 ° c ., for a time period between about 2 hours to about 16 hours . reactions using dichlorotriphenylphosphorane are conducted in the presence of a base , such as triethylamine , in a polar solvent such as acetonitrile , at temperatures of about 60 ° c . and reflux for a time period from about 1 hour and about 8 hours . compounds of the formula iii can be made according to the methods of scheme 2 . scheme 2 refers to the preparation of compounds of the formula iii , which are intermediates useful in the preparation of compounds of the formula i , in scheme 1 . referring to scheme 2 , a compound of the formula iii , can be prepared from a compound of formula iv , by heating with formamide . the aforesaid reaction can be run at a temperature from about 100 ° c . to about 160 ° c . for a period from about 1 hour to about 12 hours , preferably at about 160 ° c . for about 3 hours . the compound of formula iv is prepared from a compound of formula v by reaction with sodium methoxide , or sodium ethoxide , or sodium tert - butoxide , preferably sodium methoxide , in an alcohol solvent , such as methanol , ethanol , isopropanol , preferably methanol , at a temperature of 0 ° c . to 30 ° c ., preferably at 22 ° c ., for a period of time from 15 minutes to about 3 hours , preferably 30 minutes . the aforesaid reaction is followed by an aqueous acidic work - up . the compound of formula v is prepared from a compound of formula vi by reaction with br 2 in a polar solvent . suitable solvents include acetic acid , chloroform or methylene chloride , preferably acetic acid . the aforesaid reaction is conducted at a temperature of about 0 ° c . to about 30 ° c . preferably at about 22 ° c . ( room temperature ) for a period from about 10 minutes to about 4 hours , preferably about 30 minutes . the compounds of formula iv can also be prepared according to the methods of scheme 4 . the compounds of formula vi are prepared according to the methods of scheme 5 . additional routes for the synthesis of compounds related to formula vi are described in the literature : davies , i . w . ; marcoux , j .- f . ; corley , e . g . ; journet , m . ; cai , d .- w . ; palucki , m . ; wu , j . ; larsen , r . d . ; rossen , k . ; pye , p . j . ; dimichele , l . ; dormer , p . ; reider , p . j . ; j . org . chem . , vol . 65 , pp . 8415 - 8420 ( 2000 ). scheme 3 refers to an alternate preparation of compounds of formula iii , which are intermediates in scheme 1 . referring to scheme 3 , compounds of the formula iii , can be prepared from compounds of formula vii by reaction with an isocyanide of formula in the presence of a base . suitable bases include potassium carbonate , triethylamine , 2 , 6 - lutidine and piperazine , preferably 2 , 6 - lutidine . suitable solvents include polar solvents such as tetrahydrofuran , acetonitrile or n , n - dimethylformamide , preferably in acetonitrile or tetrahydrofuran . the aforesaid reaction may be run at a temperature between about 22 ° c . and about 70 ° c ., preferably at about 22 ° c . for a period from about 2 hours to about 4 hours , followed by about 6 hours to about 10 hours at a temperature of about 70 ° c . compounds of formula vii are known in the literature ( when l is chloro see : corey , e . j . ; loh , t - p . ; achyutha rao , s . ; daley , d . c . ; sarshar , s . j . org . chem ., 1993 , 58 , 5600 - 5602 ) or can be prepared in a manner well known to one skilled in the art . with a dehydrating agent such as pocl 3 , and a weak hindered base such as 2 , 6 lutidine or 2 , 4 , 6 - trimethylpyridine . preferably the reaction is performed in the presence of a solvent such as tetrahydrofuran , dimethyl ether or methylene chloride . the aforesaid reaction may be run at a temperature between about − 20 ° c . and about 50 ° c ., preferably at about 0 ° c . to about room temperature for a period from about 2 hours to about 48 hours , preferably about 24 hours . scheme 4 refers to an alternate preparation of compounds of formula iv , which are intermediates in scheme 2 , useful in the preparation of compounds of formula i . compounds of formula iv can be prepared from compounds of formula ix by reaction with a suitably substituted grignard reagent of the formula ( r 1 ) s - phenyl - m , wherein m is an activation group such as magnesium bromide or chloride ( see for example : jackson , w . r . ; jacobs , h . a . ; jayatilake , g . s . ; matthews , b . r . ; watson , k . g . aust . j . chem . 1990 , 43 , 2045 - 2062 ). reagents of the formula ( r 1 ) s - phenyl - m are commercially available or may be prepared by one skilled in the art . the preparation and conversion of compounds of formula x into trimethylsilyl cyanohydrins of formula ix can be performed by methods known to those skilled in the art such as for example pirrung , m . ; shuey , s . w . ; j . org . chem . 1994 , 59 , 3890 - 3897 . scheme 5 refers to the preparation of compounds of the formula vi , which are intermediates for the preparation of compounds of formula iii in scheme 2 . referring to scheme 5 , a compound of the formula vi is prepared from a compound of formula xi by reaction with a grignard reagent of the formula ( r 1 ) s - phenyl - m , wherein m is an activating group such as magnesium bromide or magnesium chloride in a solvent . suitable solvents include tetrahydrofuran , dioxane , dimethylethyl ether or diethyl ether , preferably tetrahydrofuran . the aforesaid reaction is conducted at a temperature of about − 78 ° c . to 0 ° c . for a period from about 10 minutes to about 24 hours preferably about 2 hours . reagents of the formula ( r 1 ) s - phenyl - m are commercially available or may be prepared by one skilled in the art . a compound of formula xi is prepared from a compound of formula xii by reaction with a hydroxylamine of the formula wherein p 2 and p 3 are independently ( c 1 - c 6 ) alkyl , preferably methyl , and an activating agent . suitable activating agents include carbonyldiimidazole or oxalyl chloride , preferably carbonyldiimidazole . suitable solvents include methylene chloride or dichloroethane . compounds of the formula xii are prepared from compounds of formula xiv by acid hydrolysis , such as by reaction with sulfuric acid / water ( preferably 1 : 1 ) at a temperature of about 100 ° c . to about 120 ° c ., preferably about 110 ° c . for a period from about 1 hour to about 6 hours , preferably about 4 hours . alternatively , a compound of the formula xii is prepared by base hydrolysis , such as by reaction with lithium hydroxide in water at a temperature of about 23 ° c . to about 100 ° c ., preferably at a temperature of about 80 ° c . for a period of about 4 to 10 hours . scheme 6 refers to an alternate preparation of compounds of formula i . referring to scheme 6 , compounds of the formula i can be prepared from compounds of the formula xv by reaction with a boronic ester of the formula a catalyst , and a base . suitable catalysts include copper or palladium ( such as palladium acetate ( pd ( oac ) 2 ), tetrakis ( triphenylphosphine ) palladium ( 0 ) or pd ( dppf ) cl 2 ), preferably tetrakis ( triphenylphosphine ) palladium ( 0 ). suitable bases include tertiary amine bases , such as triethylamine or pyridine , na 2 co 3 , sodium ethoxide , and k 3 po 4 , preferably triethylamine . suitable solvents include alcohols , such as methanol , ethanol and butanol , methylene chloride , dimethyl sulfoxide ( dmso ) or tetrahydrofuran ( thf ), preferably ethanol . the aforesaid reaction is typically performed under an atmosphere of nitrogen gas at a temperature of about 10 ° c . to 85 ° c ., preferably about 70 ° c . for about 6 to 72 hours . palladium - catalyzed boronic acid couplings are described in miyaura , n ., yanagi , t ., suzuki , a . syn . comm . 1981 , 11 , 7 , p . 513 . the compound of formula xv is prepared from a compound of formula xvii by reaction with a suitable bromination reagent such as phenyl trimethylammonium tribromide , n - bromosuccinimide , pyridinium bromide , perbromide , br 2 or br 2 - ph 3 p , preferably n - bromosuccinimide . the bromination may be carried out in a reaction inert solvent such as n , n - dimethylformamide , diethyl ether or tetrahydrofuran , preferably dimethyl formamide . the aforesaid reaction is conducted at a temperature of about − 78 ° c . to about 40 ° c . preferably about − 78 ° c . to about 0 ° c . for a time period between about 1 hour to about 16 hours . preferably , the reaction is conducted in the presence of a base such as lithium bis ( trimethylsilyl ( amide )). the compound of formula xvii is prepared from a compound of the formula xviii by reaction with tosylmethylisocyanide in the presence of a base in a solvent . suitable bases include alkali metal carbonates or hydroxide bases , preferably potassium carbonate . suitable solvents for the aforesaid reaction include hexane , methylene chloride , alcohols , n , n - dimethylformamide ( dmf ), n , n - dimethylacetamide or n - methylpyrrolidinone ( nmp ) preferably methanol . the aforesaid reaction may be run at a temperature between about 30 ° c . and 180 ° c ., preferably about 65 ° c ., for about 30 minutes to 24 hours , preferably about 2 hours . alternatively , a compound of the formula i can be prepared from aldehydes of formula xviii as described previously in scheme 3 for the conversion of compounds of formula viii to compounds of formula iii . compounds of formula xviii are prepared from compounds of formula xix , wherein l ′ is bromo or iodo , by a formylation reaction . suitable conditions for formylation include metal halogen exchange with isopropylmagnesium chloride in a solvent such as tetrahydrofuran at a temperature of about 0 ° c ., for a period of time of about 30 minutes , followed by the addition of n , n - dimethylformamide at a temperature of about 0 ° c ., followed by a period of time of about 2 . 5 hours at a temperature of about 50 ° c . compounds of formula xix are prepared as described in the literature ( moran , d . b . ; morton , g . o . ; albright , j . d ., j . heterocycl . chem . , vol . 23 , pp . 1071 - 1077 ( 1986 )) or from compounds of formula xx as described in scheme 1 for the conversion of compounds of formula iii to compounds of formula i . compounds of formula xx are commercially available . the compounds of the formula i which are basic in nature are capable of forming a wide variety of different salts with various inorganic and organic acids . although such salts must be pharmaceutically acceptable for administration to animals , it is often desirable in practice to initially isolate a compound of the formula i from the reaction mixture as a pharmaceutically unacceptable salt and then simply convert the latter back to the free base compound by treatment with an alkaline reagent , and subsequently convert the free base to a pharmaceutically acceptable acid addition salt . the acid addition salts of the base compounds of this invention are readily prepared by treating the base compound with a substantially equivalent amount of the chosen mineral or organic acid in an aqueous solvent medium or in a suitable organic solvent such as methanol or ethanol . upon careful evaporation of the solvent , the desired solid salt is obtained . the acids which are used to prepare the pharmaceutically acceptable acid addition salts of the base compounds of this invention are those which form non - toxic acid addition salts , i . e ., salts containing pharmacologically acceptable anions , such as hydrochloride , hydrobromide , hydroiodide , nitrate , sulfate or bisulfate , phosphate or acid phosphate , acetate , lactate , citrate or acid citrate , tartrate or bitartrate , succinate , maleate , fumarate , gluconate , saccharate , benzoate , methanesulfonate and pamoate [ i . e ., 1 , 1 ′- methylene - bis -( 2 - hydroxy - 3 - naphthoate )] salts . those compounds of the formula i which are also acidic in nature , are capable of forming base salts with various pharmacologically acceptable cations . examples of such salts include the alkali metal or alkaline - earth metal salts and particularly , the sodium and potassium salts . these salts are all prepared by conventional techniques . the chemical bases which are used as reagents to prepare the pharmaceutically acceptable base salts of this invention are those which form non - toxic base salts with the herein described acidic compounds of formula i . these non - toxic base salts include those derived from such pharmacologically acceptable cations as sodium , potassium , calcium and magnesium , etc . these salts can easily be prepared by treating the corresponding acidic compounds with an aqueous solution containing the desired pharmacologically acceptable cations , and then evaporating the resulting solution to dryness , preferably under reduced pressure . alternatively , they may also be prepared by mixing lower alkanolic solutions of the acidic compounds and the desired alkali metal alkoxide together , and then evaporating the resulting solution to dryness in the same manner as before . in either case , stoichiometric quantities of reagents are preferably employed in order to ensure completeness of reaction and maximum product yields . the activity of the compounds of the invention for the various disorders described above can be determined according to one or more of the following assays . all of the compounds of the invention , that were tested , had an ic50 of less than 10 μm in the tnfα and mapkap in vitro assays and an ed 50 of less than 50 mg / kg in the in vivo tnfα assay . the compounds of the present invention also possess differential activity ( i . e . are selective for ) for one or more p38 kinases ( i . e . α , β , γ , and δ ) or other map kinases . certain compounds are selective for p38α over p38β , γ , and δ , other compounds are selective for p38β over p38α , γ , and δ , other compounds are selective for p38 α and β over p38 γ and δ . selectivity is measured in standard assays as a ic 50 ratio of inhibition in each assay . mononuclear cells are isolated from heparinized blood ( 1 . 5 ml of 1000 units / ml heparin for injection , elkins - sinn , inc . added to each 50 ml sample ) using accuspin system - histopaque - 1077 tubes ( sigma a - 7054 ). thirty - five milliliters of whole blood are added to each tube and the tubes are centrifuged at 2100 rpm for 20 minutes in a beckman gs - 6kr centrifuge with the brake off at room temperature . the mononuclear cells which collect at the interface are removed , diluted with macrophage serum free medium ( gibco - brl ) ( medium ) to achieve a final volume of 50 ml , and collected by centrifugation for 10 minutes . the supernatant is discarded and the cell pellet is washed 2 times with 50 ml of medium . a sample of the suspended cells is taken before the second wash for counting . based on this count , the washed cells are diluted with medium containing 1 % fbs to a final concentration of 2 . 7 × 10 6 cells / ml and 75 μl of the cell suspension is added to each well of a 96 well plate . compounds are routinely tested at final concentrations from 2 μm to 0 . 016 μm , but may be tested at other concentrations , depending on activity . test agents are diluted with dmso to a final concentration of 2 mm . from this stock solution , compounds are first diluted 1 : 25 ( 5 μl of 2 mm stock + 120 μl medium containing 400 ng / ml lps and 1 % fbs then 40 μl of this dilution is diluted with 360 μl of medium with lps . serial dilutions ( 1 / 5 ) are performed by transferring 20 μl of this dilution to 80 μl of medium containing both lps and 0 . 4 % dmso , resulting in solutions containing 8 μm , 1 . 6 μm , 0 . 32 μm and 0 . 064 μm of test agent . the assay is initiated by adding 25 μl of the diluted compounds to the mononuclear cell suspension and incubating the cells at 37 c and 5 % co 2 for 4 hours . the 96 - well plates are then centrifuged for 10 minutes at 2000 rpm at 4 ° c . in a beckman gs - 6kr centrifuge to remove cells and cell debris . a 90 μl aliquot of each supernatant is removed and transferred to a 96 well round bottom plate , and this plate is centrifuged a second time to insure that all cell debris is removed . 80 μl of the supernatant is removed and transferred to a new round bottom plate . supernatants are analyzed for tnf - α content using r & amp ; d elisa . 25 μl of each sample is added to an elisa well containing 25 μl of assay diluent rd1f and 75 μl of assay diluent rd5 . the assay is run following kit directions except 100 μl of conjugate and substrate solutions are used . the amount of tnf - α immunoreactivity in the samples is calculated as follows : total = od 450 of cells that were treated with 0 . 1 % dmso only . mononuclear cells are collected from heparinized human blood as detailed above . the washed cells are seeded into 6 - well cluster plates at a density of 1 × 10 7 cells / well ( in 2 ml of medium ). the plates are incubated at 37 ° c . in a 5 % co 2 environment for 2 hours to allow adherence of the monocytes , after which time media supernatants containing non - adherent cells are removed by aspiration and 2 ml of fresh medium are added to each well . plates are incubated overnight at 37 ° c . in a 5 % co 2 environment . media are removed by aspiration . the attached cells are rinsed twice with fresh medium , then 2 ml of d - mem medium containing 10 % heat inactivated fbs are added to each well . test compounds are prepared as 30 mm stock solutions in dmso and diluted to 1250 , 250 , 50 , 10 , 2 , and 0 . 4 μm in d - mem containing 1 % dmso and 10 % fbs . to individual wells of the monocyte cultures , 20 μl of these test agent dilutions are added resulting in final test agent concentrations of 12 . 5 , 2 . 5 , 0 . 5 , 0 . 1 , 0 . 02 and 0 . 004 μm . after a 10 minute preincubation period , 20 μl of a 10 μg / ml lps solution are added to each well and the plates are incubated at 37 ° c . for 30 minutes . media subsequently are removed by aspiration , the attached monocytes are rinsed twice with phosphate buffered saline , then 1 ml of phosphate buffered saline containing 1 % triton x - 100 ( lysis buffer ; also containing 1 complete ™ tablet [ boehringer # 1697498 ] per 10 ml of buffer ) is added to each well . the plates are incubated on ice for 10 minutes , after which the lysates are harvested and transferred to centrifugation tubes . after all samples are harvested , they are clarified by centrifugation ( 45 , 000 rpm for 20 minutes ) and the supernatants recovered . 5 μl of anti - mapkap kinase - 2 antiserum ( upstate biotechnology # 06 - 534 ) is added to a microcentrifuge tube ( 1 tube for each of the above cell lysates ) containing 1 ml of a 5 % suspension of protein g - sepharose ( sigma # p3296 ) in pbs . these mixtures are incubated for 1 hour at 4 ° c . ( with rocking ) after which the beads , containing bound igg , are recovered by centrifugation and washed twice with 1 ml of 50 mm tris , ph 7 . 5 , 1 mm edta , 1 mm egta , 0 . 5 mm orthovanadate , 0 . 1 % 2 - mercaptoethanol , 1 % triton x - 100 , 5 mm sodium pyrophosphate , 10 mm sodium β - glycerophosphate , 0 . 1 mm phenylmethylsulfonyl fluoride , 1 μg / ml leupeptin , 1 μg / ml pepstatin , and 50 mm sodium fluoride ( buffer a ) by repeated centrifugation . an individual monocyte cell extract ( prepared above ) is then transferred to each tube containing a pellet of igg - coated protein g - sepharose , and these mixtures are incubated for 2 hours at 4 ° c . ( with rocking ). the beads subsequently are harvested by centrifugation , and the resulting bead pellets are washed once with 0 . 5 ml of buffer a containing 0 . 5 m nacl , once with 0 . 5 ml of buffer a , and once with 0 . 1 ml of a buffer composed of 20 mm mops , ph 7 . 2 , 25 mm sodium β - glycerophosphate 5 mm egta , 1 mm orthovanadate , and 1 mm dithiothreitol ( buffer b ). a kinase reaction mixture stock is prepared as follows : 2 . 2 μl of 10 mci / ml γ [ 32 p ] atp , 88 μl of 1 . 3 μg / ml solution of mapkap kinase - 2 substrate peptide ( upstate biotechnology # 12 - 240 ), 11 μl of 10 mm atp , 8 . 8 μl of 1 m mgcl 2 , and 770 μl of buffer b . to each of the immune complex - protein g - pellets , 40 μl of the kinase reaction mixture are added and the tubes are incubated for 30 minutes at 30 ° c . the tubes then are clarified by centrifugation and 25 μl of each supernatant is spotted onto a p81 filter paper disk ( whatman # 3698 - 023 ). after allowing all fluid to soak into the filter , each disk is placed into an individual well of 6 - well cluster plates and the filters are washed sequentially with 2 ml of 0 . 75 % phosphoric acid ( 3 washes / 15 minutes each ) and once with acetone ( 10 minutes ). the filters then are air dried and transferred to liquid scintillation vials containing 5 ml of scintillation fluid . radioactivity is determined in a liquid scintillation counter . the amount of radioactivity bound to the filter at each test agent concentration is expressed as a percentage of that observed from cells stimulated with lps in the absence of a test agent . rats were weighed and dosed with vehicle ( 0 . 5 % methyl cellulose , sigma ) or drug . one hour later , animals were injected i . p . with lps ( 50 ug / rat , sigma l - 4130 ). ninety minutes later , animals were sacrificed by asphyxiation with co 2 and bled by cardiac puncture . blood was collected in vaccutainer tubes and spun for 20 minutes at 3000 rpm . serum was assayed for tnfα levels using an elisa ( r & amp ; d systems ). this invention also encompasses pharmaceutical compositions containing and methods of treating or preventing comprising administering prodrugs of compounds of the formula i . compounds of formula i having free amino , amido , hydroxy or carboxylic groups can be converted into prodrugs . prodrugs include compounds wherein an amino acid residue , or a polypeptide chain of two or more ( e . g ., two , three or four ) amino acid residues which are covalently joined through peptide bonds to free amino , hydroxy or carboxylic acid groups of compounds of formula i . the amino acid residues include the 20 naturally occurring amino acids commonly designated by three letter symbols and also include , 4 - hydroxyproline , hydroxylysine , demosine , isodemosine , 3 - methylhistidine , norvalin , beta - alanine , gamma - aminobutyric acid , citrulline homocysteine , homoserine , ornithine and methionine sulfone . prodrugs also include compounds wherein carbonates , carbamates , amides and alkyl esters which are covalently bonded to the above substituents of formula i through the carbonyl carbon prodrug sidechain . the compositions of the present invention may be formulated in a conventional manner using one or more pharmaceutically acceptable carriers . thus , the active compounds of the invention may be formulated for oral , buccal , intranasal , parenteral ( e . g ., intravenous , intramuscular or subcutaneous ) or rectal administration or in a form suitable for administration by inhalation or insufflation . for oral administration , the pharmaceutical compositions may take the form of , for example , tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents ( e . g ., pregelatinized maize starch , polyvinylpyrrolidone or hydroxypropyl methylcellulose ); fillers ( e . g ., lactose , microcrystalline cellulose or calcium phosphate ); lubricants ( e . g ., magnesium stearate , talc or silica ); disintegrants ( e . g ., potato starch or sodium starch glycolate ); or wetting agents ( e . g ., sodium lauryl sulphate ). the tablets may be coated by methods well known in the art . liquid preparations for oral administration may take the form of , for example , solutions , syrups or suspensions , or they may be presented as a dry product for constitution with water or other suitable vehicle before use . such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents ( e . g ., sorbitol syrup , methyl cellulose or hydrogenated edible fats ); emulsifying agents ( e . g ., lecithin or acacia ); non - aqueous vehicles ( e . g ., almond oil , oily esters or ethyl alcohol ); and preservatives ( e . g ., methyl or propyl p - hydroxybenzoates or sorbic acid ). for buccal administration , the composition may take the form of tablets or lozenges formulated in conventional manner . the compounds of formula i can also be formulated for sustained delivery according to methods well known to those of ordinary skill in the art . examples of such formulations can be found in u . s . pat . nos . 3 , 538 , 214 , 4 , 060 , 598 , 4 , 173 , 626 , 3 , 119 , 742 , and 3 , 492 , 397 , which are herein incorporated by reference in their entirety . the active compounds of the invention may be formulated for parenteral administration by injection , including using conventional catheterization techniques or infusion . formulations for injection may be presented in unit dosage form , e . g ., in ampules or in multi - dose containers , with an added preservative . the compositions may take such forms as suspensions , solutions or emulsions in oily or aqueous vehicles , and may contain formulating agents such as suspending , stabilizing and / or dispersing agents . alternatively , the active ingredient may be in powder form for reconstitution with a suitable vehicle , e . g ., sterile pyrogen - free water , before use . the active compounds of the invention may also be formulated in rectal compositions such as suppositories or retention enemas , e . g ., containing conventional suppository bases such as cocoa butter or other glycerides . for intranasal administration or administration by inhalation , the active compounds of the invention are conveniently delivered in the form of a solution or suspension from a pump spray container that is squeezed or pumped by the patient or as an aerosol spray presentation from a pressurized container or a nebulizer , with the use of a suitable propellant , e . g ., dichlorodifluoromethane , trichlorofluoromethane , dichlorotetrafluoroethane , carbon dioxide or other suitable gas . in the case of a pressurized aerosol , the dosage unit may be determined by providing a valve to deliver a metered amount . the pressurized container or nebulizer may contain a solution or suspension of the active compound . capsules and cartridges ( made , for example , from gelatin ) for use in an inhaler or insufflator may be formulated containing a powder mix of a compound of the invention and a suitable powder base such as lactose or starch . a proposed dose of the active compounds of the invention for oral , parenteral or buccal administration to the average adult human for the treatment of the conditions referred to above ( e . g ., inflammation ) is 0 . 1 to 200 mg of the active ingredient per unit dose which could be administered , for example , 1 to 4 times per day . aerosol formulations for treatment of the conditions referred to above ( e . g ., adult respiratory distress syndrome ) in the average adult human are preferably arranged so that each metered dose or “ puff ” of aerosol contains 20 μg to 1000 μg of the compound of the invention . the overall daily dose with an aerosol will be within the range 100 μg to 10 mg . administration may be several times daily , for example 2 , 3 , 4 or 8 times , giving for example , 1 , 2 or 3 doses each time . aerosol combination formulations for treatment of the conditions referred to above in the average adult human are preferably arranged so that each metered dose or “ puff ” of aerosol contains from about 0 . 01 mg to about 100 mg of the active compound of this invention , preferably from about 1 mg to about 10 mg of such compound . administration may be several times daily , for example 2 , 3 , 4 or 8 times , giving for example , 1 , 2 or 3 doses each time . aerosol formulations for treatment of the conditions referred to above in the average adult human are preferably arranged so that each metered dose or “ puff ” of aerosol contains from about 0 . 01 mg to about 2000 mg of an map kinase inhibitor , preferably from about 1 mg to about 200 mg of p38 kinase inhibitor . administration may be several times daily , for example 2 , 3 , 4 or 8 times , giving for example , 1 , 2 or 3 doses each time . the following examples illustrate the preparation of the compounds of the present invention . melting points are uncorrected . nmr data are reported in parts per million ( 6 ) and are referenced to the deuterium lock signal from the sample solvent ( deuteriochloroform unless otherwise specified ). mass spectral data were obtained using a micromass zmd apci mass spectrometer equipped with a gilson gradient high performance liquid chromatograph . the following solvents and gradients were used for the analysis . solvent a ; 98 % water / 2 % acetonirile / 0 . 01 % formic acid and solvent b ; acetonitrile containing 0 . 005 % formic acid . typically , a gradient was run over a period of about 4 minutes starting at 95 % solvent a and ending with 100 % solvent b . the mass spectrum of the major eluting component was then obtained in positive or negative ion mode scanning a molecular weight range from 165 amu to 1100 amu . specific rotations were measured at room temperature using the sodium d line ( 589 nm ). commercial reagents were utilized without further purification . thf refers to tetrahydrofuran . dmf refers to n , n - dimethylformamide . chromatography refers to column chromatography performed using 32 - 63 mm silica gel and executed under nitrogen pressure ( flash chromatography ) conditions . room or ambient temperature refers to 20 - 25 ° c . all non - aqueous reactions were run under a nitrogen atmosphere for convenience and to maximize yields . concentration at reduced pressure means that a rotary evaporator was used . one of ordinary skill in the art will appreciate that in some cases , protecting groups may be required during preparation . after the target molecule is prepared , the protecting group can be removed by methods well known to those of ordinary skill in the art , such as described in greene and wuts , protective groups in organic synthesis , ( 2 nd ed ., john wiley & amp ; sons , 1991 ). a 12 l three - necked round - bottomed flask equipped with a mechanical stirrer and a condenser , connected on top with a nitrogen bubbler and a thermometer , was charged with 2 , 5 - dibromopyridine ( 442 g , 1 . 87 moles ), hydrazine hydrate ( 55 % wt ., 1057 ml , 18 . 7 moles ), poly ( ethylene glycol ) ( average mn about 300 , 1 . 87 l ), 2 - butanol ( 373 ml ) and water ( 1 . 87 l ). the mixture was heated at reflux for 29 hours . the heating source was removed and the mixture was stirred for an additional 20 hours . to the resulting slurry , cold water ( 2 . 2 l ) was added . the slurry was stirred for an additional 30 minutes and filtered . the cake was washed with cold water ( 3 × 200 ml ) and dried in a vacuum - oven ( 40 ° c .) for 48 hours . the title compound was obtained as off - white flakes ( 305 g , yield 87 %). gcms ( m / z ): 187 ( m +). h 1 nmr ( 400 mhz , cdcl 3 ): δ 8 . 14 ( d , j = 2 . 0 hz , 1h ), 7 . 55 ( dd , j = 8 . 7 / 2 . 0 hz , 1h ), 6 . 66 ( d , j = 8 . 7 hz , 1h ), 5 . 89 ( brs , 1h ), 3 . 65 ( brs , 2h ). a 500 ml three - necked round - bottomed flask equipped with a mechanical stirrer and a condenser , connected on top to a nitrogen bubbler and a thermometer , was charged with 5 - bromo - pyridin - 2 - yl - hydrazine ( 43 . 4 g , 0 . 231 moles ) and isobutyryl chloride ( 218 ml , 2 . 08 moles ). the mixture was gently refluxed for 3 hours . the heating source was then replaced with an ice - water bath and the slurry cooled to room temperature . hexane ( 220 ml ) was added and the slurry stirred at room temperature for 15 minutes and filtered . the cake was washed with hexane ( 3 × 70 ml ) and then dried in a vacuum - oven ( 35 ° c .) for 48 hours . the title compound was obtained as an off - white powder ( 58 . 96 g , yield 92 . 3 %). a 5 l three - necked round - bottomed flask , equipped with a mechanical stirrer and a thermometer , was charged with 6 - bromo - 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a ) pyridine hydrochloride ( 587 . 0 g , 2 . 12 moles ), water ( 1 . 2 l ) and dichloromethane ( 1 . 8 l ). the biphasic mixture was cooled to 5 to 10 ° c . using an ice - water bath . sodium hydroxide ( 1n aqueous solution ) ( 2 . 15 l ) was added over a period of 10 minutes . the mixture was stirred in the bath for 15 minutes . the organic layer was then isolated and the aqueous layer extracted with dichloromethane ( 600 ml ). the combined organic extracts are washed with 1 : 1 brine - water ( 2 l ) and dried ( mgso 4 ). most of dichloromethane was removed by rotary evaporation . ethyl acetate ( 800 ml ) was then added . after removing about 400 ml of solvents , hexane ( 3 . 2 l ) was added . the slurry was stirred in an ice - water bath for 2 hours and then filtered . the cake was washed with 9 : 1 hexane - ethyl acetate ( 3 × 150 ml ) and dried in a vacuum - oven ( 30 - 35 ° c .) for 18 hours . the title compound ( 471 . 6 g , yield 92 . 5 %), was obtained as a tan sandy powder . h 1 nmr ( 400 mhz , cdcl 3 ): δ 8 . 06 ( s , 1h ), 7 . 64 ( d , j = 9 . 5 hz , 1h ), 7 . 24 ( d , j = 9 . 5 hz , 1h ), 3 . 33 ( m , j = 7 . 0 hz , 1h ), 1 . 52 ( d , j = 7 . 0 hz , 6h ). a 12 l three - necked round - bottomed flask , equipped with a mechanical stirrer , an addition funnel and a thermometer , was charged with 6 - bromo - 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a ) pyridine ( 200 . 0 g , 0 . 833 moles ) and tetrahydrofuran ( j . t . baker , low water 2 . 0 l ). the solution was cooled to − 8 ° c . using an acetone / dry ice bath . a solution of isopropylmagnesium chloride in tetrahydrofuran ( 2 . 0m , 500 ml , 1 . 0 mole ) l ) was added via the addition funnel over a period of 55 minutes . the resulting brownish slurry was stirred between − 4 to 0 ° c . for 30 minutes . dimethylformamide ( aldrich , anhydrous , 155 ml , 2 . 0 moles ) was added via an addition funnel over a period of 5 minutes . the cooling bath was replaced with a heating mantle and the addition funnel was replaced with a condenser . the slurry was heated to 55 ° c . and stirred at this temperature for 2 hours . the reaction mixture was cooled to 15 ° c . and dichloromethane ( 3 l ) was added . the slurry was slowly poured into a stirred and ice - water cooled ( 15 ° c .) 10 % by weight aqueous solution of citric acid ( 3 kg ) over a period of 5 minutes . the biphasic mixture was stirred at 17 to 20 ° c . for 30 minutes . the organic layer was then isolated and the aqueous layer extracted with dichloromethane ( 5 × 1 l ). the combined organic extracts were washed with 1 : 1 v / v brine - water ( 2 l ), dried ( mgso 4 ) and concentrated . to the brownish residual solid was added ethyl acetate ( 800 ml ). the slurry was stirred at room temperature for 10 minutes at which time hexane ( 800 ml ) was added . the slurry was stirred at room temperature for 2 more hours and filtered . the cake was washed with 1 : 1 v / v hexane - ethyl acetate ( 3 × 150 ml ) and dried in a vacuum - oven ( 30 - 35 ° c .) for 18 hours . the title compound was obtained as a yellowish sandy powder ( 126 . 6 g , yield 80 %). gcms ( m / z ): 189 ( m +). h 1 nmr ( 400 mhz , cdcl 3 ): δ 10 . 00 ( s , 1h ), 8 . 49 ( s , 1h ), 7 . 79 ( d , j = 9 . 5 hz , 1h ), 7 . 68 ( d , j = 9 . 5 hz , 1h ), 3 . 47 ( m , j = 7 . 0 hz , 1h ), 1 . 56 ( d , j = 7 . 0 hz , 6h ). a 5 l three - necked round - bottomed flask , equipped with a mechanical stirrer and a thermometer , was charged with p - toluenesulfinic acid , sodium salt hydrate ( aldrich , ch 3 c 6 h 4 so 2 na . xh 2 o , 392 . 0 g ), tap water ( 2 l ) and methyl t - butyl ether ( 2 l ). the mixture was stirred at room temperature for 10 minutes at which time hydrochloric acid ( 37 % wt . in water , 142 ml , 1 . 2 moles ) was added over a period of 5 minutes . the biphasic mixture was stirred at room temperature for 30 minutes . the organic layer was then isolated and the aqueous layer extracted with methyl t - butyl ether ( 500 ml ). the combined organic extracts were concentrated to a residual white semi - solid , which was diluted with toluene ( 700 ml ). most of solvents were removed and hexane ( 1 . 8 l ) was then added . the slurry was stirred at room temperature for 30 minutes and filtered . the cake was washed with hexane ( 2 × 300 ml ) and dried in a vacuum - oven ( 30 - 35 ° c .) for 3 hours . the product , p - toluenesulfinic acid ( 240 . 0 g ,), was obtained as a white powder . a 5 l three - necked round - bottomed flask , equipped with a mechanical stirrer , a condenser and a thermometer , was charged with 2 , 5 - difluorobenzaldehyde ( 142 . 11 g , 1 mole ). toluene ( 500 ml ), acetonitrile ( 500 ml ), formamide ( 99 . 3 ml , 2 . 5 moles ) and chlorotrimethylsilane ( 139 . 6 ml , 1 . 1 moles ) were added respectively . the cloudy mixture was heated to 50 ° c . and stirred at this temperature for 7 hours . p - toluenesulfinic acid ( 218 . 68 g , 1 . 4 moles ) was added . the mixture was stirred at 50 ° c . for 6 hours and then 13 hours at room temperature . methyl t - butyl ether ( 1 . 8 l ) and water ( 1 . 7 l ) were then added . the mixture was stirred at room temperature for 15 minutes at which time the organic layer was separated . the aqueous layer was extracted with methyl t - butyl ether ( 500 ml ). most of the solvents were removed from the combined organic extracts . to the residual white semi - solid , hexane ( 1 l ) and water ( 1 l ) were added . the slurry was stirred at room temperature for 30 minutes and filtered . the cake was washed with hexane ( 2 × 200 ml ) and dried in a vacuum - oven ( 30 ° c .) for 18 hours . the product , n -[( 2 , 5 - difluoro - phenyl )-( toluene - 4 - sulfonyl )- methyl ]- formamide ( 258 . 3 g , yield 79 %,), was obtained as a white powder . a 5 l three - necked round - bottomed flask , equipped with a mechanical stirrer , an addition funnel and a thermometer , was charged with n -[( 2 , 5 - difluoro - phenyl )-( toluene - 4 - sulfonyl )- methyl ]- formamide ( 207 . 0 g , 0 . 636 moles ) and tetrahydrofuran ( j . t . baker , low water , 1 . 5 l ). phosphorous oxychloride ( 118 . 6 ml , 1 . 27 moles ) was quickly poured into the reaction mixture ( less than 5 minutes ). the mixture was stirred at room temperature for 10 minutes and then cooled to 4 ° c . using an ice / water bath . 2 , 6 - lutidine ( 445 ml , 3 . 82 moles ) was added via the addition funnel over a period of 30 minutes . the cooling bath was then removed and the mixture was stirred at room temperature for 18 hours . the reaction mixture was poured into a stirred and ice - water cooled solution of 1 . 5 kg of ice and 1 . 1 l of saturated aqueous sodium bicarbonate ( nahco 3 ). the mixture was then extracted with ethyl acetate ( 2 l plus 1 . 5 l ). the combined organic extracts were washed with 1 n aqueous hydrochloric acid ( 3 l ), saturated aqueous nahco 3 ( 3 l ) and brine ( 3 l ); and then dried ( mgso4 ). after removing all solvents , isopropanol ( 1 . 8 l ) was added to the residual brownish solid . the resulting slurry was stirred at room temperature for 2 hours . water ( 0 . 9 l ) was added and the slurry was stirred for additional 30 minutes at room temperature and then filtered . the cake was washed with 2 : 1 isopropanol - water ( 2 × 500 ml ) and dried in a vacuum - oven ( 30 ° c .) for 48 hours . the product , [ α -( p - toluenesulfonyl )- 2 , 5 - difluorobenzyl ] isonitrile ( 133 . 4 g , yield 68 %,), was obtained as a brownish powder . h 1 nmr ( 400 mhz , cdcl 3 ): δ , 7 . 7 ( d , j = 8 . 3 hz , 2h ) 7 . 41 ( d , j = 8 . 3 hz , 2h ), 7 . 18 ( m , 3h ), 5 . 91 ( s , 1h ), 2 . 50 ( s . 3h ). to a clean a dry nitrogen purged acetone boiled out 100 gallon glass lined reactor was charged , 7 . 9 kg of n -[( 2 , 5 - difluoro - phenyl )-( toluene - 4 - sulfonyl )- methyl ]- formamide ( 24 , moles ), 16 gallons of tetrahydrofuran and 7 . 8 kg of phosphorous oxychloride ( 51 moles ). the batch was allowed to stir at 20 ° c . for 30 minutes and then cooled to 3 . 5 ° c . to the batch was added 15 . 8 kg of 2 , 6 - lutidine ( 146 moles ) over 15 minutes . the reaction mixture was allowed to warm to 23 ° c . and was stirred for 17 hours at 23 ° c . the reaction was judged complete by hplc and was charged to a 40 gallon solution of 10 % sodium bicarbonate at 22 ° c ., and the contents were allowed to stir for 30 minutes . to the batch was then added 25 gallons of ethyl acetate and the layers were separated . the water layer was backwashed with 9 gallons of ethyl acetate and the product rich ethyl acetate combined with the first wash . the product rich ethyl acetate layers were added to a 10 % citric acid solution ( 20 gallons ) and then stirred . the organic layer was checked by hplc for 2 , 6 lutidine and then separated . the organic layer was washed with 10 gallons of saturated nacl and dried over 7 . 9 kg of magnesium sulfate . the drying agents were removed by filtration and the cake was washed with 4 gallons of ethyl acetate . the ethyl acetate layer was concentrated to 7 gallons under vacuum at an internal temperature of 24 ° c . the batch was then added to 11 gallons of ipo at 21 ° c . and allowed to granulate at 4 ° c . for 12 hours . the product was isolated via filtration and washed with 4 gallons of 5 ° c . ipo . the product was then dried at 34 ° c . for 22 hours with nitrogen bleed to recover 5 . 0 kg of the title compound ( 66 % yield ). to a clean dry 5 liter round bottomed flask equipped with a mechanical stirrer , nitrogen bubbler , heating mantle , temperature controller , and condenser , was charged 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a )- 6 - pyridinecarboxaldehyde ( 140 . 9 grams , 0 . 745 moles ), potassium carbonate ( 133 . 8 grams , 0 . 968 moles ), tosylmethyl isocyanide ( 146 . 9 grams , 0 . 745 moles ), and methanol ( 2114 ml ). this mixture was heated at reflux and stirred for 1 . 5 to 2 . 0 hours at 65 to 70 ° c . assay by hplc showed the reaction to be complete . the pot was concentrated atmospherically to about one third of original volume . water ( 1409 ml ), was added and the pot further concentrated to a pot temperature of 65 to 66 ° c . to remove the remaining methanol . after cooling , the desired product was extracted with methylene chloride ( 1409 ml ). the extraction was repeated twice with methylene chloride ( 2 times 705 ml ). the combined extracts were atmospherically concentrated and displaced with isopropyl alcohol ( 420 ml ). a thick slurry formed . hexanes ( 1690 ml ) were added and the slurry allowed to granulate for 12 to 16 hours at 20 to 25 ° c . the solids were collected by vacuum filtration , washed with hexanes , and dried to yield 111 . 45 grams , 97 . 8 % purity ( hplc ), 65 . 5 % of theory . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 23 ( s , 1h ), 7 . 98 ( s , 1h ), 7 . 82 ( d , 1h , j = 9 . 5 hz ), 7 . 46 - 7 . 43 ( m , 2h ), 3 . 43 ( sept , 1h , j = 7 . 05 hz ), 1 . 56 ( d , 6h , j = 7 . 05 hz ); ms 229 ( m + + 1 ). a clean , dry , 1 liter 4 neck round bottom flask equipped with mechanical stirrer , temperature probe , and purged with nitrogen , was charged with 6 -[ oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 45 . 2 grams 0 . 198 moles ) and dimethylformamide ( 271 ml ). the pot was cooled below − 60 ° c . with a dry ice / acetone bath . lithium bis ( trimethylsilyl ) amide , 1 molar solution in tetrahydrofuran ( 198 ml 0 . 198 moles ), was added , keeping the temperature below − 60 ° c . after the addition was complete , the pot was further cooled to below − 70 ° c . and stirred for 1 hour . while stirring , a solution of n - bromosuccinimide ( 35 . 24 g 0 . 198 moles ) and dimethylformamide ( 105 ml ), were stirred in a separate 500 ml round bottom flask under nitrogen . after the one hour stir at − 70 ° c ., the solution of n - bromosuccinimide and dimethylformamide was slowly added to the anion keeping the temperature below − 70 ° c . after the addition , the reaction was continued for one hour below − 70 ° c . the batch was then warmed to room temperature and quenched into methylene chloride ( 452 ml ) and 1n sodium hydroxide ( 452 ml ). the organic layer was then separated . the aqueous layer was extracted a second time with methylene chloride ( 135 ml ). the combined organic phase was washed with 1 n sodium hydroxide ( 452 ml ) and saturated brine solution ( 452 ml ). the organic phase was then dried over magnesium sulfate ( 50 grams ) and concentrated / displaced with isopropyl ether ( 226 ml ) to a temperature of 42 ° c . a thick slurry formed upon cooling . the solids were granulated at 20 to 25 ° c . for two hours , filtered , washed with isopropyl ether ( 50 ml ), and dried to afford 53 . 0 grams of light yellow solids , 96 . 4 % purity ( hplc ), 87 % of theory . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 56 ( s , 1h ), 7 . 95 ( s , 1h ), 7 . 85 ( d , 1h , j = 9 . 5 hz ), 7 . 77 ( d , 1h , j = 9 . 5 hz ), 3 . 43 ( sept , 1h , j = 7 . 05 hz ), 1 . 56 ( d , 6h , j = 7 . 05 hz ); ms : 310 , 309 , 308 , 307 ( m + + 1 ). a mixture of 2 , 5 - dibromopyridine ( 44 . 2 g , 0 . 187 moles ), hydrazine hydrate ( 55 % by weight , 105 . 7 ml , 1 . 87 mol ), poly ( ethylene glycol ) ( 187 . 0 ml ), 2 - butanol ( 37 . 3 ml ) and water ( 187 . 0 ml ) under nitrogen is refluxed gently for 29 hours . the mixture is then cooled and stirred for 20 hours . to the resulting slurry , cold water ( 220 ml ) is added . the slurry is stirred for an additional 30 minutes and filtered . the cake is washed with cold water ( 3 ×) and dried in a vacuum - oven ( 40 - 45 ° c .) for 48 hours . the title compound ( 30 . 5 g , 87 %) is obtained as off - white flakes . a mixture of 5 - bromo - pyridin - 2 - yl - hydrazine ( 4 . 34 g , 23 . 1 mmol ) and isobutyryl chloride ( 21 . 8 ml , 0 . 208 mol ) is refluxed gently for 3 hours . the mixture is then cooled to room temperature . hexane ( 22 . 0 ml ) is added and the resulting slurry stirred at room temperature for 15 minutes and filtered . the filtrate cake is washed with hexane ( 3 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 48 hours . the product ( 5 . 90 g , yield 92 . 3 %) may be obtained as an off - white powder . a biphasic mixture of the product ( 5 . 87 g , 21 . 2 mmol ), water ( 12 . 0 ml ) and dichloromethane ( 18 . 0 ml ) is cooled to 5 to 10 ° c . a 1n aqueous solution of naoh ( 21 . 5 ml ) is added over a period of 10 minutes . the mixture is stirred in the bath for 15 minutes . the organic layer is isolated and the aqueous layer extracted with dichloromethane ( 2 ×). the combined organic extracts are washed with 1 : 1 brine - water and dried ( mgso 4 ). most of the dichloromethane is removed in vacuo . ethyl acetate ( 8 . 0 ml ) is added . after removing about half of the solvent , hexane ( 32 . 0 ml ) is added . the slurry is stirred in an ice - water bath for 2 hours and filtered . the cake is washed with 9 : 1 hexane - ethyl acetate ( 3 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 18 hours . the title compound may be obtained as a sandy tan powder ( 4 . 72 g , 92 . 5 %). to a cooled (− 8 ° c .) solution of 6 - bromo - 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a ) pyridine ( 2 . 0 g , 8 . 33 mmol ) and tetrahydrofuran ( thf ) ( 20 . 0 ml ) is added a solution of isopropylmagnesium chloride in thf ( 2 . 0m , 5 . 0 ml , 10 . 0 mmol ) over 55 minutes , maintaining the temperature between − 8 to 0 ° c . the resulting brownish slurry is stirred between 4 to 0 ° c . for 30 minutes . n , n - dimethylformamide ( dmf ) ( 1 . 55 ml , 20 . 0 mmol ) is then added over 5 minutes , and the slurry heated to 55 ° c . for 2 hours . the reaction mixture is cooled to 15 ° c . and dichloromethane ( 30 . 0 ml ) added . the slurry is slowly poured into a stirring , cooled 10 % by weight aqueous solution of citric acid ( 30 . 0 g ) over a period of 5 minutes . the biphasic mixture is stirred at 17 to 20 ° c . for 30 minutes . the organic layer is separated and the aqueous layer extracted with dichloromethane ( 5 ×). the combined organic extracts are washed with 1 : 1 v / v brine - water ( 20 . 0 ml ), dried ( mgso 4 ) and concentrated to a brownish residual solid . ethyl acetate ( 8 . 0 ml ) is added , the slurry stirred at room temperature for 10 minutes and then hexane ( 8 . 0 ml ) is added . the slurry is stirred at room temperature for 2 hours and filtered . the cake is washed with 1 : 1 v / v hexane - ethyl acetate ( 3 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 18 hours . the title compound may be obtained as a yellowish sandy powder ( 1 . 27 g , 80 %). a mixture of p - toluenesulfinic acid , sodium salt hydrate ( 39 . 2 g ), water ( 200 . 0 . ml ) and methyl t - butyl ether ( mtbe , 200 . 0 ml ) is stirred at room temperature for 10 minutes , then hydrochloric acid ( 37 % wt . in water , 14 . 2 ml , 0 . 12 mol ) is poured in over a period of 5 minutes . the biphasic mixture is stirred at room temperature for 30 minutes . the layers are separated and the aqueous layer extracted with methyl - t - butyl - ether ( mtbe ) ( 50 . 0 ml ). the combined organic extracts are concentrated in vacuo ( bath temperature below 35 ° c .) to a white semi - solid . toluene ( 70 . 0 ml ) is added to the residual solid . most of solvents are removed and hexane ( 180 . 0 ml ) is added . the slurry is stirred at room temperature for 30 minutes and filtered . the cake is washed with hexane ( 2 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 3 hours . the product , p - toluenesulfinic acid may be obtained as a white powder ( 24 . 0 g ). to 2 , 6 - difluorobenzaldehyde ( 1 . 42 g , 10 . 0 mmol ) is added toluene ( 5 . 0 ml ), acetonitrile ( 5 . 0 ml ), formamide ( 0 . 993 ml , 25 . 0 mmol ) and chlorotrimethylsilane ( 1 . 40 ml , 11 . 0 mmol ) in order . the cloudy mixture is heated to 50 ° c . and stirred at this temperature for 7 hours . p - toluenesulfinic acid ( 2 . 19 g , 14 . 0 mmol ) is added , and the mixture stirred at 50 ° c . for 6 hours , then for 3 hours at room temperature . mtbe ( 18 . 0 ml ) and water ( 17 . 0 ml ) are added , and the mixture stirred at room temperature for 15 minutes . the layers are separated , and the aqueous layer extracted with mtbe ( 5 . 0 ml ). most of the solvents are removed from the combined organic extracts leaving a white semi - solid . to the residual is added hexane ( 10 . 0 ml ) and water ( 10 . 0 ml ), and the resulting slurry stirred at room temperature for 30 minutes , then filtered . the cake is washed with hexane ( 2 ×) and dried in a vacuum - oven ( 30 ° c .) for 18 hours . the title compound may be obtained as a white powder ( 2 . 58 g , 79 %). to a mixture of n -[( 2 , 6 - difluoro - phenyl )-( toluene - 4 - sulfonyl )- methyl ]- formamide ( 2 . 07 g , 6 . 36 mmol ) and thf ( 15 ml ) is added phosphorous oxychloride ( pocl 3 ) ( 1 . 19 ml , 12 . 7 mmol ) over a period of 5 minutes , and the resulting mixture stirred at room temperature for 10 minutes . the reaction is then cooled to 4 ° c . using an ice / water bath and 2 , 6 - lutidine ( 4 . 45 ml , 38 . 2 mmol ) is added over 30 minutes , maintaining the temperature less than 12 ° c . the cooling bath is removed and the mixture stirred at room temperature for 18 hours . the reaction mixture is poured into a stirred , ice water cooled solution of ice and saturated aqueous sodium bicarbonate ( nahco 3 ). the mixture is extracted with ethyl acetate ( 2 ×). the combined organic extracts are washed with 1n aqueous hydrochloric acid ( 30 . 0 ml ), saturated aqueous sodium bicarbonate ( nahco 3 ) ( 30 . 0 ml ), brine ( 30 . 0 ml ) and dried ( mgso 4 ). the solvents are removed in vacuo , and isopropanol ( 18 . 0 ml ) is added to the residual brownish solid . the resulting slurry is stirred at room temperature for 2 hours , then water is added and the slurry stirred for an additional 30 minutes at room temperature . the slurry is filtered , the cake washed with 2 : 1 isopropanol - water ( 2 ×) and dried in a vacuum - oven ( 30 ° c .) for 48 hours . the title compound may be obtained as a tan solid ( 1 . 33 g , 68 %). a mixture of [ α -( p - toluenesulfonyl )- 2 , 6 - difluorobenzyl ] isonitrile ( 1 . 79 g , 5 . 84 mmol ), 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a )- 6 - pyridinecarboxaldehyde ( 1 . 10 g , 5 . 84 mmol ), potassium carbonate ( 1 . 05 g , 7 . 59 mmol ) and acetonitrile ( 17 . 5 ml ) was refluxed for 22 hours . the reaction mixture was cooled to room temperature and poured into a stirred solution of ice water . the resulting slurry was stirred at room temperature for 2 hours and then filtered . the filtercake was washed with water ( 2 ×) and dried in a vacuum - oven ( 30 ° c .) for 48 hours to give crude compound as a brownish powder ( 1 . 8 g , 91 %). the crude compound ( 1 . 65 g ) was purified by silica gel chromatography . the title compound was obtained as a yellow solid ( 1 . 1 g , 61 %). %). lcms ( m / z ) 341 ( m + 1 ). 1 hnmr ( 400 mhz , cdcl 3 ) δ 8 . 18 ( s , 1h ), 8 . 12 ( s , 1h ), 7 . 89 ( d , 1h , j = 9 . 6 hz ), 7 . 46 - 7 . 51 ( m , 1h ), 7 . 37 ( d , 1h j = 9 . 6 hz ), 7 . 05 - 7 . 1 ( m , 2h ), 3 . 30 - 3 . 33 ( m , 1h ), 1 . 48 ( d , 6h , j = 7 . 1 hz ). this compound was prepared in an analogous manner to example 1 , starting with 2 , 5 - difluorobenzaldehyde in step e . lcms ( m / z ) 341 ( m + 1 ). h 1 nmr ( 400 mhz , cdcl 3 ) δ 8 . 15 ( s , 1h ), 8 . 10 ( s , 1h ), 7 . 79 ( d , 1h , j = 9 . 3 hz ), 7 . 43 - 7 . 46 ( m , 1h ), 7 . 32 ( d , 1h , j = 9 . 3 hz ), 7 . 15 - 7 . 18 ( m , 2h ), 3 . 31 - 3 . 36 ( m , 1h ), 1 . 52 ( d , 6h , j = 6 . 7 hz ). this compound was prepared in an analogous manner to example 1 , starting with trimethylacetyl chloride in step b and 2 , 5 - difluorobenzaldehyde in step e . lcms ( m / z ) 355 ( m + 1 ). this compound was prepared in an analogous manner to example 1 , starting with trimethylacetyl chloride in step b and 2 , 4 - difluorobenzaldehyde in step e . lcms ( m / z ) 355 ( m + 1 ). a mixture of 2 , 5 - dibromopyridine ( 44 . 2 g , 0 . 187 moles ), hydrazine hydrate ( 55 % by weight , 105 . 7 ml , 1 . 87 mol ), poly ( ethylene glycol ) ( 187 . 0 ml ), 2 - butanol ( 37 . 3 ml ) and water ( 187 . 0 ml ) under nitrogen is refluxed gently for 29 hours . the mixture is cooled and stirred for 20 hours . to the resulting slurry , cold water ( 220 . 0 ml ) is added . the slurry is stirred for an additional 30 minutes and filtered . the cake is washed with cold water ( 3 ×) and dried in a vacuum - oven ( 40 - 45 ° c .) for 48 hours . the title compound ( 30 . 5 g , 87 %) may be obtained as off - white flakes . a mixture of 5 - bromo - pyridin - 2 - yl - hydrazine ( 15 . 0 g , 79 . 8 mmol ) and cyclopropane carbonyl chloride ( 65 . 0 ml , 71 . 8 mmol ) is heated at 90 ° c . for 18 hours . the brown mixture is allowed to cool to room temperature , filtered , and washed with toluene to afford a light brown solid . this solid is taken up in chloroform ( chcl 3 ), and washed with saturated nahco 3 . the organic layer is isolated , and the aqueous layer extracted twice with chloroform ( chcl 3 ). the combined organics are washed with brine , dried over magnesium sulfate , and concentrated in vacuo to give the title compound as a tan solid ( 18 . 2 g , 96 %). to a cooled (− 10 ° c .) solution of 6 - bromo - 3 - cyclopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a ) pyridine ( 4 . 8 g , 20 . 0 mmol ) and thf ( 48 . 0 ml ) is added a solution of isopropylmagnesium chloride in thf ( 2 . 0m , 12 . 0 ml , 24 . 0 mmol ) dropwise , maintaining the temperature less than − 5 ° c . the resulting slurry is stirred between − 4 and 0 ° c . for 30 minutes . dmf ( 3 . 9 ml , 50 . 0 mmol ) is then added over 5 minutes . the reaction is then heated at 50 - 55 ° c . for 2 hours , then cooled to room temperature . the reaction is poured into a cold solution of 10 % citric acid . the reaction mixture is extracted with chcl 3 ( 3 ×). the combined organics are washed with brine , dried over magnesium sulfate , and concentrated in vacuo to a brownish solid ( 5 . 2 g ). silica gel chromatography , followed by ethyl acetate trituration yields the title compound as a yellow solid ( 1 . 8 g , 49 %). a mixture of p - toluenesulfinic acid , sodium salt hydrate ( 39 . 2 g ), water ( 200 . 0 ml ) and methyl t - butyl ether ( mtbe , 200 . 0 ml ) is stirred at room temperature for 10 minutes , then hydrochloric acid ( 37 % wt . in water , 14 . 2 ml , 0 . 12 mol ) is poured in over a period of 5 minutes . the biphasic mixture is stirred at room temperature for 30 minutes . the layers are separated and the aqueous layer extracted with mtbe ( 50 . 0 ml ). the combined organic extracts are concentrated in vacuo ( bath temperature below 35 ° c .) to a white semi - solid . toluene ( 70 . 0 ml ) is added to the residual solid . most of solvents are removed and hexane ( 180 . 0 ml ) is added . the slurry is stirred at room temperature for 30 minutes and filtered . the cake is washed with hexane ( 2 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 3 hours . the product , p - toluenesulfinic acid , may be obtained as a white powder ( 24 . 0 g ). to 2 , 4 - difluorobenzaldehyde ( 1 . 42 g , 10 . 0 mmol ) is added toluene ( 5 . 0 ml ), acetonitrile ( 5 . 0 ml ), formamide ( 0 . 993 ml , 25 . 0 mmol ) and chlorotrimethylsilane ( 1 . 40 ml , 11 . 0 mmol ) in order . the cloudy mixture is heated to 50 ° c . and stirred at this temperature for 7 hours . p - toluenesulfinic acid ( 2 . 19 g , 14 . 0 mmol ) is added , and the mixture stirred at 50 ° c . for 6 hours , then for 3 hours at room temperature . mtbe ( 18 . 0 ml ) and water ( 17 . 0 ml ) are added , and the mixture stirred at room temperature for 15 minutes . the layers are separated , and the aqueous layer extracted with mtbe ( 5 . 0 ml ). most of the solvents are removed from the combined organic extracts leaving a white semi - solid . to the residual is added hexane ( 10 . 0 ml ) and water ( 10 . 0 ml ), and the resulting slurry stirred at room temperature for 30 minutes , then filtered . the cake is washed with hexane ( 2 ×) and dried in a vacuum - oven ( 30 ° c .) for 18 hours . the title compound may be obtained as a white powder ( 2 . 58 g , 79 %). to a mixture of n -[( 2 , 4 - difluoro - phenyl )-( toluene - 4 - sulfonyl )- methyl ]- formamide ( 2 . 07 g , 6 . 36 mmol ) and thf ( 15 ml ) is added phosphorous oxychloride ( pocl 3 )( 1 . 19 ml , 12 . 7 mmol ) over a period of 5 minutes , and the resulting mixture stirred at room temperature for 10 minutes . the reaction is then cooled to 4 ° c . using an ice / water bath and 2 , 6 - lutidine ( 4 . 45 ml , 38 . 2 mmol ) is added over 30 minutes , maintaining the temperature less than 12 ° c . the cooling bath is removed and the mixture stirred at room temperature for 18 hours . the reaction mixture is poured into a stirred , ice water cooled , solution of ice and saturated aqueous nahco 3 . the mixture is extracted with ethyl acetate ( 2 ×). the combined organic extracts are washed with 1n aqueous hydrochloric acid , saturated aqueous nahco 3 , brine and dried ( mgso 4 ). the solvents are removed in vacuo , and isopropanol ( 18 . 0 ml ) added to the residual brownish solid . the resulting slurry is stirred at room temperature for 2 hours , then water ( 9 . 0 ml ) is added and the slurry stirred for an additional 30 minutes at room temperature . the slurry is filtered , the cake washed with 2 : 1 isopropanol - water ( 2 ×) and dried in a vacuum - oven ( 30 ° c .) for 48 hours . the title compound may be obtained as a tan solid ( 1 . 33 g , 68 %). a mixture of [ α -( p - toluenesulfonyl )- 2 , 4 - difluorobenzyl ] isonitrile ( 123 . 0 mg , 0 . 40 mmol ), 3 - cyclopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a )- 6 - pyridinecarboxaldehyde ( 75 . 0 mg , 0 . 40 mmol ), potassium carbonate ( 66 . 0 mg , 0 . 48 mmol ) and acetonitrile ( 2 . 0 ml ) was heated at 70 ° c . for 22 hours . the reaction mixture was cooled to room temperature and poured into ice water and brine . the aqueous layer was extracted with chcl 3 ( 3 ×). the combined organics were washed with brine , dried over magnesium sulfate , and concentrated in vacuo to a yellow solid . silica gel chromatography , followed by recrystallization ( ethyl acetate ) yielded a white solid ( 24 . 0 mg , 18 %). lcms ( m / z ) 339 ( m + 1 ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 34 ( s , 1h ), 8 . 06 ( s , 1h ), 7 . 77 ( d , 1h , j = 10 . 4 hz ), 7 . 63 - 7 . 69 ( m , 1h ), 7 . 28 - 7 . 32 ( m , 1h ), 7 . 03 - 7 . 08 ( m , 1h ), 6 . 91 - 6 . 96 ( m , 1h ), 1 . 96 - 2 . 03 ( m , 1h ), 1 . 15 - 1 . 24 ( m , 4h ). this compound was prepared in an analogous manner to example 5 starting with 2 , 5 - difluorobenzaldehyde in step e . lcms ( m / z ) 339 ( m + 1 ). this compound was prepared in an analogous manner to example 5 , staring with 1 - methylcyclopropane carbonyl chloride ( synthesized from commercial 1 - methylcyclopropane carboxylic acid ) in step b and 2 , 5 - difluorobenzalde in step e . lcms ( m / z ) 353 ( m + 1 ). this compound was prepared in an analogous manner to example 5 , starting with 1 - methylcyclopropane carbonyl chloride ( synthesized from commercial 1 - methylcyclopropane carboxylic acid ) in step b . lcms ( m / z ) 353 ( m + 1 ). this compound was prepared in an analogous manner to example 5 , starting with cyclobutane carbonyl chloride in step b and 2 , 5 - difluorobenzaldehyde in step e . lcms ( m / z ) 353 ( m + 1 ). a mixture of 2 , 5 - dibromopyridine ( 44 . 2 g , 0 . 187 moles ), hydrazine hydrate ( 55 % by weight , 105 . 7 ml , 1 . 87 mol ), poly ( ethylene glycol ) ( 187 . 0 ml ), 2 - butanol ( 37 . 3 ml ) and water ( 187 . 0 ml ) under nitrogen is refluxed gently for 29 hours . the mixture is cooled and stirred for 20 hours . to the resulting slurry , cold water ( 220 . 0 ml ) is added . the slurry is stirred for an additional 30 minutes and filtered . the cake is washed with cold water ( 3 ×) and dried in a vacuum - oven ( 40 - 45 ° c .) for 48 hours . the title compound ( 30 . 5 g , 87 %) may be obtained as off - white flakes . a mixture of 5 - bromo - pyridine - 2 - yl - hydrazine ( 4 . 34 g , 23 . 1 mmol ) and isobutyryl chloride ( 21 . 8 ml , 0 . 208 mol ) is refluxed gently for 3 hours . the mixture is cooled to room temperature . hexane ( 22 . 0 ml ) is added and the slurry is stirred at room temperature for 15 minutes and filtered . the cake is washed with hexane ( 3 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 48 hours . the product ( 5 . 90 g , yield 92 . 3 %) is obtained as an off - white powder . a biphasic mixture of the product ( 5 . 87 g , 21 . 2 mmol ), water ( 12 . 0 ml ) and dichloromethane ( 18 . 0 ml ) is cooled to 5 - 10 ° c . a 1n aqueous solution of naoh ( 21 . 5 ml ) is added over a period of 10 minutes . the mixture is stirred in the bath for 15 minutes . the organic layer is isolated and the aqueous layer extracted with dichloromethane ( 2 ×). the combined organic extracts are washed with 1 : 1 brine - water and dried ( mgso 4 ). most of the dichloromethane is removed in vacuo . ethyl acetate ( 8 . 0 ml ) is added . after removing about half of the solvents , hexane is added . the slurry is stirred in an ice - water bath for 2 hours and filtered . the cake is washed with 9 : 1 hexane - ethyl acetate ( 3 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 18 hours . the title compound may be obtained as a sandy tan powder ( 4 . 72 g , 92 . 5 %). to a cooled (− 8 ° c .) solution of 6 - bromo - 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a ) pyridine ( 2 . 0 g , 8 . 33 mmol ) and thf ( 20 . 0 ml ) is added a solution of isopropylmagnesium chloride in thf ( 2 . 0m , 5 . 0 ml , 10 . 0 mmol ) over 55 minutes , maintaining the temperature between − 8 to 0 ° c . the resulting brownish slurry is stirred between − 4 to 0 ° c . for 30 minutes . dmf ( 1 . 55 ml , 20 . 0 mmol ) is then added over 5 minutes , and the slurry heated to 55 ° c . for 2 hours . the reaction mixture is cooled to 15 ° c . and dichloromethane ( 30 . 0 ml ) added . the slurry is slowly poured into a stirring , cooled 10 percent by weight aqueous solution of citric acid ( 30 . 0 g ) over a period of 5 minutes . the biphasic mixture is stirred at 17 - 20 ° c . for 30 minutes . the organic layer is separated and the aqueous layer extracted with dichloromethane ( 5 ×). the combined organic extracts are washed with 1 : 1 volume / volume brine - water ( 20 . 0 ml ), dried ( mgso 4 ) and concentrated to a brownish residual solid . ethyl acetate ( 8 . 0 ml ) is added , the slurry stirred at room temperature for 10 minutes and then hexane ( 8 . 0 ml ) is added . the slurry is stirred at room temperature for 2 hours and filtered . the cake is washed with 1 : 1 v / v hexane - ethyl acetate ( 3 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 18 hours . the title compound may be obtained as a yellowish sandy powder ( 1 . 27 g , 80 %). a mixture of p - toluenesulfinic acid , sodium salt hydrate ( 39 . 2 g ), water ( 200 . 0 ml ) and methyl t - butyl ether ( mtbe , 200 . 0 ml ) is stirred at room temperature for 10 minutes , then hydrochloric acid ( 37 % weight in water , 14 . 2 ml , 0 . 12 mol ) is poured in over a period of 5 minutes . the biphasic mixture is stirred at room temperature for 30 minutes . the layers are separated and the aqueous layer extracted with methyl t - butyl ether ( mtbe ) ( 50 . 0 ml ). the combined organic extracts are concentrated in vacuo ( bath temperature below 35 ° c .) to a white semi - solid . toluene ( 70 . 0 ml ) is added to the residual solid . most of solvents are removed and hexane ( 180 . 0 ml ) is added . the slurry is stirred at room temperature for 30 minutes and filtered . the cake is washed with hexane ( 2 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 3 hours . the product , p - toluenesulfinic acid may be obtained as a white powder ( 24 . 0 g ). to 2 , 4 , 5 - trifluorobenzaldehyde ( 10 . 0 g , 62 . 4 mmol ) is added toluene ( 60 . 0 ml ), acetonitrile ( 60 . 0 ml ), formamide ( 6 . 2 ml , 156 . 2 mmol ) and chlorotrimethylsilane ( 8 . 8 ml , 68 . 8 mmol ) in order . the mixture is stirred at ambient temperature for 1 hour , then p - toluenesulfinic acid ( 14 . 6 g , 93 . 6 mmol ) is added , and the mixture stirred at 50 ° c . for 18 hours . the reaction is cooled to ambient temperature , then filtered . the filtrate is concentrated in vacuo to a yellow oil . silica gel chromatography yields the title compound as a white solid ( 13 . 77 g , 64 %). to a mixture of n -[( 2 , 4 , 5 - tifluoro - phenyl )-( toluene - 4 - sulfonyl )- methyl ]- formamide ( 13 . 7 g , 39 . 9 mmol ) and thf ( 140 . 0 ml ) is added pocl 3 ( 7 . 5 ml , 79 . 8 mmol ) over a period of 5 minutes , and the resulting mixture stirred at room temperature for 1 hour . the reaction is then cooled to 0 ° c . and 2 , 6 - lutidine ( 28 . 0 ml , 239 . 4 mmol ) is added over 30 minutes , maintaining the temperature less than 12 ° c . the cooling bath is removed and the mixture stirred at room temperature for 18 hours . the reaction mixture is poured into a stirred , ice water cooled solution of 10 % aqueous nahco 3 . the mixture is extracted with ethyl acetate ( 3 ×). the combined organic extracts are washed with 1n aqueous hydrochloric acid , saturated aqueous nahco 3 , brine and dried ( na 2 so 4 ). silica gel chromatography , followed by recrystallization from ethyl acetate / hexane yields the title compound as an orange solid ( 3 . 37 g , 26 %). a mixture of [ α -( p - toluenesulfonyl )- 2 , 4 , 5 - tifluorobenzyl ] isonitrile ( 172 . 0 mg , 0 . 528 mmol ), 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a )- 6 - pyridinecarboxaldehyde ( 100 . 0 mg , 0 . 528 mmol ), potassium carbonate ( 95 . 0 mg , 0 . 686 mmol ) and acetonitrile ( 2 . 0 ml ) was heated at 70 ° c . for 22 hours . the reaction mixture was cooled to room temperature and poured into water . the aqueous layer was extracted with chcl 3 ( 3 ×). the extracts were washed with brine , dried over sodium sulfate , filtered , and the filtrate concentrated in vacuo to a dark solid . silica gel chromatography afforded the title compound as a tan solid ( 90 . 0 mg , 48 %). lcms ( m / z ) 359 ( m + 1 ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 24 ( s , 1h ), 8 . 08 - 8 . 10 ( m , 2h ), 7 . 57 - 7 . 63 ( m , 1h ), 7 . 50 ( d , 1h , j = 9 . 6 hz ), 7 . 02 - 7 . 08 ( m , 1h ), 3 . 38 - 3 . 41 ( m , 1h ), 1 . 53 ( d , 6h , j = 6 . 7 hz ). this compound was prepared in an analogous manner to example 10 , starting with 2 , 3 , 4 - trifluorobenzaldehyde in step e . lcms ( m / z ) 359 ( m + 1 ). h 1 nmr ( 400 mhz , cdcl 3 ) δ 8 . 30 ( s , 1h ), 8 . 20 ( d , 1h , j = 7 . 8 hz ), 8 . 15 - 8 . 16 ( m , 1h ), 7 . 62 ( d , 1h , j = 7 . 8 hz ), 7 . 50 ( s , 1h ), 7 . 21 ( d , 1h , j = 7 . 3 hz ), 3 . 44 ( m , 1h , j = 6 . 7 hz ), 1 . 56 - 1 . 62 ( d , 6h ). this compound was prepared in an analogous manner to example 10 , starting with 2 , 3 , 5 - trifluorobenzaldehyde in step e . lcms ( m / z ) 359 ( m + 1 ). this compound was prepared in an analogous manner to example 10 , starting with 2 , 4 , 6 - trifluorobenzaldehyde in step e . lcms ( m / z ) 359 ( m + 1 ). this compound was prepared in an analogous manner to example 10 , starting with 3 , 4 , 5 - trifluorobenzaldehyde in step e . lcms ( m / z ) 359 ( m + 1 ). this compound was prepared in an analogous manner to example 10 , starting with trimethylacetyl chloride in step b . lcms ( m / z ) 373 ( m + 1 ). a mixture of 2 , 5 - dibromopyridine ( 44 . 2 g , 0 . 187 mol ), hydrazine hydrate ( 55 % by weight , 105 . 7 ml , 1 . 87 mol ), poly ( ethylene glycol ) ( 187 . 0 ml ), 2 - butanol ( 37 . 3 ml ) and water ( 187 . 0 ml ) under nitrogen was refluxed gently for 29 hours . the mixture was cooled and stirred for 20 hours . to the resulting slurry , cold water ( 220 . 0 ml ) was added . the slurry was stirred for an additional 30 minutes and filtered . the cake was washed with cold water ( 3 ×) and dried in a vacuum - oven ( 40 - 45 ° c .) for 48 hours . the title compound ( 30 . 5 g , 87 %) was obtained as off - white flakes . a mixture of 5 - bromo - pyridin - 2 - yl - hydrazine ( 15 . 0 g , 79 . 8 mmol ) and cyclopropane carbonyl chloride ( 65 ml , 71 . 8 mmol ) was heated at 90 ° c . for 18 hours . the brown mixture was allowed to cool to room temperature , filtered , and washed with toluene to afford a light brown solid . this solid was taken up in chcl 3 , and washed with saturated aqueous nahco 3 . the organic layer was isolated , and the aqueous layer extracted with chcl 3 ( 2 ×). the combined organics were washed with brine , dried over magnesium sulfate , and concentrated in vacuo to give the title compound as a tan solid ( 18 . 2 g , 96 %). to a cooled (− 10 ° c .) solution of 6 - bromo - 3 - cyclopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a ) pyridine ( 4 . 8 g , 20 . 0 mmol ) and thf ( 48 . 0 ml ) was added a solution of isopropylmagnesium chloride in thf ( 2 . 0m , 12 . 0 ml , 24 . 0 mmol ) dropwise , maintaining the temperature less than − 5 ° c . the resulting slurry was stirred between − 4 to 0 ° c . for 30 minutes . dmf ( 3 . 9 ml , 50 . 0 mmol ) was then added over 5 minutes . the reaction was then heated at 50 - 55 ° c . for 2 hours , then cooled to room temperature . the reaction was poured into a cold solution of 10 % citric acid . the reaction mixture was extracted with chcl 3 ( 3 ×). the combined organics were washed with brine , dried over magnesium sulfate , and concentrated in vacuo to a brownish solid ( 5 . 2 g ). silica gel chromatography , followed by ethyl acetate trituration yielded the title compound as a yellow solid ( 1 . 8 g , 49 %). a mixture of p - toluenesulfinic acid , sodium salt hydrate ( 39 . 2 g ), water ( 200 . 0 ml ) and methyl t - butyl ether ( mtbe , 200 . 0 ml ) was stirred at room temperature for 10 minutes , then hydrochloric acid ( 37 % wt . in water , 14 . 2 ml , 0 . 12 mol ) was poured in over a period of 5 minutes . the biphasic mixture was stirred at room temperature for 30 minutes . the layers were separated and the aqueous layer extracted with mtbe ( 50 . 0 ml ). the combined organic extracts were concentrated in vacuo ( bath temperature below 35 ° c .) to a white semi - solid . toluene ( 70 . 0 ml ) was added to the residual solid . most of solvents were removed and hexane ( 180 . 0 ml ) was added . the slurry was stirred at room temperature for 30 minutes and filtered . the cake was washed with hexane ( 2 ×) and dried in a vacuum - oven ( 30 - 35 ° c .) for 3 hours . the product , p - toluenesulfinic acid was obtained as a white powder ( 24 . 0 g ). to 2 , 4 , 5 - trifluorobenzaldehyde ( 10 . 0 g , 62 . 4 mmol ) was added toluene ( 60 . 0 ml ), acetonitrile ( 60 . 0 ml ), formamide ( 6 . 2 ml , 156 . 2 mmol ) and chlorotrimethylsilane ( 8 . 8 ml , 68 . 8 mmol ) in order . the mixture was stirred at ambient temperature for 1 hour , then p - toluenesulfinic acid ( 14 . 6 g , 93 . 6 mmol ) was added , and the mixture stirred at 50 ° c . for 18 hours . the reaction was cooled to ambient temperature , then filtered . the filtrate was concentrated in vacuo to a yellow oil . silica gel chromatography yielded the title compound as a white solid ( 13 . 77 g , 64 %). to a mixture of n -[( 2 , 4 , 5 - tifluoro - phenyl )-( toluene - 4 - sulfonyl )- methyl ]- formamide ( 13 . 7 g , 39 . 9 mmol ) and thf ( 140 . 0 ml ) was added pocl 3 ( 7 . 5 ml , 79 . 8 mmol ) over a period of 5 minutes , and the resulting mixture stirred at room temperature for 1 hour . the reaction was then cooled to 0 ° c . and 2 , 6 - lutidine ( 28 . 0 ml , 239 . 4 mmol ) was added over 30 minutes , maintaining the temperature less than 12 ° c . the cooling bath was removed and the mixture stirred at room temperature for 18 hours . the reaction mixture was poured into a stirred , ice water cooled solution of 10 % aqueous nahco 3 . the mixture was extracted with ethyl acetate ( 3 ×). the combined organic extracts were washed with 1 n aqueous hydrochloric acid , saturated aqueous nahco 3 , brine and dried ( na 2 so 4 ). silica gel chromatography , followed by recrystallization from ethyl acetate / hexane yielded the title compound as an orange solid ( 3 . 37 g , 26 %). a mixture of [ α -( p - toluenesulfonyl )- 2 , 4 , 5 - tifluorobenzyl ] isonitrile ( 130 . 0 mg , 0 . 40 mmol ), 3 - cyclopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a )- 6 - pyridinecarboxaldehyde ( 75 . 0 mg , 0 . 40 mmol ), potassium carbonate ( 66 . 0 mg , 0 . 48 mmol ) and acetonitrile ( 3 . 0 ml ) was heated at 70 ° c . for 22 hours . the reaction mixture was cooled to room , and poured into ice water . the reaction mixture was extracted with chcl 3 ( 3 ×). the combined organics were washed with brine , dried over magnesium sulfate , and concentrated in vacuo . silica gel chromatography , followed by recrystallization ( ethyl acetate / hexane ) yielded the title compound as a white solid ( 26 . 0 mg , 18 %). lcms ( m / z ) 357 ( m + 1 ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 37 ( s , 1h ), 8 . 07 ( d , 1h , j = 1 . 7 hz ), 7 . 81 ( d , 1h , j = 9 . 1 hz ), 7 . 53 - 7 . 59 ( m , 1h ), 7 . 29 ( d , 1h , j = 10 . 8 hz ), 7 . 02 - 7 . 08 ( m , 1h ), 2 . 02 - 2 . 06 ( m br , 1h ), 1 . 19 - 1 . 24 ( m , 4h ). this compound was prepared in an analogous manner to example 16 , starting with 1 - methylcyclopropane carbonyl chloride ( synthesized from commercial 1 - methylcyclopropane carboxylic acid ) in step b . lcms ( m / z ) 371 ( m + 1 ). a clean dry 5 liter round bottom flask equipped with mechanical stirring , nitrogen , heating mantle , temperature controller , and condenser , was charged with 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a )- 6 - pyridinecarboxaldehyde ( 140 . 9 gr , 0 . 745 moles ), potassium carbonate ( 133 . 8 gr , 0 . 968 moles ), tosylmethyl isocyanide ( 146 . 9 gr , 0 . 745 moles ), and methanol ( 2114 ml ). this mixture was heated to reflux and stirred for 1 . 5 to 2 . 0 hours at 65 to 70 ° c . assay by hplc showed the reaction to be complete . the pot was concentrated atmospherically to about one third of original volume . water ( 1409 ml ), was added and the pot further concentrated to a pot temperature of 65 to 66 ° c . to remove the remaining methanol . after cooling , the desired product was extracted with methylene chloride ( 1409 ml ). the aqueous layer was assayed and showed product . the extract was repeated twice with methylene chloride ( 2 x &# 39 ; s 705 ml ). the combined extracts were atmospherically concentrated and displaced with isopropyl alcohol ( 420 ml ). a thick slurry formed . hexanes ( 1690 ml ) were added and the slurry allowed to granulate for 12 to 16 hours at 20 to 25 ° c . the solids were collected by vacuum filtration washed with hexanes , and dried to yield 111 . 45 gr , 97 . 8 % purity ( hplc ), 65 . 5 % of theory . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 23 ( s , 1h ), 7 . 98 ( s , 1h ), 7 . 82 ( d , 1h , j = 9 . 5 hz ), 7 . 46 - 7 . 43 ( m , 2h ), 3 . 43 ( sept , 1h , j = 7 . 05 hz ), 1 . 56 ( d , 6h , j = 7 . 05 hz ); ms 229 ( m + + 1 ) a clean , dry , 1 liter 4 neck round bottom flask equipped with mechanical stirring , nitrogen , temperature probe , and a dry ice / acetone bath , was charged with the product from step a ( 45 . 2 gr 0 . 198 moles ) and n , n - dimethylformamide ( 271 ml ). the pot was cooled below − 60 ° c . and then lithium hexamethyldisilizane , 1 molar in tetrahydrofuran ( 198 ml 0 . 198 moles ), was added while keeping the temperature below − 60 ° c . after the addition was complete , the pot was further cooled to below − 70 ° c . and stirred for 1 hour . while stirring , a solution of n - bromosuccinimide ( 35 . 24 g 0 . 198 moles ) and n , n - dimethylformamide ( 105 ml ), were stirred in a separate 500 ml round bottomed flask under nitrogen . after the one hour stir at − 70 ° c ., the solution of n - bromosuccinimide and n , n - dimethylformamide was slowly added to the anion keeping the temperature below − 70 ° c . this temperature was critical to insure proper selectivity . after the addition was complete , the pot was stirred for one hour below − 70 ° c . the batch was warmed to room temperature and quenched into methylene chloride ( 452 ml ) and 1n sodium hydroxide ( 452 ml ). the extraction was repeated with a second aliquot of methylene chloride ( 135 ml ), and the combined organic layers washed with a second 1n sodium hydroxide ( 452 ml ) wash . the organic layer was washed with saturated brine solution ( 452 ml ), and dried over magnesium sulfate ( 50 gr ). the magnesium sulfate was filtered off , washed with methylene chloride ( 135 ml ) and the filtrate and wash combined for concentration . the methylene chloride was concentrated / displaced with isopropyl ether ( 226 ml ) to a temperature of 42 ° c . a thick slurry formed upon cooling . the solids were granulated at 20 to 25 ° c . for two hours , filtered , washed with isopropyl ether ( 50 ml ), and dried to afford 53 . 0 gr of light yellow solids , 96 . 4 % purity ( hplc ), 87 % of theory . 1 h nmr ( cdcl 3 , 400 mhz ) δ 8 . 56 ( s , 1h ), 7 . 95 ( s , 1h ), 7 . 85 ( d , 1h , j = 9 . 5 hz ), 7 . 77 ( d , 1h , j = 9 . 5 hz ), 3 . 43 ( sept , 1h , j = 7 . 05 hz ), 1 . 56 ( d , 6h , j = 7 . 05 hz ); ms : 310 , 309 , 308 , 307 ( m + + 1 ). the product from step b ( 33 . 0 gr , 0 . 107 moles ), difluorophenylboronic acid ( 25 . 34 gr , 0 . 1605 moles ), tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 12 . 36 gr , 0 . 0107 moles ), triethylamine ( 22 . 37 ml , 0 . 1605 moles ), 2b ethanol ( 495 ml ) and water ( 33 ml ), were added to a 2 liter 4 neck round bottom flask equipped with mechanical stirring , nitrogen , heating mantle , temperature controller , and a condenser . the batch was stirred while heating to 65 to 70 ° c . and then left to stir overnight at 70 ° c . in the morning , the reaction sample showed some starting material remaining by hplc . difluorophenylboronic acid ( 8 . 5 gr , 0 . 054 moles ), and triethylamine ( 7 . 53 ml , 0 . 054 moles ), were added and the reaction was allowed to proceed overnight at 70 ° c . in the morning , the reaction sample showed still some starting material remaining by hplc . difluorophenylboronic acid ( 8 . 5 gr , 0 . 054 moles ), and triethylamine ( 7 . 53 ml , 0 . 054 moles ), were added and the reaction was allowed to proceed overnight once again at 70 ° c . in the morning , the reaction sample showed still starting material remaining by hplc . toluene ( 30 ml ), was added and the reaction was allowed to go overnight once again at 70 ° c . in the morning , the reaction sample showed no more starting material by hplc . water ( 495 ml ) was added to the batch and the pot granulated for 4 hours at 20 to 25 ° c . the solids were collected by vacuum filtration , washed with 2b ethanol / water 50 : 50 ( 25 ml of each ), and dried in a vacuum oven at 45 ° c . for 4 hours under full vacuum to afford . 14 . 4 gr of crude product , ( 40 . 6 % yield , 93 . 4 % purity by hplc ). crude product ( 5 . 0 gr ), darco ® g - 60 carbon ( 500 mg ), and isopropyl alcohol ( 30 ml ), were heated to 80 ° c . in a single neck 100 ml round bottom flask . the solution was allowed to cool to 60 ° c . and filtered over filter - aid ® to remove the carbon . the cake was washed with isopropyl alcohol ( 30 ml ), then allowed to further cool to 20 to 25 ° c . and granulate overnight . the solids were collected by vacuum filtration , washed with isopropyl alcohol ( 10 ml ), and dried to afford 4 . 2 gr of the title compound , 98 . 8 % purity ( hplc ), 84 % yield . product ( 3 . 4 gr ), and acetone ( 41 ml ) were heated to 50 to 55 ° c . until a clear golden solution was achieved . the heat was removed and allowed to cool and granulate overnight at 20 to 25 ° c . the solids were collected by vacuum filtration , washed with acetone ( 7 ml ), and dried to afford 2 . 38 grams of crystal form b , 99 . 6 % purity ( hplc ), 70 % yield . ( melting point 174 - 175 ° c . at a heating rate of 5 ° c . per minute ). a 5 l three - necked round - bottomed flask , equipped with a mechanical stirrer , a condenser and a thermometer , was charged with [ α -( p - toluenesulfonyl )- 2 , 5 - difluorobenzyl ] isonitrile ( 179 . 4 g , 0 . 584 moles ), 3 - isopropyl -[ 1 , 2 , 4 ] triazolo ( 4 , 3 - a )- 6 - pyridinecarboxaldehyde ( 110 . 46 g , 0 . 584 moles ), potassium carbonate ( aldrich , & lt ; 325 mesh , 104 . 88 g , 0 . 759 moles ) and acetonitrile ( 1 . 75 l ). the mixture was heated at reflux and stirred for 22 hours . the reaction mixture was then cooled to room temperature and poured into a stirred solution of 2 kg of ice and 5 kg of water . the resulting slurry was stirred at room temperature for 2 hours and filtered . the brownish solid was washed with water ( 2 × 500 ml ) and dried in a vacuum - oven ( 30 ° c .) for 48 hours . the crude product ( 180 g ) was purified over a silica gel column ( 1 . 1 kg ) and eluted with 1 : 1 ethyl acetate - hexane ( to remove less polar impurities ), ethyl acetate and finally 20 : 1 ethyl acetate - methanol . the fractions containing mainly the product were combined and concentrated to small volume ( about 600 ml ). the resulting slurry was filtered . the cake was washed with ethyl acetate and dried in a vacuum - oven ( 30 ° c .) for 18 hours . the light brownish powder ( 142 g ) was further purified by recrystallization from isopropanol ( 800 ml ). 6 -[ 4 -( 2 , 6 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine was obtained as a light - tan powder ( 142 . 1 g , yield 61 %). melting point 175 . 7 - 176 . 2 ° c . elemental analysis , found : c 63 . 54 %, h 4 . 08 %, n 16 . 56 ; analytical calculated for : c 63 . 52 %, h 4 . 15 %, n 16 . 46 %. lcms ( m / z ): 341 ( m + 1 ). 1 hnmr ( 400 mhz , cdcl 3 ): δ 8 . 18 ( s , 1h ), 8 . 12 ( s , 1h ), 7 . 89 ( d , 1h , j = 9 . 6 hz ), 7 . 46 - 7 . 51 ( m , 1h ), 7 . 37 ( d , 1h j = 9 . 6 hz ), 7 . 05 - 7 . 1 ( m , 2h ), 3 . 30 - 3 . 33 ( m , 1h ), 1 . 48 ( d , 6h , j = 7 . 1 hz ). crude 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 5 . 0 g ) was dissolved in isopropanol ( 40 ml ). hydrochloric acid ( 13 . 3 % weight ) in isopropanol ( 4 . 4 g ) was added . the resulting slurry was stirred at room temperature for 30 minutes and filtered . the cake was washed with isopropanol and dried in a vacuum oven ( 80 ° c .) for 2 hours . 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine hydrogen chloride was obtained as an off - white solid ( 2 . 8 g , yield 50 %). 1 hnmr ( 400 mhz , cdcl 3 ): δ 8 . 49 ( d , j = 9 . 5 hz , 1h ), 8 . 38 ( s , 1h ), 8 . 16 ( s , 1h ), 7 . 90 ( d , j = 9 . 5 hz , 1h ), 7 . 49 - 7 . 53 ( m , 1h ), 7 . 13 - 7 . 23 ( m , 2h ), 3 . 43 - 3 . 50 ( m , 1h ), 1 . 55 ( d , j = 7 . 1 hz , 6h ). 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 5 . 10 g , 15 mmol ) was dissolved in isopropanol ( 25 ml ). a solution of methanesulfonic acid ( 1 . 44 g , 15 mmol ) in isopropanol ( 15 ml ) was added . the resulting slurry was stirred at room temperature for 3 hours and filtered . the cake was washed with isopropanol and dried in a vacuum oven ( 80 ° c .) for 4 hours . 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine methanesulfonate was obtained as an off - white powder ( 6 . 03 g , yield 92 %). 1 hnmr ( 400 mhz , cdcl 3 ): δ 8 . 67 ( d , j = 9 . 5 hz , 1h ), 8 . 38 ( s , 1h ), 8 . 15 ( s , 1h ), 7 . 83 ( d , j = 9 . 5 hz , 1h ), 7 . 46 - 7 . 50 ( m , 1h ), 7 . 13 - 7 . 22 ( m , 2h ), 3 . 44 - 3 . 51 ( m , 1h ), 2 . 86 ( s , 3h ), 1 . 54 ( d , j = 7 . 1 hz , 6h ). to 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 5 . 0 g , 15 mmol ) slurried in acetone ( 50 ml ) was added p - toluenesulfonic acid ( 2 . 7 g , 15 mmol ). the resulting slurry was heated to 50 ° c . to form a solution and was then cooled and stirred at room temperature for 12 hours and filtered . 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine p - toluenesulfonate was obtained . to 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 5 . 0 g , 15 mmol ) slurried in acetone ( 50 ml ) was added sulfuric acid ( 850 μl ). the resulting slurry was heated to reflux to form a solution and was then cooled and stirred at room temperature for 12 hours and filtered to yield 4 . 2 grams of 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine p - toluenesulfonate . 6 -[ 4 - bromo - oxazol - 5 - yl ]- 3 - isopropyl -[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 33 . 0 grams , 0 . 107 moles ), difluorophenylboronic acid ( 25 . 34 grams , 0 . 1605 moles ), pd ( pph 3 ) 4 ( 12 . 36 grams , 0 . 0107 moles ), triethylamine ( 22 . 37 ml , 0 . 1605 moles ), 2b ethanol ( 495 ml ) and water ( 33 ml ), were added to a 2 liter 4 neck round bottom flask ( equipped with mechanical stirring , nitrogen , heating mantle , temperature controller , and a condenser ). the batch was stirred while heating to 65 to 70 ° c . the reaction was stirred overnight at about 70 ° c . additional difluorophenylboronic acid ( 8 . 5 grams , 0 . 054 moles ) and triethylamine ( 7 . 53 ml , 0 . 054 moles ), were added and the reaction was allowed to proceed overnight at 70 ° c . additional difluorophenylboronic acid ( 8 . 5 grams , 0 . 054 moles ) and triethylamine ( 7 . 53 ml , 0 . 054 moles ), were added and the reaction was allowed to proceed overnight once again at 70 ° c . toluene ( 30 ml ) was added and the reaction was allowed to go overnight once again at 70 ° c . the reaction sample showed no more starting material by hplc . water ( 495 ml ) was added to the batch and the pot granulated for 4 hours at 20 to 25 ° c . the solids were collected by vacuum filtration , washed with 2b ethanol / water 50 : 50 ( 25 ml of each ), and dried in a vacuum oven at 45 ° c . for 4 hours under full vacuum to afford 14 . 4 grams of the title compound ( 40 . 6 % yield , 93 . 4 % purity by hplc ). crude 3 - isopropyl - 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]-[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 5 . 0 grams ), darco g - 60 carbon ( 500 mg ), and isopropyl alcohol ( 30 ml ), were heated to 80 ° c . in a single neck 100 ml round bottom flask . the solution was allowed to cool to 60 ° c . and filtered over filter - aid ® to remove carbon . the cake was washed with isopropyl alcohol ( 30 ml ), then allowed to further cool to 20 to 25 ° c . and granulate overnight . the solids were collected by vacuum filtration , washed with isopropyl alcohol ( 10 ml ), and dried to afford 4 . 2 grams of the title compound , 98 . 8 % purity ( hplc ), 84 % yield . 3 - isopropyl - 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]-[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 37 . 0 grams ), triturated in 1 : 1 ethyl acetate / hexane ( 300 ml ) at 20 to 23 ° c . the suspension was filtered and the cake washed with 1 : 1 ethyl acetate / hexane and dried in a vacuum oven at 40 ° c . for 48 hours to afford 37 . 0 grams of crystal form a . pure 3 - isopropyl - 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]-[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 3 . 4 grams ), and acetone ( 41 ml ) were heated to 50 to 55 ° c . until a clear golden solution was achieved . the heat was removed and the solution was allowed to cool , ( approximately 35 to 40 ° c . ), and granulate overnight at 20 to 25 ° c . the solids were collected by vacuum filtration , washed with acetone ( 7 ml ), and dried to afford 2 . 38 grams of crystal form b , 99 . 6 % purity ( hplc ), 70 % yield . peak underlined were not listed in the experimental pattern because either it has low intensity of less than 4 % or unresolved within ± 0 . 2 ° 2 theta . form c was also produced as either pure form c or as a mixed pattern from both fast and slow evaporations in ethyl acetate and ipa , fast evaporations in and toluene , and slow evaporations in chloroform , dichloromethane , ipa , mek , and 95 : 5 ( v / v ) ipa / water . 3 - isopropyl - 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]-[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 300 mg ), was suspended in 10 ml of 0 . 1 % methyl cellulose for 12 hours at 20 to 25 ° c . the solids were collected by vacuum filtration , and air dried for four hours to afford 300 mg of crystal form d . form d was also obtained a slurry in water , 1 : 1 ( v / v ) methanol / water , and 9 : 1 ( v / v ) acetonitrile / water at ambient and 60 ° c . or methylcellulose suspension . it is a unstable hydrate , a dihydrate by powder sample (− 10 % water by weight ) and a trihydrate ( 14 . 7 % water by weight ) by single crystal data . since dehydration occurs between 30 to 70 ° c ., drying or standing at ambient condition may cause partial decomposition . peak underlined were not listed in the experimental pattern because either it has low intensity of less than 1 % or unresolved within ± 0 . 2 ° 2 theta . 3 - isopropyl - 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]-[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine ( 39 grams ), and ethanol ( 3 . 2 ml ) were sonicated at 20 to 23 ° c . until a clear golden solution was achieved . the solution was filtered through a 0 . 2 micron filter . after slow evaporation ( 6 days ) to dryness , crystal form e ( 39 mg ) was produced . form e has been identified from xrpd analysis of 95 : 5 ( v / v ) ipa / water slow cool and fast evaporations , an ipa / water slow cool and from an ethanol slow evaporation . it is a monohydrate that dehydrates between 75 to 100 ° c . and convert to form b upon dehydration . 3 - isopropyl - 6 -[ 4 -( 2 , 5 - difluoro - phenyl )- oxazol - 5 - yl ]-[ 1 , 2 , 4 ] triazolo [ 4 , 3 - a ] pyridine , lactose , and cornstarch ( for mix ) are blended to uniformity . the cornstarch ( for paste ) is suspended in 200 ml of water and heated with stirring to form a paste . the paste is used to granulate the mixed powders . the wet granules are passed through a no . 8 hand screen and dried at 80 ° c . the dry granules are lubricated with the 1 % magnesium stearate and pressed into a tablet . such tablets can be administered to a human from one to four times a day for inhibiting cartilage damage or treating osteoarthritis . | 2 |
it is noted that like numerals are used to denote like features throughout the figures . the applicant has recently proposed a new engine control system and method ( see european patent application : 08168714 . 7 ) which utilises in - cylinder pressure measurements to provide pressure readings which are subsequently used to control engine operation . fig3 shows a representation of an engine system 10 according to ep application : 08168714 . 7 in which in - cylinder pressure measurements from cylinder pressure sensors ( indicated generally as feature 50 ) are fed ( arrow 52 ) into the vehicle &# 39 ; s engine control unit 38 . the control method in accordance with the control system is generally represented by the “ high level ” algorithm box 54 , the output of which are injection control variables 56 which are sent to the engine &# 39 ; s injectors 20 , 22 , 24 , 26 . prior to the sensor output 52 being used by the high level algorithm 54 , a “ low level ” algorithm 58 cleans up the sensor data and calculates a number of combustion parameters which are then used by the high level algorithm 54 . in order to reduce the calculation load on the ecu and to enable the engine model 54 to calculate injection control variables sufficiently quickly at all engine speeds the in - cylinder pressure measurements may conveniently be over - sampled . within the low level algorithm 58 therefore the oversampled output of the sensors 50 is filtered by a filtering module 60 to produce a raw cylinder pressure array 62 . the raw array 62 may then be passed to a scaling and diagnostic module 64 which performs pressure measurement pegging and other scaling functions in order to output a corrected pressure array 66 . it is noted that the applicant &# 39 ; s patent application ep1936157 describes a pressure pegging method that may be utilised here . the corrected pressure array 66 is then sent to a combustion parameters calculation module 68 which calculates a number of combustion parameters as described below which may then be used by the control method of an embodiment of the present invention . parameters calculated in the module 68 may comprise : the indicated mean effective pressure ( imep ) in bar ( it is noted that the indicated engine torque = imep engine × swept volume ( a constant )); ca50 %, the cumulative heat release rate ( hrr ); peak pressure and location of peak pressure ; the pressure derivative with respect to crank angle , dp / dα , for combustion noise calculations ( in particular the max dp / dα and location of this maximum may be calculated ). the control method in accordance with control system described therein is , as noted above , generally represented by the “ high level ” algorithm box 54 . the control method provides a mechanism for determining fuel quantities via a torque model 70 and for determining injection timings via a combustion centre position model 72 . both models predict injection parameters with reference to one or more mathematical functions ( as described below ). in order to maintain the accuracy of the various engine models 70 , 72 model coefficients 74 are adjusted with reference to actual measured engine parameters . the adjusted model coefficients are permanently stored within the non - volatile memory of the ecu 38 . the inventors of the present invention have realised that , in systems such as the one described above , the presence of in - cylinder pressure measurements provides a mechanism by which the cam sensor can be removed from the control system and its function replaced by the in - cylinder pressure signals . the present invention may be used with single cylinder measurements to achieve the same or similar performance of a single target cam signal or may be used with multi - cylinder individual measurements to enhance engine cold stars by reducing synchronisation times ( with only one sensor , pressure signal acts as a single target cam profile with one compression per engine cycle . with multiple sensors there are as many compressions as sensors per engine cycle . this means that for a 4 cylinders engine with 4 pressure sensors it is equivalent to a 4 targets cam sensor ). fig4 shows a representation of an engine system 90 suitable for use with embodiments of the present invention . like numerals have been used to denote like features with reference to fig1 . it can now be seen that there is no cam sensor . each cylinder now additionally comprises a pressure sensor 100 , 102 , 104 , 106 arranged to return a pressure signal to the ecu 38 . the ecu ( or a module or microcontroller 108 within the ecu ) monitors the received pressure signals from the cylinders ( 1 , 2 , 3 , 4 ) and determines whether a given cylinder meets ignition or injection thresholds . fig4 therefore also shows a monitoring module 109 and processor 110 ( for clarity the monitoring module and processor 109 , 110 are only shown located within the ecu 38 . in the event that the present invention is embodied within a module / microcontroller 108 then the monitoring module and processor would also or alternatively be located within the module 108 ). once the ecu or module has determined that a cylinder is ready for injection / ignition then the processor 110 may be arranged to phase the injection / ignition accordingly . fig4 additionally depicts a common rail 111 and a rail sensor 112 . the rail sensor 112 outputs a fuel pressure signal to the ecu 38 for use in determining cylinder readiness for injection or ignition . fig5 is a flow chart representing a method of determining cylinder readiness for injection / ignition in accordance with an embodiment of the present invention . in step 120 , the engine is cranked ( engine start up ). in step 122 , the in - cylinder pressure sensors ( 100 , 102 , 104 , 106 ) supply pressure readings to the ecu 38 ( or processing module / microcontroller 108 ) at time t . in step 124 , a first determining step is performed by the ecu 38 ( module / microcontroller 108 / processor 110 ) to determine the phasing of the cylinders ( 1 , 2 , 3 , 4 ) within the engine 10 . this step is a synchronisation step ( a stroke recognition step ) and replaces the function provided by the cam sensor ( 36 ) signal in prior art systems . in step 124 , the ecu 38 calculates the rate of change of cylinder pressure with respect to time ( or crank angle ). the present invention uses cylinder pressures to determine engine synchronisation . in the presently described embodiment , during cranking , the pressure signal acquisition is time based ( i . e . pressure signals are acquired at time intervals dt ). it is noted that dt is chosen to be sufficiently large that incorrect detection due to the effects of noise in the engine system is avoided . in other applications and embodiments it is recognised that it is possible to directly use crank angle (⊖) instead of time ( t ). if , for a given cylinder n , dpgas / dt is greater than a threshold value ( τ ), cylinder n is flagged as ready for ignition / injection . in other words the ecu 38 has determined that cylinder n is in its compression stroke . if the rate of change of pressure with time ( or crank angle ) exceeds the threshold the ecu moves onto step 126 . if the threshold value is not met then the ecu cycles back to the monitoring step 122 . in step 126 , a second determining step is performed on cylinder n to determine if the rail pressure ( received from the rail sensor 112 ) exceeds a minimum pressure value ( prmin ) required for engine operation ( the step represents a hydraulic check ). if the prmin threshold is not met the ecu 38 returns to step 124 . if the threshold value is exceeded then the ecu moves to a thermodynamic check of cylinder n in step 128 . in a third determining step ( a thermodynamic check ) in step 128 , the ecu checks to see if the in - cylinder pressure ( pgas ) exceeds a threshold value ( pgmin ). if the threshold value is exceeded then the ecu injects into cylinder n ( in step 130 ). if the threshold value is not met ( i . e . if pgas & lt ; pgmin ) then no injection takes place since pgas is insufficient to burn fuel and the ecu returns to step 124 and waits for the next acquisition of pressure values at time = t + dt . it is noted that the ecu initially monitors all cylinders in step 124 . the first cylinder for which dpgas / dt exceeds the threshold τ activates the engine synchronisation process in accordance with embodiments of the present invention . the synchronisation process stays active until the engine state is switched from “ cranking ” to “ running ” ( when idle speed is reached ). fig6 shows a trace of in - cylinder gas pressure over time for an engine operating according to the method of the present invention . it can be seen that the start time has been reduced compared to the example of fig2 by ordering the injection in the first cylinder ( first tdc is now cylinder 2 ) when the gas conditions are favourable by virtue of cylinder pressure measurement . fig6 shows the engine rpm and pressure traces for cylinders 2 , 1 , 3 and 4 . it can be seen that once the compression of cylinder 2 has been detected that injection is scheduled on that cylinder . it will be understood that the embodiments described above are given by way of example only and are not intended to limit the invention , the scope of which is defined in the appended claims . it will also be understood that the embodiments described may be used individually or in combination . | 5 |
a better understanding of various features and advantages of the present methods and devices may be obtained by reference to the following detailed description of illustrative embodiments of the invention and accompanying drawings , in which like numerals designate like elements . although these drawings depict embodiments of the contemplated methods and devices , they should not be construed as foreclosing alternative or equivalent embodiments apparent to those of ordinary skill in the subject art . referring to the drawings , and initially to fig1 , in one embodiment of a card holder and reader system according to an embodiment of the present invention , a smartcard 905 is inserted in use into a smartcard holder 904 to form a smartcard unit . the holder 904 is provided with a lanyard 927 by which the user can wear the holder 904 , with the smartcard 905 , round his or her neck . the smartcard 905 may then serve as a visible id badge , and / or may be used as an access card for , for example , unlocking doors with card readers . a smartcard reader 906 is connected to a computer 901 by a communication cable 902 with a computer connector 912 to form a computer unit . to establish communication between smartcard 905 and computer 901 , the computer unit is connected to the smartcard unit by attaching the smartcard reader 906 to the smartcard holder 904 . embodiments of smartcard readers 906 , holders 904 , and smartcards 905 , and their interactions , will be described below with reference to further figures of the drawings . the computer 901 is provided with a cpu , read only memory ( rom ), random access memory ( ram ), non - volatile storage including fixed and removable disk drives , user interfaces such as a keyboard and monitor , and external communications ports such as data port 949 . all of those features may be conventional and , in the interests of conciseness , are not described herein in more detail . referring now to fig2 , in an alternative embodiment , a smartcard 954 on an id reel 927 forms the smartcard unit . a smartcard reader 946 connected to a computer 901 by a communication cable 902 forms the computer unit . to establish communication between the smartcard 954 and the computer 901 , the smartcard unit is connected to the computer unit by attaching or inserting the smartcard 954 to the smartcard reader 946 . the smartcard reader 946 may be as shown in more detail in fig6 , described below . referring now to fig3 , in an alternative embodiment , a smartcard 905 inserted into a smartcard holder 956 with a lanyard 927 comprises the smartcard unit . a smartcard reader or tether holder 951 is connected by a communication cable 902 to a replication tether 937 , described in more detail below with reference to fig7 . the replication tether 937 mimics the physical shape and properties of a smartcard , and is inserted into a conventional desktop smartcard reader 938 connected to a computer 901 by a communication cable 902 . everything from replication tether holder 951 through computer 901 together forms the computer unit . to establish communication , the computer unit is connected to smartcard unit by attaching the replication tether holder connector 951 to the smartcard holder 956 . referring now to fig4 , in an alternative embodiment , fig4 , a smartcard 905 is inserted into a smartcard holder 921 including a smartcard reader ic and provided with a lanyard 927 to form the smartcard unit . a smartcard unit adaptor 952 is connected to a computer 901 by a communication cable 902 and computer connector 912 to form the computer unit . to establish communication , the computer unit is connected to the smartcard unit by attaching the smartcard adaptor 952 to the smartcard holder with reader 921 . referring now to fig5 , one form of smartcard reader 968 is shown being attached to smartcard holder 956 as shown in fig1 or fig3 . the connection method may be that described in more detail below with reference to fig6 , and the alignment method may be that described in more detail below with reference to fig5 through 63 . referring now to fig6 , in one embodiment of the system shown in fig2 , a smartcard 954 is connected to smartcard reader 946 using a connection method which may be that of fig6 and an alignment method which may be that of fig4 through 49 . fig7 , similarly to fig2 and 6 , shows a smartcard on a lanyard 927 being attached to a desktop smartcard reader 903 . however , in the embodiment of fig7 the card reader 903 is connected directly to the computer 901 , effectively reducing the communication cable length between them to zero . the smartcard 958 is connected to reader 903 using a mechanically hinged spring clamp 960 provided at its tip with a rounded guide 966 , as shown in more detail in fig6 . the alignment method is non - critical because fig7 shows a contactless card 958 that only has to held in reasonable proximity to the reader 903 so that the smartcard reader &# 39 ; s antenna can interrogate the smartcard 958 . in this and other embodiments , other forms of hinge and other forms of spring may be used . for example , a “ living hinge ” may be used , and may be sufficiently stiff also to act as a spring . fig8 shows a contactless smartcard 958 in a fob format being connected to smartcard reader 903 that is built into the computer 901 . the connection method may be similar to that of fig7 and the alignment method is non - critical as the card 958 only has to held in reasonable proximity to the reader 903 so that the smartcard reader &# 39 ; s antenna can interrogate the smartcard . fig9 and 10 show a smartcard reader 906 being attached to smartcard holder 904 in a manner that may be used as an embodiment of fig1 . the reader 906 may be aligned with the card in the holder 904 by the use of a projection and recess similar to that described below with reference to fig5 through 63 . the reader 906 is held in place on the holder 904 by protective flap 916 mounted on spring - loaded hinge 961 , as shown in fig6 . the protective flaps 916 may also serve to provide rfid shielding for hybrid type cards , preventing the card from being remotely accessed with the flap 916 closed as shown in fig9 . rounded holder guides 966 on the flap 916 and reader guides 967 on the reader 906 allow the reader to be pushed into place under the flap 916 without the user needing to lift the flap 916 with his other hand . fig1 and 12 show a smartcard reader 903 being attached to smartcard holder 904 somewhat similarly to the embodiment shown in fig9 and 10 . alignment may be by a projection on reader 903 fitting into a recess in holder 904 as shown in fig5 through 63 . in this embodiment the recess is covered by protective flaps 963 that slide laterally and \ or axially , allowing the card reader to be slid into place between the two flaps , and held in place by notches on the flaps gripping ribs on the edges of the reader 903 , as shown in fig7 . the shape of the flaps and the card reader serve as both connection guides and holders . the design of flap hinges 960 and 963 allows for multidirectional release . fig1 and 14 show a smartcard reader 906 being attached to smartcard holder 904 using the connection method of fig6 , in which a tab on reader 906 bearing contact sensors 910 slides into a slot containing contact pins 925 in the holder 904 , while the main body of reader 904 overlies a flat surface of holder 904 . the tab may be mounted on spring - loaded hinges 960 to ensure a sufficient contact pressure and frictional grip between the reader 906 and the holder 904 . the opening to the holder contacts 925 is shape such to allow holder &# 39 ; s contacts to be slide into place semi laterally yet when fully inserted align the contacts properly for communication purposes . correct alignment method is that detailed in fig5 through fig5 . the opening to the holder contacts 925 is shaped so as to allow the tab on the reader 906 to be slid into place semi laterally , and to be removed obliquely or semi laterally , yet when fully inserted to align the contacts properly for communication purposes . correct alignment may be ensured by the method described in more detail below with reference to fig5 through 58 . fig1 shows a smartcard reader 968 attached to smartcard 956 as shown in fig1 . electrical connection is provided by external contacts 910 , 925 on the reader 968 and the holder 956 , respectively . alignment is provided by a sloped projection and recess 966 , 967 , and by projection 935 of reader 968 fitting into recess 934 on holder 956 , as discussed below with reference to fig5 to 58 . the reader may be held onto the holder magnetically , as discussed below with reference to fig6 . this embodiment shows that a smartcard such at that disclosed by iso 7816 can be modified to allow a smart card reader to be connected and released quite easily . fig1 shows a smartcard holder 974 , which may be , for example , a holder 904 , 906 , or 956 , being outfitted with an adaptor 971 which will allow a holder connector 952 to be connected . any two different connections may be formed between holder 974 and adaptor 971 , and between adaptor 971 and connector 952 . as shown in fig1 , the connection method between the adaptor 971 and holder connector 952 is that of fig7 , using card reader guide 967 , and data pins 912 , and the alignment method via the connector is that detailed in fig5 through fig6 . sensors 910 on adaptor 971 engage card contacts 908 through an aperture in holder 974 . the adaptor 971 may or may not have a smartcard reader ic 924 built in , in the case where the ic is not in the adaptor , a different computer unit would be required , for example 968 . fig1 shows a smartcard holder 958 being outfitted with an adaptor which will allow a smartcard reader 903 to be connected . the connection method between the adaptor and holder connector is that of fig7 and the alignment method is not critical . fig1 shows a combination of a slip card holder 953 and a holder with a smartcard reader ic 921 which allows for a holder connector 952 to be connected . the connection and alignment method between the card holder 953 , 921 and a smartcard 905 within the card holder 953 is that of fig6 . the clamp hinge 961 grips the card 905 with greater force and is not meant to be easily disconnected . the connection and alignment method between the computer connector 952 and the card holder 953 , 921 is that of fig7 . fig1 shows an example of desktop smartcard reader 946 ( see fig2 ) with a spring type hinge 960 acting indirectly to hold the smartcard 905 in the smartcard reader . the mechanism is designed with an “ over center ” action such that when the flap 915 holding the smartcard against the contacts is to either side of a 45 degree angle the flap either is pushed more open to release the smartcard , or pushed more closed thus holding the smartcard firmly in the card reader . the feature of pushing the flap more open make it easier for the user to align and simply place their card on the open flap and push forward until the spring is to the other side of the 45 ° position , and snaps shut to clamp the smartcard in place . fig2 shows a user with their smartcard 905 held in the card holder 904 worn on lanyard 927 , tethered to a computer 901 with a computer unit 906 and 902 . fig2 shows a user with their smartcard 905 held in the card holder 904 worn on lanyard 927 , interacting wirelessly , in a contactless manner , with an access point card reader 965 . fig2 shows a user with their smartcard 905 held in the card holder 956 worn on a belt clip 927 , tethered to a computer 901 with a computer unit 906 and 902 . fig2 shows user at an industrial control panel computer 901 and card reader 946 . the user &# 39 ; s smartcard 905 is in a holder 956 attached to the user by a retractable cord . the user is able to log onto computer 901 by inserting the smartcard 905 in reader 946 , without removing smartcard 905 from holder 956 , or detaching holder 956 from the user . fig2 . shows the user at a desk with computer 901 and contactless desktop card reader 903 . the user connects the smartcard 958 to the computer , without needing to detach retractable cord 927 . fig2 through fig3 illustrate various forms of a card holder 904 that is distinguished by an opening that allows either direct contact to the smartcard &# 39 ; s contact pads 908 or an opening that allows necessary access to the interrogation zone of an antenna 957 of a contactless smartcard . the card holder 904 may be used with various card reader types , card types , and connection and alignment methods . referring initially to fig2 through 29 , certain basic features of smartcard holder 904 and smartcard reader 903 , 906 , 968 are illustrated . a card opening features alignment guides 934 ( see fig3 ) so as to assist aligning the reader contacts 910 with the smartcard contacts 908 and also to allow the card reader 903 , 906 , 968 to be removed easily by sliding . the system for both contact and contactless cards 905 includes a card holder 904 , an appropriate card reader 906 , 968 , 903 , and a communication cable 902 , and various computer connectors 926 , 931 , 932 . the card holder 904 has a slot configured to receive at least a portion of the smartcard 905 and the card opening extending between the slot and an outer surface of the card holder to enable either direct or indirect access to the smartcard &# 39 ; s integrated circuit chip 964 through either the smartcard &# 39 ; s contacts 908 or smartcard &# 39 ; s antenna 957 and the first alignment device 934 . the card reader 903 , 906 , 968 is removably connectable to the card holder 904 , the card reader 906 , 968 having electrical contacts 908 configured to communicate with the smartcard &# 39 ; s ic through contact pads 908 and a second alignment device 935 configured to cooperate with the first alignment device 934 to align the electrical contacts on the card reader with the opening on the card holder such that the electrical contacts can contact the electronic chip . the communication cable 902 is connected at one end to the card reader and is in electrical communication with the electrical contacts 910 of the card reader for transmitting data between the smartcard ic 964 and a computer 901 . alternatively the same alignment removably connectable method will apply to contactless smart card where the card reader 903 is aligned in proximity with the smartcard &# 39 ; s antenna 957 . the system may include an indicator light 955 on at least one of the card holder and the card reader to indicate that the card reader contacts are in communication with the smartcard &# 39 ; s electronic chip . the open card holder system allows for existing card reader connectors 910 which adhere to iso 7816 contact pad dimensions to be used . referring now to fig3 , in one variation , the card holder 904 includes magnetically attractable component 909 and the smartcard reader 906 or holder connector 912 includes a magnet 911 , or vice versa . the bevel edges 934 of the opening , see fig3 , assist in aligning the card reader contacts 910 to with the smartcard contact pads 908 in both the lateral and axial direction . in another variation , fig3 , the card reader and the card holder may be mechanically attached to each other with a hinge mechanism 960 on the carder reader . the mechanism may include one or more hinge type devices 960 and / or a spring loaded clip or flap 915 , working separately or in combination . alternatively , the mechanism may include protrusion and detent 934 and 935 on the card holder and on the card reader , so that the detent receives the protrusion when the card holder is fully received into the card reader . additionally , it is understood that a similar mechanical attachment mechanism may be used in conjunction with any of the embodiments described herein . fig3 also shows a computer connector 932 which allows the connection to computer communication port and provides an additional communication port to leaving a spare port . connector 932 has a usb male plug 950 to insert into a usb female socket in computer 901 , a usb splitter 942 that supports both cable 902 and an additional usb female socket on the exposed end of connector 932 . in another variation , shown in fig3 , the card holder 904 has protective flaps 916 with spring hinges 960 that provide the necessary force to hold the card reader 968 to the card holder 904 such that the reader contacts 910 connect to the smartcard contacts 908 . the flaps 916 can also : assist in guiding and aligning the card reader 968 on the card holder ; and , when closed , provide smartcard contact pads 908 with protection from debris and damage . fig3 also shows that the smartcard reader ic 924 can alternatively be located in the computer connector 931 at the end of communications cable 902 nearer to computer 901 , instead of on the card holder connector end 968 . this may result in a different data communication protocol being used in cable 902 , and may require a physically different cable . computer connector 931 may instead , or in addition , be a connector 932 that has an auxiliary data connector such as an additional usb port . fig3 also shows that the card holder connector end 968 may also feature a position switch , which is actuated by actuator 918 when the reader is connected to the card holder . this switch can be used for the “ card in position ” input , sometimes referred to as “ presn ”, of a standard smartcard reader ic , or for any similar system that verifies the physical presence of a smartcard in the reader . the flaps 960 are configured to pivot between a first position ( see fig9 ) in which the flaps protect the smartcard contacts 908 or antenna 957 and a second position ( see fig1 and 32 ) in which the flaps allow physical access to the smartcard contacts or wireless access to the smartcard antenna 957 . as shown in fig3 , which is a further variation of fig3 , for a contactless card reader 903 the position flaps hold the card reader 903 in place with the reader &# 39 ; s antenna 969 in the interrogation zone of the smartcard &# 39 ; s antenna 957 . the effective ranges of the two antennae can then be very short , allowing very low transmission power . when closed , the protective flaps 916 can provide rfid protection when the card reader 903 is not connected , preventing unauthorized wireless access to card 905 . the protective flaps 916 can also be easily be manipulated by the user to expose the smartcard antenna 957 when being used for an area access reader 965 , see fig2 . fig3 shows a perspective view of an example of the opening in card holder 904 for access to card contacts 908 . in this example , the “ alignment ” feature 934 is formed by smoothly beveled edges of the opening , so that the mating card reader or holder connector can be slipped into and out of place even with a motion that is more nearly parallel to the surface of the holder 904 than to the perpendicular axis . as already discussed , any of the holder 904 or 956 , the reader 968 , and the connector 931 may contain a card reader chip 924 or other electronic circuitry configured to convert power and data signals between the protocol used by the smart card 905 and the usb protocol used at plug 950 , or otherwise to at least one of encode and decode data transmitted between the smartcard electronic chip and the external device , the electronic circuitry being located in at least one of the card reader , the card holder , and the communication cable . if the reader ic is in holder 904 , then the holder 904 is in a sense a reader too , and the detachable reader 903 , 906 , 968 may then be a dumber device . however , the holder 904 is still also a card holder design so the user can maintain possession of the smart card . fig3 through 44 illustrate variations of a card holder 956 used with various card reader types , and contact card type 905 , and connection and alignment methods . the card holder 956 is distinguished by having a set of internal contacts 919 ( see fig3 to 43 ) that connect to a smartcard &# 39 ; s contacts 908 when the card is fully inserted . the internal contacts 919 are connected to a set of external contacts 925 that are accessible from the outside of the card holder &# 39 ; s holding space , which is typically a slot to receive a flat card . in other words , the holder 956 has second electrical contacts 919 on an inner surface of the slot configured to communicate with the smartcard &# 39 ; s contacts 908 and therefore with the smartcard &# 39 ; s ic , third electrical contacts 925 on an outer surface of the card holder , and electrical wiring connecting the second electrical contacts to the third electrical contacts . when the card reader is aligned with the card holder , the first electrical contacts of the card reader communicate with the third electrical contacts of the card holder . those features allow for smartcard readers 968 , 906 , etc ., or card holder connectors 951 , 952 , etc . to have various electrical connection designs or types , for example , as shown in fig6 , fig6 , and fig7 . fig3 through 39 show basic features of smartcard holder 956 and an associated smartcard reader 968 . the basic card holder 956 feature is a straight through electrical connection from internal contacts 919 to the external contacts 925 , see fig8 . this feature can have an additional capability to provide security by activating the “ presn ” contact on the smartcard reader &# 39 ; s ic 924 . an internal switch 917 to detect when a card is inserted can be communicated to the card reader either by providing a status contacts or relay contacts 922 , see fig8 and 88 , or by actuating an actuator 918 , see fig8 and 86 . alternatively a position switch may be a reed type switch and located in the card reader 968 and when the reader is in position on the holder and magnetic field is such that the switch is actuated , see fig4 . in other words , the card holder has a slot configured to receive at least a portion of the smartcard containing the electronic chip , second electrical contacts on an inner surface of the slot configured to communicate with the electronic chip , third electrical contacts on an outer surface of the card holder , and electrical wiring connecting the third electrical contacts to the second electrical contacts , the holder further having a first alignment device . the card reader is removably connectable to the card holder and has first electrical contacts configured to communicate with the third electrical contacts on the card holder and a second alignment device configured to cooperate with the first alignment device on the card holder to align the first and third electrical contacts . the communication cable is connected at one end to the card reader and is in electrical communication with the electrical contacts of the card reader for transmitting data between the smartcard electronic chip and an external device . the card holder may further include a proximity switch , which in embodiments shown in the drawings is a normally open proximity switch , located in the electrical wiring between the second and third electrical contacts , and the card reader further comprising a proximity switch actuator , such that when the first and third electrical contacts are aligned , the proximity switch actuator causes the proximity switch to change state to complete ( or break ) the connection between the second and third electrical contacts . in one variation , the proximity switch includes a reed switch and the proximity switch actuator includes a magnet . in another variation , the proximity switch includes a mechanical limit switch and the proximity switch actuator includes a pin configured to actuate the mechanical limit switch . the card reader may further include a slot for receiving at least a portion of the card holder including the third electrical contacts . in one variation , the card holder further includes a normally open proximity switch located in the electrical wiring between the first and second electrical contacts , and the card reader further includes a proximity switch actuator , such that when the first and third electrical contacts are aligned , the proximity switch actuator causes the proximity switch to close to complete the connection between the first and second electrical contacts . the proximity switch may include a reed switch and the proximity switch actuator comprises a magnet . alternatively , the proximity switch may include a mechanical limit switch and the proximity switch actuator comprises a pin configured to actuate the mechanical limit switch . additionally the card holder 956 will feature alignment guides 934 so as to assist aligning the reader contacts 910 with the holder outer contacts 925 and the holder inner contacts 919 with the smartcard contacts 908 and also to allow either the card 905 or the card reader 968 , as the case may be , to be removed easily by sliding it . the system may further include a pushbutton switch configured to enable or disable communication between the smartcard 905 and the external device 901 . additionally , the system may further include electronic circuitry configured to at least one of encode and decode data transmitted between the smartcard electronic chip and the external device . the electronic circuitry is located in at least one of the card holder , the card reader , and the communication cable . fig4 through fig4 shows various cross sectional views card reader or holder connector connections to card holder 968 as shown in fig3 . in one variation , fig4 , one of the first and second alignment devices 934 , 966 on the card holder 956 includes magnetically attractable component 909 and the other of the first and second alignment devices 935 , 967 on the smartcard reader 968 or holder connector 912 includes a magnet 911 , or vice versa . either the card reader 968 or the card holder 956 may have an opening or recess with bevel edges , see fig5 through 63 , that assist in aligning the card reader contacts 910 with the card holder contacts 925 in both the lateral and axial direction . this variation of the card reader 956 has a reed type position switch 917 arranged so that when the reader 968 is placed in contact with the holder 956 the switch activates a contact 922 that can be used to control the “ card in position ” input presn on the smartcard reader ic 924 . in another variation , fig4 , the card in position switch 917 is located internally of the card holding space with contacts 922 on the surface of the card holder 956 and the reader 968 . when card reader 968 is connected to card holder 956 the holder &# 39 ; s contacts 922 contact the reader &# 39 ; s contacts 922 to communication the status of the card 905 in the holder to the smartcard reader ic 924 . thus , the presn input of the smartcard reader ic 924 is set to true only when there is a card 905 correctly inserted into card holder 956 , and card reader 968 is correctly positioned on card holder 956 . the computer connector 933 houses the smartcard reader ic 924 and also has second communication through usb splitter 942 to allow other data access to the computer when the reader is attached . in a further variation , fig4 , the card in position switch 917 is located internally of the card holding space with contacts 922 on the surface of the card holder . when card reader 968 is connected to card holder 956 the holder &# 39 ; s contacts 922 contact the reader &# 39 ; s contacts 922 which are in turn connected to card reader actuator 918 which in wired in series to communicate the status of the card 905 in the holder 956 and the status of the card reader 968 relative to the holder 956 to the smartcard reader ic 924 . the card reader 968 is connected to the card holder 956 by a flap 915 with sprung hinges 961 . in one variation , fig4 , the card holder external contacts 925 can be oriented in a format other than standard smartcard contact pad arrangement , in this case on the bottom of the card holder . the card reader contacts 910 and card holder external contacts 925 could , for example , be as shown in fig6 or fig7 . another addition to the card holder may be a “ replication flap ” 937 , which is a member of the same shape and size as one end of a standard smartcard , and having a set of external contacts 925 mimicking the contacts on a standard smartcard , so that it may be used in a standard card reader 938 . in fig4 , the replication flap 937 is provided with a spring - loaded hinge 960 , so that it folds flat against the underside of card holder 956 when not in use . the electrical contacts 925 on the replication flap 937 are wired within the card holder 956 to the internal contacts 919 in parallel with any other set of holder external contacts 925 . fig4 shows a perspective view of the replication flap 937 of fig4 being inserted into a card reader 938 . fig4 and 46 show two standard commercially available desktop style smartcard readers . fig4 shows a smartcard 905 being inserted into a vertical style smartcard reader 938 . the card reader 938 has a holding space for the smartcard 905 that only allows for the smartcard 905 to be inserted and removed vertically , along its long axis . furthermore the standard card reader 938 is designed to accept only smartcards that meet the iso 7816 / cr 80 standard , basically a card the shape and size of a standard credit card . if the user carries the smart card in a holder , then it must be removed from the holder to be inserted into the card reader 938 . if the user has the smart card attached to an id reel 927 , then excessive lateral or fore - and - aft forces on the card can result in damage . fig4 shows a conventional horizontal card reader equivalent to the vertical card reader 938 shown in fig4 . with the reader shown in fig4 , the card must be inserted and removed horizontally , in one specific direction , as shown by the arrow . if a force is applied , for example , by the user &# 39 ; s lanyard , in a direction having a vertical component , or in any horizontal direction other than the one shown , then damage can result . fig4 shows a smartcard 905 being inserted into a vertical style smartcard reader 946 as shown in fig2 . the smartcard reader 946 has a flexible holding space which allows for the smartcard 905 to be inserted and removed with movement in any or all three axes , as shown by the arrows . at least the front wall of the slot is mounted on a hinge 960 , allowing the walls to spread apart to accommodate fore - and - aft movement . the front wall or face of the card reader 946 is replaced by a protective flap 916 which operates on a spring type hinge 960 . the protective flap 916 provides the necessary pressure to apply the smartcard contacts 908 against the card reader contacts 910 for communicative connection and yet opens sufficiently to allow the smartcard to be inserted and removed in the vertical direction . the side walls of the slot in card reader 938 , which align the smartcard contacts 908 with the reader contacts 910 in the lateral direction , are omitted and replaced with alignment guides 935 . fig4 shows the smartcard card 905 aligned in the card reader by the guides 935 and lateral movement into and out of the card reader 946 . the alignment guides 935 align the card when the card is fully inserted , but allow it to be tipped sideways or removed diagonally up and sideways . the base of the card reader 946 aligns the smartcard contacts 908 with the card reader contacts 910 in the axial direction just as is the case with the standard card reader 938 . alternatively the alignment guides 935 can provide alignment in the axial direction as well . the outside edges of the smartcard card 905 effectively are the second alignment guides 934 that cooperate with alignment guides 935 . however , other surface features may be added if it is not necessary for card 905 to comply strictly with a conventional credit card shape . fig4 shows smartcard 905 inserted in the card reader 946 and the movement of the protective flap 916 . the spring type hinge 960 can have various features which allow the protective flap to remain in the open position when the smartcard 905 is removed from the card reader 946 but when the smartcard 905 is inserted the protective flap 916 provides closing pressure necessary to make communicative contact between smartcard contacts 908 and card reader contacts 910 . fig5 shows a smartcard 954 being inserted into a horizontal style smartcard reader 946 . the smartcard reader 946 has a magnetic holding space which allows for the smartcard 954 to be inserted and removed in all three axes . the side wall supports of the card reader 938 which align the smartcard contacts 908 with the reader contacts 910 in the lateral direction are replaced with alignment guides 935 . as is best shown in fig5 , the alignment guides 935 are slightly closer together than the width of the card 954 . axial positioning of the smartcard 954 is thus assured by the rounded corners of the card seating on the alignment guides 935 . alternatively , a central end - stop can be provided on the base of reader 946 . the outside edges of the smartcard card 905 effectively are the second alignment guides 934 , however other surface features may be added . as shown in fig5 , a magnet 911 in the reader 946 and a ferromagnetic element 910 in the smartcard 954 may also be provided . the attraction between the magnetic elements 910 , 911 both provides the necessary pressure to hold the card 954 in contact with the reader 946 , and maintain electrical contact between the smartcard contacts 908 and the card reader contacts 910 for communicative connection , and assists in aligning the smartcard correctly . fig5 shows the smartcard card 954 aligned in the card reader by the guides 935 and illustrates vertical and rotational movement into and out of the card reader 946 . fig5 shows the smartcard card 954 aligned in the card reader by the guides 935 and illustrates lateral movement and rotation into and out of the card reader 946 . the card reader 946 can be design to accept various types or even multiple types of smartcards and holders . fig5 and 54 show perspective views of the various smartcards and smartcard with holders connected to an id reel 927 being attached to card readers 946 shown in fig4 and fig5 . fig5 is a perspective view of a smartcard reader 906 being connected to or removed from a smartcard holder 954 worn on a lanyard 927 . fig5 illustrates lateral movement of a smartcard reader 906 in relation to the smartcard holder 954 . as , in fig4 , the smartcard reader 906 has no side walls for lateral alignment of the smartcard contacts 908 ( or holder contacts 925 ) with the card reader contacts 910 . the smartcard holder has an alignment guide 935 which mates with the card holder alignment guide 934 , which when connected align the smartcard contacts 908 with the card reader contacts 910 in both the lateral and axial direction , while allowing insertion or removal in an oblique direction or with rotation . fig5 shows a side view of the smartcard reader 906 connected to the smartcard holder 954 . a protective flap 916 and spring type hinge 960 apply sufficient pressure to the bottom of the card holder 954 so that the smartcard contacts 908 and smartcard reader contacts 910 are in communicative contact and sufficient pressure to maintain connection to the holder during normal use , while allowing the reader 906 to freely break away as required . fig5 shows a side view of the smartcard reader 906 and smartcard holder 954 being connected or removed in the axial and vertical direction . the smartcard reader 906 and smartcard holder 954 have second alignment features 967 and 966 . the second alignment features have smooth surfaces and rounded or angled designs such that when they are in proper contact the smartcard reader can pushed or slipped onto the smartcard holder . fig5 is a perspective view of a smartcard reader 968 being connected to or removed from a smartcard holder 956 worn on a belt clip 927 . fig6 illustrates lateral movement of a smartcard reader 968 in relation to the smartcard holder 956 . as in fig5 , the smartcard reader 968 has no side walls for lateral alignment of the smartcard holder contacts 925 with the card reader contacts 910 . the smartcard holder has an alignment guide 935 which mates with an alignment guide 934 on the card holder , which when connected align the smartcard holder contacts 925 with the card reader contacts 910 in both the lateral and axial direction . fig6 shows a side view of the smartcard reader 968 of fig6 connected to the smartcard holder 956 . the card reader 968 has a magnetic device 911 that , when in proximity to a magnetic attractive device 909 on the card holder 956 , applies sufficient pressure to the bottom of the card reader 956 so that the smartcard holder contacts 925 and smartcard reader contacts 910 are in communicative contact , and sufficient pressure to maintain connection to the holder during normal use , but allows them to freely break away as required . fig6 shows a side view of the smartcard reader 968 and smartcard holder 956 being connected or removed in the axial and vertical direction . fig6 shows an end view , in section along line a - a of fig6 , showing the smartcard reader 968 and smartcard holder 956 being connected or removed in the lateral and vertical direction with possible rotation , as illustrated by the arrows . the smartcard reader 968 and smartcard holder 956 alignment features 934 and 935 have smooth surface and angled design is such that the smartcard reader can pushed or slipped onto or off of the smartcard holder and yet also align the contacts . fig6 and 65 show examples of the interface between smartcard unit and computer unit connectivity . fig6 shows a smartcard 905 with contact pads and a smartcard reader 906 , 968 , etc ., with contact sensors 910 being connected so that a computer 901 can communicate with smartcard ic 964 . the smartcard contacts 908 and the smartcard reader contacts 910 must be aligned properly and make contact with the correct corresponding sensor . fig6 shows a contactless smartcard 958 and a smartcard reader 903 being connected so that a computer 901 can communicate with the smartcard ic 964 . the smartcard 958 must be held in an appropriate orientation and distance from the smartcard reader 903 so that the reader &# 39 ; s antenna 969 can “ interrogate ” the smartcard &# 39 ; s antenna 957 and thereby communicate with the smartcard ic 964 . fig6 through fig7 show , in similar cross - sectional views , various methods of interface connectivity between the smartcard unit and the computer unit . fig6 shows a smartcard reader 906 connecting to smartcard holder 956 with a smartcard 905 , the smartcard contacts 908 are replicated on the surface of the card by transfer connections from card holder internal sensors 919 to the card holder external contact pads 925 . the smartcard reader 906 contacts 910 then connect to the card holder external contacts 925 to communicate with the smartcard . in order to hold the card reader 906 to the card holder 956 with sufficient force to make an electrical connection as well as maintain the card reader in position during normal use , the spring type hinge 960 applies a clamping pressure to protective flap 916 , which results in the smartcard reader contacts 910 sandwiching the card holder 956 . fig6 shows the a variation of fig6 where the card holder external contacts 925 and the flap 916 ( which in this case does not need to be hinged or sprung ) are a combination unit and seat in a cavity on the card holder 956 . when the card reader 906 is connected , the smartcard holder contacts 925 which are also provided with hinge type or other springs , apply sufficient pressure to the card reader contacts 910 to press the backside of the contacts against the wall of the card holder cavity and thus providing a clamping pressure to the card reader to maintain contact . fig6 shows a variation of fig6 , in which the sufficient force to make an electrical connection as well as maintain the card reader in position during normal use is achieved by the magnetic attraction between a magnet or other magnetic device 911 located in the card reader 906 and a ferromagnetic element or other magnetic attractive device 909 located in the card holder 956 . the card holder 956 alignment guides 934 , in the form of a recess with beveled walls , and the card reader 906 alignment guides 935 , in the form of a prominence with beveled sides , properly position the card reader contacts 910 with the card holder contacts 925 for communication . fig6 shows a smartcard reader 903 connecting to smartcard holder 904 with a non - contact smartcard 905 . the smartcard reader antenna 969 is held in a correct distance and orientation to be in the interrogation zone of the smartcard antenna 957 . the card holder 904 has protective flaps 916 with spring type hinges 960 . springs 960 and protective flaps 916 apply sufficient pressure to the card reader 903 to hold in proper position for communicative connection to the smartcard and to hold it in place during normal use . the protective flaps can also be constructed of a rfid blocking material such that the smartcard cannot be read when the protective flap are lying flat on the card holder , as shown in fig9 . fig7 shows a variation of fig6 , in which the card reader 906 has a cup - shaped metal magnet 911 that is the magnetic device 911 , the card reader contact 910 , and the card reader alignment device 934 . the card holder 956 has a matching ferromagnetic metal dome that is the magnetic attractive device 909 , the card holder external contact 925 , and the card holder alignment device 935 . the card reader and card holder contacts both align and provide sufficient force to make an electrical connection as well as maintain the card reader in position during normal use . fig7 is a variation of fig6 and fig6 , in which the card reader 903 magnetic device 911 and the card holder 956 magnetically attractive device 909 hold the reader 903 and the smartcard 905 together with sufficient force for the card reader to communicate with the smartcard 905 . separate beveled card reader alignment guides 935 and card holder alignment guides 934 keep the card reader 903 in position on the card holder 904 such that the card reader antenna 969 can communicate with the smartcard antenna 957 . fig7 is a variation of fig6 and fig6 where the card holder 956 has a pair of indirectly sprung holders 962 that have grooves gripping ridges on the sides of the card reader 906 . as shown in fig7 , each holder 962 may be in upper and lower pieces , with the upper piece separately movable . as shown in fig1 and 12 , the two holders 962 may be a pair of shutters that close to protect underlying contact pads or to shield an rfid antenna when the card reader 906 is not in position . the springs 961 driving the holders 962 apply an indirect sufficient force to make an electrical connection as well as maintain the card reader in position during normal use . fig7 shows a version of fig6 in which the spring contacts 910 on the reader are covered with a flexible membrane that is conductive or has conductive patches . that enables the card reader to have an entirely smooth exterior , where all surfaces can be kept clean for use in sterile or other clean environments . fig7 shows a card reader sub - assembly 973 comprising a replication card 937 having contacts and a size and shape substantially matching the contacts and the size and shape of a conventional smartcard , to enable it to be received into a standard smartcard reader 938 . the replication card 937 is connected to a card holder connector 951 by a communication cable 902 . the card holder connector 951 has contacts 910 to make communicative contact with the card holder external contacts 925 or card contacts 908 . when the replication card 937 is inserted into a card reader 938 and the card holder connector 951 is connected to a card holder 956 with a smartcard 905 , the contacts on replication card 937 replicate the contacts on the smartcard 905 just as if the smartcard 905 were inserted in the reader 938 . fig7 shows a side view in section along the lines a - a and b - b in fig7 . fig7 shows a card reader sub - assembly 930 that is a variation of fig7 where the replication card 937 is replaced with a tether connector 929 that can be connected to a smartcard reader 906 . the device 930 enables a user to provide a connection point for a smartcard reader 906 when , for example , the user is wearing protective clothing that does not allow for their smartcard holder to be exposed . as shown in fig7 , the user wearing a protective suit has the smart card 905 in its holder 904 connected to the connector 951 of the device 930 , all inside the protective suit . only the connection cable 902 is passed through the protective suit to the tether connector 929 on the outside . the tether connector 929 can then be connected to a smartcard reader 906 attached to computer 901 , to establish communication between the computer 901 and the smartcard 905 without exposing the smartcard . fig7 shows a perspective detail view of a card holder 956 that has an internal set of contacts 919 which connect to the smartcard contacts 908 on smartcard 905 and transfer those signals to a set of external contacts 925 on the external surface of the holder 956 where they can be read by a card reader 906 , etc . fig7 also shows various complementary optional features . a proximity or limit switch 917 can be located in the card receiving space of the card holder 956 that actuates when the smartcard 905 is properly inserted into the holder 956 . in this case the smartcard is acting as the limit switch actuator 918 . the limit switch can be connected to a set of contacts 922 which can be used to initiate , permit , facilitate , or break communication between the smartcard ic and the smartcard reader ic by various methods depending on various criteria , most notably the computer 901 operating system and software . if the system configuration is such that it can use the smartcard reader ic presn signal or similar , then a simple pair of contacts 922 would be used . if the system configuration continuously polls the smartcard contacts 908 , then multiple sets relay of contacts 922 may be desired . a pushbutton may be inserted into the circuit to “ manually ” create a signal indicating the card has been removed , which in many systems automatically clears and resets the smartcard reader ic buffer . fig7 shows a sectional side view of the card holder 956 shown in fig7 . fig8 shows schematically a physical actuator 918 that when moved into position closes the switch 917 contact . fig8 shows a variation of fig8 where the switch 917 is a reed type switch and is actuated by a magnetic field when a magnetic device 911 moves into a correct position . fig8 shows an example of the circuit diagram between card holder internal contacts 919 and the card holder external contacts 925 where the connection is a simple straight - through or point to point connection between each individual contact 919 and a matching contact 925 . fig8 shows the circuit of fig1 with a set of contacts of a relay between the contacts 919 and 925 . some or all of the circuit connections between 919 and 925 are open , not communicating , when the card - in - position switch 917 is not closed . fig8 shows a simple circuit with contacts 922 connected when the limit switch 917 is closed . optionally , a normally closed contact pushbutton 944 may be connected in series to open the contacts 922 manually or on demand . the switches 917 and 944 may be reversed to form a normally closed circuit . the closing , or opening , of the contacts 922 can be used to drive a card - in - position input of a card reader ic 924 . fig8 and 86 show the operation of a position switch 917 located on the card reader 906 . when the smartcard 905 is properly fully inserted in the card holder 956 card holding space , as shown in fig8 , the smartcard forces the actuator 918 up , extending beyond or above the surface of the card holder 956 . when the smartcard reader 906 is also properly connected , so that contacts 910 and 925 are aligned and contacting each other , the card reader position switch or contact 917 is aligned with the card holder actuator 918 and is actuated , remaining closed while the smartcard remains inside the card holder . if the smartcard 905 is removed as shown in fig8 , the card holder actuator 918 retracts back below the surface of the card holder 956 , breaks contact with the switch or contact 917 , and the card reader 906 position switch 917 is deactivated . fig8 and 88 show a variation of fig8 and 86 , in which the card holder actuator 918 closes a position switch 917 in the card holder which in turn close a pair of contacts 922 on the surface of the card holder that are in contact with mating contacts on the card reader . the card reader is able to detect a closed circuit between its two contacts 922 and recognize that the smartcard 905 is in position . when the smartcard 905 is removed from the card holding space the actuator 918 opens the limit switch 917 and therefore the contacts 922 . fig8 shows a general circuit diagram of one embodiment of a connection between smartcard 905 , smartcard holder 904 , smartcard reader 906 , and computer 901 . the smartcard contacts 908 are connected to the smartcard reader contacts 910 which are read by the smartcard reader ic 924 which in turn interfaces with the computer 901 via the communication cable 902 and data connectors 950 and 949 . in addition the smartcard holder contacts 922 for the smartcard position switch 917 provide status signal to smartcard reader ic through the smartcard reader contacts 922 . fig9 shows an example of the physical devices associated with circuit shown in fig8 . the circuits and devices to left side of the connection symbol & lt ;-& gt ;∥& lt ;-& gt ; in fig8 and subsequent figures are part of the smartcard unit , the circuits and devices to the right of the part of the computer unit . the smartcard unit is distinguished by the fact it contains the smartcard and that it stays on the person of the user when the two units are separated in normal operation . the connection symbol indicates the interface between the computer unit and smartcard unit , the features of which interface are disclosed in this application . in particular , if the user moves away from computer 901 without first disconnecting , the system should in most embodiments disconnect without damage at the indicated division between the smartcard unit and the computer unit . fig9 and fig9 show a variation of fig8 and fig9 where the card holder is a card holder 954 , the smartcard reader is instead a smartcard holder connector 952 , and the smartcard reader ic is located in the computer connector 931 . regardless of the variation from that of fig8 and fig9 the connection interface remains consistent where the circuits and devices to left side of the connection symbol & lt ;-& gt ;∥& lt ;-& gt ; are part of the smartcard unit , the circuits and devices to the right of the connection symbol are part of the computer unit . fig9 and fig9 show yet another variation with the smartcard 958 being a contactless type , and the smartcard reader 903 also a contactless type and built into the computer 901 still follows the same concept where the circuits and devices to left side of the connection symbol & lt ;-& gt ;∥& lt ;-& gt ; are part of the smartcard unit , the circuits and devices to the right of the part of the computer unit . in a card holder that provides rfid shielding for smartcards with standard antenna design , the antenna is essentially the size of the smartcard , so it is necessary to have a protective flap that exposes the entire smartcard . if the smartcard has an antenna with smaller diameter area , only a portion of the smartcard needs to be exposed in order for a card reader to be able to communicate with the smartcard ic . alternatively , a smartcard can be designed with a reed type switch which disables the antenna when in the presence of a magnetic field . device access . no direct contact with card . the reader has an contactless cards 958 in a credit card form , the card holder may may also have antenna and is capable of being read by while in use , and designed to allow the smartcard or holder to be card reader of types 1 , 2 , or 3 transformed into standard card holder of types 1 , 2 , or 3 with integrated card reader card holder or smartcard unit guide , feature to help alignment of card reader guide , a feature to help alignment of the card reader features on the either or both the card holder and card reader to replicates the actual card &# 39 ; s contact pins such that it can be read reader type 2 in a desktop format or built in to computer reader type 1 in a desktop format or built in to computer reader type 3 in a desktop format or built in to computer products , but rather are designed to mate with the contacts on the card holder . designed to be used with card holder which has a light to indicate when the card reader or connector is properly a clip like device that slides onto an fob or smartcard with or card holder or smartcard unit guide , feature to help attach the contacts or switch to detect card in position and a reader in connected to the smartcard or holder while in use , and designed readers or holder connectors to be attached . it may also include although specific preferred embodiments are shown and described herein , it will be appreciated by those skilled in the art that additions , deletions , modifications , and substitutions not specifically described may be made without department from the spirit and scope of the invention . thus , various aspects of the present devices and methods enable or facilitate various of the following features : in order for a user to maintain possession of their smartcard while placing the smartcard in a reader either : 1 . the smartcard reader adaptor or connector having a sufficiently pliable cable is attached to the user &# 39 ; s smartcard holder directly or indirectly which is worn by the user with a lanyard , id reel , belt clip , armband , etc . see , for example , fig1 and fig4 , fig2 and fig2 . 2 . the smartcard holder attached to the user via an id reel or sufficiently “ stretchable ” cord is inserted into a smartcard reader adaptor . see fig2 and fig2 in order for the connection of smartcard holder to a smartcard reader adaptor to be practical and desirable three basic criteria can be met : to meet these criteria the smartcard holder and the smartcard reader adaptor may have the following features : 1 . the smartcard holder and smartcard reader adaptor have structures features that align the contacts of smartcard holder with those of the smartcard reader adaptor . 2 . the smartcard holder and smartcard reader adaptor have structures features that apply appropriate force to maintain connection to each other . 3 . the smartcard holder and smartcard reader adaptor have structures features that allow their separation laterally and \ or vertically , in addition the axial method . 4 . the smartcard holder and smartcard reader adaptor have structures features that allow their connection laterally and \ or vertically , in addition the current axial method . that may make them easier to connect single handed and / or blind by feel . “ a smartcard is a device that includes an embedded integrated circuit chip ( icc ) that can be either a secure microcontroller or equivalent intelligence with internal memory or a memory chip alone . the card connects to a reader with direct physical contact or with a remote contactless radio frequency interface . with an embedded microcontroller , smartcards have the unique ability to store large amounts of data , carry out their own on - card functions e . g ., encryption and mutual authentication and interact intelligently with a smartcard reader . smartcard technology conforms to international standards iso / iec 7816 and iso / iec 14443 and is available in a variety of form factors , including plastic cards , fobs , subscriber identity modules sims used in gsm mobile phones , and usb - based tokens .” the term “ smartcard ” as used in this application includes , but is not limited to , the smartcard alliance definition , and includes but is not limited to , other standards and definitions referenced herein . many factors influence the detail design “ shape ” of a smartcard unit , a smartcard or smartcard holder and smartcard reader . first , smartcards come in three forms , contact , contactless , and hybrid . a hybrid implements both contact and contactless interfaces to the smartcard &# 39 ; s integrated circuit . second , the computer requirements — operating system and / or software — can influence what features are required in the smartcard holder and smartcard reader . other factors would be defined by end - user requirements or preferences ( for example , rfid shielding ) or the environment ( for example , office versus industrial , where features such as chemical resistance , heavy duty , or clean room compliant are desired ). contact type smartcards are governed by iso / iec 7810 and iso / iec 7816 series of standards which define features such as physical shape and characteristics , electrical connector positions and shapes , electrical characteristics , communications protocols , etc ., of the card . of particular note is iso - 7816 - 3 activation / deactivation sequencer which initiates and automatic emergency deactivation upon card removal . this requirement influences the design of all contact smartcard readers to include a “ card in position ” switch . if the electronic device &# 39 ; s operating system or software requires a card removal policy then it may be necessary to add secondary “ card in position ” switch on the card holder so that the security system is not bypassed by the user removing their smartcard holder after logging onto the system . contactless type smartcards are governed by iso / iec 14443 - x which define features such as physical characteristics including antennae dimensions , radio frequency power and signal interface , etc of the card . contactless type smartcards come not only in a credit card type format but in other various shapes and sizes depending on their antennae dimensions , these are sometimes referred to as tags and fobs . contactless and hybrid type smartcards requiring rfid shielding may require smartcard holders with a “ window ” feature that allows the user open the window when presenting to an area access reader or when attaching an electronic device &# 39 ; s smartcard reader . the “ window ” can be spring loaded to automatically close . additionally , the window can be designed to hold the electronic device &# 39 ; s smartcard reader in place . see , for example , fig9 to 12 . physical modifications to a contact type smartcard as defined by iso / iec 7810 to have features for easy smartcard reader connection will be considered a smartcard holder . see u . s . pat . d 511 , 355 , illustrated in fig1 . a “ smartcard reader ” typically is understood to mean a device with the smartcard integrated circuit such as those by nxp . see fig1 and fig1 . the interface is connected to the contacts which communicate with the smartcard and contacts which communicate with the computer . in some cases the smartcard interface integrated circuit may be located in the smartcard holder itself . in order for the smartcard held within the smartcard holder to communicate with the computer an interconnecting element with holder adaptor and computer adaptor is required . typically this interconnecting element contains the smartcard interface integrated circuit . however , as is explained elsewhere in this specification , the smartcard ic , or equivalent functionality , may be located in many different places in the chain of communication between a smartcard and an external computer or other device . several embodiments and variations of a smartcard unit ( smartcard , or smartcard and holder ) and a computer unit ( smartcard reader connected to a computer , or computer with built in smartcard reader connection system ) are described herein for various smartcard forms . details of the smartcard unit and computer unit connection are disclosed and explained . in some embodiments , the smartcard ic is in the “ smartcard unit ” rather than the “ computer unit .” a design concept goal is to enable the user to maintain possession of their smartcard by either attaching a computer unit to the smartcard unit or attaching the smartcard unit to the computer unit in such a manner that makes it simple , easy , and fast to connect and align them together as well as easy to separate , particularly in the unintentional case . the design concepts apply to both contact and contactless cards and readers . in case of contact cards , one design criteria is reliable alignment and contact between the card reader and smartcard &# 39 ; s contact pads ; whereas with contactless cards the corresponding design criteria is proximity and access to the smartcard antenna &# 39 ; s interrogation zone . the system includes electronic circuitry configured to at least one of encode and decode data transmitted between the smartcard electronic chip and the computer , otherwise known as a smartcard integrated circuit , it is what enables the a smartcard and computer to communicate with one another . primarily the smartcard ic is part of the computer unit , meaning the smartcard ic can reside either in the component which connects to the smartcard unit , see fig3 , the component which connects to the computer , see fig3 , or in the computer itself , see fig8 . in a variation , the smartcard ic is located in the smartcard unit , see fig1 . in the case where the smartcard holder is also effectively a smartcard reader , however , the connection features disclosed here still apply as the smartcard unit with a smartcard ic still enables the user to maintain possession of their smartcard . there are two different “ operating modes ” the for smartcard unit and computer unit connection system . the first is where the computer unit attaches to the smartcard unit worn by the user with the computer unit &# 39 ; s communication cable tethering the user to the computer , see fig5 . the second is where the smartcard unit worn by the user attaches to the computer unit , with the smartcard unit being tethered to the user by an id reel or other sufficiently “ stretchable ” cord , see fig6 . in the embodiments , there are basically two different types of computer unit styles , contact and contactless , where the computer unit style is dependent on the type of smartcard used . there are basically three different types of smartcard units , simple smartcard in credit card format , simple smartcard in a holder , and modified smartcard , for example , fob , heavy duty , modified simple smartcard , etc . the smartcard holder has at least six variations : direct , indirect , shielded , and unshielded for contact style cards ; shielded and unshielded for contactless style cards . there are at least two basic connection methods , mechanical and magnetic . there are numerous connection designs , for example , smartcard unit “ clips ” to computer unit vs computer unit “ clips ” to smartcard unit . any combination of computer unit and smartcard unit connection has two common features disclosed here . simple , fast , multidirectional , and safe connect - ability and remove - ability and easy self - alignment features . although specific embodiments and combinations of features have been described , the skilled reader will understand how to combine features of different embodiments to produce new combinations and embodiments within the scope of the appended claims . in one embodiment , a card holder and reader system is described for a smartcard having an electronic chip . the system includes a card holder , a card reader , and a communication cable . the card holder is configured to receive at least a portion of the smartcard containing the electronic chip while enabling external electrical access to the electronic chip , and has a first alignment device . the card reader is removably connectable to the card holder . the card reader has first electrical contacts configured to communicate with the electronic chip on the smartcard and a second alignment device configured to cooperate with the first alignment device to align the first electrical contacts on the card reader for communication with the electronic chip . the communication cable is connected at one end to the card reader and is in electrical communication with the first electrical contacts for transmitting data between the smartcard electronic chip and an external device . | 6 |
example embodiments will now be described more fully with reference to the accompanying drawings . example embodiments are provided so that this disclosure will be thorough , and will fully convey the scope to those who are skilled in the art . numerous specific details are set forth such as examples of specific components , devices , and methods , to provide a thorough understanding of embodiments of the present disclosure . it will be apparent to those skilled in the art that specific details need not be employed , that example embodiments may be embodied in many different forms and that neither should be construed to limit the scope of the disclosure . in some example embodiments , well - known processes , well - known device structures , and well - known technologies are not described in detail . the terminology used herein is for the purpose of describing particular example embodiments only and is not intended to be limiting . as used herein , the singular forms “ a ,” “ an ,” and “ the ” may be intended to include the plural forms as well , unless the context clearly indicates otherwise . the terms “ comprises ,” “ comprising ,” “ including ,” and “ having ,” are inclusive and therefore specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . the method steps , processes , and operations described herein are not to be construed as necessarily requiring their performance in the particular order discussed or illustrated , unless specifically identified as an order of performance . it is also to be understood that additional or alternative steps may be employed . when an element or layer is referred to as being “ on ,” “ engaged to ,” “ connected to ,” or “ coupled to ” another element or layer , it may be directly on , engaged , connected or coupled to the other element or layer , or intervening elements or layers may be present . in contrast , when an element is referred to as being “ directly on ,” “ directly engaged to ,” “ directly connected to ,” or “ directly coupled to ” another element or layer , there may be no intervening elements or layers present . other words used to describe the relationship between elements should be interpreted in a like fashion ( e . g ., “ between ” versus “ directly between ,” “ adjacent ” versus “ directly adjacent ,” etc .). as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . although the terms first , second , third , etc . may be used herein to describe various elements , components , regions , layers and / or sections , these elements , components , regions , layers and / or sections should not be limited by these terms . these terms may be only used to distinguish one element , component , region , layer or section from another region , layer or section . terms such as “ first ,” “ second ,” and other numerical terms when used herein do not imply a sequence or order unless clearly indicated by the context . thus , a first element , component , region , layer or section discussed below could be termed a second element , component , region , layer or section without departing from the teachings of the example embodiments . spatially relative terms , such as “ inner ,” “ outer ,” “ beneath ,” “ below ,” “ lower ,” “ above ,” “ upper ,” and the like , may be used herein for ease of description to describe one element or feature &# 39 ; s relationship to another element ( s ) or feature ( s ) as illustrated in the figures . spatially relative terms may be intended to encompass different orientations of the device in use or operation in addition to the orientation depicted in the figures . for example , if the device in the figures is turned over , elements described as “ below ” or “ beneath ” other elements or features would then be oriented “ above ” the other elements or features . thus , the example term “ below ” can encompass both an orientation of above and below . the device may be otherwise oriented ( rotated 90 degrees or at other orientations ) and the spatially relative descriptors used herein interpreted accordingly . by way of an overview , in a voltage compensation system , series strings of pv modules , or parallel groups of series strings , are each provided with an associated dc to dc converter coupled in series with the string . when the pv modules are exposed to sunlight and hence producing a dc voltage , the converter imposes a bias voltage on the dc voltage of the series string . this results in a string voltage across the string that is not solely dependent on the working voltage of the series string of pv modules for a given level of sunlight . an mpp tracking algorithm controls the dc to dc converter such that the maximum power output point ( or as close to it as is possible ) of each string may be maintained . if this is not possible , an average value or other approximation may be used . when multiple series strings are connected in parallel such that they provide a common array output , a common inverter may be coupled to the array . the inverter is controlled in such a way as to determine the dc voltage , and hence the voltage of the entire pv array . this , in turn , affects the voltage at which the pv series strings operate . referring to fig1 a , the operation of a conventional dc / dc converter arrangement for use with one or more photovoltaic ( pv ) cells can be understood . as shown therein , the output from a photovoltaic cell or string of such cells 2 is passed into a dc / dc converter 4 and the output 6 of that converter 4 forms the output of the circuit . as a result , all of the power from the cell or string 2 passes through the converter 4 . the purpose of such an arrangement is for the cells or string 2 to be matched in voltage or current with their associated converter or converters 4 so that a plurality of cells or strings 2 may be connected in parallel or series while still operating at their individual optimum power points . while this can be beneficial for the efficiency of the cell or string 2 , all of the power flowing through the cell or string 2 also flows through the associated converter 4 and presents a significant drawback since the power rating for the converter 4 must be the same as the power rating for the cell or string 2 . by way of example , the arrangement of in fig1 a may be operated according to a dc / dc converter technique which has a fixed loss of 2 % and a variable loss of 4 % at full load . if the string 2 was rated as having a 1 kw power peak , the conventionally arranged converter 4 in fig1 a must be rated for 1 kw throughput . it would therefore have a fixed loss of 20 w and a variable loss ranging from zero at no load to 40 w at full load . the best possible conversion efficiency would be 94 %. fig1 b illustrates a functional block diagram of a converter arrangement in accordance with the embodiments described herein . the pv cells or string 2 are arranged in combination with the dc / dc converter 4 so that the output 8 of the circuit results from a combination of the cells or string 2 and the dc / dc converter 4 , rather than being solely from the converter 4 . the converter 4 in fig1 b can be operated to contribute a bias voltage to the voltage across the cells or string 2 , so that the overall output 8 of the circuit matches a target voltage . the bias voltage may add to or subtract from the voltage contributed by the cells or string 2 , dependent on the target voltage which is to be met . this is represented by the bidirectional arrows in fig1 b denoting the alternative “ boost ” and “ buck ” configurations available with the arrangement shown therein . the converter 4 in fig1 b only contributes a bias voltage , which makes a relatively small change to the voltage or current of the pv cells or string 2 . thus , the power transferred by the converter 4 is only a function of the amount of the bias itself , not of the entire output 8 of the string 2 and converter 4 in combination . as one skilled in the art will appreciate , the losses of a dc / dc converter are inevitably a function of its power throughout its operation . therefore , in the arrangement shown in fig1 b , the losses of the dc / dc converter 4 are proportionate only to the amount of the bias which it contributes . the converter power rating must therefore equal or exceed maximum bias power . it need not equal the maximum power for the cells or string 2 . going back to the numerical example set out above in relation to fig1 a , if the same converter technique was used with the arrangement shown in fig1 b and if one allows for a maximum converter bias of 10 % of the maximum output from the cells or string 2 , then the converter &# 39 ; s fixed loss would be 2 w and the variable loss would be 4 w . the equivalent conversion efficiency would be 99 . 4 %. hence the arrangement shown in fig1 b provides significant efficiency improvement over the prior art arrangements due to the method of operation of the selected dc / dc converter , regardless of the particulars of its internal design . as will be recognized by one skilled in the art , prior art arrangements typically include a single dc / dc converter in conjunction with an entire array of photovoltaic ( pv ) cells . such an array may include multiple strings of pv cells connected in series and / or parallel . in such a conventional arrangement , the power from the entire array would be input to the inverter . the arrangement would include an inverter controller which would operate an mpp algorithm to determine the optimal voltage for the entire array . this would be an aggregate value for the entire array , and not the optimum for each individual string . each string would typically generate a few amps , for example in the region of 2 to 5a . however , a typical array could generate in the region of 1000a . typical working voltages of a pv string could be in the region of 500v to 900v and would vary with temperature as is known . in contrast , typical values of the bias voltage imposable by the dc / dc converter according to the embodiments described herein , exemplified in fig1 b , could be in the region of 5 % to 10 % of the string voltage . there are significant advantages of operating a dc / dc converter as shown in fig1 b . an individual dc / dc converter can be provided in series with each string , in series therewith . with an associated converter in series with each series string , the optimum voltage output conditions of each pv module , and hence the maximum power output point of each string as a whole , may be maintained regardless of any inverter parameter changes . furthermore , each string may output a different optimum dc voltage to the other strings in an array as the respective converter buffers each string from the other strings in the array . turning to fig1 c , a more detailed example can be seen . as shown therein , multiple pv modules 10 are coupled together in series strings 11 or groups of series strings 11 . each series string 11 has a respective output terminal 12 a , 12 b . the series strings 11 may be coupled in parallel with other series strings 11 to form a parallel array 13 of pv modules . the parallel arrangement of the array 13 enables the pv series strings 11 to be configured such that the array 13 has common array output terminals 14 a , 14 b . these common terminals 14 a , 14 b may be connected to a common dc circuit such as a power processing system 16 , which in a non - limiting example may be , an inverter . additionally , series strings 11 and sub - arrays ( not shown ) may be grouped together in other combinations as the operating conditions may require . an inline dc / dc converter 15 , or other voltage regulator is coupled in series with the pv modules of each series string 11 . the converter 15 may be positioned at any point in the series string . its position may be selected to suit physical constraints , the arrangement for earthing ( grounding ) due to different manufacturers of pv panels having different earthing requirements , or for enabling a convenient common connection with other series strings 11 by way of output terminals 12 a , 12 b . as is shown in fig6 , each converter 15 has an associated bias control system comprising support components and a maximum power point ( mpp ) tracking algorithm within a controller . as discussed in the background section above , for a given level of insolation and temperature , each pv cell or module has an optimal dc operating voltage . ignoring any other circuit influences , each series string 11 will therefore present an optimum dc string voltage to the converter 15 that is variable according to the conditions . in operation , when a series string 11 as shown in fig1 c is exposed to sunlight , the mpp algorithm , together with the control system , adjusts the converter 15 to provide a suitable bias voltage , to be combined with the voltage across the series string of pv modules , to provide a target voltage across output terminals 12 a and 12 b . therefore , by using the inline converter 15 , the voltage across the series string of pv modules may be adjusted independently of the voltage at the output terminals 12 a , 12 b . the voltage at the terminals 12 a , 12 b typically remains largely constant under the control of the inverter 16 or other dc load , although it may be affected to some extent by the behaviour of the converter 15 . due to the compensating action of the converter 15 , the string 11 as a whole can operate at an optimum dc voltage according to the string conditions and regardless of circuit conditions outside of the series string 11 . the converter 15 can impose a bias voltage on the optimum dc voltage of the series string at any given time . therefore the dc voltage across the string of pv modules can be changed and controlled over time in order to achieve maximum efficiency of the pv cells in the string , or to meet some other target , regardless of the voltage at the output terminals 12 a , 12 b . when there are multiple series strings 11 present in the array 13 , each series string , in conjunction with the bias voltage adjustment provided by the inline converter 15 , can present a dc voltage across the series string output terminals that is substantially equal to that of other series strings . in turn , these substantially equal string output voltages present a common dc voltage across the common output terminals of the array 14 a , 14 b . the output across the terminals 14 a , 14 b of the array thus presents a substantially uniform dc voltage to the common inverter 16 or other load . thus , in effect , the converter 15 provides a buffer between the optimum voltage across the pv modules of a series string and the voltage output across the terminals 12 a , 12 b of the series string as a whole . it also provides compensation from external circuit influences on the series string output terminals that would otherwise influence the dc voltage of the pv modules of the series string 11 tending them away from their optimum level output voltage . in the arrangement of a pv array with a biasing device in each string as illustrated in fig1 c , a common inverter 16 may be coupled to the pv array by way of the common array outputs 14 a , 14 b . the inverter 16 can thereby convert the dc output of the array 14 a , 14 b to an ac output 19 suitable for connection to the electrical distribution network of the location . this may be used for transmitting power back to the distribution network . even when an inverter 16 is connected to the common output terminals 14 a , 14 b of an array , the in line converter or converters 15 can , by imposing a bias voltage on the dc voltage produced by the series string , be controlled to make adjustments for the local operational conditions for each series string 11 independently of the other series strings , and hence independently of any influence of the common inverter 16 coupled to the common array output 14 a , 14 b . the common inverter 16 may be adjusted according to an overall mpp algorithm or optimized in accordance with , for example , the parameters of any power distribution system to which it is coupled without affecting the efficiency of each individual series string 11 . any change in inverter 16 parameters which may affect the properties of the inverter 16 input do not affect the optimum dc voltage output of each series string 11 as any change in voltage at the output terminals 12 a , 12 b of each series string 11 is compensated for by the inline converters 15 . thus , the adjustment enabled by converter 15 in each series string 11 allows the inverter 16 coupled across the array 13 to be adapted for optimal operational efficiency based on substantially stable outputs from each of the series strings 11 . there exist a number of power electronic switched - mode techniques for adjusting a dc voltage . these include operation any of a buck converter , a boost converter , and an inverter or rectifier . however the power loss in these techniques is such that the overall benefit in efficiency would be small if used in a conventional arrangement such as that shown in fig1 a . the fixed power losses of such techniques are a function of the rated power throughput , and it is difficult to achieve losses of less than about 2 % of rated power . furthermore , the main power semiconductors are rated for the full range of possible input voltage and current . therefore putting all the power from a string of pv modules through a buck converter , boost converter , inverter or receiver would not be efficient or cost effective . by way of contrast , in the embodiments of fig1 b to 5d , the converter 15 need only supply the required dc bias voltage such that a substantially equal dc voltage be presented across the output terminals 12 a , 12 b by each series string 11 . consequently , the power throughput of the converter is a function only of the dc bias voltage , and not of the full string dc output voltage . thus , the power rating of the converter 15 is small compared with that of the full series string and the overall array rating , and is determined by the maximum required dc bias voltage . fixed and variable losses in the converter 15 are substantially lower than those that would be present for a converter exposed to the full string voltage . this can also result in a reduction in the cost of the components forming the converter . turning to fig2 a to 4b , a number of embodiments comprising different arrangements of converter 15 will be described . the converters may provide a positive potential ( boost mode ), negative potential ( buck mode ), or adjustable potential ( bipolar ) to the optimum dc series string voltage produced by the pv modules . maintenance of the bias voltage requires a net output of power in the converter which is , of course , proportional to the bias voltage and the current flow in the converter . in all illustrated embodiments , only the power semiconductor components are illustrated . one skilled in the art would recognize that there may also be additional components such as snubbers , freewheeling diodes , and de - magnetising diodes as would be understood by one skilled in the art . fig2 a to 2d show a boost mode converter where the flow of current is from the series string to the output terminals 12 a , 12 b . specifically , fig2 a and 2c show a flyback arrangement and fig2 b and 2d show a forward arrangement . a boost mode converter would be employed where the minimum optimum series string voltage is a constraint on the inverter 16 input parameters . in the embodiments of fig2 a and 2b the converter input is coupled to the string output at 24 . the output of the converter is coupled in series with the string output in order to increase the output voltage across output terminals 12 a and 12 b . with the embodiment of fig2 a , when exposed to sunlight , a dc voltage is produced by the pv modules 10 . by way of current induced in the windings of the transformer 20 , energy is stored in the transformer magnetising inductance when transistor 22 is turned on , and delivered to the transformer secondary circuit 20 a when the transistor is turned off . in another embodiment , the converter input may be taken from the converter output , illustrated at point 28 of fig2 c . with the embodiment of fig2 b , power is delivered to the output 12 a when the transistor 22 is turned on . by way of current induced in the inductance 27 , energy is stored in the inductance 27 when transistor 22 is turned on , and delivered to the output circuit 12 a continuously when transistor 22 is on or off , as would be understood by the skilled person . in another embodiment , the converter input may be taken from the output across the output terminals 12 a , 12 b illustrated at point 29 of fig2 d . some designs of pv panel require a blocking diode or anti - backfeed device , for example , at night when the strings do not receive any insolation , if there is a damaged string present in the array , or a particular string is in the shade . by appropriate choice of component voltage ratings , the boost mode embodiments of fig2 a , 2 b , 2 c and 2 d can provide this functionality . fig3 a to 3d show buck mode converters where the flow of bias current is from the output terminals 12 a , 12 b to the series string 11 . specifically fig3 a and 3c show a flyback arrangement and fig3 b and 3d show a forward arrangement . a buck mode converter would be employed where the maximum series string voltage would be a constraint on the inverter 16 input parameters . with the embodiment of fig3 a , the input of the converter is coupled in series with the string at point 30 . this reduces the voltage delivered to the dc output across output terminals 12 a , 12 b . the output of the converter is connected in parallel with the string at point 32 , adding to the available current from the string . in another embodiment , the converter output may be coupled to the output terminals 12 a 12 b rather than the string output illustrated at point 34 of fig3 c ). this may result in a more efficient conversion . with the embodiment of fig3 b , the input of the converter is coupled in series with the string at point 30 . this reduces the voltage delivered to the dc output across output terminals 12 a , 12 b . the output of the converter is connected in parallel with the string , adding to the available current from the string . in another embodiment , the converter output may be coupled to the output terminals 12 a , 12 b rather than the string , illustrated at point 34 of fig3 d ). this may result in a more efficient conversion . turning to fig4 a , a push - pull converter in bipolar mode is shown with an active rectifier . a bipolar mode converter would be employed where the series string voltage is close to the average required at the inverter 16 input and therefore requires a relatively small bias voltage , which may be either positive or negative with respect to the optimum string voltage output as required . this arrangement hence allows the lowest conversion losses in the converter . the fully controlled push - pull converter can operate over a range of conditions by adjusting the relative phase of the control signals to the transistors 22 on either side of the transformer 10 , and power can flow in either direction . the left side of transformer 20 is coupled in series 40 with the string whilst the right side is coupled in parallel 42 . power may be extracted in series and added in parallel , giving a voltage reduction , or extracted in parallel and added in series , giving a voltage increase to the voltage output across terminals 12 a , 12 b . in another embodiment , the parallel branch ( right hand side of transformer 20 ) may be coupled to the output across terminals 12 a , 12 b rather than the string , illustrated at point 44 of fig4 b . this embodiment may be more efficient when providing buck conversion . in a further embodiment , a unipolar mode could be obtained by way of replacing two of the transistors 22 shown in fig4 a and 4b with diodes as would be clear to the skilled person . the side of the transformer with the diodes would be the converter output . when the converter output is on the left hand side of transformer 20 , operation would be in the boost mode and , when it is on the right hand side of transformer 20 , operation would be in the buck mode . in a further embodiment , as shown in fig5 a to 5d , a ćuk converter may be used . with the ćuk converter boost mode embodiment of fig5 a , a dc voltage is produced by the pv modules 10 . energy is stored in the inductance 51 when transistor 22 is turned on . when the transistor 22 is turned off , energy is delivered to the transformer primary circuit 20 , and hence to the secondary rectifier circuit , through the coupling capacitors 52 . the converter input is coupled to the string output at 24 . the output of the converter is coupled in series with the string output in order to increase the output voltage across output terminals 12 a and 12 b . with the ćuk converter buck mode embodiment of fig5 b , the input of the converter is coupled in series with the string at point 30 . this reduces the voltage delivered to the dc output across output terminals 12 a , 12 b . the output of the converter is connected to the output terminals , adding to the available current from the string . in a further embodiment of the ćuk converter boost mode , the converter input may be coupled to the output terminals 12 a , 12 b rather than the string output , illustrated at point 34 of fig5 c . this may result in a more efficient conversion . in a further embodiment of the ćuk converter buck mode , the converter output may be coupled to the string output rather than the output terminals 12 a , 12 b illustrated at point 30 of fig5 d . this may result in a more efficient conversion . in all embodiments , the bipolar transistor ( s ) could also be , for example , mosfets or insulated gate bipolar transistors ( igbt ) or any combination thereof . many of the embodiments described above can be arranged such that any failure in the power semiconductors results in a fall - back state . for example , in the circuit of fig2 a , if the transistor 22 fails to conduct because of a fault , continuity between the string and the output is inherently maintained through the transformer 20 secondary winding and the diode . if the transistor 12 were to become a short circuit , then a protection device , for example a fuse opens and continuity is again maintained . because of the low power throughput of the converter , co - ordination of the protection device with the prospective short circuit current is simplified . most commonly , failure modes occur where the boost / buck function is lost but the string is still connected to the output terminals 12 a , 12 b . in this event , and with the fall - back state available , the string can continue to deliver power at a sub - optimal mpp level . this is in contrast to a traditional full converter where a failure in the power semiconductors may result in a total loss of string output . fig6 illustrates an embodiment showing a flyback boost converter arrangement as illustrated in fig2 a arranged as part of a bias control system . a controller 60 is associated with each converter 15 and contains an mpp tracking algorithm . the algorithm may be provided by way of software download to a programmable controller device 60 such as , but not limited , to a microcontroller , or may be hard - wired into the controller 60 by other means such as an application specific integrated circuit ( asic ). the support components which , as can be seen , can be low - cost resistive components , provide measurement points of the series string , and enable the controller 60 to be supplied with the information upon which the mpp algorithm contained within is applied . the controller 60 receives series string inputs of string voltage 61 and string current 62 , and may also receive converter current 63 and adjusted string output voltage 64 . as previously described , the converter 15 is self - contained , requiring no external coupling to any other series string . the controller 60 is able to turn the transistor 22 on and off to provide a pulse - width modulation to the flow of current in the converter 15 . this action imposes a corresponding positive bias on the optimum dc voltage output of the series string of pv modules , resulting in an independently controllable dc string output voltage across terminals 12 a and 12 b . as has been explained above , the bias voltage imposed on the series string voltage is adjusted in order to maintain the voltage output at the series string output terminals 12 a , 12 b in line with other series strings 11 in the array 13 . the converter 15 , is typically independent and self - contained . however , the controller 60 may be provided with data communications capabilities . a separate control input 65 to the controller 60 can be used by an external system to send a control signal to the controller 60 . this could , for example , adjust the action of the converter 15 such that the bias voltage imposed on the series string 11 can be adjusted for reasons external to the converter 15 , rather than for maintaining the voltage substantially constant across the series strings . the local measurements provided by inputs 61 to 64 could , therefore , be overridden by the separate control input 65 if desired . additionally or alternatively , the controller 60 may be provided with condition monitoring capabilities to communicate monitoring data such as series string operating parameters to a remote monitoring device . the embodiment illustrated in fig6 includes a controller 60 for its respective converter in each string . however , a single controller may also be arranged to monitor and control two or more converters in their respective strings . this requires a controller of sufficient processing speed and power to enable multiplexing without affecting controller performance . the string voltage and current and the output voltage data can be used to detect likely faults in a series string , string box or string box interconnection . a string box is a unit located in the vicinity of the array to marshal the connections to a group of individual strings and to provide various facilities for interconnection with other string boxes , over - current protection , isolation for maintenance purposes , and monitoring for condition and safety reasons . a string box interconnection is a connection between string boxes , which gathers the output from the boxes for transfer to the array output . thus a system is provided which enables individual adjustment to each series string 11 to be made in order to achieve a desired string output voltage across its output terminals 12 a , 12 b to buffer the optimum output voltage of the pv modules and to compensate for external circuit influences . with all embodiments , neither the converter 15 nor the associated components need provide galvanic isolation as each series string 11 operates independently and there is generally only a unipolar ( positive or negative ) potential between the pv panel and earth . furthermore , there is always one common coupling between each series string and the dc busbar . this negates problems associated with common - mode voltages attributable to the switching action of a converter 15 or inverter 16 . the choice of a suitable bias voltage range for the boost or buck function allows optimisation of the system cost and efficiency . the component cost and power loss of the embodiments described are approximately proportional to the maximum bias voltage provided by the converter in each string . in known systems , there may be insufficient knowledge to make a fully informed choice of the bias voltage range that the system will need to provide during its lifetime . the present system enables adaption to changing pv string characteristics during the lifetime of the panels , and particularly the diversity of their characteristics , can be undertaken . these characteristics could change with , for example , age of the panels , contamination of the panels , the replacement of panels with those of a differing manufacturer , and other unknown effects which will may only become apparent after long term usage . furthermore , if a pv string 11 displays such an altered characteristic that its associated converter 15 cannot achieve the mpp , the converter 15 can operate at the best available setting , under the influence of the controller 60 . the controller 60 may be able to indicate this limiting condition by way of its aforementioned data communications capabilities . an additional converter could then be added in series to provide an extended bias voltage range without the need to hold stocks of alternative converter types . there is no need for the inline converter 15 to itself have any intelligence , to change its bias for example from 5 % to 10 %, since a separate controller can be provided to monitor operation of the inline converter and the series string as a whole and additional or alternative inline converters can be added simply and easily if needed . the embodiments described hereabove can be achieved by retrofitting a dc / dc converter within an existing series string of pv modules . this could replace existing converters which are arranged to convert the entire output of a series string or array , hence , resulting in significant energy savings . when an inverter is used as a load across the common outputs of a pv array as shown in fig1 c , such an inverter can monitor the output of the array . it can therefore detect whether a particular dc / dc converter can optimise the output of the associated string at a particular voltage . the inverter can also balance the requirements of optimising each string or array with increasing its own efficiency , which is also temperature sensitive . the embodiments and arrangements as described herein can be implemented in a range of different pv strings and arrays , for use with any suitable load at the output . furthermore , the aforementioned arrangements of a converter positioned in a series string of pv modules is equally applicable to any system where it is desired that an optimum voltage output of a certain device be shielded or buffered from external circuit influences . the optimum voltage output of the device may continue to be produced while other parts of the circuit are only subjected to the voltage produced after the converter has imposed its compensating bias voltage . the foregoing description of the embodiments has been provided for purposes of illustration and description . it is not intended to be exhaustive or to limit the disclosure . individual elements or features of a particular embodiment are generally not limited to that particular embodiment , but , where applicable , are interchangeable and can be used in a selected embodiment , even if not specifically shown or described . the same may also be varied in many ways . such variations are not to be regarded as a departure from the disclosure , and all such modifications are intended to be included within the scope of the disclosure . | 8 |
for a better understanding of the present invention , together with other and further objects , advantages , and capabilities thereof , reference is made to the following disclosure and appended claims in connection with the above described figures and description of some of the aspects of the invention . the present invention provides for a method of making agglomerates which facilitate the breakup of the surface oxide layers so that the coalescence of the aluminum metal / alloy particulates can be achieved at lower temperatures . this would be advantageous in plasma melting of aluminum based agglomerates where excessive heating can cause undesirable effects , for example , evaporation of low melting high vapor pressure alloying elements or reaction ( decomposition ) of reinforcement phases . the process of this invention relates to agglomerating aluminum based material . the resulting agglomerates are suitable for plasma melting rapid solidification processing ( pmrs ). the aluminum based material is aluminum metal or an aluminum metal alloy such as an aluminum - copper - magnesium alloy . a slurry is first formed of the aluminum based material , and one or more fluxing agents . preferred fluxing agents are compounds capable of decomposing into boric oxide at elevated temperatures . most preferred of these compounds are boric acid , and boric oxide . the purpose of the fluxing agent is to aid in breaking up the oxide films . in a preferred embodiment the boric oxide yielding compound makes up from about 1 % to about 5 % by weight of the powder charge . the slurry can also contain organic binders . the liquid medium is then removed from the slurry . this can be done by any number of methods , but the preferred methods are by spray drying and air drying . as a result of the process of this invention , agglomerates of the aluminum based material are produced which contain flux or fluxes . these agglomerates are suitable for use in plasma melting rapid solidification processing . when boric oxide or boric acid are the fluxes , the low melting boron a boric oxide - aluminum oxide flux when the agglomerates are heated . the flux helps in breaking of the oxide film on the aluminum based material . thus the addition of the boric oxide yielding compound results in coalescence of the particles of the aluminum based material at temperatures lower than would be required otherwise . in accordance with a preferred embodiment of this invention , the agglomerated particles are dewaxed by standard methods to remove the binder if deemed necessary before further processing . the agglomerates are sintered by standard methods to impart sufficient strength to the particles for subsequent operations . it is preferred that the aggomerated particles be classified to obtain the desired particle size ranges . the agglomerated particles are entrained in a carrier gas which is preferably argon . the agglomerated particles entrained in the carrier gas are then fed through a high temperature zone having a temperature sufficient to allow the metal particles to melt and coalesce together . the source for the high temperature zone can be a plasma such as a dc or rf , or a flame spray gun . the preferred high temperature source is a dc plasma gun . in accordance with a preferred embodiment , the agglomerates are injected into the hot plasma jet using the carrier gas . the agglomerates are then cooled and the molten and coalesced metal particles are resolidified . in accordance with the preferred embodiment , the resolidification is done by allowing the resulting high temperature treated particles to travel out of the high temperature zone to a cooler zone having a temperature below the solidification temperature of the metal to allow the metal to resolidify . the resulting particles are spherical in shape . the metal exhibits a microstructure similar to rapidly solidified gas atomized powders at cooling rates of from about 10 2 to about 10 5 ° c ./ sec . the typical particle size of the resulting particles is from about 25 to about 200 micrometers in diameter . the typical particle size of the starting powders that are used in making the agglomerates phase particles is less than about 20 and preferably less than about 10 micrometers in diameter . details of the principles and operation of plasma reactors are well known . a typical plasma gun incorporates a conical thoriated tungsten cathode , a water - cooled annular copper anode which also serves as a nozzle , a gas injection system and a powder injection system . gases used are selected for inertness and / or energy content . these gases include but are not limited to argon , hydrogen , helium , and nitrogen . plasma gun operating power levels are generally in the 5 to 80 kw range . the location of the power injection port varies with the nozzle design and / or the powder material . it is either in the nozzle ( anode ) throat or downstream of the nozzle exit . the plasma jet is not a uniform heat source . it exhibits steep temperature ( enthalpy ) and velocity gradients which determine the velocity and temperature achieved by the injected powder particles ( agglomerates ). in addition , the particle trajectories ( and hence the temperature and velocity ) are affected by the particle size , shape , and thermophysical properties . the particle temperature is controlled by appropriately selecting the plasma operating conditions ( plasma gas composition and flow rate and plasma gun power ) and the injection parameters ( injection port location and carrier gas flow rate . the powders made from agglomerates produced by the process of this invention can be consolidated to net shape using conventional powder metallurgy techniques , for example , pressing and sintering , isostatic pressures , forging , extrusion , and combinations thereof . the following non - limiting examples illustrate how the agglomerates of aluminum based material are used in making composite particles of aluminum - silicon carbide . agglomerates consisting essentially of about 20 % by weight silicon carbide having an average diameter of about 13 micrometers and the balance an aluminum based alloy 2124a1 having an average diameter of about 16 micrometers are made by air drying in a tray a slurry of the silicon carbide , the aluminum alloy , polyvinyl butyral as a binder supplied by monsanto under the trade name of butvar b - 76 , and ethyl alcohol as the liquid slurry medium . the binder content is about 2 % by weight of the powder charge . particle size analysis of the dried agglomerates indicates a mean particle size of about 86 micrometers . the agglomerates are subsequently dewaxed and sintered in a hydrogen furnace . the dewaxing temperature and time are about 400 ° c . and about 2 hours respectively . sintering is carried out at about 600 ° c . for about 4 hours . the agglomerates are then cooled slowly to room temperature . the dewaxed and sintered agglomerates are then screened into different size ranges . agglomerates in the size range of from about 63 to about 75 micrometers are melted using a d . c . plasma torch . a mixture of argon and hydrogen is used for the plasma gas : argon flow rate -- about 16 l / min , and hydrogen flow rate -- about 1 l / min . the plasma gun power is about 12 kw . a 1 . 75 mm diameter injection port at the nozzle exit is used for injecting the powder agglomerates into the plasma jet . argon at a flow rate of about 1 . 5 l / min . is used as the carrier gas . the resulting powder is then collected at the chamber bottom . a sem photograph of the resulting plasma processed material is shown in fig1 . a second batch of agglomerates is made using about 1 % by weight addition of boric acid to the slurry during the agglomeration process . this batch is processed , that is , dried dewaxed and sintered and plasma sprayed using the same parameters as used for example 1 . a sem photograph of the resulting plasma processed material is shown in fig2 . the procedure described in example 2 is repeated except that the plasma gun power is about 8 kw . a sem photograph of the resulting plasma processed material is shown in fig3 . from the three figures it can be seen that the material resulting from agglomeration with boric acid ( fig2 and 3 ) have more spherical particles than material resulting from agglomeration without boric acid ( fig1 ). furthermore , fig3 shows that the spheroidization occurs at the lower power level . while there has been shown and described what are at present considered the preferred embodiments of the invention , it will be obvious to those skilled in the art that various changes and modifications may be made therein without departing from the scope of the invention as defined by the appended claims . | 1 |
the preferred embodiments of the present invention will now be described in detail while referring to the accompanying drawings . fig1 and 2 illustrate an ink jet recording apparatus according to the first embodiment of the present invention . fig1 is a top view for the general structure of the apparatus and fig2 is a cross sectional side view for the state where an automatic paper feeding unit ( hereafter referred to as an &# 34 ; asf &# 34 ;) is installed in the apparatus . the ink jet recording apparatus in this embodiment can handle , as recording media , cut sheet paper , such as normal recording paper and post cards , and continuous sheet paper , such as fanfold paper . usually , cut sheet paper is supplied either by an asf or manually . since the asf has two bins 30a and 30b , as is shown in fig2 cassettes holding sheets of two different sizes , for example , can be set up at the same time and employed as desired by a user . the feeding mechanisms of the bins 30a and 30b are identical . more specifically , a plurality of cut sheets ( not shown in fig2 ) that are stacked on pressing plates 31a and 31b are forced by springs 32a and 32b toward pickup rollers 33a and 33b , respectively . as the pickup roller 33a or 33b is rotated in consonance with a feeding start command , the sheets are separated and fed one by one . when cut sheet paper is employed as a recording medium , a resist roller 11 is set so that it can urge a feeding roller 10 by the manipulation of a release lever ( not shown ). the cut sheet that is supplied by the asf is fed to a recording area along a feeding path that is formed around the feeding roller 10 as it is rotated . in the recording area , a paper pressing plate 12 is forced toward the feeding roller 10 by the elasticity of leaf springs . here , the feeding force further acts on the cut sheet , which is fed between an ink jet head 20j and a platen 24 . this feeding is performed intermittently for each scan by the ink jet head 20j , which will be described later , and the feeding distance corresponds to the row length , in a cut sheet feeding direction , of a plurality of ink ejection nozzles that are provided in the ink jet head 20j . the cut sheet , which is fed every scan and on which recording is performed by the discharge of ink from the ink jet head 20j , is fed gradually upward within the apparatus and is finally discharged in consonance with the rotations of an assist roller 13 and a discharge roller 14 ( and spurs 13a and 14a that are pressed by the respective rollers 13 and 14 ). the asf is not employed for continuous sheet paper . a continuous sheet that is supplied through a paper supply port 35 is fed by driving a pin tractor 3 . the resist roller 11 is released by the release lever so that it is not pushed toward the feeding roller 10 . the continuous sheet that is fed up to the recording area is shifted intermittently with every scan of the ink jet head 20j , in the same manner as is performed for the cut sheets , and is gradually transported upward within the apparatus . recording is performed during this period . an asf motor 26 ( see fig1 ), which is provided in the apparatus body at the home position , is employed to drive a pickup roller of the asf or an absorption pump in a capping unit 25 . the driving power required for the feeding process of a recording medium , such as the drive force of the feeding roller 10 , can be acquired via a gear row 41 ( see fig1 ) from an lf motor ( not shown ), which is located at the position opposite to the home position . fig3 is a block diagram that mainly illustrates the control arrangement of the ink jet recording apparatus shown in fig1 and 2 . a control circuit board 100 , a print circuit board , is installed in the bottom of the apparatus body , as is shown in fig2 . an mpu 101 , a gate array ( ga ) 102 , a dynamic ram ( dram ) 103 , and a mask rom ( mask rom ) 107 are provided on the control circuit board 100 . further , motor drivers , i . e ., a carriage motor driver ( cr motor driver ) 104 , a paper feeding motor driver ( lf motor driver ) 105 , and an asf motor driver 106 , are provided on the control circuit board 100 . at the same time , a centronics interface ( if ) circuit board 110 , which is formed as a print circuit board , is connected to the control circuit board 100 to enable the reception of recording data from a host device . the mpu 101 of the control circuit board 100 executes data processing for the entire apparatus , the mask rom 107 is employed to store the procedures , and the dram 103 is employed as a work area for the above data processing . various circuits that are involved in the process performed by the mpu 101 are packaged in the gate array 102 . the mpu 101 converts image data , which are transferred from the host device via the i / f 110 , into data that are employed by the ink jet head 20j to form an image by ink ejection , and then transfers the resultant data to the driver of the ink jet head 20j by the ejection timing of the ink jet head 20j . further , the mpu 101 drives motors 22 , 28 and 26 via the drivers 104 , 105 and 106 , respectively . the cr motor 22 is driven based on linear encoder information acquired via a carriage 21 , while the ejection timing is controlled . in addition , the mpu 101 executes a process for key entry and information display on a front panel 130 and a process in consonance with detection information that is received from a home position ( hp ) sensor 38 , a tractor ( rrl ) sensor 36 , a paper ( pe ) sensor , and a paper type discrimination sensor 37a . the structure of a paper feeding ( hereafter referred to as an &# 34 ; lf &# 34 ;) mechanism of the recording apparatus shown in fig1 and 2 will now be explained . when cut sheet paper is selected as a recording medium , the release lever 251 is set to a cut sheet select state , as is shown in fig4 through 6 , and then the resist roller 11 that is held by a resist roller holder 5 is pressed against the long feeding roller 10 by a resist roller spring 245 ( see fig5 ). likewise , an auxiliary roller 16 , which is held by the resist roller holder 5 so that it moves upward and downward , is pressed against the feeding roller 10 by an auxiliary roller spring 248 , which is provided in the resist roller holder 5 ( see fig5 ). fig1 is a top view illustrating the cam structure of the release shaft shown in fig5 . a pinch roller 12 , which is supported by a shaft 223a , is held by a pinch roller holder 223 , and is pressed against the feeding roller 10 by a pinch roller spring 246 ( see fig5 ). the pinch roller spring 246 is bent by a protrusion 241c of a release shaft 241 , and generates a pressing force by the spring elasticity against its support point 246a . the positional relationship between cams 241b and 241c of the release shaft 241 is as shown in fig1 . the cams 241b and 241c are so located that they do not interfere with each other . under these conditions , the drive force of the lf motor 28 is transferred to the feeding roller 10 and the discharge roller 14 ( see fig6 ). the drive force imparted the feeding roller 10 is transferred via the series that comprises an lf motor gear 231 , an deceleration gear 232 , and an lf deceleration gear 233 , and to a feeding roller gear 234 , which is inserted into the feeding roller 10 , so that the feeding roller 10 is rotated . the drive force to the discharge roller 14 is transferred via the series that comprises the lf motor gear 231 , the deceleration gear 232 , and an lf deceleration gear 235 to a discharge roller gear 236 , which engages the discharge roller 14 , so that the discharge roller 14 is rotated . since the feeding roller 10 employed in this embodiment is elongated in the main scanning direction , distortion can be completely eliminated for a large sized sheet . in addition , the rotation speed of the discharge roller 14 is higher than that of the feeding roller 10 in this embodiment to ensure that at a recording position a recording medium will be flat . more specifically , with a feeding roller diameter of φ38 . 808 ( 0 , - 0 . 06 ), a discharge roller diameter of φ15 . 515 (± 0 . 03 ), a deceleration rate of the feeding roller of 1 / 36 , and a deceleration rate of the discharge roller of 1 / 15 , the rotation speed of the discharge roller is increased about 1 % ( 0 . 08 % to 1 . 19 % while considering crossing ). as for the transfer of the drive force of the lf motor 28 to the pin tractor 233 , the drive force is transferred via the lf motor gear 231 and the deceleration gear 232 to the lf deceleration gear 233 , and not up to the pin tractor 3 because the transfer between the lf deceleration gear 233 and a clutch gear 237 is cut off . more specifically , the clutch gear 237 is pushed toward a frame 2 side ( in a direction where the lf deceleration gear 233 is connected ) by a clutch spring 247 , which is shown in fig6 b . the clutch gear 237 is , however , separated from the lf deceleration gear 233 against the urging force exerted by a cam 252b of a slide cam 252 that interlocks with the release lever 251 . the arrangement of the lf driving mechanism when continuous sheet paper is selected will now be described . when the release lever 251 is pulled down to set the apparatus in the continuous sheet select state , as is shown in fig7 a gear 241a of the release shaft 241 , which engages a gear 251a of the release lever 251 , is rotated in the direction indicated by the arrow a . as the release shaft 241 is rotated , as is shown in fig8 its protrusion 241b pushes the resist roller holder 5 down to separate the resist roller 11 from the feeding roller 10 and to remove the resist roller 11 from the paper feeding path . a rotation support point 22a of the resist roller holder 5 is provided on the side of the pinch roller holder 223 . even when the auxiliary roller 16 , which is held by the resist roller holder 5 so that it moves up and down , also moves in a direction where it separates from the feeding roller 11 , it merely weakens the pressing force to the feeding roller 10 because of the auxiliary roller spring 248 . further pressure by the protrusion 241c on the pinch roller spring 246 is released , and the pressing force of the pinch roller 12 on the feeding roller 10 is accordingly reduced . as is described above , even in the continuous sheet select state , the pressing forces of the pinch roller 12 and the auxiliary roller 16 on the feeding roller 10 are not set to &# 34 ; 0 &# 34 ;. the individual reasons will now be explained . as for the reduced pressure by the pinch roller on the feeding roller 10 , although the accuracy in feeding continuous sheet paper is controlled by the pin tractor 3 , the pinch roller 12 is sometimes separated from the surface of the feeding roller 10 at page boundaries ( perforations ), and proper pressure is therefore required to prevent this phenomenon . as for the reduced pressure exerted by the auxiliary roller 16 on the feeding roller 10 , it is necessary to decrease the allowable difference , of a paper position that is detected by a paper sensor , that is caused by a weight percentage of a sheet ( represented by grammage or ream weight ) or by a thickness difference in paper types . as is shown in fig1 , depending on the thickness of a sheet , some sheets are fed while wrapped around the feeding roller 10 , and other sheets are fed along a feeding roller opposing portion 4a of a paper pan 4 . supposing that an interval between the feeding roller 10 and the feeding roller opposing portion 4a of the paper pan 4 is l , an allowable feeding difference may be a maximum 2l . supposing that a detection position of a flag 37b of the paper sensor 37 is p and a contact point of the auxiliary roller 16 and the feeding roller 10 is q , the auxiliary roller is so positioned that p is always located downstream of q in a paper feeding direction . when the paper sensor detects a sheet , the sheet is always located on the feeding roller 10 and the allowable detection difference can be reduced . in this embodiment , the pressure force of the pinch roller 12 exerted on the feeding roller 10 is 1200 g in the cut sheet select mode , and 200 g in the continuous sheet select mode . the pressure force of the auxiliary roller 16 exerted on the feeding roller is 75 g in the cut sheet select mode , and 20 g in the continuous sheet select mode . further , the recording apparatus in this embodiment is so designed that the pressure can be varied as needed . in other words , the apparatus comprises pressure adjusting means . the pressure adjusting means includes a mechanism that selects a position at which pressure is released and a position at which pressure is gradually increased from the release position . the pressure adjusting means may also have a mechanism wherein one end of a helical coil spring , for example , which applies pressure to the pinch roller , contacts the external surface of a rotary shaft , which has a notch , and the other end of the coil spring is secured ; and wherein as the shaft is rotated , the contact position is altered either to the external surface of the shaft or the notch to select the release position or the pressure position . the drive force of the lf motor 28 in the continuous sheet select mode is transferred individually toward the feeding roller 10 , the discharge roller 14 , and the pin tractor 3 . since the transfer to the feeding roller 10 and to the discharge roller 14 is the same as is performed in the cut sheet select mode , no explanation for it will be given . as for the pin tractor 3 , the drive force is transferred from the row that comprises the lf motor gear 231 , the deceleration gear 232 , the lf deceleration gear 233 , and the clutch gear 237 to a tractor gear 238 that engages a tractor shaft 15 , which is in turn rotated to transfer the drive force to the pin tractor 3 ( see fig9 a and 9b ). more specifically , although the clutch gear 237 is pressed toward the frame 2 side by the clutch spring 247 , in the continuous sheet select mode the clutch gear 237 is coupled with the lf deceleration gear 233 and to the tractor gear 238 by the cam 252c of the slide cam 252 . simultaneously , the side portion of the slide cam 252 acts on the tractor sensor 209 , and the sheet select mode is changed from the cut sheet select mode to the continuous sheet select mode . as is described above , according to the present invention , a recording medium can be maintained flat both during the feeding and the recording regardless of whether the recording medium is cut sheet paper or continuous sheet paper , and paper distortion can be prevented , so that high quality image recording can be provided . further , according to the present invention , a constant print start position can be maintained regardless of the paper type , such as cut sheet paper or continuous sheet paper . in addition , according to the present invention , the feeding of a thick recording medium , such as a post card , is ensured . the ink jet head 20j has 128 ink ejection nozzles arranged in one row . when the ink jet head 20j is attached to the carriage 21 , the arrangement of the nozzles is along the above described direction in which a recording medium is fed ( hereafter , this will be referred to as a sub scan direction ). the ink jet recording apparatus in this embodiment can perform full color recording with yellow ( y ), magenta ( m ), cyan ( c ) and black ( bk ) ink , and monochrome recording with bk ink . in the arrangement for performing full color recording , the ink jet head 20j and ink tanks 20t , in which colored inks , y , m , c , and bk are respectively retained , are provided individually detachable from the carriage 21 . when y ink runs out or when the replacement of a tank is required , the pertinent tank can be replaced with another ink tank , or when the ink jet head 20j must be replaced , only the ink jet head need be changed . with the above described structure , 128 ink ejection nozzles of the ink jet head 20j are assigned to each ink by the predetermined counts , and ink chambers and ink supply paths are individually formed in consonance with the assignments . in the arrangement for performing monochrome recording , the ink jet head 20j and the ink tank 20t for bk ink are integrally formed as one unit , which is provided detachable from the carriage 21 . the carriage 21 to which the ink jet head 20j and the ink tank 20t are attached can be shifted by the drive force produced by a carriage motor 22 that is transferred via a belt 23 , which is connected to part of the carriage 21 , as is shown in fig1 . by engaging a guide shaft 21a and a guide piece 21b , which are located in the horizontal direction in fig2 to slide freely , the carriage 21 can be shifted along the guide shaft 21a and the guide piece 21b , and accordingly scanning for recording is possible . when no recording is performed , the carriage 21 is shifted back to a home position that is to the left in fig1 and the face of the ink jet head 20j in which the ink ejection nozzles are arranged is capped with a capping unit 25 . the data for shifting the carriage 21 are detected by an encoder film 27 , which is provided in parallel to the guide shaft 21a , and optical or magnetic encoder devices 51a and 51b ( see fig2 ) that are attached to the carriage 21 to sandwich the encoder film 27 . an electric signal is transmitted from the apparatus body to the ink jet head 20j via a flexible circuit board 44 . in this embodiment , to ensure that a recording medium will be maintained flat even downstream along the feeding path from the recording position , a first spur is positioned opposite the discharge roller 14 with a recording medium between them , a second spur is positioned upstream along the feeding path from the first spur and downstream from the feeding roller 10 , and the discharge roller 14 , discharge means consisting of the two spurs , and a platen are located in the same plane . as another arrangement to ensure that a recording medium will be maintained flat , a plurality of spurs are located at matrix positions in the main scan direction ( the direction that is perpendicular to the feeding path ). the second embodiment of the present invention will now be described . the same reference numbers are used to denote the components in this embodiment that correspond to or are identical with those in the first embodiment , and no explanation for them will be given here . in the second embodiment , as is shown in fig1 , a sheet is held on a feeding roller 10 by a resist roller 11 and a pinch roller 12 . when cut sheet paper is selected as a recording medium , a release lever 251 is set in a cut sheet select state , as is shown in fig1 through 15b , and then the resist roller 11 that is held by a resist roller holder 222 is pressed against the long feeding roller 10 by a resist roller spring 245 ( see fig1 ). the pinch roller 12 is held by a pinch roller holder 223 , and is pressed against the feeding roller 10 by a pinch roller spring 246 ( see fig5 ). the pinch roller spring 246 is bent at a protrusion 242b of a pinch roller release shaft 242 and generates pressing force by the spring elasticity at its support point 246a . as for the transfer of the drive force of an lf motor 28 to a pin tractor 3 , the drive force is transferred via an lf motor gear 231 and a deceleration gear 232 to an lf deceleration gear 233 , but not up to the pin tractor 3 because the transfer between the lf deceleration gear 233 and a clutch gear 237 is cut off . more specifically , the clutch gear 237 is pushed toward a chassis 1 side ( in a direction where the lf deceleration gear 233 is connected ) by a clutch spring 247 that is shown in fig1 b . the clutch gear 237 , however , is separated from the lf deceleration gear 233 against the urging force exerted by a cam 251c of a slide cam 251b that interlocks with the release lever 251 . the arrangement of the lf driving mechanism when continuous sheet paper is selected will now be described . when the release lever 251 is pulled down to set the apparatus in the continuous sheet select state , as is shown in fig1 , a gear 241a of the resist roller release shaft 241 and a gear 242a of the pinch roller release shaft 242 , both of which engage a gear 251a of the release lever 251 , are rotated together in the direction indicated by the arrow a . as the resist roller release shaft 241 is rotated , as is shown in fig1 , its protrusion 241b pushes the resist roller holder 222 to separate the resist roller 11 from the feeding roller 10 and to remove the resist roller 11 from the paper feeding path . as the pinch roller release shaft 242 is rotated , the pressure exerted by the protrusion 242b on the pinch roller spring 246 is released , and the pressing force exerted by the pinch roller 12 on the feeding roller 10 is accordingly reduced . a reflective sensor 52 ( see fig1 ) is provided in part of the apparatus body , and is employed to read bar code information that adheres to an ink tank 20t or an ink jet head 20j . the ink tank 20t or the ink jet head 20j can thus be identified . the structure of a paper pan unit in this embodiment will now be explained while referring to fig1 . members and items in the unit are for a coupled driving feeding mechanism , and include a paper pan 221 , the resist roller 11 , the resist roller holder 222 , the resist roller 245 , the resist roller release shaft 241 , the pinch roller 12 , the pinch roller holder 223 , the pinch roller spring 246 , the pinch roller release shaft 242 , and a paper sensor 37 that will be described later . the unit is installed in the frame 2 from the bottom as viewed in fig1 . with this unit , ( 1 ) the assembly of the entire apparatus is easier , ( 2 ) the maintenance can be improved because of easy replacement of items , and ( 3 ) the number of assembly procedures can be reduced . since all the unit items are of the coupled driving type , the feeding accuracy of the unit does not differ from that when the items are formed as a unit . more specifically , as the drive transfer system , which includes the lf motor 28 , and the feeding roller 10 are integrally formed in the apparatus body , the normal rotation of the feeding roller 10 is constantly maintained , and the coupled driving unit , which forces a recording medium into contact with the feeding roller 10 to generate the drive force , does not interfere with the rotation of the feeding roller 10 . the structure of the paper sensor in this embodiment will now be described while referring to fig2 and 21 . the paper sensor 37 is located in the vicinity of the feeding path under the feeding roller 10 , as is shown in fig2 and 21 . the interval l from the position where the power sensor 37 detects a recording medium to the pinch roller 12 is determined to be twice a recording width in the feeding direction ( the sub scan direction ), which the ink jet head 20j can record by one scanning . in this embodiment two level buffers for image recording data are provided to develop and process the recording data at high speed . more specifically , while recording data in the buffer at the first stage are to be recorded , recording data necessary for the next scanning are developed in the second stage buffer , so that time required for data development does not directly affect the scanning time for the ink jet head 20j . after the paper sensor 37 has detected the absence of a recording medium along the feeding path , a recording area that is at least twice a recording width in the feeding direction , which is available for the recording buffers , i . e ., for one scanning recording , must be left in a recording medium . since in this embodiment a recording width in the feeding direction , which is available for one scanning , is 8 . 96 mm ( 1 / 360 inches × 127 dots ), with l of 27 . 5 mm , the above described requirement is satisfied . further , the paper sensor 37 in this embodiment is positioned 1 / 2 ( 50 mm ) of the short side of a post card away from the paper reference position , so as to detect all types of paper . a paper type discrimination sensor 37a is positioned 335 mm away from the paper reference position and located at the same position as that of the paper sensor 37 , as viewed in the cross section of the apparatus , so as to distinguish 80 digits of continuous sheet paper from 136 digits . it should be noted that data that extend beyond a determined width for a recording region are discarded . the feature of the lf motor 28 of the embodiment will now be described . the diameter of the lf motor 28 in the embodiment is designed smaller than that of the feeding roller 10 . the reason for that setting is explained below . [ lf motor having a smaller diameter than that of a feeding roller ] torque that is required for the acceleration of a motor is acquired by the following expression . tf is generated by the friction of the driving mechanism , and is characterized by the mechanical structure . when the frequency fn is reached , the activation frequency f0 , and the acceleration time tn are set to constant values and the mechanism is driven by a motor that has an identical step angle , the required torque τ is subject to the driving mechanism inertia j . the driving mechanism inertia j is the sum of the rotor inertia jr of the motor and inertia jm of the other driving mechanism , and the required torque is therefore subject to the motor - rotor inertia jr . although in general a high output = a high performance , since actually a large motor uses a lot of torque to drive the rotor of the motor , torque ( output ) that is supplied to the operation of the driving mechanism is reduced considerably more than was expected . the following means are useful to reduce the rotor inertia of the motor . ( iv ) do not provide magnetic powder for a portion that does not face a stator ; and further , an advantage of a compact motor is that the maximum response frequency is high . in this embodiment , fn = 1800 [ pps ], f0 = 600 [ pps ], tn = 16 . 758 [ m . sec ], and a motor of θ = 7 . 5 [°] is employed . further , a 2 -- 2 phase exciting driving system is adopted to improve the angle accuracy . therefore , a large motor has a low performance relative to a response frequency , and taking the specification of a product into account , employing a compact motor is more advantageous . in this embodiment , with an external size φ35 × thickness of 15 and with rotor material : nd - fe - b , rotor inertia jr = 2 . 5 [ g . cm ] is acquired and the motor driving is performed at a high speed and with a high output . an ink jet recording system of the present invention comprises means ( e . g ., electrothermal energy conversion device or laser light ) for generating thermal energy that is employed to perform ink ejection , and provides excellent effects where the ink status is varied by employing the thermal energy . this system can perform more delicate recording with a higher density . for the specific arrangement and the principle , it is preferable to employ the basic principle that is disclosed in the specifications of , for example , u . s . pat . no . 4 , 723 , 129 and u . s . pat . no . 4 , 740 , 796 . this system is applicable for both a so - called on - demand type and a continuous type . the system is especially effective with the ondemand type because at least one drive signal that corresponds to the image recording data , and that gives a rapid temperature rise which exceeds nucleate boiling , is supplied to an electrothermal energy conversion device that is positioned relative to a liquid ( ink ) bearing sheet and a liquid path . the thermal energy is thus generated by the electrothermal energy conversion device , and film boiling is effected on a thermally affected face of a recording head , so that bubbles in liquid ( ink ) can be formed in one - to - one correspondence with the drive signal . in consonance with the growth or shrinkage of the bubbles , liquid ( ink ) is discharged via an ejection opening and at least one droplet is formed . when the drive signal has a pulse form , the size of the bubble is immediately and properly altered , so that liquid ( ink ) which has an especially excellent response can be preferably ejected . an appropriate pulse drive signal is described in the specifications of u . s . pat . no . 4 , 463 , 359 and u . s . pat . no . 4 , 345 , 262 . with the employment of the conditions that are described in the specification of u . s . pat . no . 4 , 313 , 124 , which relates to the temperature rising rate on the thermally affected face , even more excellent recording can be performed . besides the arrangement of a recording head , disclosed in the above described specifications , wherein the ejection ports , the liquid path , and the electrothermal energy conversion device are combined , the present invention also includes the arrangement disclosed in the specifications of u . s . pat . no . 4 , 558 , 333 and u . s . pat . no . 4 , 459 , 600 , wherein a thermally acting portion is located in a curved area . in addition , the effects of the present invention can be obtained in the arrangements disclosed in japanese patent application laid - oden no . 59 - 123670 wherein a common slit serves as an ejection portion for a plurality of electrothermal energy conversion devices ; and in japanese patent application laid - open no . 59 - 138461 wherein an opening in which a pressure wave of thermal energy is absorbed corresponds to an ejection portion . in other words , according to the present invention , recording is ensured to be efficiently performed regardless of the shape of a recording head . the present invention is also applicable to a recording head of a full line type whose length corresponds to the maximum width of a recording medium that a recording apparatus can handle . such a recording head may be a combination of a plurality of recording heads to attain the length , or may be one integrally formed recording head . moreover , the present invention is effective for the above described serial type recording head , a recording head that is fixed to the apparatus body , a replaceable , chip type recording head that can be electrically connected to the apparatus body or can receive ink from the apparatus body , or a cartridge type recording head for which an ink tank is integrally formed . it is desirable that ejection recover means for a recording head , and extra auxiliary means be provided as additional components of the recording apparatus arrangement because the effect of the present invention can be provided more steadily . more specifically , capping means for a recording head , cleaning means , pressurizing or absorption means , extra heating means provided by employing an electrothermal energy conversion device or another heating device , or a combination of the two , and extra ejection means for discharging ink that is not required for the recording can be employed . although only one recording head is provided for a single ink , a plurality of recording heads may be mounted that correspond to a plurality of inks for which recording colors and densities differ . more specifically , the present invention is effective not only for the apparatus that has a recording mode with only a main color , black , but also for an apparatus that provides at least one full color mode , which has different color combinations or color mixture , with either an integrally formed recording head or a combination of a plurality of recording heads . further , although ink has been explained as a liquid in the above described embodiments of the present invention , ink that solidifies at room temperature or lower and that melts or liquefies at room temperature may be employed . or , since an ink jet system generally maintains the temperature of ink within the range of 30 ° c . to 70 ° c . to hold the viscosity of ink within the steady ejection range , ink may be used that liquefies at the time of the execution of a recording signal . in addition , to aggressively prevent the temperature from rising due to thermal energy by employing that energy to liquefy solid ink , or to prevent the evaporation of ink , ink may be employed that solidifies while it settles down and is liquefied by heating . the present invention is available for ink that is liquefied by the application of thermal energy , such as ink that is liquefied by providing thermal energy in consonance with a recording signal and is then discharged , or ink that becomes solid by the time it reaches a recording medium . the ink in this case may be formed opposite an electrothermal energy conversion device while it is held as a liquid or a solid in a porous sheet recess or a through hole , as is described in japanese patent application laid - open no . 54 - 56847 or japanese patent application laid - open no . 60 - 71260 . in the present invention , the above described film boiling system is the most effective for these ink types . further , an ink jet recording apparatus according to the present invention is employed as an image output terminal for a data processing apparatus , such as a computer , a copy machine that is combined with a reader , or a facsimile that has a communication function . as described above , the present invention ensures that a recording medium can be maintained flat during the feeding process and during the recording process , regardless of whether the recording medium is cut sheet paper or continuous sheet paper , and can prevent distortion and thus provide high quality image recording . | 1 |
various embodiments are described by way of example to illustrate the principles employed in the invention . fig1 illustrates a beam resonator 10 comprising two substantially parallel beams 10 a and 10 b which are rigidly connected at their extremities . the connections of the beams at their extremities are substantial and yokes 11 and 12 thus formed at the extremities have a high stiffness . the beams are therefore referred to , in the terminology of modal beam analysis , as ‘ clamped ’. the vibration of the beams is denoted by the arrows y . such a resonator , referred to herein as ‘ clamp - clamp ’, will resonate at a first mode natural frequency given by the equation : f = frequency e = young modulus i = mass moment of inertia m = mass / unit length l = beam length if the connecting yoke 11 at one end of the resonator 10 is substantially weakened the beams can no longer be considered clamped , as they are allowed a degree of rotation about their connection point , in the terminology of modal beam analysis the yoke is then approaching the ‘ pinned ’ condition . this condition is shown in fig2 , and the ‘ clamp - pinned ’ system will now resonate at a natural frequency given by the equation : from equations ( 1 ) and ( 2 ) it can be seen that the transition from fully clamped to fully pinned results in an approximately 30 % change in frequency . if the yoke connection is lost the beams are referred to as ‘ free ’, and the clamped - free system now resonates at a natural frequency given by the equation : from equations ( 2 ) and ( 3 ) it can be seen that the transition from fully pinned to fully free results in an approximately 77 % change in frequency . in addition to a change in frequency , the modal shape of the clamp - clamp system differs significantly to that of the clamp - pinned arrangement . a generalised view of the displacement of the beam in clamped and pinned mode is shown in fig3 . the curve 30 illustrates the variation in maximum displacement of the beam over its length when the yokes 11 and 12 are ‘ clamped ’. the curve 31 illustrates the corresponding displacement when the yoke 11 is ‘ pinned ’. fig4 shows the variation of local beam bending with respect to position along the beam for the clamp - clamp state ( curve 40 ) and the clamp - pinned state ( curve 41 ). there are further modal changes as the clamp - pinned condition progresses to clamped - free . a sensor , such as a piezoelectric device , responding to localised beam flexure would exhibit a signal response with position along the length of the beam in a manner similar to the profiles shown in fig4 . as well as a voltage amplitude variation with length there can also be observed a polarity change , or phase change , of the vibration signal along the length . in summary , the transition from a clamp - clamp state to a clamp - pinned state , or from a clamp - pinned state to a clamp - free state results in changes in frequency , amplitude and phase of vibration relative to position on beam . it also follows that a change from clamp - clamp to clamp - free will obviously have a similar result . the measurement of change of these parameters in response to an event influencing the modal classification of the resonator ( e . g . clamp - clamp to clamp - pinned , clamp - pinned to clamp - free ) forms the basis of this invention . in applications where there is depletion of a substance or build - up of material , such as corrosion or scaling , the actual substrate may form a stiffening member on the beam yoke and thus contribute to the status of the yoke as clamped or pinned . fig5 shows a simple embodiment of a dual beam system , similar to that shown in fig1 . depletion of material at the connection of the beams forming yoke 11 produces a thinner , less substantial connection as shown at 13 in fig5 and can produce a change to a pinned state at this end of the resonator . however in general such a system would require significant depletion of material to manifest a modal change . improvements on this basic system are shown in fig6 and fig7 ; in both these cases the simple connection yoke 11 is replaced by a box section 15 . the section achieves its stiffness from the spatially separated members 14 and 14 a , and a small reduction of thickness of a part of either member 14 , 14 a will manifest a substantial change in rigidity — thus altering the stiffness of the section . fig6 particularly shows a system where in the rigidity of the box section is modulated by the longitudinal stiffness of the member 14 . fig7 shows the segments 16 and 17 between the members 14 and 14 a ; they will significantly influence the rigidity of section 15 if their flexural or longitudinal stiffness is altered . fig8 shows a refinement of the system in fig6 and allows for a ‘ bolt - on ’ section stiffener 18 to be used to join the beams at the end in place of member 14 . the stiffener 18 is secured by bolts 19 to each of the beams 10 a and 10 b , this forms a convenient means of selecting the material , shape and size of a section member to suit a particular application . fig9 a illustrates a specific embodiment based on the system shown in fig8 , although in principle any of the systems previously described could be used . piezoelectric transducers are strategically placed to indicate the amplitude and phase of the flexure of the beam at a specific location . the signal from each transducer relates directly to the modal pattern formed by the clamp or pinned condition of the yoke . lateral vibration of the beam structure is shown by the arrows y . in the system shown in fig9 a , piezoelectric transducers 21 , 22 and 23 are disposed at different locations along the inner surface of the lower beam 10 b in order to obtain a measure , represented by the relevant piezo output voltage , of the displacement of the beam at those locations when the system is in a resonant vibratory mode induced by a drive piezoelectric transducer 24 disposed ( in this example ) at the clamped end of the resonant beam system . in this system the transducer 23 acts as a reference , because it is located close to a node and the displacement of the adjacent part of the resonator is minimal . the drive transducer 24 may have a regenerative feedback connection ( known per se in the art ) from one or more of the sensing transducers 21 , 22 or 23 . electromagnetic drive and sensing transducers may be used in place of piezoelectric transducers . other forms of transducer , such as capacitative , optical or acoustic transducers may be used as appropriate . fig9 b is a graph of piezo voltage against distance measured along the beam , the curves 90 and 91 being for the clamped and pinned condition respective at the end 11 . the particular piezo voltages are given by the intersections of the projection lines 21 , 22 a and 23 a ( through respective transducers 21 , 22 and 23 ) with the curves 90 and 91 . the embodiment shown in fig9 includes an enclosure 93 for the sensor , the enclosure comprising a tube which has a gland 94 for wires to pass to the transducers through a closed end of the tube . o - ring seals 95 and 96 are disposed between the beam structure 10 and the tube near the ends of the tube , from the open end of which the box section 15 protrudes . fig1 illustrates the variation of the piezoelectric voltages v a and v b , from the sensors 21 and 22 ( curves 101 and 102 ) and the frequency of resonance ( curve 103 ), as a function of the decreasing stiffness of the section stiffener 18 . curve 101 exhibits a phase change ( shown at 104 ). the curve 100 shows the substantially constant piezo voltage v ref obtained from the transducer 23 . it follows that the progress of any physical , chemical , or biological effect leading to the depletion or build - up of the sacrificial section stiffener material can be monitored by measuring the modulation or variation of these piezoelectric sensor signals over time . as an example , a section stiffener made from iron will have its thickness , and hence its stiffness depleted , in a corrosive environment over time and measurement of va , vb or frequency will indicate the rate of corrosion . it further follows that selection of other materials in the electrochemical series can exhibit the same corrosion / deposition effects in the appropriate electrolyte or reactive medium . signal processing techniques , such as the following , can be employed to enhance the result : ( a ) division of va by vb will result in a ratio dependent on section stiffness but independent of amplitude of signals or system damping . ( b ) division of va or vb by vref will result in a ratio dependent on section stiffness but independent of amplitude of signals or system damping . ( c ) measurement of phase of vb will form a simple method of indicating the point at which a specific section stiffness is reached . ( d ) a plurality of piezoelectric sensor mounted alone the beam can be monitored for change of phase to indicate progress of change of section stiffness . ( e ) if the resonator is at fill temperature equilibrium with its environment the modal shape will indicate section stiffness independently of temperature . ( f ) frequency signal has some temperature dependency so comparison of modal shape with frequency signal will yield both temperature and section stiffness from a single resonator . in general terms the invention can provide a force transducer . with the section stiffener removed as shown in fig1 ( which otherwise resembles fig9 ) the stiffness of the pinned yoke will be altered towards the clamped state by the presence of external forces 111 , 112 on the yoke , either in compression or tension . these forces can be mechanical , electrical or magnetic . the movement of the beams 10 a and 10 b will create a velocity and therefore a shear action within a fluid . by measuring energy loss , or the quality factor q , of the signal the viscous shear loss can be determined , and thus the fluid viscosity . similarly , the damping capacity of any solid connected to the yoke can be determined from the q of the resonant signal . the elastic properties of a viscoelastic fluid can be derived from the change in resonant frequency due to the stiffening of the yokes a result of the elastic modulus of the fluid . fig1 illustrates sectionally a different embodiment in which the beam structure 10 comprises an internal cyclindrical beam 120 and an external cylindrical beam 121 . the beams are connected by a relatively thick yoke member 122 at a ‘ clamped ’ end and by a yoke member 123 at the other end . reduction of the stiffness of this yoke 123 changes the connection at this end from ‘ clamped ’ to ‘ pinned ’. fig1 includes sensing transducers 21 , 22 and 23 disposed on the external beam and a drive transducer 24 disposed on the yoke member 122 . the beam structure is enclosed by a tube 93 which has a gland 94 and intermediate o - ring seals 95 and 96 . fig1 is similar to fig1 but illustrates vibration of the structure in a longitudinal mode ( arrow x ). as a further example , fig1 a and 14 b shows the degeneration of a clamp - pinned structure 10 shown in fig1 a to the clamp - free condition as the member 11 at one end vanishes the structure is clamped at its other end 140 . all the resonators can be operated in harmonic modes above the natural frequency . there are proportional movements in modal / frequency behaviour at higher modes than a fundamental mode . | 6 |
turning now to fig2 the initial setup between the terminal and the kdc must be made in an authentic manner such that the information transported to the terminals from the kdc is not modified . one implementation is where the transport is made within a secured area , such as secured area 23 . since subsequent communications between the kdc and each terminal depend upon the prior communication , it is important that at some period in time they both contain the proper information for start - up , and ideally this is done in the secured area so that there can be no breach of security . on the initial system setup ( based on the secured area implementation shown in fig2 ) the terminals are brought within the secured area 23 , and the kdc can generate terminal - unique key pairs for each terminal . the exact function of these key pairs will be described later . the kdc will generate a terminal - unique decryption key for each terminal and the corresponding encryption key . this encryption key must be placed in the terminal - unique key storage for each terminal with the corresponding decryption key stored in the terminal - unique key storage at the kdc under the address of that terminal . in addition , a random number , ua for terminal a , unique to each terminal is stored in the verification information storage at the kdc also at the address of this terminal . this same random number must be loaded and stored in the verification information storage in the terminals and will be used for a verification check on the first call setup to the kdc . fig3 and 4 are flow charts representing the action that occurs within a terminal , for example , terminal a . fig5 is a flow chart representing what actions occur within the key distribution center . the discussion which will follow is a discussion with respect to a time sequence between the terminal and the kdc to illustrate both how terminal - unique keys are updated , and how call - setup and session keys are distributed . this discussion will occur with respect to fig6 through 28 . fig6 through 19 show the apparatus within the terminal and show on a step - by - step basis how the call - setup keys and the session keys are established . fig2 through 28 show the apparatus within the kdc , each figure showing a specific operational aspect of the establishment of the keys . turning now to fig6 we will discuss the specific apparatus used in the terminals . the actual generation of the numbers will be discussed hereinafter . apparatus 72 is a random number generator which is a device or algorithm that produces bits ( zeros and ones ) that are equally likely to occur . this generation may be based upon a noisy diode and any number of algorithms can be used to attain statistically independent output of 0 &# 39 ; s and 1 &# 39 ; s . the more equally likely these random number generators are , i . e ., the more random this function is , the higher the security level will be . the output of the random number generator is a serial stream of zeroes and ones where the correlation between one or a group of bits is zero . the bidirectional asymmetric key generator , apparatus 73 , takes as input a random number from random number generator 72 and will compute an encryption key and the matching decryption key such that the encryption key cannot be derived from the decryption key and vice versa . the generation of these keys as an example could be done in accordance with the rsa algorithm , as described by rivest , shamir , and adleman in a paper entitled , &# 34 ; a method for obtaining digital signatures and public key crypto systems , 38 which publication is hereby incorporated by reference , which appeared in cacm , vol . 21 , no . 2 , february , 1978 , on pages 120 - 126 . apparatus 74 implements a bidirectional asymmetric cryptographic algorithm ( e . g ., the rsa algorithm ) that is , a cryptographic algorithm based on two distinct keys where the encryption key cannot be derived from the decryption key and vice versa . apparatus 74 has two inputs ( i and k ) and one output ( o ). the input i is the bits to be encrypted or decrypted . the input k is the key , either encryption or decryption ( the rsa algorithm performs the same function regardless of encryption or decryption ). the output will be the inputted bits encrypted or decrypted with the supplied key . this algorithm is also described in the aforementioned paper . functionally , apparatus 75 is the embodiment of two functions f and g such that : given f ( r , p ) and p , one cannot determine r ; g ( r1 , f ( r2 , p ), p )= g ( r2 , f ( r1 , p ), p ); and given f ( r1 , p ), f ( r2 , p ), and p one cannot determine r1 , r2 , or g ( r1 , f ( r2 , p ), p ). apparatus 75 performs the above functions via , for example , the diffie - hellman algorithm , which is described in a paper by diffie and hellman entitled &# 34 ; new directions in cryptography ,&# 34 ; published by the ieee transactions on information theory , vol . ip - 22 , november , 1976 , on pages 644 - 655 , which is hereby incorporated by reference . the input to this algorithm is a base y , a modulus q and an exponent exp . the output is y raised to the exp power modulus the q . the functions f and g are the same as discussed above in this example . the storage requirements are depicted by registers 71 , 70 and 76 . these are the semi - permanent register 71 which contains both the verification information va and the terminal - unique key information eak used to encrypt messages to the kdc . temporary register 70 can be in any state initially and is used during the interaction with the kdc on a secure call setup . the address register permanently contains the address ( i . e ., a public piece of information that uniquely identifies a to the kdc ) of the terminal ( terminal a in this case ) where it is located . during a secure session ( or call ) setup , the address register will also contain the address of the terminal which is being called . the registers containing verification information and encryption and decryption information may vary in size depending upon the specific algorithm used but in this example should be on the order of 1 , 000 bits each . information pertaining to the symmetric session key and the random number should be on the order of 100 bits , and the address information will be dependent upon a terminal numbering plan both unique and known to the kdc . for example , it could be the telephone number of the specific terminal or it could be the serial number of the terminal . turning to fig2 we will now discuss the working of the modules within the key distribution unit . the address register at the kdc , register 200 , performs the same function as the address register at the terminal . the rsa function at the kdc , apparatus 210 , performs the same function as the rsa function at the terminal , as previously described . the random number generator , apparatus 211 , performs the same function as the random number generator at the terminal previously mentioned . the generator of the encryption and decryption keys apparatus 212 has the same function as described previously in the terminal . apparatus 213 is a generator of the parameters used as inputs to the apparatus 75 described previously . for this particular example these parameters are the base and modulus for the diffie - hellman algorithm . it requires as input the output of the random number generator , apparatus 211 . the method of generation is described in the aforementioned paper by diffie . there is a semi - permanent storage at the kdc , registers 214 and 216 , which stores verification information va and terminal - unique decryption key information dak between calls . semi - permanent registers 215 and 217 are used to store information during the call setup progress . these registers have the same functions as described previously for the terminal . the operation of the system will now be explained beginning with fig3 . initially the key management equipment in the terminal will be in the wait state until a request is received from the terminal controller processor to initiate a secure call . at this point , as discussed , there is stored in the terminal the terminal - unique encryption key that will be used to encrypt information that is sent to the kdc . also stored is the verification information . these two pieces of information were stored from the last call ( or from the initial setup ) that was made by this terminal . this is shown in fig6 as va and eak . once a request is received to initiate a secure call , the address of the called party must be given to the key management equipment via the controller processor . this is seen in fig3 box 31 . at this point , there are generated new call - setup keys . this is shown in box 32 and in fig7 as eka and dka . in box 33 there is shown the generation of partial session keys that will be used to encrypt data on the link from terminal b to terminal a . this is shown in fig8 as eba and dba . at this point , the verification information is updated using the keys that were just generated . the update function is specified as follows : where &# 39 ; denotes updated and va1va2 = va . va is the stored verification information and the e &# 39 ; s are the just - generated encryption keys . the properties of f are as follows : ( 1 ) for every v , e1 , e2 : f ( v , e1 )≠ f ( v , e2 ) where e1 ≠ e2 ; ( 2 ) for every v21 , v2 , e : f ( v1 , e )≠ f ( v2 , e ) where v1 ≠ v2 ; ( 3 ) given v and v &# 39 ;≠ f ( v , e ) it is difficult to determine e ; and ( 4 ) in the case where e is an asymmetric encryption key , d cannot be determined from e . for this example , va &# 39 ;= va1 &# 39 ;| va2 &# 39 ; where va = va1 | va2 , va1 &# 39 ; is equal to va1 encrypted with eka , and va2 &# 39 ; is equal to va2 encrypted with eba . this update process is depicted in fig9 . the first half of the verification information va1 is read from storage and provided as an input to the rsa algorithm . the key that is used to encrypt this information is the call - setup key , eka , that was just generated . this becomes va1 &# 39 ; and overwrites va1 as seen in fig1 . next , the second half of the verification information va2 is encrypted using eba just generated . the result va2 &# 39 ; overwrites va2 in the storage register . this is shown in fig3 box 34 , and in summary , the updated verification information va &# 34 ; is the verification information stored from the previous call , or given to the terminal on the initial setup from the kdc , where half is encrypted using the encryption part of the partial session key generated on this call and the other half is encrypted using the call - setup key for that call . at this point , as shown in box 36 , fig3 and in fig1 , the message can be formatted to the kdc . the contents of this message are the encryption parts of the two keys that were just generated . both the partial session key to be established between terminal a and b , eba , and the new call - setup key eka are encrypted using the terminal - unique encryption key eak stored from the previous call from the kdc to the terminal or given to the terminal on the initial setup . at this point , the information that can be destroyed from the terminal is the terminal - unique encryption key , eak , stored at the terminal from the previous call , and both the call - setup encryption key , eka , and the partial session encryption key , eba , that were generated by the terminal . the encrypted message is then appended to the address , a , of the originating terminal followed by the address , b , of the called terminal . this message is now sent to the kdc . the terminal now will enter a wait state waiting for the information to be received from the kdc . this is depicted in box 37 of fig3 . as shown in fig5 the kdc will be in a wait state until a message is received from terminal a . this is shown in fig5 box 50 . once the message is received , the kdc reads the address information within the message into the address register which gives it the index of the decryption key that must be used to decrypt the message . the kdc has in its storage from the previous call the matching verification information for each terminal and the terminal - unique decryption key for each terminal . this is depicted in fig2 , boxes 214 and 216 . the message from terminal a is decrypted using the terminal - unique decryption key corresponding to that terminal , dak . the keys , both the new call setup key eka and the partial session key eba ( to be distributed to terminal b ) is temporarily stored in the kdc memory as depicted in fig2 . at this point , as shown in fig2 , the kdc can update its verification information in the exact same manner as the terminal . this is done by encrypting each half of the stored verification information va with the received session key information eba and the received call - setup key information eka , shown in fig2 . this produces the update verification information va &# 34 ;. the key distribution center , as shown in fig2 , will now generate a bidirectional asymmetric encryption / decryption key pair , eak &# 39 ;, dak &# 39 ;. the primes denote updated information . eak &# 39 ; will be distributed to terminal a to be used on the next call setup to the key distribution center . the decryption key dak &# 39 ; overwrites the decryption key dak that was stored from the previous call . two other pieces of information are also generated at this time . these are the parameters that will be used by the terminals to create symmetric session keys ; in this case they are the parameters of the diffie - hellman algorithm . one is the base y and the other is the modulus q as previously described . functionally , the amount of information that is generated at the kdc and sent to each terminal may vary depending upon the precise algorithm . this information is stored in temporary storage and will be used as part of the message sent back to both terminal a and terminal b . this generation process is depicted in fig2 and refers to the flow chart box 55 , fig5 . by this point , as shown in fig2 , the kdc must have received a message from terminal b in order to complete the call to terminal a . if not , the kdc process for terminal a must wait until the process for terminal b has reached this point . this is so it can give terminal a the partial session key information eab generated at terminal b and also to be able to give terminal b the partial session key eba generated at terminal a . coordination between the processes must take place so that the same parameters generated by one process overwrites the parameters generated by the other process . this insures that the parameters sent to the terminals for the purpose of generating symmetric session keys are the same . once the internal exchange is made between the a registers and the b registers to coordinate the information inside the key distribution center , the messages can now be formatted for the terminals . this is shown in fig2 . the message to terminal a will consist of the new terminal - unique key information eak &# 39 ; that will be used on a subsequent call to the kdc . it will also consist of the partial session key information eab which it received from terminal b . it will also consist of the verification information va &# 34 ; or a known reduction of va &# 34 ; in terms of the number of bits . it will also consist of the base y and the modulus q of the diffie - hellman algorithm . these five pieces of information will be encrypted using the call - setup key eka received in the message from terminal a . the kdc destroys eka , eba , eak &# 39 ;, y , and q corresponding to terminal a and destroys ekb , eab , ebk &# 39 ;, y , and q corresponding to terminal b . the kdc will then send this output message back to terminal a . an analogous encrypted message is sent from the kdc to terminal b . at this point the kdc is finished with its processing . fig2 shows the configuration of the kdc after the call to terminal a has been dropped . the kdc has updated verification information va &# 34 ; and updated terminal - unique decrypt key information dak &# 39 ; which will be used on a subsequent call between terminal a and the kdc . referring back to the flow chart , fig3 for terminal a , the key management equipment at the terminal has been in a wait state while the kdc has been functioning . fig1 shows the key information stored at the terminal during this wait state . it is the updated verification va &# 34 ; information and both decrypt keys dka and dba corresponding to the previously generated encryption keys . fig1 shows how the information received from the kdc is used in accordance with the box 38 , fig3 . the call - setup decryption key dka is used to decrypt the message received from the kdc . the five values ( previously discussed ) sent from the kdc are now used in the following way . the first piece of information is the new distribution key eak &# 39 ; that is stored in the semi - permanent register 71 and will be used on a following call made from this terminal to the kdc . it is the updated terminal - unique encryption key . the second piece of information is the partial session key eab which was generated at b and sent through the kdc to terminal a . the third piece of information is the updated verification information va &# 34 ;, which can now be compared with the verification information stored at terminal a . the fourth and fifth pieces of information are the parameters to the diffie - hellman algorithm , the base y and the modulus q , which terminal a stores in temporary storage . referring to fig4 box 40 , at this point the terminal will compare the verification information it received from the kdc and either the verification information which is presently stored or some known reduction of that verification information -- fig1 . if this matches , then the process will continue as normal . if this does not match , an alarm could be given to the terminal controller processor of a potential intruder threat on a previous call . assuming a success of the compared verification , the terminal can now take down the channel to the kdc and establish a channel to terminal b , if not already established . at this point , terminal a and terminal b can communicate data securely using the asymmetric session keys eab and eba . if a symmetric session key is needed , the following steps can be taken . the calculation of the message to be sent to terminal b is shown in fig1 . first , the base y and modulus q of the diffie - hellman algorithm are used along with a random number ra generated by the random number generator 72 . these inputs are given to the diffie - hellman algorithm 75 and the output is then an input to the rsa function 73 . the random number ra is also stored in temporary storage . eab is used as the key to the rsa function 73 . at this point the session key information eab received from terminal b and the base number y may be destroyed . the output of the rsa algorithm is sent to terminal b . terminal a &# 39 ; key management equipment will now enter a wait state shown in fig4 box 44 , waiting for a message to be returned from terminal b . the idle state is depicted in fig1 and in storage is the decrypt session key dab which terminal a generated , the modulus q of the diffie - hellman algorithm generated by the kdc and the random ra number that was generated by terminal a . as shown in fig1 , upon receipt of the message from terminal b , terminal a will decrypt the message using its decryption key dba stored from the initial generation of the partial session key . dba can now be destroyed . the output of this will be fed into the diffie - hellman algorithm as the base . the exponent will be the random number ra which was priorly generated and the modulus q is also input into the algorithm . the output of the diffie - hellman algorithm will be symmetric session key information which will equal the session key information that terminal b has calculated . q and ra can now be destroyed . at this point , terminals a and b have established symmetric session key information between themselves that is not derivable by the kdc . this key information may be used in a symmetric key algorithm like the data encryption standard ( des ) to encrypt data . what is stored now in the terminal until the next request for a secure session ( or call ), as shown in fig1 , is the updated verification information va &# 34 ; and the terminal - unique key eak &# 39 ; which it received from the kdc to be used to encrypt the next message to the kdc . it should be noted that the actual generation of the desired data at the terminal and at the kdc is operative under control of a computer processor and is programmed in accordance with the flow charts shown in fig3 - 5 to perform the sequence of data transfers detailed herein . such a processor , while not shown , can be any one of several well - known microprocessors , such as for example , the intel 8086 microprocessor , working in conjunction with the terminal and kdc apparatus shown and detailed herein above . it should also be noted that one skilled in the art could use different encryption algorithms and different equipments to achieve the same results disclosed herein without departing from the spirit and scope of our invention . | 7 |
while the present invention is susceptible of embodiment in various forms , there will hereinafter be described , presently preferred embodiments , with the understanding that the present disclosure is to be considered as an exemplification of the invention , and is not intended to limit the invention to the specific embodiments disclosed herein . the nonwoven laminate of the present invention is comprised of coarse denier meltblown filaments , wherein a spunbond resin is utilized with a conventional meltblown process so as to capture thicker filaments . in general , the meltblown process utilizes a molten polymer is extruded under pressure through orifices in a spinneret or die . traditionally , high velocity air impinges upon and entrains the filaments as they exit the die . usually the energy of this step is such that the formed filaments are greatly reduced in diameter and are fractured so that microfibers of finite length are produced . utilizing a spunbond resin with a lower melt flow rate , as well as lowering the air pressure , however , allows the collected filaments to take on a thicker diameter , providing the overall collective web with a desirable coarse texture . the process to form either a single layer or a multiple - layer fabric is continuous , that is , the process steps are uninterrupted from extrusion of the filaments to form the first layer until the bonded web is wound into a roll . methods for producing these types of fabrics are described in u . s . pat . no . 4 , 041 , 203 , hereby incorporated by reference . the resultant filaments may be of various cross - sectional profiles , which are not considered a limitation to the practice of the present invention . in a particular embodiment , a polypropylene spunbond resin , commercially known as pp3155 made available by exxon chemical company was utilized . the aforementioned resin had a 35 mfr and was extruded at an average die temperature of 562 ° fahrenheit with an approximate throughput of 7 . 1 grams / hole / min . further , the distance between the meltblown die and the collective surface was around the order of 19 inches . the resultant meltblown filaments have a denier between that of 5 and 50 microns . suitable polymers that may be used in the meltblowing process of the present invention include those selected from the group consisting of polyolefins , polyesters , polyetheresters , and polyamide . optionally , prior to extrusion , the single polymeric resin can be compounded with various melt - additives , so as to assist with the processing conditions , enhance the performance of the web , or enhance the appearance of the web , such additives including , but not limited to thermal stabilizers , colorants , and aromatics . the dual purpose cleaning wipe of the present invention also comprises a soft , absorbent layer capable of picking up liquids and particulates . a nonwoven of this nature may be a fibrous nonwoven layer or a continuous filament nonwoven layer . in general , continuous filament nonwoven fabric formation involves the practice of the spunbond process . a spunbond process involves supplying a molten polymer , which is then extruded under pressure through a large number of orifices in a plate known as a spinneret or die . the resulting continuous filaments are quenched and drawn by any of a number of methods , such as slot draw systems , attenuator guns , or godet rolls . the continuous filaments are collected as a loose web upon a moving foraminous surface , such as a wire mesh conveyor belt . when more than one spinneret is used in line for the purpose of forming a multi - layered fabric , the subsequent webs are collected upon the uppermost surface of the previously formed web . the web is then at least temporarily consolidated , usually by means involving heat and pressure , such as by thermal point bonding . using this means , the web or layers of webs are passed between two hot metal rolls , one of which has an embossed pattern to impart and achieve the desired degree of point bonding , usually on the order of 10 to 40 percent of the overall surface area being so bonded . when staple fibers are utilized to form the absorbent nonwoven layer , the fibers may begin in a bundled form as a bale of compressed fibers . in order to decompress the fibers , and render the fibers suitable for integration into a nonwoven fabric , the bale is bulk - fed into a number of fiber openers , such as a garnet , then into a card . the card further frees the fibers by the use of co - rotational and counter - rotational wire combs , then depositing the fibers into a lofty batt . the lofty batt of staple fibers can then optionally be subjected to fiber reorientation , such as by air - randomization and / or cross - lapping , depending upon the ultimate tensile properties of the resulting nonwoven fabric . the fibrous batt is integrated into a nonwoven fabric by application of suitable bonding means , including , but not limited to , use of adhesive binders , thermobonding by calender or through - air oven , and hydroentanglement . in one embodiment , the absorbent precursor web and the meltblown precursor web are juxtaposed and hydroentangled on a three - dimensional image transfer device . such three - dimensional image transfer devices are disclosed in u . s . pat . no . 5 , 098 , 764 , which is hereby incorporated by reference . the two precursor webs may be advanced onto the three - dimensional image transfer device so that the meltblown precursor web is facing the hydraulic jets of the hydroentanglement process and the absorbent precursor web is in contact with the three - dimensional transfer device . hydroentangling the precursor webs in this manner allows for the meltblown filaments to become more integrated into the absorbent precursor web . further , the meltblown filaments fragment with the force of the water through the meltblown web . the resultant laminate is more drapeable due to the fragmented meltblown filaments . in a second embodiment , the absorbent precursor web and the meltblown precursor web are juxtaposed and hydroentangled on a three - dimensional image transfer device . the two precursor webs may be advanced onto the three - dimensional image transfer device so that the absorbent precursor web is facing the hydraulic jets of the hydroentanglement process and the meltblown web is in contact with the three - dimensional transfer device . hydroentangling the precursor webs in this manner allows for the meltblown filaments to remain substantially more intact . the resultant laminate is stiffer due to minimal fragmentation of the meltblown filaments . in a third embodiment , the meltblown filaments are extruded and collected directly onto the absorbent precursor web and then subsequently hydroentangled on a three - dimensional image transfer device . optionally , the dual performance nonwoven laminate may comprise an additional layer , including , but not limited to a microporous film , a supportive member , such as a spunbond or mesh scrim , or a barrier layer of sorts . further , the laminate may be comprised of apertures of varying shapes and sizes wherein the apertures extend either partially or entirely though the laminate . further still , the laminate may optionally be impregnated with a cleaning agent or placed within a tub or other packaging means containing the desired cleaning agent . the dual performance cleaning laminate embodying the principles of the present invention are suitable as a dry or wet wipe substrate for cleaning both domestic and industrial surfaces , and further for use in skin / facial cleaning . the present nonwoven fabric wipe can be provided in forms that are suitable for use as a dry wipe to absorb liquid , and to provide extra scrubbing effect , as needed . | 1 |
fig3 is a block diagram of the present invention . as shown in fig3 , a quartz oscillator 10 is used as a frequency generator , which sends out a modulation signal and a sampling signal and ensures initial phases of these two signals are locked . the modulation signal passes a programmable pll 12 to have a frequency f 0 . the sampling signal passes a divider 22 to get a lower sampling frequency f sp . the modulation signal then passes a circuit switch 32 . because the circuit switch has not been activated yet , the modulation signal is immediately sent to a laser diode 14 without any change . the modulation signal drives the laser diode 14 to produce a laser light beam emitted to a target 16 . this beam is reflected by the target 16 and then received by an optical receiver ( not shown ) in a receiver 18 . the receiver 18 demodulates the laser light beam into a reception signal . next , the reception signal is transmitted by a non - activated circuit switch 34 to an analog - to - digital converter 20 . the sampling signal with the sampling frequency f sp first passes an amplifier 24 and a schmitt trigger 26 to get a better sampling pulse , and is then transmitted to the analog - to - digital converter 20 . the reception signal is sampled in the analog - to - digital converter 20 according to the frequency f sp of the sampling signal to get a v ad digital signal . the sampled result is subsequently sent to a data processor 28 for further processing . in order to get the phase shift caused by the circuit itself and make correction , a microprocessor 30 and a calibration component 36 can be used to control the circuit switches 32 and 34 so that the modulation signal is directly sent to the analog - to - digital converter 20 after passing the calibration component 36 and is then sampled using the same sampling frequency , thereby obtaining another v ad digital signal . the data processor 28 can thus subtract the phase shift caused by the circuit itself . the data processing process in the data processor 28 is shown in fig4 . the modulation signals with the high modulation frequency f 0h and the low modulation frequency f 0l and the sampling signal s d [ k ] are multiplied by ri [ k ] and rq [ k ] generated by the program , respectively ( step s 10 ). the frequency of the modulation signal can be controlled by the programmable pll 12 to be high or low . next , arctangent operations are performed to let the range of function be within − π / 2 ˜ π / 2 ( step s 12 ). phase unwrapping is then performed to convert the phase into the range of 0 ˜ 2π ( step s 14 ). subsequently , the distance and the resolution are obtained ( steps s 16 to s 20 ). finally , a high - precision distance is acquired through scale combination calculation . the distance calculation steps by means of phase are illustrated below . the laser light beam emitted by the laser diode is received by the receiver . in view of phase , phase change will surely occur in this process , which can be expressed as : φ = 2 π f 0 t d = 2 π f 0 ( 2 d / c ) ( 1 ) where f 0 is the modulation frequency , t d is the light travel time , d is the distance , and c is the light speed . because the phase repeats every 2π , the maximal measured range ( or called non - ambiguity range ( nar )) can be obtained from ( 2 ): the light wave emitted by the laser diode that is modulated by the frequency f 0 and the reception signal can be respectively expressed as : s e ( t )= ŝ e [ a e + cos ( 2 π f 0 t )] ( 5 ) s d ( t )= ŝ d [ a + cos ( 2 π f 0 t + ψ d + φ e )] ( 6 ) where ψ d is the phase shift generated during light propagation , φ e is the phase shift generated by the modulation signal in the instrument , ŝ e and ŝ d are the amplitude of the emission and reception light wave , respectively . because the two signals have no negative values , a dc term a e and a is added in the formulas . the under sampling technique is then exploited . if f sp is the sampling frequency and nf sp is the frequency closest to f 0 , the reception signal after sampling can be expressed as : s d [ k ]= ŝ d [ a + cos ( 2 π f 0 kt sp + ψ d + φ e )] ( 7 ) where t sp = 1 / f sp and k is an integer . the synchronous signals ri [ k ]= sin ( 2 πf al kt sp ) and rq [ k ]= cos ( 2πf al kt sp ) with the frequency f al = f 0 − nf sp are multiplied by the reception signal s d [ k ] to get new signals mi [ k ] and mq [ k ]. if 2 πf al kt sp = k π / 2 , then f sp = 4 f 0 /( 4n + 1 ), ri [ k ]= sin ( k π / 2 ), rq [ k ]= cos ( k π / 2 ), where f sp = 4 f 0 /( 4n + 1 ) can be acquired by adjusting the frequency f 0 of the modulation signal . that is , when the sampling frequency and the modulation frequency are related as above , mi [ k ] and mq [ k ] can be respectively expressed as : mi [ k ] = s d [ k ] × ri [ k ] = { a + cos [ 2 π f 0 kt sp + ( ψ d + ϕ e ) ] } sin ( k π / 2 ) = 1 / 2 { cos [ ( 2 n + 1 ) k π ] sin ( ψ d + ϕ e ) - sin ( ψ d + ϕ e ) } + a × sin ( k π / 2 ) ( 8 ) mq [ k ] = s d [ k ] × rq [ k ] = { a + cos [ 2 π f 0 kt sp + ( ψ d + ϕ e ) ] } cos ( k π / 2 ) = 1 / 2 { cos [ ( 2 n + 1 ) k π ] cos ( ψ d + ϕ e ) + cos ( ψ d + ϕ e ) } + a × cos ( k π / 2 ) ( 9 ) every four consecutive k values are grouped together . when k is odd , mi [ k ] are averaged to get ave ( mi [ k ]). when k is even , mq [ k ] are averaged to get ave ( mq [ k ]). table 1 shows the values of mi [ k ] and mq [ k ] for k = 0 ˜ 3 : because the value of an arctangent function tan − 1 is defined between − π / 2 and π / 2 , the phase obtained by the formula ( 10 ) is also within the range between − π / 2 and π / 2 . the signs of the numerator and the denominator of the arctangent function correspond to the signs of sin φ and cos φ , respectively . because both sine and cosine are continuous functions with a modulo of 2π , the quadrant where the phase belongs can be determined according to the signs of the numerator and the denominator of the arctangent function . table 2 is used to unwrap the phase to the range between 0 and 2π . this technique is called phase unwrapping . if the distance between the receiver and the target is 0 , φ e can be obtained in the same way . the formula ( 10 ) is subtracted by φ e to get the phase shift , and the formula ( 2 ) is then used to obtain the distance . when the frequency f 0 is high , the measured range is small but the resolution is high ; when the frequency f 0 is low , the measured range is large but the resolution is low . to sum up , the present invention proposes a multi - modulation frequency laser range finder and a method for the same , in which the sampling frequency is fixed , and a programmable pll is used to adjust the frequency of the modulation signal , thereby accomplishing a modulation frequency with multiple choices . users can select two appropriate frequencies based on the distance to be measured to acquire the actual distance after calculation . moreover , the circuit of the present invention is more simplified as compared to the prior art . only one pll and two transfer switches are required , and it is not necessary to use any mixer . the errors and the cost can thus be greatly reduced . although the present invention has been described with reference to the preferred embodiment thereof , it will be understood that the invention is not limited to the details thereof . various substitutions and modifications have been suggested in the foregoing description , and other will occur to those of ordinary skill in the art . therefore , all such substitutions and modifications are intended to be embraced within the scope of the invention as defined in the appended claims . | 6 |
the present invention is based on the discovery of a family of compositions that can produce glasses of excellent stability which can be cerammed to produce substantially transparent glass - ceramics containing forsterite as the predominant crystal phase . the present inventive forsterite glass - ceramics are suitable for employment in the telecommunications industry when doped with transition metal - ions , such as cr 4 + . forsterite ( mg 2 sio 4 ), an orthosilicate of the olivine family with only 33 mole % silica , does not form a glass , even on rapid quenching . the challenge , then , was to create a stable glass from which forsterite , and not the more siliceous mg - rich crystals like enstatite ( mgsio 3 ), could form . the best approach seemed to be to attempt to produce a stable glass with a tendency towards amorphous phase separation on cooling or subsequent reheating . the dispersed phase could be made rich in mgo and the continuous phase rich in glass - formers like silica and alumina . hence , the present inventive , substantially transparent glass - ceramic is based on a composition consisting essentially , in weight percent on an oxide basis , of it should be noted that alkali other than k 2 o can be used . partial molar replacement of k 2 o up to about 50 %, by li 2 o , na 2 o , rb 2 o , and cs 2 o is possible . the most preferred composition range , for best transparency , is based on a composition consisting essentially , in weight percent on an oxide basis , of to secure fluorescence in the inventive , substantially transparent forsterite glass - ceramics , up to 1 wt . % chromium oxide is added to the parent glass , with the preferred range being about 0 . 003 to 0 . 3 wt . % chromium oxide . the following table sets forth a number of glass compositions , expressed in terms of parts by weight on the oxide basis , illustrating the parameters of the present invention . the table also presents the ceramming schedule in ° c . and hours , as well as the crystal phases observed in each resulting glass - ceramic . inasmuch as the sum of the individual components in each recited glass approximates 100 , for all practical purposes the tabulated values may be deemed to reflect weight percent . the batch ingredients for preparing glasses falling within the inventive composition ranges may comprise any materials , either the oxides or other compounds , which , upon being melted together , will be converted into the desired oxide in the proper proportions . the exemplary glasses were produced in the following manner . the batch materials were compounded , mixed together to assist in securing a homogeneous melt , and then placed into platinum crucibles . the crucibles were introduced into a furnace operating at temperatures of 1400 - 1600 ° c ., and the batches were melted for 4 - 16 hours . the melt was poured as free “ patties ” and transferred to an annealer operating at about 550 - 600 ° c . the glass patties were subjected to a ceramming cycle by placing them into a furnace and heat treating according to the following schedule : a first exposure to a temperature within the range of about 600 - 800 ° c . for a period of time sufficient to generate the development of nuclei therein , usually about between 2 - 16 hours . second , the nucleated glass patties were then exposed to a temperature within the range of about 900 - 1000 ° c . for a period of time sufficient to effect the growth of crystals on the nuclei . the period of time will generally be about between 1 - 4 hours . the inventive compositions are self - nucleating due to liquid - liquid phase separation and therefore require no added nucleating agents . more specifically , nucleation is promoted by amorphous phase separation . however , even though nucleating agents are not required , in most cases the addition of nucleating agents , such as tio 2 ( up to 5 wt . %), results in a finer crystal size and improved transparency . the crystalline phases of the resulting glass - ceramic materials were identified using x - ray powder diffraction . in the inventive glass - ceramics , transparency is a function of the microstructure which is a function of the composition and heat treatment . the microstructure of the inventive glass - ceramics contains forsterite microcrystals of 10 - 50 nm in size ( in preferred compositions ) in a stable alkali aluminosilicate glass . the total crystallinity ranges from about 10 % to 50 % by volume depending on the individual composition . the forsterite microcrystals which make - up the crystalline phase are internally grown in the base glass during the ceramming cycle . the forsterite crystal structure in the present inventive , glass - ceramic material provides both tetrahedral and octahedral cation sites of appropriate size to house transition metal cations . specifically , the forsterite microcrystals can concentrate certain transition metals into specific crystalline sites , for example cr 4 + into tetrahedrally - coordinated sites , and cr 3 + , ni 2 + , co 2 + , cu 2 + , and mn 2 + into octahedrally - coordinated sites . thereby , optical activity is obtained in the inventive glass - ceramics . as known in the optics and laser art , crystals with tetrahedrally - coordinated cr 4 + ions provide unique optical characteristics . therefore , in one possible application , the present inventive , transparent , forsterite glass - ceramics doped with transition metal ions , are suitable for employment in the optics and laser industries in such specific applications as optical amplifiers and pump lasers . in laboratory experiments , example 3 was doped with 0 . 05 wt . % cr 2 o 3 , and fluorescence measurements were taken . as shown in fig1 the chromium emission spectra for the present forsterite glass - ceramics vary with the state of oxidation . generally , a cr 3 + peak just below 1 μm is observed as a shoulder on a cr 4 + peak centered near 1 . 2 μm . the latter is enhanced by increasing the state of oxidation of the parent glass . potential applications for the present inventive , substantially transparent , forsterite glass - ceramic materials include femtosecond and tunable lasers , wide - band optical fiber amplifiers , and regenerative amplifiers in the near infrared . although the present invention has been fully described by way of examples , it is to be noted that various changes and modifications will be apparent to those skilled in the art . therefore , unless otherwise such changes and modifications depart from the scope of the present invention , they should be construed as included therein . | 2 |
the main components of a configuration file translation system 10 , according to the present invention , are shown in fig1 . the system 10 generally includes one or more data dictionaries 12 and a translator 14 , as will be described in greater detail below . the system 10 interfaces between a source device having one or more existing source configuration scripts 20 and a destination device requiring the translation of the source configuration script ( s ) 20 . the system 10 translates source commands in the source configuration script ( s ) 20 into destination commands in one or more output or destination configuration scripts 22 . the system 10 can include any number of the data dictionaries 12 . each of the data dictionaries 12 preferably contains the information needed by the translator 14 to convert the source script 20 for one specific source device to the destination script 22 for one specific destination device . for example , if there is a product x that has 2 versions , and there is a desire to translate scripts from both x . 1 and x . 2 to be usable for a product y , there would be 2 data dictionaries : x . 1 —& gt ; y and x . 2 —& gt ; y . there is no limit on the number of data dictionaries ( and therefore devices ) the translator 14 can support , provided there is a meaningful way for a user to select the correct dictionary to use for a particular script translation . in the describing the translation of a script from a device x for use on a device y , the device x is referred to herein as the “ source device ” and device y is referred to herein as the “ destination device .” the data dictionaries 12 are preferably used in combination with the translator 14 but may also be used independently to facilitate manual translation , if desired . moreover , the data dictionaries 12 may be plain text or encrypted text . in addition , the data dictionaries 12 may be supplied by the supplier of the translator 14 or they may alternatively be generated by the user and then compiled with the translator 14 . the translator 14 can be a standalone application or a sub - module of a broader network management application . the data dictionaries 12 preferably describe source commands and corresponding destination commands according to predefined assumptions and syntax rules . each command preferably includes a series of keywords and parameters , and some command definitions include optional keywords and / or parameters . in some cases , one source command for the source device may translate into two or more destination commands for the destination device to implement the same functionality . in some cases , one or more source commands for the source device may not have any corresponding destination command ( s ) for the destination device ( e . g . if a feature is not supported on the destination device ). based on these assumptions , a data dictionary syntax can be defined and used to describe the translation of any source script to any destination script . in the exemplary embodiment , the configuration scripts are command line interface ( cli ) configuration scripts having cli commands , although other types or forms of commands are within the scope of the present invention . a cli command basically includes a number of keywords and some parameters , where sections of the command may be recursive . for example , a cli command to configure a t1 / e1 channel group is described as follows : the keywords in this command are shown in bold , while the parameters are shown in italics . the description of this command specifies that the range parameter can recur several times . for example , a valid command would be : channel - group 2 timeslots 1 - 3 , 5 - 7 , 9 - 11 , 13 , 16 , 18 speed 64 the exemplary data dictionary syntax rules and the manner in which the translator 14 interprets the data dictionary script language will now be described in greater detail followed by illustrative examples . hypothetical cli commands are used in the examples but should not be construed as actual cli commands or as a limitation on the present invention . each of the data dictionaries 12 includes dictionary entries describing source commands ( i . e ., a source command block ) used by the source device and the corresponding destination commands ( i . e ., a destination command block ) used by the destination device . information in the data dictionary is case insensitive . for any cli command being described , the keywords are listed as is in the dictionary . any parameters are indicated using a “%” symbol , followed by a character indicating the parameter type . the defined types include % s for strings , % a for ip addresses & amp ; masks ; % x for a hexadecimal number ; % d for a decimal number ; and % m for mapping parameters ( see example 10 ). to uniquely identify a parameter within a command , a number is appended to the type character described above . for example , a command containing two hexadecimal numbers would use % x1 to describe the first parameter and % x2 to describe the second parameter . if a parameter can take a specific set or range of values , this is indicated by providing the range enclosed in “& lt ;” and “& gt ;” after the parameter name ( see example 2 ). a parameter name that is used both in the source command and in one or more of the destination commands means that the parameter value is to be copied into the destination command ( see example 1 ). a parameter name in a destination command ( e . g . % s2 ) that has no counterpart in the source command results in a failure to translate . the type description of a parameter is used to resolve possible ambiguous commands . for example , if there is a command that has a different meaning depending on the parameter , the indicated type can be used to determine the correct command at translation time . there is preferably no further processing of the type field beyond resolving ambiguous commands . this implies that if the dictionary maps command - x % d1 to command - y % d1 and the script contains command - x somenumber , the translator output will be command - y somenumber . any portion of a cli command that can occur more than once ( such as the range parameter in the channel - group command example above ) is enclosed within a “^” symbol to define a recursive block . a recursive block of a cli command can be separated by either a comma or a space ( see examples 4 and 5 ). this is indicated by adding a comma in the block specification . for example , ^ port % d1 ^ indicates that the specified block can occur many times as port 1 port 2 port3 etc . if the entry was specified as ^ port % d1 ,”, the final comma indicates that the command syntax is port 1 , port 2 , port 3 etc . recursive command blocks cannot be nested . if a command contains optional parameters , they are enclosed in square brackets . cli commands with optional parameters are internally expanded into all the possible combinations of optional parameters ( see example 7 ). if an argument is optional in the source command , it is also optional in the destination command . only those combinations in which all required destination command arguments are found in the source command are taken into account . in one example , commands can only contain up to 32 optional parameters , and nested optional blocks are allowed ( see examples 8 and 9 ). it is possible that a parameter in the source command needs to be manipulated before being put in a destination command . for example , if one command takes a port number as an argument ( port % d1 ), and the port numbering scheme is different for the destination device in that all port numbers are offset by 1000 , this can be specified by including a mathematical expression in the destination command ( see example 3 ). all such expressions are enclosed in “& amp ;” symbols ( dest port & amp ;% d1 + 1000 & amp ;). mathematical expressions enclosed in “& amp ;” are preferably only found in destination commands and contain parameters of type % d or % x only . such expression blocks cannot contain optional or recursive arguments . if at least one of the arguments in the expression are of type hex (% x1 ), the result will also be in hexadecimal . if a destination command block contains a sentence that starts with the word “$ prompt ”, this indicates that the user will be prompted to enter the necessary cli command ( see example 11 ). if a destination command block contains a sentence that starts with the word “$ password ”, the user will be prompted to enter a username / password ( see example 12 ). any destination commands that start with the word “$ ignore ” will be ignored . this can be useful for commands with optional parameters as will be illustrated later . any comments that are found in the original script are preferably copied to the translated version as is . any commands that could not be translated are preferably copied into the destination script as a comment , with an additional line above it indicating the error , or reason the translation was not done . the above syntax rules can be used to describe essentially any cli command and provide a mapping to the corresponding destination command using the same syntax . however , it is possible that there will not always be a one - to - one mapping between commands . it may happen that a single cli command for device x could translate into a series of corresponding cli commands for device y . in order to accommodate this possibility , a destination command block containing a sequence of destination commands can be defined using block delimiters . after the description of a cli source command in the dictionary , for example , the symbols “ begin ;” and “ end ;” can be used to denote the beginning and end of a destination command block , containing the sequence of destination cli commands . these block delimiter symbols are preferably on a line by themselves . based on these syntax rules , below is an example of a dictionary entry for a fictional channel group command . assign timeslots { circumflex over ( )}% s1 { circumflex over ( )} to channel - group % d1 [ with speed % d2 ] it is possible that a command that contains a recursive argument may need to be translated into a series of cli commands each taking a single instance of that parameter . the example below describes this case , again using fictional cli commands for illustration purposes . create user tom create user bob create user marie assign password tomspasswd to user tom assign password bobspasswd to user bob assign password mariespasswd to user marie such a rule is described in the dictionary by leaving out the recursive symbol (^) from the destination command as follows : by leaving out the “^” symbol in the destination command ( s ), the translator will repeat the destination command once for each occurrence of the block enclosed in the “^” symbols . this section contains examples of dictionary entries and explains how the translator treats them internally . all of the cli commands illustrated in these examples are for illustration purposes only and are not intended to limit the invention in any way . the above block shows how a source command is translated into the corresponding destination command . the values of the arguments % dl and % d2 are copied from the original command into the destination command . if the line being translated is set interface 2 speed 5 , the resulting output will be interface 2 has speed 5 . the above example is identical to the first one , with the exception that the argument % d1 can only take on the values indicated in the range indicated . as shown , values can include ranges , or single values separated by a comma . in this case , if the line being translated is set interface 2 speed 5 , the resulting output will be interface 2 has speed 5 . if the command being translated is set interface 6 speed 5 , the translation will result in an error since interface number 6 is not in the range of valid values . the above example has the same results as the previous cases , except that in the destination command , the value of argument % d1 is offset by 1000 . any valid mathematical expression could be used including addition , subtraction , multiplication and division . the above example uses the recursive block syntax (^) to specify that an argument can be found more that once in the command . for example , a valid command could be set interface 1 2 3 4 5 6 7 speed 5000 . in this case the destination command would be interface 1 2 3 4 5 6 7 has speed 5000 . notice that the recursive argument specification in the destination command contains an extra comma at the end . this is an indication to the translator that when copying the argument values to the destination command , they must be comma separated . in this case , the command set interface 1 2 3 4 5 6 7 speed 5000 would translate into interface 1 , 2 , 3 , 4 , 5 , 6 , 7 has speed 5000 . in the above example , the argument % d1 is enclosed in a recursive block in the source command , but not in the destination command . this indicates that the destination command must be repeated several times , once for each instance of the argument . for example , the command set interface 1 2 3 4 5 6 7 speed 5000 , would result in the following output : interface 1 has speed 5000 interface 2 has speed 5000 interface 3 has speed 5000 interface 4 has speed 5000 interface 5 has speed 5000 interface 6 has speed 5000 interface 7 has speed 5000 in the above command , the parameter encapsulation % s1 is indicated to be optional . in this case , the translator expands this to contain both forms of the command , so the above entry is equivalent to having the following : in this case , the command set interface 1 speed 5000 is translated into interface 1 has speed 5000 based on the first rule . the command set interface 1 speed 5000 encapsulation ppp will be translated into interface 1 has speed 5000 with encapsulation ppp based on the second rule . set interface { circumflex over ( )}% d1 { circumflex over ( )} speed % d2 [ encapsulation % s1 [ state % s3 ]] the above source command has nested optional parameters . in this case the command is again expanded into all its possible forms as illustrated below : set interface { circumflex over ( )}% d1 { circumflex over ( )} speed % d2 encapsulation % s1 state % s3 set interface { circumflex over ( )}% d1 { circumflex over ( )} speed % d2 [ encapsulation % s1 [ state % s3 ]] the above example is identical to the previous one , except that in this case the argument start % s3 is optional in the source command but not in the destination command . in this case , the possible combinations are : set interface { circumflex over ( )}% d1 { circumflex over ( )} speed % d2 encapsulation % s1 state % s3 all other combinations are ignored by the translator since the arguments found in the source command must always match the arguments in the destination command ( s ). this command uses the concept of mapping . in the source command , there is a portion of the command that needs to be mapped to something different for the destination command . this is accomplished by using the mapped type (% m1 ), and then specifying the mapping within the command block . for each of the mapped parameters found in the source command , there is preferably a map description block located within the command description . a map description block has the following syntax : the translator will then expand the command into as many versions as there are mappings , in this case : once the command has been expanded , the usual translation rules are then applied . in the above example , when the translator encounters the given command in the cli source file , the user will be prompted with whatever string follows the “$ prompt ” keyword , and given the option to enter one or more cli commands . user / password commands are an example of a command that cannot automatically be translated , since the passwords stored in cli configuration files are typically encrypted . using the “$ password ” keyword , the translator is informed that it must provide the user with a way to enter a username / password . note that the $ ignore keyword is used here to ensure that the translator does not mind that the parameters % s1 and % s2 that are a part of the source command are not used anywhere in the destination command ( s ). with reference to fig2 , one embodiment of the translator 14 of the present invention includes three major components : a user interface module 30 , a current data dictionary module 32 , and a translator logic module 34 . the user interface module 30 contains code that is related to the translator user interface such as functions for prompting the user for input and providing feedback relating to the translation process . the current data dictionary module 32 creates the internal representation of the information contained in the data dictionary that was selected by the user based on the source device from which the script was obtained , and the destination device for which it is being translated . the translator logic module 34 contains code that processes the source configuration script and accesses the information stored in the current data dictionary to produce the translated version or destination configuration script . the user interface module 30 is preferably a simple module provided so that all user - interface - related functionality can be found in one central location , allowing the translator to be easily ported to different platforms . one embodiment of the user interface module 30 includes a single user interface class ( translatorui ). this class provides methods required to prompt the user for any input required during the translation process . in addition , it provides the necessary functions that can be used by the translator logic module 34 to display information regarding the status of the translation process . with reference to fig3 , a class diagram of the current data dictionary module 32 is shown . according to one embodiment of the current data dictionary module 32 , the functionality is implemented using the classes described in greater detail below . as described above , each cli command is considered to be composed of a set of keywords , arguments , regular expressions , and other elements . a class is used to represent each of the elements comprising a cli command such that each command is converted into command tokens ( i . e ., tokenized ) in the internal representation of the current data dictionary . the base class for all of the elements or command tokens is the command token class ( cmdtoken ) 40 . it contains some virtual functions to determine the token type and contents . a token container class ( tokencontainer ) 50 is used as a base class to any other classes that can contain lists of command tokens or any of its derived classes . a command keyword class ( cmdkeyword ) 42 is used to represent any keywords that are found in a cli command . it inherits from cmdtoken and provides the same basic functionality . a command mapped class ( cmdmapped ) 44 is used to represent a mapped type as described in example 10 above . it inherits from cmdtoken and additionally contains a table describing the mappings described in the dictionary . a command argument class ( cmdargument ) 46 is used to represent arguments found in cli commands . it inherits from cmdtoken and additionally contains parameter range information . a command regular expression class ( cmdregexp ) 48 is used to represent regular ( mathematical ) expressions found in the data dictionary . it inherits from cmdtoken and provides additional functions to evaluate a regular expression . a command recursive class ( cmdrecursive ) 50 is used to represent a recursive portion of a cli command description . it inherits from cmdtoken . since a recursive block can contain a number of tokens , this class also inherits from tokencontainer . in addition to inherited functionality , it contains a list of tokens that can be found in the recursive block and the recursive block delimiter ( comma or space ). a command optional class ( cmdoptional ) 52 is used to represent a part of a cli command description that is enclosed in square brackets , meaning that it is an optional parameter . it inherits from cmdtoken . since an optional block in a cli command description can contain a number of tokens , this class also inherits from tokencontainer . in addition to inherited functionality , this class contains a list of tokens found in the optional command block . a dictionary entry class ( dictionaryentry ) 56 is used to represent a single cli command description found in the current data dictionary . note that this class is used to describe both source and destination cli commands . it contains a method through which a cli command description can be passed . the dictionaryentryclass converts the provided command into a series of tokens as described above , and stores the information hierarchically in a list . a destination command class ( dstcommand ) 58 is used to represent a series of cli commands . a single source cli command may map to a number of destination cli commands . this “ group ” of destination commands is contained in a single dstcommand instance . this object contains methods to allow a new cli command description to be added to the group . it also provides a function to test whether a given source command can be mapped to the contained group of destination commands by verifying that all required parameters exist . it further provides a translate method which produces the result given an existing cli source command . a source command class ( srccommand ) 60 is used to represent a cli command that is read from the source cli script . it can take a cli command string and convert it into a series of tokens for internal representation . it also provides some methods to check for necessary arguments and to check whether it maps to a given source script command line . a dictionary entry container class ( dictentrycontainer ) 62 is used to represent a complete entry described in the data dictionary . it links an instance of dictionaryentry containing a source command description , with an instance of dstcommand containing the corresponding set of destination command descriptions . a dictionary class ( dictionary ) 64 is used to contain the internal representation of all the information contained in the data dictionary script file . it contains a list of dictentrycontainer objects . it provides functions to add entries , to sort the dictionary alphabetically by source command string , to load a data dictionary from a file descriptor , and to locate an entry ( using binary search ) that maps to a specific source command string . when loading a data dictionary , all entries that contain mapped arguments or optional components are automatically expanded into a number of entries . the above classes are used to represent the information contained in the current data dictionary . the data structures forming the internal representation 68 of the data dictionary are shown in fig4 . a dictionary object 70 is created for the current data dictionary . each command described in the current data dictionary is expanded into one or more dictentrycontainer objects 72 . each such dictentrycontainer object 72 contains a pointer to a dictionaryentry object 74 representing the source command and a pointer to a dstcommand object 76 , which contains a list of dictionaryentry objects 78 representing the group of corresponding destination commands . in the exemplary embodiment , the dictionary object 70 is a singleton and only one data dictionary can be loaded into memory at any given moment . after all the commands described in the data dictionary have been represented in memory using the above objects , the dictionary is ordered alphabetically by source command string . this allows a binary search algorithm to be used when searching through the dictionary for entries matching a given command . the translator logic module 34 ( fig2 ) contains the functionality needed to implement the translation logic . based on user input , it loads the appropriate data dictionary files and makes the necessary calls to build the internal data structures . when a cli script is selected for translation , it makes the necessary calls to load each command , search through the dictionary to find the matching entry , and generate the appropriate output based on the source cli command and the destination dictionary entries . one embodiment of the translator logic module 34 includes a single class ( translator ) that provides the functions described in detail below . in one example , the translator software is created using an object oriented programming language , such as c ++. other software implementations of the translator modules and other forms of data structures for representing the current data dictionary are also within the scope of the present invention . in one example , the translator software is run offline on a host pc , although other implementations are contemplated . referring to fig5 , one method of translating a configuration script into a destination script is described in greater detail below . the first step in a translation is to select the dictionary that must be used , step 110 . the specific dictionary selected is based on the type of device for which the existing cli script was created and the type of device for which it is being translated . once the appropriate dictionary is selected by the user , the translator class reads the text file and builds the internal representation 68 of the current data dictionary ( fig4 ), step 112 . when a dictionary entry is read from the data dictionary file , the source cli command is first converted into a sequence of tokens which are put into a dictionaryentry object 74 . any ranges that are encountered in the source command string are encapsulated in a cmdargument object that is created to represent the given argument . once the dictionaryentry object describing the source cli command has been created , it is inserted into a dictentrycontainer object 72 . the translator class then proceeds to load the destination cli commands that are found between the “ begin ;” and “ end ;” block delimiters of the dictionary entry . each destination cli command is tokenized in the same way as described above , and the tokens are used to construct the corresponding dictionaryentry object 78 . each of the destination cli commands is represented by a single dictionaryentry object 78 . the dictionaryentry objects 78 that correspond to the destination cli commands are grouped together by inserting them into a dstcommand object 76 . this dstcommand object 76 is then inserted into the dictentrycontainer object 72 created in the first step , thus establishing the link between the source cli command and the group of destination cli commands in a dictionary entry . each such dictentrycontainer object 72 is inserted into the global dictionary object 70 , so that after all the entries in the dictionary text file have been processed , the data dictionary internal representation data structure is populated . once the complete dictionary has been loaded into memory as described above , the source configuration script is processed , step 114 . the translator class reads the cli script file to be translated line by line and translates each of the cli commands found . the first step is to convert the source cli command into a series of tokens using the srccommand class . once that is done , the data dictionary internal representation is accessed to find corresponding destination commands , step 116 . the first token is extracted from the series of source command tokens , and the dictionary data structure is searched to find an entry that begins with the same token . since the dictionary data structure is alphabetically ordered , a binary search algorithm is applied . it is possible that there are several forms of a command that begin with the same keyword . for this reason , when the binary search algorithm terminates , a sequential search is performed to find the first and last dictionary entries that begin with the desired token . this search results in a group of dictionary entries that may potentially be used to translate the original cli command . for each of these potential dictionary entries , the translator class attempts to match the tokenized source cli command to the tokens in the dictionary entry , step 118 . if the tokens match , a reference to the dictionary entry is kept , otherwise it is ignored . at the end of this process , if there are no dictionary entries left , the translator class calls the appropriate translatorui method that either prompts the user asking for manual translation or inserts a comment into the output script indicating that the command could not be translated ( depending on application options ), step 120 . if the search process yields exactly one dictionary entry , step 122 , the commands contained in that entry &# 39 ; s dstcommand object 76 are used to generate the appropriate output , step 124 . if more than one dictionary entry matches the cli command , the translatorui class is called which presents the available options and prompts the user to select the dictionary entry to use for the translation , step 126 . the commands contained in the dstcommand object 76 of the selected entry are then used to produce the output , step 124 . this process is repeated for each command in the source cli script until all commands have been translated , step 130 . in summary , the cli translation system 10 of the present invention provides users with the ability to translate cli configuration scripts intended for one specific type of device , into scripts that provide the same functionality ( where possible ) but use the cli syntax of a different type of device . this makes the process of upgrading network infrastructure much simpler , since it automates what was before a tedious and time consuming task . the translation system 10 allows a user to take an existing cli configuration script , specify the device for which it was created , select the device on which it is to be loaded , and the translator will generate a new script for the specified destination device . modifications and substitutions by one of ordinary skill in the art are considered to be within the scope of the present invention , which is not to be limited except by the following claims . | 8 |
fig2 illustrates the main blocks of a computer 30 capable of performing the present invention method . minor blocks and sub - blocks are well known in the art and omitted for clarity . the computer 30 includes a processor ( e . g . cpu ) 32 , a memory 34 , and a display device 36 . the processor 32 includes a timer ( counter ) 38 , however this device may also be supplied outside the processor 32 . the memory 34 can be a random - access memory , such as sdram or flash memory , or a read - only memory . the memory may be external to the processor 32 as depicted or may be a memory internal to the processor . further provided to facilitate user input / output are several peripheral devices : a keyboard 40 , a touchpad 42 , and another device 44 ( e . g . mouse ). a control program 46 is provided in the memory 46 for controlling operations of the keyboard 40 and touchpad 42 according to the present invention method . the computer 30 can be provided in a compact notebook housing such as that shown in fig1 , as a larger desktop computer , or as a small handheld device ( i . e . pda , mobile phone ). as a whole , the computer 30 is capable of performing a wide variety of operations and computations . the keyboard 40 comprises multiple keys ( see fig1 for example ) and outputs a digital signal to the processor 32 corresponding to key states . this can be realized by , for example , the well - known keyboard basic input output system ( bios ), although other methods are not excluded . the keyboard 40 is capable of generating three events at the processor 32 : ( 1 ) a make event generated at the instant that a key of the keyboard 40 is depressed , ( 2 ) a break event generated at the instant a key is released , and ( 3 ) a repeat event generated after a key is held down for longer than a repeat threshold time . in the following a single key is discussed , as the effect of multiple keys being depressed simultaneously or sequentially is equivalent to a single key being depressed according to the principle of superposition . the touchpad 42 is of a standard variety and may include specialized supporting buttons , such as those used to emulate mouse input . the touchpad 42 can be a wired or wireless device such as touchpads 14 , 26 illustrated in fig1 . the touchpad 42 utilizes an electrode grid or other device to output a position or movement signal to the processor 32 for interpretation . irrespective of the inner workings , the touchpad 42 allows a user to sweep a finger or stylus across its surface to generate the position or movement signal . in the following , the touchpad 42 is active ( turned on ) by default , and temporarily deactivated ( turned off ) according to the present invention method . cooperative operation of the touchpad 42 and the keyboard 40 is achieved by the control program 46 . please refer to fig3 showing a schematic diagram of operations of the control program 46 . as mentioned , the keyboard 40 is capable of generating a make event 50 , a break event 52 , and a repeat event 54 at the processor 32 . when these events are detected , the control program 46 performs the following : on the make event 50 : turn off the touchpad 42 , turn on the timer 38 ; on the break event 52 : turn off the touchpad 42 , turn on the timer 38 ; on the repeat event 54 : turn on the touchpad 42 , turn off the timer 38 ; on timer 38 expiry : turn on the touchpad 42 . as the touchpad 42 may be in use during any of these events , execution of the break event 52 is conditional on the touchpad 42 not outputting position / movement signals . that is , when the touchpad 42 is being operated by the user , the break event 52 does not turn off the touchpad 42 and does not turn on the timer 38 . the timer 38 expiry event can be realized by counting for a predetermined deactivation interval . when the deactivation interval is reached , the timer 38 turns on the touchpad 42 . the deactivation interval can be set to one value or set to different values depending on whether the make event 50 or break event 52 occurs . please refer to fig4 illustrating a flowchart that further defines operation of the control program 46 performing the present invention method . such a flowchart can be readily converted into a program of a suitableprogramming language ( i . e . c , assembly language ) and then compiled into executable code by one skilled in the art . the procedure illustrated in fig4 is executed on the make , break , and repeat events 50 , 52 , 54 . in step 100 , key states of the keyboard 40 are detected . if a key press is detected in step 100 , then step 102 determines if there is user input at the touchpad 42 . when no user input is detected at the touchpad 42 , step 104 is determines if the timer 38 is already on . upon determination that the timer 38 is off , step 106 is executed . step 106 turns the touchpad 42 off and turns the timer 38 on . next , step 108 determines if the break event 52 is responsible for execution of this procedure . if the break event 52 has occurred , step 110 ( like step 102 ) determines if there is user input at the touchpad 42 . finally , if the touchpad 42 is not being used for input , step 112 turns off the touchpad 42 and turns on the timer 38 . the procedure of fig4 evaluates conditions for turning the touchpad 42 off and accordingly turning the timer 38 on , and is independent of timer code . fig5 illustrates flowchart of a periodically executed timer procedure performed in conjunction with the procedure of fig4 . the procedure of fig5 could be called by a timer interrupt . in step 200 , the procedure determines if the timer 38 on . if the timer 38 is found to be on , step 202 increments the timer count . then , step 204 checks if the touchpad 42 deactivation interval has been reached . when the deactivation interval has been reached , i . e . the timer 38 has elapsed , step 206 activates the touchpad 42 and resets the timer 38 . together the procedures of fig4 and fig5 realize the operations of the control program 46 as illustrated in fig3 . fig6 illustrates a timing diagram of the result achieved by the present invention method . as can be seen , the make event 50 or break event 52 turns off the touchpad 42 for the deactivation interval . once the deactivation interval has elapsed , the touchpad 42 is reactivated . fig6 shows how activation of the touchpad 42 and deactivation of the timer 38 by the repeat event 54 depends on the lengths of the repeat threshold time and the predetermineddeactivation interval of the touchpad 42 . when the repeat threshold time is shorter than the deactivation time , the repeat event 54 reactivates the touchpad 42 and turns off the timer 38 . oppositely , when the repeat threshold time is longer than the deactivation time , the timer reactivates the touchpad 42 . as such , depending on the specific application , either detecting the repeat event 54 or the activation of the timer 38 on the make event 50 may be omitted . in addition , the repeat threshold and the deactivation interval may be one and the same . finally , in fig6 , the conditional deactivation of the touchpad on the break event 52 is shown by dashed line 90 . a touchpad and keyboard can be used in combination according to five main scenarios , all of which the present invention addresses . the first scenario is keyboard use only , in which accidental touchpad use is undesirable . here , turning off the touchpad 42 for the deactivation interval upon a key press or release prevents unwanted input though the touchpad ( e . g . shirt sleeve brushing the touchpad ). so , during typing where multiple keys are depressed and released continuously , the touchpad 42 remains effectively inactive . the second scenario is touchpad use only . since the present invention leaves the touchpad 42 turned on by default , uninterrupted touchpad use is possible . the third scenario is a transition from typing to touchpad use . as the user moves his hand from the keyboard 40 to the touchpad 42 , the deactivation interval expires and the touchpad 42 becomes activated and ready to accept input . the fourth scenario is a transition from touchpad use to typing , which the present inventionaccommodates . finally , the fifth scenario is simultaneous touchpad and keyboard use . the fifth scenario is facilitated by the resulting action of the break event 52 being dependent on if the touchpad 40 is in use . the present invention computer 30 and method as executed by the program 46 as described addresses these combination scenarios better than the prior art hot key approach , which tends to make combined touchpad and keyboard use inconvenient . in contrast to the prior art , the present invention automatically deactivates a touchpad according to keyboard keys being depressed , held depressed , and released . as a result , the present inventioneliminates the need for a manually activated hot key and offers improved convenience over such approach . those skilled in the art will readily observe that numerous modifications and alterations of the device may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims . | 6 |
referring to fig1 , an example nanoplasmonic system 10 includes optical sources 12 , nanotransducers 14 , and a nanoplasmonic device 20 . the nanoplasmonic device 20 includes a heatable layer 22 having a heating side 24 and a cooling side 26 and a cooling structure 28 adjacent to the cooling side 26 . the cooling structure 28 includes nanostructures described more fully below . the heatable layer 22 may be , for example , a magnetic memory material responsive to heat , a photovoltaic cell , or a lithography material . in operation , each optical source 12 and nanotransducer 14 combination can produce a sub - wavelength spot 16 of optical energy on the heatable layer 22 . the nanotransducers 14 may be , for example , known devices for localizing incident radiation into a sub - wavelength heated spots such as nanoparticles , nanoantennas and nanowaveguides . each spot 16 corresponds to a localized energy receiving site . would also be possible to translate a single optical source 12 and nanotransducer 14 combination to successively illuminate the spots 16 . radiative heat transfer at the nanoscale is the fundamental mechanism in coupling the sub - wavelength optical spots 16 produced by each optical spot 12 and nanotransducer 16 combination . when two objects are not in contact , i . e . when these two objects are separated by a distance , there is still a heat transfer between objects due to radiative heat transfer . the heat is transferred between these two bodies through electromagnetic radiation . classically , this electromagnetic radiation from an object is related to the temperature of the object , and is known as the blackbody radiation . the electromagnetic radiative heat transfer from an object to another object not only depends on the temperature of the radiator , but also other factors as well , including the distance between two objects . electromagnetic radiation from an object scales with 1 / r , where r is the distance from the object . the electromagnetic power scales with 1 / r ̂ 2 . however , at the nanoscale , that is , the sub - wavelength scale , when objects are separated by less than sub - wavelength scale , the radiative heat transfer between the surfaces can be several orders of magnitude higher than predicted by planck &# 39 ; s blackbody radiation . the radiative heat transfer at sub - wavelength distances can be three orders of magnitude higher than the prediction by planck &# 39 ; s blackbody radiation . this enhancement is due to electromagnetic energy tunneling of the evanescent fields , and excitation of surface plasmon or phonon polaritons on the structures . there are several ways to enhance this radiative heat transfer between objects . when the objects are brought into the sub - wavelength near - field regime , the radiative energy transfer between objects is enhanced due to evanescent coupling of the electromagnetic energy between objects . this phenomenon is also referred to as photon tunneling , and it is observed if the objects are separated by less than the wavelength of light . in addition , surface plasmon resonances or phonon resonances also improve the electromagnetic energy transfer . if the structures support surface plasmon resonances or surface phonon resonances , the electromagnetic energy transfer substantially increases . as used herein , plasmonic cooling or phononic cooling correspond to cooling an object through enhanced energy transfer when one or more of the structures supports surface plasmon resonances or surface phononic resonances , respectively . while the space or gap between objects may be , for example , air or vacuum , material such as dielectrics may also be used . referring to fig2 , the nanoplasmonic device 20 includes a heatable layer 22 and a cooling structure 28 ′ formed on a substrate 30 . the substrate may be for example a semiconductor or dielectric material such as silicon or any other suitable material such as ceramic glass or amorphous glass and is generally much thicker than the other layers . the heatable layer may be , for example , 5 nm to 30 nm thick . the cooling structure 28 ′ may be , for example , 5 nm to 200 nm thick . the cooling structure 28 ′ is formed from a dielectric or semiconductor 32 with embedded nanoparticles 34 that support surface plasmon or phonon resonance . the size of the nanoparticles 34 can be between 5 nm and 200 nm . it is expected that particle sizes on the order of 5 nm to 20 nm is preferable . the alternating pattern of particles as a percentage of total width can be referred to as the duty cycle . a typical duty cycle for the particles is around 50 percent . the dielectric 32 can be , for example , an oxide such as silicon dioxide , titanium dioxide , or tantulum pentoxide . the nanoparticles 32 can be made of metals such as gold , silver , aluminum , platinum , or copper to support surface plasmon resonances . alternatively , the nanoparticles 32 can be made of sic , cubic boron nitride ( cbn ), hexagonal boron nitride ( hbn ), or boron carbide bc to support surface phonon resonances . these structures can be fabricated using different techniques . one potential way to fabricate these structures is the thin - film deposition and patterning techniques , which are well - known and heavily utilized by semiconductor companies and hard - disk drive companies . thin film layers can be deposited using different techniques such as sputtering , thermal evaporation , or ion beam deposition . the patterning of these structures can be achieved using photolithographic techniques . alternatively , patterning of these structures can also be achieved using more recently developed techniques including self - ordered arrays or nanoimprint lithography . different patterns can be made of nanoparticles embedded into a dielectric or semiconductor layer . different patterns can be obtained by using different duty - cycles between particles . also , different patterns include the possible shapes that can form the cross section of the layer . different patterns can refer to different cross sections of nanoparticles , including , for example , spherical , cylindrical , rectangular and square . different patterns can also refer to different arrangements of these particles with respect to each other , including regular distribution with constant duty - cycle and random distribution . this utilizes the coupling between fundamental electromagnetic and thermal phenomena . placing patterned structures that can support surface plasmon resonances and phonon resonances improve the localized electromagnetic and optical field distribution around these regions . such localized and improved optical fields improve the radiative energy transfer between these particles and the heatable layer thereby improving the localized heating and cooling . referring to fig3 , the nanoplasmonic device 20 includes a heatable layer 22 and a cooling structure 28 ″ formed on a substrate 30 . the substrate may be for example a semiconductor or dielectric material such as silicon or any other suitable material such as ceramic glass or amorphous glass and is generally much thicker than the other layers . the heatable layer may be , for example , 5 nm to 30 nm thick . the cooling structure 28 ″ may be , for example , 5 nm to 200 nm thick . the cooling structure 28 ″ includes a gap 36 between the heatable layer 22 and the polariton layers 38 , 40 , 42 , 44 . the gap 36 facilitates the radiative energy transfer between the layers . this gap should be very small , i . e . nanoscale scale or sub - wavelength scale , to facilitate phonon tunneling ( or evanescent energy coupling ) between the structures . the layer underneath is selected so that it supports surface phonon resonances or alternatively it can be selected to support surface plasmon resonances . this way the radiative energy transfer between the objects is further enhanced . the polariton layers 38 , 40 , 42 , 44 are a multilayer structure , where each layer may have a different thickness and material property . each layer may have a different property from the other . the stack supports surface plasmon resonances or surface phonon resonances . these are surface waves that can be excited under specific conditions . the layers can be surface plasmon resonance supporting metals such as gold or silver ; or surface phonon resonance materials such as sic , cubic boron nitride ( cbn ), hexagonal boron nitride ( hbn ), or boron carbide bc . in between the layers are dielectric layers . referring to fig4 , the nanoplasmonic device 20 includes a heatable layer 22 and a cooling structure 28 ′″ formed in the substrate 30 . the cooling structure 28 ′″ includes sub - micron channels 46 in the substrate 30 for use with a circulating cooling fluid , for example , water . inside of each channel 46 are nanorods 48 to improve heat absorption by the cooling fluid . shapes other than rods could also be employed . the cooling structure 28 ′″ may be , for example fabricated in a silicon substrate . the substrate 30 can be formed from two halves anodically bonded together and similarly bonded to the heatable layer 22 . e - beam lithography techniques can be used to form the channels in each half . before bonding , the nanostructures can be deposited by glancing angle deposition ( glad ). the nanostructures can be rods of copper for example . it should be noted that the cooling structure 28 ′″ is localized under the spot 16 . this localization can be employed in the other embodiments herein as well . this allows not only the more rapid cooling possible with nanoscale structures , but also the focusing of the cooling effects more closely to where they are needed . it should be evident that this disclosure is by way of example and that various changes may be made by adding , modifying or eliminating details without departing from the fair scope of the teaching contained in this disclosure . the invention is therefore not limited to particular details of this disclosure except to the extent that the following claims are necessarily so limited . | 6 |
referring to fig1 and 2 , the illustrated toothbrush comprises a hollow body member of a molded plastics material indicated generally at 2 and including an open - ended cylindrical portion 4 , a tapering intermediate portion 6 , a narrow neck portion 8 and an upwardly open , cup - shaped end portion 10 into which the neck portion feeds . located within the cylindrical portion 4 of the body member 2 is a cartridge 12 containing toothpaste , one end 14 of the cartridge 12 being sealed , and the other end of the cartridge 12 incorporating a piston 16 in conventional manner . actuating means for the toothbrush are indicated generally at 18 and comprise a flexible bellows 20 , the interior of which feeds into an integrally molded reservoir in the form of a tube 22 , the central axis of which is perpendicular to that of the bellows 20 . one end of the tube 22 incorporates a one - way valve 24 and the other end of the tube 22 is open . the actuating means 18 are located in the intermediate portion 6 of the body member 2 with the end of the tube 22 incorporating the one - way valve 24 extending through the one end of the cartridge 12 to interconnect the interior of said cartridge 12 with the interior of the tube 22 by way of said valve 24 , and with the other end of the tube 22 feeding into the hollow neck portion 8 of the body member 2 , and being sealed from the interior of the intermediate portion 6 . the intermediate portion 6 of the body member 2 incorporates a flexible , overmolded button 26 or thumb grip , the undersurface of which engages with the end of the bellows 20 remote from the tube 22 when said bellows 20 are in their normal expanded condition shown in fig1 and 2 . depression of the button 26 thus moves the bellows 20 into a compressed condition , subsequent release of the button 26 resulting in return of the button 26 and the bellows 22 to their normal positions as illustrated . the base of the end portion 10 of the body member 2 has an aperture 28 formed therethrough in which is mounted a control valve indicated generally at 30 . more particularly , the valve 30 , which is integrally molded from a soft thermoplastic elastomer or a silicone rubber , comprises a circular diaphragm portion 32 from one side of which projects a nose portion 34 . the control valve 30 is secured in the aperture 28 in the base of the end portion 10 as best seen with reference to fig3 a and 3 b with the radially outer regions of the diaphragm portion 32 overmolded on the bounding edge of the aperture 28 and with the nose portion 34 projecting upwardly from the base of the end portion 10 . the brush is completed by a head indicated generally at 36 and including a base plate 38 upstanding from which are a plurality of bristles 40 and in which is formed a tapered outlet 42 , again as best seen in fig3 a and 3 b . the head 36 is a sealing snap - fit into the cup - shaped end portion 10 into an assembled operative position in which the outlet 42 is axially aligned with the control valve 30 and in which the nose portion 34 of the valve 30 seats in , to seal , the outlet 42 as shown in fig2 and 3 a , the base plate 38 and end portion 10 together defining a sealed chamber in the end of the brush . on compression of the bellows 20 by depression of the button 26 , the volume within the brush between the one - way valve 24 , which prevents flow from left to right as viewed in fig2 and the outlet 42 through the base plate 38 , which is closed by the nose portion 34 of the valve 30 , is pressurised such that fluid therein , be it air or paste , is urged into forcible engagement with the one side of the diaphragm portion 32 to distort said diaphragm portion 32 whereby the nose portion 34 is displaced from the outlet 42 as seen in fig3 b , and the fluid can exit through the outlet 42 . on release of the button 26 , the bellows 20 expand and return to their normal condition shown in fig2 thus reducing the pressure in the aforementioned volume . as soon as the increased pressure is removed from the diaphragm portion 32 of the control valve 30 , the valve 30 immediately returns , by virtue of its inherent resiliency , the effect of atmospheric pressure on the side of the diaphragm portion remote from the nose portion 34 , and the slight draw - back pressure within said volume ( see below ), to its rest position with the nose portion 34 sealing the outlet 42 . the net result of the bellows 20 returning to its expanded condition is to create a suction effect in the volume between the now closed control valve 30 and the one - way valve 24 , which serves to open the valve 24 whereby paste from the cartridge 12 , which is under atmospheric pressure by way of the piston 16 , is drawn into the tube 22 . this charging of the tube 22 with paste is accompanied by movement of the piston 16 to the left as viewed in fig2 return movement to the right being prevented by one - way means ( not shown ) in conventional manner . thus it will be appreciated that initial charging of the toothbrush with paste to fill the volume downstream of the valve 24 is achieved by sequential depression and release of the button 26 . the configuration of the brush is such that on depression of the button 26 , a pre - determined quantity of paste is extruded through the outlet 42 and onto the bristles 40 sufficient for use by the user on release of the button 26 , although additional paste , if required , can be obtained by further depressions of the button 26 . as can be seen in the drawings , and in particular in fig3 a , the nose portion 34 of the valve 30 in the rest position thereof extends substantially to the outer end of the outlet 42 and seals against said outer end in a knife edge manner whereby no previously extruded paste can remain in the outlet 42 after use of the toothbrush , no further paste can be extruded through the outlet 42 , and the ingress of water and dirt through the outlet is prevented . such an arrangement thus results in an extremely hygienic product and virtually eliminates the possibility of bacteria growing within the brush . fig1 illustrates that the toothbrush comprises a small number of individual parts all of which can be separately molded and robotically assembled . the opening and closing of the outlet 42 , as well as the feeding of paste to and through said outlet 42 , are all achieved as a direct result of pressurisation of the paste , and without the requirement for any mechanical linkage between the actuating means 18 and the outlet 42 . thus there is no imposition upon the configuration of the hollow neck portion 8 which can be located at a variety of angles relative to the main extent of the body member 2 and can be flexible relative thereto , while the size of the head of the brush can be reduced compared with those containing sliders and the like . fig4 a , 4 b and 5 detail an alternative head in which the bristles 40 are located in a series of pre - formed holes 44 in the upper surface of the end extent 10 of the brush , rather than being part of a separate head for insertion into the end extent 10 . the end extent 10 is bored to provide a chamber therein together with an outlet 42 and a seating for the control valve 30 , the diaphragm portion 32 of the valve 30 being retained in the seating by means of a snap - fit ring 46 . the diaphragm portion 32 may be overmolded on , or separate from , the ring 46 , while the ring 46 may be welded in the seating instead of being a snap - fit therein . alternatively the ring 46 may be dispensed with and the edge regions of the diaphragm portion 32 welded or otherwise secured to the seating . clearly the precise construction of the toothbrush may differ from those detailed above without departing from the scope of the invention . the actuation means may be other than bellows operated , and may comprise relatively conventional trigger - operated pumps . it must be appreciated , however , that the described actuating means has the advantage that , in the event that the control valve 30 is inadvertently displaced from the outlet 42 subsequent to use , it will not be possible to recharge the bristles 40 with paste because of the open nature of the volume between the outlet 42 and the valve 24 and the inability to create the necessary suction effect within that volume . such an arrangement thus prevents the extrusion of excessive amounts of paste that might otherwise occur in the event of failure of the valve 30 . there may be a plurality of outlets 42 feeding to the bristles and a corresponding plurality of valves 30 , which may or may not be interconnected with one another . the diaphragm portions 32 of the valves 30 of fig1 , 3 a and 3 b may be secured in position other than by overmolding , for example by ultrasonic welding or by being a pop - in friction fit in the associated opening 28 . other modifications and variations will be apparent to those skilled in the art . the described toothbrushes are inherently user friendly in view of their compact and ergonomic design and their simple operation , while the pre - determined quantity of paste supplied to the bristles by the simple pneumatic actuating system can readily be varied to suit particular requirements . the product is ideally suited to the mass market because of its convenience for day to day use , but is also appropriate for specialised niche markets such as travellers , sportsmen and other related users . although described in relation to toothbrushes , it will be appreciated that the basic inventive concept has application to other types of brushes provided with containers for paste or other dispensable materials . | 0 |
referring to fig5 , and 7 a , a nail magazine in accordance with the present invention is shown comprising a casing 30 , a magazine shaft 40 , belts of nails 50 , and a cover 60 . the casing 30 is a hollow circular open frame member having a vertical mounting rod 31 upwardly extended from the periphery at one side , a horizontal mounting rod 32 perpendicularly extended from the periphery at one peripheral open side thereof remote from the vertical mounting rod 31 , a retaining hole 35 in the periphery , a stepped nail feeding wall 33 in the peripheral open side , and a wear resistant guide face 34 at the bottom side of the stepped nail feeding wall 33 . the stepped nail feeding wall 33 defines an inwardly sloping upper tread 331 , a lower tread 332 , and a riser 333 between the upper tread 331 and the lower tread 332 . the magazine shaft 40 is vertically located on the center inside the casing 30 , comprising a shaft 41 fixedly upwardly extended from the center of the bottom wall of the casing 30 , a tubular flange 42 formed integral with the periphery of the shaft 41 and defining with the periphery of the shaft 41 an annular groove 43 , a magazine spring 44 mounted in the annular groove 43 around the periphery of the shaft 41 , and a nail carrier sleeve 45 axially movably sleeved onto the and supported on the magazine spring 44 above shaft 41 . the tubular flange 42 has at least one , for example , two vertically extended and substantially h - shaped guide grooves 46 formed in the periphery . each guide groove 46 comprises a top open end 462 , a short vertical section 461 downwardly extended from the top open end 462 , a long vertical section 464 vertically extended toward the bottom side of the tubular flange 42 , a transverse section 463 connected between the bottom end of the short vertical section 461 and an upper part of the long vertical section 464 , and a circular guide plate 48 fastened to the periphery of the nail carrier sleeve 45 and peripherally disposed in contact with the inside wall of the casing 30 to guide vertical movement of the nail carrier sleeve 45 smoothly and stably . the long vertical section 464 has two ends closed . the nail carrier sleeve 45 comprises at least one , for example , two raised portions 47 projected from the inside wall and respectively coupled to the guide grooves 46 . by means of inserting the raised portions 47 through the top open end 463 into the short vertical section 461 of each guide groove 46 and then rotating the nail carrier sleeve 45 relative to the tubular flange 43 through an angle to move the raised portions 47 through the transverse section 463 of each guide groove 46 to the respective long vertical section 464 , the nail carrier sleeve 45 is coupled to the tubular flange 43 and can be moved vertically up and down along the long vertical section 464 of each guide groove 46 . each belt of nails 50 is comprised of a plurality of substantially l - shaped nails fastened together by a belt or the like , each nail having a flat elongated nail body , an angled head extended from the top end of the nail body , a point extended from the bottom end of the nail body , and an upwardly extended and biased toothed strip on the middle ( the nails of the belt of nails are of the conventional products , no reference signs or numbers are used in the drawings to indicate the angled head , nail body , point , and toothed strip of each nail ). when rolling up one belt of nails 50 , the angled heads of the nails of an outer layer are respectively rested on the angled heads of the nails of an inner layer . after one belt of nails 50 has been rolled up , it is put in the casing 30 around the nail carrier sleeve 45 with the angled head of the nail at the center rested on the top side of the nail carrier sleeve 45 . in order to fit the configuration of the nails , the nail carrier sleeve 45 is made having a collar 49 around the periphery that prevents direction contact of the toothed strip of each nail of the belt of nails 50 with the periphery of the nail carrier sleeve 45 . the cover 60 is fastened to the casing 30 by a hinge 62 and adapted to close the casing 30 , having a retaining rib 67 formed in the inside wall for engaging into the retaining hole 35 to lock the cover 60 to the casing 30 , a nail feeding wall 64 formed in the peripheral open side corresponding to the nail feeding wall 33 of the casing 30 . when the cover 60 is closed , the nail feeding walls 33 and 64 form a nail feed hole 65 ( see fig8 ), and the flat inside top wall 66 of the cover 60 is pressed on the angled heads of the nails of the belt of nails 50 . the nail feeding wall 64 defines two triangular steps 641 and 642 and a vertical face 643 disposed between the steps 641 and 642 . referring to fig7 a , when the nail magazine is empty , the magazine spring 44 supports the nail carrier sleeve 45 in the upper limit position where the raised portions 47 of the nail carrier sleeve 45 are respectively at the closed top ends of the long vertical sections 464 of the guide grooves 46 , and therefore the nail carrier sleeve 45 does not fall from the tubular flange 43 . referring to fig7 b , after loading of one belt of nails 50 in the magazine shaft 40 , the lead end of the belt of nails 50 is pulled outward toward the nail feeding wall 33 of the casing 30 , for enabling the angled head of the first nail of the belt of nails 50 to be rested on the upper tread 331 , and then the cover 60 is closed to hold down the belt of nails 50 , keeping the toothed strips of the leading nails of the belt of nails 50 suspended in between the riser 333 and the vertical face 643 . after the loading of a complete belt of nails 50 , the cover 60 is closed to hold down the loaded belt of nails 50 , and the magazine spring 44 is compressed . at this time , the raised portions 47 of the nail carrier sleeve 45 are moved to the closed bottom ends of the long vertical sections 464 of the guide grooves 46 , and the loaded belt of nails 50 are firmly supported in between the casing 30 and the cover 60 , keeping the leading nails in line with the nail feed hole 65 . as illustrated in fig8 the triangular steps 641 and 642 provide the nail feed hole 65 with an output space having a width gradually reducing toward the outside , and the inwardly sloping tread 331 of the nail feeding wall 33 guides the nails of the loaded belt of nails 50 to move into the nailing position in the nail feed hole 65 smoothly . the wear resistant guide face 34 supports and guides the movement of the points of the nails of the loaded belt of nails 50 . referring to fig7 c , when nails are driven out of the nail magazine one after another , the magazine spring 44 imparts an upward pressure to the sleeve 50 , and the circular guide plate 48 guides vertical movement of the sleeve 50 along the long vertical sections 464 of the guide grooves 46 subject to the feeding of the loaded belt of nails 50 , and therefore feeding nails are constantly maintained in line with the nail feed hole 65 . further , the arrangement of the guide grooves 46 must match with the pulling force of the feeding of the loaded belt of nails 50 , i . e ., the rotary force employed to the nail carrier sleeve 45 upon feeding of the loaded belt of nails 50 . the pulling force of the feeding of the loaded belt of nails 50 cause the raised portions 47 to be moved in direction away from the transverse sections 463 of the guide grooves 46 , preventing disconnection of the raised portions 47 from the guide grooves 46 of the tubular flange 43 . a prototype of nail magazine has been constructed with the features of fig5 ˜ 8 . the nail magazine functions smoothly to provide all of the features discussed earlier . although a particular embodiment of the invention has been described in detail for purposes of illustration , various modifications and enhancements may be made without departing from the spirit and scope of the invention . accordingly , the invention is not to be limited except as by the appended claims . | 5 |
fig1 shows a bucket type hat 10 comprising a bucket 11 which comprises a generally circular side wall 16 . it will be appreciated that the side wall 16 is in most cases other than purely circular in that it must conform to the wearer &# 39 ; s head , which is rarely if ever purely circular . the circular side wall 16 may have an upper edge 18 and a lower edge 24 . it should be noted at this point that orientational terms such as upper and lower and others refer to the drawing as viewed by an observer . orientational terms must be understood to provide semantic basis for purposes of description , and do not limit the invention or its component parts in any particular way . a brim 17 projects radially outwardly from the bottom edge 24 of the bucket 11 . both the bucket 11 and the brim 17 may be formed from generally flaccid materials , such as leather , fabrics , woven and non - woven polymeric materials , and others . such materials are flaccid yet are form holding to one degree or another . as employed herein , “ flaccid ” signifies that the subject material is readily bendable , and may deform under gravity if not restrained by a reinforcing influence . by way of example of one reinforcing influence , the hat 10 may hold its form due to its configuration . that is , because the side wall 16 forms a generally circular closed loop , and if provided with a top panel such as the top panel 22 which closes the otherwise open top of the side wall 16 , the hat 10 avoids spontaneous collapse . however , the hat 10 is nonetheless susceptible to undesirable deformation such as by incidental contact with environmental objects , repositioning by the wearer , temperature fluctuations , and other effects . form holding signifies that the element so described has sufficient rigidity by virtue of inherent properties of the material or by its configuration or both , so as to maintain its form in the absence of outside forces other than those imposed by the mass and , where provided , elasticity of the constituent materials . the hat 10 has at least one adjuster for adjusting a visual aspect of the bucket 11 and the brim 17 . each adjuster , the nature of which will shortly be described , is disposed to maintain the respective conditions to which each is adjusted . a first adjuster serves the purpose of adjusting the diameter of the bucket 11 . a second adjuster serves the function of adjusting a visual aspect of the brim 17 . the first adjuster may comprise at least one loop such as the loop 15 of fig1 , and a belt 12 which is dimensioned and configured to encircle the bucket 11 and to pass through and be retained in place against the bucket 11 by the loop 15 . the belt 12 has a fastening element disposed to hold the belt 12 at a selected length . the belt 12 may be long enough to overlap itself after encircling the bucket 11 . the fastening element may comprise hook and loop fastening material comprising hook material 13 and loop material 14 . the loop material 14 engages and adheres to the hook material 13 upon contact and is manually separable there from . one side of the belt 12 may bear the hook material 13 and the other side of the belt 12 may bear the loop material 14 . this arrangement assures that one end of the belt 12 may engage the other end of the belt 12 without twisting the belt 12 . the loop 15 may comprise a plurality of loops 15 located about the periphery of the lower edge 24 of the bucket 11 , and each spaced apart from each adjacent loop 15 ( see fig2 ). alternatively , the loop 15 may comprise an elongated sleeve ( not shown ) which spans a sufficient extent of the circumferential periphery of the bucket 11 to assure that the belt 12 will perform the function described herein . fig1 and 2 show illustrative effects of adjustment of the belt 12 . in fig1 , the belt 12 is shown only loosely engaging the bucket 11 . the bucket 11 displays sagging and non - planar configuration of the side wall 16 and of the top panel 22 . in fig2 , the belt 12 has been drawn slightly tighter , thereby constricting the bucket 11 . the bucket 11 has thereby been squeezed such that the sagging and non - planar configuration of fig1 gives way to smooth , flat configuration of the side wall 16 and the top panel 22 . referring now to fig3 , the second adjuster may comprise a form holding element disposed in the brim of the hat . the form holding element may comprise a manually formable filament such as a metallic wire 20 . the metallic wire 20 may be located along the periphery of the brim 17 . the present invention is susceptible to modifications and variations which may be introduced thereto without departing from the inventive concepts . for example , although the invention has been described with respect to the hat 10 including a top panel 22 , a hat according to aspects of the invention need not include the top panel 22 . the top of the side wall 16 may be open . alternatively , the top of the hat 10 may be domed , conical , or otherwise configured ( these variations are not shown ). locations of features of the invention may be varied from those shown . for example , the belt 12 and the loops 15 may be concealed within the side wall 16 rather than outside the side wall 16 as shown . also , the belt 12 may be located anywhere along the vertical dimension of the side wall 16 , where of course the vertical dimension refers to the drawing figures as rendered . the precise location is not critical to the invention . the location merely need assure that the belt 12 be operable as described to modify the appearance of the bucket 11 . components of a hat according to any aspect of the invention may be incorporated into the hat or alternatively may be separate there from . for example , the belt 12 may be arranged to drop into place over the bucket 11 , rather than being held to the bucket 11 by the loops 15 . components presented in the singular may be provided in the plural . where feasible , it would be possible to provide a single component rather than a plurality of components . for example , the wire 20 may comprise a plurality of wire segments ( not shown ) rather than a single length filament . along a similar vein , the belt 12 may comprise joined sections ( not shown ) rather than comprising a single strip of material . while the present invention has been described in connection with what is considered the most practical and preferred embodiment , it is to be understood that the present invention is not to be limited to the disclosed arrangements , but is intended to cover various arrangements which are included within the spirit and scope of the broadest possible interpretation of the appended claims so as to encompass all modifications and equivalent arrangements which are possible . | 0 |
throughout the drawings , the same or like parts are designated by the same numerals . fig1 is an axial cross - sectional view of an exhaust gas recirculation valve according to a first embodiment of the invention . in fig1 , a sliding shaft support component ( bushing ) 9 like a cylinder and a shaft 4 sliding vertically along the inner circumference of the sliding shaft support component 9 are provided inside a housing 1 having a mounting face 1 a on which an actuator such as a motor , not shown , is mounted , and a mounting face 1 e on an engine , not shown , and the other components , the shaft 4 being connected to a valve 3 for controlling the flow of exhaust gas and supported by the sliding shaft support portion 9 a of the sliding shaft support component 9 . fig2 is a partly enlarged view of the sliding shaft support portion 9 a . the sliding shaft support portion 9 a of the sliding shaft support component 9 and the shaft 4 a supported by the sliding shaft support portion 9 a are made of different materials , and provided with some clearance 20 at the early time , namely at ordinary temperatures from the relationship of a thermal expansion difference at high temperatures . some clearance is needed even though they are made of same material . when the exhaust gas recirculation valve according to the invention is activated , namely , when a flow of exhaust gas occurs in the exhaust gas passage inside 1 b , the temperatures of the housing 1 , the sliding shaft support component 9 , the shaft 4 and other parts making up the exhaust gas recirculation valve are all elevated . at this time , the clearance 20 between the sliding shaft support portion 9 a and the shaft 4 a is contracted due to thermal expansion of the members on both sides , but because the shaft 4 needs to be slid vertically at high temperatures , some clearance 20 , not designed as 0 , exists at high temperatures . in this embodiment , to suppress an exhaust gas , foreign matter and water from leaking through the clearance 20 and entering the actuator portion , a seal 7 is provided on an upper part of the sliding shaft support portion 9 and held with a plug 6 and the sliding shaft support portion 9 , as shown in fig1 ( fig3 ). fig3 is an enlarged view of a portion a encircled by the dotted line in fig1 , and fig4 is a perspective view of each of the parts making up the sliding shaft support portion . the seal 7 has a hole 7 a opened along the shaft 4 , and incorporated between the sliding shaft support component 9 and the plug 6 . the seal 7 exists in a space 15 provided , and is movable or deformable to some extent within the space 15 without being secured rigidly . also , the seal 7 is assembled in contact with the shaft 4 and with reference to the shaft 4 . also , the seal 7 is roughly positioned by the shaft 4 rather than any other member , and is made of a deformable elastic material . in conclusion , even if the shaft 4 is inclined corresponding to the clearance 20 , the seal 7 is also moved in accordance with its inclination , because the seal 7 is incorporated along the shaft 4 as above described , whereby the hole 7 a in the inner diameter portion is less likely to wear eccentrically . the plug 6 is secured to the housing 1 to hold the seal 7 and the sliding shaft support component 9 via a ring 8 . also , even if an exhaust gas , foreign matter or water leaks through the sliding shaft support portion 9 a , it is prevented from reaching the neighboring housing 1 c to damage the housing 1 c due to corrosion . moreover , the space 15 containing the seal 7 has basically an outside face shaped like a plane , whereby a planar portion 6 a and a planar portion 7 b of the seal 7 are contacted in the plane to provide a countermeasure against leakage , namely , serve as a seal for keeping the exhaust gas , foreign matter or water from leaking through the sliding shaft support portion 9 a . also , the sliding shaft support component 9 is provided with an undercut portion , or a groove 9 b , thereby preventing the seal 7 a from biting . referring to fig5 , the embodiment 1 will be now described . fig5 is an explanatory view for explaining the action situation of the seal 7 namely , the leakage suppressing situation of the seal 7 , where a leakage of exhaust gas , foreign matter or water occurs from the sliding shaft support portion 9 a due to a pressure difference produced between the exhaust gas passage inside and outside 1 b - 1 d , when the exhaust gas recirculation valve of the invention is activated to cause a flow of exhaust gas in the exhaust gas passage inside 1 b . when a flow of exhaust gas occurs in the exhaust gas passage inside 1 b , a pressure 30 from the sliding shaft support portion 9 a is exerted on the lower face of the seal 7 due to a pressure difference between the exhaust gas passage inside and outside 1 b - 1 d . the seal 7 subjected to the pressure 30 is moved to the upper part of the space 15 provided beforehand owing to its pressure or a vertical sliding motion of the shaft 4 , so that the seal 7 b and the plug 6 a , as well as the seal 7 a and the shaft 4 are intimately contacted and sealed . since the housing 1 c is also sealed with the ring 8 , there is consequently no ventilation between the exhaust gas passage inside 1 b and the exhaust gas passage outside 1 d . accordingly , it is possible to suppress leakage of exhaust gas , foreign matter or water to the exhaust gas passage outside 1 d . fig6 is an enlarged cross - sectional view of a portion a corresponding to that encircled by the dotted line in fig1 in a valve according to a second embodiment . as shown in fig6 , the sealing ability with the shaft 4 is enhanced by increasing the number of seals 7 provided on the upper part of the sliding shaft support component 9 and increasing the thickness of a contact portion ( 7 a ) with the shaft 4 , thereby leading to a greater wear resistance of the seal inner diameter portion 7 a . consequently , the exhaust gas recirculation valve has a greater durability . particularly , when two or more seals are provided , a seal 72 subjected to the pressure 30 and a seal 71 contact with the plane 6 a are different , whereby the seal 71 is less likely to undergo local fluctuations or variations in the pressure 30 , achieving the stable sealing performance . when a pressure difference between the exhaust gas passage inside and outside 1 b - 1 d occurs , and the pressure 30 from the sliding shaft support portion 9 a is exerted onto the lower face of the seal 7 , the seal 7 b and the plug 6 a , as well as the seal 7 a and the shaft 4 , are intimately contacted , and sealed . for example , when the exhaust gas recirculation valve of the invention is activated for a long time , a wear occurs between the seal 7 a and the shaft 4 , but if the seal 7 is made of an elastic material , the seal 7 is intimately contacted with the shaft 4 to secure the sealing function , even though the seal inner diameter portion 7 a has worn . referring to fig7 , the second embodiment will be further described . fig7 is an explanatory view for explaining the action situation of the seal when the exhaust gas recirculation valve of the invention is activated for a long time . in fig7 , at the early time , namely , in a situation where the exhaust gas recirculation valve is not used too much , the seal 7 is in a sealing state as indicated by the broken line , thereby sealing a gap between the seal inner diameter portion 7 a and the shaft 4 . on the other hand , when the exhaust gas recirculation valve is activated for a long time , namely , in a situation where the seal inner diameter portion 7 a has worn , the seal 7 is in a sealing state as indicated by the solid line , thereby sealing a gap between the seal inner diameter portion 7 c and the shaft 4 . herein , though the position of the seal inner diameter portion is changed from 7 a to 7 c due to wear , the pressure 30 exerted from the sliding shaft support portion 9 a is basically equal , whereby the sealing function is not changed . in conclusion , the sealing function is not lost due to wear of the seal inner diameter portion 7 a , whereby the sealing performance equivalent to that at the early time ( 7 a ) can be achieved in the sealing state ( 7 c ) after wear . this is achieved because the seal 7 has a conical shape projecting in a direction where the pressure 30 is exerted , whereby a force is applied to the seal in a direction contacting with the shaft 4 due to a pressing force of the pressure 30 , thereby preventing a degradation in the sealing performance with the shaft 4 even in a worn state . an assembling procedure will be described with reference to fig1 ., a filter 5 and the sliding shaft support component 9 are inserted into the housing 1 having a valve seat 2 , and the seal 7 is installed . then , the ring 8 is set and the plug 6 is press fit securely . by press fitting the plug 6 , the sliding shaft support component 9 can be also secured . then , the shaft 4 connected with an exhaust gas flow control valve 3 is inserted , and a spring 10 , a spring holder 11 and a stopper 12 are assembled with the shaft 4 . referring to fig8 , an assembling method of inserting the shaft 4 connected with the exhaust gas flow control valve 3 will be described . fig8 is an explanatory view for explaining the method for assembling a bearing portion seal structure according to the first and second embodiments . since the seal 7 is made of the elastic material as described above , care must be taken so that the seal is not inverted in a direction to the exhaust gas passage outside 1 d in inserting the shaft 4 . thus , one assembling method involves applying a positive pressure 31 from a direction of the exhaust gas passage outside 1 d , as shown in fig8 , for example . thereby , when the shaft 4 comes closer to the seal 7 , the seal is deformed in a direction to the exhaust gas passage inside 1 b , as indicated by the solid line in fig8 . then , the shaft 4 is inserted and after insertion , the application of the positive pressure 31 is stopped . since the seal 7 is singly formed with the seal inner diameter portion 7 a along the shaft 4 , the seal is made along the shaft 4 by stopping the application of the positive pressure 31 , as indicated by the broken line in fig8 . with this method using the seal 7 made of elastic material , the poor assembling of the seal 7 is prevented to achieve the inherent sealing function . the bearing portion sealing structure according to the embodiments comprises the housing having the actuator mounting face and the mounting face on an engine component , the sliding shaft support portion provided inside the housing , and the shaft connected with the flow control valve of the exhaust gas recirculation valve sliding vertically along the sliding shaft support portion , in which the sliding shaft support portion is provided with the seal member , whereby when a flow of exhaust gas occurs inside the exhaust gas passage , the exhaust gas , foreign matter or water is prevented from leaking through the sliding shaft support portion to the exhaust gas passage outside due to a pressure difference between the exhaust gas passage inside and outside . also , the seal member provided in the sliding shaft support portion is made of the elastic material so that it may be deformed in accordance with a pressure difference caused between the inside and outside of the exhaust gas passage . also , the seal member provided in the sliding shaft support portion is like a doughnut , and a thin plate having a difference in the height between the outer diameter and the inner diameter . by providing the difference in the height , a pressure receiving face is formed for a pressure difference arising between the inside and outside of the exhaust gas passage , whereby the air tightness is improved in accordance with an operating stress . also , the plug is provided to keep the air tightness in the seal member installed portion . also , the seal member provided in the sliding shaft support portion is not secured rigidly , but supported on the shaft , so that the hole center and the axial center of the seal member are matched to be favorable for wear resistance . also , the sliding shaft support component on which the seal member is installed is provided with an undercut portion , or a groove , to prevent the seal member from biting the sliding shaft support portion . also , the sliding shaft support component is secured by the plug and the ring , the ring securing the sliding shaft support component , and having a role of preventing exhaust gas , foreign matter or water through the sliding shaft support portion from entering the housing portion . also , the seal member provided in the sliding shaft support portion can cope with the required durability by increasing the number of seal members provided , or increasing the thickness of the contact portion with the shaft . also , in inserting the shaft into the seal member , a positive pressure is applied from an appropriate direction to easily insert the shaft , resulting in higher assembling ability . also , the bearing portion seal structure according to these embodiments can suppress the exhaust gas , foreign matter or water from leaking through the sliding shaft support portion and entering the actuator portion . also , since the seal is made of the elastic material , the sealing performance equivalent to that at the early time can be secured even if the seal inner diameter - portion is worn , thereby maintaining the air tightness with the shaft . likewise , since the seal is made of the elastic material , the seal is prevented from being hurt and inverted by the method of applying a positive pressure in assembling , whereby the assembling ability is improved , and the intrinsic sealing performance is achieved . | 5 |
fig1 illustrates an example of a convertible aircraft galley refrigerator / chiller with a side door access that allows passengers to retrieve complimentary products from the side entrance without entering the galley . a galley monument 23 is shown at a perspective view to illustrate both the entrance to the galley area 15 and the aisle / walkway 20 used by the passengers . the monument 23 includes a number of features , including bays 22 for storing beverage carts used to serve the passengers , a counter 24 that can be used to prepare beverages and meals , storage cabinets 26 to house mugs , supplies , cleaning supplies , or other emergency equipment , and ovens 28 for heating meals . it is understood that galleys can include other features known to those of ordinary skill in the art , the recitation of which is omitted herein for brevity . at the corner of the monument 23 is a refrigeration unit 30 having a front panel 32 and a handle 34 used to open a door 36 . on the side of the monument 23 is an aisle wall 38 that is outside of the galley area 15 , and includes a self - serve station 40 that passengers can access . the self - serve station 40 includes a door 42 , which may be a sliding panel or a pivoting door that accesses the interior of the refrigeration unit 30 . items such as cans of soda or bottles of water can be loaded into the refrigeration unit 30 by flight attendants in the galley area 15 via door 36 , and removed using the side door 42 in the self - serve station 40 . however , as explained below , passengers do not have access to the entirety of the refrigeration unit &# 39 ; s interior , but rather only a selected portion of the interior can be accessed by the passengers . fig3 shows how a supplemental or auxiliary compartment can be formed in the refrigeration unit 30 that limits access through the side door 42 . a frame 44 for the refrigeration unit 30 includes a floor 46 , a ceiling 48 , a rear wall 50 , and a removable first side wall 52 . the first side wall 52 can be placed on either the right side or the left side of the frame 44 , depending upon the arrangement of the galley and the placement of the refrigeration unit 30 . opposite the removable first side wall 52 is an open side window that is aligned with the passenger self - serve station 40 in the monument wall 38 . the door 36 with handle 34 on the front of the refrigeration unit includes a seal to prevent chilled air from escaping , and a second door 56 may be used to access the auxiliary compartment . placed within the open side window is a side access compartment 58 sized to fit into a cut - out 60 in the wall 38 . the side access compartment 58 is tub - shaped wherein the bottom of the tub establishes a dividing wall 62 inside the interior of the refrigeration unit 30 . the top 64 and bottom 66 panels cooperating with the dividing wall 62 to define a side compartment interior space , the dividing wall 62 separating the side compartment interior space from a main chilled compartment . to maintain the side access compartment 58 within the cut - out 60 , a transverse retaining lip 68 spaced from the dividing wall 62 bears against the outside surface of the wall 38 , and can be mounted to the wall using any number of ways , including fasteners , adhesives , and the like . the transverse retain lip 68 extends from the top and bottom panels 64 , 66 ( and preferably a rear panel 70 ) to secure the side access compartment to the fixed galley monument wall 38 . the side compartment is accessed via a side door 42 , which can also be any number of types of doors , from sliding to hinged , to a pull - out panel . in a first preferred embodiment , the door 42 slides in grooves within the self - serve station to easily open and close the unit . the side door 42 provides access to the side compartment , but only up to the dividing wall 62 . other items stored in the main compartment of the refrigeration unit are inaccessible though the side door 42 , ensuring that costlier items cannot be taken through the self - serve station by passengers . the configuration allows drinks and snacks to be placed in the refrigeration unit 30 via the first and second front doors 36 , 56 in both the main chilled compartment and the side access compartment , and wherein access to the main chilled compartment is foreclosed via the side door . in a first preferred embodiment , the rear panel 70 is open ( see fig3 ) to allow circulation of the chilled air from the main compartment to enter the side compartment , along the opening can also be established in the top panel 64 , although to prevent passengers from reaching over the dividing wall 62 some mesh or grid is preferred over the opening . the side access compartment 58 is preferably formed from a single sheet of metal or polymer , stamped into the desired shape , and inserted into the cavity in the frame . aluminum could be used due to its corrosion resistant properties and easy of shaping , or other materials could be used equally as well , as long as the material possesses the necessary strength after shaping to not deform or corrode once inserted into the chilled environment of the refrigeration unit 30 . the refrigeration unit can include locks on either the front doors 36 , 56 or the side door 42 to prevent entry without a key where greater control is required over the contents of the refrigeration unit . the benefit of the present invention is the cost and weight savings of using the primary chiller to cool a second compartment , which is more efficient and saves costs and weight . this also saves space , as the volume that would be needed to house a second refrigeration system for the second chiller can be used to store beverages , food , wine , beer , or other products served on the flight . it will be apparent from the foregoing that while particular forms of the invention have been illustrated and described , various modifications can be made without departing from the spirit and scope of the invention . accordingly , it is not intended that the invention be limited , except as by the appended claims . | 5 |
referring to the figures , the dilution device 10 includes a housing 12 having side walls 14 , a bottom wall 16 and a top wall 18 defining an interior 20 . a generally tubular connector 22 is disposed in the side wall 16 of the housing 12 and the bore of the connector 22 opens into the interior 20 of the housing 12 . the connector 22 is designed to be connected to suitable tubing ( not shown ) for communication with a source of primary gas such as for example oxygen . the opposite end of the housing 12 is provided with an opening 24 leading into a cylindrical member 26 adapted for connection to a mask hose or the like for egress of the dilution stream of the primary gas and air . the bottom wall 16 of the housing 12 is provided with an opening 28 and a tubular seal 32 extends into the housing 12 immediately adjacent the bore opening of the connector 22 . an opposed pair of openings , 33a and 33b , in the wall of the tubular seal 32 are aligned with the bore opening of the connector 22 . a cylindrical nozzle member 30 having a diameter essentially the same as the inside diameter of the tubular seal 32 is received in the tubular seal 32 for rotation about its longitudinal axis within the seal . open ended , perpendicularly intersecting bores 34 and 35 extend through the member 30 normal to its longitudinal axis . one open end 36 of each of the bores 34 and 35 is aligned with the passage opening of the connector 22 depending upon the axial orientation of the nozzle member and the opposite open end 38 is constricted to define a nozzle orifice through which the primary gas enters the housing 12 . the nozzle orifice of the bore 34 is smaller than the nozzle orifice of the intersecting bore 35 . rotation of the nozzle member 30 to align bore 34 with the opening of the connector 22 decreases the flow of primary gas as compared to the flow of primary gas when bore 35 is aligned with the connector opening . the nozzle member 30 is secured in the tubular seal 32 by a retainer 40 having a central opening 42 which receives a mounting lug 44 formed on the upper end of the nozzle member 30 . the lower end of the retainer 40 is radially extended to define a wing 46 , the lower surface 48 of which rides on the upper end of the tubular seal 32 to retain the nozzle member 30 in the seal . a handle 50 is attached to the lower end of the nozzle member 30 to facilitate rotation of the nozzle member . the upper wall 16 of the housing 12 is cut away to define an air inlet port 52 which communicates with the exterior of the housing . a selector disk 56 overlies the upper wall 16 and is rotatably mounted thereover by an upstanding spindle 54 on the upper wall which extends through a central opening 58 in the selector disk . a portion of the selector disk is cut away to define a segment which corresponds in configuration to the inlet port 52 in the upper wall 16 . the lower peripheral edge of the selector disk 56 is provided with a series of indentations or detents 60 which are spaced about the periphery of the disk and cooperate with a spring loaded follower 62 to provide positive stopping action at each of the detent positions . the detents 60 are located to correspond to disc positions overlying the inlet port 52 to partially cover the port restricting the amount of air flow to provide a specific concentration diluent gas in the dilution air stream . a handle 64 is provided on the upper surface of the selective disc for manually rotating the disc . disposed in the interior 20 of the housing 12 are a pair of partitions 66 which abut at their upper edges with the top wall 16 and at one end with the housing sidewall 16 adjacent the opening of connector 22 . the opposite end of each partition 66 terminates adjacent the egress opening 24 and is free standing . the partitions 66 define a central dilution chamber 68 in which air drawn through the air inlet port is mixed with the primary gas to form the dilution stream . preferably , as shown , the abutting end portions 66 &# 39 ; of the partitions 66 are disposed at an angle to the main body of the partition to correspond to the shape of the inlet port 52 to conform that portion of the dilution chamber 68 underlying the inlet port conform to the configuration of the air inlet port . a vent chamber 70 is defined between one of the partitions 66 , a portion of the housing sidewall 14 , and a divider 72 . the vent chamber 70 communicates with the exterior of the housing through a vent 78 . the divider 72 consists of a frame 74 open at its center carrying a membrane flap 76 affixed to the frame along its top edge by suitable adhesive bonding or sonic welding or the like . the flap 76 normally closes the open area of the frame 74 and seals the vent chamber 70 from the vent 78 . in the event of an increase of pressure in the vent chamber 70 , the flap 76 is forced away from the frame 76 allowing fluid communication from the vent chamber to the outside through the vent 78 . the choice of membrane material for the flap 76 is not critical and good results have been achieved with thin film polyethylene or mylar film . the flap 76 is slightly larger than the opening in the frame so that under normal operating conditions with a reduced pressure within the housing 12 the flap lies tightly against the frame member so that air cannot be entrained through the vent 78 . the divider 72 is held in position by opposed channels 80 which are defined between spaced apart ribs 82 carried on the partition 66 and the sidewall 16 of the housing 12 . the bottom wall 16 of the housing 12 is provided with a pair of stops 84 which are positioned to contact the handle 50 of the cylindrical member and to stop its rotation at a point where one of the intersecting bores 34 or 35 is aligned with the inlet opening of the connector 22 and the outlet of the tubular seal 32 . indicia 86 are scribed on the bottom wall 18 for indicating the primary gas dilution ranges as selected by the position of the nozzle member 30 . the selector disk 56 is similarly provided with indicia 86 located about its periphery to indicate the concentration of primary gas in the dilution stream as a result of the degree to which the air inlet port 52 is covered by the selector disk . the indicia 86 on the selector disk 56 correspond with the detent positions on the underside of the selector disc . the housing 12 , including the tubular seal 32 , is preferably molded as a single piece from a suitable molded plastic material such as for example polyethylene or abs polymer and co - polymer . the partitions 66 , which can be made from the same material , are affixed in their respective positions to form the dilution chamber 68 and the vent chamber 70 and the divider 72 inserted in the channels 80 to close the vent chamber . the nozzle member 30 is inserted into the tubular seal 32 through the opening in the bottom wall 16 and the retainer 40 is affixed on the mounting lug 44 on the upper end of the nozzle member 30 to retain it in the bore of the tubular seal 32 . the connector 22 is affixed in the housing 12 and the housing assembly is completed by affixing the upper wall 16 by suitable adhesive or by sonic welding over the top edge of the sidewalls 14 of the housing 12 with the cutout segment aligned with the diverging portion of the partitions 66 to define the air inlet port 52 . the selector disk 56 is located over the upper wall 16 with the spindle member 54 extending through the central opening in the disk . the selector disk 56 is held on the spindle member 54 by a retainer clip snapped in a groove formed in the spindle member as is conventional in the art . during assembly the selector disk 56 is also aligned so that the edges of the segment are aligned with the edges of the segment of the cover disc and the upper edges of the partitions 66 . in operation a tube ( not shown ) leading to a source of primary gas , i . e ., oxygen , is inserted over the connector 22 for leading the primary gas through the nozzle member 30 into the dilution chamber 68 . the nozzle member 30 is rotated in the tubular seal 32 to a selected position where one of the two intersecting bores , 34 or 35 , is aligned with the openings 33a and 33b in the tubular seal 32 for the ingress of the primary gas into the dilution chamber 68 . the choice of which of the bores to * be used depends upon the desired concentration range of the primary gas in the dilution stream . thus bore 34 , with its smaller nozzle , is selected when the desired concentration is to be in the range of about 24 % to about 32 % and bore 35 , because of its larger nozzle , being selected when the desired concentration range is about 35 % to about 55 %. as explained , the nozzle member handle 50 is rotated clockwise or counter clockwise until it engages one of the two stop members on the bottom wall 18 of the housing 12 , depending upon the desired dilution range for the primary gas . the retainer 40 and the wing 46 formed thereon rotate with the nozzle member 30 and the stops on the wing prevent contact the lug on the disk handle 64 to prevent rotation of the selector disc in one or the other direction depending upon the position of the nozzle member and the retainer . the flow of the primary gas through the nozzle of the selected bore reduces the pressure in the dilution chamber 68 and outside air is drawn into the dilution chamber through the air inlet port 52 where it mixes with the primary gas to form the dilution stream . the dilution stream exits the housing 12 through the egress opening 24 and flows to the use point , i . e . a patient . the selector disc 56 is rotated in its permissible direction to one of the dilution points which is positively indicated by the urging of the lock follower 62 into the detent 60 corresponding to the selected dilution as indicated by the indicia 86 on the selector disk . rotation of the selector disc 56 brings the leading edge of the cutout segment in the disk out of alignment with the corresponding edge of the air inlet port 52 thus partially closing the air inlet port and restricting the flow of air into the dilution chamber 68 . the more that the selector disc 56 is rotated the more restricted the air inlet port 52 becomes and the greater the concentration of primary gas in the dilution stream . the dilution stream exits the dilution chamber body at the outlet side which is connected to a hose leading to the using location . any obstruction in the line leading to the use point will produce resistance to the flow of the dilution stream which results in back pressure in the dilution chamber 68 and in the vent chamber 70 which is also open to the egress opening 24 . the back pressure acts against the membrane flap in the divider 72 causing it to open providing fluid communication between the vent chamber 70 and the exterior of the device 10 through the vent 78 and pressure in the interior of the housing 12 is relieved and normal operating pressure is restored in the dilution chamber . once the backpressure is relieved , the membrane flap of the divider 72 closes and the vent chamber is resealed . in this manner the back pressure does not restrict the intake of dilution air which can result in unduly high concentration of primary gas in the dilution stream . the following is an example of the device as described above utilized to dilute a primary stream of oxygen in air . the device was operated with no down stream resistance at oxygen settings ranging from 24 % to 60 %. the percent oxygen in the dilution stream was analyzed at each of the settings by a probe in the gas stream at the output end of the device . the probe was connected to a fuel cell and signal from the cell was digitized and read out by a digital monitor . following this the device was again operated at the same range of oxygen settings but this time a down stream resistance was simulated by reducing the outflow orifice at the output end of the apparatus from its normal diameter of 16 . 25 mm to 6 mm in diameter . the oxygen content of the dilution steam was again analyzed as described above . the flow rate of oxygen was 3 liters per minute . the difference in oxygen concentration of the dilution steam with no resistance and that with resistance it was reported as 0 2 % difference . the results are reported in table 1 below . table 1__________________________________________________________________________device with back pressure compensation according to theeffect of back pressureinvention . sub . 2 % flow rate % increase o . sub . 2 o . sub . 2 % o . sub . 2 % setting analyzed lpm w / resistance difference__________________________________________________________________________24 24 3 30 626 26 3 30 428 28 6 32 430 30 6 34 432 32 6 35 335 35 9 44 940 40 12 48 845 45 12 52 750 50 15 57 755 56 15 64 960 60 15 69 9__________________________________________________________________________ the same test protocol was applied to an oxygen device constructed in accordance with in u . s . pat . no . 3 , 794 , 072 . price , et al . the results are reported in table 2 . table 2__________________________________________________________________________prior art device / effect of back pressureo . sub . 2 % o . sub . 2 % flow rate % increase o . sub . 2 % setting analyzed lpm o . sub . 2 w / resistance difference__________________________________________________________________________24 24 3 44 2026 26 3 44 1828 29 6 45 1730 31 6 46 1635 34 9 90 5540 39 12 93 5350 53 15 95 45__________________________________________________________________________ fig8 is a plot of the oxygen concentration in the diluted steam with no back pressure versus 0 2 % difference in the oxygen concentration of the dilution stream as a result of the back pressure . the dashed line represents results obtained using the prior art device and the solid line represents the results using the device of the present invention . it will be understood that the divider 72 in the vent chamber 70 which constitutes the valve for equalizing back pressure within the device maybe otherwise constructed . for example , the valve maybe located in pressure chamber in the sidewall of the device 10 rather than as a divider 72 as described . however , for economy of manufacture and assembly , it is preferred to use the divider 72 and flap arrangement as illustrated . in addition to substantially reducing the effect of back pressure on the concentration of the primary gas in the dilution stream it will be appreciated that the diluter of the present invention is convenient to use . all that is required is to dial the concentration range to set the proper bore for the cylindrical member and then to dial the specific concentration within the selected concentration range . there is no necessity for assembly or disassembly to change parts as is required in many of the commercially available designs . when utilized for respiratory care or as part of the oxygen delivery system for a patient . the device of the present invention substantially reduces the effect of down steam obstacles which may cause sufficient back pressure to increase the concentration of oxygen in the dilution gas . the device of the present invention substantially reduces the necessity for monitoring the oxygen content of the output of the device . as will be understood by those skilled in the art , various arrangements other than those described in detail in the specification will occur to such persons skilled in the art , which arrangements lie within the spirit and scope of the invention . it is , therefore , to be understood that the invention is to be limited only by the claims appended hereto . | 6 |
to facilitate an understanding of the preferred embodiment , the general architecture and operation of a controller will initially be described . the specific architecture and operation of the preferred embodiment will then be described with reference to the general architecture . fig1 a shows an example of a storage drive system ( with an optical disk or tape drive ), included in ( or coupled to ) a computer system . the host computer ( not shown ) and the storage device 110 ( also referred to as disk 110 ) communicate via a port using a disk formatter “ df ” 104 . in an alternate embodiment ( not shown ), the storage device 110 is an external storage device , which is connected to the host computer via a data bus . the data bus , for example , is a bus in accordance with a small computer system interface ( scsi ) specification . those skilled in the art will appreciate that other communication buses known in the art can be used to transfer data between the drive and the host system . as shown in fig1 a , the system includes controller 101 , which is coupled to buffer memory 111 and microprocessor 100 . interface 109 serves to couple microprocessor bus 107 to microprocessor 100 and a micro - controller 102 and facilitates transfer of data , address , timing and control information . a read only memory (“ rom ”) omitted from the drawing is used to store firmware code executed by microprocessor 100 . controller 101 can be an integrated circuit ( ic ) that comprises of various functional modules , which provide for the writing and reading of data stored on storage device 110 . buffer memory 111 is coupled to controller 101 via ports to facilitate transfer of data , timing and address information . buffer memory 111 may be a double data rate synchronous dynamic random access memory (“ ddr - sdram ”) or synchronous dynamic random access memory (“ sdram ”), or any other type of memory . disk formatter 104 is connected to microprocessor bus 107 and to buffer controller 108 . a direct memory access (“ dma ”) dma interface ( not shown ) is connected to microprocessor bus 107 and to data and control port ( not shown ). buffer controller ( also referred to as “ bc ”) 108 connects buffer memory 111 , channel one ( ch 1 ) logic 105 , error correction code (“ ecc ”) module 106 to bus 107 . buffer controller 108 regulates data movement into and out of buffer memory 111 . ch 1 logic 105 is functionally coupled to sas module 103 that is described below in detail . ch 1 logic 105 interfaces between buffer memory 111 and sas module 103 . sas module 103 interfaces with host interface 104 a to transfer data to and from disk 110 . data flow between a host and disk passes through buffer memory 111 via channel 0 ( ch 0 ) logic 106 a . ecc module 106 generates ecc that is saved on disk 110 during a write operation and provides correction mask to bc 108 for disk 110 read operation . the channels , ch 0 106 a , ch 1 105 and channel 2 ( not shown ) are granted arbitration turns when they are allowed access to buffer memory 111 in high speed burst write or read operations for a certain number of clocks . the channels use first - in - first out (“ fifo ”) type memories to store data that is in transit . firmware running on processor 100 can access the channels based on bandwidth and other requirements . to read data from device 110 , a host system sends a read command to controller 101 , which stores the read commands in buffer memory 111 . microprocessor 100 then reads the command out of buffer memory 111 and initializes the various functional blocks of controller 101 . data is read from device 110 and is passed to buffer controller 108 . to write data , a host system sends a write command to disk controller 101 , which is stored in buffer 111 . microprocessor 100 reads the command out of buffer 111 and sets up the appropriate registers . data is transferred from the host and is first stored in buffer 111 , before being written to disk 110 . cyclic redundancy code (“ crc ”) values are calculated based on a logical block address (“ lba ”) for the sector being written . data is read out of buffer 111 , appended with ecc code and written to disk 110 . fig1 d shows a sas frame 129 that is received / transmitted using sas module 103 . frame 129 includes a www address 129 a , a start of frame (“ sof ”) value 129 g , a frame header 129 b that includes a frame type field 129 e , payload / data 129 c , crc value 129 d and end of frame (“ eof ”) 129 f . wwn address 129 a is used for each open connection at a given time . also , a frame may be an interlock or non - interlocked , specified by field 129 e . for an interlock frame , acknowledgement from a host is required for further processing , after the frame is sent to the host . non - interlock frames are passed through to a host without host acknowledgement ( up to 256 frames per the sas standard ). fig1 b shows a top level block diagram for sas module 103 used in controller 101 . sas module 103 includes a physical (“ phy ”) module 112 , a link module 113 and a transport module (“ trn ”) 114 described below in detail . a micro - controller 115 is used to co - ordinate operations between the various modules . a sas interface 116 is also provided to the phy module 112 for interfacing with a host and interface 117 is used to initialize the phy module 112 . fig1 c shows a detailed block diagram of sas module 103 with various sub - modules . incoming data 112 c is received from a host system , while outgoing data 112 d is sent to a host system or another device / component . phy module 112 includes a serial / deserializer (“ serdes ”) 112 a that serializes encoded data for transmission ( 112 d ), and de - serializes received data ( 112 c ). serdes 112 a also recovers a clock signal from incoming data stream 112 c and performs word alignment . phy control module 112 b controls serdes 112 a and provides the functions required by the sata standard . link module 113 opens and closes connections , exchanges identity frames , maintains ack / nak ( i . e . acknowledged / not acknowledged ) balance and provides credit control . as shown in fig1 c , link module 113 has a receive path 118 that receives incoming frames 112 c and a transmit path 120 that assists in transmitting information 112 d . addresses 121 and 122 are used for received and transmitted data , respectively . wwn index module 119 a is used for maintaining plural connections states , described below in detail . receive path 118 includes a converter 118 c for converting 10 - bit data to 8 - bit data , an elasticity buffer / primitive detect segment 118 b that transfers data from a receive clock domain to a transmit block domain and decodes primitives . descrambler module 118 a unscrambles data and checks for cyclic redundancy check code (“ crc ”). transmit path 120 includes a scrambler 120 a that generates crc and scrambles ( encodes ) outgoing data ; and primitive mixer module 120 b that generates primitives required by sas protocol / standard and multiplexes the primitives with the outgoing data . converter 120 c converts 8 - bit data to 10 - bit format . link module 113 uses plural state machines 119 to achieve the various functions of its sub - components . state machines 119 includes a receive state machine for processing receive frames , a transmit state machine for processing transmit frames , a connection state machine for performing various connection related functions and an initialization state machine that becomes active after an initialization request or reset . transport module 114 interfaces with ch 1 105 and link module 113 . in transmit mode , trn module 114 receives data from ch 1 105 , loads the data ( with fibre channel header ( fcp ) 127 ) in fifo 125 and sends data to link module 113 encapsulated with a header ( 129 b ) and a crc value ( 129 d ). in receive mode , trn module 114 receives data from link module 113 ( in fifo 124 ), and re - packages data ( extracts header 126 and 128 ) before being sent to ch 1105 . ch 1 105 then writes the data to buffer 111 . state machine 123 is used to co - ordinate data transfer in the receive and transmit paths . wwn index module 119 a , as shown in fig2 a , includes a table with “ n ” ( where n is greater than 1 ) elements . wwn index module 119 a stores information about each open connection between storage controller 101 and a device / host . wwn index module 119 a has plural rows / layers . each row ( for example , row 206 in fig2 a ) is referred to by its wwn index value ( address value ) 205 . for example , row 206 includes a sas address field ( 64 bit wwn address ) 200 , an initiator connection tag ( 16 bits ) 201 , an i / o counter ( 10 bits ) 202 , a single bit (“ v ”) 203 to indicate the validity of an entry and a fresh ( f ) field 204 that indicates the latest row that is being serviced . when an open address frame is received , the wwn address 129 a ( wwn address field ) of the received frame is compared with the wwn address field ( 200 ) in module 119 a . a successful comparison returns a wwn index value 205 . this wwn index value 205 is provided to mc 115 . since the wwn index value 205 is an 8 - bit field , mc 115 can handle it very efficiently . it is noteworthy that the present invention is not limited to any particular size of module 119 a or any of its entries . for example , wwn index value 205 is not limited to an 8 - bit value or any other size . if a wwn address of an open address frame is not recognized by module 119 a entries and the first frame is of command type , then a new entry ( or row 206 ) is created and its i / o count 202 is set to one . the new row 206 is allocated a wwn index value 205 , so that when a frame from the same source / connection arrives again , then module 119 a can return the proper wwn index value ( 205 ) after the comparison . for each frame crossing link module 113 , the frame type is checked . if the frame is of command type , the i / o counter of the active entry is incremented ( increased ) ( 202 ). if the frame is of response type , the i / o count of the active entry is decremented ( decreased ). when the i / o count reaches zero , the valid bit 203 is reset and the entry becomes vacant . fig2 b shows a detailed diagram of wwn module 119 a with row 206 . the various entries are loaded in rows based on receive access ( path ) 207 and transmit access ( path ) 208 . reset command 209 is used to reset module 119 a . mc 102 , mc 115 or mp 100 may issue the reset command . “ get index by wwn ” 213 ( or signal 213 ) allows searching of module 119 a by wwn address 200 and / or initiator tag value 201 . mc 115 , mc 102 or mp 100 may use this function . if the “ get index by wwn ” function 213 finds an entry that matches a search term ( for example , for an incoming frame ), then the wwn index value 205 is returned with a “ success ” flag . if no match is found then a new entry is allocated and the new value is returned . if the table is full based on signal 213 , then a “ fail ” flag is returned . a successful allocation causes the valid bit 203 to be set . the valid bit 203 is cleared fro an entry when the i / o counter value 202 reaches a certain value , for example , 0 . signal / command “ inc by index ” 212 is used to increment the index value 205 . also , mp 100 ( or mc 102 or 115 ) may load a row ( for example , 206 ) by using an index value 205 ( by using “ load by index ” command 211 ). using “ clear by index ” signal / command 210 clears entries in a row ( 206 ). fig4 shows a flow diagram for using module 119 a , according to one aspect of the present invention . turning in detail to fig4 , in step s 400 , a request to open connection is made between a device ( sas peer device ) 300 a ( fig3 a ) and controller 101 . if the request is accepted , then a connection is established in step s 401 , otherwise the process loops back to step s 400 and waits . the connection is shown as 301 a in fig3 a . at this stage the i / o counter value is zero ( shown as 202 a ). in step s 402 , the process determines if a wwn address entry exists . if yes , the process moves to step s 404 . if an entry does not exist in step s 402 , then an entry is created in step s 403 . in step s 404 , a wwn index value is established for the entry ( wwn index value 205 ). in step s 405 , a frame is received / transmitted by controller 101 . in step s 406 , the process determines if a frame is of command type . if yes , then i / o counter value 202 is incremented ( 202 b , fig3 b ). if the frame is not of command type , then in step s 408 , the process determines if the frame is of response type . if the frame is of a response type , then the i / o counter value 202 is decremented ( 202 b , fig3 f ). if the frame is not of a response type ( in step s 410 ), then the connection is closed in step s 410 and in step s 411 , all the entries are de - allocated with the i / o counter value 202 cleared to zero ( 202 a , fig3 a ). fig3 a - 3g illustrate the use of wwn module 119 a , according to one aspect of the present invention . fig3 a shows that a connection 301 a is established between controller 101 and device 300 a . i / o counter value is zero , shown as 202 a . fig3 b shows that a command 300 is received and thereafter , the i / o counter value is increased to 1 ( shown as 202 b ). fig3 c shows that data 301 is received from device 300 a and i / o counter value remains the same ( i . e . 1 ). fig3 d shows that controller 101 receives another command 302 and that device 300 a is ready for a transfer ( shown as 300 b ). the i / o counter value is increased to 2 , shown as 202 c . fig3 e shows that data 304 is received by device 300 a via controller 101 and data 303 is received from device 300 a . i / o counter value remains 2 ( shown as 202 c ). fig3 f shows that command 300 is complete and a response 305 is received by device 300 a . i / o counter value is decreased to 1 and is shown as 202 b . fig3 g shows that data 306 is received by device 300 a via controller 101 . after command 302 is complete , response 307 is sent to device 300 a . thereafter , the i / o counter value is decreased to zero , shown as 202 a . in one aspect of the present invention , a dynamic wwn module is provided that dynamically updates connection information . also , the wwn module provides an easy to use index value that can be used by mc 115 , mc 102 and mp 100 . although the present invention has been described with reference to specific embodiments , these embodiments are illustrative only and not limiting . many other applications and embodiments of the present invention will be apparent in light of this disclosure . | 7 |
referring to fig1 the process of the present invention is shown in schematic form using a side - elevational view . the apparatus for the process is represented generally as element 10 . the apparatus 10 includes a first web unwind 12 for a first web 14 and an optional second web unwind 16 for a second web 18 . for purposes of illustration only , the first web unwind 12 shall be described as having a roll of plastic film and the second web unwind 16 shall be described as having a roll of fibrous nonwoven web material such as a spunbond , meltblown or bonded carded web as well as an air laid or wet laid web . it should be understood , however , the unwinds 12 and 16 may be used to feed any type of web material into the process which is compatible with the equipment and objects of the present invention . in order to further manipulate the properties of the materials formed by way of the present invention , it has been found advantageous to control the speed of the unwinds 12 and 16 . as a result , it is desirable to provide each of the unwinds with driving and / or braking means ( not shown ) to control the speed of the unwinds as will be explained in further detail below . such driving and / or braking means are widely known and commonly used in conjunction with such unwinds to control tension . the first web 14 or simply &# 34 ; web &# 34 ; if only one unwind is being used is taken off the unwind 12 and is passed into a creping and aperturing assembly 20 which includes a first or patterned roll 22 and a second or an anvil roll 24 both of which are driven and / or braked with respect to one another so as to create a speed differential between the two rolls 22 and 24 . suitable means for driving the patterned roll 22 and the anvil roll 24 include , for example , electric motors ( not shown ). the patterned roll 22 is typically made from a durable material such as steel to reduce the wear on the roll as much as possible . the patterned roll 22 has a pattern of raised areas 26 separated by a pattern of depressed areas 28 . see fig2 . the raised areas 26 are designed to contact the surface of the anvil roll 24 . the size , shape , pattern and number of raised areas 26 on the pattern roll 22 can be varied to meet the particular end - use needs of the user . typically the relative percentage of raised areas per unit area of the roll will range between about 5 and about 50 percent and the average contact area of each of the raised areas 26 will range between about 0 . 20 and about 1 . 6 square millimeters . generally , the height of the raised areas 26 can range between about 0 . 25 and about 1 . 1 millimeters though heights outside this range can be used for specific applications if so desired . as a result , the number of contact areas per unit area of the pattern roll 22 will generally range between about 3 and about 100 raised areas per square centimeter of the roll . the footprint or shape of the raised areas 26 on the pattern roll 22 can also be varied . ovals , squares , circles and diamonds are several examples of shapes that can be used . unlike the prior apparatus and processes which ran the pattern roll faster than the anvil roll , when the anvil roll is run faster than the pattern roll , a much different material is created . by running the anvil roll 24 faster , the material being sent through the process is compacted by the anvil roll 24 against and between the raised areas 26 on the pattern roll 22 thereby causing creping and increasing the basis weight of the material . the degree of creping will depend in part upon the speed differential of the two rolls , the wind up speed and the area ( spacing and depth ) between the raised areas 26 . it has been found , for example , that a pattern roll 22 with large surface area pins and a high density will produce a more open and visually apparent apertured film than when using smaller raised areas 26 or pins and a lower density . another desired feature of the pattern roll 22 is that its temperature can be varied ( heated or cooled ) relative to the anvil roll 24 . heating and or cooling can affect the features of the web and / or the degree of bonding if multiple webs are being run through the process at the same time . common heating techniques include hot oil and electrical resistance heating . the anvil roll 24 is characterized in that its surface is much smoother than the pattern roll 22 and preferably is flat . it is also possible , however , that the anvil or second roll 24 may have a slight pattern in it and still be considered flat for purposes of the present invention . for example , if the anvil roll is made from or has a softer surface such as resin impregnated cotton or rubber , it will develop surface irregularities yet will still be considered flat for purposes of the present invention . such surfaces are collectively referred to as &# 34 ; flat .&# 34 ; the anvil roll 24 provides the base for the pattern roll 22 and the web material to shear against . typically the anvil roll 24 will be made from steel or materials such as hardened rubber , resin - treated cotton or polyurethane . the composition , degree of tack and hardness of the anvil roll 24 will impact the shape of the resulting apertures in the web 32 . the anvil roll 24 also may have flat areas separated by depressed areas ( not shown ) so that only select areas of the anvil roll 24 will contact the pattern roll 22 . the same technique may be used on the pattern roll 22 . as a result , aperturing and / or creping can be selectively imparted to specific regions of the web being processed . as with the pattern roll 22 , the anvil roll 24 may be heated and / or cooled to further affect the properties of the web being processed . the pattern roll 22 and the anvil roll 24 are counterrotated at differential speeds to create varying types of materials . the first or pattern roll 22 is rotated at a first rotational speed measured at its surface and the second or anvil roll 24 is rotated at a second rotational speed measured at its surface . in all cases , however , the anvil roll 24 is rotated at a faster speed than the pattern roll 22 . the positioning of the two rolls with respect to one another may be varied to create a nip area 30 between the pattern roll 22 and the anvil roll 24 . the nip pressure can be varied depending upon the properties of the web itself and the type of aperturing and creping desired . other factors which will allow variances in the nip pressure will include the speed differential between the pattern roll 22 and the anvil roll 24 , the temperature of the rolls and the size and spacing of the raised areas 26 . for such materials as films and nonwovens , the nip pressure will range between about 2 . 0 and about 6 . 0 kilograms per lineal millimeter ( kg / 1 mm ). other pressures are also possible depending upon the particular end use . the differential speed between the pattern roll 22 and the anvil roll 24 causes a shear between the raised areas 26 on the pattern roll 22 and the anvil surface on the anvil roll 24 which scores the web and creates apertures through the web 14 . if the speed differential is increased further , the incoming web begins to bunch up in and around the raised areas 26 of the pattern roll 22 thereby creping the web as it passes through the nip area 30 . once the web 14 has gone through web creping and aperturing assembly 20 its features and contours are changed significantly as shown by the photomicrographs of the materials set forth in the examples below . as the web 14 leaves the creping and aperturing assembly 20 , the apertured and / or creped web 32 is collected on the web winder 34 . the web winder collects the creped and / or apertured web 32 . as with the first unwind 12 and the second unwind 16 , the winder 34 is driven by an electric motor or other drive source which can be varied so as to adjust the speed at which the finished web 32 is wound up into a roll 36 . as will be explained in further detail below , the speed at which the web 32 is wound on the winder 34 will also affect the properties and appearance of the web 32 . alternatively , the web winder 34 may be eliminated and the web 32 may continue in line ( not shown ) for further processing as , for example , conversion into a liner material for a personal care absorbent article . both the inlet speed and the withdrawal speed of the web or webs 14 can be varied to change the conditions of the process . for example , the inlet speed of the web 14 can be equal to or faster than the first or pattern roll 22 . its speed also can be equal to or slower than the rotational speed of the second or anvil roll 24 . exiting the nip area 30 the web , webs or laminate can have a withdrawal speed which is equal to or faster than the first roll and slower or equal to the rotational speed of the second roll . in addition to running just a single web 14 through the apparatus and process 10 shown in fig1 it is also possible to run multiple webs through the same apparatus 10 , provided one or more additional unwinds such as the second unwind 16 are added to the machinery . for example , the first unwind 12 may be fitted with a film and the second unwind 16 may be fitted with the same or a different material such as a fibrous nonwoven web 18 . the two webs 14 and 18 are fed into the creping and aperturing assembly 20 in the same manner as before . due to the increased thickness of material , the nip pressure and heating conditions may have to be varied to achieve the desired results and appearance in the laminate 32 formed by joining the two webs 14 and 18 together . if aperturing of the film in a film and nonwoven combination is desired , it is generally more advantageous to position the film layer 14 adjacent the pattern roll 22 . having described the process , a series of sample single layer and multi - layer web laminates were formed to further illustrate the present invention . the samples and the test methods used to evaluate them are set forth below . several test methods were employed in determining the properties of the materials according to the present invention . the methods for determining these properties are set forth below . the basis weights of the various materials described herein were determined in accordance with federal test method number 191a / 5041 . sample size for the specimens was 15 . 24 × 15 . 24 centimeters and three values were obtained for each material and then averaged . the values reported below are for the average . the thickness of the materials including laminates was measured using the starrett bulk test . under this test a 12 . 7 × 12 . 7 centimeter sample of the material was compressed under a load of 0 . 05 pounds per square inch ( 3 . 5 grams per square centimeter ) and the thickness was measured while under this load . higher numbers indicate a thicker material . five samples were measured for each material and then averaged . values given are for the average . the frazier air permeability of the materials was determined in accordance with federal test method number 191a / 5450 . five specimens of each material were tested and then averaged to obtain the reported values . the surface of many of the materials according to the present invention had enhanced topography due to the process of the present invention . by running the anvil roll faster than the pattern roll the web material being processed is compacted within the nip area . due to mechanical pressure and optional heating , the web material can be both creped and apertured . this creped and apertured material was found to have enhanced aesthetic acceptance due to its ability to channel fluids from its top surface down through to its bottom surface . the surface of the materials according to the present invention exhibited a relatively high topography which was irregular in design . as shown by the profilometry data below , the standard deviation of the film cross - sections between apertures was quite irregular from aperture to aperture . stylus profilometry is a test method which allows measurements of the surface irregularity of a material using a stylus which is drawn across the surface of a material . as the stylus moves across the material , data is generated and is fed into a computer to track the surface profile sensed by the stylus . this information can in turn be plotted to show the degree of deviation from a standard reference line and thus demonstrate the degree of irregularity of a material . surface profilometry data was generated for examples 1 through 4 and is set forth below . this data was then plotted in fig8 . the film surfaces of the materials in examples 1 through 4 were scanned using a rank taylor talysurf laser interferometric stylus profilometer model from rank taylor hobson ltd . of leicester , england . the stylus used a diamond tip with a nominal 2 micron radius ( part # 112 / 1836 ). prior to data collection , the stylus was calibrated against a highly polished tungsten carbide steel ball standard of known radius ( 22 . 0008 millimeters ) and finish ( part # 112 / 1844 ). during testing , the vertical position of the stylus tip was detected by a helium / neon laser interferometer pick - up ( part # 112 / 2033 ). the data were collected and processed using form talysurf version 5 . 02 software running on an ibm pc compatible computer . the stylus tip was drawn across the sample surface at a speed of 0 . 5 millimeters per minute and over a distance of 1 . 25 millimeters . the test characterized the longer wavelength structure of the surface of the films between the apertures . the paths tracked by the stylus of the profilometer were across the top surface of the materials from aperture to aperture . the average profile waviness ( wa ) was determined for each film from ten individual scans taken from aperture to aperture . to perform the procedure , a 5 millimeter by 5 millimeter scan consisting of 256 datalogged profiles was taken from the top surface of each film using the diamond tip stylus . the surface data was filtered using a 0 . 25 millimeter wave filter which rejected the finest surface detail but retained the longer wavelength structure . ten profiles were extracted from the wave - filtered surfaces . average profiles for each set of ten profiles were plotted on the same 500 micron vertical scale for a measured distance of about 1 . 25 millimeters and are shown in fig8 along with the mean waviness ( wa ) and standard deviation values which define the convoluted structure of the film between the apertures . a total of five examples are set forth below . in examples 1 through 3 the web 14 was a thermoplastic film . in example 4 there were two webs used including a thermoplastic film and a fibrous nonwoven web . in example 5 the web was a fibrous nonwoven web . the film used in examples 1 through 3 had a thickness or bulk of 0 . 025 millimeters . its composition included , on a weight percent basis based upon the total weight of the web , 76 percent na - 206 low density polyethylene ( ldpe ) with a density of 0 . 918 grams per cubic centimeter ( g / cm 3 ) and a melt index of 13 . 0 grams per 10 minutes at 190 ° c . under a load of 2160 grams . the polymer is available from quantum incorporated of wallingford , conn . the remaining portion of the composition was 24 weight percent titanium dioxide ( tio 2 ) concentrate which included 50 weight percent tio 2 and 50 weight percent low density polyethylene carrier thus making the total weight percent of tio 2 in the film 12 percent and the remaining 88 percent ldpe . the tio 2 is available from the ampacet company of mount vernon , n . y . under the grade designation 41171 . in example 4 the film was a 0 . 019 millimeter thick cast film containing on a weight percent basis based upon the total weight of the film , 94 percent of the above - described na - 206 lldpe and 6 percent of a titanium dioxide concentrate ( grade designation 110313 ) from the ampacet company . this concentrate included 70 weight percent tio 2 and 30 weight percent ldpe carrier resin . thus the effective tio 2 concentration in the film was 4 weight percent and the ldpe concentration was 96 percent . the fibrous nonwoven web used in example 4 was a spunbond web made from side - by - side bicomponent fibers . the fibers comprised approximately 50 weight percent dow grade 6811a polyethylene from the dow chemical company of midland , mich . and approximately 50 weight percent exxon 3445 polypropylene from the exxon chemical company of darien , conn . the fibers so produced were essentially continuous in nature and had an average fiber diameter of 22 microns . the nonwoven web had a basis weight of 16 . 6 grams per square meter ( gsm ) and the fibers of the nonwoven web were treated with y12488 polyalkylene oxide - modified polydimethylsiloxane non - ionic surfactant wetting package from osi specialties , inc . of danbury , conn . this package references u . s . pat . no . 5 , 057 , 361 . the surfactant addition to the nonwoven web was 0 . 4 percent based upon the total dry weight of the web . for more information on forming bicomponent spunbond webs see u . s . pat . no . 5 , 336 , 552 to strack et al . which is incorporated herein by reference in its entirety . in example 5 the fibrous nonwoven web used was a three layer prebonded composite of spunbond , meltblown and spunbond webs with the meltblown web in the middle . the laminate included a 7 . 0 gsm meltblown layer between two layers of approximately 10 . 5 gsm spunbond material for a total laminate weight of 28 gsm . the spunbond fibers were approximately 20 microns in diameter and the meltblown fibers were approximately 3 microns in diameter . the laminate was point bonded with a bond area of approximately 15 percent and approximately 48 bond points per square centimeter . the spunbond resin was grade pf - 304 polypropylene from himont u . s . a ., inc . and the meltblown resin was grade 3746g polypropylene from the exxon chemical company . an example of how to form such a laminate can be found in brock et al . u . s . pat . no . 4 , 041 , 203 which is incorporated herein by reference in its entirety . the equipment used to aperture the webs in the examples was similar to that described above . three different bond pattern rolls were used . the pattern roll for examples 1 , 2 and 5 used diamond - shaped pins set in offset rows . the pin specifications included a pin height of 0 . 38 mm , equal axis lengths of 1 . 06 mm , total pin surface area of 1 . 12 mm 2 , a pin density of 30 . 3 pins per square centimeter and a total bond or contact area of 35 percent . the patterned roll used in example 3 was similar to the one just described in that the pins were also diamond - shaped in offset rows with the difference being the pin dimensions and density . the pins used on this roll had a pin height of 0 . 42 mm , equal axis lengths of 0 . 85 mm , total pin surface area of 0 . 72 mm 2 , a pin density of 42 . 2 pins per cm 2 and a total bond or contact area of 31 percent . for example 4 the patterned roll used round pins set in a random pattern not in uniform offset rows . the pin height was 0 . 48 mm , the surface area of each pin was 0 . 40 mm 2 , the pin density was 93 . 5 pins per square centimeter and the total bond or contact area was 37 percent . all of the above pattern rolls had a diameter from raised surface to raised surface of 18 . 0 centimeters . the anvil roll was constructed from steel , had a smooth surface and a diameter of 18 centimeters . both of the rolls were heated using an internal hot oil system . the two rolls were adjusted to be in contact with one another and the nip pressure was adjusted as indicated below . in this example the pattern roll described above was heated to a temperature of 85 degrees celsius and the anvil roll was heated to a temperature of 82 degrees celsius . the nip pressure along the interface between the pattern roll and the anvil roll was 35 psig ( 4 . 98 kilograms per lineal millimeter ( kg / lmm )). the pattern roll was adjusted to a rotational speed of 6 . 7 meters per minute and the anvil roll had a rotational speed of 12 . 2 meters per minute . this resulted in a pattern roll to anvil roll speed ratio of 1 . 0 : 1 . 8 . the film unwind had a constant brake tension applied thereto . the inlet speed of the film was 7 . 3 meters per minute . as a result , the film was being fed into the aperturing assembly while under a slight tension to reduce wrinkling . once the film exited the aperturing assembly , it was wound up on a winder roll at a rate of 7 . 9 meters per minute . the resultant film is shown in fig3 of the drawings . as can be seen from the photomicrograph , the film was both apertured and slightly creped . before processing , the film had a basis weight of 25 . 4 grams per square meter ( gsm ) a thickness of 0 . 025 millimeters and essentially no porosity . after processing , the basis weight increased to 28 grams per square centimeter . thickness increased to 0 . 48 millimeters and the porosity was measured to be 6 . 2 standard cubic meters per minute . the percent open area due to the aperturing was 7 percent which was much less than the 31 percent contact area on the pattern roll thus further demonstrating the creped nature of the resultant web . the film web of example 1 was subjected to the profilometry testing outlined above . the average waviness ( wa ) of the ten samples was 47 . 0 microns as measured over a width of approximately 1 . 25 millimeters and the standard deviation for the ten samples was 17 . a plot of the profilometry data is presented in fig8 of the drawings . as can be seen in relation to the other curves , the material of example 1 ( as compared to the below - discussed materials of examples 2 through 4 ) was the second smoothest of the materials due to the lower speed differential between the pattern roll and the anvil roll . in addition , the standard deviation was relatively low which indicated that the undulations in the film between the apertures was more uniform than with the other film only materials . as a point of comparison , two commercially available apertured films were also subjected to the same profilometry testing . the first film was a driweave body side liner material from an always ® sanitary napkin manufactured by the procter and gamble company of cincinnati , ohio . it had an average surface waviness ( wa ) of 53 . 9 and a standard deviation of 8 . 9 . this material had a higher amplitude but a lower standard deviation thus indicating a more uniform material across the solid film areas between the apertures . the second material was a vacuum apertured film ( code # 2 aibnn ) from the bi - plast company of pieve fissiraga ( mi ), italy . it had an average surface waviness ( wa ) of 27 . 3 and a standard deviation of 6 . 7 . here again , this material when compared to the apertured film of example 1 had a lower standard deviation thus indicating a more uniform film surface between apertures . in this example the pattern roll described above was heated to a temperature of 85 degrees celsius and the anvil roll was heated to a temperature of 82 . 2 degrees celsius . the nip pressure along the interface between the pattern roll and the anvil roll was 30 psig ( 4 . 23 kg / lmm ). the pattern roll was adjusted to a rotational speed of 3 . 6 meters per minute and the anvil roll had a rotational speed of 12 . 2 meters per minute . this resulted in a pattern roll / anvil roll speed ratio of 1 . 0 : 3 . 3 . the film unwind had a constant brake tension applied thereto . the film inlet speed was 6 . 1 meters per minute . once the film exited the aperturing assembly , it was wound up on a winder roll at a rate of 4 . 3 meters per minute . the resultant film is shown in fig4 of the drawings . as can be seen from the photomicrograph , the film was both apertured and creped . the creping was much more pronounced than in example 1 and , as a result of the extra creping , the film exhibited stretch properties in the machine direction . before processing , the film had a basis weight of 25 . 4 gsm , a thickness of 0 . 025 millimeters and essentially no porosity . after processing , the basis weight increased to 41 . 4 gsm . thickness increased to 0 . 84 millimeters and the porosity was measured to be 15 . 7 standard cubic meters per minute . the percent open area due to the aperturing was 19 percent which once again was less than the contact area ( 31 percent ) of the pattern roll . the film web of example 2 was subjected to the profilometry testing outlined above . the average waviness ( wa ) of the ten samples was 90 . 6 microns as measured over a width of approximately 1 . 25 millimeters and the standard deviation for the ten samples was 42 . a plot of the profilometry data is presented in fig8 of the drawings . as can be seen in relation to the other curves , the material of example 2 had a higher degree of undulations and a greater average amplitude of the surface waviness ( wa ) than the material in example 1 . the standard deviation was also greater thus showing a greater degree of irregularity of the web material between the apertures . in this example the pattern roll described above was heated to a temperature of 90 . 5 degrees celsius and the anvil roll was heated to a temperature of 76 . 7 degrees celsius . the nip pressure along the interface between the pattern roll and the anvil roll was 40 psig ( 5 . 74 kg / lmm ). the pattern roll was adjusted to a surface rotational speed of 3 . 0 meters per minute and the anvil roll had a surface rotational speed of 18 . 3 meters per minute . this resulted in a pattern roll / anvil roll speed ratio of 1 . 0 : 6 . 0 . the film unwind had a constant brake tension applied thereto . the film inlet speed was 7 . 6 meters per minute . once the film exited the aperturing assembly , it was wound up on a winder roll at a rate of 4 . 9 meters per minute . the resultant film is shown in fig5 of the drawings . as can be seen from the photomicrograph , the film was both apertured and creped . the creping was more pronounced than in examples 1 and 2 and as a result of the extra creping , the film exhibited stretch and recovery properties in the machine direction . before processing , the film had a basis weight of 25 . 4 gsm , a thickness of 0 . 025 millimeters and essentially no porosity . after the processing , the basis weight increased to 40 . 3 gsm . thickness increased to 0 . 81 millimeters and the porosity was measured to be 16 . 9 standard cubic meters per minute . the percent open area due to the aperturing was 20 percent based upon the surface area of the film . the film web of example 3 was subjected to the profilometry testing outlined above . the average waviness ( wa ) of the ten samples was 106 . 7 microns as measured over a width of approximately 1 . 25 millimeters and the standard deviation for the ten samples was 38 . a plot of the profilometry data is presented in fig8 of the drawings . as can be seen in relation to the other curves , the material of example 3 had a higher degree of undulations and a greater average amplitude of the surface waviness ( wa ) than the rest of the materials tested . this was due to the much higher speed differential in this example between the pattern roll and the anvil roll . the standard deviation was also high thus showing a greater degree of irregularity of the web material between the apertures as compared to the commercially available materials described above . in this example the pattern roll described above was heated to a temperature of 85 degrees celsius and the anvil roll was heated to a temperature of 79 . 5 degrees celsius . the nip pressure along the interface between the pattern roll and the anvil roll was 5 . 03 kg / lmm . the pattern roll was adjusted to a rotational speed of 3 . 3 meters per minute and the anvil roll had a rotational speed of 18 . 3 meters per minute . this resulted in a pattern roll / anvil roll speed ratio of 1 . 0 : 5 . 5 . the film unwind had a constant brake tension applied thereto . the film had an inlet speed of 3 . 7 meters per minute . as a result , the film was being fed into the aperturing assembly while under a slight tension to reduce wrinkles . along with the film , there was also fed into the nip a supply of the above - describe nonwoven from a second unwind at the same speed . the film was positioned adjacent the patterned roll although it should be noted that other aperturing and creping attempts were successful with the film oriented to the anvil roll side of the assembly . the material emerging from the exit side of the nip was a coapertured laminate with the apertures extending through both layers of the laminate . see fig6 . once the film / nonwoven laminate exited the aperturing assembly , it was wound up on a winder roll at a rate of 3 . 3 meters per minute . before the aperturing / bonding process , the film had a basis weight of 18 . 7 gsm and the nonwoven had a basis weight of 16 . 6 gsm for a non - bonded combined basis weight of 35 . 3 gsm . after processing , the basis weight increased to 36 . 0 gsm . before processing , the film thickness was 0 . 019 mm and the nonwoven thickness was 0 . 43 mm for a combined unbonded thickness of 0 . 45 mm . after processing , the laminate thickness was 0 . 33 mm thereby showing a reduction in overall thickness . porosity went from essentially zero due to the unapertured film to a value of 13 . 7 standard cubic meters per minute . open area for the laminate was 16 percent . a notable observation with respect to this example was the lack of residual film around the perimeters of the apertures . on the film only samples ( examples 1 through 3 ), there was consistently observed the presence of a flap - like member around the perimeter of the apertures . with the coapertured film / nonwoven laminate of example 4 , this flap was not nearly as prevalent . as a result , the material was very soft to the touch with no scratchy surface and this was believed to be attributed to the lack of the residual film flaps . such a material may be used in a personal care absorbent article such as a sanitary napkin with the film side positioned towards the absorbent core or with the nonwoven positioned towards the absorbent core . the film and fibrous nonwoven web laminate of example 4 was subjected to the profilometry testing outlined above . the average waviness ( wa ) of the ten samples was 22 . 0 microns as measured over a width of approximately 1 . 25 millimeters and the standard deviation for the ten samples was 11 . a plot of the profilometry data is presented in fig8 of the drawings . as can be seen in relation to the other curves , the material of example 4 had a lower degree of undulations and a lower average amplitude of the surface waviness ( wa ) than the rest of the materials tested . it is believed that this was due to the cushioning effect the fibrous nonwoven layer had on the film layer even though the speed differential in this example between the pattern roll and the anvil roll was almost a great as that used in example 3 which did have the greatest average surface waviness . the standard deviation was also low thus showing less irregularity in the surface of the material of the web between the apertures . here again it is believed that this was due to the cushioning effect of the fibrous nonwoven web layer . in this example the pattern roll described above was heated to a temperature of 99 degrees celsius and the anvil roll was heated to a temperature of 82 degrees celsius . the nip pressure along the interface between the pattern roll and the anvil roll was 5 . 74 kg / lmm . the pattern roll was adjusted to a rotational speed of 3 . 0 meters per minute and the anvil roll had a rotational speed of 18 . 0 meters per minute . this resulted in a pattern roll to anvil roll speed ratio of 1 . 0 : 6 . 0 . the nonwoven unwind had a constant brake tension applied thereto . as a result , the spunbond / meltblown / spunbond ( sms ) nonwoven laminate was being fed into the aperturing assembly while under a slight tension and at a speed of 6 . 1 meters per minute . once the sms laminate exited the aperturing assembly , it was wound up on a winder roll at a rate of 3 . 6 meters per minute . the resultant film is shown in fig7 of the drawings . as can be seen from the photomicrograph , the sms laminate was both apertured and slightly creped with an open area of 12 percent . before processing , the web had a basis weight of 28 . 4 gsm , a thickness of 0 , 228 millimeters and a porosity of 3 . 8 standard cubic meters per minute . after the processing , the basis weight increased to 36 . 2 gsm , thickness increased to 0 . 73 millimeters and the porosity increased to 12 . 3 standard cubic meters per minute . as can be seen from the foregoing examples , the process of the present invention is capable of providing a wide variety of materials including single layer materials and laminates which may be creped and / or apertured . these materials can be used in a wide variety of applications , one being as a liner material for a sanitary napkin . a small scale confidential consumer use test was conducted to evaluate one of the materials according to the present invention against a conventional pattern roll faster film cover on a sanitary napkin . referring to fig9 of the drawings , the personal care absorbent article , which in this case was a sanitary napkin 90 , included a liquid pervious top sheet 92 and a bottom sheet 94 with an absorbent core 96 disposed between the top sheet 92 and the bottom sheet 94 . the sanitary napkin according to the present invention utilized the apertured and creped film from example 2 above as the top sheet 92 . the second film used for the top sheet 92 was made according to a more conventional process whereby the pattern roll rotates at a faster surface velocity than the anvil roll . both films were made from the same film composition as was described in example 2 . the preapertured bulk and basis weight for the conventional pattern faster film were 0 . 0375 millimeters and 37 . 5 grams per square meter respectively . this film was apertured using the previously described pattern roll with a 31 percent bond area . the pattern roll was rotated approximately two times faster than the anvil roll . the resultant pattern faster film had a final basis weight of 30 . 5 gsm which was a reduction in basis weight due to the stretching of the film during the aperturing process . the pattern faster film had a bulk of 0 . 64 millimeters , a 23 percent open area and a porosity of 26 . 7 cubic meters per minute . both sanitary napkins used the same chassis which included an absorbent core 96 made from two layers of wood pulp fluff each weighing 6 grams and with a combine bulk of 9 millimeters . the bottom sheet or baffle 94 was a 0 . 025 millimeter thick low density polyethylene film . in between the top sheet and the absorbent core there was positioned a 33 . 2 gsm bicomponent through - air bonded spunbond nonwoven web 98 made from 5 denier polyethylene / polypropylene side - by - side bicomponent fibers which had been treated to render the fibers wettable . the top sheets were placed on top of the spunbond layers and the top sheets and bottom sheets of the sanitary napkins were peripherally sealed to one another . twelve napkins of each construction were worn by women with medium to heavy menstrual flows . each woman wore both constructions for four hours each or until leakage occurred . at the end of each wearing , the women were asked to evaluate each napkin construction for dryness , stain masking , cover cleanliness and absorbency . the sanitary napkin using the top sheet according to the present invention ( example 2 ) was rated better overall especially in the areas of cover cleanliness and stain masking . the surface of the pattern roll faster top sheet had less three - dimensionality thus resulting in fluid hang - up and a wet surface whereas the material of the present invention did not exhibit these traits . these results were significant considering the fact that the pattern faster film had greater open area and greater porosity . the resilient and irregular surface of the material of the present invention is believed to be especially important in the area of maintaining a clean and dry surface with distancing from the body . despite the significant land area between the apertures , the highly creped surface topography kept fluid away from the body while transporting the fluid into and through the apertures . having thus described the invention in detail , it should be apparent that various modifications and changes can be made in the present invention without departing from the spirit and scope of the following claims . | 8 |
before any embodiments of the invention are explained in detail , it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the following drawings . the invention is capable of other embodiments and of being practiced or of being carried out in various ways . fig1 - 5 are schematic diagrams of an existing braking system 10 having anti - lock braking capability and traction control capability . the invention , as shown in the schematic diagrams of fig6 and 7 and described with reference to those figures below , is an improvement of the system shown in fig1 - 5 . the existing braking system 10 is described first so that the improvements and advantages of the invention are better understood when introduced . the braking system 10 includes a brake pedal 14 that is actuable by a driver of the vehicle ( such as any typical automobile — not shown ). the brake pedal 14 is actuated by pressure applied from the driver &# 39 ; s foot when it is desired to slow or stop the vehicle , or to keep the vehicle in a stopped state once stopped . the brake pedal 14 is coupled to a piston shaft 18 that actuates two pistons within a master cylinder assembly 22 . the master cylinder assembly 22 includes a reservoir 26 for containing a volume of hydraulic fluid (“ brake fluid ”) and further includes a body 30 in which two separate chambers are formed , each containing one of the pistons that are mounted on the piston shaft 18 . the master cylinder body 30 includes two outlets 34 , 36 — one from each of the chambers so that two independent brake fluid circuits 40 , 42 are established for redundancy to maintain some braking ability in the event that one of the brake fluid circuits becomes inoperable . the braking system 10 further includes a plurality of braking devices 48 for slowing and stopping the vehicle wheels from rotating . in the most typical construction , disc - type braking devices are utilized . each disc - type braking device 48 includes a rotor 52 coupled for rotation with a wheel of the vehicle and a caliper 56 that selectively applies a squeezing pressure to the rotor 52 to slow the rotor 52 ( and vehicle wheel ) by friction . in a four - wheeled vehicle , the left - rear and right - front braking devices 48 are operated on the first brake circuit 40 , and the left - front and right - rear braking devices 48 are operated on the second brake circuit 42 . although different braking devices 48 are actuated by the brake circuits 40 , 42 , the layout and function of the brake circuits 40 , 42 are identical . the types of braking devices 48 may vary from one braking system to another or within the braking system 10 ( i . e ., larger disc brakes for front wheels or disc - type front brakes with drum - type rear brakes ). the size / type of the components within either brake circuit 40 , 42 may also vary , but it will be understood that the second brake circuit 42 includes the same basic features and functions as the first brake circuit 40 , which is described in detail . the reference numbers of all parts of the first brake circuit 40 are shared with the corresponding parts of the second brake circuit 42 . during normal braking operation , the brake fluid in the brake circuit 40 ( and also in the brake circuit 42 ) must be compressed to hydraulically actuate the braking devices 48 as shown in fig2 . this is accomplished by movement of the pistons within the chambers of the master cylinder 22 . pressurized brake fluid in the first circuit 40 is in communication with each of the braking devices 48 through a single normally - open pilot valve 60 and separate normally - open inlet valves 64 that are in parallel with each other in a position “ downstream ” of the pilot valve 60 ( i . e ., closer to the braking devices 48 ). in parallel with each inlet valve 64 is a one - way check valve 68 . a normally - closed outlet valve 72 is provided in communication with each of the braking devices 48 . when the system is operating normally and the brake pedal 14 is pressed by the driver , high pressure brake fluid is in communication with the braking devices 48 through the valves 60 , 64 . the normally - closed outlet valves 72 keep the high pressure brake fluid in communication with the braking devices 48 , isolating the brake fluid supply path from the separate brake fluid return path ( discussed later ). under normal circumstances , when the driver releases the brake pedal 14 , the pressure in the brake fluid is relieved by expanding back “ upstream ” into the master cylinder 22 through the same path that the brake pressure was originally supplied to the braking devices 48 ( through the normally - open pilot valve 60 and the normally - open inlet valves 64 — see fig3 ). thus , during normal braking , no valves of the brake circuit 40 need to be actuated whatsoever . as well - known in the art , anti - lock braking is effected by sensing impending wheel lock ( skidding on road surface ) with a sensor and relieving a predetermined amount of brake pressure from the locked wheel ( s ) by opening the normally - closed outlet valve 72 associated with the locked wheel ( s ). this allows for better control of the vehicle during hard braking . brake fluid released from the supply side to the return side through either of the outlet valves 72 is accumulated at an accumulator chamber 76 and can be later returned to the reservoir 26 of the master cylinder 22 by a self - priming pump 80 that is driven by a motor 82 . next , the traction control function of the existing braking system 10 is described . the basic function of traction control is to apply selective braking force at a slipping wheel to maintain greater control of the vehicle through greater traction with the road surface . this is usually accomplished automatically or “ on - the - fly ” without input from the driver by using a sensor to monitor for wheel slip and then activating the braking system 10 as described below . although the terms “ slip ” and “ slipping wheel ” are used herein , it should be understood that the various components ( e . g ., sensors , controller , controlled valves ) available today may operate fast enough to virtually eliminate noticeable slipping or spinning . fig4 illustrates the braking system 10 building brake pressure for traction control functionality . notice that the brake pedal 14 is not being pressed by the driver . the pilot valve 60 and the inlet valves 64 are all switched from their normally - open state to a closed state which prevents the transfer of brake fluid and the pressurization of brake fluid across the valves 60 , 64 . a prime valve 86 in parallel with the pilot valve 60 is switched from a normally - closed state to an open state . this allows the motor - driven pump 80 to be operated to draw brake fluid from the master cylinder 22 through the prime valve 86 . operation of the pump 80 supplies pressurized brake fluid to each of the inlet valves 64 , which are closed until the vehicle &# 39 ; s control unit senses wheel slip and demands braking force at one or more of the braking devices 48 . when traction control braking is needed , the inlet valve ( s ) 64 are opened in a controlled manner to limit the slippage of the slipping wheel on the road surface . to release the pressure in the brake fluid that was pressurized during traction control type pressure build , the pilot valve 60 and the prime valve 86 are returned to their normal or at - rest states so that the pump 80 sends the brake fluid back to the master cylinder 22 through the pilot valve 60 ( see fig5 ). in view of the above description , it should be clear that the pilot valve 60 , the inlet valves 64 , the outlet valves 72 , the prime valve 86 , and the pump 80 are all required in order to provide the braking system 10 with the desired anti - lock braking functionality and the “ on - the - fly ” traction control functionality . thus , the braking system 10 is irreducibly complex for the functions required of it . fig6 and 7 are schematic diagrams illustrating a braking system 100 of the invention that provides anti - lock braking functionality and limited driver - induced traction control functionality without either of the pilot valve 60 or the prime valve 86 of the existing braking system 10 . thus , the braking system 100 of the invention provides most of the capability of the existing system 10 with much less cost and complexity . the braking system 100 and its various functions are discussed in greater detail below . some details of the components and functionality of the brake system 100 is common with the braking system 10 and may not be repeated . reference is made to the above description . furthermore , elements of the brake system 100 that are common with elements of the brake system 10 of fig1 - 5 are given the same reference number , incremented by 100 in fig6 and 7 . the braking system 100 of fig6 and 7 ( and the vehicle in which the braking system 100 is implemented ) operates in a normal mode , an anti - lock braking mode , and a traction control mode . in normal mode , the driver presses on the brake pedal 114 and hydraulic pressure in the brake fluid is generated at the master cylinder 122 and conveyed along individual brake fluid supply lines 115 through the normally - open inlet valves 164 associated with each braking device 148 so that the braking device 148 is actuated to slow / stop the corresponding vehicle wheel . in one construction , this can occur by a hydraulically actuated brake caliper 156 that is actuated by the pressurized brake fluid to squeeze or clamp onto the brake disc or rotor 152 that rotates with the wheel . alternate braking devices may operate in different ways while still falling within the scope of the invention . in normal mode , when the driver releases the brake pedal 114 , the pressure in the brake fluid subsides by expanding back “ upstream ” into the master cylinder 122 through the same path that the brake pressure was originally supplied to the braking devices 148 ( through the normally - open inlet valves 164 along the brake fluid supply lines 115 ). thus , like with the braking system 10 of fig1 - 5 , no valves are actuated whatsoever during operation in normal mode . anti - lock braking is also carried out in much the same way as with the braking system 10 of fig1 - 5 . when braking - induced wheel lock is sensed ( or sensed to be imminent ), brake pressure is released in a controlled manner from the affected braking device ( s ) 148 via the associated outlet valve ( s ) 172 . excess brake fluid that is bled through the outlet valve ( s ) 172 during anti - lock braking operation is fed through brake fluid return lines 125 to the accumulator chamber 176 and is later returned to the master cylinder 122 by the motor - driven self - priming pump 180 . during traction control mode , the braking system 100 provides the same basic function as the existing braking system 10 in that brake pressure is applied to a slipping wheel and the brake pressure is gradually reduced as the slipping wheel regains traction with the road surface . however , because the braking system 100 does not include the pilot valve 60 or the prime valve 86 of the existing braking system 10 , the braking system 100 does not build and retain fluid pressure in the braking circuit ( s ) 140 , 142 for later gradual application to the braking device ( s ) 148 while the vehicle is in motion . thus , the traction control mode of the braking system 100 does not operate “ on - the - fly ” to automatically intervene during normal driving , and is instead manually selected and the pressure in the hydraulic brake fluid is manually generated . the driver may manually put the braking system 100 into traction control mode when the vehicle becomes stuck on a slick or loose road surface such as ice , mud , etc . or when the vehicle becomes stuck due to being off of the road surface . thus , the traction control mode of the braking system 100 serves to enable the driver to maneuver the vehicle out of a stuck condition once the driver realizes that the vehicle has become stuck . for this purpose and referring now to fig8 , the brake system 100 is provided with an input such as a push - button - actuated switch 150 that is marked “ tcs on / off ”, “ vehicle stuck ”, “ manual traction control ” etc . and that is actuable by the driver of the vehicle to put the braking system 100 into traction control mode . the switch 150 is coupled to a controller 159 , such as the vehicle &# 39 ; s main control module , that is configured to control the valves 164 , 172 of the braking system 100 . the controller 159 may be the same controller that controls the outlet valves 172 during anti - lock braking action . as shown in fig8 , the controller 159 may be in communication with various sensors such as wheel speed sensors ( wss ) 161 at each wheel so that information regarding each wheel &# 39 ; s speed is conveyed to the controller 159 for enacting the proper actuation of the valves 164 , 172 during anti - lock braking action and traction control action . for example , if the controller 159 receives signals from the wheel speed sensors 161 indicating that a slip threshold has been exceeded for one or more wheels ( i . e ., rotating significantly slower than one or more of the other wheels during braking ), the controller 159 is configured to identify the wheel that has inadequate traction and requires anti - lock operation . the controller 159 signals to the outlet valve 172 associated with the appropriate wheel ( s ) to relieve brake pressure at the corresponding brake device ( s ) 148 until the wheel speeds are within the slip threshold . the monitoring of the wheel speeds and activation of the outlet valve ( s ) 172 may take place many times per second so that maximum braking performance is achieved . in the event that the vehicle becomes stuck or one or more driven wheels are sensed to be spinning , the controller 159 receives signals from the wheel speed sensors 161 so that the spinning wheel ( s ) can be identified . as used herein a “ spinning ” wheel is a driven wheel that is or has been sensed to be rotating faster than a rate corresponding to the vehicle &# 39 ; s rate of travel , although the “ spinning wheel ” may not be perceptibly spinning or may have stopped spinning . the driver actuates the switch 150 to turn the traction control system on . the controller 159 recalls which driven wheel ( s ) were spinning . the controller 159 closes all of the inlet valves 164 for the wheel ( s ) that were not sensed to be spinning ( including all non - driven wheels and any driven wheel that was not sensed to be spinning ). this action allows braking force to be targeted to only the spinning wheel ( s ). fig6 and 7 illustrate an example in which the left - front wheel is sensed to be spinning while the other three wheels are not . accordingly , in this example , the inlet valves 164 associated with the left - rear , right - front , and right - rear wheels are actuated to move to the closed state . when the traction control system is on , the braking system 100 enters a dedicated mode for getting the vehicle out of a stuck condition . the traction control mode is not suitable for regular driving of the vehicle , and in some constructions is only able to be actuated when the vehicle is stopped . with the braking system 100 in the traction control mode , the driver presses on the brake pedal 114 to generate pressure in the braking circuits 140 , 142 . however , hydraulic pressure is only transmitted to the braking device ( s ) 148 that are not blocked by closed inlet valves 164 . thus , in the example of fig6 and 7 , braking force is only applied at the braking device 148 associated with the slipping left - front wheel . the driver may be prompted ( e . g ., by the controller 159 ) to press on the brake pedal 114 by a message on a vehicle display after the traction control mode is activated . because the hydraulic pressure is generated manually by the driver pressing on the brake pedal 114 , no pumps ( e . g ., the pump 180 in the corresponding brake fluid circuit 142 between the slipping wheel and the master cylinder 122 ) are operated to build hydraulic brake fluid pressure for traction control . after the braking force is generated at the braking device ( s ) 148 of the slipping wheel ( s ), the brake pedal 114 is released . in some constructions , the vehicle &# 39 ; s display may prompt the driver that the brake pedal 114 can be released . after the braking force has been established , and before the driver releases pressure from the brake pedal 114 , any inlet valve ( s ) 164 that were open during the building of hydraulic brake pressure are closed . as shown in fig7 , the inlet valve 164 for the left - front braking device 148 has moved from the open state to the closed state . thus , the braking device 148 for the left - front wheel is activated to apply braking force to the wheel , and the brake pressure in the circuit 142 is trapped between the inlet valve 164 and the braking device 148 for the left - front wheel so that the braking force initially generated by the driver &# 39 ; s actuation of the brake pedal 114 is temporarily held without further interaction from the driver . after releasing the brake pedal 114 , the driver may press on the accelerator pedal ( not shown ) in order to move the vehicle . the braking force at the slipping wheel ( s ) ( the left - front wheel in the example of fig6 and 7 ) is gradually released to allow an increasing amount of driving power to reach the slipping wheel as the vehicle begins to move successfully out of the stuck condition . the gradual release of braking force is accomplished by controlling gradual or pulsed opening of the outlet valve 172 to gradually release brake fluid that has been trapped between the inlet valve 164 and the braking device 148 , which relieves hydraulic pressure in the trapped brake fluid and lessens the amount of the braking force . if the first attempt to move the vehicle out of the stuck condition is unsuccessful or the vehicle becomes stuck again , the manual traction control mode is re - activated by the driver . the driver may be required to actuate the switch 150 again and will re - pressurize the brake fluid by pressing on the brake pedal 114 again . this process can be repeated as necessary to release the vehicle from the stuck condition . once the vehicle regains normal traction , as sensed by the wheel speed sensors 161 , the manual traction control mode is automatically shut off and the vehicle returns to the normal mode in which braking only occurs while pressure on the brake pedal 114 exists ( i . e ., brake pressure is not stored ). optionally , in some constructions , the structure of the brake system 100 is further simplified while retaining traction control functionality by removing the anti - lock braking feature . this allows the elimination of the pumps 180 , the motor 182 , and the accumulator chambers 176 from the illustrated braking system 100 . the manual traction control functionality remains in - tact as described above . thus , a braking system can be provided with traction control functionality with a minimum of hardware . various features and advantages of the invention are set forth in the following claims . | 1 |
the described process was used to isolate the weakly adsorbing product - related side compounds of fibrinopeptide a for further characterization . the fibrinopeptide a had been produced by chemical synthesis which generally leads to the formation of product - related side compounds . the side compounds represent potential health risks and have to be removed in the chromatographic purification of the pharmaceutical . characterization of the side compounds allow for evaluation of the health risk and improvement of the chemical synthesis in order to reduce formation of the side compounds . the feed was prepared by weight . in order to obtain approximately 110 ml of feed solution , 0 . 45 g of crude fibrinopeptide a was dissolved in a mixture of 92 . 6 g de - ionized water , 22 . 5 g acetonitrile , and 3 . 0 g acetic acid . the concentration of the crude material was 3 . 6 g / l . the feed contained approximately 1 . 1 g / l fibrinopeptide a ( feed purity 30 %). kromasil c18 - 100 - 10 was used as preparative and analytical stationary phase . the column size was 4 . 6 mm i . d .× 100 mm l in both cases . analytics were performed using an agilent hp 1100 series ( agilent , santa clara , calif ., usa ). for the analytics , a flow rate of 0 . 5 ml / min was used and a gradient from 0 - 100 % solvent b was run within 45 min . the injection volume was 50 μl ( feed ) and 100 μl ( fractions ), respectively . the solvents were the same for analytical and preparative experiments and were prepared by weight . 1 l of solvent a contained 903 . 6 g of de - ionized water , 48 . 2 g of acetonitrile , and 0 . 9 g of tfa . 1 l of solvent b contained 486 . 7 g of de - ionized water , 400 . 0 g of acetonitrile , and 0 . 5 g of tfa . the reported process was carried out using contichrom ® lab - 10 equipment from chromacon , zurich , switzerland . the uv - absorption was monitored at 280 nm , and the temperature was 25 ° c . for both analytics and preparative runs . uv - detectors were mounted at the outlet of each column . the cycle duration was 98 . 2 min and the cyclic accumulation phase of the novel process was 8 cycles . the separation phase was omitted . the final elution phase for the elution of the accumulated w - compounds and the isolation by fractionation at 1 min per fraction and had a duration of 80 . 3 min . thus the duration of the complete run was 8 × 98 . 2 min + 80 . 3 min = 866 min = 14 . 4 h . the load was 4 ml of sample per cycle , which corresponds to 14 . 4 mg crude material per cycle ( feed concentration 3 . 6 mg / ml crude ). thus , during the entire experiment 8 × 14 . 4 mg /( 2 × 1 . 66 ml )= 34 . 7 mg of crude material per ml of column volume was loaded . the load per time and total column volume was 2 . 4 g / l / h . the fractions obtained from the final elution phase were analyzed using the chromatographic analytics . an overlay of the analytical chromatograms of a feed sample and fractions containing enriched and isolated weakly adsorbing side compounds of fibrinopeptide a is shown in fig6 . a zoom of the chromatogram is provided in fig7 . the chromatograms show significant enrichment and high purity of the side - compounds . a compound of particular interest is indicated with an arrow in fig7 . this compound could be obtained with a purity of 80 % in one of the fractions of the final elution phase . the concentration of the compound in this fraction was approximately 8 - fold larger than the concentration of the compound in the feed mixture . in the batch reference experiment , 1 . 375 ml of sample was loaded corresponding to a load of 3 mg crude per ml of column volume . the load per time and total column volume was 1 . 4 g / l / h . thus the load per time and total column volume was in the same order of magnitude for the process described in example 1 and in this example . the gradient operated in the single column batch reference had the same slope as the final elution phase gradient in the process reported in example 1 , and the flow rate was almost the same . the reference run was fractionated with a rate of 1 min / fraction . an overlay of the analytical chromatograms of different fractions showing the purest fractions containing w impurities obtained from the single column batch reference run is provided in fig8 . it can be noticed that 1 . with the single column batch process it was not possible to obtain a single w - product - related compound with high purity . 2 . the product - related compounds are far less concentrated than the ones obtained using the novel process the difference between the batch and the novel process is particularly striking in the case of the compound that is indicated with an arrow in fig7 ( example 1 ) and fig8 ( comparative example ). while with the presented process ( example 1 ) a fraction of & gt ; 80 % purity of this product - related impurity is obtained , the fraction with the highest purity isolated by conventional batch chromatography has & lt ; 20 % purity . the low purities obtained with single column chromatography are due to the large amounts of main compound ( fibrinopeptide a ) present in the samples . the concentration of the compound of interest , obtained by single column chromatography is 6 - 7 - fold lower than the concentration obtained using the novel process . thus , by pooling and concentrating w - fractions containing the compound of interest from 6 - 7 batch runs one could obtain the same compound of interest concentration as with the novel process but not the same purity . note that , if the process described in example 1 would have been operated for a longer time period , the enrichment could have been carried on even further . the described process was used to enrich and isolate the strongly adsorbing product - related side compounds of fibrinopeptide a using the same materials as described in example 1 . only the operating parameters were different and are reported in table 3 . the cyclic accumulation phase of the process was run for five cycles . the separation phase was operated for one cycle . during the final elution phase , fractions were taken at 1 min / fraction . the chromatograms , recorded by the uv detector located on one of the column outlets during the interconnected state ic show the accumulation of the strongly adsorbing x compounds due to the internal recycling ( fig9 ). the samples obtained during in the final elution phase of the process were analyzed offline using hplc . an overlay of the feed chromatogram and chromatograms of fractions with the highest purities of single product - related impurities are shown in figure ( the purity is defined as the ratio between the main peak area and the total peak area ). it is difficult to assign the peaks of the product - related impurities fractions to the peaks of the feed chromatogram in the analytical chromatograms , and additional analytics such as mass spectrometry would be required to unambiguously identify specific compounds . however it can be clearly seen that strongly adsorbing compounds were obtained with high concentration and purity . the described process was used to enrich and isolate fatty acid ethyl ester species . thereby certain fatty acid ethyl ester species that were previously close to the limit of detection were increased in concentration so that a clear signal in the analytics was obtained . in comparison , a single column batch gradient experiment was carried out using the same time - specific load as in the process at a flow rate of 3 ml / min and with 0 . 25 min fractionation intervals . in the batch run , the main compound , eicosapentaeonic acid ethyl ester ( epa - ee ) elutes first and the secondary compound docosahexaeonic acid ethyl ester ( dha - ee ) elutes later . a number of other fatty acid ethyl esters are eluting in between . in the batch chromatogram the peaks cannot be distinguished , however , from the fractionation and offline analysis of the fractions using gas chromatography , the positions , concentrations and purities of the main fatty acid ethyl ester species could be identified . in this case , the concentrations and purities of fatty acid ethyl ester species x , eluting in between epa - ee and dha - ee , were of particular interest . using the information on peak positions and concentrations from the single column batch experiment , the novel process was designed and operated for the enrichment and isolation of the fatty acid ethyl esters eluting in between epa - ee and dha - ee . the novel process was operated with two 6 mm i . d .× 150 mm l c18 silica reversed phase columns with 15 um particles and 120 a pore size and aqueous ethanol solution as solvent under isocratic conditions . the cyclic accumulation phase was 10 cycles , the cyclic separation phase was omitted and the final elution was carried out through both columns after the column that did not contain the compounds of interest had been cleaned and re - equilibrated . the fractionation was done at 0 . 5 min per fraction at a flow rate of 2 ml / min . the fractions from both processes were analyzed using gas chromatography ( gc ). a comparison of two gc chromatograms showing the purest fractions with respect to a fraction of the intermediate fatty acid ethyl esters x is shown in fig1 ( upper part : results from novel process , lower part : results from batch process ). in the chromatogram of one of the fractions obtained with the novel process , a compound was discovered ( indicated with an arrow in fig1 ) which was not clearly detectable in the feed chromatogram ( not shown ). the compound is present with a purity of 15 . 2 % and a concentration far above the detection limit re - analyzing the feed chromatogram , it was found that this compound was present in the feed solution with a purity of 0 . 05 %+/− 0 . 02 % with a concentration verging on the detection limit of the method . also in the case of the single column run , the compound concentration was close to the detection limit and the purity was only 0 . 04 +/− 0 . 02 %. the maximum concentrations obtained in any of the fractions for the abovementioned compound is 3 . 1 relative mass units in the feed mixture , 0 . 5 relative mass units in the highest concentration fraction of the single column batch process and 26 . 8 relative mass units in the high purity fraction of the novel process . the mass balance for the compound in the novel process is 7 . 8 %. summarizing , with the novel process it was possible to increase the concentration of the compound of interest by approximately a factor of 9 and to increase the purity by & gt ; 300 - fold over the feed concentration and purity , respectively . with the single column batch process no improvement in terms of concentration and purity over the feed properties could be obtained . the superior enrichment and isolation capabilities of the novel process significantly facilitated the identification of the newly discovered compound whose existence was previously not clear . | 2 |
let vertex z of reflector 1 be at the origin of a cartesian coordinate system with axes x , y and z ( fig1 ) in this case , the z axis extends in the vertical direction , while the x axis coincides with the optical axis . a rectangular light field 2 of height h and width b is to be produced in the plane x = f 2 . let center z &# 39 ; of the lamp filament be at f 1 ; 0 ; 0 . the basic shape of reflector 1 can be clearly described by a three - dimensional equation for a spatially extended surface : ## equ1 ## at the intersection with plane y = o , the two - dimensional curve results from it ## equ2 ## this is the equation of an ellipse with long semiaxis a and short semiaxis b . the center of this ellipse is at a ; 0 ; 0 , their vertices are thus at 0 ; 0 ; 0 and 2a ; 0 ; 0 . semiaxes a and b are selected so that all light beams that come from point f 1 ; 0 ; 0 and fall on the ellipse unite at f 2 ; 0 ; 0 . this is the case , if ## equ3 ## on the other hand , rom the basic shape of the reflector at the intersection with the plane z = 0 , the curve results ## equ4 ## this is the equation of a parabola with parameter p , this parameter p is selected so that all light beams that come from point f 1 ; 0 ; 0 and fall on this parabola are reflected parallel to the optical axis . this is the case , if the basic shape of reflector 1 can thus be described as follows : ## equ5 ## all light beams that come from point f 1 ; 0 ; 0 and fall on reflector 1 in plane y = o and z = o combine in plane x = f 2 into a focal line 3 which extends parallel to the y axis and r which z = o . this focal line 3 is just as long as reflector 1 is wide , i . e ., b = b . all other light beams that strike reflector 1 outside planes y = o and z = o no longer combine exactly in this focal line 3 . but this is advantageous for the reasons discussed as follows . the real , not ideally small , lamp filament produces light beams whose source is more or less distant from point f 1 ; 0 ; 0 . from that results a natural light diffusion . this is the greater , the more extended the lamp filament is or the closer lamp filament is to the surface of the reflector . therefore , it is greatest for vertex z of reflector 1 and becomes smaller the farther away the reflecting surface is from point f 1 ; 0 ; 0 , i . e ., from center z &# 39 ; of the lamp filament . but there , the distortions of the parabolic ellipsoid are just strongest so that the two light - diffusing effects considerably overlap in a uniform basic diffusion over all reflector parts . further to this point , it is well known that there is always a natural scattering of light in real optical systems . this scattering is substantially proportional to the dimensions of the light source , i . e ., the dimensions of the filament , and inversely proportional to the distance between the reflecting plane and the light source . consequently , those areas of the reflector which are the greatest distance from the filament produce the smallest natural scattering of the image of the filament in the light field area at focal point f 2 . this phenomenon becomes more pronounced as the distance of the reflector area from the three axes x , y and z increases . consequently , these are the areas which produce the greatest &# 34 ; distortion &# 34 ; in the reflector of the instant invention . in other words , these areas reflect the light beam in such a way that it does not meet the light field plane on a caustic line along the y - axis , but rather strikes it at a certain distance therefrom so that the light being reflected from the off - axis reflector areas are scattered more in the z - direction . these small natural scatterings and greater distortions compensate one another , which results in a reflected image which is generally rectangular and uniform in intensity . thus , an almost rectangular light field 2 is produced , having a width b determined first by width b of the reflector and second by the length of the lamp filament in the y direction . height h of light field 2 is essentially determined by the width of the lamp filament in the z direction , but further also by said distortions by the parabolic ellipsoid on its off - axis points . whenever a lamp filament has a wide helical winding and thus a very inhomogeneous light density distribution , that is manifested in the imaging properties of the reflector in a certain irregularity of the illumination in the light field , then it is advantageous if a slight light - diffusing structure is overlaid on the basic shape of the parabolic ellipsoid . then , the regularity of the illumination of light field 2 is substantially improved without significantly enlarging the width and height of the light field . in the cases in which a larger light field is desired , this can be obtained by a coarser light - diffusing structure . in any case , the overlaid light - diffusing structure , without additional operation , can be applied in a numerically controlled milling of the shaping tool for the parabolic ellipsoid ( see fig4 ). selection of a suitable milling diameter of 2 · r , automatically produces small lateral cylinder surfaces of radius r , whose width b &# 39 ; and height h &# 39 ; are formed by the respective step width in the numerically controlled milling operation . in a reflector 1 having the dimensions x = 75 , y = 150 , f 2 = 760 , f 1 ( fig2 )= 46 . 2 , f 1 ( fig3 )= 46 . 9 ; the values for a coarser light - diffusing structure of the radius r , width b &# 39 ; and height h &# 39 ; are approximately r = 20 , h &# 39 ;= 4 - 8 and b &# 39 ;= 1 and for a slight light - diffusing structure the values are r = 40 , h &# 39 ;= 2 - 4 and b &# 39 ;= 1 . an enlargement of the width and height of the light field is also obtained if center z &# 39 ; of the lamp filament is shifted from point f 1 ; 0 ; 0 in the direction of the reflector . the same effect is obtained if semiaxes a and b of the ellipse and parameter p of parabola are calculated as follows ; ## equ6 ## with f &# 39 ;& gt ; f 1 and with lamp center z &# 39 ; at f 1 ; 0 ; 0 . if only width b of light field 2 is to be enlarged , the following is selected ; ## equ7 ## with f &# 39 ;& gt ; f 1 and lamp center z &# 39 ; at f 1 ; 0 ; 0 . on the other hand , if f &# 39 ;& lt ; f 1 is selected , with lamp center z &# 39 ; at f 1 ; 0 ; 0 light field b becomes smaller than reflector width b . finally , if only height h of light field 2 is to be enlarged , the calculation is made ## equ8 ## with f &# 39 ;& gt ; f 1 and lamp center z &# 39 ; at f 1 ; 0 ; 0 . from the above considerations , it is evident that the focal point of the ellipse and the focal point of the parabola intersect the x - axis an insignificant distance from one another , that distance , however , determines the width of the light field . corrrespondingly , the focal point of the ellipse and the focal point of the parabola can be spaced an insignificant distance from one another on the y - axis , that distance determining the length of the light field . accordingly , the width and length of the light field can be adjusted to a desired size by adjusting the focal lengths of the ellipse and parabola without adversely affecting the rectangular reflected image . if the parabola is replaced by an arc with radius r , this circular ellipsoid can be represented , mathematically closed , as follows : ## equ9 ## for y & lt ;& lt ; r is then ## equ10 ## the circular ellipsoid thus again changes into a parabolic ellipsoid , whose parabola parameter is p = r . for very narrow reflectors with small width b , the parabola can thus be replaced by an arc . as a result , in certain production processes , advantages for the production of the shaping tool can result . from the foregoing description , one skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . | 8 |
the method in accordance with the invention assumes the following : depending on the type of the burning material , a wide range of incineration products are obtained which are designed below as aerosols or also as particles for the sake of simplicity . hot fires produce large quantities of aerosols of small diameter . for example , an aerosol structure or cluster comprising 100 molecules of co 2 has a diameter of approximately 2 . 5 nm . fires with a so - called low energy conversion per unit of time , i . e ., so - called smoldering fires , produce aerosols with a diameter of up to 100 μm and partly also macroscopic suspended matter , e . g ., ash particles . a scattered - light fire detector which is suitable for recognizing all kinds of fires would therefore have to recognize aerosols with a diameter of 2 . 5 nm to 100 μm , i . e ., it would have to cover a range of five powers of ten . as a result of their high efficiency , infrared - radiating gaas leds have been used exclusively in practice as radiation sources in scattered - light fire detectors , which leds radiate at a wavelength λ of 880 nm . the intensity of the scattered radiation caused by a particle primarily depends on the ratio of the diameter of the particle ( which is assumed to be a sphere for the sake of simplicity ) to the wavelength of the incident radiation . although the shape and the absorption coefficient of the particle play an additional role , these parameters can obviously not be influenced in the present context . the so - called rayleigh scattering decreases proportionally to λ 4 for a particle diameter below 0 . 1 λ . it follows from this that fire detectors working with infrared - radiating leds have a steeply dropping sensitivity for particle - diameters of less than approximately 90 nm . an additional factor is that the rayleigh scattering is not omnidirectional but has characteristic maximums at 0 ° and 180 ° and characteristic minimums at 90 ° and 270 °. for particles with diameters of 0 . 1 λ to 3 λ , which in the case of an infrared - radiating led is from approximately 90 nm to approximately 2 . 5 μm , the mie effect is relevant ; which is even stronger directionally dependent than the rayleigh scattering and moreover shows destructive and constructive interference effects by interaction of the introduced radiation with the radiation reflected on the particle . above 3 λ the scattering intensity is substantially independent of the wavelength and depends primarily on the type and the shape of the particle . it follows from this that the low sensitivity of scattered - light fire detectors for hot fires , e . g ., open wood fires , is caused by the high wavelength of the infrared radiation in relationship to the diameter of the particles to be detected . this can be counteracted neither by increasing the amplification of the signal supplied by the photodetectors , nor by increasing the intensity of the introduced radiation , because in both cases the sensitivity of the detector for large and macroscopic particles ( e . g ., dust , vapors from industrial processes and cigarette smoke ) will become too high . by alternately irradiating the measuring volume with infrared radiation and blue light and by separately processing the signals proportional to the received scattered radiation , it is possible , as is principally known from the aforementioned wo 01 / 59 737 , to considerably increase the sensitivity of the detector for particles of small diameter , especially such for which the rayleigh radiation is relevant . it can be easily shown mathematically that the sensitivity increases by a factor of 10 or more . the increase in the sensitivity of the detector for particles of a small diameter is alone not sufficient for obtaining a secure alarm decision , i . e ., for avoiding false or deceptive alarms . it is not the case , contrary to the assumption made in wo 01 / 59 737 , that the irradiation of the measuring volume with blue light for large and small particles supplies scattered radiation of approximately the same intensity . examinations on this part have shown to the contrary that especially small particles supply scattered radiation of very similar intensity in the infrared region and under blue light , both in the forward and , at a lower level , the backward radiation region . as was further observed , it is only the addition of the angular dependence of the intensity of the scattered radiation which allows obtaining secure criteria which allow differentiating between deceptive values and consequential products of fires in a manner substantially independent of the kind of the material that is burned . in accordance with the invention , four scattered radiation intensities are therefore measured in each measuring cycle , namely the forward scattered radiation and the backward scattered radiation in the infrared region and the same values in the blue light region . the corresponding quiescent value level , preferably with a reduction for security purposes ( according to a multiplication of the quiescent value levels with a factor & lt ; 1 , i . e ., a scaled quiescent value level ), is subtracted from the signal levels which are proportional to the measured intensities , which subtraction is made for increasing the measuring dynamics and in order to simplify the further processing . the thus obtained resulting values are then compared in an evaluation logic circuit with stored values , especially threshold values . additional information is obtained by the formation of the quotients of the resulting values and renewed comparison with the stored reference values . the results of these operations can be combined and evaluated on their part , e . g ., adjusted to the respective environment in which the detector is used . in this way a number of meaningful intermediate results can be obtained , e . g ., for different preliminary alarms and finally also alarm signals . fig1 shows a first preferred embodiment of a detector suitable for performing this method . a spherical measuring volume with a center 1 . 5 is defined on a base plate 1 . 7 , which measuring volume is schematically indicated with a thin circle . an infrared - radiating led 1 . 1 a emits radiation along a first radiation axis into said measuring volume . precisely opposite of the same , there is a blue - radiating led 1 . 1 b which emits radiation into the measuring volume along a second radiation axis . the first and the second radiation axis coincide . a main axis under an angle of α = 120 ° to this common radiation axis also extends through the center 1 . 5 of the measuring volume . a first photodiode 1 . 2 a and 1 . 2 b are arranged opposite of one another on said main axis . as a result , the main axis on which the respective receiving axes of the two photodiodes are situated encloses with the first radiation axis of the “ infrared ” led 1 . 1 a an acute angle β = 60 °. the same acute angle is accordingly enclosed by the main axis with the ( second ) radiation axis of the “ blue ” led 1 . 1 b . as a result , the photodiode 1 . 2 a measures under an angle of 120 ° the infrared forward scattered radiation as produced by the “ infrared ” led 1 . 1 a on particles in the measuring volume and the blue scattered radiation as produced by the “ blue ” led 1 . 1 b is measured under a backward scattered radiation of 60 °. conversely , the photodiode 1 . 2 b measures the blue forward scattered radiation which is produced by the “ blue ” led 1 . 1 b under an angle α of 120 ° and the infrared backward scattered radiation which is produced by the “ infrared ” led 1 . 1 a under a backward scattering angle of 60 °. in order to avoid any stray reflections , the leds and the photodiodes are situated in tube bodies such as 1 . 6 . for the same reason suitably shaped diaphragms such as 1 . 3 a , 1 . 3 b as well as 1 . 4 a and 1 . 4 b are arranged between the leds and the photodiodes . further sensors such as a temperature sensor at 1 . 8 and a gas sensor at 1 . 9 are arranged on the base plate 1 . 7 . as is conventional , a circuit board for producing the current pulses for the leds 1 . 1 a and 1 . 1 b as well as for processing the electric signals supplied by the photodiodes 1 . 2 a and 1 . 2 b is situated beneath the base plate 1 . 7 . as is also conventional , the base plate 1 . 7 is housed in a detector housing ( not shown ) which allows an exchange between the ambient air and the air in the measuring chamber , but at the same time keeps outside light away from the measuring chamber . fig2 shows a second embodiment of the detector with the same components as in fig1 , but with a different geometrical arrangement . in order to explain this arrangement in closer detail , the first digit of the respective reference numeral is provided here with “ 2 ” instead of “ 1 ”. in contrast to fig1 , only the radiation axes of the infrared - radiating led 2 . 1 a and the blue - radiating led 2 . 1 b which go through the measuring center 2 . 5 will coincide . the receiving axis of the photodiode 2 . 2 a encloses an angle α 1 = 120 ° with the radiation axis of led 2 . 1 a and with the radiation axis of the blue - radiating led 2 . 1 b an angle β 2 = 60 °. the receiving axis of the photodiode 2 . 2 b encloses conversely with the radiation axis of the infrared - radiating led 2 . 1 a an angle α 1 = 60 ° and with the radiation axis of the blue - radiating led 2 . 1 b an angle α 2 = 120 °. accordingly , the first photodiode 2 . 2 a measures the forward scattered radiation of the “ infrared ” led 2 . 1 a and the backward scattered radiation of the “ blue ” led 2 . 1 b . the second photodiode 2 . 2 b conversely measures the forward scattered radiation which is produced by the “ blue ” led 2 . 1 b and the backward scattered radiation which is produced by the “ infrared ” led 2 . 1 a . the photodiodes 2 . 2 a and 2 . 2 b can exchange their positions with the leds 2 . 1 a and 2 . 1 b , so that the two photodiodes are situated precisely opposite with respect to the measuring center 2 . 5 . this geometrical arrangement of the four components , i . e ., that of the two leds and the two photodiodes , is less favorable than that of fig1 because only 75 % of the four measured scattered radiations orginate from the same measuring volume . this is illustrated by the intersecting surfaces between the beams which are shown by omitting the angular dependency both of the intensity of the emitted radiations as well as the sensitivity of the photodiodes as well as the diffraction effects which occur unavoidably on the edges . in the case of detectors which ( as in the embodiment ) comprise further sensors such as 2 . 8 and 2 . 9 , there is an additional factor that the measuring center 2 . 5 is disposed in a strongly eccentric fashion with respect to the center of the base plate 2 . 7 . this leads to the consequence that the sensitivity of the detector is not omni - directional as in the case of the first embodiment , but that it is dependent upon the direction from which the consequential products from the fire enter the detector and its measuring volume . fig3 shows a third embodiment of the detector with the same components as in fig2 , but with a different geometrical arrangement . in order to illustrate this in closer detail , the first digit of the respective reference numeral is provided here with “ 3 ” instead of “ 2 ”. in contrast to fig1 , only the receiving axes of the photodiodes 3 . 2 a and 3 . 2 b coincide which pass through the measuring center 3 . 5 . these receiving axes form the main axis . the “ infrared ” led 3 . 1 a encloses with the latter an acute angle α 1 = 60 ° and an obtuse angle β 1 = 120 °. the “ blue ” led 3 . 1 b is situated opposite of the “ infrared ” led 3 . 1 a with respect to the main axis , which “ blue ” led accordingly encloses with the main axis an acute angle β 2 = 60 ° and an obtuse angle α 2 = 120 °. as a result , the photodiode 3 . 2 a receives both the infrared forward scattered radiation as well as the blue forward scattered radiation , whereas the photodiode 3 . 2 b receives both the infrared backward scattered radiation as well as the blue backward scattered radiation . other than is the case in fig2 , the two leds and the two photodiodes cannot be provided in this arrangement with an exchanged position , because in this case the two photodiodes would simultaneously measure the forward scattered radiation of the one led and then the backward scattered radiation of the other led , i . e ., supply four measured values of which two would be approximately the same in pairs . as in the case of fig2 , only 75 % of the four measured scattered radiations each originate from the same measuring volume in the embodiment according to fig3 as well . it is more advantageous than in the case of fig2 in that the measuring volume , even in the case that the detector comprises further sensors such as 3 . 8 and 3 . 9 , is situated closer to the center of the base plate 3 . 7 , so that the sensitivity of the detector depends less strongly on the direction from which the consequential products from the fire enter the detector . an additional advantageous aspect in comparison with fig2 is in the geometry according to fig3 that all diaphragms 3 . 3 a , 3 . 3 b and 3 . 4 a , 3 . 4 b are arranged close to the measuring volume and are situated in a substantially symmetrical fashion around the same . under the conditions that are the same otherwise , the positioning of the “ blue ” led 3 . 1 b causes a larger diameter of the base plate 3 . 7 as compared to fig1 . although it applies to all embodiments that the scattered radiations are measured under angles of 120 ° or 60 °, the adherence to these angles is not a necessary precondition for performing the method proposed for implementing the invention . the important aspect is merely that the angles are chosen in such a way that in the forward scattered radiation direction and in the backward scattered radiation direction sufficiently high intensities can be measured on the one hand and sufficiently different intensities can be measured in the forward scattering region and in the backward scattering region of the respective particles for the largest possible number of different consequential fire products . | 6 |
the powered rolling and crimping device prc of current invention is generally shown in fig1 . in the preferred embodiment , the powered roller / crimper prc is designed to be attached to and pulled by a conventional walk - behind tractor . typical examples of these types of tractors are manufactured by dr , troy - built , and bcs . for the purposes of the current invention , a walk - behind tractor is a tractor that does not accommodate a riding operator so that the operator walks behind the tractor and guides the tractor with a linkage that may include handlebars , hand grips , or the like . in the preferred embodiment , the tractor power takeoff extends rearward from the back of the tractor so that the powered rolling and crimping device prc engages the power takeoff and is towed behind the tractor in a “ tow configuration ”. fig1 shows the prc device in the tow configuration . however , in alternative embodiments , the tractor power takeoff may extend forward from the front of the tractor so that the current invention also has a front - mounted “ push configuration ”. in the push configuration the prc device extends out in front of the tractor so that the tractor pushes the prc device . the push configuration enables an operator to access corners and tight spots that would otherwise be inaccessible . as generally shown in fig1 , the powered rolling and crimping device prc comprises a linkage assembly 10 . the linkage assembly 10 includes a mounting plate 12 and a base connecting member 14 as well as a drive shaft 16 with a flexible coupler 17 . the linkage assembly 10 also includes a dynamic stabilizing device 11 and a vertical stabilizing member 13 . as shown in fig1 , the mounting plate 12 bolts to a power takeoff housing of a tractor . a drive shaft stabilizer flange 18 bolts to the mounting plate 12 . the drive shaft 16 extends through the mounting plate 12 and stabilizer flange 18 , and meshes with the splines of the tractor power takeoff shaft . the dynamic stabilizer device 11 has a first end that is connected to the tractor and a second end connected to the vertical stabilizing member 13 . a mounting bracket 15 for auxiliary wheels extends rearward from the vertical stabilizer . the auxiliary wheels enable a user to more easily maneuver the prc device for transportation and storage . in the preferred embodiment , the dynamic stabilizer device 11 is a shock absorber that further stabilizes the prc device and relieves stress on the tractor power takeoff assembly and drive shaft 16 . the linkage assembly 10 is connected to a roller assembly 20 . the roller assembly 20 comprises the crop roller frame support member 22 , endplates 24 , and a crop roller 26 . the linkage assembly 10 base connecting member 14 extends to the roller assembly 20 crop roller frame support member 22 . in the preferred embodiment , an axle ( not shown ) extends from each end of the crop roller 26 . end portions of the axle nest in a bearing assembly on the inner side of each of the end plates 24 so that the axle turns in the bearing assemblies . in the preferred embodiment , the crop roller component 26 comprises a smooth cylindrical roller . in alternative embodiments , the cylindrical roller 26 may include straight or angular projections that crimp the crops as the roller 26 is towed behind the tractor . in further alternative embodiments a plurality of crop rollers 26 may be incorporated into a single powered rolling and crimping device prc . in the preferred embodiment , the base connecting member 14 extends further away from the tractor to a crimping assembly 30 . the crimping assembly 30 primarily comprises a stationary support beam 32 and a movable crimping bar 34 . the crimping assembly 30 stationary support beam 32 is connected to the crop roller frame support member 22 by the base connecting member 14 and a plurality of horizontally extending stabilizers 28 . the stationary support beam 32 is also connected to the vertical stabilizing member 13 . a pair of vertically oriented crimping member control rods 36 extend through the stationary support beam 32 to the crimping bar 34 . a helical compression spring 38 encircles each of the crimping member control rods 36 and maintains the crimping bar 34 in the extended position . the crimping bar 34 is raised and lowered by a crimping bar lifting assembly 40 . in the preferred embodiment , the crimping bar lifting assembly 40 essentially comprises a gearbox 42 , a pair of output power shafts 44 , and at least one cam lobe 48 mounted on each output power shaft 44 . the gearbox 42 is mounted on the aft portion of the base connecting member 14 . the gearbox 42 receives input torque from the driveshaft 16 and distributes the torque to the two output power shafts 44 that extend latterly from the gearbox 42 . the output power shafts 44 are secured and supported by a plurality of shaft support flanges 46 . the shaft support flanges 46 are mounted on the horizontal stabilizers 28 that connect the crop roller base frame member 22 with the stationary support beam 32 . a cam lobe 48 is attached to each output power shaft 44 between two of the respective shaft support flanges 46 . as the output power shafts 44 rotate , the periphery of the cam lobes 48 engages cam followers 50 that extend horizontally from a top portion of each of the crimping bar control rods 36 . as each cam lobe 48 rotates , the associated cam follower 50 travels upwardly along the periphery of the ramp portion of the cam lobe 48 . when the cam followers 50 reach the nose portion of the respective cam lobes 48 , the crimping bar 34 is in the fully raised position and the helical compression springs 38 are fully compressed . as the cam followers 50 pass over the nose portion of associated the cam lobes 48 , the helical compression springs 38 drive the crimping bar 34 downwardly so that the crimping bar 34 crimps the target cover crops . as the output power shafts 44 and associated cam lobes 48 continue to rotate , the cycle repeats itself as the cam followers 50 once again travel upwardly along the ramp portion of each of the respective cam lobes 48 . as discussed supra , the current invention also includes an alternative embodiment ( i . e . a push configuration ) wherein the prc device is disposed in front of the walk - behind tractor so that the tractor pushes the prc device . in the alternative embodiment , the gearbox 42 and linkage assembly 10 are rotated 180 degrees to extend rearward and the vertical stabilizing member 13 is relocated to avoid interference with the linkage assembly 10 . other aspects of the invention are essentially unaffected by the modification . in operation , the mounting plate 12 is bolted to the tractor power takeoff housing so that the tractor power takeoff engages the drive shaft 16 . the drive shaft 16 provides input power to the gearbox 42 . the gearbox 42 rotates laterally extending power output shafts 44 . cam lobes 48 mounted on the power output shafts 44 engage corresponding cam followers 50 . the cam followers 50 are attached to crimping bar control rods 36 that essentially raise and release a crimping bar 34 . as the tractor propels the powered rolling and crimping device across a field , targeted cover crops are first flattened by the crop roller 26 and then crimped by the crimping bar 34 . the combination of the rolling and crimping action of the powered roller crimper prc destroys the cover crop without cutting or uprooting the cover crop stalks . in the preferred embodiment , the number of crimping cycles per unit of time is a direct function of tractor power takeoff rotary speed ( for example power takeoff revolutions per minute ( rpm )). at a constant power takeoff rpm , if a user increases the ground speed that the device is propelled across a field , the number of crimping cycles per linear foot is decreased . if the user decreases his speed , the number of crimping cycles per linear foot is increased . this arrangement allows a user to vary his horizontal travel speed to apply more crimping cycles to areas of a filed in which cover crop growth has the greatest density . a change in the gearing of a tractor power takeoff transmission ( if equipped with a transmission ) will increase or decrease the crimping rate by increasing or decreasing the power takeoff rpm . in alternative embodiments , the power takeoff transmission may receive input from the tractor wheels so that the prc device delivers ( for example ) a specified number of crimping cycles per linear foot of travel . in further alternative embodiments , the prc gearbox 42 may be modified so that the gearbox 42 comprises a selectable - speed transmission . in this embodiment , the prc device crimping revolutions are selectable by a user independent of the tractor power takeoff rpm . for the foregoing reasons , it is clear that the current invention provides an innovative means of destroying a cover crop . the invention may be modified in multiple ways and applied in various technological applications . the current invention may be customized as required by a specific operation or application , and the individual components may be modified and defined , as required , to achieve the desired result . for example , although the preferred embodiment is intended for use with a walk - behind tractor , in alternative embodiments the scale of the components may be increased or decreased . an implement with the design described herein may be used with other types of powered devices including conventional riding - type farm tractors as well as devices that would not conventionally be considered to be “ tractors ”. such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to included within the scope of the following claims . | 0 |
fig1 shows a child car seat temperature alert 20 . in this embodiment the sensors are incorporated into the car seat 20 . the car seat can be constructed to accept a baby , infant , toddler or child . a weight sensor 22 in the bottom of the car seat is sized based upon the weight of the baby , infant , toddler or child that is placed in the seat . while a weight sensor can be included in the seat 20 , the buckle 31 can be used to identify that a child has been secured into the seat 20 . a typical baby 30 seat has a plurality of shoulder or chest straps 30 that extend from the back 21 of the seat 20 to one part of the buckle 31 . the first part of the buckle 31 is secured into a receiver 40 in the seat 20 . a release button 32 , released the secured buckle 31 . the seat 20 or buckle 31 includes at least one temperature sensor , power supply , signaling system , and optionally a global positioning system ( gps ). when the system detects that a child has been left within the seat 20 an antenna 90 transmits a signal to alert parents , a care giver or authorities . in another contemplated embodiment , the sensors are placed in an intermediary buckle device that is essentially a male and female buckle extension that goes between the buckle 31 and the receiver 40 . this embodiment is shown and described in more detail in other figures of this document . fig2 shows an interconnecting module 40 for use on an existing child seat . this device allows a parent or care giver to utilize the child alert system without requiring replacement of the entire seat . this device can also be transferred from one seat to another . the interconnecting module 40 has a female buckle receiver 43 and a male buckle . because the interconnecting module 40 is not integrated into the baby seat , a weight sensor is not available to determine if a child is in the seat . the male portion of the buckle is constructed in two parts , or with two contacts 41 and 42 with an insulator between the two contacts . it is also contemplated that a magnetic or proximity sensor can be used to determine if the buckle is secured inside of a baby seat . to release the male portion from a seat , the existing buckle release mechanism is operated ( 32 from a previous figure ). the male buckle from the seat is released with one or more buttons 44 . within the interconnecting module 40 is a microcontroller 45 or other processing module 45 . this processor is connected to a power supply 48 or battery and sensor ( s ) 49 , and an antenna 47 or similar communications device . the sensor ( s ) include a minimum of a temperature sensor , but could include a gsp module , proximity sensor , thermal sensor or weight sensor . it is also contemplated that the interconnecting module 40 could include a light emitting diode led or a speaker to provide information regarding the status of the battery or confirmation that the interconnecting module 40 is operating . the temperature sensor 49 monitors the ambient temperature at or around the interconnecting module 40 . two sensors can be placed on opposite sides of the interconnecting module 40 to monitor the temperature facing the child and facing away from the child to obtain a differential or to reduce radiated human temperature confusion in readings . when a child is first placed into the seat and buckled into the seat , the interconnecting module 40 will generally register the temperature of the inside of the car . over time the temperature will change as the child is being transported . the graph shows two scenarios with both an initially hot vehicle and an initially cold vehicle to provide signaling from either extreme . fig3 shows temperature changes over time and for determining when to send an alert . starting with the upper plot that shows an initially hot vehicle , this vehicle is in a sunny summer environment where the initial inside temperature of the vehicle is shown at 130 degrees . when the child is buckled into the vehicle , the vehicle is started , the driver will operate the air conditioning or vents to cool the interior of the vehicle . when the buckle is connected , the time starts at 0 minutes . connecting the buckle powers or starts the monitoring . the temperature drops 50 as the interior of the vehicle is brought to a comfort level and the comfort level is maintained 51 as the car is being driven . at some point the driver will reach their destination and turn the car off . if the buckle is opened , then the monitoring will stop . in the upper graph , the child is left buckled in the vehicle with the windows closed . the temperature inside the vehicle increases from heat of the sun 52 until the increase in temperature exceeds a threshold 54 . in the preferred embodiment , the temperature rise rate 53 that indicates the child has been left in the vehicle is 10 , 12 or 15 degrees of rise in a three - minute period of time . the threshold may be fixed or adjustable as dictated by testing . a first threshold of 100 degrees and / or 120 degrees may also trigger a signal regardless of the temperature rise rate . in the lower plot , the child is placed in a cold vehicle . connecting the buckle powers or starts the monitoring . the temperature rises 60 as the interior of the vehicle is brought to a comfort level and the comfort level is maintained 61 as the car is being driven . at some point the driver will reach their destination and turn the car off . if the buckle is opened , then the monitoring will stop . the child is left buckled in the vehicle with the windows closed . the temperature inside the vehicle decreases from the cold exterior of the vehicle 62 until the decrease in temperature exceeds a threshold 64 . in the preferred embodiment , the temperature drop 63 rate that indicates the child has been left in the vehicle is 10 , 12 or 15 degrees of drop in a three minute period of time . the threshold may be fixed or adjustable as dictated by testing . there can also be lower thresholds that trigger a signal regardless of the temperature drop rate . fig4 shows a block diagram of the components in the child car seat temperature alert . the left portion of this figure is for the sensor module regardless of the module being installed in a seat or a buckle device . the right portion of the figure is for a receiver module . both of these modules can be combined as a single unit , but separating them provides for lower power consumption of a battery powered unit ( left ) that transmits 80 a low - power short - range single through bluetooth or other low - power wireless transmission to a higher power transmitter 86 ( right ) that can be powered by a cigarette light in a vehicle . the temperature monitor has a controller 70 that is powered by a rechargeable or replaceable battery 74 . it is also contemplated that the power can come from connection with a vehicle , but this adds a requirement for wiring and connection that is less convenient . the controller 70 is shown connected to sensor 73 , such as a temperature sensor and optionally a gps sensor that can determine the geographical location of where the child is located the enable authorities to rescue a child . this diagram shows a weight sensor 77 and a speaker 78 that can provide sounds or speech to indicate sensing , un - bucked condition or low battery . an led can also be included . one or more buttons 71 can be incorporated . this figure shows contacts 72 or a switch or a load cell to indicate that a child is present and the buckle is secured . a transmitter 75 is connected to the controller 70 and the transmitter has an antenna 76 for transmission of a warning condition at higher power for help . the separate antenna 81 can be connected to a separate controller 83 that can send 86 a warning to a person &# 39 ; s cell phone , cellular device or to authorities . the controller can also be connected to the horn and lights and / or windows 85 of the vehicle to open or crack the windows to provide some relief before a person arrives to provide assistance . there can be a connection or integration into the internal control electrical bus structure of the vehicle . fig5 shows a pictorial diagram of an animal collar 92 with a receiver 94 . the collar 92 has an integrated sensor , power supply and transmitter / receiver module 93 . the collar unit is in communication 80 with the receiver / signaling unit 94 . to maintain the temperature sensor in a location that is unlikely to receive high temperature and / or abrupt temperature changes the location of the temperature sensor is arranged on a weighted collar to place the sensor off of the top or bottom hanging location of the collar to keep the sensor out of the sun and to reduce the potential for the sensor sitting directly under the chin where the sensor does not receive ambient temperature . fig6 shows a block diagram of the components in the animal collar temperature alert . because a dog or other animal does not generally sit on a seat or a particular location in a vehicle , determining if an animal is in the vehicle is determined by a proximity sensor . the proximity sensor is with a short - range transmitter and receiver , like a bluetooth device that has a range of about 10 meters . a bluetooth device further requires limited power and can intermittently send a signal for proximity and for the temperature . the sensor is integrated with the collar . in operation , when the animal collar is within blue tooth proximity of the receiver 94 in the vehicle and the vehicle is off , the temperature of the collar 92 is monitored by the receiver . the monitoring is consistent with the monitoring disclosed previously herein this disclosure . thus , specific embodiments of an occupant car temperature alert have been disclosed . it should be apparent , however , to those skilled in the art that many more modifications besides those described are possible without departing from the inventive concepts herein . the inventive subject matter , therefore , is not to be restricted except in the spirit of the appended claims . | 6 |
the drl1 - 1 and the drl1 - 3 allele were kindly provided by i . bancroft ( jic , norwich ), resp . r . simon ( university , koeln ), elol , elo2 , elo3 and elo4 were obtained from j . l . micol ( umh , alicante ). total genomic dna of the drl1 - 2 mutant , dsb1 / 30d2 , was prepared according to pruitt and meyerowitz ( 1986 ) and digested with hind3 . amongst the pool of fragments a 5 . 8 kb h3 fragment was generated containing the intact ds and flanking plant dna . this pool was ligated in conditions that favor the formation of monomeric circles . primers to both ds ends were added pointing outwards the ds ( primer 1 : 5 ′- cgggattttcccatcctactttcatccctg - 3 ′ ( seq id no : ______ ) and primer 2 : 5 ′- ttcgtttccgtcccgcaagttaaata - 3 ′) ( seq id no : ______ ) and pcr reaction was done . a fragment of 1 . 4 kb was amplified and cloned in the pgem - t ( promega ) vector , a h3 digest confirmed the presence of a h3 site . the dna sequence was determined of 682 bp plant dna flanking the 3 ′ end of ds and of 585 bp plant dna flanking the 5 ′ end of ds . 100 % homology was found with a 250 bp genomic fragment flanking a tds in the drl1 - 1 mutant , obtained after transactivation of the ds from the dsb1 line ( bancroft et al ., 1993 ). a drl1 genomic fragment containing the intron - less coding region was amplified on wild - type dna ( ler ecotype ) with primer 3 ( 5 ′- ttttgtaggcagtgtgttta - 3 ′) ( seq id no : ______ ) to the 5 ′ end of the 250 bp published drl1 sequence ( bancroft et al ., 1993 ) and primer 4 ( 5 ′- tcgtcgttttatgattttat - 3 ′) ( seq id no : ______ ) at the 3 ′ end of the gene and cloned in pgem - t to create the plasmid pgemt :: drl1 . pcr reactions were done on 10 ng of total genomic dna in 50 μl buffer ( 1 . 5 mm mgcl2 , 50 mm kcl , 10 mm tris - hcl , ph 8 . 3 , 0 . 2 mm gelatin ), containing 0 . 2 mm of each dntp , 0 . 2 μm of each primer and 2 . 5 units of taq polymerase ( amplitaq ®, perkin elmer ). pcr conditions were : one cycle 5 minutes at 95 ° c ., 1 minute at 50 ° c . and 1 minute at 72 ° c ., and 34 cycles 1 minute at 95 ° c ., 1 minute 50 ° c . and 1 minute 72 ° c . ; primers were designed by the computer program oligo 4 primer analysis software ( rychlik , 1990 ). dna sequence was determined on an applied biosystems 37 ° a automated dna sequencer using the 35s - dideoxy method ( sanger et al ., 1977 ). direct and reversed m13 primers were used to sequence both strands at least once . intelligenetic &# 39 ; s suite software was used to assemble and analyze dna sequence data . an rflp was found between the genomes of the ler and col ecotypes using a bcll restriction enzyme digest and the drl1 genomic clone as a probe . the drl1 gene has been mapped by using a set of 100 recombinant inbred lines ( http :// nasc . nott . ac . uk / new_ri_map . html ). a gst - drl1 c - terminal fusion was expressed in e . coli top 10f ′ and the “ crude ” extract was purified on glutathion - agarose . after adjusting the protein solution to 1 mm cacl 2 , it was mixed batch - wise for 15 minutes at room temperature with cam - sepharose equilibrated with binding buffer consisting of 40 mm tris - hcl ph 7 . 5 , 50 mm nacl , 3 mm mgcl 2 , 0 . 2 mm cacl 2 , and 0 . 1 mm dtt according to liao and zielinski ( 1995 ). the slurry was packed into a column , the buffer drained and the column washed with 5 bed volumes of binding buffer . bound proteins were eluted in buffer containing 40 mm tris - hcl ph 7 . 5 , 200 mm nacl , 1 mm mgcl 2 , 2 mm egta , and 0 . 1 mm dtt . equal proportions of the unbound , wash , and elution fractions were separated by sds - page and proteins detected by silver staining . quickprep ® micro mrna purification kit ( pharmacia ) was used to isolate mrna . the mrna was extracted by homogenizing approximately 100 mg of tissue and was bound to oligo ( dt )- cellulose . the mrna samples were treated with dnasei during 1 hour to ensure the absence of genomic dna . this is important since drl1 is an intronless gene . 60 - 90 ng of mrna from each sample was reverse transcribed by using the superscript preamplification system for first strand cdna synthesis ( gibco brl ). in ler respectively drl1 - 2 and drl1 - 3 plants , cdna synthesis was started from primer 5 ( agccccaaaatatgtttgcatta ) ( seq id no : ______ ) and respectively primer 6 ( tcgcgttgatgatttcttgtgtc ) ( seq id no : ______ ). primer set p5 - p7 ( primer 7 : ctagaccgcaaccaaaactatgc ) ( seq id no : ______ ) is used to amplify wild - type cdna , while primer set p6 - p7 is used for the drl1 - 2 and drl1 - 3 mutant samples . in drl1 - 1 mutants primers 6 or a ds primer 1 was used to start the cdna synthesis . the cdna was amplified with primer 8 ( gtgggcaaccttgtagtggtaag ) ( seq id no : ______ ) and p6 . to amplify the fragments , taq polymerase and a 10 × pcr buffer of perkin elmer were used . the pcr conditions were the same for each reaction : 3 minutes denaturation at 94 ° c ., followed by 35 cycles of 45 seconds denaturation at 94 ° c ., 45 seconds annealing at 55 ° c . and 2 minutes extension at 72 ° c ., followed by a one time extension of 3 minutes . not only the cdna , but also the dnasei treated mrna from each sample was amplified with the same primer sets . since drl1 is an intronless gene , the genomic sequence of the gene could also serve as a template during the amplification of the cdna , which could lead to false positive signals . therefore the extracted mrna was treated with dnasei before cdna synthesis . for each tissue pcr was conducted on the cdna as well as on the dnasei treated mrna samples . all samples were blotted on a nitro - cellulose filter and hybridized with a drl1 probe . following amplification , the pcr products were run on a 0 . 8 % agarose gels , blotted on to nylon membranes , then hybridized at 65 ° c . with a labeled drl1 dna probe , a pcr product amplified with primers p5 - p7 . the signals were visualized by analysis of the blots on a phosphoimager . a promoter fragment of 1240 bp of the drl1 gene , defined as pdrl1 , was amplified from genomic landsberg erecta dna with the modified primer 9 : actagcgccatgggtttttaaac ( seq id no : ______ ) containing a sphi restriction site and a modified primer 10 : tagttacttggcatgcaggttatctg ( seq id no : ______ ) containing an ncoi restriction site . the amplified sequence was cloned into the pgus1 plasmid ( kindly provided by j . botterman , aventis ) as a sphi - ncoi fragment to create a translational gus gene fusion . the pdrl1 - gus cassette was cloned as a pvuii fragment in the smai site of the pgsv4 plant transformation vector containing a kanamycine resistance marker ( kindly provided by j . botterman , aventis ) and transformed into e . coli jm109 . the pgsv4 :: pdrl1 :: gus plasmid was transferred to the agrobacterium tumefaciens strain c58c1rif r ( pgv2260 ) ( deblaere et al ., 1985 ) by triparental mating using the helper strain hb101 ( prk2013 ) according to van haute et al ., 1983 . transgenic plants containing the pdrl1 :: gus construct were obtained after root explant transformation of ler plants using kanamycin selection ( valvekens et al ., 1988 ). histochemical staining using x - gluc was used to assay drl1 promoter activity in intact seedlings ( jefferson et al ., 1987 ) and on thin sections of plastic embedded tissue ( de block and van lijsebettens , 1998 ). the promoter - coding sequence of drl1 was amplified from ler dna with pfu polymerase using primers 11 : aaggagaaccaaagccattagt ( seq id no : ______ ) and p 12 : gcattagcgattaatgaagctg ( seq id no : ______ ). the fragment ( 2576 bp ) was cloned in the ecorv site of a pgem - 5zf (+) vector ( promega ) and transformed into e . coli jm109 . the drl1 genomic sequence was cloned as noti - ncoi fragment in the plasmid paux3133 ( goderis et al ., 2002 ) and subsequently transferred to the pmodul3337 plasmid containing a basta selectable marker gene ( goderis et al ., 2002 ) by endonuclease pi - pspi cloning . the pmodul3337 :: drl1 plasmid was transferred to the agrobacterium tumefaciens strain c58c1rifr ( pgv2260 ) ( deblaere et al ., 1985 ) by triparental mating ( van haute et al ., 1983 ). the drl1 gene was transformed into drl1 - 2 root explants ( valvekens et al ., 1988 ) and transgenic shoots were selected on phosphinotricin 15 mg / l . the progeny of these transgenic shoots were germinated onto gm and the seedlings scored for the restoration of the wild - type phenotype . root explants of wt t1 seedlings were tested for ppt resistance in a tissue culture assay : they were incubated for 4 days on cim medium containing 15 mg / l ppt and then transferred for two weeks on sim medium containing 15 mg / l ppt ( valvekens et al ., 1988 ). resistant root explants were covered with shoots whereas the sensitive controls did not develop callus or shoots . [ heading - 0056 ] morphological and cellular characterization of the leaves , shoot apical meristems and primary roots for the morphological and cellular analysis the expanded first two leaves , or the first and third leaves ( as indicated ) of drl1 - 2 ( 35 days ) and ler ( 28 days ) were harvested . the whole - mounted leaves were fixed in 100 % methanol and cleared in 90 % lactic acid . measurements of palisade and epidermal cell numbers were obtained from digitized camera - lucida drawings , made from the adaxial leaf surface using differential interference contrast optics on a diaplan microscope ( leitz , wetzlar , germany ). image analyses were performed with the public domain image program ( version β - 3b ; scion corporation , frederick , md ., usa ). statistical significance of the mean differences ( p ≦ 0 . 05 ) were analyzed by means of the t - test using the “ statistical package for the social sciences ” ( release 10 . 0 . 5 ) ( spss inc , chicago , ill ., usa ) on normally distributed data sets . in case of skewed distribution , the data were transformed to logarithmic values to normalize it . shoot apices and first expanded leaves were fixed in faa ( formaldehyde / acetic acid / ethanol ), embedded in historesin , serially sectioned ( 5 μm sections , ralph glass knife , reichert jung 2040 autocut ) and stained with toluidine blue ( 0 . 05 %). the number of palisade cells was counted in the microscope in several sections at the widest part of the lamina . a t - test on the means was performed by spss . twelve - day - old seedlings of drl1 - 2 and wild - type germinated in vitro on hoagland medium and grown in vertical position were mounted ( seedling + agar block ) onto a slide and the primary roots were stained with a drop of propidium iodide ( pi ) solution ( 10 μg / ml ). after addition of a cover slip the samples were visualized in a zeiss lsm510 confocal microscope using the 543 nm excitation and 505 - 530 emission lines for pi . seeds were germinated in vitro on gm medium ( valvekens et al ., 1988 ) solidified with phytagel ( 0 . 35 %) in vertical position , every two days the position of the root tip was marked on the plate ( ler and elo4 ) or the plates were scanned ( drl1 - 2 ). root growth was measured during a period of 17 days . vector and strains used were provided with the matchmaker two - hybrid system vector ( clontech , palo alto , calif ., usa ). the coding sequence of the drl1 gene was amplified using the following primers : 5 ′- gtttaaaaacccatggcgctagttgt - 3 ′ ( seq id no : ______ ) and 5 ′- atttgtatgattaaaagtaagctgca - 3 ′ ( seq id no : ______ ). the pcr fragment was cut with ncoi and sali and was cloned into the multi - cloning site of pgbkt7 dna - bd yeast expression vector ( clontech , palo alto , calif ., usa ) resulting in the pgad - drl1 plasmid . the gal4 activation domain cdna fusion library of cell suspension was previously described ( de veylder et al ., 1999 ). the screen to identify drl1 interactors was assayed in the two - hybrid system by transforming the saccharomyces cerevisiae hf7c ( mataura3 - 52 his3 - 200 ade2 - 101lys2 - 801 trp1 - 901 leu2 - 3 112 gal4 - 542 gal80 - 538 lys2 :: gal1uas - gal1tata - his3 ura3 :: gal417mers ( 3 ×)- cyc1tata - lacz ) strain with pgad - drl1 and the cell suspension library using the lithium acetate method ( gietz et al ., 1992 ). to estimate the number of independent cotransformants , { fraction ( 1 / 1000 )} of the transformation mix was plated on medium lacking leucin and tryptophan . the rest of the transformation mix was plated on medium to select for histidin prototrophy ( trp − , leu − and his − ). of the his + colonies , the activation domain plasmids were isolated as described by hoffman and winston ( 1987 ). the pgad10 inserts were pcr amplified using the primers 5 ′- agggatgtttaataccactac - 3 ′ ( seq id no : ______ ) and 5 ′- gcacagttgaagtgaacttgc - 3 ′ ( seq id no : ______ ) to determine the length of the inserts . plasmid dna was electroporated into escherichia coli dh5α and the sequence of the inserts was determined . extracted dna was also used to retransform hf7c to test the specificity of the interaction . pdrl1 - gus plants germinated onto lnm ( smalle et al ., 1997 ) for 7 days were transferred to medium containing ethylene blockers ( lnm + 75 μm agno 3 or lnm + 7 . 5 μm avg [ sigma ]). after three days the plants were transferred to a medium containing an ethylene inducer ( lnm + 25 μm acc ). pdrl1 - gus plants grown on lnm were used as a positive control . as a control of the ethylene blocking and inducing effects , pacs1 - gus ( van der straeten et al ., 1992 ) and pdr5 - gus ( ulmasov et al ., 1997 ) were grown in the conditions described above . whole mount gus - staining was done according to jefferson et al ., 1987 . to perform a semi - quantitative rt - pcr , total rna was extracted from the shoot apices using trizol ( invitrogen ). total rna ( 2 μg ) was used as template to synthesize the cdna by using the superscript ™ first strand synthesis system for rt - pcr ( invitrogen ). to assess the levels of rna in each sample , actin cdna was amplified with primers 5 ′- gtgccaatctacgcgggtttc - 3 ′ ( seq id no : ______ ) and 5 ′- caatgggactaaaacgcaaaa - 3 ′ ( seq id no : ______ ) and hybridized . the drl1 gene was amplified using primer 5 ′- tcgcgttgatgatttcttgtgtc - 3 ′ ( seq id no : ______ ) and 5 ′- ctagaccgcaaccaaaactatgc - 3 ′ ( seq id no : ______ ). the an gene was amplified with primers 5 ′- tgagacggtgccgtggtatgg - 3 ′ ( seq id no : ______ ) and 5 ′- gttgcctactggtggattcc - 3 ′ ( seq id no : ______ ). the amplification of the cdnas was terminated in the exponential phase of the pcr ( 18 cycles ). the intensity of the hybridized fragments were measured with image quant version 4 . 1b ( molecular dynamics ). the drlox lines were constructed by introducing a p35s - drl1histag construct into drl1 - 2 . homozygous lines were selected and used for the measurements . expanded first and third rosette leaves were removed from the plants , scanned and image analysis was done with the program scion image . the data were analyzed with the statistical program spss . the drl1 - 2 mutant was originally named nrl1 ( clarke et al , 1996 ) and was identified as a leaf mutation when screening 250 f2 populations derived from a cross between the dsb1 line containing the ds element cloned in the leader of the p35s - streptomycin phosphotransferase gene and marked by a p35s - hygromycin phosphotransferase ii gene ( bancroft et al ., 1992 ) and the actn25 line containing an ac element with a p35s - ac - transposase ( swinburne et al ., 1992 ), both lines are of the landsberg erecta ( ler ) ecotype . drl1 - 2 mutant individuals were obtained in the f2 as full greens on a streptomycin / hygromycin - containing selective medium ( number of the f2 population was dsb1 - 30 ). a mutant individual was crossed to wild - type ler and the f2 analyzed : 702 wt and 217 drl1 - 2 were obtained showing that drl1 - 2 is a nuclear recessive mutation ( χ2 ( 3 : 1 )= 0 . 87 ; p & gt ; 0 . 05 ). genetic linkage analysis was done between the drl1 - 2 mutation and the tds in this f2 population . no recombination was found analyzing 919 f2 and 38 f3 of the drl1 - 2 hmr class of which the maximum genetic distance was calculated as 6 . 6 ± 3 . 3 cm ( f2 data ) or 1 . 3 ± 1 . 2 cm ( f3 data ) ( koomeef and stam , 1987 ). these data indicated that drl1 - 2 is likely to be induced by ds insertion . genomic dna of 9 independent drl1 - 2 mutants was digested with hindiii and hybridized with an ac probe : none of these lines did contain the parental ds band of around 14 kb ( bancroft et al ., 1993 ), instead they all contained a new band of 5 . 8 kb showing that germinal transposition of the ds had occurred . the tds had transposed into ± 1 . 2 kb hindiii fragment . three more drl1 alleles have been obtained . drl1 - 1 ( bancroft et al ., 1993 ) and drl1 - 3 ( r . simon , unpublished results ) have been isolated after independent ds transactivation experiments starting from the dsb1 parental line ( table 1 ). drl1 - 4 corresponds to elo4 , an ems - induced leaf mutant ( berna et al ., 1999 ). drl1 - 2 was isolated as a mutant with narrow leaves , compared to wild - type ( fig1 , panels a and b ). the lamina length varied enormously among different drl1 - 2 individuals . the drl1 - 4 mutants had a less severe phenotype with significantly narrower leaf lamina , but normal leaf length , and the number ( 7 to 8 ) of rosette leaves in drl1 - 4 comparable to that of the wild - type , whereas it varied from 4 to 9 in drl1 - 2 . the lamina width and area of the first and second expanded rosette leaves of a subpopulation of drl1 - 2 individuals with normal leaf length were measured by image analysis and they were significantly reduced when compared with the wild - type ( fig1 , panels c and d ). the pattern formation of lateral growth along the length axis of the leaf results in a certain ratio between lamina length and petiole length . this ratio was affected in the subpopulation of drl1 - 2 individuals with normal leaf length , i . e . drl1 - 2 mutants had enlarged lamina length and reduced petiole length . in some mutant individuals no clear transition between lamina and petiole was seen ( fig1 , panels a and b ). in serial sections through expanded first and second leaves of drl1 - 2 ( 35 - day - old seedlings ), palisade cells were larger and more irregularly shaped than in wild - type and intercellular spaces were present next to the adaxial epidermis ( fig1 , panel e ). in addition , the lateral growth was severely reduced , the lamina was thicker and the midvein less pronounced ( fig1 , panel e ). these features may indicate ventralization of the leaf . the number of palisade cells in serial sections of an expanded leaf blade was taken as a measure for lateral growth ( tsuge et al ., 1996 ). there were 53 . 4 ± 3 . 4 cells in the drl1 - 2 mutant at the largest width ( n = 3 ), 104 . 2 ± 14 . 1 in the drl1 - 4 mutant ( n = 4 ), and 112 . 0 ± 5 . 4 cells in ler ( n = 3 ); thus the number of palisade cells was reduced by 50 % in drl1 - 2 and slightly reduced in drl1 - 4 . epidermal and palisade cells of cleared expanded first and second leaves were visualized with differential interference contrast microscopy and image analyzed . statistically significantly smaller cells were present in the dorsal epidermis of drl1 - 2 ( fig1 , panel f ) and drl1 - 4 mutants . the palisade layer contained significantly larger cells in drl1 - 2 ( fig1 , panel f ) and drl1 - 4 mutants . analysis showed that drl1 - 2 and drl1 - 4 are strong and weak alleles , respectively ( table 1 ). to investigate the polarity in leaves , the dorsal markers , pphab - gus and prev - gus , and the ventral markers , pfil - gus and pyab3 - gus ( kindly provided by j . bowman , university of california , davis ), were introgressed into drl1 - 2 . these marker lines displayed promoter activity in the dorsal part of the leaf primordium , including the vascular bundles , and in the abaxial part of the leaf primordia , excluding vascular bundles , respectively ( fig1 , panels g and i ; pphb - gus and pyab3 - gus ). serial transverse sections of leaf primordia of f2 drl1 - 2 mutants containing the prev - gus , pphab - gus , pfil - gus and pyab3 - gus markers showed β - glucuronidase ( gus ) activity either in the dorsal or the ventral side , similar to the parental marker lines ( fig1 , panels h and j ; pphb - gus and pyab3 - gus ). these results demonstrate that the pattern of polarity for these genes was not altered in the drl1 - 2 mutant leaves , indicating that the dorsal and ventral identity was maintained . this feature was confirmed by the normal polarity in vascular bundles with adaxial xylem and abaxial phloem and the normal functional differentiation of the palisade cells , visible by the number of chloroplasts . germination of drl1 - 2 seeds was severely affected . of a total of 168 seeds sown onto germination medium , 74 did not germinate ( 44 %), 39 were seedling lethal ( 23 %), and only 55 grew further to maturation ( 33 %). scanning electron microscopy and sections showed that upon emergence from the shoot apical meristem the leaf primordia were much smaller than in the wild - type ( fig2 , panels a , b , e , and f ). this is also apparent from transverse sections through the shoot apical meristem . in addition , the mutant leaf primordia emerged more slowly than did the wild - type ones ( fig2 , panels c to f ). longitudinal sections through the sam confirmed that in the mutant it was more dome - shaped than that of the wild - type ( fig2 , panels c and d ). transverse sections of the sam showed that the phyllotaxis of leaves 1 and 2 of the drl1 - 2 was not opposite , but oblique , indicating that the pattern of leaf initiation is defective in the mutant ( fig2 , panels e and f ). the more dome - shaped sam , the smaller leaf primordia , and the aberrant phyllotaxis indicate that the sam organization is defective in the drl1 - 2 mutant . primary root growth kinetics demonstrated that root growth was severely affected in drl1 - 2 and less defective in drl1 - 4 ( fig2 , panel h ). the reduced root growth was probably related to root apical meristem defects as illustrated in longitudinal sections of 12 - day - old primary roots of several drl1 - 2 mutant individuals ( fig2 , panel g ). these sections also demonstrated that the cortex cells in the elongation zone were more expanded in the mutant than in the wild - type ( fig2 , panel g ). hypocotyl elongation was significantly reduced in the mutant , not because of a reduction in cell size ( hypocotyl cells were even larger in the mutant ; fig2 , panels c and d ), but probably because of a smaller number of cell divisions . flowering in drl1 - 2 was delayed by 1 week . mutant inflorescences were fasciated and their size one - third that of the wild - type ( fig2 , panels i and j ), indicating that the inflorescence meristem activity was defective . flowers consisted of normal floral organs , but their arrangement was abnormal and the number of stamen was reduced : 4 . 36 ± 0 . 73 in drl1 - 2 ( n flowers = 22 ) compared with 6 in wild - type ( fig2 , panel k ); these defects relate to floral meristem organization . the growth of the drl1 - 2 primary root is dramatically reduced and the elo4 primary root growth is intermediary between drl1 - 2 and ler . the root epidermis is normally arranged in root hair forming cell files alternating with root hairless cell files . in the drl1 - 2 mutant root hair cell files were adjacent and hence pattern formation in the root epidermis of the mutant is defective . after inverse pcr on genomic dna of the drl1 - 2 mutant , the sequence was determined of 682 bp plant dna flanking the 3 ′ end of the tds and of 585 bp plant dna flanking the 5 ′ end of the tds : 100 % homology was found with a 250 bp genomic fragment , named drl1 , flanking a tds in the drl1 - 1 mutant obtained after an independent transactivation of the ds from the dsb1 line ( bancroft et al ., 1993 ). the full genomic drl1 sequence revealed one continuous open reading frame of 302 amino acids . in addition 100 % homology was found between the drl1 genomic sequence and a full - length cdna hence the drl1 gene is intron - less . upon ds insertion in drl1 - 2 no target site duplication had occurred in the plant dna . the 3 ′ end of the tds element is deleted by 22 bp including the terminal inverted repeat , four bases of plant dna have been deleted and one extra c added to the 5 ′ side of the tds , as a consequence no reversion events could be obtained from this allele . the ds insertion corresponds with aa38 in the protein sequence of drl1 - 1 ( bancroft et al ., 1993 ), with aa 256 in drl1 - 2 , and with aa 262 in drl1 - 3 ( table 1 ). in the drl1 - 2 mutant , the open reading frame extends 40 amino acids within the tds . the mutation in elo4 ( berna et al ., 1999 ) has yet to be determined . the drl1 gene sequence was used as a probe towards mutant and wild - type plant dnas digested with several restriction enzymes and showed that the drl1 gene is single copy in the arabidopsis genome . the map position of drl1 was determined on the ri map at the top half of chromosome 1 between the markers g12080 and 0818 ( http :// nasc . nott . ac . uk / new_ri_map . html ). the 0818 marker corresponds to the plant dna flanking the ds - containing t - dna in the dsb1 parental line . the drl1 gene , identified after transactivation of ds from the dsb1 line , maps at 0 . 06 cm distant from the 0818 marker . the ds thus transposed over a short distance of only 12 kb , a clear example of targeting tagging . an allelism test between drl1 - 2 and angustifolia ( tsuge et al ., 1996 ), a mutant with a similar leaf phenotype as drl1 - 2 and a map position at the top half of chromosome 1 , was performed and showed that they represent two independent loci . partial or complete reversion events of the mutant phenotype to wild - type have been obtained from the drl1 - 1 allele ; these were shown to be excision events of the ds element from the drl1 gene ( bancroft et al ., 1993 ). we introduced the wild - type drl1 gene with its 1240 bp promoter fragment , delineated at the 5 ′ end by primer 11 , into the homozygous drl1 - 2 mutant by using a t - dna construct containing the bar selectable marker gene conferring resistance to phosphinotricin ( ppt ). seventeen independent ti transgenic lines were obtained . they segregated wild - type to mutant seedlings in a 3 to 1 ratio or in a 15 to 1 ratio indicating one , resp . two t - dna loci . all together 320 t2 wild - type seedlings were tested for ppt resistance they were all resistant and 33 drl1 - 2 seedlings were ppt sensitive showing the presence of the t - dna containing the wt drl1 gene and proving that complementation had occurred . these data demonstrated that the drl1 - 2 phenotype is due to a ds insertion in the drl1 gene . our complementation analysis showed that the 1240 bp promoter fragment contained all the regulatory information to direct correct gene activity throughout the plants &# 39 ; life cycle . drl1 codes for an homologue of the yeast tot4 / kti12 that associates with elongator the drl1 protein ( atdrl1 ) shares a high level of homology with the tot4 / kti12 protein of baker &# 39 ; s yeast ( saccharomyces cerevisiae ) ( p34253 ) ( butler et al ., 1994 ; frohloff et al ., 2001 ). the tot4 protein copurifies with the elongator complex , which is important for the regulation of transcription elongation of rnapii ( frohloff et al ., 2001 ). full - length genomic sequences homologous to drl1 were obtained in schizosaccharomyces pombe ( cab66461 ), caenorhabditis elegans ( z99281 ), drosophila melanogaster ( 046079 ), mus musculus ( bab22635 ), anopheles gambiae ( agcp15124 ), human ( aah12173 ), oryza sativa ( cld000341 . 4 ), and methanopyrus kandleri ( np — 614962 ). an alignment presented by fichtner et al . ( 2002 ), showed the homology between scp34253 , spcab66461 , cez99281 , dmo46079 , mmbab2263 , ataaf79415 , and hsaah12173 . thus , drl1 is not only conserved among eukaryotes , but homologs also are found in archaea , suggesting that drl1 is a universal and ancient protein . putative drl1 orthologs were also identified in expressed sequence tag collections of many plant species ( dicots , monocots , mosses , and conifers ) and other organisms . an overview of the actual drl1 homologs is given in table 8 . the drl1 protein contains a conserved atp / gtp - binding domain ( p - loop : pdoc00017 in prosite ) ([ ag ]- x ( 4 )- g - k -[ st ]) spanning the amino acids 8 through 15 . this domain is conserved among the homologs of tot4 as also described by fichtner et al . ( 2002 ). this p - loop is one of the four highly conserved sequence motifs , which are required for guanine nucleotide binding and gtp hydrolysis in gtp - binding proteins ( kaziro et al ., 1991 ). drl1 also contains a n [ kr ] xd box ( amino acids 148 - 152 ), which is another conserved box of the gtp - binding protein , important for direct interaction with the guanine ring . the other two highly conserved boxes of gtp - binding proteins are not present in the drl1 protein . a highly conserved region among drl1 and its homologs ( amino acids 194 - 199 , pxx [ as ] t ) is found in many atp or enzymes utilizing gtp ( http :// www . expasy . ch / tools / scanprosite /). an in vitro assay demonstrated that the c - terminal 100 amino acids of the drl1 protein bound calmodulin in a calcium - dependent manner . o &# 39 ; neil and degrado ( 1990 ) showed that the binding of calmodulin to its targets is a sequence - independent recognition of amphiphilic α - helices . we found a stretch of 17 amino acids , within the c - terminal 100 amino acids of drl1 ( amino acids 257 - 273 ) that is very probably the calmodulin - binding domain . the prediction program on the calmodulin target database ( ikura , 2000 ) identified the same stretch as a putative cam - binding site . because this stretch was the only predicted cam - binding site in the c - terminal 100 amino acids of the drl1 protein , these amino acids comprise very probably the cam - binding site . reported cam - binding domains were compared to identify the critical elements required in the binding process . based on the conserved hydrophobic residues within these motifs , two related motifs for calcium - dependent binding , termed 1 - 8 - 14 and 1 - 5 - 10 , were described ( rhoads and friedberg , 1997 ). in our proposed stretch , the motif lxxxfxxlxxxxxl and the net charge of + 5 were found , according to the characteristics of an 1 - 8 - 14 cam - binding motif of type a . because the cam - binding site is sequence independent , the prediction program of the calmodulin target database ( ikura , 2000 ) was used to look for putative cam - binding sites in the drl1 homologs . no cam - binding sites were predicted in the human , mouse , or yeast homologs . in the homolog of fruit fly , a putative cam - binding site is also predicted at the c - terminal end of the protein . for the rice homolog , the predicted cam - binding site also shares sequences homology with the putative cam binding site in drl1 . these data indicate that the regulation of the drl1 protein is conserved among plants through the binding of cam . the entire drl1 coding sequence was used as a “ bait ” in a yeast two - hybrid screening using a cdna library of cell suspensions . of about one hundred colonies selected on leu − trp − his − medium , total dna was prepared and transformed into e . coli . the size of the inserts of the “ pray ” plasmids was checked by pcr and subsequently the dna sequence was determined . table 2 summarizes information on the type of drl1 - interacting proteins that were obtained in the yeast two - hybrid screen and were confirmed after retransformation into the drl1 - containing yeast strain and selection on leu − trp − his − medium . amongst the drl1 - interacting proteins were a histone h2a , h 2 b and a histone acetyltransferase . these proteins are components of the chromatin , resp . the chromatin remodeling complexes during transcription . their interaction with drl1 indicates that drl1 has a function in the transcription elongation process in analogy to its homologue , tot4 / kti12 in yeast ( frohloffet al ., 2001 ). drl1 interacts with retinoblastoma , a regulator of the e2f transcription factors that activate s - phase specific genes that promote growth by cell division ( de veylder et al ., 2002 ), and with profilin , an interactor of e2f . drl1 also interacts with ath12 , a member of the homeobox - leucine zipper transcription factors of which several members have been shown to control pattern formation processes during plant development . the data indicate that drl1 is also involved in the transcription initiation processes through the interaction with transcription factors that control either growth or pattern formation in plants . drl1 gene expression was analyzed by rt - pcr followed by a southern hybridization using total rna isolated from roots , hypocotyls , cotyledons , shoot apices , stems , inflorescence apices , different developmental stages of leaves and flowers . mrna of drl1 was detected in every plant organ investigated in the wild - type landsberg erecta , hence it is not organ - specific ( table 3 ). drl1 is also expressed at different growth stages of arabidopsis cell suspension cultures . in addition drl1 mrna was present in a mixture of leaves in different developmental stages of the drl1 - 2 and drl1 - 3 mutants , which indicates that a truncated drl1 protein might be formed in the mutant plants . it was not possible to detect drl1 transcript in drl1 - 1 mutants ; this might be due to the small size of the expected pcr product ( 90 bp ). a sphi - ncoi drl1 promoter fragment was generated after pcr amplification using primer 1 and primer 8 and it was fused at the start codon of the gus coding sequence . this promoter fragment was used in a complementation test of the drl1 - 2 mutant and it was shown to contain all sequences necessary to direct complete gene activity . the drl1 promoter activity was analyzed at the cellular level in several transgenic lines transformed with the pdrl1 :: gus chimeric construct using histochemical analysis of serial transverse sections through plastic - embedded tissues ( de block et van lijsebettens 1998 ). homogeneous gus activity was detected in globular , heart and torpedo - stage embryos ( fig4 , panels a and b ). high gus activity was shown in the funiculus and the outer integument of the ovules ( fig4 , panel c ). other tissues were negative for x - gluc . in transverse sections of the shoot apical meristems ( n = 6 ) of 8 to 12 day - old seedlings a ring - shaped staining was observed indicating gus activity in the peripheral zone of the shoot apical meristem ( fig4 , panel d ). the section more superficial of the sam showed a circular x - gluc staining consistent with a continuous peripheral zone in this position ( fig4 , panel e ). the sections more distal from the sam showed only x - gluc staining at the periphery of the vascular bundle . longitudinal sections through shoot and inflorescence apices showed gus activity to be most prominent in the l2 layer , less in the l1 layer and not present in the l3 ( n = 3 ) ( fig4 , panel f ). in young leaf primordia the x - gluc staining was apparent as a continuous blue linear and median area including vascular bundles and the mesophyll in between the vascular bundles ( fig4 , panels d and e ). gus activity occurred as a linear area conform with the basal part of the dorsal site of the leaf primordia . transverse serial sections of expanding leaves showed a patchy gus activity : staining was seen in individual palisade and spongy mesophyll parenchyma cells . gus activity was absent from the mesophyll cells at the leaf tip , at the margin of the distal part of the leaf lamina and at the ventral mesophyll of the midrib ( fig4 , panels l , m , n ). these are exactly the first parts of the leaf in which cell divisions arrest . in the leaf epidermis gus activity was restricted to the stomatal guard cells that are generated by cell division from epidermal meristemoids after cell divisions have ceased in the epidermal pavement cells . gus activity was also typically observed around the vascular bundles . the pdrl1 :: gus pattern coincides with the patchy pattern of expression of the pcyclat :: gus during leaf development ( donnelly et al ., 1999 ; cyc1at is equivalent to arath ; cycbl ; 1 ) and indicates that the drl1 promoter might be cell cycle regulated . whole mount x - gluc staining was done on flowers and primary roots ( jefferson et al ., 1987 ). young flower organs stained completely blue , fully developed sepals and petals did not show any gus activity in analogy with fully developed leaves , a gradient of gus activity was observed in the stamen and carpels ( fig4 , panels g , h , j , k , i ). the promoter sequence of drl1 ( the same sequence that was used in the pdrl1 - gus construct ) was analyzed with the plantcare program ( rombauts et al ., 1999 ) that predicts the presence of cis - acting regulatory elements , an overview is given in table 4 . the drl1 promoter contained 15 light responsive , several cis - acting elements involved in hormone signaling ( ethylene , abscisic acid , methyl jasmonate , gibberellins , salicylic acid ), wound signaling and stress signaling . the gaseous hormone ethylene is an important regulator of plant growth and development processes including germination , senescence , abscission , flowering , stress responses , cell elongation , fruit ripening and pattern formation . ethylene regulation of drl1 transcription was analyzed using pdrl1 - gus transgenic seedlings in a histochemical assay ( jefferson et al ., 1987 ). the influence of exogenous ethylene was followed by using antagonists of ethylene perception ( silver ions ). the endogenous production of ethylene was blocked by using 1 - aminoethoxyvinylglycine ( avg ), an acc synthase inhibitor . ethylene effects were re - induced by adding a synthetic variant of ethylene , 1 - aminocyclopropane - 1 - carboxylic acid ( acc ). pdrl1 - gus plants grown on a medium containing silver ions had a severely reduced patterning of the gus staining in the root tip , compared to transgenic plants grown on lnm , in which the root tip is highly stained . no differences were seen in plants grown on medium containing avg . this means that the blocking of the ethylene biosynthesis had no effect on the drl1 promoter activity , while the blocking of the exogenous ethylene perception reduced the drl1 transcription in the root tip . drlox4 is a moderate drl1 - overexpressing line and drlox10 is a highly drl1 - overexpressing line , based on northern analysis . both constructions have been made by overexpressing drl1 by means of the 35 s promoter in the drl1 - 2 mutant background . the width , length and area of the leaf has been increased in the overexpressing plants , the mean values were significantly higher in the transgenic lines compared to wt ( fig5 ). table 5 shows the significance levels of the parameters for the drlox10 line are consistent between leaf 1 and leaf 3 , i . e ., they all differ significantly from the wt ( except for the lamina length ). the conclusion is that overexpression of drl1 modifies the size of the leaves . the fully - expanded leaves of the overexpression lines drlox4 and drlox10 had an increased lamina area . we determined whether this was due to an increase in cell number or cell volume or both . the cell area of the upper and lower epidermis and the palisade parenchyma was measured in the drlox lines and the results are graphically represented in fig6 . the cell area in the three cell layers of the third leaf were significantly larger than the ler control and showed that an increase in cell expansion contributed to the enlarged leaf lamina area . the palisade cell number was determined at the largest width of the lamina using serial sections . the palisade cell number was significantly increased in the drlox10 line showing that an increase in cell number contributed to the increase in lamina area ( fig7 ). the conclusion is that drl1 plays an activating role in both growth processes of cell division and cell expansion . root growth kinetics was measured of the drlox lines to determine whether overexpression of the drl1 gene induced an increased root meristem activity . in the highest overexpression line , drlox10 , there is an increased primary root growth compared to ler ( fig8 ), however it is not statistically significant . the primary root growth in drlox4 is lower than in the ler control indicating that the level of drl1 overexpression in this line is not sufficient to restore wild - type root meristem activity of the drl1 - 2 mutation . the data indicate that at high drl1 overexpression such as in the drlox10 line the root apical meristem activity is restored to wild - type . the drlox10 line was back crossed ( bc ) to ler wild - type and a f3 line , drlox10b5 has been selected in which the drl1 - 2 mutation was segregated . this bc line is being analyzed at the morphological and anatomical level to study the effect of the overexpression in a wild - type background . the palisade cell number at the widest width was counted in half a leaf blade of fully expanded first and third leaves and was significantly increased in the drlox10b5 line ( leaf 1 : 72 . 9 cells ± 2 . 6 ; leaf 3 : 94 . 9 cells ± 6 . 3 ) compared to the ler control ( leaf 1 : 55 . 5 cells ± 3 . 4 ; leaf 3 : 82 . 0 cells ± 12 . 1 ). the data confirm that overexpression of the drl gene increases cell number in leaves . interacting proteins of yeast tot4 / kt112 and their homologs in arabidopsis in yeast , protein - protein interactions by two - hybrid analysis were done on a large scale to define molecular networks . two web sites with this information ( http :// mips . gsf . de / proj / yeast / cygd / db / index . html / and http :// yeast . cellzome . com /) were used to unravel the network of proteins that interact with tot4 / kti12 . an analysis of protein - protein interaction was also described by uetz et al . ( 2000 ). tot4 / kt112 interacted with ygl230c as bait and , in addition , the latter interacted with three more proteins , uga4 , yor161 , and hap5 . uga4 ( amino acid permeability ) and yor161 ( unknown function ) are not discussed further . the blastp program of the tair site ( http :// www . arabidopsis . org /) was used to find the arabidopsis homologs of the yeast elongator components and the tot4 / kti12 - interacting proteins . besides drl1 ( at1g13870 ), homolog of tot4 / kti12 , arabidopsis homologs were identified : at5g13680 ( elp1 ), at1g49540 ( elp2 ), at5g50320 ( elp3 ), at3g11220 ( elp4 , high e - value of 0 . 005 ), hap2 - 3 - 5 homologs ( edwards et al ., 1998 ), at1g25500 ( yor161c ), and at2g01170 ( uga4 ) ( fig9 ). using the psi - blast program ( altschul et al ., 1997 ), arabidopsis homologs were found for elp5 ( at2g18410 ), elp6 ( at4g10090 ) ( ponting , 2002 ), ygl230c ( at4g23860 ), and hap4 ( at5g25820 ) ( fig9 , asterisks ). the psi - blast for hap4 was done with the kluyveromyces lactis homolog ( af072675 ). functional analysis of a . thaliana homologs of the yeast elongator components the elo class of narrow leaf mutants ( berna et al ., 1999 ) consists of 4 independent loci that have been mapped onto the chromosomes ( robles and micol , 2001 ). the map positions were compared to the genomic positions of the arabidopsis homologues of the yeast elongator components . the elo2 and elol mutations were located in the same region as atelp1 , resp . atelp4 . the dna sequence of these genes was determined in the respective mutants and they contained a point mutation as indicated in table 6 . the mutation in atelp 1 changed a tgg into the stop codon tag resulting in a truncated protein of 1087 aa ( fig1 ). the mutation in atelp4 changed a ag into a aa at the splice acceptor site of the third intron , resulting in the selection of the next splice acceptor site . as a consequence the fourth exon was deleted in the cdna ( which was verified experimentally ) and a frame shift occurred with a precocious stop codon ( fig1 ). the elo4 mutation ( berná et al ., 1999 ; robles and micol , 2001 ) was shown to be allelic to drl1 ( table 1 ). in elo4 , a single base change introduced a premature stop codon at amino acid 194 ( a c - to - t change at the nucleotide level at position 579 ). the leaves of elo1 and elo2 were analyzed by serial sectioning , image analysis and dic optics . the leaves were narrower due to a reduction in cell number in elo1 and elo2 ( fig1 ), counting the number of palisade cells in the widest part of the lamina as a measure for cell number as described by tsuge et al ., 1996 . the cell area was reduced in the epidermis and increased in the palisade cell layer in analogy to the drl1 - 2 mutation ( fig1 ; fig1 ). the weak elo4 ( drl1 - 4 ) allele had only a significant effect in the epidermis ( fig1 ). the root growth kinetics was measured during 17 days after germination and showed that the growth was reduced in the elo and drl1 - 2 mutants ( fig1 ). the leaf and root analyses showed similar phenotypes between the elo mutants and the drl1 - 2 mutant and provided evidence for a similar function in organ growth and the existence of a functional elongator complex in plants . double mutant analyses are being done to further strengthen this hypothesis . in yeast the elongator complex consists of 6 proteins , elp1 - elp6 . in arabidopsis however only for four subunits of the elongator complex homologues can be found ( elp1 - elp4 ). elp2 encodes a protein , which contains wd 40 repeats , important for protein - protein interactions . elp3 encodes a histon acetyl transferase . the elp2 and elp3 arabidopsis homologues , as well as drl1 and the drl1 interactors are placed under control of the constitutive 35s promoter ( p35s ); by means of the gateway technique a plant transformation vector containing the p35s - gene constructs is made . transgenic overexpression lines are constructed by introducing these constructs into plants using the floral dip method . homozygous overexpression lines are analyzed and subsequently crossed with homozygous lines containing different overexpression constructs . the homozygous overexpression plants or the combinations of two different types of overexpressing plants show a modulated plant architecture and growth . a double mutant analysis was done between drl1 - 2 and angustifolia distorted trichomes1 ( an dis1 ), a mutant with a leaf phenotype similar to that of drl1 - 2 , in addition to a trichome mutation , dis1 , in the an background . the n2 line homozygous for the andis1 mutations in a ler background was obtained from the nottingham arabidopsis stock center ( nottingham , uk ). compared to the drl1 - 2 mutants , an mutants have normal roots , flowers , and inflorescences , but wrinkled siliques . these four phenotypic differences between the two mutants were used to analyze the characteristics of the double mutant . homozygous an f2 plants that were heterozygous for drl1 - 2 ( selected for hygromycin resistance ) were self - fertilized and analyzed in the f3 population : 1 double mutant with a drl1 - 2 phenotype segregated to 3 an homozygous plants . from the comparison of the vegetative phenotype of the ler , drl1 - 2 , an dis1 , and the drl1 - 2 — an dis1 double mutant , it could be concluded that drl1 - 2 is epistatic to an . the level of an transcript in a drl1 - 2 background was assessed by means of semi - quantitative rt - pcr . the an expression levels were compared to the amount of actin transcript ( fig1 ). in the strong drl1 - 2 allele with severely reduced drl1 transcript , a significant up - regulation of the an transcript ( up to 2 - fold ) was seen . in the weak drl1 - 4 allele with slightly reduced drl1 transcript , the level of an transcript was comparable with wild - type . the up - regulation of an transcript in the drl1 - 2 allele suggests that drl1 acts as a repressor for an expression . double mutant analysis showed that drl1 acts upstream of an , a transcriptional corepressor that regulates polar expansion of palisade cells , probably by controlling the arrangement of cortical microtubuli ( kim et al ., 2002 ). the up - regulation in drl1 - 2 shoot apices of an transcript could explain the increase in palisade cell size in the drl1 - 2 mutant without affecting the polarity . indeed , recessive mutation at the an locus results in a reduction of palisade cell size ( tsuge et al ., 1996 ). in yeast , elongator was described as a histone acetyltransferase complex associated with the elongating form of rnapii to facilitate transcription elongation ( otero et al ., 1999 ). the rnapii transcription elongation complex is believed to control gene expression by remodeling the chromatin through histone acetylation ( winkler et al ., 2002 ) and by regulating the movement along the dna ( kim et al ., 2002b ). although elongator was not detected on promoters or open reading frames in vivo ( pokholok et al ., 2002 ), numerous data suggest a role for elongator in transcriptional regulation . elongator was originally found stoichiometrically associated with the elongating form of rnapii and to bind preferentially to the hyperphosphorylated form of rnapii in vitro ( otero et al ., 1999 ). mutations in transcription - elongating machinery confer increased sensitivity to the drug 6 - au , as was also seen in the tot mutants ( shaw and reines , 2000 ). moreover , microarray analysis using deletion mutants of elongator components ( elp1 , elp2 , elp4 , and elp6 ) revealed that subsets of genes were down - or up - regulated , indicating that elongator is important to regulate the expression of specific sets of genes ( krogan and greenblatt , 2001 ). in arabidopsis , we propose that elongator regulates transcription of several genes involved in specific processes during development . in the drl1 - 2 mutant , the an transcript is up - regulated suggesting an inhibitory function of drl1 on an transcription . several of the drl1 phenotypes also suggest an activating or inhibitory role of drl1 on specific processes such as meristem activity and organ growth . cdna - aflp analysis was performed ( breyne et al ., 2002 ) on total rna prepared from shoot apices of two week - old elo1 , elo2 and elo4 seedlings including the shoot apical meristem ( sam ), the first and second rosette leaf in the expansion stage and the third and fourth leaf in the primordium stage . the transcriptomes of the elo mutants were compared to ler ( wild - type ). fourteen primer combinations were used to amplify approximately 1000 aflp fragments ( transcripts ) and were analyzed on polyacrylamide gels . around 10 transcripts were differentially regulated in the elo mutants compared to ler . the same fragments were up - or down - regulated in elo1 , elo2 and elo4 ( table 7 ), indeed a similar molecular phenotype is expected for components of one complex . the number of differentially regulated fragments was consistent with the severity of the elo phenotype : most severe phenotype in elo2 , intermediate in elo1 and weak in elo4 . ectopic bands such as present in mutant and absent in wild - type or the reverse were not seen . the low frequency of 1 % of transcripts with altered expression in the elongator mutants suggests a selective regulatory function in transcription for the elongator complex in plants . table 2 drl1 - interacting proteins obtained in a yeast two - hybrid screening . number of number of general processes clones specific proteins clones transcription initiation 4 rb - related protein 2 profilin 1 athb12 1 ribosomal proteins 14 14 protein modification / 8 ubiquitin 5 degradation protease inhibitor 1 phospholipase d 1 protein folding 1 mrna processing 2 2 photosynthesis 4 electron transport 2 rubisco small 1 subunit photosystem i subunit 1 membrane traffic and 5 protein targeting 2 protein transport vesicular transport 3 chromatin 2 histone h2a 1 histone h2b 1 hat 1 unknown / putative 13 13 proteins signaling proteins 5 receptor like kinase 1 phosphate transporter 1 atp synthase subunit 2 atp / gtp binding 1 protein translation 2 elongator factor 1 2 c - metabolism 5 sucrose 1 glucose 1 other 3 cell wall 3 3 electron transport 3 3 cation channels 1 ankyrin 1 alkaloid biosynthesis 1 strictosidin synthase 1 cytochrome p450 1 1 spindle pole body 1 1 nuclear export factor 1 1 a significance of & gt ; 0 . 05 means that the null hypothesis is accepted ( a ) and that the parameter does not differ between wt and overexpressing line . in case p & lt ; 0 . 05 the null hypothesis is not accepted ( na ), in all cases the mean values of the transgenic lines were higher than those of wt . the proteins were identified either as genomic sequences ( genomic ) or as partial cdna ( expressed sequence tag [ est ]). in case of the partial cdnas , identity and similarity were given for the strengths of cdna , which encodes that part of the protein with the highest homology to drl1 . altschul , stephen f ., thomas l . madden , alejandro a . schäffer , jinghui zhang , zheng zhang , webb miller , and david j . lipman ( 1997 ). gapped blast and psi - blast : a new generation of protein database search programs . nucleic acids res . 25 , 3389 - 3402 . bancroft , i ., bhatt , a . m ., sjodin , c ., scofield , s ., jones , j . d . g ., and dean , c . ( 1992 ). development of an efficient two - element transposon tagging system in arabidopsis thaliana . mol . gen . genet . 233 , 449 - 461 . bancroft , i ., jones , d . j ., and dean , c . ( 1993 ). heterologous transposon tagging of the drl1 locus in arabidopsis . plant cell 5 , 631 - 638 . berna , g ., robles , p ., and j . l . micol ( 1999 ). a mutational analysis of leaf morphogenesis in arabidopsis thaliana . genetics 152 : 729 - 742 . butler , a . r ., white , j . h ., folawiyo , y ., edlin , a ., gardiner , d ., and stark , m . j . ( 1994 ). two saccharomyces cerevisiae genes which control sensitivity to g1 arrest induced by kluyveromyces lactis toxin . mol . cell . biol . 14 , 6306 - 6316 . breyne p , dreesen r , vandepoele k , de veylder l , van breusegem f , callewaert l , rombauts s , raes j , cannoot b , engler g , inzé d , and zabeau m ( 2002 ). transcriptome analysis during cell division in plants . proc . natl . acad . sci . 99 : 14825 - 14830 . byrne , m . e ., barley , r ., curtis , m ., arroyo , j . m ., dunham , m ., hudson , a ., and martienssen , r . a . ( 2000 ). asymmetric leaves 1 mediates leaf patterning and stem cell function in arabidopsis . nature 408 , 967 - 971 . clarke , j ., de bleeckere , m ., royaert , s ., vanderhaeghen , r ., van montagu , m ., and van lijsebettens , m . narrow leaf1 , a gene controlling leaf lamina formation in arabidopsis . abstract presented at the 10th fespp congress on “ from molecular mechanisms to the plant : an integrated approach ,” firenze ( italia ), sep . 9 - 13 , 1996 . [ plant physiol . biochem ., special issue , 54 ( so4 - 21 )]. cnops , g ., wang , x ., linstead , p ., van montagu , m ., van lijsebettens , m ., and dolan , l . ( 2000 ). tornado1 and tornado2 are required for the specification of radial and circumferential pattern in the arabidopsis root . developm . 127 , 3385 - 3394 . deblaere , r ., bytebier , b ., de greve , h ., deboeck , f ., schell , j ., van montagu , m ., and leemans , j . ( 1985 ). efficient octopine ti plasmid - derived vectors for agrobacterium - mediated gene transfer to plants . nucl . acids res . 13 , 4777 - 4787 . de block , m ., and van lijsebettens , m . ( 1998 ). gus enzyme histochemistry on semi - thin sections of plastic - embedded arabidopsis tissue . in arabidopsis protocols ( methods in molecular biology , vol . 82 ), j . m . martinez - zapater , and j . salinas ( eds .). totowa , humana press , pp . 397 - 407 [ 0 - 89603 - 391 - 0 ]. de jager , s . m ., and murray , j . a . h . ( 1999 ). retinoblastoma proteins in plants . plant molec . biol . 41 , 295 - 299 . de veylder , l ., de almeida engler , j ., burssens , s ., manevski , a ., lescure , b ., van montagu , m ., engler , g . and inze , d . ( 1999 ). a new d - type cyclin of arabidopsis thaliana expressed during lateral root primordia formation . planta 208 ( 4 ): 453 - 462 . de veylder , l ., beeckman , t ., beemster , g . t . s ., krols , l ., terras , f ., landrieu , i ., van der schueren , e ., maes , s ., naudts , m . and d . inzé ( 2001 ). functional analysis of cyclin - dependent kinase inhibitors of arabidopsis . plant cell 13 : 1653 - 1667 . de veylder , l ., beeckman , t ., beemster , g . t . s ., de almeida - engler , j ., ormenese , s ., maes . s ., naudts , m ., van der schueren , e ., jacqmard , a ., engler , g . and inze , d . ( 2002 ). control of proliferation , endoreduplication and differentiation by the arabidopsis e2fa / dpa transcription factor . embo j . 15 , 1360 - 1368 . di cristina , m ., sessa , g ., dolan , l ., linstead , p ., baima , p ., ruberti , i ., and morelli , g . ( 1996 ). the arabidopsis athb - 10 ( glabra2 ) is a hd - zip protein required for regulation of root hair development . plant j . 10 , 393 - 402 . di laurenzio , l ., wysocka - diller , j ., malamy , j . e ., pysh , l ., helariutta , y ., freshour , g ., hahn , m . g ., feldmann , k . a ., and benfey , p . n . ( 1996 ). the scarecrow gene regulates an asymmetric cell division that is essential for generating the radial organization of the arabidopsis root . cell 86 , 423 - 433 . dolan , l ., janmaat , k ., willemsen , v ., linstead , p ., poethig , s ., roberts , k ., and scheres , b . ( 1993 ). cellular organization of the arabidopsis thaliana root . developm . 119 , 71 - 84 . dolan , l ., duckett , c . m ., grierson , c ., linstead , p ., schneider , k ., lawson , e ., dean , c ., poethig , s ., and roberts , k . ( 1994 ). clonal relationships and cell patterning in the root epidermis of arabidopsis . developm . 120 , 2465 - 2474 . donnelly , p . m ., bonetta , d ., tsukaya , h ., dengler , r . e ., and dengler , n . g . ( 1999 ). cell cycling and cell enlargement in developing leaves of arabidopsis . developm . biol . 215 , 407 - 419 . edwards , d ., murray , j . a . h ., and smith , a . g . ( 1998 ). multiple genes encoding the conserved ccaat - box transcription factor complex are expressed in arabidopsis . plant physiol . 117 , 1015 - 1022 . eshed , y ., baum , s . f ., perea , j . v . and j . l . bowman ( 2001 ). establishment of polarity in lateral organs of plants . current biol . 11 : 1251 - 1260 . fellows , j ., erdjument - bromage , h ., tempst , p ., and svejstrup , j . q . ( 2000 ). the elp2 subunit of elongator and elongating rna polymerase ii holoenzyme is a wd40 repeat protein . j . biol . chem . 275 , 12896 - 12899 . fichtner , l ., frohloff , f ., bürkner , k ., larsen , m ., breunig , k . d ., and schaffrath , r . ( 2002 ). molecular analysis of kti12 / tot4 , a saccharomyces cerevisiae gene required for kluyveromyces lactis zymocin action . mol . microbiol . 43 , 783 - 791 . frohloff , f ., fichtner , l ., jablonowski , d ., breunig , k . d ., and schaffrath , r . ( 2001 ). saccharomyces cerevisiae elongator mutations confer resistance to the kluyveromyces lactis zymocin . embo j . 20 , 1993 - 2003 . gaudin , v ., lunness , p . a ., fobert , p . r ., towers , m ., riou - khamlichi , c ., murray , j . a . h ., coen , e ., and doonan , j . h . ( 2000 ). the expression of d - cyclin genes defines distinct developmental zones in snapdragon apical meristems and is locally regulated by the cycloidea gene . plant physiol . 122 , 1137 - 1148 . gietz , d ., st . jean , a ., woods , r . a . and schiestl , r . h . ( 1992 ). improved method for high efficiency transformation of intact yeast cells . nucleic acids res . 20 , 1425 goderis i . j . w . m ., de bolle , m . f . c ., francois , i . e . j . a ., wouters , p . f . j ., broekaert , w . f . and cammue , b . p . a . ( 2002 ). a set of modular plant transformation vectors allowing flexible insertion of up to six expression units . plant mol . biol . 50 , 17 - 27 . hawkes , n . a ., otero , g ., winkler , s ., marshall , n ., dahmus , m . e ., krappmann , d ., scheidereit , s ., thomas , c . l ., schiavo , g ., erdjument - bromage , h ., tempst , p ., svejstrup , j . q . ( 2002 ). purification and characterization of the human elongator complex . j . biol . chem . 277 ( 4 ), 3047 - 3052 . hoffman , c . s . and winston , f . ( 1987 ). a ten - minute dna preparation from yeast efficiently releases autonomous plasmids for transformation of escherichia coli . gene 57 , 267 - 272 jefferson , r . a ., kavanagh , t . a . and bevan , m . w . ( 1987 ). gus fusions : β - glucuronidase as a sensitive and versatile gene fusion marker in higher plants . embo j . 6 , 3901 - 3907 . kaziro , y ., itoh , h ., kozasa , t ., nakafuku , m ., and satoh , t . ( 1991 ). structure and function of signal - transducing gtp - binding proteins . annu . rev . biochem . 60 , 349 - 400 . kerstetter , r . a ., bollman , k ., taylor , r . a ., bomblies , k ., and poethig , r . s . ( 2001 ). kanadi regulates organ polarity in arabidopsis . nature 411 , 706 - 709 . kim , g .- t ., tsukaya , h ., and uchimiya ( 1998 ). the rotundifolia3 gene of arabidopsis thaliana encodes a new member of the cytochrome p - 450 family that is required for the regulated polar elongation of leaf cells . genes & amp ; dev . 12 : 2381 - 2391 . kim , g .- t ., shoda , k ., tsuge , t ., cho , k .- h ., uchimiya , h ., yokoyama , r ., nishitani , k ., and tsukaya , h . ( 2002a ). the angustifolia gene of arabidopsis , a plant ctbp gene , regulates leaf - cell expansion , the arrangement of cortical microtubules in leaf cells and expression of a gene involved in cell - wall formation . embo j . 21 , 1267 - 1279 . koornneef , m . and stam , p . ( 1987 ). procedure for mapping by using f2 and f3 populations . arabidopsis inf serv . 25 , 35 - 40 . krogan , n . j . and greenblatt , j . f . ( 2001 ). characterization of a six - subunit holo - elongator complex required for the regulated expression of a group of genes in saccharomyces cerevisiae . mol . cell . biol . 21 , 8203 - 8212 . li , y ., takasgi , y , jiang , y ., tokunaga , m ., erdjument - bromage , h ., tempst , p . and komberg r . d . ( 2001 ). a multiprotein complex that interacts with rna polymerase ii elongator . the journal of biological chemistry , 276 , 32 , 29628 - 29631 . liao , b ., and zielinski , r . e . ( 1995 ). production of recombinant plant calmodulin and its use to detect calmodulin - binding proteins . methods cell biol . 49 , 481 - 494 . long , j . a ., moan , e . i ., medford , j . i ., and barton , m . k . ( 1996 ). a member of the knotted class of homeodomain proteins encoded by the stm gene of arabidopsis . nature 379 , 66 - 69 . masucci , j . d ., and schiefelbein , j . w . ( 1996 ). hormones act downstream of ttg and gl2 to promote root hair outgrowth during epidermis development in the arabidopsis root . plant cell 8 , 1505 - 1517 . mcconnell , j . r ., emery , j ., eshed , y ., bao , n ., bowman , j ., and k . barton ( 2001 ). role of phabulosa and pha voluta in determining radial patterning in shoots . nature 411 : 709 - 713 . nelissen h , clarke j , de block m , de block s , vanderhaeghen r , zielinski r , dyer t , lust s , inze d , van lijsebettens m ( 2003 ). drl1 , a homolog of the yeast tot4 / kti12 protein , has a function in meristem activity and organ formation in plants . plant cell 15 : 1 - 17 o &# 39 ; neil , k . t ., and degrado , w . f . ( 1990 ). how calmodulin binds its targets : sequence independent recognition of amphiphilic α - helices . trends biochem . sci . 15 , 59 - 64 . otero , g ., fellows , j ., li , y , de bizemont , t ., dirac , a . m . g ., gustafsson , c . m ., erdjument - bromage , h ., tempst , p ., and svejstrup , j . q . ( 1999 ). elongator , a multisubunit component of a novel rna polymerase ii holoenzyme for transcriptional elongation . molec . cell 3 , 109 - 118 . pokholok , d . k ., hannett , n . m ., and young , r . a . ( 2002 ). exchange of rna polymerase ii initiation and elongation factors during gene expression in vivo . mol . cell 9 , 799 - 809 . ponting , c . p . ( 2002 ). novel domains and orthologues of eukaryotic transcription elongation factors . nucleic acids res . 30 , 3643 - 3652 . pruitt , r . e ., and meyerowitz , e . m . ( 1986 ). characterization of the genome of arabidopsis thaliana . j . mol . biol . 187 , 169 - 183 . reinhardt , d ., mandel , t ., and kuhlemeier , c . ( 2000 ). auxin regulates the initiation and radial position of plant lateral organs . plant cell 12 , 507 - 518 . rhoads , a . r ., and friedberg , f . ( 1997 ). sequence motifs for calmodulin recognition . faseb j . 11 , 331 - 340 . robles , p ., and micol , j . l . ( 2001 ). genome - wide linkage analysis of arabidopsis genes required for leaf development . mol . genet . genomics 266 , 12 - 19 . rombauts , s ., déhais , p ., van montagu , m . and rouzé , p . ( 1999 ). plantcare , a plant cis - acting regulatory element database . nucl . acids res . 27 ( 1 ): 295 - 6 . rychlik , w ., spencer , w . j ., and rhoads , r . e . ( 1990 ). optimization of the annealing temperature for dna amplification in vitro . nucl . acids res . 18 , 6409 - 6412 . sabatini , s ., beis , d ., wolkenfelt , h ., murfett , j ., guilfoyle , t ., malamy , j ., benfey , p ., leyser , o ., bechtold , n ., weisbeek , p ., and scheres , b . ( 1999 ). an auxin - dependent distal organizer of pattern and polarity in the arabidopsis root . cell 99 , 463 - 472 . sanger , f ., nicklen , s ., and coulson , a . r . ( 1977 ). dna sequencing with chain - terminating inhibitors . proc . natl . acad . sci . usa 74 , 5463 - 5467 . sawa , s ., watanabe , k ., goto , k ., kanaya , e ., morita , e . h ., and okada , k . ( 1999 ). filamentous flower , a meristem and organ identity gene of arabidopsis , encodes a protein with a zinc finger and hmg - related domains . genes & amp ; developm . 13 , 1079 - 1088 . scheres , b ., di laurenzio , l ., willemsen , v ., hauser , m .- t ., janmaat , k ., weisbeek , p ., and benfey , p . n . ( 1995 ). mutations affecting the radial organization of the arabidopsis root display specific defects throughout the embryonic axis . developm . 121 , 53 - 62 . shaw , r . j ., and reines , d . ( 2000 ). saccharomyces cerevisiae transcription elongation mutants are defective in pur5 induction in response to nucleotide depletion . mol . cell . biol . 20 , 7427 - 7437 . siegried , k . r ., eshed , y ., baum , s . f ., otsuga , d ., drews , g . n . and j . bowman ( 1999 ). members of the yabby gene family specify abaxial cell fate in arabidopsis . developm . 126 : 4117 - 4128 . smalle , j ., haegman , m ., kurepa , j ., van montagu , m . and van der straeten , d . ( 1997 ). ethylene can stimulate arabidopsis hypocotyl elongation in the light . proc . natl . acad . sci . usa 94 ( 6 ): 2756 - 2761 swinburne , j ., balcells , l ., scofield , s . r ., jones , j . d . g ., and coupland , g . ( 1992 ). elevated levels of activator transposase mrna are associated with high frequencies of dissociation excision in arabidopsis . plant cell 4 , 583 - 595 . tsuge , t ., tsukaya , h ., and h . uchimiya ( 1996 ). two independent and polarized processes of cell elongation regulate leaf blade expansion in arabidopsis thaliana ( l .) heynh . developm . uetz , p ., giot , l ., cagney , g ., mansfield , t . a ., judson , r . s ., knight , j . r ., lockshon , d ., narayan , v ., srinivasan , m ., pochart , p ., qureshi - emili , a ., li , y ., godwin , b ., conover , d ., kalbfleisch , t ., vijayadamodar , g ., yang , m ., johnston , m ., fields , s ., and rothberg , j . m . ( 2000 ). a comprehensive analysis of protein - protein interactions in saccharomyces cerevisiae . nature ( london ) 403 , 623 - 627 . ulmasov , t ., murfett , j ., hagen , g . and guilfoyle , t . j . ( 1997 ). aux / laa proteins repress expression of reporter genes containing natural and highly active synthetic auxin responsive elements . plant cell 9 : 1963 - 71 . valvekens , d ., van montagu , m ., and van lijsebettens , m . ( 1988 ). agrobacterium tumefaciens - mediated transformation of arabidopsis thaliana root explants by using kanamycin selection . proc . natl . acad . sci . usa 85 , 5536 - 5540 . van den berg , c ., willemsen , v ., hage , w ., weisbeek , p ., and scheres , b . ( 1995 ). cell fate in the arabidopsis root meristem determined by directional signaling . nature 378 , 62 - 65 . van der graaff , e ., den dulk - ras , a ., hooykaas , p ., and keller , b . ( 2000 ). activation tagging of the leaf petiole gene affects leaf petiole development in arabidopsis thaliana . developm . 127 , 4971 - 4980 . van der straeten , d ., rodrigues - pousada , r . a ., villarroel , r ., hanley , s ., goodman , h . m . and van montagu , m . ( 1992 ). pnas 89 ( 20 ): 9969 - 73 van haute , e ., joos , h ., maes , m ., warren , g ., van montagu , m ., and schell , j . ( 1983 ). intergeneric transfer and exchange recombination of restriction fragments cloned in pbr322 : a novel strategy for the reversed genetics of the ti plasmids of agrobacterium tumefaciens . embo j . 2 , 411 - 417 . wada , t ., tachibana , t ., shimura , y ., and okada , k . ( 1997 ). epidermal cell differentiation in arabidopsis determined by a myb homolog cpc . science 277 , 1113 - 1116 . walia , h ., chen , h . y ., sun , j - m ., holth , l . t ., and davie , j . r . ( 1998 ). histone acetylation is required to maintain the unfolded nucleosome structure associated with transcribing dna . j . biol . chem . 273 , 14516 - 14522 . walker , a . r ., davison , p . a ., bolognesi - winfield , a . c ., srinivasan , j . c . m ., blundell , t . l ., esch , j . j ., marks , m . d ., and gray , j . c . ( 1999 ). the transparent testa glabra1 locus which regulates trichome differentiation and anthocyanin biosynthesis in arabidopsis , encodes a wd40 repeat protein . plant cell 11 , 1337 - 1349 . winkler , g . s ., petrakis , t . g ., ethelberg , s ., tokunaga , m ., erdjument - bromage , h ., tempst , p ., and svejstrup , j . q . ( 2001 ). rna polymerase ii elongator holoenzyme is composed of two discrete subcomplexes . j . biol . chem . 276 , 32743 - 32749 . winkler , g . s ., kristjuhan , a ., erdjument - bromage , h ., tempst , p ., and svejstrup , j . q . ( 2002 ). elongator is a histone h3 and h4 acetyltransferase important for normal histone acetylation levels in vivo . proc . natl . acad . sci . usa 99 , 3517 - 3522 . wittschieben , b . o ., otero , g ., de bizemont , t ., fellows , j ., erdjument - bromage , h ., ohba , r ., li , y ., allis , c . d ., tempst , p ., and svejstrup , j . q . ( 1999 ). a novel histone acetyltransferase is an integral subunit of elongating rna polymerase ii holoenzyme . molec . cell 4 , 123 - 128 . | 2 |
in accordance with the present invention , it is has been found that growth of a nanowhisker in a non - preferential direction ( e . g ., in an & lt ; 001 & gt ; direction from an ( 001 ) crystal plane ) is , once established , stable . the present invention more particularly recognizes the possibility to define and to stabilize the growth direction by controlling conditions at the onset of the nucleation event . the following discussion describes an exemplary application of the invention to [ 001 ] inp nanowhiskers grown by metal - organic vapor phase epitaxy directly on ( 001 ) inp substrates . the nanowhiskers were characterized by scanning electron microscopy and transmission electron microscopy and found to have structural characteristics substantially superior to those of comparative whiskers grown in the preferential & lt ; 111 & gt ; b direction , as will be discussed in detail below . the inp nanowhiskers were grown using low - pressure metal - organic vapor phase epitaxy ( movpe ). aerosol - produced , 50 nm au - particles were deposited on ( 001 ) inp substrates , which were then placed within a horizontal reactor cell on an rf - heated graphite susceptor . a hydrogen carrier gas flow of 6 l / min at a pressure of 100 mbar ( 10 kpa ) was used . a constant phosphine flow at a molar fraction of 1 . 5 × 10 − 2 was supplied to the reactor cell and the samples were heated up to 420 ° c . over 5 minutes . after this temperature ramp step , growth of nanowhiskers was immediately commenced by introducing trimethylindium ( tmi ) into the reactor cell . the tmi molar fraction was 3 × 10 − 6 , and the typical growth time was 8 minutes . it should be noted that this method of producing whiskers differs from the often - used procedure of whisker growth , where au particles are annealed at higher temperature prior to whisker growth in order to de - oxidize the surface and alloy the au catalyst with the semiconductor material . in addition , in order to improve the growth of [ 001 ] nanowhiskers in relation to competing bulk growth at the ( 001 ) surface , the substrate with the deposited au particles was dipped into a solution of poly - l - lysine before inserting it into the growth chamber . l - lysine ( 2 , 6 diaminocaproic acid ) is known to be an adhesion - active substance with low vapor pressure . the monohydrate melts under decomposition between 212 - 214 ° c ., leaving a thin passivation layer at the surface . this layer prevents inp - growth on the bare ( 001 ) inp surface . sample characterization was carried out using a jsm 6400 f field emission scanning electron microscope ( sem ), operated at 15 kv . fig1 ( a ) to 1 ( d ) show sem - images of [ 001 ] inp nanowhiskers grown by the procedures described above . fig1 ( a ) is a top view . fig1 ( b ) is an enlarged top view . fig1 ( c ) is view on a substrate tilted by 30 °, and fig1 ( d ) shows magnification of a single whisker after a clockwise rotation of the substrate by 40 °. in fig1 ( b ), a rectangular whisker shape formed by stepped { 110 } side - facets of the [ 001 ] oriented whiskers is clearly evident . a most remarkable effect of the whisker growth in [ 001 ] is the high crystalline perfection observed . fig3 ( a ) to 3 ( e ) show high - resolution transmission electron microscopy ( tem ) images of inp wires grown in [ 001 ] and & lt ; 111 & gt ; b in comparison . the [ 001 ] wires appear to be defect - free , whereas & lt ; 111 & gt ; b grown whiskers contain a high concentration of stacking faults . the energetic differences for hexagonal or cubic stacking sequences in & lt ; 111 & gt ; b are small , and the stacking faults , as planar defects vertical to the growth direction , can freely end at the nanowhisker side facets . the formation of similar defects during growth in [ 001 ] would need to overcome an activation barrier for the creation of frank partial dislocations . fig3 ( a ) is a side view showing a defect - free [ 001 ]- grown nanowhisker . fig3 ( b ) is an enlargement of the boxed area in fig3 ( a ), showing the atomic lattice of the defect - free zincblende structure in a [ 110 ] projection . fig3 ( c ) is a fourier transform of the [ 110 ] projection . fig3 ( d ) is a side view showing a conventionally grown & lt ; 111 & gt ; b - directed nanowhisker with stacking faults all along the wire . fig3 ( e ) is a close - up of the nanowhisker of fig3 ( d ), showing mirror plane stacking faults resulting in wurtzite - structure segments . the tem images of fig3 ( a ) to 3 ( e ) were taken from nanowhiskers broken off from the substrate by touching a tem grid to the nanowhisker substrate . the higher materials perfection for nanowhiskers grown in [ 001 ] was also evident in photoluminescence studies . for photoluminescence ( pl ) studies , nanowhiskers were transferred to a thermally oxidized si wafer on which a gold pattern was created to facilitate localization and identification of the whiskers studied by pl . the measurements were performed at liquid - he temperatures . a frequency - doubled nd - yag laser emitting at 532 nm was used for excitation . the luminescence was collected through an optical microscope , dispersed through a spectrometer , and detected by a liquid - n 2 cooled ccd . photoluminescence measurements of single [ 001 ] inp nanowhiskers grown in accordance with the invention exhibited a narrow and intense emission peak at approximately 1 . 4 ev , whereas & lt ; 111 & gt ; b conventionally grown reference whiskers showed additional broad luminescence peaks at lower energy . fig4 ( a ) shows photoluminescence spectra from an & lt ; 001 & gt ; nanowhisker of the invention , with strong bandgap - related luminescence associated with the whisker ( thick line ) and a typical & lt ; 111 & gt ; b whisker with weaker luminescence and an additional broad peak at lower energies ( thin line ; small peaks superimposed on top of the broad main feature are artifacts resulting from interference within the ccd ). fig4 ( b ) shows an sem image of the & lt ; 001 & gt ; whisker , showing the strong pl in fig4 ( a ). the differences between the situation with and without annealing may be explained by the schematics in fig2 ( a ) and 2 ( b ). fig2 ( a ) shows growth from an au - droplet at the ( 001 ) surface after annealing . inp will be locally dissolved to form an au / in alloy , resulting in the formation of a pit . two side facets within the pit are of { 111 } b - character . at high temperature (& gt ; 500 ° c . ), inp will be locally dissolved in a reaction with the au . typical au / semiconductor interfaces , which develop under such conditions within the pit , are the low - energy facets { 111 } b and { 011 }, rather than the ( 001 ) facet which defines the substrate major surface . nucleation on such low - energy facets could be the starting point for the commonly observed whisker growth in [ 1 - 11 ] and [- 111 ], as well as the more seldom observed & lt ; 011 & gt ; direction reported for gaas - mbe . fig2 ( b ) shows growth , in accordance with the invention , from an au - droplet without annealing . the au / in - alloy forms by reaction of the au with tmi , such that the ( 001 ) surface underneath the au - droplet remains essentially intact . without annealing at higher temperature , the reaction between inp and au will be suppressed . in and p , dissolved within the au - droplet , will be mostly from the supply of tmi and ph 3 from the vapor phase , and not at the cost of the substrate material . upon reaching a critical supersaturation , nucleation starts at the inp ( 001 )/ au interface , and , consequently , wire growth can be controlled to occur in the [ 001 ] direction . in all samples , areas were found where [ 001 ] wires were dominant , but also areas with dominantly & lt ; 111 & gt ; b wires . since slightly misoriented substrates ( 0 . 2 °) were used , this different behavior may be due to lateral differences in the step structure at the ( 001 ) substrate surface . it will thus be appreciated that the invention can achieve , among other advantages , ( 1 ) nano - wires which are highly perfect zincblende crystals that are free of stacking faults , exhibiting intense single - wire luminescence , and ( 2 ) the capability of vertical growth on the industrially viable ( 001 ) substrate orientation . | 8 |
it is an object of the invention to provide new analgesic compositions suitable for the treatment of pain in mammals , and in particular for the treatment of acute and neuropathic pain in humans . a desirable analgesic agent is a compound capable of exerting its favourable analgesic effect by effectively reducing or alleviating pain sensations , while having reduced or no side effects . in addition , a long - lasting analgesic effect of the drug may also be found beneficial in some cases of pain treatment . according to the invention , compounds of the general formulas i and ii and pharmaceutically acceptable salts thereof are useful for treatment of pain , that includes acute and chronic pain . unexpectedly , the inventors were now able to show that certain branched - chain fatty acids and derivatives thereof have marked effect against acute pain , as is demonstrated by studies using acceptable animal model systems . moreover , it has now been found that , surprisingly , some members of the family of compounds of the general formula i , which were not shown to be effective anticonvulsants in assays previously described in the parent application us 09 / 462 , 533 ( international publication wo 99 / 02485 ), have significant analgesic activity . in the specification , the branched - chain fatty acid compounds of the general formula i , or pharmaceutical acceptable salts thereof , will be collectively referred to as “ bfas ”. specific bfas will be referred to , hereinafter , according to the number of carbons in their particular r 1 and r 2 alkyl chains . for example , valproic acid which has propyl groups at both r 1 and r 2 positions , is defined as m ( 3 , 3 ). similarly , 2 - propylnonanoic acid is defined as m ( 3 , 7 ), 2 - heptylnonanoic acid is defined as m ( 7 , 7 ) etc . r 1 and r 2 alkyl chains of bfas may be straight or branched chains , saturated or unsaturated chains having one or more double and / or triple bonds . the salt forms of the branched fatty acids will be referred to by a suffix including the salt symbol . for example , the sodium salt form of 2 - propylnonanoic acid is defined as m ( 3 , 7 )- na . suitable salts of the compounds of the general formula i include any pharmaceutically acceptable counter ion . in certain preferred embodiments the counter ion is selected from , but not limited to , na + , li + , k + , nh 4 + , ca ++ and mixtures of these ions . derivatives of branched - chain fatty acids of the general formula ii and pharmaceutically acceptable salts thereof are also useful analgesic compounds in accordance with the invention . these compounds in which the hydrogen atom of the carboxyl group of the branched fatty acid is replaced by a lipid moiety ( ester derivatives of bfas ), or the hydroxyl group of the carboxyl group is replaced by an amine group ( amide derivatives of bfas ), will hereinafter be collectively referred to as “ dp - bfas ”. the bfas and dp - bfas compounds can be prepared essentially by the processes described in u . s . application ser . no . 09 / 462 , 533 , ( the disclosure of which is herein incorporated in its entirety by reference ), or by similar or alternative processes as they are known in the art . as mentioned above , the branched - chain lipophilic molecules may be used as free acids , their physiologically acceptable salts or mixtures thereof , esters and amides . currently preferred useful compounds in accordance with the invention include the fatty acid residues 2 - pentylheptanoic acid [ m ( 5 , 5 )], 2 - propyldodecanoic acid [ m ( 3 , 10 )], 2 - propylnonanoic acid [ m ( 3 , 7 )] and 2 - heptylnonanoic acid [ m ( 7 , 7 )]. both the free acid and salt forms of the compounds are useful analgesics in accordance with the invention . other preferred useful compounds are derivatives of bfas (= dp - bfas ) wherein the hydrogen atom of the carboxyl group of the bfa is replaced by a lipid moiety , preferably a polar lipid and more preferably a phospholipid . thus , the preferred embodiments of the invention encompass the use of the following dp - bfa compounds : 1 - stearoyl - 2 - propylnonanoyl - sn - glycero - 3 - phosphocholine , 1 - stearoyl - 2 - propyldodecanoyl - sn - glycero - 3 - phosphocholine , 1 - stearoyl - 2 - pentylheptanoyl - sn - glycero - 3 - phosphocholine and 1 - stearoyl - 2 - heptylnonanoyl - sn - glycero - 3 - phosphocholine . of the preferred members of both formula i and formula ii , the currently most preferred compounds are 2 - pentylheptanoic acid and 1 - stearoyl - 2 - pentylheptanoyl - sn - glycero - 3 - phosphocholine . it is important to note that when a dp - bfa molecule of the general formula ii includes a glycerol based moiety at position a of the compound of the general formula ii , the branched fatty moiety may be linked to the glycerol - based moiety at any one of positions sn - 1 , sn - 2 or sn - 3 . linkage at position sn - 2 of a phospholipid , namely bfa linked to a lyso - phospholipid moiety , is preferred in accordance with the invention . the dp - bfas in accordance with the invention may be active per se or as prodrugs , which may be cleaved by an enzymatic or non - enzymatic reaction , preferably at the target site . for example , it has been reported that increase of phospholipase a 2 activity is associated with inflammation and neuropathic pain [ kawakami ( 1998 ) clin orthop . 351 : 241 - 51 ; saal et al . ( 1990 ) spine 15 : 674 - 8 ]. hence , bfas which are bound , for example , to a phospholipid at the sn - 2 position , may be released by these enzymes whose activity is elevated at the site of pain . the preferred type of lipid moiety selected for the generation of a dp - bfa compound , may depend on the specific disorder or pathology associated with the pain and its location . for example , sphingolipids which are found especially in nervous tissue and cell membranes may be preferred lipids in the case where the analgesic compound is to be targeted to the brain or other cns tissues . the dp - bfas compounds , being amphiphilic in nature , may penetrate biological membranes and barriers , thus facilitating the transport of the drug into privileged tissues and organs . moreover , the dp - bfa drugs , having the bfas covalently linked to a lipophilic moiety , may exhibit favourable therapeutic activity e . g . improved pharmacokinetic properties and potency . indeed , it was shown by the inventors of the present invention that the dp - bfa derivatives are more advantageous drugs in at least two aspects : ( i ) they are more potent as having increased analgesic effect on a molar basis in comparison to the corresponding branched - chain fatty acids , and ( ii ) their effect generally lasts for longer time , thus making them effective drugs for the treatment of chronic pain . in addition at least some of the dp - bfas were found to be much less sedating compared to their branched - chain fatty acids counterparts , therefore dp - bfas are expected to exhibit reduced side effects and toxicity . any suitable route of administration is encompassed by the invention including , but not limited to , oral , intravenous , intramuscular , subcutaneous , inhalation , intranasal , topical , rectal , epidural , systemic transdermal application or other known routes . in one preferred embodiment , the useful pharmaceutical compositions of the invention are administered orally or intravenously . in another preferred embodiment the route of administration is by topical application . preferred embodiments of the topical application include nasal and ocular applications . the pharmaceutical compositions may be in a liquid , aerosol or solid dosage form , and may be formulated into any suitable formulation including , but not limited to , solutions , suspensions , micelles , emulsions , microemulsions , ointments , gels , patches , suppositories , capsules , tablets , and the like , as will be required for the appropriate route of administration . compositions for oral administration may include , but are not limited to , powders or granules , suspensions or solutions in water or non - aqueous media , sachets , capsules or tablets . thickeners , diluents , flavorings , dispersing aids , preservatives , emulsifiers or binders may be desirable . formulations for topical administration may include , but are not limited to , lotions , ointments , gels , creams , suppositories , drops , liquids , sprays and powders . conventional pharmaceutical carriers , aqueous , powder or oily bases , thickeners and the like may be added . in the case of topical application , the composition including a pain - alleviating amount of a compound of the general formula i or ii , is preferably applied on or in close proximity to the tissue associated with the pain . administration may follow the injury that induces the pain sensation , or alternatively may precede the insult or stimuli that are likely to provoke pain . on early administration , medicaments including the analgesic compounds of the general formula i or ii , will be useful as prophylactic medicaments that may prevent , delay or alleviate the progression of pain symptoms . for example , the useful compounds , in accordance with the invention , may be administered to a patient before going through a surgical procedure , a painful dental treatment , entering the final stages of labor contractions etc ., thus resulting in prevention , amelioration or reduction in the levels of post - operative or other pain . the dose ranges for the administration of the compositions of the invention are those large enough to produce the desired analgesic effect . for treating acute pain , the compounds of the general formula i or ii may be employed at a daily dosage in the range of from about 0 . 01 gram to about 10 grams . the dosing range of the medicament varies with the route of administration and the condition of the patient suffering from pain . the dosage administered will also be dependent upon the age , sex , health , weight of the recipient , concurrent treatment , if any , frequency of treatment , severity of the symptoms and the specific nature of the pain to be treated . in addition , dosage should be modified according to the patient response , as it is common in the practice that the tolerance thresholds of patients and their perception of painful sensation may be quite different . dosage regimen and means of administration will be determined by the attending physician or other person skilled in the art . the invention will now be illustrated by the following non - limiting examples . the useful compounds in accordance with the invention , can be prepared by processes as described below in examples 1 to 3 , or by any alternative processes as they are known in the art . it should be appreciated that while , for the sake of clarity , the following discussion and synthesis examples relate to straight - chain saturated members of the bfas and dp - bfas families , also branched and unsaturated bfas and dp - bfas , are included within the useful compounds in accordance with the disclosure of the present invention . anhydrous tetrahydrofuran ( thf , 900 ml ) and diisopropylamine ( 121 . 97 g , 1 . 208 mol ) were added to a dry argon flushed flask under an atmosphere of argon . n - butyllithium in hexane ( 740 ml of 1 . 6 m , 1 . 184 mol ) was added to the magnetically stirred solution at such a rate as to maintain the temperature below 0 c . n - heptanoic acid ( 80 . 81 g , 0 . 62 mol ) was then added to the cold basic solution and again the temperature was kept below 0 c . after 15 min , hmpa ( 230 ml , 1 . 28 mol ) was added to the milky white solution , which , after 5 min of stirring at 5 c , became transparent and light yellow . the solution was then stirred for an additional 15 min at 5 c , and n - pentyl bromide ( 89 . 32 g , 0 . 592 mol ) was added at once at 0 c . the reaction temperature immediately rose to 18 - 20 c . after 2 hours of additional stirring at room temperature , the reaction was processed in the following manner . dilute hydrochloric acid ( 10 %) was added at 0 c until the mixture became acidic . the aqueous layer was separated and extracted with petroleum ether ( bp 30 - 60 c ). the combined organic layers were washed with dilute hydrochloric acid and h 2 o . the organic layer was then dried and the solvent was removed . the residue was distilled . yield was 87 g ( 73 %) of colorless oil , bp . 85 - 90 ( 1 mm hg ). tlc analysis : silica gel 60 f254 on aluminum sheet . eluent is a mixture of pentane with ether ( 8 : 2 v / v ). nmr ( cdcl3 ), δ ( ppm ): 0 . 85 - 0 . 95 ( m , 6h ), 1 . 28 - 1 . 33 ( broad s , 12h ), 1 . 47 - 1 . 50 ( m , 2h ), 1 . 56 ( m , 2h ), 2 . 31 ( m , 1h ). ms ( es , negative . ions mode )= 198 . 99 ( m − h ) 31 the procedure for preparation of other bfas is analogues to the synthesis of the 2 - pentylheptanoic acid mentioned above . the analysis was performed on tlc under the conditions as mentioned above . nmr ( cdcl 3 ), δ ( ppm ): 084 ( m , 6h ), 1 . 2 - 1 . 33 ( 18h ), 1 . 43 ( m . 2h ), 1 . 59 ( m . 2h ), 2 . 35 ( m . 1h ). ms ( es , negative . ions mode )= 241 . 13 . ( m − h ) 31 nmr ( cdcl 3 ), δ ( ppm ): 084 ( m , 6h ), 1 . 2 - 1 . 33 ( 10h ), 1 . 43 ( m . 2h ), 1 . 59 ( m . 2h ), 2 . 35 ( m . 1h ). ms ( es , negative . ions mode )= 199 ( m − h ) 31 nmr ( cdcl 3 ), δ ( ppm ): 084 ( m , 6h ), 1 . 2 - 1 . 33 ( 10h ), 1 . 43 ( m . 2h ), 1 . 59 ( m . 2h ), 2 . 35 ( m . 1h ). ms ( es , negative . ions mode )= 254 . 4 ( m − h ) nmr ( cdcl 3 ), δ ( ppm ): 084 ( m , 6h ), 1 . 2 - 1 . 33 ( 34h ), 1 . 43 ( m . 2h ), 1 . 59 ( m . 2h ), 2 . 35 ( m . 1h ). ms ( es , negative ion mode )= 353 . 4 ( m − h ) 31 . the synthesis of the salt forms of branched - chain fatty acids is exemplified below by the synthesis procedure for 2 - heptylnoanoic acid sodium salt . anhydrous ethanol ( 120 ml ) and 2 - heptylnonanoic acid ( 10 gr , 0 . 039 mol ) were added to a dry argon flushed flask under an atmosphere of argon . sodium ethylate ( 69 . 92 ml of 0 . 53 m , 0 . 037 mol ) was added to the magnetically stirred solution at room temperature . after 5 - 6 hours the solvent was removed . the 2 - heptylnonanoic acid sodium salt was re - crystallized from acetone . sodium titration is 100 %. nmr analysis is the same as for the 2 - heptylnonaoic acid . the synthesis of 1 - stearoyl - 2 - propylnonanoyl - sn - glycero - 3 - phosphocholine is a two - stage process . the first stage is the preparation of 2 - propylnonanoic anhydride . the second stage includes binding of the bfa to the lipid moiety , in this case a lyso - lecithin , and isolation of the final product . in a round - bottom single - neck flask ( 250 ml ), equipped with a reverse condenser ( water cooling ) and magnetic stirrer , 2 - propylnonanoic acid ( 100 g , 0 . 5m ), acetic anhydride ( analytical , 400 ml , 1 . 06m ) and pyridine ( analytical , 44 ml , 0 . 5m ) were introduced . this reaction mixture was stirred by magnetic stirrer for 4 hours at 70 c . after that acetic anhydride was evaporated at a pressure of 20 mm hg . residue was distilled at 1 mm hg and fraction which is boiling at 150 - 152 c was collected . this is 2 - propylnonanoic anhydride . yield was 85 % ( 81 . 1 g ). analyses : tlc is performed on plates of silica gel 60 f254 ( merck ). eluent is chloroform ( analytical ). one spot was visible in uv spectra . rf = 0 . 89 . elemental analysis : c 24 h 46 o 3 . calculated : c 75 . 39 %, h 12 . 04 %. found : c 75 . 25 %, h 11 . 95 %. lyso - lecithin ( 1 - stearoyl - sn - glycero - phosphatidylcholine ; 2 g , 3 . 82 mm ), sodium salt of valproic acid ( 0 . 7 g , 4 . 2 mm ) and 2 - propyl - nonanoic anhydride ( 20 ml ) were introduced under argon into a round - bottom single - neck flask ( 500 ml ), equipped with a reverse condenser ( water cooling ) and magnetic stirrer . the reaction mixture was heated in oil bath ( 80 - 100 c ) until disappearance of the lyso - lecithin ( tlc monitoring ) in the solution ( about 3 hours of heating ). the unreacted valproic anhydride was then distilled from the reaction flask by heating ( 110 - 120 c ) under vacuum ( about 0 . 1 mm hg ). the residue was dissolved in chloroform and the precipitate of sodium salt of valproic acid was separated from the solution by centrifugation . the obtained solution was concentrated by heating in an evaporator . after cooling , the chloroform solution of the reaction product was filtered on a chromatography column composed of silica gel 60 ( 70 - 230 mesh ). for purification of 1 gr . of raw reaction product 30 gr . of silica gel are used . a mixture of chloroform , methanol and water ( 65 : 35 : 5 v / v ) is used as an eluent . 2 - propylheptyl acetic acid and its unreacted anhydride appear with the front of the eluent . the product is a white wax . after chromatography , purification of the product is performed by washing with n - pentane ( three washes , each using a 20 ml portion ). the obtained product was dried in vacuum at 40 ° c . yield was 60 % ( 1 . 5 g ) tlc analysis : silica gel 60 f254 on aluminum sheet . eluent is chloroform ( stabilized by amylene ). one spot was visible in uv spectra . rf = 0 . 3 . elemental analysis : c 38 h 76 o 8 np . calculated : c 64 . 62 %, h 10 . 77 %, n 2 . 00 %, p 4 . 39 %. found : c : 64 . 00 %, h 10 . 9 %, n 2 . 21 %, p 4 . 4 %. 1 h nmr . ( cdcl3 ), δ ( ppm ): 0 . 86 - 0 . 92 ( m , 9h ), 1 . 26 ( broad s , 42h ), 1 . 42 - 1 . 44 ( m , 2h ), 1 . 53 - 1 . 61 ( m , 4h ), 2 . 24 - 2 . 34 ( m , 3h ), 3 . 38 ( s , 9h ), 3 . 81 - 4 . 45 ( broad m , 8h ) and 5 . 20 - 5 . 28 ( m , 1h ). 31 p nmr ( cdcl3 ), δ ( ppm ): - 3 . 0 ( respectively h 3 po 4 in d 2 o ) ( s ) elemental analysis : m 2h 2 o ( calculated / found %): c = 61 . 54 / 62 . 18 ± 0 . 51 , h = 10 . 79 / 10 . 40 ± 0 . 15 , n = 1 . 89 / 1 . 71 ± 0 . 05 , p = 4 . 18 / 4 . 04 . ms ( es , positive ions mode )= 706 ( m + h ) + . tlc : silica gel 60 f254 on aluminum sheet . eluent is mixture of chloroform - methanol - water ( 64 : 25 : 4 ). one spot . r f . = 0 . 68 . nmr ( cdcl 3 ), δ ( ppm ): 084 ( m , 9h ), 1 . 25 - 1 . 37 ( 40h ), 1 . 41 ( m . 2h ). 1 . 49 - 1 . 59 ( m . 4h ), 2 . 25 - 2 . 35 ( 3h ), 3 . 37 ( 9h ), 3 . 38 - 4 . 48 ( 8h ), 5 . 2 ( m , h ). elemental analysis : m 2h 2 o ( calculated / found %): c = 61 . 54 / 61 . 36 ± 0 . 05 , h = 10 . 79 / 9 . 91 ± 0 . 34 , n = 1 . 81 / 1 . 75 ± 00 . 4 , p = 4 . 18 / 3 . 65 . ms ( es , positive ions mode )= 706 ( m + h ) + . tlc : silica gel 60 f254 on aluminum sheet . eluent is mixture of chloroform - methanol - water ( 64 : 25 : 4 ). one spot . r f . = 0 . 67 . nmr ( cdcl 3 ), δ ( ppm ): 084 ( m , 9h ), 1 . 25 - 1 . 37 ( 48h ), 1 . 41 ( m . 2h ), 1 . 49 - 1 . 59 ( m . 4h ), 2 . 25 - 2 . 35 ( 3h ), 3 . 37 ( 9h ), 3 . 38 - 4 . 48 ( 8h ), 5 . 2 ( m , h ). elemental analysis : m 1h 2 o ( calculated / found %): c = 64 , 70 / 64 , 05 ± 0 . 08 , h = 11 , 04 / 11 , 21 ± 0 . 13 , n = 1 . 80 / 1 . 81 ± 00 . 3 , p = 4 . 0 / 3 . 02 . ms ( es , positive ions mode )= 762 ( m + h ) + . tlc : silica gel 60 f254 on aluminum sheet . eluent is mixture of chloroform - methanol - water ( 64 : 25 : 4 ). one spot . r f . = 0 . 73 . nmr ( cdcl 3 ), δ ( ppm ): 084 ( m , 9h ), 1 . 25 - 1 . 37 ( 48h ), 1 . 41 ( m . 2h ), 1 . 49 - 1 . 59 ( m . 4h ), 2 . 27 - 2 . 35 ( 3h ), 3 . 22 ( 9h ), 3 . 38 - 4 . 48 ( 8h ), 5 . 2 ( m , h ). elemental analysis : m 2h2o ( calculated / found %): c = 63 . 56 / 63 . 52 ± 0 . 12 , h = 11 . 24 / 10 . 33 ± 0 . 03 , n = 1 . 80 / 1 . 65 ± 00 . 4 , p = 4 . 00 / 4 . 28 . ms ( es , positive ions mode )= 749 ( m + h ) + . tlc : silica gel 60 f254 on aluminum sheet . eluent is mixture of chloroform - methanol - water ( 64 : 25 : 4 ). one spot . r f . = 0 . 71 . nmr ( cdcl 3 ), δ ( ppm ): 084 ( m , 9h ), 1 . 28 - 1 . 35 ( 46h ), 1 . 41 ( m . 2h ), 1 . 59 ( m . 4h ), 2 . 27 - 2 . 33 ( 3h ), 3 . 22 ( 9h ), 3 . 38 - 4 . 48 ( 8h ), 5 . 2 ( m , h ). the synthesis of the amide analogs of the branched chain fatty acid is exemplified below by the synthesis procedure for 2 - propyloctadecanamide [ dp - m ( 3 , 16 )- amide ]. the synthesis of the amide derivatives of bfas compounds is a two - step procedure . the chloride derivative of the branched chain fatty acid is prepared at the first stage , followed by the addition of the amide itself at the second stage . the other dp - amnides are prepared according to an analogous procedure to the synthesis of 2 - propyloctadecanamide described below . overall , the synthesis can be described according to the following synthetic pathway : c 16 h 33 ( c 3 h 7 ) ch — cooh + so 2 cl 2 { right arrow over (— hso 3 cl )} c 16 h 33 ( c 3 h 7 ) ch — cocl + nh 3 { right arrow over (— nh 4 cl )} c 16 h 33 ( c 3 h 7 ) ch — conh 2 2 - propyloctadecanoic acid ( 200 mg , 0 . 61 mmol ) was introduced into a single neck round - bottom flask , equipped with a magnetic stirrer and a reverse condenser . three milliliters of so 2 cl 2 were also placed in the flask . the reaction mixture was brought to reflux and left for one hour . the reaction mixture was then evaporated . dry benzene ( 5 ml ) was added to the residue and then evaporated . this procedure was repeated twice . the resultant residue was dissolved in 5 ml of dry tetrahydrofuran and then 0 . 2 ml of 0 . 5 m ammonia in dioxane was added to this solution . the suspension thus obtained was stirred with a magnetic stirrer for one hour and then evaporated . petroleum ether was added to the residue and the mixture was stirred . the obtained solid was filtered , and then washed twice with water and petroleum ether . the precipitate was dried under vacuum ( 10 mm hg ) for three hours at room temperature . the product was a white powder . the yield was 80 %. tlc analyses : silica gel 60 on aluminum sheet . eluent was a mixture of petroleum ether with diethyl ether ( 3 : 7 , v / v ). indicator was a spray of 4 - methoxybenzaldehyde ( 10 ml ), abs . ethanol ( 200 ml ), 98 % sulfuric acid ( 10 ml ), glacial acetic acid ( 2 ml ). the chromatogram was sprayed with this indicator , dried and then charred at 100 - 150 ° c . one spot was observed . r f = 0 . 2 . elemental analysis : c 23 h 47 no . calculated : c 78 . 19 %, h 13 . 31 %, n 3 . 97 %. found : c 78 . 09 %, h 13 . 11 %, n 3 . 77 %. 1 h nmr . ( cdcl 3 ), δ ( ppm ): 0 . 84 - 0 . 93 ( m , 6h ), 1 . 24 - 1 . 41 ( m , 34h ), 1 . 52 - 1 . 60 ( broad s , 4h ), 2 . 06 - 2 . 15 ( m , 1h ) and 5 . 30 - 5 . 36 ( d , 2h ). tlc analyses : silica gel 60 on aluminum sheet . eluent was a mixture of petroleum ether with diethyl ether ( 3 : 7 , v / v ). indicator was a spray of 4 - methoxybenzaldehyde ( 10 ml ), abs . ethanol ( 200 ml ), 98 % sulfuric acid ( 10 ml ), glacial acetic acid ( 2 ml ). the chromatogram was sprayed with this indicator , dried and then charred at 100 - 150 ° c . one spot was observed . r f = 0 . 2 . elemental analysis : c 12 h 25 no . calculated : c 72 . 36 %, h 12 . 56 %, n 7 . 04 %. found : c : 72 . 50 %, h 12 . 81 %, n 7 . 22 %. 1 h nmr . ( cdcl 3 ), δ ( ppm ): 0 . 85 - 0 . 94 ( m , 6h ), 1 . 22 - 1 . 42 ( m , 14h ), 1 . 51 - 1 . 60 ( m , 2h ), 2 . 06 - 2 . 18 ( m , 1h ) and 5 . 32 - 5 . 44 ( d , 2h ). tlc analyses : silica gel 60 on aluminum sheet . eluent was a mixture of petroleum ether with diethyl ether ( 3 : 7 , v / v ). indicator was a spray of 4 - methoxybenzaldehyde ( 10 ml ), abs . ethanol ( 200 ml ), 98 % sulfuric acid ( 10 ml ), glacial acetic acid ( 2 ml ). the chromatogram was sprayed with this indicator , dried and then charred at 100 - 150 ° c . one spot was observed . r f = 0 . 2 . elemental analysis : c21h 43 no . calculated : c 77 . 53 %, h 13 . 23 %, n 4 . 30 %. found : c 77 . 56 %, h 13 . 39 %, n 4 . 39 %. 1 h nmr . ( cdcl 3 ), δ ( ppm ): 0 . 86 - 0 . 92 ( m , 6h ), 1 . 24 - 1 . 43 ( m , 30h ), 1 . 52 - 1 . 60 ( m , 4h ), 2 . 08 - 2 . 12 ( m , 1h ) and 5 . 28 - 5 . 36 ( d , 2h ). effects of bfas and their derivatives tested in tail - flick assay ( a model system for acute pain ) the analgesic effect of branched - chain fatty acids ( bfas ) and their dp - bfas derivatives was tested by using the tail flick assay in mice . the tail - flick test is a heat nociception test initially employed by d &# 39 ; amour and smith [ d &# 39 ; amour and smith ( 1941 ) j . pharmacol . exp ther . 72 : 74 - 79 ] and is a widely used animal model system for quantitative measurements of acute pain threshold . this model uses radiated infrared ( ir ) heat source that is directed to the tail of a restrained mouse . the threshold of tolerance for heat is indicated by a time - meter , which is stopped instantaneously when the tail flicks . this time is defined as ‘ withdrawal latency ’. male cd - 1 mice weighing around 25 - 30 grams ( 4 - 8 animals per each dose of the tested compound ) were used . the animals were put in clear plastic cages above an ir source ( 7371 - plantar ™ analgesia instrument , ugo basile ), where the ir generator is placed directly underneath the tail of the mouse and the light beam is focused on the proximal third of the tail . the withdrawal latency , namely the time interval from the starting of the infrared radiation until the animal feels pain and flicks its tail is determined . the initial withdrawal latency for each animal was measured at t = 0 and was determined as its baseline threshold . in order to determine the analgesic effect of a tested drug , the drug ( 10 to 200 mg / kg body weight ) was intraperitoneally ( i . p .) injected to the mice . withdrawal latency was determined at different time points post - injection as indicated . each reading was performed 2 - 3 times and the mean value was calculated . withdrawal latencies of the treated animals , expressed as percentage of the withdrawal latency of the control group of animals treated with vehicle alone , are shown table 1 . the withdrawal latency at each time point post injection is the average of 4 - 8 animals per group . withdrawal latency at t = 0 for all tested animal was around 9 to 12 seconds . paired t - test was used to assess significance in comparison to the baseline value ( t = 0 ). morphine was used as a positive control ( 2 animals per dose ). as shown in table 1 , a statistically significant increase in withdrawal latency , indicating an increase in the animal pain threshold , can be seen with the different amounts of the bfas and dp - bfas molecules . the largest analgesic effects in this experiment were demonstrated with 1 - stearoyl - 2 - pentylheptonanoyl - sn - glycero - 3 - phosphocholine , 2 - pentylheptanoic acid and 2 - propyldodecanoic acid . the most potent drug in this assay was dp - m ( 5 , 5 ), which was , on a molar basis , about 3 - 4 times more potent than m ( 5 , 5 ). it is important to note that the tested compounds exerted their analgesic effect in a dose dependent fashion ( results for dp - m ( 5 , 5 ) are shown in fig1 ). it should also be pointed out that duration of the analgesia effect with most tested bfa compounds in this model system was for about 1 . 5 - 2 hours following dosing . with the lipid derivatives , dp - bfas , a significant effect was demonstrated for up to 5 - 6 hours post injection . prolonged effect of the drugs was also demonstrated with subcutaneously ( s . c .) injected dp - m ( 5 , 5 ), where 40 - 60 % increase in withdrawal latency of animals treated with 50 and 100 mg / kg dp - m ( 5 , 5 ), in comparison to the vehicle - treated animals , was shown at 5 - 6 hours post injection . generally , the animals treated with the dp - bfa derivatives were less sedative in comparison to the animals treated with the corresponding bfas compounds . conclusions : the results of the “ tail - flick ” study demonstrate that bfas and dp - bfas compounds are effective in reducing acute pain sensation . effects of bfas tested in writhing assay ( a model for peripheral acute pain ) the analgesic effects of bfas were evaluated in an animal model system for peripheral acute pain , the writhing model system . the writhing model represents a chemical nociception test , based on the induction of a peritonitis - like condition in the animals by injecting irritant substances intraperitoneally ( i . p .). the writhing test is a simple and reproducible assay , which is characterized by repeated contractions of the abdominal muscles accompanied by extension of the hindlimbs of the animal ( jaques , arzneimittelforschung , 27 , 1698 - 70 , 1977 : siegmund et al , proc . soc . exp . biol . 95 : 729 : 731 , 1957 ). pain is induced in cd - 1 mice by i . p . injection of acetic acid ( 0 . 6 %, 10ml / kg in ddh 2 o ). the number of writhes ( abdominal constriction followed by dorsiflexion and extension ) occurring during a 15 min . time period is recorded , starting 5 minutes after acetic acid administration . average of around 20 to 30 writhes were recorded during this period of time in animals injected with the acetic acid only or animals treated with vehicle . the treated animals are subcutaneously ( s . c .) injected , 30 minutes prior to the injection of the acetic acid , with different doses of the tested compounds in amounts ranging from 10 to 200 mg / kg body weight . animals treated with vehicle only , serve as control . reduction in the number of writhes in response to acid that is injected following administration of the bfas or dp - bfas , demonstrates that these compounds may serve as effective analgesics useful for treatment of acute pain . effects of bfas measured in the chronic constriction injury ( cci ) model system ( neuropathic pain ) the chronic constriction injury ( cci ) is an animal model system developed by bennet and xie [( 1988 ) pain 33 : 87 - 107 ] for producing a chronic peripheral mononeuropathy in rodents . neuropathic pain is induced by loose ligation of the sciatic nerve and is characterized by hyperalgesia ( increased sensitivity to painful stimuli ) and allodynia ( the sensitivity in response to normally innocuous stimuli ). male , sprague - dawley ( sd ) rats , weighing around 200 - 250 grams , are anesthetized by i . p . injection of ketamine ( 50 mg / kg ) and xylazine ( 10 mg / kg ). the common sciatic nerve is exposed at the middle of the thigh of the hind left foot . four ligatures are tied loosely around the nerve with a spacing of about lmm between them . then the incision is closed . five to seven days later the nociception threshold is evaluated by quantifying sensitivity of the foot to mechanical stimuli or cold temperatures to assess allodynia . the mechanical sensitivity of the animal foot is measured using the von frey test . a von frey filament is applied to the plantar surface of the foot and the frequency of foot withdrawals is measured [ kim and chung ( 1992 ) pain 50 : 355 - 63 ]. cold sensitivity is quantified by monitoring brisk foot withdrawal in response to acetone . acetone is applied to the plantar surface of the animal foot and the frequency of foot withdrawal is measured as described by choi et al . [( 1994 ) pain 59 : 369 - 376 ]. in another set of experiments , hyperalgesia to noxious pain is quantified by using radiated infrared ( ir ) heat as the pain stimulus similarly to the procedure described above in example 4 for the tail flick assay , except that in this case the ir is focused on the plantar hind paw of a rat . the withdrawal latency of the hind paw is recorded in animals pre - treated with various dosages of bfas / dp - bfas ( 10 - 200 mg / kg body weight ) or vehicle only ( control ). the withdrawal latency is recorded at 15 , 45 , 75 , 105 and 145 minutes following s . c . injection of the tested drug or vehicle solution . the determined withdrawal latency is compared to the initial withdrawal latency for each animal as measured at t = 0 ( baseline threshold ), and to the withdrawal latency measured for the uninjured right hind foot . same behavioral tests aimed to establish nociceptive threshold values for naive uninjured rats , are conducted on all animals one day prior to surgery . the analgesic effect of bfas and dp - bfas is tested by recording increase in the withdrawal latency measured for the injured left foot in the animals treated with these drugs . the analgesic effect is also assessed by the von frey and cold sensitivity tests . spinal cord hemisection is an acceptable model system for inducing central chronic neuropathic pain . male sprague - dawley ( sd ) rats weighing around 200 - 250 grams are deeply anesthetized with ketamine ( 50 mg / kg ) and xylazine ( 10 mg / kg ). the spinal cord is hemi - sectioned at the level of t9 to t12 with a scalpel blade without damage to the surrounding vasculature . then the incision is closed . sham operated animals serve as a control group . behavioral tests representing mechanical and thermal allodynia as described above in example 6 are performed pre - operatively and post - operatively for both hind limbs . the preoperative testing is performed one day prior to surgery and serves to establish both individual and group baseline behaviors . the tests are performed on alternate days , starting on the fifth to seventh day following surgery , and are carried on for up to 30 days . mechanical allodynia of the paw is quantified by measuring the number of brisk paw withdrawals in response to normally innocuous mechanical stimuli applied by von frey filaments [ christensen et al . ( 1996 ) pain 68 : 97 - 107 ]. the analgesic effect of the bfas and dp - bfas compounds is tested . a decrease in the number of paw withdrawals in response to stimuli by von frey filaments is an indication for analgesia . the beneficial effects are also assessed in the thermal tests where increase in the withdrawal latency for the ipsilateral foot of the injured animals treated with the drugs is an indication for analgesic activity . conclusions : the tested branched - chain fatty acids and their dp - derivatives are potential analgesics that may serve for treating pain , including neuropathic pain . the foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting . persons skilled in the art will appreciate that many variations and modifications can be made which do not depart from the teaching of the present invention . therefore , the invention is not to be construed as restricted to the particularly described embodiments , rather the scope , spirit and concept of the invention will be more readily understood by reference to the claims which follow . | 0 |
terms or words used in this specification and claims are not interpreted being limited to common or dictionary meanings , and the inventor may appropriately define the concept of terms in order to describe his / her invention in the best way , and on the basis of that principle , the terms or words should be interpreted to meet the technical ideal of the present invention . the invention may , however , be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein ; rather , that alternate embodiments included in other retrogressive inventions or falling within the spirit and scope of the present disclosure can easily be derived through adding , altering , and changing , and will fully convey the concept of the invention to those skilled in the art . hereinafter , embodiments of the present invention will be described below in more detail with reference to the accompanying drawings . fig2 is a view illustrating communication between a can communication network device and a modbus communication network device through a gateway device 20 according to the present invention . first , referring to fig2 , a gateway device 20 may replace the related art can module 12 . additionally , the gateway device 20 may relay the can communication device and the modbus communication network device 23 . the can communication network device may be a vehicle 10 . the modbus communication network device 23 may be a device 13 that has an installed application program 22 using modbus communication . that is , unlike that physical communication conversion is required in order to allow the can communication to be compatible through the related art can module 12 , the gateway device 20 may perform mutual conversion of the can communication 11 and the modbus communication 21 without the can module 12 . additionally , the gateway device 20 allows the can communication and the modbus communication to be smooth according to fast conversion by defining a mutual conversion process in advance . fig3 is a detailed configuration view of a gateway device 20 according to the present invention . fig4 is a detailed configuration view illustrating a conversion unit 34 of a gateway device according to the present invention . referring to fig3 and 4 , when examining the gateway device 20 , a can terminal 32 transmits / receives data to / from an external can communication network device 31 . the can terminal 32 may be one of can data communication available protocol terminals . versions of a communication protocol may vary . moreover , a can receive buffer 33 may store the inputted data in can format . the can receive buffer 33 may manage the stored data . moreover , the can receive buffer 33 may transmit the received data to a first input unit 41 . the conversion unit 34 may convert the data in can format , which are received from the can receive buffer 33 through the first input unit 41 , into the data in modbus format . moreover , the converted data are outputted to a first output unit 42 . moreover , a modbus transmit buffer 35 stores and manages the data in modbus format , which are outputted from the first output unit 42 . the modbus transmit buffer 35 may transmit the stored data in modbus format to a modbus communication network device 37 through a modbus terminal 36 . moreover , the modbus terminal 36 may transmit / receive data to / from the modbus communication network device 37 . the modbus terminal 36 may be one of data communication available protocol terminals . additionally , versions of a communication protocol may vary . the modbus communication network device 37 receives the data in modbus format , which are transmitted through the modbus terminal 36 , and performs necessary processing in order to transmit a response according thereto to the modbus terminal 36 . the modbus receive buffer 38 receives the response data , which are transmitted from the modbus communication network device 37 , through the modbus terminal 36 , and stores / manages the received response data . the modbus receive buffer 38 transmits the stored response data to a second input unit 44 of the conversion unit 34 . moreover , the conversion unit 34 converts the response data in modbus format , which are transmitted through the second input unit 44 , into the data in can format , and then , outputs the converted data to a second output unit 43 . the can transmit buffer 39 stores and manages the response data in can format , which are outputted from the second output unit 43 . moreover , the can transmit buffer 39 may transmit the stored data through the can terminal 32 . the can communication network device 31 may receive the response data in can format , which are transmitted through the can terminal 32 . accordingly , communication is performed between the can communication network device 31 and the modbus communication network device 37 . fig4 is the detailed configuration of the conversion unit , as mentioned above . fig5 is a data structure diagram illustrating a conversion process between a can protocol and a modbus protocol . hereafter , a data converting process will be described with reference to fig4 and 5 . referring to fig4 , the conversion unit 34 includes a data converting unit 45 , a first input unit 41 , a first output unit 42 , a second input unit 44 , and a second output unit 43 . first , when examining a process for converting a can format into a modbus format , the data converting unit 45 receives the data in can format through the first input unit 41 . the first input unit 41 may be expressed as a can input unit . the data converting unit 45 analyzes the inputted data in can format , and maps the analyzed data into the data in modbus format in order to perform data conversion . moreover , the data converting unit 45 generates the data in modbus format by using the inputted data in can format in order to perform data conversion . here , the inputted data as the data in can format includes a first data part 501 including can id , a second data part 502 including a data length code ( dlc ), and a third data part 503 including data . for example , a can input data frame or an output data frame may include a can identifier , a dlc , and a plurality of can data units . additionally , the data in modbus format to be outputted includes a fourth data part 504 including an address , a fifth data part 505 including a function code , a sixth data part 506 including data , and a seventh data part 507 including a cyclic redundancy check ( crc ) value . for example , a modbus input data frame or a modbus output data frame may include an address , a function code , a plurality of modbus data units , and a crc code . accordingly , the data converting unit 45 generates the fourth data part 504 including an address of a modbus format data , and maps the first data part 501 including can id into the fourth data part 504 . accordingly , the data converting unit 45 generates the sixth data part 506 including data , and maps the third data part 503 into the sixth data part 506 . additionally , the data converting unit 45 generates the fifth data part 505 including a function code , determines the function code according to a modbus communication protocol in order to satisfy a data transmission purpose , and designates the determined function code of an output data frame in order to include it in the fifth data part 505 . moreover , the data converting unit 45 performs a crc calculation operation on the data of the third data part 503 of the inputted can data , according to a modbus protocol , and generates a seventh data part by using the obtained crc value from the crc calculation operation . then , the data converting unit 45 sequentially combines the generated fourth to seventh data parts 504 to 507 to generate output data in modbus format , and then , sequentially outputs the converted data through the first output unit 42 . accordingly , data conversion from can data into modbus data is accomplished . moreover , when examining a process for converting a modbus format into a can format , the data converting unit 45 receives the data in modbus format through the second input unit 44 . the data converting unit 45 analyzes the inputted data in modbus format and generates the data in can format in order to perform data conversion . additionally , according to the above configuration , the inputted data as the data in modbus format includes an eighth data part 508 including an address , a ninth data part 509 including a function code , a tenth data part 510 including data , and an eleventh data part 511 including a crc value . additionally , according to the above configuration , the data to be outputted in can format includes a twelfth data part 512 including can id , a thirteenth data part 513 including a data length code ( dlc ), and a fourteenth data part 514 including data . accordingly , the data converting unit 45 generates the twelfth data part 512 including the can id of can format data and maps the eighth data part 508 including an address of the inputted modbus format data into the twelfth data part 512 . accordingly , the data converting unit 45 generates the fourteenth data part 514 including data , and maps the data of the tenth data part 510 into the sixth data part 506 . additionally , the data converting unit 45 generates the thirteenth data part 513 , and analyzes the number of bytes in the modbus format tenth data part 510 in order to store it in the thirteenth data part 513 . here , since the maximum number of data bytes in can data format is 8 , if the analyzed number of data byes in modbus format is greater than 8 , the data converting unit 45 sequentially divides data bytes by 8 bytes , and then , configures can data that are to be outputted . furthermore , the data converting unit 45 generates a plurality of divided output data frames and sequentially outputs them . then , the data converting unit 45 combines the generated twelfth to fourteenth data parts 512 to 514 to generate output data in can format , and then , outputs the converted data through the second output unit 43 . accordingly , data conversion from modbus format data into can format data is accomplished . fig6 is a flowchart illustrating a communication method of a gateway device 20 according to the present invention . first , a can communication network device 31 transmits data in can format into a gateway device 20 in operation s 600 . then , the gateway device 20 receives the data in can format and stores them in a can receive buffer 33 in operation s 605 , and converts the data stored in the receive buffer 33 into the data in a modbus format in operation s 610 . then , the gateway device 20 transmits the converted data in modbus format into a modbus communication network device 37 in operation s 615 . then , the modbus communication network device 37 performs necessary processing according to the received data , and then transmits response data according thereto to the gateway device 20 in operation s 620 . then , the gateway device 20 stores the received response data in modbus format in a modbus receive buffer 38 in operation s 626 , and converts the stored response data into data in can format in operation s 630 . the gateway device 20 transmits the converted response data in can format into the can communication network device 31 in operation s 635 . through the above processes , communication between a can communication network device and a modbus communication network device becomes available . the gateway device between modbus and a can and the communication method of the gateway device according to the present invention can also be embodied as computer readable codes on a computer readable recording medium . the computer readable recording medium is any data storage device that can store data which can be thereafter read by a computer system . examples of the computer readable recording medium include read - only memory ( rom ), random - access memory ( ram ), cd - roms , magnetic tapes , floppy disks , optical data storage devices , and carrier waves ( such as data transmission through the internet ). the computer readable recording medium can also be distributed over network coupled computer systems so that the computer readable code is stored and executed in a distributed fashion . ( also , functional programs , codes , and code segments for accomplishing the present invention can be easily construed by programmers skilled in the art to which the present invention pertains .) although embodiments have been described with reference to a number of illustrative embodiments thereof , it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this disclosure . more particularly , various variations and modifications are possible in the component parts and / or arrangements of the subject combination arrangement within the scope of the disclosure , the drawings and the appended claims . in addition to variations and modifications in the component parts and / or arrangements , alternative uses will also be apparent to those skilled in the art . | 7 |
as used herein , the singular forms “ a ,” “ an ” and “ the ” include plural referents unless the context clearly dictates otherwise . thus , for example , reference to “ a polypeptide ” includes a mixture of two or more polypeptides and the like . as used herein , “ about ” means approximately or nearly and in the context of a numerical value or range set forth means ± 15 % of the numerical . as used herein “ animal ” means a multicellular , eukaryotic organism classified in the kingdom animalia or metazoa . the term includes , but is not limited to , mammals . non - limiting examples include rodents , aquatic mammals , domestic animals such as dogs and cats , farm animals such as sheep , pigs , cows and horses , and humans . wherein the terms “ animal ” or “ mammal ” or their plurals are used , it is contemplated that it also applies to any animals . as used herein the term “ patient ” is understood to include an animal , especially a mammal , and more especially a human that is receiving or intended to receive treatment . as used herein , the term “ therapeutically effective amount ” refers to that amount of a therapy ( e . g ., a drug or chemotherapeutic agent ) sufficient to result in the amelioration of age - related hearing loss — presbycusis — or other neurodegenerative disorder or one or more symptoms thereof , prevent advancement of age - related hearing loss or other neurodegenerative disorder , or cause regression of age - related hearing loss or other neurodegenerative disorder . the cba / caj mouse is an inbred mouse strain developed for longevity , and was therefore used as a model to study age - related hearing loss . a composition comprising aldosterone , which maintains homeostasis for potassium and sodium physiologically in the body is administered by itself , and in combination with ammonium chloride , and / or aspirin salicylic acid , and / or ibuprofen , to treat or delay the onset of key aspects of age - related hearing loss ( arhl )— presbycusis . it has also been found that cba / caj mouse serum ald levels declined with age . treatments with ald were analyzed for its effect on mouse inner ear auditory function , which shows that in mice aldosterone treatment reduces arhl , and combining aldosterone with the above - mentioned compounds will increase its effectiveness , and allow for lower dosing of aldosterone to achieve significant therapeutic effects . cba / caj mice ( the jackson laboratory , bar harbor , me .) were treated with aldosterone doses 0 . 00048 mg / day to 0 . 00476 mg / day to determine the dose - response curve using slow - release , subcutaneous ald pellets ( innovative research of america - ira , sarasota , fla .). after 60 ( 2 months ) or 120 days ( 4 months ) of ald implantation , mice were anesthetized with a combination of ketamine and xylazine ( 100 μl i . p . of sterile saline containing 100 mg / ml ketamine and 80 mg / ml xylazine ) for abr measurements . a dose of 0 . 0016 mg / day was found to be optimal for abr threshold improvements relative to age - matched control mice . serum ald levels decrease with age in humans ( hegstad , et al ., aging and aldosterone . am j med . 1983 march ; 74 ( 3 ): 442 - 8 ; hallengren b ., et al ., 80 - year - old men have elevated plasma concentrations of catecholamines but decreased plasma renin activity and aldosterone as compared to young men . aging ( milano ). 1992 ; 4 ( 4 ): 341 - 5 ; bauer , age - related changes in the renin - aldosterone system . physiological effects and clinical implications . drugs aging . 1993 ; 3 ( 3 ): 238 - 45 ; belmin , et al ., changes in the renin - angiotensin - aldosterone axis in later life . drugs aging . 1994 ; 5 ( 5 ): 391 - 400 ; mulkerrin , et al ., aldosterone responses to hyperkalemia in healthy elderly humans j am . soc . nephrol . 1995 ; 6 ( 5 ): 1459 - 62 ) and other mammals , including rodents ( brudieux , et al ., age - related decreases in plasma adrenocorticotropic hormone , corticosterone , and aldosterone responses to exogenous corticotropin - releasing hormone in the rat . gerontol . 1995 ; 41 ( 6 ): 308 - 14 ; magdich , age and the effect of adrenocorticotropic hormone on aldosterone secretion in rats . bull . eksp . biol . med . 1980 ; 89 ( 7 ): 19 - 20 ; kau , et al ., age - related impairment of aldosterone secretion in zona glomerulosa cells of ovariectomized rats . j . investig . med . 1999 ; 47 ( 8 ): 425 - 32 ). for example , mean serum ald levels in mouse pups are in the 1300 ± 150 pg / ml range ( mcdonald , et al ., disruption of the β subunit of the epithelial na + channel in mice : hyperkalemia and neonatal death associated with a pseudohypoaldosteronism phenotype . proc . natl . acad . sci . u s a . 1999 ; 96 ( 4 ): 1727 - 1731 ). in aging mice these mean levels decline , to 900 ± 100 pg / ml ( wang , et al ., chronic hyperaldosteronism in a transgenic mouse model fails to induce cardiac remodeling and fibrosis under a normal - salt diet . am . j . physiol . renal physiol . 2004 ; 286 : f1178 - f1184 ). a direct role for ald in arhl has yet to be demonstrated , however a significant correlation has been identified between low serum ald and severity of presbycusis in elderly human subjects ( tadros , et al ., high serum aldosterone levels correlate with lower hearing thresholds in aged humans : a possible protective hormone against presbycusis . hear . res . 2005 ; 209 : 10 - 18 ). cba / caj mice ( the jackson laboratory , bar harbor , me .) were treated with aldosterone starting at 16 - 17 months of age . treatment consisted of a subcutaneous implantation of a 120 - day release pellet of d - aldosterone ( 0 . 0016mg / day ; innovative research of america , sarasota , fla .) behind the shoulder in ald treatment mice ( n = 5 ), and same - age control mice ( n = 5 ) mice . the mice were kept in their home cages in the usf vivarium room in the global center for hearing & amp ; speech research , 12 hour light / dark cycle , 21 degrees c ., in a relatively quiet environment with non - invasive auditory testing monthly . after the four month ( 120 day ) course of treatment concluded , the mice were euthanized by injecting a commercial euthanasia solution , euthasol @, ( 0 . 22 ml / kg ) intraperitoneally . the depth of narcosis / anesthesia was assessed by using the interdigital pinch reflex . death was confirmed by terminal phlebotomy / exsanguinations and perfusion . after the mice were sacrificed , the brachial vessels are exposed after removing the skin over the axilla and the vessels ware cut . blood was allowed to free - flow from the puncture site and collected with a sterile pasteur pipette , then transferred to an eppendorf tube in a 37 ° c . water bath for 30 min , centrifuged 2000 rpm for 25 min , and then the serum was taken off and stored at − 80 ° c . also a thoracotomy may performed to gain access to the heart was punctured by an 18g sterile hypodermic needle . blood collection was done quickly to avoid clotting . blood was collected in sample containers without any preservatives . the blood was permitted to clot and centrifuged at room temperature at 2000 rpm . samples were stored at − 20 ° c . until use . the mice were , and tested for ald protein levels using rabbit anti - aldosterone igg - based elisa kit ( cat . no 1875 , alpha diagnostic int ., san antonio tex .) that uses a competitive solid phase . briefly , 50 μl of plasma or standard was added to rabbit anti - aldosterone igg - coated elisa strips and 100 μl of an aldosterone - avadin conjugated solution added to each sample . the samples were mixed for 5 - 10 seconds , followed by washing 3 times with the supplied wash buffer . a horseradish peroxidase substrate ( aldosterone - hrp conjugate ) was added ( 150 μl ) to each well and mixed for 5 - 10 seconds . the reaction was incubated at room temperature for 1 - 15 minutes , followed by addition of a reaction cessation solution ( 50 μl ) which was mixed for 5 - 10 seconds . solution absorbance was measured at 450 nm . the color is inversely proportional to the concentration of aldosterone in the sample . serum aldosterone ( ald ) levels declined as the mice aged , to approximately half their original values , which was statistically significant , from around 110 pg / ml in 2 - 4 month old mice to around 60 pg / ml in 12 - 18 month old mice , as seen in fig1 . supplementing aging mice with ald hormone treatments increased ald levels such that the 120 day - old mice ( middle age ) showed the highest serum ald levels , which showed statistically significant differences from the 2 - 4 month old and aging control mice , as seen in fig2 . however , the three subject groups were all within the normal ald physiological range for mice . spiral ganglion neuron ( sgn ) degeneration with age is an important biomarker of presbycusis - age - related hearing loss ( arhl ). arhl represents the top communication deficit and neurodegenerative disorder in aged populations . a relationship between aldosterone ( ald ) serum levels and the severity of arhl in old human subjects suggests that ald may be involved in the etiology of arhl ( tadros , et al ., high serum aldosterone levels correlate with lower hearing thresholds in aged humans : a possible protective hormone against presbycusis . hearing research . 2005 ; 209 : 10 - 18 ). in addition , sgn density declines 30 - 60 %, from apex to base in old cba / caj mice compared to young adults ( tang , et al ., age - related hearing loss : gab a , nicotinic acetylcholine and nmda receptor expression changes in spiral ganglion neurons of the mouse . neuroscience . 2014 ; 259 : 184 - 93 ). it has been shown that higher serum aldosterone ( ald ) levels correlate with lower hearing thresholds in older human subjects ( tadros , et al ., high serum aldosterone levels correlate with lower hearing thresholds in aged humans : a possible protective hormone against presbycusis . hearing research . 2005 ; 209 : 10 - 18 ), and that serum aldosterone ( ald ) levels declined between young adult and middle - aged in cba / caj mice . as such , mouse inner ear auditory structure and function was studied with respect to ald plasma levels . cba / caj mice ( the jackson laboratory , bar harbor , me .) were treated with aldosterone starting at 16 - 17 months of age . treatment consisted of a subcutaneous implantation of a 120 - day release pellet of d - aldosterone ( 0 . 0016mg / day ; innovative research of america , sarasota , fl ) behind the shoulder in ald treatment mice ( n = 5 ), and same - age control mice ( n = 5 ) mice . the mice were kept in their home cages in the usf vivarium room in the global center for hearing & amp ; speech research , 12 hour light / dark cycle , 21 degrees c ., in a relatively quiet environment with non - invasive auditory testing monthly . after the four month ( 120 day ) course of treatment concluded , the mice were euthanized by injecting a commercial euthanasia solution , euthasol ®, ( 0 . 22 ml / kg ) intraperitoneally . the depth of narcosis / anesthesia was assessed by using the interdigital pinch reflex . death was confirmed by terminal phlebotomy / exsanguinations and perfusion . after sacrifice , a cochlear modiolus ( cm ) was dissected from the temporal bone , & amp ; pooled together for measuring nkcc1 protein and mrna expression . the other cm was prepared for immunohistochemistry as described below . data was analyzed using one - way anova , and two - way repeated measures anova through graphpad prism 5 . 0 with protein level measurements ( δ intensity = background tissue intensity − experimental area intensity ) ( graphpad software , la jolla , calif .). for western blot and rt - pcr , cells were placed in ripa buffer and sonicated . protein concentration was measured using the bradford method . proteins were separated by sds - page . the antibodies used for the western blots were : na +- k +- atpase subunits and nkcc1 ( cell signaling , cambridge , mass .). total cellular rna was extracted using the rneasy plus mini kit ( 74134 ). for rt - pcr , 10 ng of total cellular rna was reverse transcribed and complementary dna was amplified , using the enhanced avian hs rt - pcr - 100 kit ( sigma , hsrt20 ). nkcc proteins play important roles in determining na + and k + concentrations in key physiological systems , including cardiac , vascular , renal , nervous and sensory systems . nkcc levels and functionality are altered in certain disease states , and tend to decline with age . a sensitive , effective way of regulating nkcc protein expression has significant bio - therapeutic possibilities . ald supplementation was analyzed for its ability to regulate nkcc1 protein expression . application of ald to a human cell line ( ht - 29 ) revealed that ald can regulate nkcc1 activity and protein expression levels , quite sensitively and rapidly , as shown in ( data not shown ). utilization of a specific inhibitor of mineralocorticoid receptors , eplerenone , implicated mineralocorticoid receptors as part of the ald mechanism of action . further experiments with cycloheximide ( protein synthesis inhibitor ) and mg132 ( proteasome inhibitor ) revealed that ald can upregulate nkcc1 by increasing protein stability , i . e ., reducing ubiquitination of nkcc1 . having a procedure for controlling nkcc1 protein expression opens the doors for therapeutic interventions for diseases involving the mis - regulation or depletion of nkcc proteins , for example in the cochlear lateral wall , during aging . along with declines in serum levels of ald in aging cba mice ( fig1 and 2 , above ; and zhu , x ., et al . ( 2014 ). aldosterone reduces spiral ganglion neuron loss in middle age cba / caj mice . assoc . res . otolaryngol . abstr . 37 , 7 ), nkcc1 and na , k - atpase gene and protein expression was found to decline with age in the cba mouse cochlea , including the stria vascularis of the lateral wall ( ding , b ., et al . ( 2014 ) simultaneous declines in nkcc1 and na , k - atpase , but not kir4 . 1 and kcnq1 / kcne1 , are found in the cochlear lateral wall of cba / caj mice with age - related hearing loss . soc . neurosci . abstr . 39 ). both mrna levels and protein levels of the subunits of na , k - atpase showed a clear decline in aged mice , which correlated among all the subunits , as seen in fig3 ( a ) and ( b ). an analysis of the data indicated a relative expression patterns were statistically significant , as seen in fig3 ( c ) and ( d ). aldosterone ( ald ) binds with mineralocorticoid receptors ( mcr ). mcr distribution in cochlear modiolus ( cm ) was analyzed in young adult ( 3 month old ) cba / caj mice and multiplex rt - pcr performed to determine mcr mrna expression in the spiral ganglion neurons , as seen in fig4 . samples of the treatment mice were then compared to detect mcr mrna in spiral ganglion neurons from the young cba / caj ( cba ) mouse ( 2 - 3 month old ) compared to middle age mouse ( 20 - 21 month old ) control ( saline )- treated mouse and middle age ald - treated mouse . modiolar samples from young mouse showed slightly elevated mcr levels compared to modiolar samples from middle - age control mice and the ald - treated middle aged mice , as seen in fig5 . mcr protein was run on a western blot to determine protein levels in spiral ganglion neurons from young adult ( 2 - 3 month old ), and middle - aged ( 20 - 21 month old ) mice , as seen in fig6 ( a ) . the expression level of modiolar tissue samples was analyzed as relative to the expression of beta - actin as the loading control , showing ald - treated middle age mice has similar mcr protein levels to young mice , which were both statistically significantly different from the middle age control mice , as seen in fig6 ( b ) . this cm expression suggests that spiral ganglion neurons ( sgns ) are possible targets for ald hormonal influences . for immunohistochemistry , mice were sacrificed , and one of the cochleae dissected , fixed in 4 % paraformaldehyde in pbs overnight at 4 ° c ., decalcification in 10 % edta in pbs for a week at 4 ° c ., and incubated in cryoprotection solution overnight at 4 ° c . the cochleae were embedded into degassed oct overnight at 4 ° c ., orientated into the cryomold with oct degassed for 1 hour , then frozen at − 80 ° c . cryosectioning was performed at 5 μm per section . the cochlear cross sections were stained with hematoxylin and eosin ( h & amp ; e ) and mcr ( h - 300 ) ( sc - 11412 , santa cruz bio ). the spiral ganglion neurons were counted by metamorph imaging software ( molecular devices , center valley , pa 18034 - 0610 ) and data analyzed by graphpad prism ( graphpad software , inc . la jolla , calif .). brain slices were obtained from 3 mon old cba / caj mice and stained with an antibody to mcrs , as seen in fig7 . the relative protein expression of mcrs from the immunohistochemical staining was subjectively analyzed in regions include spiral ganglion , cochlear nerve fibers , stria vascularis , spiral ligament , organ of corti , tectorial membrane and reissner &# 39 ; s membrane . results are summarized in the table . levels of staining for mcr presence in young adult and middle - aged mice was determined by densitometry analysis ( metamorph image analysis system ) of immunocytochemistry sections . the relative densities from densitometry measurements were determined , as seen in in fig8 , showing young mice had the highest level of mcr expression with middle age mouse controls showing approximately ⅓ the expression levels of the young mice . ald treatment of the middle age partially rescued the expression levels seen in the young adult . spiral ganglion neuron ( sgn ) cell density was measured from 4 different topographical area , comparing ald - treated middle - aged mice to age - matched controls . h & amp ; e staining showed that for the ald treatment group , sgn density was higher in the upper apical , as seen in fig9 , lower apical , seen in fig1 , upper basal , seen in fig1 , and lower basal , seen in fig1 , regions than the untreated control mice throughout the cochlea . further , this increase in sgn is correlated with abr threshold shifts ( shown below ) in the same mice . the experimental group also showed an upregulation of mineralocorticoid receptors , in sgns of the experimental mice relative to controls . lastly , prepulse inhibition , indicate provocative increases in auditory temporal processing in our ald - treated aging cba mice ( halonen et al . 2014 ). ald appears to play a key role in preserving hearing and for modulating sgn degeneration stria vascularis degeneration in the aging cochlea . ald supplementation shows use in preserving hearing , reducing sgn degeneration , and stimulating mcr upregulation in the aging cochlea . initial investigations have implicated the mineralocorticoid , steroid hormone ald synthesized in the glomerulosa of the adrenal gland , as a regulator of nkcc1 . for instance , when adrenalectomized rats received a multiday treatment of ald , there was a 63 % increase in nkcc1 activity as measured by bumetanide - sensitive efflux of 86 rb for vascular smooth aortic muscle ( jiang , et al ., aldosterone regulates the na — k - 2c1 cotransporter in vascular smooth muscle . hypertension 41 : 1131 - 1135 , 2003 ). interestingly , application of ald did not elevate nkcc1 transcripts as determined by real - time polymerase chain reaction . additionally , nkcc1 - knockout mice have deficient or abnormal responses to ald ( kim , et al ., salt sensitivity of blood pressure in nkcc1 - deficient mice . am j physiol renal physiol 295 : f1230 - f1238 , 2008 ., wall , et al ., hypotension in nkcc1 null mice : role of the kidneys . am j physiol renal physiol 290 : f409 - f416 , 2006 ). ald can exert its action by binding to mineralocorticoid receptors ( type i ) to form a complex that interacts with nuclear dna to exert gene transcription and protein synthesis ( phakdeekitcharoen , et al ., aldosterone increases na + - k + atpase activity in skeletal muscle of patients with conn &# 39 ; s syndrome . clin endocrinol ( oxf ) 74 : 152 - 159 , 2010 , tsuchiya , et al ., aldosterone - dependent regulation of na — k - atpase subunit mrna in the rat ccd : competitive pcr analysis . am j physiol renal fluid electrolyte physiol 271 : f7 - f15 , 1996 ). the present study tested the hypothesis that ald can directly and precisely increase nkcc1 expression . cell culture and buffers . human colon adenocarcinoma epithelial ht - 29 cells ( obtained from the laboratory of dr . edward seto , moffitt cancer res . center , tampa fla .) were utilized in the present investigation , since they express nkcc1 , which can be effectively detected in these cells using straightforward protein techniques ( more complicated procedures involving manipulation of transfected constructs not necessary ), and since previous reports have demonstrated ht - 29 utility for being a representative epithelial cell line for investigations of cell signaling and transductional factors and pathways ( cox , et al ., effects of autonomic agonists and immunomodulatory cytokines on polymeric immunoglobulin receptor expression by cultured rat and human salivary and colonic cell lines . arch oral biol 52 : 411 - 416 , 2007 ). these include , for example , studies of comm domain - containing protein 1 , which is involved in nkcc1 ubiquitination and transcriptional regulation of epithelial na + channels ( enac ) located in the apical membrane of polarized epithelial cells , in particular , cells in the colon , kidney , and lung , by ald ( cohen , et al ., induced differentiation in ht29 , a human colon adenocarcinoma cell line . j cell sci 112 : 2657 - 2566 , 1999 , epple , et al ., early aldosterone effect in distal colon by transcriptional regulation of enac subunits . am j physiol gastrointest liver physiol 278 : g718 - g724 , 2000 , smith , et al ., commd1 interacts with the cooh terminus of nkcc1 in calu - 3 airway epithelial cells to modulate nkcc1 ubiquitination . am j physiol cell physiol 305 : c133 - c146 , 2013 ). ht - 29 cells were grown in dmem media ( invitrogen , carlsbad calif .) with 10 % fbs and antibiotics . cells were grown in a humidified 95 %/ 5 % co 2 incubator at 37 ° c . experiments were performed at 70 - 80 % confluence . 86 rb uptake . similar to previous studies of nkcc1 activity ( gagnon & amp ; delpire , molecular determinants of hyperosmotically activated nkcc1 - mediated k_ / k_exchange . j physiol 588 : 3385 - 3396 , 2010 ), cells were plated on six - well dishes and incubated at 37 ° c ./ 5 % co 2 until confluent . for the uptake , cells were first washed twice with 1 ml of isosmotic saline ( 140 mm nacl , 5 mm kcl , 2 mm cacl 2 , 0 . 8 mm mgso 4 , 5 mm glucose , 5 mm hepes buffered to ph 7 . 4 , and 300 . 5 mosm ). cells were then preincubated for 15 min in 1 ml of the same isosmotic saline plus 1 mm ouabain ( sigma )± 20 μm bumetanide ( sigma , st . louis mo .). the preincubation solution was then aspirated and replaced with an identical solution containing 1 μci of 86 rb and 1 mm ouabain ± 20 μm bumetanide . four 5 μl aliquots of flux solution were sampled at the beginning of each 86 rb uptake condition and used as standards . after a 20 - min uptake , the radioactive solution was aspirated , and the cells were washed three times with 1 ml of ice - cold solution , lysed for 1 h with 500 μl of 0 . 25 n naoh , and neutralized with 250 μl of glacial acetic acid . 86 rb tracer activity was measured by using 150 μl of lysate for γ - scintillation counting . nkcc1 flux was expressed in millimoles of k + per micrograms of protein per minute . relative quantitative rt - pcr . total rna was extracted using the rnaeasy mini kit ( qiagen , valencia calif .). quantitative reverse transcription - polymerase chain reaction ( qrt - pcr ) was performed using two methods : per manufacturer &# 39 ; s suggestion using the enhanced avian hs rt - pcr - 100 kit ( hsrt20 ; sigma ) and the fast real - time pcr system with their sybr green pcr master mix ( 7900ht ; applied biosystems , carlsbad calif .). primers used for qrtpcr were as follows : the semiquantitative qrt - pcr reaction took place at 45 ° c . for 50 min . the competition between primer sets was excluded by adjusting the reaction condition . then , the primer products were pcr amplified directly . a first cycle of 10 min . at 95 ° c ., 45 s at 65 ° c ., and 1 min at 72 ° c . was followed by 45 s at 95 ° c ., 45 s at 65 ° c ., and 1 min at 72 ° c . for 25 cycles . the conditions were chosen so that the rnas analyzed were in the exponential phase of amplification . each set of reactions always included a no - sample negative control . we usually performed a negative control containing rna instead of cdna to rule out genomic dna contamination . the real - time rt - pcr reaction mixture was prepared using the sybr - green pcr master mix . thermal cycling conditions were the same as in the semiquantitative method . amplification specificity was checked using melting curves . both negative and positive controls were included in each pcr reaction . all assays were carried out three times as independent pcr runs for each cdna sample . gene expression was referenced to the expression of β - actin as the housekeeping gene . each gene expression level was normalized with respect to β - actin mrna content . calculations of expression were performed with the 2δδct method ( bustin , et al ., quantitative real - time rtpcr — a perspective . j mol endocrinol 34 : 597 - 601 , 2005 ). western blot . cell lysates were prepared in ripa buffer ( pierce 89901 ; thermo scientific , waltham , mass .) with protease inhibitor cocktail ( 78430 ; thermo scientific ). cell samples were homogenized in buffer , followed by centrifugation at 2 , 000 rpm for 10 min at 4 ° c . supernatants were subjected to western blot analysis by loading 200 μg of protein per lane , after the protein concentrations were determined by bradford protein assay . proteins were fractionated by sds - page gel electrophoresis and transferred to a pvdf blotting membrane ( whatman , piscataway , n . j .). the blot was incubated with primary antibodies against β - actin and na — k - 2c1 cotransport protein ( cell signaling , danvers mass . ); primary antibodies for p - sgk1 , sgk1 , pnedd4 - 2 , and nedd4 - 2 were utilized ( concentration 1 : 1 , 000 ). the secondary antibody was horseradish peroxidaseconjugated goat anti - rabbit igg ( 1 : 2 , 000 ; cell signaling ). tl - uptake in single cells for the detection of nkcc1 activity . to measure nkcc1 activity , we used a fluorescence assay to assess cotransporter activity in single isolated ht - 29 cells ( delpire & amp ; austin , kinase regulation of na + — k + - 2cl − cotransport in primary afferent neurons . j physiol 588 : 3365 - 3373 , 2010 , geng , et al ., the ste20 kinases spak and osr1 regulate nkcc1 function in sensory neurons . j biol chem 284 : 14020 - 14028 , 2009 , weaver , et al ., a thallium - sensitive , fluorescence - based assay for detecting and characterizing potassium channel modulators in mammalian cells . j biomol screen 9 : 671 - 677 , 2004 ). ht - 29 cells were incubated at 37 ° c ./ 5 % co 2 for 24 h before use . for the uptake experiment , thallium was used as the tracer for the k + ( fluxortm thallium detection kits ; invitrogen ). cells were first loaded with the thallium - sensitive fluxortm dye ( 1 ×) in a hypotonic ( 275 . 5 mosm ) low chloride solution ( 125 mm nameso3 , 2 mm kcl , 2 mm cacl 2 , 0 . 8 mm mgso 4 , 5 mm glucose , and 20 mm hepes ) plus 1 × powerload concentrate and 2 . 7 mm probenecid ( supplied by the kit ) for 90 min . the loading solution was then aspirated , and cells were washed three times with the same solution to remove excess dye . cells were then preincubated for 10 min using 1 ml of the same saline containing 1 mm ouabain and 2 . 7 mm probenecid in the presence or absence of 20 μm bumetanide ( sigma ). for the detection of fluorescence , the preincubation solution was removed , and the cells were treated with a 340 . 5 mosm hypertonic stimulus solution containing the following ( in mm ): ( 2 . 8 tiso 4 , 140 nacl , 2 kcl , 2 cacl 2 , 0 . 8 mgso4 , 5 glucose , 20 hepes , 27 sucrose , 1 ouabain , and 2 . 7 probenecid ) in the presence or absence of 20 μm bumetanide . images were made using a x40 × objective inverted florescent microscope at 488 - nm excitation wavelength . ht - 29 cells were loaded with the thallium - sensitive dye fluxor ( invitrogen ). fluxor fluorescence ( excitation / emission : 488 / 525 nm ) was recorded after 90 s upon addition of 2 . 8 mm t1504 to the external medium . the difference between the two measurements , made with and without bumetanide treatment , represents the bumetanide - sensitive component of the tl + uptake , mediated by nkcc1 . immunoprecipitation ( autoubiquitination assay ) and western blot analysis . an autoubiquitination assay was followed ( garg , et al ., effect of the na — k - 2cl cotransporter nkcc1 on systemic blood pressure and smooth muscle tone . am j physiol heart circ physiol 292 : h2100 - h2105 , 2007 ). cell extracts were prepared in a modified radioimmunoprecipitation assay 1 ( ripa ) buffer , containing the following ( in mm ): 50 tris · hcl at ph 7 . 4 , 150 nacl , 1 edta , and 1 dithiothreitol with 1 % nonidet p - 40 , 0 . 1 % sds ; in a 1 : 200 - diluted protease inhibitor cocktail ( sigma ), containing the following ( in mm ): 1 pmsf , 10 nem , and 0 . 1 iodoacetamide immunoprecipitations were accomplished using a rabbit polyclonal anti - nkcc1 antibody ( cell signaling ). antibody was bound to lysate with endogenous nkcc1 , and then beads were added . bound proteins were eluted in 1 × sds sample buffer , fractionated on an sds - polyacrylamide gel , transferred onto a pvdc membrane ( ge healthcare , piscataway , n . j . ), and immunoblotted with anti - ubiquitin antibody visualized using enhanced chemiluminescence detection reagents ( pears , shelton conn .) according to the manufacturer &# 39 ; s instructions . sources . chloroquine , an agent that impairs lysosomal acidification ( lysosome inhibitor ), mg - 132 ( proteasome inhibitor ), cycloheximide ( translation inhibitor ), and gsk650394 ( sgk inhibitor ) were purchased from sigma ( st . louis , mo .). the polyclonal antibodies to nkcc1 and β - actin were purchased from cell signaling ( cambridge , mass . ); and the polyclonal antibodies to p - sgk ( thr256 ) and sgk from santa cruz ( dallas , tex .). the polyclonal antibodies to p - nedd4 - 2 ( s328 ), nedd4 - 2 , and lamp2 were purchased from abcam ( cambridge , mass . ), and the polyclonal antibody to lc3 was purchased from novus biologicals ( littleton , colo .). statistical analysis . images from films were imported into adobe photoshop ( v 5 . 0 ), and further processed using adobe photoshop cs and imagej ( national institutes of health ) for the densitometry analysis . data are reported as means ± sd . statistical analyses were performed with prism 4 . 0 ( graphpad software , san diego calif .). differences were analyzed with a one - or a two - way repeated measures anova as appropriate or a two - way anova followed by bonferroni post hoc analyses that were corrected for multiple comparisons . values of p & lt ; 0 . 05 were considered significant . ald induced a sustained induction of nkcc1 . ald treatment upregulated nkcc1 protein activity and expression levels , which remained relatively stable for over 12 - 24 h of treatment , as seen in fig1 and 14 ( a ) and ( b ). this up - regulation took effect within the first 2 h of ald treatment ( 1 μm ), as seen in fig1 ( a ) and ( b ). the threshold of nkcc1 induction was quite sensitive , as there was a significant response at ˜ 10 pm , seen in fig1 ( a ) and ( b ). further , simultaneous treatment with ald ( 1 μm ) and eplerenone ( 20 μm ), a mineralocorticoid receptor antagonist , prevented the ald upregulation of nkcc1 protein expression , as seen in fig1 ( a ) and ( b ). the increase of nkcc1 protein expression by ald is not associated with mrna induction but is mediated by mineralocorticoid receptors . we investigated whether the increased protein expression of nkcc1 was tied to elevated mrna levels by using rt - pcr . both methods utilized here resulted in similar findings : there was no mrna change with ald stimulation , seen in fig1 ( a ) , ( b ) and 19 . these results indicate that the ald - induced increase of nkcc1 protein expression is associated with the activation of mineralocorticoid receptors by ald . ald enhances the stability of nkcc1 protein . we discovered that ald increases nkcc1 protein levels , whereas induction of nkcc1 mrna synthesis is absent . the regulation of intracellular protein levels is highly dependent on two factors : ribosomal protein synthesis , which is associated with mrna levels ; and posttranslational modification , which is independent of transcriptional activation and translational regulation . to explore the possibility that posttranslational modification is the mechanism by which ald exerts its effects , cells were treated with cycloheximide , a translation inhibitor , for 3 , 6 , or 9 h . the results show that in the presence of ald ( 1 μm ) the decline of nkcc1 protein levels was much slower in response to cycloheximide , relative to the nontreated cells , as seen in fig2 ( a ) ,( b ) and ( c ). cells were then treated with mg132 ( 20 μg / ml ) to inhibit the ubiquitination of nkcc1 protein . specifically , in the presence of mg132 , proteins that are polyubiquitinated will accumulate intracellularly , often as aggregates . this accumulated pool is typically nonfunctional . the effect of ald on nkcc1 expression was mimicked by mg132 , suggesting that ald reduces proteasomal degradation of nkcc1 . interestingly , when combining ald with mg132 treatments , the increased level of nkcc1 protein expression was the same as the ald or mg132 treatments alone , seen in fig2 ( a ) and ( b ). next , global protein translation was inhibited with cycloheximide , while simultaneously treating with mg132 and ald . in the presence of cycloheximide , the joint effect of ald and mg132 did not increase the nkcc1 stability relative to either ald or mg132 treatments alone , as seen in fig2 ( a ) and ( b ). apparently , ald promotes nkcc1 protein stability and subsequently enhances its accumulation in cells by preventing posttranslational modifications involving ubiquitination of nkcc1 . ubiquitination , but not the lysosome pathway , is involved in nkcc1 induction by ald . a parallel experiment was performed with chloroquine ( cq ), a lysosome inhibitor , to exclude the possibility that prolonged mg - 132 treatment depleted free ubiquitin by nonspecific inhibition of lysosome degradation of nkcc1 and to confirm whether or not ald is involved in a lysosome pathway . in fig2 ( a ) and ( b ), the positive marks indicate application of ald , mg - 132 , or cq . activation of lysosome pathway proteins is given in fig2 ( a ) ( lc3 - i and - ii and lamp - 2 ). as shown in fig2 ( b ) , ald and mg - 132 treatments induce nkcc1 protein expression similarly [ 1st bar ( control ) vs . 2nd and 3rd bars ], whereas nkcc1 protein expression increased when ald ( 1 μm ) was combined with cq ( 50 μm ) treatment ( 4th bar ). the combined treatment with mg - 132 ( 20 μm ) and cq ( 5th bar ) on the induction of nkcc1 equals the effects of ald and cq together ( 4th bar ) but exceeds those of ald , cq , or mg132 alone ( 2nd , 3rd , and 6th bars ). note that only when the lysosome pathway blocker cq was used was their significant upregulation of lc3ii and lamp - 2 expression levels . taken together , these data suggest that ald specifically suppresses the proteasomal degradation of nkcc1 without affecting its degradation via the lysosomal pathway . ald decreases the endogenous ubiquitination of nkcc1 and inhibition of sgk1 activation blocks this downregulation . to confirm the role of ubiquitination of nkcc1 in the ald mechanism , we blocked the endogenous ubiquitination of ht - 29 cells by applying mg132 ( 20 μm ). two hours after the mg132 application , cells were treated with ald ( 1 μm ) or the sgk1 inhibitor gsk 650394 ( 50 μm ) or ald ( 1 μm ) combined with sgk1 inhibitor gsk 650394 ( 50 μm ) for 24 h . it was previously shown that sgk1 regulates na + / cl − cotransporter ( ncc ) and nkcc1 has structural similarities to ncc ( arroyo , et al ., nedd4 - 2 modulates renal na_ - cl — cotransporter via the aldosterone - sgk1 - nedd4 - 2 pathway . j am soc nephrol 22 : 1707 - 1719 , 2011 ). as predicted from the results of fig2 ( a ) and ( b ), the nkcc1 expression in the three groups ( with or without ald treatment , or ald + gsk 650394 ) was equal , as seen in fig2 ( a ) and ( b ). correspondingly , endogenous ubiquitinated nkcc1 was significantly reduced in the ald - treated cells ( middle bar ), because fewer mono - and polyubiquitin bands were seen in the ald treatment group relative to the cells in the non - ald group , as seen in fig2 ( a ) and ( b ) ( compare left bar to middle bar ). next , blocking sgk1 reduces the ability of ald to suppress nkcc1 ubiquitination , as seen in fig2 ( a ) and ( b ) ( compare middle bar to right bar ). these results , utilizing a complete endogenous system ( auto - ubiquitination assay ), confirm that ald is responsible for the inhibition of the nkcc1 ubiquitination , likely mediated by sgk1 - nedd4 - 2 activation . ald inhibits the degradation of nkcc1 through the sgk1 - nedd4 - 2 pathway . interaction between enac ( a n + channel ) and nedd4 - 2 is required for enac internalization and protein stability ( arroyo , et al ., nedd4 - 2 modulates renal na_ - cl — cotransporter via the aldosterone - sgk1 - nedd4 - 2 pathway . j am soc nephrol 22 : 1707 - 1719 , 2011 ). specifically , nedd4 - 2 binds enac via a specific domain called the py motif . mutation of this domain induces a kidney disease called liddle &# 39 ; s syndrome . since nkcc1 and nccs belong to the cation cl − cotransporters ( cccs ), and the cccs exhibit a common structure in their functional regulation domains , such as the membrane associated domain and the phosphoacceptor sites ( richardson & amp ; alessi , the regulation of salt transport and blood pressure by the wnk - spak / osr1 signalling pathway . j cell sci 121 : 3293 - 3304 , 2008 , simard , et al ., characterization of a novel interaction between the secretory na + — k + - 2cl − cotransporter and the chaperone hsp90 . j biol chem 279 : 48449 - 48456 , 2004 ), we hypothesize that there is a similarity in the regulation of ncc and nkcc1 inductions by ald . to test this , we found that ald increases the phosphorylation of sgk1 and nedd4 - 2 and concomitantly there is an increased induction of nkcc1 protein expression , as seen in fig2 ( middle bar ). it was also observed that the sgk1 inhibitor gsk 650394 ( 50 μm ) blocked phosphorylation of sgk1 and nedd4 - 2 , as seen in fig2 , but the total protein expressions of sgk1 and nedd4 - 2 showed no differences ( compare middle bar to right bar ). lastly , ald in the presence of gsk 650394 did not increase protein expression of nkcc1 , as seen in fig2 ( compare middle bar to right bar ). these data suggest that the most likely target of ald in regulation of nkcc1 is the ald - sgk1 - nedd4 - 2 pathway . influence of ald on nkcc1 transporter activity . it is possible that increasing nkcc1 protein expression may not have a significant physiological functional role unless there is a parallel increase in potassium transport activity . we hypothesize that the overall activity levels of nkcc1 are associated with its expression levels in cells . to test this hypothesis , a more efficient and sensitive method , fluorescence ion flux assays was adopted to measure nkcc1 transporter activity . the signal intensity was analyzed using ti + as a surrogate of k + and a ti + - sensitive fluorescent dye ( flixortm ) to visualize ti + uptake through nkcc1 in single cells . the signal intensity corresponding to the relative k + efflux was measured in a total of 24 cells . we found that when ald was added to the culture medium , a marked increase in fluorescence was observed , reflecting upregulated tr uptake , as seen in fig2 . adding mg132 and the combination of ald with mg132 had identical enhancements similar to the ald treatment alone , as seen in fig2 ( 3 rd and 4 th bars ), since the fluorescence intensities were identical among them . nkcc1 proteins play important roles in key physiological systems , including neural , cardiac , renal , and sensory systems . correction of mis - regulation of the expression and functionality of nkcc1 that accompanies disease states and aging would have biotherapeutic and pharmaceutical implications . the present study demonstrates for the first time that this naturally occurring steroid hormone can precisely and sensitively regulate nkcc1 protein expression and accompanying functionality . additionally , the present investigation revealed that ald exerts its regulatory effects on nkcc1 protein expression via mineralocorticoid receptors without altering mrna levels . prevailing evidence suggests that the mechanisms underlying rapid ald effects , such as actions observed in the present study , can involve activation of protein kinases and secondary messenger signaling cascades and also modulation of the transcriptional action of ald through mineralocorticoid receptors ( guo , et al ., axin and gsk3 - b control smad3 protein stability and modulate tgf - γ signaling . genes dev 22 : 106 - 120 , 2008 ). additionally , rapid nongenomic effects of ald have been recognized for some time , but whether or not mineralocorticoid receptors are involved remains controversial ( eisen et al ., novel membrane receptors for aldosterone in human lymphocytes : a 50 kda protein on sds - page . cell mol biol 40 : 351 - 358 , 1994 , marver , influence of adrenalectomy and steroid replacement on heart citrate synthase levels . am j physiol endocrinol metab 246 : e452 - e457 , 1984 , thomas , et al ., mechanisms underlying rapid aldosterone effects in the kidney . annu rev physiol 73 : 335 - 357 , 2011 ). for example , spironolactone can have nongenomic actions in cases of diabetic retinopathy . also , in the rccd2 rat cell line , early increases in transepithelial sodium transport elicited by ald are not associated with transcriptional events but operate through the pkcα signaling pathway . this is accompanied by serine and threonine phosphorylation of the endogenous mineralocorticoid receptors . interestingly , activation of this pkcα signaling cascade appears as a key event in the development of the later genomic response ; blockade of this initial pathway prevents the late response to ald ( fuller & amp ; young , mechanisms of mineralocorticoid action . hypertension 46 : 1227 - 1235 , 2005 ). additionally , nongenomic effects of ald can be inhibited by specific mineralocorticoid receptor antagonists , such as eplerenone and water soluble ru28318 ( le moëllic , et al ., early nongenomic events in aldosterone action in renal collecting duct cells : pkc - alpha activation , mineralocorticoid receptor phosphorylation , and cross - talk with the genomic response . j am soc nephrol 15 : 1145 - 1160 , 2004 , michea , et al ., eplerenone blocks nongenomic effects of aldosterone on the na + / h + exchanger , intracellular ca 2 + levels , and vasoconstriction in mesenteric resistance vessels . endocrinology 146 : 973 - 980 , 2005 ). grossmann and colleagues ( grossman , et al ., human mineralocorticoid receptor expression renders cells responsive for nongenotropic aldosterone actions . mol endocrinol 19 : 1697 - 1710 , 2005 , mihallidou , nongenomic actions of aldosterone : physiological or pathophysiological role ? steroids 71 : 277 - 280 , 2006 ) proposed three possible ald signaling pathways : genomic ( mineralocorticoid receptor dependent ), nongenomic ( mineralocorticoid receptor dependent ), and nongenomic ( mineralocorticoid receptor independent ). our study suggests that the nkcc1 protein induction resides on the rapid nongenomic , mineralocorticoid receptor - dependent ald pathway , since the time to start the enhancement of nkcc1 protein expression in response to ald treatments is relatively short , is blocked by eplerenone , and shows no changes in mrna levels . previous studies implicate posttranslational phosphorylation associated with nkcc1 expression changes ( akar et al ., vasoconstrictors and nitrovasodilators reciprocally regulate the na_ - k_ - 2c1_ - cotransporter in rat aorta . am j physiol cell physiol 276 : c1383 - c1390 , 1999 , delpire & amp ; austin , kinase regulation of na + — k + - 2cl − cotransport in primary afferent neurons . j physiol 588 : 3365 - 3373 , 2010 , grossmann & amp ; gekle , new aspects of rapid aldosterone signaling . mol cell endocrinol 308 : 53 - 62 , 2009 , haas & amp ; forbush , the na — k — cl cotransporter of secretory epithelia . annu rev physiol 62 : 515 - 534 , 2000 , kenneth & amp ; delpire , molecular determinants of hyperosmotically activated nkcc1 - mediated k_ / k — exchange . j physiol 588 : 3385 - 3396 , 2006 , richardson , et al ., regulation of the nkcc2 ion cotransporter by spak - osr1 - dependent and - independent pathways . j cell sci 124 : 789 - 800 , 2010 , simard , et al ., characterization of a novel interaction between the secretory na + — k + - 2cl − cotransporter and the chaperone hsp90 . j biol chem 279 : 48449 - 48456 , 2004 ). in contrast , the present investigation is the first report that ald exerts its effects on nkcc1 expression via prevention of posttranslational ubiquitination , e . g ., reduces proteasome - dependent degradation of the nkcc1 protein . further , we explored the physiological action of nkcc1 in ald induction . stimulation of nkcc1 increases na + , k + , and cl − fluxes , as previously noted ( flatman , regulation of na — k - 2c1 cotransport by phosphorylation and protein - protein interactions . biochim biophys acta 1566 : 140 - 151 , 2002 , forbush , regulatory activation is accompanied by movement in the c terminus of the na - k - cl cotransporter ( nkcc1 ). j biol chem 287 : 2210 - 2220 , 2012 , grossmann & amp ; gekle , new aspects of rapid aldosterone signaling . mol cell endocrinol 308 : 53 - 62 , 2009 , jiang , et al ., aldosterone regulates the na — k - 2c1 cotransporter in vascular smooth muscle . hypertension 41 : 1131 - 1135 , 2003 , sid , et al ., stimulation of human and mouse erythrocyte na (+)- k (+)- 2cl (−) cotransport by osmotic shrinkage does not involve amp - activated protein kinase , but is associated with ste20 / sps1 - related proline / alanine - rich kinase activation . j physiol 588 : 2315 - 28 , 2010 , thastrup , et al ., spak / osr1 regulate nkcc1 and wnk activity : analysis of wnk isoform interactions and activation by t - loop transautophosphorylation . biochem j 441 : 325 - 337 , 2012 ). ion flux assays represent functional assays that measure efflux of ions through cotransporters such as nkcc1 . radioactive 86 rb flux assays have been used effectively to study activity of a number of k + channels and cotransporters and was employed in the present investigation . the cotransporter unidirectional efflux of rb + ( as a tracer for k + ) is an accepted method to measure cotransporter activity , despite it being bidirectional . also , the net flux under physiological conditions is inward because of the inward gradients resulting from the equilibrium potentials for both na + and cl − ( jiang , et al ., aldosterone regulates the na — k - 2cl cotransporter in vascular smooth muscle . hypertension 41 : 1131 - 1135 , 2003 ). recently , a fluorescent assay for the measurement of thallium ions through potassium channels was used to measure nkcc1 activity ( kim , et al ., salt sensitivity of blood pressure in nkcc1 - deficient mice . am j physiol renal physiol 295 : f1230 - f1238 , 2008 ). we utilized this methodology following the protocol of the delpire group ( geng , et al ., the ste20 kinases spak and osr1 regulate nkcc1 function in sensory neurons . j biol chem 284 : 14020 - 14028 , 2009 ), since they and other groups have shown similar results between 86 rb and fluxor . this method uses tr as a surrogate of k + , and a ti + - sensitive fluorescent dye ( flix - ortm ) to visualize tr uptake through nkcc1 in single cells ( hille , potassium channels in myelinated nerve : selective permeability to small cations . j gen physiol 61 : 669 - 686 , 1973 , hille , potassium channels in myelinated nerve : selective permeability to small cations . j gen physiol 61 : 669 - 686 , 1973 , niswender , et al ., novel assay of gi / o - linked g protein - coupled receptor coupling to potassium channels provides new insights into the pharmacology of the group iii metabotropic glutamate receptors . mol pharmacol 73 : 1213 - 1224 , 2008 , weaver , et al ., a thallium - sensitive , fluorescence - based assay for detecting and characterizing potassium channel modulators in mammalian cells . j biomol screen 9 : 671 - 677 , 2004 ). we found that addition of ald to the media resulted in a marked increase in fluorescence of nkcc1 with both the 86 rb and t + methodologies . mg132 and the combination ald and mg132 treatments have identical enhancements to ald treatment alone . combining the data from the experiments with ald and mg132 effects on nkcc1 protein expression and the 86 rb and tl + uptake fluorescence studies , suggested that increasing nkcc1 protein expression involves increasing its functional activity levels . summary and conclusions . the present investigation demonstrated that nkcc1 protein expression can be sensitively regulated by application of the naturally occurring hormone ald . further experiments suggested that this expression regulation occurs via mineralocorticoid receptors and takes place utilizing mechanisms involving protein stabilization , i . e ., reduction of nkcc1 ubiquitination . since mis - regulation of na and k + , and / or declines in nkcc1 proteins are involved in many disease states and in aging , being able to precisely control nkcc1 expression levels and functionality has note - worthy biotherapeutic implications for improved clinical practice and drug development . cba / caj mice ( the jackson laboratory , bar harbor , me .) were treated with aldosterone starting at 16 - 17 months of age . treatment consisted of a subcutaneous implantation of a 120 - day release pellet of d - aldosterone ( 0 . 0016 mg / day ; innovative research of america , sarasota , fla .) behind the shoulder in ald treatment mice ( n = 5 ), and same - age control mice ( n = 5 ) mice . the mice were kept in their home cages in the usf vivarium room in the global center for hearing & amp ; speech research , 12 hour light / dark cycle , 21 degrees c ., in a relatively quiet environment with non - invasive auditory testing monthly . during treatment , blood pressures were measured for the mice at 2 and 4 months after start of treatment . as seen in fig2 ( a ) and ( b ), neither aging nor the hormone treatment appeared to affect either diastolic or systolic blood pressure . after the four month ( 120 day ) course of treatment concluded , the mice were euthanized by injecting a commercial euthanasia solution , euthasol ®, ( 0 . 22 ml / kg ) intraperitoneally . the depth of narcosis / anesthesia was assessed by using the interdigital pinch reflex . death was confirmed by terminal phlebotomy / exsanguinations and perfusion . cell lysates were collected and subject to western blot and rt - pct analysis . the cells were placed in ripa buffer and sonicated . protein concentration was measured using the bradford method . proteins were separated by sds - page . the antibodies used for western blot were : anti - inos , nnos and caspase - 3 antibodies ( cell signaling , cambridge , mass .). total cellular rna was extracted using the rneasy plus mini kit ( 74134 ). for rt - pcr , 10 ng of total cellular rna was reverse transcribed and complementary dna was amplified , using the enhanced avian hs rt - pcr - 100 kit ( sigma , hsrt20 ). sgn showed age - correlated levels of caspase - 3 , an apoptotic pathway marker , as seen in fig2 ( a ) and ( b ). however , treatment of mice with ald showed statistically significant downregulation of the apoptotic pathways , as seen in fig2 ( a ) , which reduced caspase - 3 to levels below even the young mice samples . additionally , changes in inflammation related genes , inos and nnos , gene expression in modiolar tissue samples from young adult ( 2 - 3 mon ), control middle - aged ( 20 - 21 mon ), and ald - treated middle - aged ( 20 - 21 mon ) cba / caj mice show no alteration in nos expression between the three treatment groups , as seen in fig2 ( a ) and ( b ). however , while inos protein levels were approximately the same between the three treatment groups , as seen in fig3 ( a ) and ( b ), nnos protein levels were significantly elevated in middle age control mice , as seen in fig3 ( c ) . as nnos protein levels are altered , whereas mrna levels are not , it is believed that the data point to likely stabilization of nnos protein in the sgn . the alterations in inflammation related genes indicate pharmacologic - based treatments of presbycusis will benefit from anti - inflammatory drug treatment . cba / caj mice ( the jackson laboratory , bar harbor , me .) were measured for auditory brainstem responses ( abrs ) and then treated with aldosterone starting at 16 - 17 months of age . treatment consisted of a subcutaneous implantation of a 120 - day release pellet of d - aldosterone ( 0 . 0016 mg / day ; innovative research of america , sarasota , fla .) behind the shoulder in ald treatment mice ( n = 5 ), and same - age control mice ( n = 5 ) mice . the mice were kept in their home cages in the usf vivarium room in the global center for hearing & amp ; speech research , 12 hour light / dark cycle , 21 degrees c ., in a relatively quiet environment with non - invasive auditory testing monthly . auditory brainstem responses ( abrs ) were measured again at 2 and 4 months after treatment started auditory brainstem responses were obtained as follows . the mice were anesthetized with a mixture of ketamine / xylazine ( 120 and 10 mg / kg body weight , respectively , intraperitoneal injection ) prior to all experimental sessions . all recording sessions were completed in a soundproof acoustic chamber ( iac ) with body temperature maintained with a heating pad . abrs were measured using biosig ( tdt , alachua , fla .) data - acquisition system which recorded responses to 5 ms tone pips ( 0 . 5 - m rise - fall times ) with a cos 2 onset envelope , presented at rate of 29 / sec . wave i threshold was defined as the lowest intensity which elicited a clearly replicable response . abrs were measured pre - treatment and post - treatment at 2 and 4 mon . the pre - treatment abr threshold was used as the baseline to calculate the thresholds shifts . the wave i peak - to - peak amplitudes were analyzed . data was compared using graphpad prism 5 . 0 ( graphpad software , inc . la jolla , calif ., usa . aged mice were compared to hormone - treated aged mice for auditory brainstem response ( abr ). abr thresholds elevated significantly in the control group at 4 month of treatment relative to the ald group , with hormone - treated mice showed improvement in 12 khz , seen in fig3 , 24 khz , seen in fig3 , 32 khz , seen in fig3 , and 36 khz , seen in fig3 , frequency response at 2 months and 4 months . it is also noted that the data show more profound improvements seen in responses to higher frequencies , as seen in fig3 through 35 . a comparison of the sgn density to abr showed that as the mice lost sgn density in the upper basal region , seen in fig3 ( a ) , and lower basal region , seen in fig3 ( b ) , the correlations between sgn density and 24 and 36 khz abr threshold shifts indicate that fewer sgns are associated with poorer hearing ( higher abr thresholds ). physiological place - frequency mapping of the mouse cochlea ( muller et al . hearing res ., 2005 , 63 - 73 ), state that 24 and 36 khz are located at upper and lower basal turns of the cochlea , which match to the segments with the most cell density loss with age in cba / caj mice . the abr thresholds elevated significantly in the control group at 60 and 120 days of treatment relative to the ald group at 24 , 32 , 36 khz , at 120 days , indicating ald may play a key role in preserving hearing and for modulating sgn degeneration in the aging cochlea . it could be a component in developing treatments to prevent or slow down the progression of age - related hearing loss — presbycusis . abr thresholds were significantly elevated in the control , non - treated , group relative to the ald treated group at 24 , 32 and 36 khz , at 120 days . abr peak 1 amplitude increased as a function of increasing stimulus intensity . the peak 1 amplitude increased significantly at high sound levels in ald treated mice , relative to the control group . declines in hormone levels play a role in age - linked diseases , including neurodegenerative conditions such as arhl . over - active or accumulating inflammatory responses or markers are another of the key etiologies implicated in aging , particularly in neurodegenerative disorders , including alzheimer &# 39 ; s disease and age - related macular degeneration ( seddon et al . 2005 ; nash et al . 2013 ). in particular , there is evidence that increased inflammatory activity and accumulation of inflammatory biomarkers in the auditory system may play a significant role in arhl in humans ( verschuur et al . 2012 ). indeed , several inflammatory markers in the cochlea are associated with hearing threshold changes in older adults , such as tnf - α , il - 6 and c - reactive protein ( verschuur et al . 2012 ; tokarz et al . 2013 ). since aspirin in low doses is very widely used in the primary and secondary prevention of coronary atherosclerosis in aged persons , optimal doses and durations are quite well understood clinically ( beers 2006 ). therefore , inclusion of a safe anti - inflammatory drug in combination with ald , would likely be a potent , safe inhibitor of the progression of arhl . cba / caj mice ( the jackson laboratory , bar harbor , me .) were treated with aldosterone starting at 16 - 17 months of age . treatment consisted of a subcutaneous implantation of a 120 - day time - release pellet of d - aldosterone ( 0 . 0016mg / day ; innovative research of america , sarasota , fla . ), a pellet containing ald ( 0 . 0016 mg / day ) and aspirin ( 0 . 125 mg / day , 0 . 083 mg / day or 0 . 042 mg / day ), or a placebo , embedded subcutaneously behind the shoulder . as male mice weigh on average 28 . 0 g at week 9 and female mice 23 . 1 g , doses of the anti - inflammatory were designed to bracket a dose of 5 mg / kg / day . a total five groups ( n = 8 , half male and half female ) were tested . treatment continued for 120 days or until the mouse was euthanized . the mice were kept in their home cages in the usf vivarium room in the global center for hearing & amp ; speech research , 12 hour light / dark cycle , 21 degrees c ., in a relatively quiet environment with non - invasive auditory testing monthly . after the four month ( 120 day ) course of treatment concluded , the mice were euthanized by injecting a commercial euthanasia solution , euthasol ®, ( 0 . 22 ml / kg ) intraperitoneally . the depth of narcosis / anesthesia was assessed by using the interdigital pinch reflex . death was confirmed by terminal phlebotomy / exsanguinations and perfusion . after the mice were sacrificed , the brachial vessels are exposed after removing the skin over the axilla and the vessels ware cut . blood was allowed to free - flow from the puncture site and collected with a sterile pasteur pipette , then transferred to an eppendorf tube in a 37 ° c . water bath for 30 min , centrifuged 2000 rpm for 25 min , and then the serum was taken off and stored at − 80 ° c . also a thoracotomy may performed to gain access to the heart was punctured by an 18g sterile hypodermic needle . blood collection was done quickly to avoid clotting . blood was collected in sample containers without any preservatives . the blood was permitted to clot and centrifuged at room temperature at 3000 × g . samples were stored at − 20 ° c . until use . the mice were , and tested for ald protein levels using rabbit anti - aldosterone igg - based elisa kit ( cat . no 1875 , alpha diagnostic int ., san antonio tex .) that uses a competitive solid phase . the dose - response curve was designed to bracket 5 mg / kg daily for 120 days using subcutaneous , time - release pellets ( slow - release , innovative research of america - ira , sarasota , fla . ), similar to the time - release pellets described in previous examples . optimal aspirin dosages permit analysis of varying dosages of ald , based on the results above , to determine synergism of ald with aspirin , such as allowing reduction in the effective ald dosage , for reducing arhl . auditory sensitivity is assessed with pre - pulse inhibition of the acoustic startle response , where the frequency and intensity of the pre - pulse is varied to obtain threshold sensitivity across the mouse hearing range , as described above . temporal processing in background noise is assessed by a temporal - gap - in - noise acoustic startle paradigm , as described in rodent aging auditory system ( e . g ., barsz et al . 2002 ). from extensive studies of the aging rodent auditory system by us and other groups , it is important to make the following arhl biomarker measurements ( particularly sensitive to detecting middle age signs of presbycusis in humans and rodents ) prior to drug administration ( baseline ) and at longitudinal time points during drug administration : auditory sensitivity will be assessed using abr thresholds with frequencies that cover the mouse / rat hearing range . mice were treated at middle age , as above , using 0 . 0016 mg / day of d - aldosterone , a combination of 0 . 0016 mg / day of d - aldosterone and 0 . 042 mg / day of aspirin ; and a control placebo ( saline ). placebo showed an increase in abr shift at both the 24 khz and 36 khz tests , as seen in fig3 ( a ) and ( b ). treatment with aldosterone only resulted in reduced abr shifts , as seen previously and shown in fig3 ( a ) and ( b ). by comparison , the combination treatment of aldosterone and aspirin showed significantly decreased abr thresholds compared to the control group at both 2 and 4 month of treatment , which did not change significantly over time . these results were similar to the ald group , with hormone - treated mice showed improvement in 24 khz , seen in fig3 ( a ) . in testing at 36 khz , seen in fig3 ( b ) , frequency response at 2 months was increased significantly , which was slightly reduced at 4 months . ald will be administered in combination with ibuprofen as described in example 7 , to test the efficacy of combining ald with this fda - approved anti - inflammatory agent , which has very few side effects , when administered chronically in moderate dosages . specifically , the dose - response curve brackets 2 . 5 mg / kg daily for 120 days using subcutaneous , time - release pellets ( slow - release , innovative research of america - ira , sarasota , fla .). upon determination of the optimal ibuprofen dosage , analysis of varying dosages of ald , based on the results above , determine synergism of ald with ibuprofen , such as allowing reduction in the effective ald dosage , for reducing arhl . spiral ganglion neuron ( sgn ) degeneration with age is an important biomarker of presbycusis — age - related hearing loss ( arhl ). arhl represents the top communication deficit and neurodegenerative disorder of our aged population . our previous study indicates a relationship between aldosterone ( ald ) serum levels and the severity of arhl in old human subjects , suggesting that ald may be involved in the etiology of arhl ( tadros , et al ., high serum aldosterone levels correlate with lower hearing thresholds in aged humans : a possible protective hormone against presbycusis . hearing research . 2005 ; 209 : 10 - 18 ). also serum aldosterone ( ald ) levels declined between young adult and middle - aged in cba / caj ( cba ) mice . but with 120 day ald ( 0 . 0016 mg / day ) treatments in middle - aged cbas , these treated mice showed the highest serum ald levels , but still within the normal ald physiological range for mice . ( zhu , et al ., aldosterone reduces spiral ganglion neuron loss in middle - aged cba / caj mice . aro abstract . 2014 ; 008 ). ammonium chloride ( nh 4 cl ) as part of a proposed treatment of presbycusis is based on the fact that nh 4 cl has been used with fda approval as a diuretic ; nh 4 cl increases nkcc1 protein expression and activity in several studies in other physiological systems ( jayakumar et al . 2008 ; ikebe et al . 2001 ); c ) nh 4 cl can also increase na , k - atpase activity ( masui et al . 2002 ; garcon et al . 2007 ). for large doses , nh 4 cl can induce metabolic acidosis , but in lower doses taken orally , there are no significant side effects in the short term . our preliminary data , as shown in fig3 , demonstrates that nh 4 cl ( 5 mm , 24 hr ) treatment in vitro ( ht - 29 human cell line ) enhances the mrna expression of na , k - atpase compared to vehicle treatment ( control ). these data suggest that nh 4 cl could be used as part of a treatment to prevent age - related na , k - atpase down - regulation , and therefore part of a treatment for arhl in combination with ald , for the advantage of decreasing both effective dosages and reducing possible side effects . combining ald with ammonium chloride will increase the efficacy of ald through use of an fda - approved drug , with very few side effects when administered in moderate dosages . the effective ald dosage will be combined with several levels of ammonium chloride ( dose - response curve ), as determined from previous studies of the use of ammonium chloride in mice ( reisinger et al . 2009 ; hafner 2008 ; sato et al . 2011 ; nowik et al . 2010 ; lina et al . 1999 ; sinawat et al . 2003 ). specifically , mice will be fed a custom manufactured chow with 1 - 2 % nh 4 cl added to their normal diet ( 3028c , harlan teklad , indianapolis , ind .). once the optimal ammonium chloride dosage is determined , an additional experiment will be conducted for two dosages of ald , to determine any synergism between ald and ammonium chloride , i . e . if the effective amount of ald is reduced when administered in a combination with ammonium chloride , for reducing arhl . for the ald combinations that are effective , a combination using ibuprofen will be tested and the effects of a combination of ald with aspirin , ibuprofen or nh 4 cl treatments will compare the activity of nkcc1 , kc , cl − and na , k - atpase channels in the sv - k1 stria vascularis cell line , using bumetanide sensitive efflux 86 rb uptake , hplc determination of adp derived from an atp assay , and the fluxor potassium ion channel assay ( life technologies ) will be used to detect the activities of these channels , in addition to protein synthesis ( translation ) and mrna ( transcription ) levels . in the preceding specification , all documents , acts , or information disclosed does not constitute an admission that the document , act , or information of any combination thereof was publicly available , known to the public , part of the general knowledge in the art , or was known to be relevant to solve any problem at the time of priority . the disclosures of all publications cited above are expressly incorporated herein by reference , each in its entirety , to the same extent as if each were incorporated by reference individually . while there has been described and illustrated specific embodiments of compounds and methods of treating age - related hearing disorders , it will be apparent to those skilled in the art that variations and modifications are possible without deviating from the broad spirit and principle of the present invention . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween . | 0 |
fig1 is a schematic block diagram of a field programmable gate array ( fpga ) 1 and associated configuration data storage in the form of memory 4 . the fpga 1 comprises a functional portion 3 comprising a programmable gate array structure . the programmable gate array structure comprises , for example , an m × n array of configurable logic blocks ( clb &# 39 ; s )— not shown . the fpga 1 is connected to the configuration data memory 4 through a communication link 9 which at one end is connected to an output 7 of the configuration data memory 4 and at the other end to an input of the fpga 1 . the fpga 1 also includes configuration data decryption circuitry , in the form of logic 5 and memory 6 , for applying a decryption process to configuration data received through a communication link 10 extending between the input 8 and an input of the decryption circuitry . the decryption circuitry also includes an output for outputting decrypted configuration data to the functional portion 3 of the fpga through a communication link 11 so as to configure the functional portion . the memory 6 serves to store a decryption key and the logic 5 is configured to apply a decryption algorithm to configuration data using the decryption key as an operand of the algorithm . key data defining the operand is loadable from the memory 6 into the logic 5 through a communication link 16 . the decryption key storage 6 is formed of non - volatile elements based on eeprom technology , that is e 2 prom technology . alternatively , the non - volatile elements could be based on flash memory , fusible link prom , uv - eprom , otprom , ferroelectric cells , laser programmable fuses or any other suitable technology compatible with the technology used elsewhere in the fpga 1 . multiple combinations of technologies may also be used in a single fpga . the non - volatile decryption key storage 6 is loadable with the decryption key either at the manufacturing stage , or post - manufacture through decryption key input 13 which is shown with dashed lines in fig1 . the fpga 1 also includes a disabling element 14 , in the form of a fusible switch , the purpose of which is to bar external communication to the decryption key storage 6 from the decryption key input 13 after the disabling element 14 has been actuated . the disabling element 14 is responsive to a disabling signal applicable to the decryption key input 13 in that receipt of the disabling signal effects an irreversible change in the disabling switch leaving that switch permanently in the open state thereafter . with this design , the application designer can load the decryption key into the decryption key storage 6 , confirm that the decryption key has been successfully loaded and then issue a disabling signal to the input 13 of the decryption key storage 6 to actuate the disabling element 14 . the functional portion 3 of the fpga 1 is formed of volatile elements based on sram technology . the sram technology of the functional portion 3 of the fpga 1 is generally compatible with the eeprom technology used for the non - volatile decryption key storage 6 . alternatively , other technologies may also be used for the functional portion 3 which fulfill the requirement of compatibility with the technology used for the other fpga components , most especially the decryption key storage 6 . to further enhance security , the non - volatile elements of the decryption key memory 6 are physically dispersed among the volatile elements of the functional portion 3 of the fpga 1 . this procedure renders the physical chip layout less susceptible to reverse engineering . fig5 shows schematically a chip layout of parts of the fpga 1 , namely the functional portion 3 , the decryption key storage 6 and the decryption algorithm logic 5 . the non - volatile elements of the decryption key storage 6 are dispersed over the chip layout among the volatile elements of the functional portion 3 . a programmable logic device having a plurality of security bits dispersed over areas of configuration data memory blocks is described in u . s . pat . no . 5 , 349 , 249 to chiang et al the contents of which is incorporated herein by reference . to design the fpga based system , the application engineer will prepare the configuration data for programming the functional portion 3 of the fpga 1 in a conventional manner . the designer will then select an encryption key and enter that encryption key into an encryption algorithm available to the designer as a design tool . the designer will then apply the encryption algorithm using the encryption key he has specified to encrypt the configuration data . the encrypted configuration data will then be stored by the designer in the configuration data storage 4 which may be embodied in non - volatile memory or any suitable recording medium . the generic encryption algorithm will have an inverse function constituting the decryption algorithm embedded in the decryption algorithm logic 5 of the fpga 1 . the designer - specified encryption key will also have a corresponding decryption key , again linked by an inverse function , which may be the identity function , and this decryption key will be loaded into the decryption key storage 6 of the fpga 1 either directly by the designer or by the manufacturer at the behest of the designer , as described further above with reference to fig1 . fig2 shows in the form of a flow diagram the designer initiated configuration data encryption process . the method proceeds by inputting a configuration data set in step 20 and then applying to the configuration data set in step 21 an encryption algorithm 23 having as an operand the designer - specified encryption key 22 discussed further above with reference to fig1 . the encrypted configuration data set output from step 21 is then stored in step 24 on a recording medium , such as the configuration data storage 4 illustrated in fig1 or an intermediate storage medium . fig3 shows in the form of a schematic flow diagram the designer - initiated storage of the decryption key into the non - volatile decryption key storage 6 of the fpga 1 . the process proceeds by inputting the encryption key in step 30 , generating a decryption key from the encryption key in step 31 and writing the decryption key to the decryption key storage 6 of the fpga 1 in step 32 . fig4 shows in the form of a flow diagram a method of reconfiguring the fpga 1 of fig1 with encrypted configuration data from the configuration data storage 4 . reconfiguration is typically performed on power - up , but may also be performed on - the - fly in some designs . the encrypted configuration data is input into the fpga in step 40 and then decrypted in step 41 by applying a decryption algorithm 43 to the encrypted configuration data . the decryption algorithm 43 uses a decryption key 42 stored in the decryption key storage 6 of the fpga 1 . the decrypted configuration data is distributed in step 44 within the functional portion 3 of the fpga 1 , thereby to configure the fpga 1 . the decryption algorithm 43 embedded in the decryption algorithm logic 5 is stateful to further enhance security , but could be stateless in lower security systems . a stateful decryption algorithm may be realized in hardware using linear feedback shift register designs , for example . fig6 shows an alternative embodiment of the invention . like reference numerals are used for parts having a similar function to those of the embodiment of fig1 . as in the preceding embodiments there is shown an fpga 1 and associated configuration data memory 4 interconnected through a communication link 9 , output 7 and input 8 . the fpga 1 also includes key data memory 6 connected to a communication link 16 for providing the key data for decryption purposes . by contrast to the preceding embodiments , dedicated decryption circuitry is not provided , but rather the decryption function is subsumed in the functional portion 3 of the fpga and in a state machine 17 . the state machine 17 is configured to detect completion of decryption of a set of configuration data and , in response thereto , to generate an output on communication link 25 to the functional portion 3 of the fpga . the role of the state machine 17 will be more readily understood after the following discussion of the design of the functional portion 3 of the fpga . fig7 shows the modified design of a configurable logic block ( clb ) 27 and associated registers of the functional portion 3 in more detail . the functional portion 3 comprises a plurality of clb &# 39 ; s , for example an m × n two - dimensional array thereof , the clb &# 39 ; s being arranged to receive encrypted configuration data from the communication link 10 and key data from the communication link 16 . associated with the clb 27 of fig7 there is a set of configuration registers 18 . as in a conventional fpga design , the configuration register set 18 serves to hold configuration data which , when loaded into the clb 27 , configures the clb 27 according to that data . however , by contrast to conventional designs , there is also provided a set of holding registers 19 for each clb . referring to fig7 the holding register set 19 shown therein serves to hold a further set of configuration data . the holding register set 19 is connected to receive configuration data from an output of the clb 27 and to load configuration data stored therein into the configuration register set 18 . in fig7 the connection between the register sets 18 and 19 is shown as a parallel connection , but it could also be a serial connection . the holding register set 19 also has an input for receiving a trigger signal from the state machine through the state machine communication link 25 . furthermore , the configuration register set 18 has an input for receiving a global reset signal and is designed so that on receipt of a reset signal through this input it adopts a default state . the contents of the configuration register set 18 in the default state , when loaded into the clb 27 , causes the fpga to operate as a decryption engine so that encrypted configuration data received through the communication link 10 is decrypted according to the key data received through the communication link 16 , output from the clb 27 in decrypted form , and supplied to the holding register set 19 where it is stored . completion of the decryption process is detected by the state machine which , in response thereto , outputs a signal to communication link 25 , which when received by the holding register set 19 , causes the contents of the holding register set 19 , i . e . the decrypted configuration data , to be loaded into the main configuration register set 18 and then into the clb 27 which then changes state from its decryption engine state into the desired programmed state for conventional fpga operation . a programmable logic device having a configuration memory capable of storing two sets of configuration data is described in u . s . pat . no . 5 , 426 , 378 to randy t . ong , the contents of which are incorporated herein by reference . as will be appreciated , the embodiment of fig6 and 7 may be modified to include a decryption key input and disabling element as described further above with reference to fig1 . the alternative embodiment described above with reference to fig6 and 7 can be implemented with a reduced number of devices to provide the added functionality of decryption with a reduced chip area . this is achieved by designing the functional portion 3 of the fpga so that , as a default , it adopts a decryption configuration in which it operates as a decryption engine . in the light of the foregoing it will be appreciated that a field programmable gate array may be provided which comprises a functional portion having a configurable logical structure ; an input for receiving configuration data for configuring the functional portion ; and decryption means for applying a decryption process to the configuration data to generate decrypted configuration data for configuring the functional portion of the field programmable gate array . the decryption means may be made up of means for storing a decryption key and means for applying a decryption algorithm to the configuration data using the decryption key as an operand of the algorithm . in the conventional manner there may also be provided means for distributing the decrypted configuration data from the decryption means to the functional portion so as to configure the functional portion . it will be appreciated that although particular embodiments of the invention have been described , many modifications / additions and / or substitutions may be made within the spirit and scope of the present invention as defined in the appended claims . | 6 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.