text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the polymerized lactam component of the above polymers is formed from cyclic monomeric lactams of the formula ## str1 ## where y is an alkylene group having at least about three carbon atoms , preferably from about 3 to 12 or 14 , and more preferably from about 5 to about 11 carbon atoms . a preferred monomer is ε - caprolactam . lactam monomers in addition to ε - caprolactam include alpha - pyrrolidinone , piperidone , valerolactam , caprolactams other than the ε - isomer , capryllactam , lauryllactam and the like . in addition to lactams unsubstituted on their carbon chains , lactams having substituents on the carbon chain which do not inhibit or otherwise adversely affect the polymerization of the lactam are also included within the scope of the invention . during polymerization the cyclic lactam ring is opened to provide the following monomeric unit ## str2 ## which , together with other lactam molecules , produces a polymeric block of the formula ## str3 ## where x is an integer greater than one . the monomeric lactam unit can also react with the polyacyl alkoxide . similarly , a polylactam block , when joined with a polyacyl unit forms a polymer segment of the formula ## str4 ## where r is a hydrocarbon group described hereinbelow , a and a &# 39 ; are acyl groups , x is an integer greater than one , y is an integer equal to or greater than one , and b is an integer equal to zero or one . thirdly , in the course of the polymerization of the components described above , a polyol can react with the polymerizable lactam unit or block to produce a polymer segment of the formula ## str5 ## where x and n are integers equal to at least one and where z is a hydrocarbon , substituted hydrocarbon or acylated hydrocarbon group which , together with the oxygen atom attached thereto , forms a polyether or polyester segment of a polymer molecule . the z hydrocarbon , substituted hydrocarbon and acylated hydrocarbon groups can be of any size even polymeric such as polybutadiene , generally limited to about six carbon atoms , said groups being preferably alkylene , arylene , alkylene carbonyl , arylene carbonyl , and mixtures thereof . even more preferred are unsubstituted aliphatic groups such as methylene , ethylene , propylene , butylene and the like . other suitable z groups include phenylene , chlorophenylene , tolylene , isobutylene , isopropylene , ethylcarbonyl , propylcarbonyl , ethylsulfonyl , propylthiocarbonyl and the like . the preference indicated above for unsubstituted aliphatic z groups means that terpolymers of this invention which contain polyether segments are preferred over other embodiments which contain polyester segments . in preferred aspects of this invention , it is theorized that the lactam is present in the polymer in the form of polylactam blocks which are alternated with blocks of polyol and polyol segments to form the polymer . the polylactam blocks when present can be of any size but customarily have molecular weights of at least about 500 , preferably at least about 1000 . the polymerized polyol components of the polymers of this invention are formed from polyol intermediates having at least two hydroxy groups . available commercial polyols of this class are produced by reacting , for example , propylene oxide or ethylene oxide with glycols , glycerol , pentaerythritol , glucose , amines , and the like . included within the scope of the above class are a large number of suitable compounds ranging from the simple diols such as ethylene glycol to complex polymeric polyols such as poly ( ε - caprolactone ) diol . other polyol compounds include alkylene glycols such as diethylene glycol , triethylene glycol , tetraethylene glycol , tetramethylene glycol , propylene glycol , dipropylene glycol , hexylene glycol , 1 , 2 - propanediol , 1 , 3 - propanediol , 1 , 3 - hexanediol , 1 , 5 - pentanediol , butylene glycol , 1 , 4 - butanediol , dicyclopentadiene glycol , heptaethylene glycol and isopropylidene bis ( p - phenyleneoxypropanol - 2 ); diols other than alkylene glycols such as pyrocatechol , resorcinol , hydroquinone , hydroxyethyl acrylate and hydroxypropyl methacrylate ; polyols having more than two hydroxy functions such as glycerol , pentaerythritol , 1 , 2 , 6 - hexanetriol , 1 - trimethylol propane , pyrogallol and phloroglucinol ; polymeric polyols such as polyethylene glycols , polypropylene glycols , polyoxypropylene diols and triols , castor oils , polybutadiene glycols and polyester glycols , and a large number of compounds containing substituents other than hydroxy groups such as 2 , 4 - dichlorobutylene glycol and 2 , 2 &# 39 ;- 4 , 4 &# 39 ; bis ( chlorohydroxyphenyl ) ether . in addition to all the hydroxy compounds set forth above , the thio compounds analogous to the above compounds having sulfur atoms in place of oxygen are also included within the scope of the invention . a few examples include hydroxyethyl thioglycolate , ethylene glycol bis -( thioglycolate ), pentaerythritol tetrakis -( thioglycolate ) and thiodiglycol . if the polyol intermediate is a polymer , the molecular weight of the polyol can be any amount . commercially available polymeric polyol compounds have molecular weights from 200 to 5000 , but polymers with molecular weights outside that range are also useful in the practice of the instant invention . if the polyol intermediate or segment is a single molecule having at least two hydroxy groups such as ethylene glycol , a suitable polyol segment according to the invention would have a molecular weight of at least 62 . the third component of the terpolymers of this invention has the following structural configuration in the polymer chain : where r is a hydrocarbon group , a and a &# 39 ; are acyl radicals , y is an integer equal to at least one , and b is an integer equal to zero or one . the r group can be any hydrocarbon group having at least two valence bonds for attachment to the acyl groups shown in the above formula . examples include functional groups obtained by the removal of hydrogen atoms from methane , ethane , propane , hexane , dodecane , benzene , toluene , cyclohexane and the like . the polyvalent r group can be of any size but is preferably limited to about 20 carbon atoms , and more preferably about eight carbon atoms . if the integer &# 34 ; y &# 34 ; is one , the linkage will be a diacyl group . the a group can be any acyl group and preferably are ## str6 ## groups . most preferred among the above groups is the carbonyl group . values for the integer &# 34 ; y &# 34 ; have a direct relationship to the thermoplasticity of the terpolymer . if the integer &# 34 ; y &# 34 ; is greater than one , the linkage will be a higher polyacyl . the higher the value of &# 34 ; y &# 34 ;, the more highly crosslinked will be the finished polymer . values for &# 34 ; y &# 34 ; can be as high as six or eight , but more preferably do not exceed two or three . the polymerized product comprising the aforementioned components can have a number of different structures depending upon the process conditions and the relative proportions of ingredients used in the reaction system . polymers can be prepared having relatively small segments of lactam units joined to similarly short segments of polyol units through the polyacyl linkage described above . or large segments of one polymeric component can be combined with a larger number of comparatively small segments of another polymeric unit , which small segments are joined to one another through the polyacyl linkage as well as to the other type of polymeric component . or segments of varying sizes of both the lactam and the polyol polymeric units can be combined through the polyacyl components to form a highly random terpolymer . another form of polymer within the scope of this invention are block polymers , where moderately large size blocks or segments of the lactam and polyol polymeric units are positioned alternately in the polymer chain and joined through the polyacyl group described above . if the polyacyl linkages are , for purposes of simplification , considered to be a part of either a lactam or polyol block , then the block polymers of this invention can be discussed in terms of two alternating blocks designated as a and b blocks , instead of in terms of complicated patterns of three blocks designated as a , b and c blocks . block polymers prepared according to this invention can have three general structural configurations , ab , aba and a repeating pattern of ab segments . following a general characterization of a block copolymer prepared within the scope of this invention as ab , aba or repeating ab , it should be recognized that the exact structural configuration may vary somewhat from the general characterization of the polymer . as an illustration , one theoretical formula for a lactam - polyolpolyacyl lactam block terpolymer of the repeating ab type could be ## str7 ## where y , x , x &# 39 ;, x &# 34 ;, n and w are all integers equal to one or more ; b is an integer equal to zero or one ; r is a divalent or polyvalent hydrocarbon group ; ( o - z ) n is a polyol segment or a polymeric moiety and z is a hydrocarbon or substituted hydrocarbon group ; y is an alkylene group having at least three carbon atoms ; a and a &# 39 ; are acyl groups ; and r &# 39 ; is an aliphatic or substituted aliphatic hydrocarbon wherein the ester group is attached to other than an aromatic radical . if for instance y is a straight chained alkylene group , a and a &# 39 ; are carbonyl groups , z is ethylene , -- ch 2 ch 2 --, and r is phenylene , the terpolymer would be a caprolactam - ethylene glycol polymer where the caprolactam segments of the polymer are joined to one another and to the ethylene glycol segments through terephthaloyl linkages . other lactam - polyol polymers , both of the ab , aba as well as the repeating ab type , will become immediately apparent to those skilled in the art in view of this disclosure . it should therefore be noted that the above structural formula is set forth for illustrative purpose only , and is not intended as a limitation of the polymers within the scope of the invention . when the polymers of this invention are of the aba type , where one block of one type of polymer segment is located between two blocks of the other type of polymer segment , the polymers can be of either the polyol - lactam - polyol type or the lactam - polyol - lactam type . of the two types , the latter is a preferred type of aba polymer . if the lactam - polyol - polyacyl lactam polymer is a block polymer , the polyol blocks can , like the polylactam blocks , be of any size but customarily have molecular weights of at least about 500 , preferably at least about 1000 . the ratio of the number of lactam to polyol blocks can also vary . since the block polymers can be of either the type designated as ab , aba or repeating ab , the ratio of lactam blocks to polyol blocks can vary from 2 : 1 to 1 : 1 to 1 : 2 . mixtures of two or more block polymers having different ratios of the lactam and polyol blocks will produce ratios of polymer blocks intermediate between the above stated ratios . in the above theoretical formula for a lactam - polyol block terpolymer , the polyacyl linkage is represented as located between two lactam polymer segments as well as between a polyether segment and a lactam polymer segment . as a practical matter , the polyacyl linkages will also be located occasionally between two polyol blocks . it should be noted , moreover , that the polyacyl linkages need not invariably be positioned between lactam and polyol blocks since the necessary linkage can be provided in the form of an ester linkage by the oxygen atom of the polyether segment and the carbonyl group of a polylactam segment . following is a general characterization of the lactam polyolpolyacyl lactam terpolymer produced according to the invention . as an illustration , the lactam - polyol - polyacyl lactam or acyl polylactam terpolymer has the general formula : ## str8 ## wherein ( o - z ) n is a polyol segment or a polymeric moiety and z is a hydrocarbon or substituted hydrocarbon group said group being alkylene , arylene , alkylene carbonyl , arylene carbonyl , and mixtures thereof ; a and a &# 39 ; are acyl groups selected from ## str9 ## r is a polyvalent hydrocarbon group ; y is an alkylene or substituted alkylene having from about 3 to about 14 carbon atoms ; y is an integer equal to at least one , and b is an integer equal to zero or one ; x , x &# 39 ;, x &# 34 ;, and x &# 39 ;&# 34 ; are integers and the total number of x &# 39 ; s is equal to 2w + 2 ; and n and w are integers equal to one or more . as mentioned earlier , the terpolymers of this invention are characterized by the presence of both ester and amide linkages between the monomeric segments of the polymer . the term &# 34 ; monomeric segment &# 34 ; is intended to apply to the polymerized reaction product of a monomer , whether the reaction product is a single unit such as ## str10 ## or a block of several units such as ## str11 ## regarding the breadth of the terms &# 34 ; ester linkage &# 34 ; and &# 34 ; amide linkage &# 34 ;, the linkages can of course be composed of acyl groups other than carbonyl groups since the polyacyl linkage described above includes thiocarbonyl , sulfonyl , and phosphoryl groups as well as the more conventional carbonyl groups . the molecular weight of the terpolymers can vary widely from a number average molecular weight of just a few thousand to 1 million or higher . for thermoplastic uncrosslinked polymers , a preferred range for number average molecular weight is from about 10 or 20 , 000 to about 100 , 000 to 200 , 000 . if the polymers are crosslinked , the molecular weights of the polymers can be much higher in the range of 100 , 000 to several million . when block polymers are formed , the molecular weight of the polyol blocks is an important consideration in selecting preferred polymers within the scope of this invention . polyol blocks having a number average molecular weight of about 500 or 600 or more generally tend to have good low temperature properties . this lower level of molecular weight for the polyol blocks is subject to some variation insofar as low temperature properties can also be affected by the degree of block polymerization , the nature of the block polymer , i . e . ab , aba or repeating ab , the ratio of the lactam content to the polyol content , and the particular lactam and polyol present in the polymer . polyol segments having a molecular weight of at least 62 can also constitute a portion of the terpolymer as well as the polyol blocks having molecular weights of 500 to 600 or greater . for example , ethylene glycol as the polyol segment provides a terpolymer having improved tensile elongation and impact resistance . regarding a maximum molecular weight of the polyol blocks , preferred polymers have polyol blocks with a maximum number average molecular weight of about 6000 , and more preferably about 4000 . above these levels the polyol prepolymer tends to exhibit a reduced hydroxyl functionality , due to unsaturation , thereby making more difficult the incorporation of polyol into the polymer . in addition to the three principal monomeric constituents which together produce the terpolymers of this invention , other polymerizable monomers can also be used to prepare polymers having four or more polymerizable constituents . as an example , if the polyol constituent of a terpolymer of this invention is polybutadiene diol , the resultant terpolymer could be , after the lactam - polyol - polyacyl lactam polymerization , subsequently reacted with a vinyl compound such as styrene to crosslink the polymer through its vinyl unsaturation . still other monomers could be chosen which could be polymerized directly into a linear polymer chain . the quantity of such additional monomers could be very large , even as great as 50 % or more of the total polymerizable constituents but preferably is limited to quantities of 25 % or less of the total monomer content . the polymers prepared according to this invention exhibit a broad range of properties which can be adjusted to provide compositions particularly well adapted for a specified end use . in addition to crosslinking , adjustment of polymer structure , and molecular weight adjustment of polymer blocks , other means of varying the properties of the polymers can also be employed . crystallinity of the polymers , which can be present in the lactam segments of the polymers , can be increased or decreased by variation of polymerization temperatures . since any crystallinity in the polymers of this invention is largely present in the lactam segments of the polymer , variation of the lactam content of the polymer can also result in a variation of polymer crystallinity . polymers with relatively high degrees of crystallinity tend to be strong , rigid polymers whereas those with little or no crystallinity are more elastomeric in nature . as mentioned earlier , the type of lactam , polyol and polyacyl lactam components can also affect the properties of the finished polymer . as an example , polyethylene glycol polymer segments tend to produce polymers with a high water absorptivity whereas polypropylene glycol or polytetramethylene glycol polymer segments produce polymers with comparatively low water absorptivities . as another example , caprolactam polymer segments in the polymers of this invention produce polymers which are stronger and more rigid than homologous polymers containing segments of a higher lactam such as capryllactam or dodecanolactam . even more significantly , use of a lactam will yield an essentially linear polymer whereas use of a tris or tetrakislactam will result in a branched or crosslinked terpolymer . similarly bis - lactams can be employed to produce a branched or crosslinked polymer . high crosslinked polymer can be made through the use of polyols having more than two hydroxy groups . with all the foregoing techniques available for modifying and adjusting the properties of the polymers of this invention , it can be appreciated that the polymers can be used in a number of end use applications . one such use is a textile fiber . throughout the entire range of ratios of polymeric components , from polymers containing very little polyether component to those containing a large amount , the polymers have properties which make them useful as textile fibers . in addition to being the sole constitutent of a textile fiber , the terpolymers can also be used as one component in a composite or conjugate fiber . it is contemplated that conjugate fibers of nylon and the terpolymers of this invention will be particularly useful in a number of textile and other applications . other textile applications for the terpolymers include their use in the manufacture of non - woven fabrics and as high moisture regain fibers . the terpolymers can also be manufactured into foamed articles , either during or after their polymerization , to produce rigid and flexible foams . because of their method of preparation directly from the monomeric components , the polymers can be prepared in large shapes such as furniture and furniture components and automobile parts . the terpolymers can also be produced in the form of molding resins which can subsequently be molded by injection molding , extruding , thermoforming or other techniques to produce products of virtually any shape . the more highly elastomeric compositions can be used in manufacture of automobile tires and tire components . the polymers can also be modified with fillers , fibers , pigments , dyes , stabilizers , plasticizers , flame retardant and other polymeric modifiers to alter their properties and thereby enlarge even further the scope of their applicability . one such modification comprises reinforcing the polymers with fillers or fibers which have been treated with coupling agents capable of increasing the bonding of the fillers or fibers to the polymer molecules . a large number of organosilane compounds have been found to be especially capable of performing this task of improving adhesion between polymer and filler or fiber . examples of some suitable organosilane couplers for use with the polymers of this invention include 3 - aminopropyl triethoxysilane , glycidoxypropyl trimethoxysilane and n - trimethoxysilylpropyl - n - beta - amino - ethyl - amine . preferred fillers and fibers include quartz , wollastonite , feldspar , calcined kaolin clay , glass fibers and other high performance fibers such as graphite , boron , steel and the like . the concentrations of fillers and fibers can vary from very small amounts such as one or two volume percent up to 70 or 80 volume percent or more . the terpolymers are prepared by either initiating the anionic catalyzed polymerization of lactam with a polyether - polyester prepolymer initiator , or the formation of the initiator from dicarboxylic acid esters and aliphatic polyols or aliphatic polyether polyols in the presence of lactam as a reaction solvent , followed by the anionic catalyzed polymerization of the lactam . as an illustration , one theoretical formula for the terpolymer is presented as a result of the following formulation schematic of a typical process according to the invention . ## str12 ## where x and b are integers equal to at least one ; z is a hydrocarbon , substituted hydrocarbon or acylated hydrocarbon group ; y is an alkylene group having at least about three carbon atoms , preferably from about 3 to 12 or 14 carbon atoms ; and r is a divalent hydrocarbon ; and n is an integer equal to one or more . the foregoing illustration represents only one typical formulated schematic of the inventive process and terpolymer produced thereby , and should not be construed as the only process and / or terpolymer afforded by this invention . the polyether - polyester prepolymer initiators result from the transesterification of aliphatic polyols and / or aliphatic polyether polyols and dicarboxylic acid esters . the dicarboxylic acid esters or dialkyl esters useful in the prepolymer formation have the general formula : ## str13 ## wherein r &# 39 ; is an alkyl such as methyl , ethyl , propyl , isopropyl , butyl , isobutyl , 2 - ethyl hexyl and the like , alkenyls , aryls and mixtures thereof ; d is an integer ; and when the radical ## spc1 ## and the like . specific dialkyl esters according to the above formula include , for example , dialkylaryloates such as dimethyl terephthalate and dimethyl isophthalate ; and dialkylalkanoates such as diethyl sebacate , dibutyl adipate , diethyloxalate and the like . the catalysts used as catalyst i in the foregoing illustration of a typical formulated schematic of the inventive process are transesterification prepolymer catalyst , for example alkali metals and alkaline earth metals , zinc , cadmium , manganese , iron , nickel , cobalt , tin , lanthanum , lead or bismuth or combinations thereof , salts such as calcium , manganese , cobalt or zinc acetate , lithium hydride , sodium alcoholates , zinc succinate or zinc acetyl acetonate , oxides such as lead oxide ( pbo ), antimony oxide ( sb 2 o 3 ), or germanium oxide ( geo 2 ), magnesium methoxide , and combinations such as antimony trioxide / manganese acetate or antimony trioxide / titanium dioxide . other suitable catalyst include caprolactam magnesium bromide , and selected grignard agents , for example , ethyl magnesium bromide . catalyst i is used in quantities of from about 0 . 005 to about 0 . 2 % by weight , preferably about 0 . 01 to about 0 . 10 % by weight based on the quantity of dicarboxylic acid ester . polymerization temperatures can vary from the melting point of the lactam or less up to the melting point of the resultant polymer or more . depending upon the particular ingredients being used , this can encompass a range from 70 ° to 230 ° c or more . preferred polymerization temperatures are from about 90 ° to about 190 ° c and more preferably from about 120 ° to about 180 ° c for caprolactam terpolymers . such a technique produces desired polymerization of a terpolymer having high strength and modulus . times required for complete polymerization will vary considerably depending upon polymerization temperatures and the specific ingredients used in the polymerization system . polymerization time varies from at least about one minute , preferably from 1 to 30 minutes , and can be extended to any duration up to several days or more . generally , polymerization times of from 1 to 30 minutes are preferred for most polymerization systems . the lactam monomer , dicarboxylic acid ester and polyol used in the polymerization have both been described in ample detail above . the lactam polymerization catalyst ( catalyst ii ) useful herein includes that class of compounds commonly recognized as suitable basic catalysts for the anhydrous polymerization of lactams . in general , all alkali or alkaline earth metals are effective catalysts either in the metallic form or in the form of hydrides , halohydrides , alkylhalides , oxides , hydroxides , carbonates and the like . also useful are a number of organometallic compounds of the metals mentioned above such as metal alkyls , metal phenyls , metal amides and the like . examples include sodium hydride , potassium hydroxide , lithium oxide , ethyl magnesium bromide , calcium fluorohydride , strontium carbonate , barium hydroxide , methyl sodium buthyl lithium , potassium phenyl , diphenyl barium , sodium amide and magnesium diethyl . all of the foregoing compounds react with the lactam monomer to form the metal lactam , which is the active catalytic agent in the lactam polymerization mechanism . the metal lactam catalyst can therefore be formed in situ by reaction of one of the foregoing metals or metal compounds with lactam monomer in the polymerization medium or by prior reaction of the metal or metal compound with a stoichiometric quantity of lactam monomer . examples of metal lactam catalysts include sodium caprolactam , bromomagnesium caprolactam , magnesium caprolactam , bromomagnesium pyrrolidinone , chlorocalcium caprolactam and the like . catalyst concentrations can range from a fraction of one mole percent to 15 or 20 or more mole percent of the lactam monomer to be polymerized . the polyacyl linkage , as well as the ester and amide linkages , are incorporated into the polymer chain through the reaction of the polyacyl alkoxide with the lactam and polyol constituents . in the formula set forth above for the polyacyl alkoxide useful herein , the r group can be any hydrocarbon group having the necessary number of available valences to bond to itself all of the acyl groups included in the compound . the hydrocarbon group can be of any size but preferably contains a maximum of eight or ten carbon atoms . examples of suitable r groups include phenylene , biphenylene , methylene , hexylene , tolylene , and analogous hydrocarbons having more than two sites available for bonding to acyl groups . the amount of polyacyl alkoxide useful in the preparation of the terpolymers of this invention depends upon the quantities of lactam and polyol being used . for preferred polymerizations , it is desirable that the polyacyl alkoxide be present in an amount from 100 to about 500 , preferably from about 100 to about 200 , equivalent percent of the polyol . if the polyacyl alkoxide is present in an amount less than a molecularly equivalent amount based on the polyol , polyol prepolymer formation occurs , but the subsequent lactam polymerization is very slow . in those preferred polymerization systems where the polyacyl alkoxide concentration exceeds the amount stoichiometrically equivalent to the polyol , the excess can be from 0 . 01 to about 30 or more mole percent of the lactam monomer . a preferred range is from about 0 . 1 to about 10 mole percent of the lactam monomer , and more preferably from about 0 . 2 to about 5 mole percent of the lactam monomer . the lactam and polyol can be present in any relative proportions ranging up to 99 parts of either component to 1 part of the other . preferred ratios of the two polymer - forming materials depend upon the end use to which the finished polymer is to be put . for end use applications requiring strong rigid materials , the lactam content of the polymerizable medium should be relatively high such as 60 or 80 or even 90 % or more lactam . for other applications where elastomeric properties such as high elongation or where water absorption is desirable , the relative proportions of the two monomers can be reversed so that the polymerizable medium will contain 60 or 80 or 90 % or more of the polyol compound . where water absorption is desired , polyethylene glycol can be used as the major polyol compound . polymers containing about equal quantities of both lactam and polyol are preferred for a great many uses because of the advantageous combination of properties achieved by such polymers . three terpolymers were prepared using the quantities of ingredients listed in table 1 . in each of the processes listed , the polymeric polyol was heated under vacuum at 125 °- 180 ° for 30 minutes to dry . the transesterification prepolymer catalyst and dmt were added and the mixture stirred under a nitrogen atmosphere at 200 ° c . intermittently a slight stream of nitrogen was allowed to pass through the reactor to remove evolved methanol . after 40 minutes reaction time the mixture was evacuated for 5 - 10 minutes . to the resulting prepolymer was added caprolactam and santowhite powder . the temperature of the resulting prepolymer - caprolactam solution was adjusted to 160 ° c and grignard reagent added . the mixture was evacuated for 2 - 3 minutes to remove ether and ethane . the vacuum was released to nitrogen and the catalyzed prepolymer solution poured into a vertical mold of 10 inches × 10 inches × 1 / 8 inch dimensions which had been heated to 160 ° c . after an hour the mold was opened and the sample removed . tensile properties of the resulting terpolymers are reported in table 2 . table 1__________________________________________________________________________ prepolymer catalyst glycol used dmt . sup . 4 caprolactam swp . sup . 5 grignard . sup . 6process type amount compound gms gms gms . gms . ml . __________________________________________________________________________a magnesium acetate . sup . 1 0 . 4 ml polymeg . sup . 3 2000 117 15 . 5 273 2 5 tetraisopropyl orthotitanate . sup . 2 0 . 08 mlb tetrabutyl orthotitanate 0 . 063 ml carbowax . sup . 7 4000 90 7 . 0 205 1 . 5 5c zinc acetate 0 . 2 gm &# 34 ; &# 34 ; 90 7 . 7 205 1 . 5 5__________________________________________________________________________ . sup . 1 0 . 1 molar in methanol . sup . 2 0 . 8 molar in 2 . propanol . sup . 3 polytetramethylene glycol . sup . 4 dimethyl terephthalate . sup . 5 santowhite powder . sup . 6 ethyl magnesium bromide 3 molar in diethyl ether . sup . 7 polyethylene glycol table 2______________________________________ tensile fail tensile strength % modulusterpolymer psi elongation psi______________________________________a - 30 % ptmg 6530 720 47 , 000b - 30 % peg 7000 520 57 , 000c - 30 % peg 6800 550 101 , 000______________________________________ five polyethylene glycol terpolymers were prepared from polyester prepolymers formed in caprolactam solution . the quantities of ingredients and the various transesterification catalysts used are listed in table 3 . in each of the processes listed , the polymeric glycol , caprolactam and santowhite powder were heated under vacuum to distil 25 ml . caprolactam . ( in process f and g , cadmium acetate dihydrate and zinc acetate dihydrate were added prior to caprolactam distillation . in the remaining processes , the transesterification catalyst was added after caprolactam distillation .) after the initial distillation of caprolactam , a reflux condenser was attached to the reaction flask and a vacuum take off with a dry ice cooled receiver attached to the condenser outlet . the dmt and transesterification catalyst were added and the reactor evacuated to reflux caprolactam at a temperature of 110 °- 140 ° c . progress of the reaction was followed by measurement of evolved methanol . after methanol evolution had ceased , the temperature of the reaction mixture was adjusted to 130 ° c and 5 ml . grignard reagent catalyst added . the reaction flask was evacuated for 2 minutes to remove ether and ethane and the vacuum released to nitrogen atmosphere . the catalyzed mixture was poured into a 160 ° c mold described in example 1 . after 1 hr the mold was opened and the sample removed . tensile properties of the resulting terpolymer are reported in table 4 . table 3______________________________________ reactants carbowax . sup . 1 4000 - 90 gms caprolactam 229 gms santowhite powder 1 . 5 gms dmt . sup . 2 7 . 7 gmsii transesterification catalystterpolymer d grignard . sup . 3 0 . 6 mlterpolymer e aluminum iso - propoxide 0 . 2 gmterpolymer f cadmium acetate 0 . 26 gm &# 34 ; g zinc acetate 0 . 22 gm &# 34 ; h magnesium methoxide . sup . 4 0 . 9 mliii copolymerization catalyst - grignard . sup . 3 5 ml . ______________________________________ . sup . 1 polyethylene glycol . sup . 2 dimethyl terephthalate . sup . 3 ethyl magnesium bromide - 3 molar in diethyl ether . . sup . 4 1 molar in methanol table 4______________________________________tensile yield tensile fail tensileter - strength % elon - strength % moduluspolymer psi gation psi elongation psi______________________________________d 6200 507 84 , 000e 3700 15 5900 470 62 , 400f 3700 25 6200 497 68 , 000g 3800 20 6100 477 78 , 000h 3700 25 6500 518 91 , 500______________________________________ several terpolymers were prepared employing different types and quantities of glycols . the terpolymers were prepared using the quantities of ingredients listed in table 5 . the transesterification reaction and copolymerization with caprolactam were run according to procedures described in example 2 . tensile properties of the resulting terpolymers are reported in table 6 . table 5__________________________________________________________________________glycol used prepolymer % in catalyst gms gms gms caprolactam stabilizer ml . process material copolymer material amount glycol dmt . sup . 1 charge distilled material gms grignard . sup . 2__________________________________________________________________________i polymeg . sup . 3 2000 30 grignard . sup . 2 0 . 6 ml 90 10 . 2 227 25 swp . sup . 4 1 . 5j polymeg . sup . 3 2000 50 mg ( och . sub . 3 ). sub . 2 . sup . 5 1 ml 150 16 . 0 164 25 flectol - h 1 . 5 4 . 5k polymeg 1000 30 grignard 0 . 6 ml 90 19 . 6 221 25 swp 1 . 5 5 . 0l polymeg 1000 40 grignard 0 . 6 ml 120 24 . 5 188 25 swp 1 . 5 5 . 0m polymeg 650 30 grignard 0 . 6 ml 90 28 . 0 216 25 swp 1 . 5 5 . 0n polymeg 650 40 grignard 0 . 6 ml 120 36 . 8 155 25 swp 1 . 5 5 . 0o polymeg 1000 21 62 . 5 butane diol 6 grignard 0 . 6 ml 17 . 1 50 . 2 196 . 3 25 swp 1 . 5 5 . 0p polyglycol . sup . 6 e - 6000 50 mg ( och . sub . 3 ). sub . 2 1 ml 150 5 . 0 171 25 flectol - h 1 . 5 5 . 0q polyglycol e - 1450 50 zinc acetate 5 gm . 1500 220 . 2 1446 100 flectol - h 1 . 5 35r niax pcp - 0240 . sup . 7 30 mg ( och . sub . 3 ). sub . 2 1 ml 90 10 . 8 227 25 flectol - h 1 . 5 5 . 0s niax pcp - 0240 . sup . 7 40 mg ( och . sub . 3 ). sub . 2 1 ml 120 13 . 7 195 25 flectol - h 1 . 5 5 . 0t polymeg 2000 30 mg ( och . sub . 3 ). sub . 2 900 niax pcp 0240 5 mg ( och . sub . 3 ). sub . 2 11 ml 150 109 . 6 1975 100 dnpd . sup . 8 6 50u polymeg 2000 30 mg ( och . sub . 3 ). sub . 2 900 niax pcp 0240 10 13 ml 300 124 . 3 1814 100 dnpd . sup . 8 6 50v polymeg 2000 30 mg ( och . sub . 3 ). sub . 2 900 niax pcp 0240 15 mg ( och . sub . 3 ). sub . 2 14 ml 450 139 . 0 1655 100 dnpd 6 50w voranol 2000 . sup . 9 30 grignard 0 . 6 ml 90 7 . 7 229 25 swp 1 . 5 5 . 0x voranol 2000 . sup . 9 50 mg ( och . sub . 3 ). sub . 2 0 . 9 ml 150 15 . 3 164 25 swp 1 . 5 5 . 0__________________________________________________________________________ . sup . 1 dimethyl terephthalate . sup . 2 ethyl magnesium bromide - 3 molar in diethyl ether . sup . 3 polytetramethylene glycol . sup . 4 santowhite powder . sup . 5 magnesium methoxide - 1 molar in methanol . sup . 6 polyethylene glycol . sup . 7 polycaprolactone diol . sup . 8 n , n &# 39 ;- dl - 2 - naphthyl - p - phenylene diamine . sup . 9 polypropylene glycol table 6__________________________________________________________________________ tensile yield tensile fail tensileterpolymer strength % strength % modulusprocesscomposition psi elongation psi elongation psi__________________________________________________________________________i 30 % ptmg 2000 4600 50 6870 533 89 , 400j 50 % ptmg 2000 4850 773 26 , 000k 30 % ptmg 1000 4700 60 5980 533 82 , 800l 40 % ptmg 1000 5190 776 25 , 700m 30 % ptmg 650 5850 685 38 , 300n 40 % ptmg 650 3100 754 15 , 400o 21 % ptmg 1000 2720 156 6 , 5006 % butane diolp 50 % peg 6000 3260 14 4400 588 61 , 000q 50 % peg 1450 2270 * 250 * r 30 % polycaprolactone 2700 29 7100 715 40 , 000s 40 % polycaprolactone 2300 60 4000 650 27 , 200t 30 % ptmg 2000 6900 * 470 * 5 % polycaprolactoneu 30 % ptmg 2000 5200 * 473 * 10 % polycaprolactonev 30 % ptmg 2000 5000 * 530 * 15 % polycaprolactonew 30 % ppg 4790 340 82 , 800x 50 % ppg 3190 482 28 , 800__________________________________________________________________________ * tensile data for extruded strand two terpolymers were prepared from polyester synthesized from an aliphatic dibasic ester using the quantities of ingredients specified in the following table : table 7______________________________________terpolymer process y z______________________________________glycol used polymeg . sup . 1 2000 polymeg . sup . 1 1000reactantsgms . glycol 90 90gms . santowhite powder 1 . 5 1 . 5gms . caprolactam charged 225 218gms . caprolactam distilled 25 25gms . diethyl sebacate 13 . 2 24 . 5ml . mg ( och . sub . 3 ). sub . 2 . sup . 2 0 . 9 1 . 0ml . grignard . sup . 3 5 . 0 5 . 0______________________________________ . sup . 1 polytetramethylene glycol . sup . 2 1 molar in methanol . sup . 3 ethyl magnesium bromide -- 3 molar in diethyl ether . the terpolymers were prepared according to the procedure described in example 2 . tensile properties of the terpolymers are reported in the following table : table 8______________________________________ tensile fail tensileterpolymer strength % modulusprocess composition psi elongation psi______________________________________y 30 % ptmg 2000 7200 575 81 , 400z 30 % ptmg 1000 5600 516 62 , 800______________________________________ the following example 5 is a calculated example of a predictable cross - linked terpolymer which could be prepared by the inventive process . a crosslinked terpolymer is prepared using the quantities of ingredients listed in table 9 . table 9______________________________________material amount______________________________________polymeg . sup . 1 2000 90 gm . caprolactam 214 gm . santowhite powder 1 . 5 gm . dimethyl terephthalate 6 . 9 gm . mg ( och . sub . 3 ). sub . 2 . sup . 2 1 ml . trimesoyl tris - caprolactam 3 . 2 gm . bmc . sup . 3 23 ml . ______________________________________ . sup . 1 polytetramethylene glycol . sup . 2 1 molar in methanol . sup . 3 bromo magnesium caprolactam -- 0 . 4 molar in caprolactam the caprolactam , polymeg 2000 , and santowhite poweder are heated under vacuum to distil 25 gms . caprolactam in order to dry the mixture . a reflux condenser is attached to the reactor with a dry ice - cooled receiver attached to the condenser outlet . dimethyl terephthalate and mg ( och 3 ) 2 added to the mixture and the reactor evacuated to reflux caprolactam . progress of the transesterification reaction is followed by measurement of evolved methanol condensed in the dry ice - cooled receiver . when methanol evolution has stopped , the reactor vacuum is released to nitrogen and 0 . 5 ml water added to destroy the magnesium methoxide catalyst . the reflux is replaced with a distilling head and the mixture re - evacuated to distil 10 ml . caprolactam to re - dry . trimesoyl tris - caprolactam is added and dissolved , and the mixture cooled to 100 ° c . the mixture is cast into a vertical mold ( described in example 1 ) which has been heated to 100 ° c . the mixture is cast by means of a metering pump . the bmc catalyst is injected into the stream by means of a second metering pump and the streams mixed by a kenics static mixer . after casting is complete , the mold is heated to 160 ° c over a 15 minute period and held at 160 ° c for an additional 45 minutes , after which the mold is opened and the sample removed . | 2 |
in the following , embodiments of the present invention will be described with reference to the accompanying drawings . fig1 is a block diagram showing an example of a communication apparatus in which a power supply ic according to a first embodiment of the invention is used . in fig1 , a cellular phone is shown as an example of a communication apparatus . in fig1 , a communication apparatus 1 includes a power supply circuit unit 2 having a plurality of power supply circuits , an audio circuit unit 3 , a rf circuit unit 4 comprised - of transceiver circuits and the like , a cpu logic circuit unit 5 for controlling the power supply circuit unit 2 , the audio circuit unit 3 , and the rf circuit unit 4 , a display unit 6 , an antenna 7 , an operation unit 8 comprised of operation buttons , a speaker 9 , a microphone 10 , and a battery 11 . the power supply circuit unit 2 , the audio circuit unit 3 , the rf circuit unit 4 , and the cpu logic circuit unit 5 are molded on a single substrate , creating a single module 12 . the power supply circuit unit 2 generates a predetermined constant voltage from the power supplied from the battery 11 , and supplies power to the audio circuit unit 3 , the rf circuit unit 4 , and the cpu logic circuit unit 5 . the cpu logic circuit unit 5 responds to instruction from the operation unit 8 by controlling the operations of the power supply circuit unit 2 , the audio circuit unit 3 , the rf circuit unit 4 , and the display unit 6 . the rf circuit unit 4 transmits and receives signals through the antenna 7 . the audio circuit unit 3 receives signals from the microphone 10 , and outputs signals to the speaker 9 . fig2 is a block diagram showing an example of the construction of the power supply circuit unit 2 shown in fig1 . fig2 illustrates an example in which one switching regulator and three series regulators are provided . in fig2 , the power supply circuit unit 2 includes a switching regulator 21 , series regulators sr 1 - sr 3 , a charge control circuit 22 for controlling the charging of the battery 11 , and an sim card interface circuit 23 for providing an interface between an sim card 27 and the cpu logic circuit unit 5 . the power supply circuit unit 2 further includes a power - on logic circuit 24 , which controls the operations of the switching regulator 21 , the series regulators sr 1 - sr 3 , the charge control circuit 22 , and the sim card interface circuit 23 in response to a positive power supply voltage vbat supplied from the battery 11 . the power supply circuit unit 2 is integrated as a single ic , except for few components which cannot be integrated . this ic serves as a power supply ic . the switching regulator 21 , the series regulators sr 1 - sr 3 , and the sim card interface circuit 23 receives power from the battery 11 . the power - on logic circuit 24 monitors a positive power supply voltage vbat of the battery 11 . the charge control circuit 22 receives a dc voltage from an ac / dc adapter 28 , and controls the charging of the battery 11 using the dc voltage . the power - on logic circuit 24 instructs the charge control circuit 22 to suppress the charging of the battery 11 if the positive power supply voltage vbat of the battery 11 exceeds a predetermined level . the switching regulator 21 supplies power to the cpu logic circuit unit 5 . the series regulators sr 1 and sr 2 supply power to the rf circuit unit 4 . the series regulator sr 3 supplies power to the audio circuit unit 3 . the series regulators sr 1 and sr 2 are controlled by the cpu logic circuit unit 5 as to their enable status . fig3 is a circuit diagram showing an example of the switching regulator 21 . fig3 shows an example in which the switching regulator 21 is provided as a dc - dc converter of the synchronous detection type . the switching regulator 21 in fig3 includes a p - channel - type mos transistor ( hereinafter referred to as a pmos transistor ) 31 serving as a driver transistor for switching , an n - channel - type mos transistor ( hereinafter referred to as an nmos transistor ) 32 serving as a driver transistor for switching , and a smoothing circuit unit 33 which smoothes the output of the pmos transistor 31 and the nmos transistor 32 for outputting . the switching regulator 21 further includes a reference voltage generating circuit unit 34 for generating and outputting a predetermined reference voltage vr , a potential dividing circuit unit 35 for dividing a potential vo output from the smoothing circuit unit 33 to generate and output a divided potential vd , an error amplifier 36 for amplifying an error of the divided potential vd with respect to the reference voltage vr and for outputting the amplified error , and a control circuit unit 37 for the switching control of the pmos transistor 31 and the nmos transistor 32 in response to the output of the error amplifier 36 . a pad vin is coupled to the positive power supply voltage vbat of the battery 11 , and a pad gndp is coupled to a negative power supply voltage gnd of the battery 11 . between the pad vin and the pad gndp , the pmos transistor 31 and the nmos transistor 32 are connected in series , with the gate of the pmos transistor 31 and the gate of the nmos transistor 32 being coupled to the control circuit unit 3 , respectively . the junction of the pmos transistor 31 and the nmos transistor 32 is connected to a pad lx . between the pad lx and the negative power supply voltage gnd , a coil l and a capacitor c are connected in series , together forming the smoothing circuit unit 33 . the junction of the coil l and capacitor c serves as an output terminal of the switching regulator 21 , outputting a predetermined voltage vo . the output voltage vo is input into the potential dividing circuit unit 35 through a pad out for potential division by the potential dividing circuit unit 35 . the divided potential vd is supplied to one of the input ends of the error amplifier 36 . the potential dividing circuit unit 35 includes a series connection of resistors r 1 and r 2 . this series connection is situated between the pad out coupled to the output voltage vo and a pad gnda coupled to the negative power supply voltage gnd . a junction of the resistors r 1 and r 2 is connected to one of the input ends of the error amplifier 36 for the provision of the divided potential vd . the other input end of the error amplifier 36 receives the reference voltage vr , and the output end of the error amplifier 36 is connected to the control circuit unit 37 . the output voltage vo is divided by the potential dividing circuit unit 35 , and the error amplifier 36 amplifies a difference between the divided potential vd and the reference voltage vr . the control circuit unit 37 is equipped with an oscillator ( not shown ) for generating a saw - tooth pulse signal , for example , and a comparator ( not shown ). the comparator compares the output signal of the oscillator with the output signal of the error amplifier 36 . the comparator controls the on time of the pmos transistor 31 and the nmos transistor 32 in response to the comparison . in so doing , the control circuit unit 37 alternately switches on the pmos transistor 31 and the nmos . transistor 32 , without switching on both at the same time . the signal output from the junction of the pmos transistor 31 and the nmos transistor 32 is smoothed by the smoothing circuit unit 33 comprised of the coil l and the capacitor c for output as the output voltage vo . fig4 is a circuit diagram showing an example of the series regulators sr 1 - sr 3 . the series regulators sr 1 - sr 3 all have the same circuit construction . in fig4 , a series regulator srm ( m = 1 - 3 ) is taken as an example for the illustration purpose . the series regulator srm in fig4 includes a reference voltage generating circuit unit rem for generating and outputting a predetermined reference voltage vrm , a potential dividing circuit unit dem , an error amplifier ampm , and a pmos transistor pm that serves as a driver transistor to provide a pad outm with an electric current responsive to a potential input into the gate from the error amplifier ampm . the pmos transistor pm is situated between a pad vddm coupled to the positive power supply voltage vbat and a pad outm . a drain voltage of the pmos transistor pm is provided as an output voltage vom . resistors ram and rbm , which together constitute the potential dividing circuit unit dem , are connected in series between the pad outm and a pad gnds coupled to the negative power supply voltage gnd . the divided potential vdm is output from the junction of the resistors ram and rbm , and is input into the inverted input of the error amplifier ampm . the non - inverted input of the error amplifier ampm receives the reference voltage vrm , and the output of the error amplifier ampm is connected to the gate of the pmos transistor pm . further , the error amplifier ampm receives an enable signal sem from the cpu logic circuit unit 5 . when the enable signal sem is asserted , the error amplifier ampm stops operation , so that the pmos transistor pm becomes non - conductive , thereby stopping the supply of the output voltage vom . the output voltage vom is divided by the potential dividing circuit unit dem . the error amplifier ampm amplifies a difference between the divided potential vdm and the reference voltage vrm , and supplies its output to the gate of the pmos transistor pm . in this manner , the error amplifier ampm controls the operation of the pmos transistor pm such as to keep the output voltage vom at a desired voltage level . fig5 is a schematic diagram showing the power supply ic that corresponds to the power supply circuit unit 2 of fig2 . fig5 illustrates an example of arrangement of the switching regulator 21 and the series regulators sr 1 - sr 3 on an ic chip . a pad to which the enable signal sem is supplied is omitted from illustration of fig5 . in fig5 , the pmos transistor 31 ( pmostr ) and the nmos transistor 32 ( nmostr ) of the switching regulator 21 are arranged near an edge 41 of a rectangular ic chip 40 . the pmos transistors p 1 - p 3 of the respective series regulators sr 1 - sr 3 are arranged near an edge 42 opposite the edge 41 of the ic chip 40 . moreover , the switching regulator 21 and the series regulators sr 1 - sr 3 are situated near a diagonal line of the ic chip 40 ( i . e ., situated near the opposite corners of the ic chip 40 ). moreover , the reference voltage generating circuit unit 34 , the potential dividing circuit unit 35 , the error amplifier 36 , and the control circuit unit 37 of the switching regulator 21 are provided at the position of a controller 43 shown in fig5 , which is close to the pmos transistor 31 and the nmos transistor 32 . likewise , the reference voltage generating circuit units re 1 - re 3 , the potential dividing circuit units de 1 - de 3 , and the error amplifiers amp 1 - amp 3 of the respective series regulators sr 1 - sr 3 are provided at the position of respective controllers 44 - 46 shown in fig5 , which are close to the respective pmos transistors p 1 - p 3 . other circuits of the power supply circuit unit 2 , i . e ., the charge control circuit 25 , the sim card interface circuit 26 , and the power - on logic circuit 27 , are arranged at a center portion 47 of the ic chip 40 . the pads vdd , vin , vdd 1 - vdd 3 , and vddc are coupled to the positive power supply voltage vbat of the battery 11 . the pads gndp , gnda , gnds , and gndc are coupled to the negative power supply voltage gnd of the battery 11 . the coil l and the capacitor c of the smoothing circuit unit 33 are externally attached to the ic chip 40 through the pad lx . fig6 is a diagram showing the relationship between noise levels and the distance between the switching regulator oscillating at 800 khz and the series regulators . as can be seen from fig6 , a distance of 1 . 5 mm between the switching regulator and the series regulators provides a 5 % noise reduction compared to when the distance between the switching regulator and the series regulators is 0 . 2 mm . the size of the power supply ic shown in fig5 is 3 mm on a side . as shown in fig5 , the driver transistor of the switching regulator 21 is arranged near the edge 41 , and the driver transistors of the series regulators sr 1 - sr 3 are arranged near the edge 42 . with this provision , an effect of the noise generated by the switching regulator 21 on the series regulators sr 1 - sr 3 is successfully reduced . the above description has been provided with reference to an example in which a switching regulator functioning as a dc - dc converter of the synchronous detection type is used . in fig3 , however , a diode 51 may be used as a flywheel diode in place of the nmos transistor 32 . in such a case , the switching regulator 21 of fig3 has a construction as shown in fig7 . in fig7 , the same elements as those of fig3 are referred to by the same numerals and symbols . a switching regulator based on the use of a flywheel diode is well known in the art , and a description thereof will be omitted . when the switching regulator as shown in fig7 is used , a schematic diagram of the power supply ic is changed from that of fig5 to that of fig8 . in fig8 , the same elements as those of fig5 are referred to by the same numerals and symbols , and a description thereof will be omitted . in what follows , differences will only be described . fig8 differs from fig5 in that the diode 51 serving as a flywheel diode is provided in place of the nmos transistor 32 . other construction is the same , and a description thereof will be omitted . moreover , fig3 and fig7 are directed to a case in which a voltage - reduction - type switching regulator is employed . if a boosting - type switching regulator is used , the circuit construction will be changed to that of fig9 . in fig9 , the same elements as those of fig3 are referred to by the same numerals and symbols , and a description thereof will be omitted . in fig9 , the switching regulator 21 includes a nmos transistor 61 serving as a switching transistor that switches in response to a control signal applied to the gate , a smoothing circuit unit 62 for smoothing the output signal of the nmos transistor 61 for outputting of the smoothed signal , the reference voltage generating circuit unit 34 , the potential dividing circuit unit 35 , the error amplifier 36 , and the control circuit unit 37 for the switching control of the nmos transistor 61 in response to the output of the error amplifier 36 . the output voltage vo is divided by the potential dividing circuit unit 35 , and the error amplifier 36 amplifies a difference between the divided potential vd and the reference voltage vr . the control circuit unit 37 is equipped with an oscillator ( not shown ) for generating a saw - tooth pulse signal , for example , and a comparator ( not shown ). the comparator compares the output signal of the oscillator with the output signal of the error amplifier 36 . the comparator controls the on time of the nmos transistor 61 in response to the comparison . the signal output from the nmos transistor 61 is smoothed by the smoothing circuit unit 62 comprised of a diode d 2 serving as a rectifying diode , a coil l 2 , and a capacitor c 2 . the smoothed signal is output as the output voltage vo . when the switching regulator as shown in fig9 is used , a schematic diagram of the power supply ic is changed from that of fig5 to that of fig1 . in fig1 , the same elements as those of fig5 are referred to by the same numerals and symbols , and a description thereof will be omitted . in what follows , differences will only be described . fig1 differs from fig5 in that the pmos transistor 31 is removed , and that the nmos transistor 32 is replaced by the nmos transistor 61 . other construction is the same , and a description thereof will be omitted . the above embodiment has been described with reference to a case in which one switching regulator and three series regulators are provided . the present invention is not limited to such a configuration , and is applicable to a case in which at least one switching regulator and at least one series regulator are provided . further , the present invention is not limited to these embodiments , but various variations and modifications may be made without departing from the scope of the present invention . the present application is based on japanese priority application no . 2002 - 362149 filed on dec . 13 , 2002 , with the japanese patent office , the entire contents of which are hereby incorporated by reference . | 7 |
before beginning a detailed description of the subject invention , mention of the following is in order . when appropriate , like reference numerals and characters may be used to designate identical , corresponding , or similar components in differing drawing figures . furthermore , in the detailed description to follow , example sizes / models / value / ranges may be given , although the present invention is not limited thereto . still furthermore , any clock or timing signals in the drawing figures are not drawn to scale but rather , exemplary and critical time values are mentioned when appropriate . when specific details are set forth in order to describe example embodiment of the invention , it should be apparent to one skilled in the art that the invention can be practiced without , or with variations of , these specific details . lastly , it should be apparent that differing combinations of hard - wired control circuitry and software instructions may be used to implement embodiments of the present invention , that is , the present invention is not limited to any specific combination of hardware and software . fig1 is a block diagram illustrating a hand - held gps unit 100 which may be used in accordance with an embodiment of the topographical data display technique of the present invention . as illustrated in fig1 an entry device 110 , such as a keypad or touchpad , is connected to a cpu ( central processing unit ) 130 of the hand - held gps unit 100 . an antenna 151 is connected to an rf front - end 150 whose output is connected to a gps dsp ( digital signal processor ) 120 . radio frequency signals from a plurality of satellites ( not shown ) are received by the antenna 151 and processed by the rf front - end 150 and the gps dsp 120 . the cpu 130 , in addition to receiving an output from the gps dsp 120 , is connected to a memory card or other memory device 140 , a code ram ( random access memory ) 160 , a system ram 165 , and a vram ( video random access memory ) 170 . the output of the vram 170 is fed to a vctrl ( video controller ) 190 , which in turn feeds the display screen 180 , which is normally an lcd ( liquid crystal display ) device . in operation , data corresponding to a topographical map of a particular area is stored in a compressed form in the memory card 140 . the total amount of data is limited only by the capacity of the memory card 140 . the area that is covered by the given amount of compressed topographical data is determined by the compression ratio of the data compression algorithm used . in the present invention , the compression ratio is effected by the resolution of the initial dem data ( size of the data grid step ), the desired range of zooms when the topographical data needs to be presented , an acceptable level of data degradation — lossy compression , and a size of the screen . since the present invention allows one to achieve a very high data compression ratio , it provides the largest area of coverage for a given memory card size . the gps dsp 120 , in conjunction with the cpu 130 and the code ram 160 and system ram 165 , determines the exact location of the hand - held gps unit 100 . the cpu 130 , in conjunction with the memory card 140 , code ram 160 , system ram 165 , vram 170 and vctrl 190 , display that portion of the stored topographical map including the exact location of the hand - held gps unit 100 on the display screen 180 . the various features of the present invention are discussed in detail below . these features may be effected with the hand - held gps unit 100 illustrated in fig1 . topographic information is available in different digital data formats and provides coverage of large areas . the most common is a digital elevation model where elevation values of the earth surface are recorded and stored at the vertices of a regular grid , usually rectangular . this is the input elevation data format that is used by the present invention . many other digital elevation formats can be converted into dem by knowledgeable in the art by using many commercial tools , e . g . arcview from esri . such grids can take a lot of memory , and thus data compression is required even for desktop computers . high compression ratios can be achieved only by using lossy compression algorithms . that is , the restored decompressed elevations differ from the original ones . to provide a fast local access to the compressed data , the original grid is divided into cells ( relatively small rectangular pieces ) such that each cell can be decompressed independently from the others . to the overall time that is required to restore elevation values for the area that is shown on the unit display the cell size is selected such that its size is comparable with the actual area that can be displayed at a particular range of zooms . therefore , at most only 4 cells , for example , need to be decompressed for every screen for a particular range of zoom level . it is clear that digital map displays at different zoom levels can have different resolution of the underlying data . when a device displays 10 mi width across the screen , for example , the effective feature resolution that is available to the user is much less than when the same screen covers only a 100 m width across the screen . therefore , to allow the same device to efficiently and quickly display topographical data for a large range of zoom levels , cells of different size and different resolution that cover the same area are used . for example , a cell with the most detailed resolution may be based on a topographical grid with 10 m grid steps and have 128 × 128 grid points . the next level of cells will have also 128 × 128 grid points but with a grid step of 100 m , and another level of cells will have the same number of points , but with a 1000 m grid step . therefore , with the same speed of decompression , different cell levels cover area 100 times larger with an appropriate reduction in resolution of only 10 times . there are many lossy image and data compression techniques that control average degradation of data quality by controlling rms ( root mean square ) value of the introduced data error . however , a compression of an elevation data also requires controlling the maximum compression / decompression error as well . otherwise , a user can encounter deep ravines or steep cliffs that are not correctly shown on a decompressed topographical map , even though the rms error value of the total compression is relatively small . similarly , during compression of the depth data , it is important to control a relative error of compression , since an depth error of 10 m is not important at an depth of 1000 m but is very important at the actual depth of 10 m . in addition to the common procedure of controlling the rms error value of lossy compression , the topographical data display technique in accordance with the present invention also controls the maximum and / or relative error of compression / decompression . to provide good quality of compression , both the root mean square error ( rmse ) and the maximum error must be controlled . the rmse directly depends on the compression ratio , and a required rmse can be obtained by changing the compression ratio . however , the value of the maximum error is quite arbitrary . after the desired rmse has been obtained , all cell points are checked for deviation . if a deviation is greater than an acceptable level , the values of deviation and point positions are written into an archive . during decompression , the restored decompressed elevation data of a point is corrected by using deviation value stored in the archive . the format of the correction values table can be as follows . the table is written to the end of the each cell archive and consists of the deviations and coordinates of the points with the deviations equal or greater than d . the initial cells must be compared with the cells restored from the archive . let c be a counter of elements . its value is initially 0 . a linear search is effected ( along the rows , over the whole cell ) for elements with large deviations ( that is , the absolute value s of the difference between the original elevation data and the restored data from the archive is greater than d ). if s & lt ; d , then c is incremented and the search continues . otherwise , c is written into the archive , then 2 ( s − d ) if s & gt ; 0 , and 2 ( s + d )+ 1 else . after that , c is set to 0 and the process goes on . the value of d is to be coordinated with the rms error value , such that the number of points to be stored is small . after a cell is decompressed , the additional correction table is checked , and if its size is & gt ; 0 then the correction is applied to a decompressed cell . first , d is read from the archive . then , on each step , values c and v are read . if v is odd , s =( v − 1 )/ 2 − d , otherwise s = v / 2 − d . the pointer in the cell is moved to the c elements and s is added to the pointed element . the process goes on until the correction values are exhausted . the correction algorithm can be performed for any lossy compression algorithm . the amount of information loss is usually controlled by the size of the resultant archive . one can obtain the required rms error value by changing this size . an example of such an algorithm is disclosed in u . s . pat . no . 5 , 764 , 807 , issued jun . 9 , 1998 , and entitled : data compression using set partitioning in hierarchical trees . any data that is loaded into a nonvolatile memory of a portable device must be prepared off line and then used in real time . an important difference between the present invention and any other method is that other methods are generally symmetric in terms of processing complexity . compression and decompression with the tiff method takes about the same computing power . the only difference is that off - line , a large amount of data can be prepared while on - line only a small amount of data is decompressed at every given time . therefore , while the total time that is required to compress or decompress the entire data set is about the same , user experience is positive since , due to the limitation of the viewing screen area , the user is working only with a small amount of data at every moment . in the present invention , the amount of time and processing power that is used for compression and decompression of the same tile of data is vastly different . compression of each tile is done recursively many times to achieve the best possible compression ratio under the given limitation on error rms and maximum error . in particular , in the process of off - line compression , each tile is compressed and decompressed many times to make sure that the error rms is close to the allowed value but is not too small since a value smaller than the allowed rms value will produce a larger data set — that is , unnecessarily poorer compression . also note , that since the corrections for the excessive errors are stored as an explicit list , there is a danger of having a very high compression ratio that is based only on rms values , only to have the total size of the archive too large because too many point corrections need to be stored to avoid having points with excessive errors . then , it is quite possible that by reducing the rms value and , therefore slightly increasing the size of the compressed data , one however , can get rid of most of the large error points and , therefore , will reduce the overall size of the archive . such an iterative nature of the compression algorithms makes it unsymmetrical but very well suited to be used on small hand - held devices with limited processing power . an additional elevation buffer ( grid ) may be used to increase the processing speed and reduce the required memory size for small map scales . it is actually a sub - grid of the original grid . its size should be greater than the size of any of the following requests . the number of nodes is fixed , and the step is chosen according to the intended zoom scales at which this grid will be used . the elevations of the nodes are exactly the same as for the corresponding original nodes . the elevation buffer scrolls over the map according to elevation requests . to reduce calculations it is organized as a torus . during scrolling only the origin of the buffer is shifted , but not the data itself . thus , only new nodes are to be filled . this feature , in addition to the use of a cell compression structure where it each cell can be decompressed independent of the others , helps to increase the dynamic range of the zoom scales of data presentation without an undue increase in the processing speed of decompression . a screen grid , in its turn , simplifies the topographical lines calculation , map turning , seamless lines drawing when the map scrolls and so on . its sides are parallel to the screen . the step determines speed and quality of the topographical lines . a small step provides better quality , but slower speed . the screen grid should be larger than the screen itself ( for scrolling ). note that the screen sides are not necessarily parallel to the sides of the cells ( that is , the original grid ), due to rotation . moreover , after translation to original coordinates , the screen rectangle is generally transformed to a parallelogram ( because of the fact that the x and y axes can be changed disproportionately , for example , being specified as longitude and latitude respectively ). as illustrated in fig2 the original grid in shown as dashed lines , the above - described intermediate grid in shown as thin black lines , and the screen grid border as thick black lines . first , the elevation values of a decompressed cell are written to the intermediate grid and then the elevations of the screen grid are calculated using the intermediate grid . let , the step of the intermediate grid mesh be a unit of measurement , and let the grid nodes coordinates ( x , y ) be integers . the elevation of the screen grid nodes can be calculated by the following elevation formula : f ( x , y )=( 1 . 0 − c x )*( f ( [ x ],[ y ] )*( 1 − c y )+ f ( [ x ],[ y ]+ 1 )* c y )+ c x *( f ( [ x ]+ 1 ,[ y ] )*( 1 c y )+ f ( [ x ]+ 1 ,[ y ]+ 1 )* c y ), where [ z ] denotes an integer part of z , c x = x −[ x ]; c y = y −[ y ]; and for integer n 1 and n 2 one denotes by f ( n 1 , n 2 ) the elevation of a node ( n 1 , n 2 ). this formula is uniquely defined by the following condition : elevations of nodes are kept unchanged and elevation values are linear along the coordinate lines within a mesh . the advantage of this formula is that it uses only the 4 nearest nodes of the grid . as shown in fig3 the above - noted formula represents a hyperboloid surface on the mesh . there can be other surfaces ( including quadrics ) that are defined on the mesh and have the exact values on its corners . topographical lines ( isolines , elevation or contour lines ) are imaginary lines that join points of equal elevation on the surface of the land above or below a reference surface such as mean sea level . when referring to isolines , one usually means a family of isolines with elevations that are divisible by a step of isolines . with regard to building topographical lines using a grid of elevations , that is , the screen grid described above , each screen grid mesh is divided into 4 triangles by its central point . the elevation of the central point is supposed to be the average of the corner elevations . elevation lines are built for each of the triangles independently ( as if the terrain surface was consist of such flat triangles ). the lines are parallel within the triangles and attach with each other on sides of adjacent triangles . this is illustrated in fig4 . isolines for the horizontal triangle are not displayed . for the rest of the triangles , elevations of the vertices are sorted in ascending order ( in the picture , a 1 , a 2 and a 3 have elevations h 1 , h 2 and h 3 respectively , and h 1 & lt ;= h 2 & lt ;= h 3 ). then the isolines intersecting a 1 a 2 and a 1 a 3 , are determined and then − a 2 a 3 and a 1 a 3 . in both cases , it is necessary to calculate a ratio in which the isoline with elevation h , h 1 & lt ;= h & lt ;= h 3 divides corresponding intervals . this is illustrated in fig5 . the elevation value can be determined in real time for any map location , using the elevation formula noted above . to provide better consistency with elevation lines one can calculate the elevation using the screen grid and the same formula or to determine elevation using the triangulation technique described above . all these methods provide similar results . as noted above , in accordance was an object of the present invention , the user can view an elevation profile of a selected road , street , trail , track , or any other line feature and can view an elevation profile along the line of travel or perpendicular to the line of travel or at any arbitrary angle with respect to the line of travel and at any distance from the current position . all of the elevation profiles noted above can be represented as a polygonal line . such a line can be divided by a set of points to polygonal lines of equal length ( this length should be small enough depending on the required profile resolution ). then one can calculate the elevation of each point from the set as noted above and build the graph of the profile . fig6 - 8 illustrate display screens for various elevation profiles . this concludes the description of the example embodiment . although the present invention has been described with reference to a number of illustrative embodiments thereof , it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this invention . more particularly , reasonable variations and modifications are possible in the component parts and / or arrangements of the subject combination arrangements within the scope of the foregoing disclosure , the drawings , and the appended claims without departing from the spirit of the invention . in additions to variations and modifications in the component parts and / or arrangements , alternative uses will also be apparent to those skilled in the art . | 6 |
some embodiments of the current invention are discussed in detail below . in describing embodiments , specific terminology is employed for the sake of clarity . however , the invention is not intended to be limited to the specific terminology so selected . a person skilled in the relevant art will recognize that other equivalent components can be employed and other methods developed without departing from the broad concepts of the current invention . as mentioned , earlier , one disadvantage limiting capsule capability is battery life . based on size of the capsule , batteries that could be used in the capsule have only enough energy to support about 8 hours with very less functionality . this 8 hrs . time is adequate to pass through the small intestine but not the large intestine . if battery life can be extended beyond their normal 6 - 8 hours capsule operation up to 72 hours , the large intestine can also be evaluated . even longer battery life would allow imaging throughout the system at normal speed as well as slowed speed . without external control 2 frames per second are captured . methods of motion control , will result in more pictures taken and a slower passage through the small intestine consuming more battery life . constrained by size that can be conveniently swallowed , batteries currently used fit in the 11 mm by 26 mm capsule size . a typical battery used is a silver oxide battery similar to battery number 394 from energizer . this battery has 60 ma - h capabilities with a circumference of 9 . 5 mm and a thickness of two cells of 7 . 2 mm . higher capacity batteries would have either larger circumference or would be thicker . according to this invention , an approach to extend the battery life is to replace batteries with rechargeable batteries and / or replace by energy harvester . in standard capsule , an energy source for recharging the battery as the capsule migrates through the body is then necessary and it would be more painful to patient . according to this invention , the battery will be replaced by energy harvester , which helps to make the capsule more smaller , easier to swallow and could have more functionalities . the using of this energy harvester could also allow elimination of the batteries if the capsule requirements will match harvested power . capsule size reduction would result with 8 mm of battery removed . although several sources of energy within the human body are available , the preferred embodiment of this invention utilizes the energy harvesting from blackbody radiation . the human body radiates energy the same as any blackbody . this radiation energy is in the infrared wavelength . radiation from a blackbody at a specific temperature is determined by planck &# 39 ; s blackbody radiation law , as illustrated in fig2 a and its simulated results at various temperature are shown in fig2 b . in this equation as illustrated in fig2 a , c = speed of light , k = boltzman &# 39 ; s constant , h = planck &# 39 ; s constant , λ = wavelength , and t = temperature in kelvin . as the temperature increases , the wavelength at the peak energy decreases . fig2 c shows the simulated results of peak energy wavelengths with functions of the temperature . the total amount of energy generated at a specific temperature are shown in fig3 , which depicts that available harvesting energy at body temperature of 310 kelvin is about 500 watts per square meter . according to this invention , there are also several other potential sources of energy within the body . one example is body vibration created due to the daily activities , other surrounding issues , and / or other organ functioning ( e . g . heart , vein , artery etc . ), from which energy could be harvested and feed to the system according to this invention , mechanisms for harvesting such energy might be electromagnetic ( 0 . 05 watts per square meter ), piezoelectric ( 6 watts per square meter ), or electrostatic ( 0 . 04 watts per square meter ). another example is body heat , using a mechanism for thermoelectric harvesting . alternatively , energy can be harvested from rf signals from outside the body . the signal from the imaging capsule is sent to an external receiver , typically held close to the body . rf signals from this receiver can help power the capsule . although blackbody radiation is discussed in the most detail below , according to this invention , any of the above sources of energy can also be utilized , especially in combination . power consumption for current capsules is 25 mwatt . at 25 mwatt , the 60 ma - h ( 60 ma - h × 3 v = 180 mwatt ) battery will be consumed in 7 . 2 hours . this can be extended indefinitely with the ability to harvest greater than 25 mwatt of continuous blackbody radiation . according to this invention there is 500 watts per meter available to be harvested with in the human body . the preferred capsule diameter is 11 mm so the harvesting device should fit within this diameter . the peak wavelength for maximum energy for human body temperature , 310 kelvin , is 9 microns . this maximum energy peak wavelength can be derived by determining the maximum energy wavelength of planck &# 39 ; s radiation law equation as shown in fig2 a . from the calculated results , as shown in fig3 , it gives the entire amount of blackbody energy generated and available for harvesting at a specific temperature . at 310k , approximately 500 w / m 2 can be harvested . this energy harvester which could be integrated into the capsule , is formed using the semiconductor material . adjusting a material that would harvest at a peak frequency of 9 microns results in high intrinsic carriers and thus high dark current . devices adjusted to high infrared wavelengths are normally operated at low temperatures ( 77 k ). a compromise and workable solution is to adjust to the near infrared range that has less intrinsic carriers and lower dark current at 300k . a potential tuning range is between 3 microns and 5 microns . within this range the harvested energy for different harvest conversion efficiencies is shown in fig4 . if 50 % efficiency harvesting is achieved , 47 watts per square meter is harvested . according to this invention , this harvest capability translates to 0 . 047 mwatt per square millimeter . the area of a harvest device that fits into a 7 mm diameter capsule ( remember that the final goal is reduced size ) would be 6 . 9 mm × 6 . 9 mm = 47 . 61 square millimeters resulting in 2 . 23 mwatt harvested . this would supply power to continuously charge the battery and have continuous capsule operation through put the digestive tract once the power of capsule electronic components is reduced . focal plane array , read out integrated circuit and communication devices can be redesigned to consume less than 0 . 5 mwatt each by lower voltage and weak inversion operation resulting in a total of 1 mwatt . led power consumption will be the main power used in short bursts . the led &# 39 ; s will be pulsed and need high energy ( 60 mw per led times four led &# 39 ; s equals 240 mwatt ) for short duration . short durations are only for less than 1 msec three times every second if recording visible , infrared illuminated and dark every second . if only illuminating 1 msec three times per second then average power would only be 0 . 240 mw × 3 or 0 . 72 mwatts and be well within the capability of harvesting . total estimated operating average operating power would be 0 . 5 mwatt × 2 + 0 . 72 mwatt = 1 . 72 mwatt . as long as led &# 39 ; s are used for visible and infrared illumination a storage medium would be necessary to supply the temporary peak power surge . if a capacitor was made with thin cmos gate oxide in the 47 square millimeter area there would be 15 microfarads of capacitance . using i dt = c dv it can be shown that with 15 microfarads of capacitance would cause the voltage to be depleted . i dt = 240 mwatts / 3 v × 1 msec = 80 μa - sec = 15 μf × dv . dv = 5 . 33 volts . batteries will need to be used until a solution of capacitance more than an order of magnitude greater is available . fig5 shows the generalized preferred embodiment of endoscopy capsule system , according to this invention . on one end of the capsule is the imaging section 98 , in the middle is the energy storage / management section 100 , and on the opposite side is the energy harvester and communication components 101 . fig6 shows the preferred embodiment of this invention for endoscope system , integrating with an energy harvester . the middle section 100 is the power storage section connected to management system ( not shown here in details ) which includes electronics comprising with inverter , storage , and energy harvester , explained later . as a storage , capacitor or rechargeable battery or their combination is integrated and placed in middle section 100 . in one end of the capsule all the signal processing electronics and part or whole of the are housed . main components this consists of an antenna 102 , a transmitter 104 , and others ( not shown here ). the imaging section 98 comprises a focal plane array ( a . k . a . image sensor ) 106 with a cmos readout integrated circuit built in , emitter source ( e . g . led ) 108 provide illumination for imaging purposes , while a lens 110 focuses light in the desired spectrum on the focal array . power for the focal array 106 and light emitter 108 is provided by the energy storage section 100 . the energy storage section 100 is placed in the body of the capsule next to the imaging section , and takes up most of the space within the capsule . making smaller will not only makes the capsule more compact , but also reduces the power consumption which enables it to capture more images and include more functionality . according to this invention , energy harvester , could be with or without battery . if battery is used , the only one battery may need . the energy harvester 112 and power management unit 114 are placed for optimal energy absorption and connected to each other . alternatively , the power management unit 114 can be integrated into the energy harvester 112 itself , as discussed in more detail below . a lens 118 focuses infrared light on the energy harvester 112 , and can be formed from any material which is suitable for this purpose . for example , magnesium fluoride , calcium fluoride , zinc selenide , barium fluoride , amtir i , arsenic fluoride , zinc sulfide , sapphire , silicon , germanium , or some combination thereof . fig7 shows a graph of various possible materials and their suitability for transmitting ir wavelengths . the transmitter 104 and antenna 102 are also located in this section of the capsule . the power management unit 114 is connected to the energy storage section 100 through connection 116 to control flow of energy to and from the energy storage 100 , and then all other components which require power ( the transmitter 104 , focal array 106 , and light emitter 108 ) are connected to the power management unit . as long as the connections described above are maintained , the placement of the various components can be placed in many different ways . for example , the focal array 106 or energy harvester 112 can be formed as layers which cover all or part of the outer shell of the capsule . such a choice increases the surface area of both devices and improves performance of the device as a whole . additionally , the antenna might be formed as a layer disposed below or on top of the focal array or harvester layer . if the antenna is formed on top , then it should be formed from a material which does not absorb wavelengths of interest , otherwise it might hinder performance of the device as a whole . any combination of the above descriptions is possible . fig8 is a schematic showing the alternate endoscope capsule in the preferred embodiment , according to this invention , wherein same numerals are used for the similar parts , so that repeated explanation is omitted here . in this preferred embodiment where the focal array 106 remains the same , but the energy harvester 112 and power management unit 114 are integrated and formed as a layer which covers the entire outer surface of the pill . fig9 is another alternate embodiment , except where the antenna 102 is also formed as an outer layer , placed below the energy harvester 112 . in this another embodiment of this invention , the numerals are used for the same parts so that repeated explanation is omitted here . fig1 is another embodiment of this endoscopic capsule invention , where the antenna 102 layer and energy harvester 112 layer cover the entire surface except for the imaging section . this embodiment might be favorable in situations where the materials used for the antenna and / or energy harvester might block the wavelengths which the imager is designed to detect . as an another example of the embodiments ( not shown in here ), the focal array 106 might be a layer which covers the battery section and imaging section , while the energy harvester 112 might be a layer which covers the remaining surface area without overlapping the focal array 106 . the antenna might then be a layer which is located under or over one or both of the layers 112 and 106 . as another example , the focal array 106 and energy harvester might be layers which cover the entire pill , stacked on top of one another . the antenna could then be placed inside , or formed as a layer under the layers 106 and 112 , over the layers 106 and 112 , or even placed between the layers 106 and 112 . fig1 is a schematic showing a another preferred embodiment of this current invention for endoscope capsule system , wherein the same numerals represent the similar parts as explained in fig8 , and 8 - 10 , so that repeated explanations are omitted here . according to this invention , the battery is completely omitted . in this case , the harvester generates energy and feed directly to the system . this is system can be with and without light emitters . as light emitters consume more power , light emitter can be omitted . as explained earlier , harvesting power is enough to take the image , signal processing , and transmitting to outside . the light emitter 108 is only necessary when the focal array 106 is designed to sense visible light . if , instead , the focal array is designed to sense outside the visible spectrum only , such as infrared imaging , then the light emitter can be omitted and the device as a whole can function on the harvested energy alone . the embodiment in fig1 shows the endoscope - capsule as much reduced in size , but alternatively , the empty space in the middle can be utilized in a number of ways , as discussed further below . the preferred embodiment of this invention for endoscope capsule system includes several sections , and othe of them is the energy harvester device and its integration with power management system which can reduce the size and make it longer to operate more than 10 hrs . or so capturing gi &# 39 ; s image , as it passes . the harvester technique is explained below , as an example , but not limiting the invention . for simplicity , we would provide an example in related to harvester which is made using high wavelength absorption material such as hgcdte based material systems . however , it can be related to other semiconductor materials such as insb , etc . a preferred material for infrared harvesting is mercury cadmium telluride ( hgcdte ). hgcdte &# 39 ; s bandgap can be tuned between 0 . 8 μm to 25 μm . it has been determined that the bandgap can be adjusted by varying the percentage of hg versus cd . the equation showing this relationship is eg =− 0 . 302 + 1 . 93x − 0 . 81x 2 + 0 . 832x 3 +( 5 . 35 × 10 4 ) t ( 1 − 2x ) where x is the amount of cadmium ( cd ). this equation is plotted in fig1 a . the absorption spectra of the hgcdte with various cd contents are calculated and it is show in fig1 b . adjustment of cadmium versus mercury can result in a reasonable implementation that has the ability to harvest wavelengths from 3 μm to 10 μm . the upper limit of 10 μm was chosen to maintain a reasonable forward voltage . there are several factors that contribute to infrared harvesting efficiency . the ability of a material of absorb energy in the wavelength of available energy is a key factor . this key factor determining the net conversion efficiency of harvester is quantum efficiency ( qe ). ( qe ) is the probability that an incident photon of energy egwill deliver an electron to the external circuit . qe varies per wavelength for different solar harvesting technologies . fig1 c shows how qe varies in hgcdte across wavelengths . other factors affecting conversion efficiency are cell layer thicknesses , contact resistances and leakages to achieve the bandgap upper limit of 10 μm , 17 % cadmium versus 83 % mercury is used . once energy is harvested , conditioning of that energy must be done to supply voltage and current to devices and charge batteries . power management devices designed to interface between the infrared harvesting structure and output device can be designed with current cmos technology . to have versatile output voltage range , a 0 . 35 μm process with high voltage options up to 10 volts would be used . this will allow internal harvested voltages to go beyond 3 volts and be regulated to a desired 3 volt output . according to this invention , if 30 % efficiency of harvesting is achieved , 125 watts per square meter is harvested . this harvest capability translates to 0 . 125 mwatt per square millimeter . the area of a circular harvest device that fits into the 11 mm diameter capsule would be 9 . 5 mm × 9 . 5 mm × 3 . 14 = 283 square millimeters resulting in 35 . 4 mwatt harvested . this would supply substantial power to continuously charge the storage element ( e . g . capacitor or battery ) and have continuous capsule operation throughout the digestive tract . alternatively , if the harvest device is formed as a layer all along the capsule shell as well as a circular disk , harvested energy could be even higher . a harvester which is a layer covering only the battery section alone will have a surface area of approximately 275 square millimeters . combined with the circular disk harvester , this would result in approximately 69 . 78 mwatt harvested . the specific structure of the preferred embodiments , as explained in fig5 to 12 is highly variable . although the connections must be constant within every variation , the specific placement of each component can be changed in many ways , especially if the battery is been eliminated completely . fig1 is a schematic showing the very basic method of connecting the components . an energy harvester and power management unit are integrated into a single unit , either monolithically formed on the same wafer , or fabricated separately and then stacked and connected with metal bumps . a energy storage ( e . g . battery ) is then connected to the power management unit , and the focal array and communication device are separately connected to the power management unit . the components must all be connected in roughly the same way . the power management unit and energy harvester are connected to form an integrated system . the power management unit then connects to the energy storage ( e . g . battery or capacitor ) to store / recharge and distribute the energy to the other components of the capsule . alternatively , the power management unit might be connected only to the batter and harvester , while all of the other components needing power connect directly to the battery as well . fig1 shows an alternate schematic for a method of connecting the components , according to this invention . in this embodiment , the integrated power unit comprises an energy harvester , a battery controller , and a dc - dc converter . the harvester supplies power to the energy storage ( e . g . capacitor or battery ) controller , which is connected to the dc - dc converter and to an external battery . the dc - dc converter is connected to the external focal array and communication components . all components as shown in fig1 , can also be made to sicglec chip , sizes of 1 to 5 sq . mm with thickness of less than 1 mm using cmos technology . fig1 and 14 are meant to serve as examples for how to connect the various components , and are not intended to be limiting . other obvious variations would occur to a person skilled in the art . according to this invention , the energy harvester can be structured many different ways . the device is structured as shown in fig1 i . the device is built on substrate 200 , and consists of semiconductor layers 202 and 204 . those layers are doped opposite ( either 202 is p - doped and 204 is n - doped , or vice versa ). additional layers of p or n doped material can also be inserted , or an intrinsic layer to form a p - i - n junction ( not shown in here ). although pn - junctions and pin - junctions are favorable , other types of junctions are possible as well ( not shown ). for example , the device might utilize schottkey - junctions , nbn , nbp , pb - i - n structures , quantum wells , quantum dots , or a combination . electrical contacts 206 and 210 are formed such that each contact connects with a different semiconductor layer , and they are electrically insulated from each other with passivation material 208 . substrate 200 can be left as a support layer , doped to be part of the junction , etched out , or it can act as a power management system if formed from an integrated circuit is made on the substrate . if the integrated circuit ( may make to power management system ) is used as the substrate for energy harvester , then the harvester is fully integrated with the power management system , and external connection is unnecessary . if the integrated circuit ( part of the power management unit ) is not integrated into the harvester , then the harvester must be connected externally to the power management unit . fig1 a shows how the power management unit 212 would be connected to the energy harvester through use of indium bumps 214 . the electrodes 216 in power management unit connects the energy harvester to other component such as image sensor and light emitter ( if any ), and also to the signal processing circuit for transmission ( not shown here ). other integrated circuit for image sensor and also for the transmission all could be also integrated into one circuit ( not shown here ), according to this invention . fig1 b is an alternate embodiment according to this invention , wherein all numerals as explained in fig1 a , represents the same parts , so that repeated explanation is omitted here . only difference is that the hybrid integration can also be hybridly connected to other integrated circuit , and or image sensor through the bumps 214 , placed in other side of power management unit 212 . the preferred embodiment utilizes primarily hgcdte , as an example , wherein hgcdte is manufactured on an undoped silicon substrate 200 with a deposited layer of cdte ( not shown ). the cdte is a buffer layer to reduce stress between the silicon substrate and hgcdte substrate , and can be doped or not . doping with iodine creates n - type hgcdte as the first layer 202 . doping with arsenic creates the p - type hgcdte on top , 204 . metal ohmic contacts 206 and 210 are made to the n - type and p - type devices on the top side , insulated from each other with passivation layer 208 . illumination is from the bottom silicon side . all infrared wavelengths between 1 μm and greater than 10 μm will pass through the silicon cdte substrate . up to 1 μm of wavelength energy does not pass to the hgcdte since it is absorbed by the cdte and also si substrate . this configuration creates a pn - junction sitting on top of a silicon substrate , but many other configurations can be used instead . for example , pin - junctions , schottkey junctions , quantum wells , quantum dot junctions , nbn detectors , or a combination . additionally , the p - layer and n - layer need not be configured in the manner that is pictured . the layers could be easily reversed , and they need not be single layers . fig1 . shows the structure of a single diode ( energy harvester ). it might alternatively be placed in an array , or in combination with more diodes . the number of diodes in parallel or series will depend on desired current and voltage . the voltage in the case of the capsule harvesting structure will be above 4 to 5 volts to compensate for drop across the protection diode and to give more headroom to the power management unit . fig1 a shows such a configuration for energy harvester 220 , where two diodes are connected in series on the same wafer , according to this invention wherein same numerals represent the similar parts , as explained in fig1 and fig1 , so that repeated explanation is omitted here . any number of diodes can be connected in series and in parallel , and this figure is intended only as an example , not a limitation . when multiple such junctions are used , they can be formed from the same materials ( hgcdte ) or different ones . if different materials are used within the same wafer , a buffer layer ( or several ) might be required in order to minimize lattice mismatch . if the diodes forming energy harvester 220 , are connected through indium bumps instead , as illustrated in another embodiment , as shown fig1 b , according to this invention , where buffer layers are not necessary . fig1 a shows the single - diode element for energy harvester as placed in an array 230 according to this invention wherein same numerals represent the similar parts , so that repeated explanation is omitted here . to achieve this , the harvester element might be formed separately and then connected , or they can be formed on the same wafer by forming multiple contacts for one semiconductor layer to form the harvester 230 , while keeping one common contact for the other semiconductor layer . alternatively , if placed in an array , each pixel need not be identical . each harvester element comprising different types of diodes or different material types can also be utilized in order to expand the spectrum absorbed . fig1 b shows how such an array might be connected to an power management integrated circuit unit in much the same way as was shown in fig1 b , and 17 b the cmos power management unit can be connected to the energy harvester in a number of ways . the simplest is to connect it to the ohmic contacts by way of indium “ bumps .” alternatively , the power management circuit can be integrated directly into a silicon substrate , which the energy harvester is then formed on . in this way , the power management unit and energy harvester are both contained on the same wafer , and additional connection is not needed . alternatively , if multiple diodes connected in series or parallel are being used , the power management unit might be integrated into one or more diodes , and then another ( or multiple ) diode is connected to the integrated system through indium bumps . as can be seen , the energy harvester structure is incredibly variable , depending on the specific needs of the structure being used . once formed , the harvester and power management unit can also be further thinned in order to save space within the capsule . preferably the combined energy harvester and power management unit will be less than 150 micrometers thin , but the preferred size can vary depending on placement and space available . an advantage of thinning out the silicon substrate is reducing absorption of light in the spectrum of interest . the focal array lens and infrared lens can alternatively be integrated directly into the shell of the capsule . typically capsules are formed from clear plastic , but they might instead be formed from materials appropriate for use as lenses and then designed in such a way as to concentrate light on the focal array or energy harvesting device , or both . as alternatives to the above preferred embodiment , the capsule according to this invention , can be formed from many different materials , and can be configured to absorb in different wavelengths . for example , the light emitter ( e . g . led ) is only needed when imaging within the visible spectrum . however , the focal array can also be formed from materials which allow for non - visible imaging , such as ir . if this is done , then the either light emitter sensing that ir wavelengths , or nor light emitter are not necessary . in the case of capsule without light emitter , the ir image sensor is used which provide thermal imaging when capsule passes through the gi . the light emitter is the main source of power draw within the capsule , so eliminating them allows for use of a smaller energy storage ( e . g . battery ), or even elimination of the energy storage altogether . with this in mind , many more options open up . the capsule can be made smaller and easier to swallow , or the extra space can be used for additional features , such as tissue sampling or ph testing . alternatively , the extra space can be used for energy harvesters which are bigger , which opens the possibility to use the alternative harvesters mentioned previously . although these alternatives are currently not as effective as the blackbody radiation harvester , they may be preferable in some embodiments due to cost of manufacturing or other factors . along a similar idea , the imaging focal array might utilize a combination of visible imaging and uv or ir imaging . in this case , some light from an light emitter might be needed , but not as much as if the focal array is purely visible imaging . in this case , the battery can be reduced but likely not eliminated altogether . whereas many alterations and modifications of the present invention will no doubt become apparent to a person of ordinary skill in the art after having read the foregoing description , it is to be understood that the particular embodiments shown and described by way of illustration are in no way intended to be considered limiting . therefore , reference to the details of the preferred embodiments is not intended to limit their scope . although the invention has been described with respect to specific embodiment for complete and clear disclosure , the appended claims are not to be thus limited but are to be construed as embodying all modification and alternative constructions that may be occurred to one skilled in the art which fairly fall within the basic teaching here is set forth . although the invention has been described with respect to specific embodiment for complete and clear disclosure , the appended claims are not to be thus limited but are to be construed as embodying all modification and alternative constructions that may be occurred to one skilled in the art which fairly tall within the basic teaching here is set forth . | 0 |
the part sectional view of a strapping apparatus can be seen in fig1 . a handle 1 , only shown in part , which is utilized for holding the apparatus is situated on the strapping apparatus . below the handle is situated an actuating lever 2 which is pulled in the direction of the handle in order to effect some operating steps of the strapping apparatus . this is explained below . a tensioning strap ( not shown ) is initially looped around a packaged item ( not shown ). the two ends of the loop , in this case , lie at the position for a connecting point 3 where the two ends will be welded together , clamped together or connected together in a similar manner . so that the tensioning strap lies tightly around the packaged item , prior to welding it is tightened by means of a frictional wheel 4 , which in this case operates against a support 5 , by being pressed in a rotating manner onto the top surface of the tensioning strap and consequently keeping hold of it and pulling it in a rotational direction . the frictional wheel 4 is driven by means of the hollow wheel ( not visible ) of a planetary gear unit 7 . in the case of said design , the planetary carrier 6 is provided with a corresponding external toothing 8 in order to fix or release the planetary carrier 6 in its rotation . by way of its pivot lever arm 10 , a pivot lever 9 engages in the external toothing 8 by means of a support toothing 11 which is mounted on the end of the pivot lever arm 10 and thus prevents the planetary carrier 6 from being able to rotate . when the support toothing 11 engages in the external toothing 8 of the planetary carrier 6 , the planetary carrier 6 is therefore fixed and a rotation of the drive 12 is transmitted to the hollow wheel by means of the planetary wheels 13 and consequently to the frictional wheel 4 which is connected thereto . in the case of a comparable design , the output onto the frictional wheel 4 can be effected as an alternative to this by means of the planetary carrier . in the case of this comparable design , the hollow wheel is then provided with a corresponding external toothing in order to fix or release the hollow wheel in its rotation . when the support toothing engages in the external toothing of the hollow wheel , the hollow wheel is therefore fixed and a rotation of the drive is transmitted by means of the planetary wheels to the planetary carrier and consequently to the frictional wheel which is connected thereto . consequently a rotation of the drive is transmitted by means of the planetary wheels of the planetary gear unit and from the planetary gear unit by means of the planetary wheel carrier to the frictional wheel 4 . the frictional wheel , in a lowered state , then pulls the tensioning strap tightly around the packaged item until the tensioning strap is finally connected , preferably welded to form a loop running around the packaged item . the strapping apparatus can then be removed from the tensioning strap , the contact between the frictional wheel and the tensioning strap , however , having first to be released . as a result of the friction applied to the tensioning strap , the tensioning strap is tensioned with the frictional wheel to a certain extent and as the drive for the frictional wheel is also correspondingly tensioned , difficulties can occur when releasing the frictional wheel from the tensioning strap . in order to overcome the difficulties , the transmission of the load from the drive to the frictional wheel is interrupted . to this end , as shown in fig2 , the actuating lever 2 is pulled in the direction of the handle 1 . in this case , the pivot lever 9 is actuated by means of a connecting rod 14 such that the support toothing 11 on the pivot lever arm 10 is pivoted out of the external toothing 8 on the planetary carrier 6 . as a result , the planetary carrier 6 is then freely rotatable . if a rotation were then to be brought into the planetary gear unit 7 by means of the drive 12 , the planetary wheels 13 would rotate in particular the planetary carrier 6 , but no longer the hollow wheel with the frictional wheel 4 fastened thereto . consequently , the path of action between the frictional wheel 4 and the drive 12 is interrupted . a load transmitted from the drive 12 to the frictional wheel 4 is also interrupted in the path of action in the same way . load possibly still present in the path of action or pretension resulting therefrom is consequently reduced by means of a possibly only slight rotation of the planetary carrier 6 and the frictional wheel 4 is then no longer under load or pretension . in the case of an alternative design as described above , by actuating the pivot lever the support toothing is moved out of engagement from an external toothing on the hollow wheel which consequently is freely rotatable . if , then , in the alternative design , a rotation of the drive is brought into the planetary gear unit , the hollow wheel is rotated by means of the planetary wheels , but no longer the planetary carrier on which , in the case of the alternative design , the frictional wheel is fastened . consequently , in the case of the variant , the path of action between the frictional wheel and the drive is interrupted in a comparable manner along the path of action , at the same time load still present in the path of action or pretension resulting therefrom being reduced by means of a possibly only slight rotation of the hollow wheel and the frictional wheel is released from load or pretension . if the actuating lever 2 , as shown in fig3 , is then pulled even further upward in the direction of the handle 1 , in the case of the two alternative designs described , the pivot lever 9 is also moved further to the side by means of the connecting rod 14 . the pivot lever arm 10 , in this case , initially compresses an elastic means in the form of a helical spring 15 until it abuts against a bearing block 16 on which or in which the planetary gear unit 7 is rotatably mounted . if the actuating lever 2 is actuated further , the connecting rod 14 is moved further to the side . in this case , the pivot lever 9 , however , cannot pivot any further but the force applied by the connecting rod 14 is transmitted by means of the pivot axis 17 of the pivot lever 9 to the bearing block 16 and the bearing block pivots thereupon about a pivot axis 18 . as a result , the planetary gear unit situated on the bearing block 16 is also pivoted and thus the frictional wheel 4 which is flange - connected thereto is lifted up from the support 5 and the tensioning strap ( not shown ) located between the frictional wheel and the support is able to be removed . the pivoting of the bearing block 16 about the axis of rotation 18 is effected , in this case , against the force of a resetting spring 19 which is supported on the one side on the bearing block 16 and on the other side on the housing 20 of the strapping apparatus . afterwards , in order to return back into the start position , the actuating lever 2 is released again and consequently also the connecting rod which is moved by the actuating lever . as a result of releasing the connecting rod 14 , on account of the resetting spring 19 the bearing block 16 is initially pivoted back down again , as a result of which the frictional wheel 4 is also pressed back onto the support 5 . in this case , the pivot lever 9 is also pivoted back with regard to the bearing block 16 as a result of the helical spring 15 and the support toothing 11 on the pivot lever arm 10 re - engages with the external toothing 8 on the planetary carrier 6 . consequently , the planetary carrier 6 is fixed again in its rotational position and rotation brought from the drive 12 into the planetary gear unit 7 is to be transmitted by means of the planetary wheels 13 to the frictional wheel 4 again . in the case of the alternative design which was discussed above with reference to the external toothing on the hollow wheel , the hollow wheel would be fixed in its rotational position by means of the support toothing and rotation brought from the drive into the planetary gear unit would be transmitted to the frictional wheel again by means of the planetary carrier which is then incorporated again in the path of action . consequently , the frictional wheel 4 is then able again in each case to apply the desired tensile force to a tensioning strap which is situated between the frictional wheel and the support 5 . if a connection as described above is then produced again at the connecting point 3 , the support toothing 11 can be moved out of engagement again and the frictional wheel can be moved upward in a load - free manner as described above . | 1 |
as described above , there is positive proof that the object can be achieved according to the present invention . hereinafter , the description will be made of the evaluation result concerning the characteristic properties of a magnetic recording medium prepared in accordance with the present invention , including the preparation method . first , on implementing the present invention , an ion beam gun having the structure shown in fig5 has been used . in the structure of this gun , an electron : e − is supplied from a hollow cathode 7 at the center to a magnetic disc 6 and an anode 8 to cause plasma to the anode 8 , the ion generated by this plasma accelerates the ion on the magnetic disc 6 by means of a potential difference ( accelerating voltage ) with ground . at this time , an electron is supplied from the hollow cathode at the same time , the ion is neutralized , and therefore the surface of the magnetic disc will not be charged . in this connection , reference numerals 11 and 10 denote a magnetic field and a line of magnetic force respectively . as a role of increasing the density of plasma at the anode , electric current is caused to flow through an electromagnet 9 to thereby cause the magnetic field 11 and the line of magnetic force 10 . the feature of this gun is that it has no component to be consumed because it has no filament for supplying an electron unlike the so - called ion beam , nor has any grid for acceleration or neutralization . for a magnetic disc to be treated , there has been used a glass substrate produced by hoya having surface roughness ra of 0 . 3 nm as a substrate , on which coni alloy of 30 nm as a under seed layer , a crmo film of 25 nm as a under layer , a cocrptb film of 22 nm as a magnetic layer , and a dlc film of 4 nm as a protective layer have been formed respectively . on forming as the film , there has been used mdp - 250b manufactured by intevac inc . the substrate temperature is 250 ° c . the magnetic disc 6 having such a history as described above has been put in a treating chamber , which has been evacuated at 1e - 5 pa or less . the treatment condition of the dlc film surface is shown in table 1 . h - a denotes a current value of the hollow cathode ; a - a , a current value of the anode ; and atog , voltage between the anode and the ground . as the treatment procedure , after the evacuation , ar is caused to flow through the hollow cathode 7 , and after discharging of the hollow cathode 7 , nitrogen , which is treated gas , is caused to flow through the anode 8 . after the anode 8 is caused to discharge , current is caused to flow through an electromagnet 9 , and voltage ( accelerating voltage ) between the anode 8 and the ground has been set to become an arbitrary value . after the condition is satisfied , the magnetic disc 6 has been inserted into the front surface of the gun to perform the treatment . the treatment time has been controlled by a timer and when the treatment is finished , all power supply and all gas have been stopped . as a comparison , a sputter carbon nitride film 4 nm and an untreated dlc film 4 nm have been prepared . as the evaluation method , the nitrogen density to a depth of 5 å from the surface of the dlc film has been measured through the use of the esca ( electron spectroscopy for chemical analysis ). the esca means an x - ray photoelectron spectral analyzer . an x - ray source is utilized to generate a photoelectron , and energy based on chemical bonding inherent in material is measured , whereby the amount of the material can be determined . the film quality was measured by presence or absence of variations in the raman spectrum , the adherence of the lubricant was measured using ft - ir , and the forms of the surface were compared by measuring ra by means of afm . in this respect , for the lubricant , fluorine lubricant was used , and the lubricant concentration was adjusted so as to have film thickness of about 17 . 5 å on an untreated dlc film using solution of 0 . 0750 %. for evaluation of the magnetic disc apparatus , a high - speed tangential force when the mr magnetic head is brought into a contact state at a number of rotation of 12000 rpm was measured for comparison . further , the disc was installed into the magnetic storage device , random seek was performed for 10000 hours at an amount of floating 5 nm of the magnetic head being constant , and thereafter , the read - write error was measured to compare fluctuations ( an increase in error indicated by %). the result is shown in table 2 . from the foregoing evaluation result , in a magnetic disc according to the present invention , it is possible to improve the adherence of the lubricant ( lb ) as compared with the dlc film as single substance about 30 % or higher at nitrogen density of the extra surface being about 20 at % without causing any changes in the film quality of the dlc film itself , to arbitrarily change the surface roughness from the roughness of the substrate to about ra of about 1 . 5 nm , and to reduce the high - speed tangential force to half of the conventional one or less , and it could be confirmed that the error is hardly increased . in the respective embodiments , attention was focused on peak of n 1 s from the data of esca as shown in fig8 for analysis . in this energy band , however , each of — c — n , — c ═ n , and — c ≡ n is contained as a bond of cn , and the peak cannot be clearly separated . therefore , it is considered to be a mixture of — c — n , — c ═ n , and — c ≡ n bonds as shown in the figure . the medium prepared under the condition shown in the table 1 was mounted on hdd , and a random seek test for 10000 hours was conducted . as a result , none of the embodiments was crashed , but in the first and second comparisons , two unit and one unit among three units were crashed respectively , and thereafter any error could not be measured . further , in the present invention , the investigation was performed in detail for each adherence treatment process of the lubricant . as the reason , an amount of scattering of the lubricant from above the magnetic disc is affected by the number of rotation of the magnetic disc , the temperature of the magnetic storage device at the time of operation , and share ware caused by the magnetic head , and is attributable to the adherence characteristic of the lubricant onto the overcoat surface . this characteristic is a factor which determines the durability to sliding property of the magnetic disc . the treatment condition is shown in table 3 , and the result is shown in table 4 . on preparing the sample , the film deposition process was performed in the same manner as described above . as regards the comparison , as a third comparison , a sputter cn film ( n content 15 . 3 %) with thickness of 4 nm and a dlc film untreated with thickness of 4 nm have been prepared . a dlc film surface treatment condition of the sixth to eighth embodiments is that the deviation range is taken larger than the first to fifth embodiments as shown in table 3 . in order to evaluate the adherence of the lubricant on the above - described samples , 0 . 1 % concentration solution of the fluorine lubricant was prepared , and the sample was coated at a fixed pull - up speed at normal temperature . the film thickness immediately after coated was assumed to be adhered film thickness , next in order to dry in the atmosphere , heat treatment was conducted at 80 ° c . for two hours , and thereafter , the film thickness was assumed to be film thickness after heat treatment . further , in order to confirm an adsorbed state with the protective layer , it is dipped in fluorine solvent used as a solvent , and the remaining lubricant film thickness after pulled up was assumed to be film thickness after rinsed . the thicker the film thickness after rinsed is , the surface of the protective layer and the lubricant are more well - suited to each other , and the compatibility becomes an index representing easiness of the lubricant to adhere to the protective layer . also , it is a fixed amount that represents this film thickness by a ratio to the film thickness after the heat treatment , and the remainder is a surplus amount . also , as relative comparison of adherence , when the film thickness after rinsed of the fourth comparison is set to 1 , a ratio of each of the respective samples to the film thickness after rinsed was represented as adherence ratio . since the ratios of the surplus amount and the fixed amount change depending upon the initial coated film thickness ( adherence ) of the lubricant , in order to compare , it is necessary to standardize . as a result , as shown in table 4 , the sputter cn film of the third comparison indicates the substantially same value as the dlc film of the fourth comparison in adherence and film thickness after heat treatment , but the film thickness after rinsed is reduced to about one fifth of that of the dlc film . in comparison with them , in the sixth to eighth embodiments according to the present invention , the adherence and the film thickness after heat treatment are about 30 å in either case , which is 1 . 5 times as high as that of the dlc film , and it can be seen that the coverage is great . also , the film thickness after rinsed is 8 to 12 . 4 å , and it can be seen that the adherence of the lubricant onto the dlc film is about two or three times advantageous . in this case , it is different from the adherence of table 2 , and this results from different concentration of the solution of the lubricant previously described . simple comparison cannot be made . therefore , the fixed amount is about 1 . 3 or 1 . 9 times as high as that of the dlc film , and is capable of greatly contributing to reduced amount of scattering on the magnetic disc of the actual machine . the ratio of the fixed amount of the lubricant layer according to the present invention amounts to 29 % or higher . also , fig9 shows an afm image on the overcoat surface after n - treatment on the surface of the dlc film performed in accordance with the present invention in comparison with the untreated surface of the dlc film . as seen from this , there are formed finer irregularities on the dlc film surface treated in accordance with the present invention than untreated goods . accordingly , it is considered that the high - speed tangential force can be deteriorated . in this respect , fig7 shows the outline of the magnetic storage device used in the present invention , and fig6 shows an example of layer structure of the magnetic recording medium according to the present invention . for the layer structure according to the present invention , a under layer 14 and a magnetic layer 13 are laminated on a glass substrate 15 , on top of which there is laminated a protective layer ( dlc film ) 12 , only whose surface has been treated with nitrogen . also , the magnetic storage device is constructed such that the magnetic recording medium 1 is installed into the spindle 2 , and the magnetic head 3 arranged on the magnetic recording medium 1 is supported by a suspension 23 and a head arm 16 , and is positioned by a servomechanism 4 . a signal from the magnetic head 3 passes through a lead wire 22 , passes through flexible flat wiring 20 from a lead wire assembled connector 21 , and is signal - processed at an electric circuit 5 on a r / w circuit substrate 18 by a coupling connector 19 . a housing 17 , in which all of these are contained , is the magnetic storage device . from the foregoing , according to the present invention , it is possible to obtain a high - reliability magnetic disc in an area , in which the amount of floating of the magnetic head is 10 nm or less at the overcoat thickness of 5 nm or less . according to the present invention , it is possible to provide a high - reliability magnetic recording medium and magnetic disc apparatus , which is improved in magnetic head floating stability , high - speed contact tangential force , hto and medium error , capable of high - density recording in an area in which ultra - low levitation is 10 nm or less . | 6 |
as will be appreciated by one skilled in the art , the present invention may be embodied as a method , system , or computer program product . accordingly , the present invention may take the form of an entirely hardware embodiment , an entirely software embodiment ( including firmware , resident software , micro - code , etc .) or an embodiment combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” furthermore , the present invention may take the form of a computer program product on a computer - usable storage medium having computer - usable program code embodied in the medium . any suitable computer usable or computer readable medium may be utilized . the computer - usable or computer - readable medium may be for example , but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a non - exhaustive list ) of the computer - readable medium would include the following : an electrical connection having one or more wires , a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , a portable compact disc read - only memory ( cd - rom ), an optical storage device , a transmission media such as those supporting the internet or an intranet , or a magnetic storage device . note that the computer - usable or computer - readable medium could even be paper or another suitable medium upon which the program is printed , as the program can be electronically captured , via , for instance , optical scanning of the paper or other medium , then compiled , interpreted , or otherwise processed in a suitable manner , if necessary , and then stored in a computer memory . in the context of this document , a computer - usable or computer - readable medium may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer - usable medium may include a propagated data signal with the computer - usable program code embodied therewith , either in baseband or as part of a carrier wave . the computer usable program code may be transmitted using any appropriate medium , including but not limited to the internet , wireline , optical fiber cable , rf , etc . computer program code for carrying out operations of the present invention may be written in an object oriented programming language such as java ® ( java ® is a trademark or registered trademark of sun microsystems , inc . in the united states and other countries ), smalltalk , c ++ or the like . however , the computer program code for carrying out operations of the present invention may also be written in conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). the present invention is described below with reference to flowchart illustrations and / or block diagrams of methods , apparatuses ( systems ) and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer program instructions . these computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer program instructions may also be stored in a computer - readable memory that can direct a computer or other programmable data processing apparatus to function in a particular manner , such that the instructions stored in the computer - readable memory produce an article of manufacture including instruction means which implement the function / act specified in the flowchart and / or block diagram block or blocks . the computer program instructions may also be loaded onto a computer or other programmable data processing apparatus to cause a series of operational steps to be performed on the computer or other programmable apparatus to produce a computer implemented process such that the instructions which execute on the computer or other programmable apparatus provide steps for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . with reference now to fig1 , there is depicted a block diagram of an exemplary computer 100 , with which the present invention may be utilized . computer 100 includes a processor unit 104 that is coupled to a system bus 106 . a video adapter 108 , which drives / supports a display 110 , is also coupled to system bus 106 . system bus 106 is coupled via a bus bridge 112 to an input / output ( i / o ) bus 114 . an i / o interface 116 is coupled to i / o bus 114 . i / o interface 116 affords communication with various i / o devices , including a keyboard 118 , a mouse 120 , a compact disk - read only memory ( cd - rom ) drive 122 , and a flash memory drive 126 . the format of the ports connected to i / o interface 116 may be any known to those skilled in the art of computer architecture , including but not limited to universal serial bus ( usb ) ports . computer 100 is able to communicate with a server 150 via a network 128 using a network interface 130 , which is coupled to system bus 106 . network 128 may be an external network such as the internet , or an internal network such as an ethernet or a virtual private network ( vpn ). a hard drive interface 132 is also coupled to system bus 106 . hard drive interface 132 interfaces with a hard drive 134 . in one embodiment , hard drive 134 populates a system memory 136 , which is also coupled to system bus 106 . system memory 136 is defined as a lowest level of volatile memory in computer 100 . this volatile memory may include additional higher levels of volatile memory ( not shown ), including , but not limited to , cache memory , registers , and buffers . code that populates system memory 136 includes an operating system ( os ) 138 and application programs 144 . os 138 includes a shell 140 , for providing transparent user access to resources such as application programs 144 . generally , shell 140 ( as it is called in unix ®— unix is a registered trademark of the open group in the united states and other countries ) is a program that provides an interpreter and an interface between the user and the operating system . shell 140 provides a system prompt , interprets commands entered by keyboard 118 , mouse 120 , or other user input media , and sends the interpreted command ( s ) to the appropriate lower levels of the operating system ( e . g ., kernel 142 ) for processing . as depicted , os 138 also includes kernel 142 , which includes lower levels of functionality for os 138 . kernel 142 provides essential services required by other parts of os 138 and application programs 144 . the services provided by kernel 142 include memory management , process and task management , disk management , and i / o device management . note that unix ® is merely an exemplary os that can be utilized by the presently described computer 100 , which may utilize any other appropriate os , including , but not limited to , windows ® ( windows ® is a registered trademark of microsoft , inc . in the united states and other countries ), linux ® ( linux ® is a registered trademark of linus torvalds in the united states and other countries ), etc . application programs 144 include a browser 146 . browser 146 includes program modules and instructions enabling a world wide web ( www ) client ( i . e ., computer 100 ) to send and receive network messages to the internet . computer 100 may utilize hypertext transfer protocol ( http ) messaging to enable communication with server 150 . application programs 144 in system memory 136 also include an enterprise computer system optimizer ( ecso ) 148 . ecso 148 is software that performs the functions described in the figures below . in one embodiment , computer 100 is able to download ecso 148 from service provider server 150 , including in an “ on demand ” basis . in another embodiment , service provider server 150 performs all of the functions associated with the present invention ( including execution of ecso 148 ), thus freeing computer 100 from using its own resources . note that ecso 148 is able to monitor activities , as described below , or an enterprise computer system ( ecs ) 152 , which is coupled to computer 100 either directly via the network interface 130 , or indirectly via the network 128 . ecs 152 is preferably an enterprise system that is made up of multiple computers , servers , storage devices , printers , etc . that utilize some or all of the architecture shown for computer 100 . thus , computer 100 functions as a monitoring computer that oversees the ecs 152 in a manner described below , and then creates an optimized architecture framework for ecs 152 using replacement components in the architecture of ecs 152 . the hardware elements depicted in computer 100 are not intended to be exhaustive , but rather represent and / or highlight certain components that may be utilized to practice the present invention . for instance , computer 100 may include printers , alternate memory storage devices such as magnetic cassettes , digital versatile disks ( dvds ), bernoulli cartridges , and the like . these and other variations are intended to be within the spirit and scope of the present invention . with reference now to fig2 , a high - level flow chart of exemplary steps taken to optimize an enterprise computer system in order to create an improved architecture framework is presented . as depicted in initial block 202 , the process may begin by assigning team members to enterprise architecture focus areas ( fas ). these fas focus on business pain points , which have been previously identified , by a computer such as computer 100 , for an enterprise computer system such as ecs 152 shown in fig1 . pain points are defined as conditions that lead to a reduced efficiency of total operations of the ecs 152 . examples of such pain points in ecs 152 that are identified computer 100 include , but are not limited to , the following : computer repair work orders — ecso 148 , shown in fig1 , may identify a history of repair work orders for elements within ecs 152 . this history may be stored in a database within computer 100 , and may be identified by flags in the database . load balancing — ecso 148 may also identify excessive or improper load balancing between components within ecs 152 . for example , if a first server has to help a second server beyond some pre - defined limit set by ecso 148 , then this indicates that there is some type of operational deficiency in the second server , which is not able to handle its own assigned workload . bottlenecks — ecso 148 may also identify work and / or data transmission bottlenecks between components of ecs 152 . for example , ecso 148 may monitor one or more processors found in ecs 152 that have a recorded history of stalls that have occurred due to waiting for processing results from a particular processor that is repeatedly slow to handle requested jobs , such as a co - processing job . similarly , a particular piece of software may be identified in ecs 152 that has a history of causing other software components ( applications , routines , etc .) to stall . for example , web pages running in ecs 152 may have to wait repeatedly for a media file that is slow to upload into the web pages . e - mail failures — ecso 148 may also identify e - mail failures that repeatedly occur within ecs 152 . ecso 148 can identify the root cause of such failures ( e . g ., mistyping of e - mail addresses by users , exceeding daily e - mail usage limits set by a service , exceeding attachment limits for attachments to an e - mail , hardware failures in an e - mail server , etc .) by the use of flags , error messages , etc . that are interpreted by ecso 148 . unauthorized computer usage — ecso 148 can monitor for and detect improper computer usage , such as downloading games , video clips , etc . that cause the system to slow down , using resources of ecs 152 for personal use , including voice over ip ( voip ) phone calls , etc . besides the pain points that are identified by computer 100 , human team members in the fas can also identify pain points , which are then input into computer 100 , which utilizes software logic to create optimization solutions . examples of pain points identified by team members include , but are not limited to , the following : building layout faults — these problems include those identified by a risk analysis performed by the team members . such a risk analysis may identify an improper design and / or layout of a building in which employees of the enterprise utilize computer equipment . this improper design / layout may lead to supply deliveries of physical products ( i . e ., paper , drinks , etc .) being dropped against sensitive computer equipment ; botanical plants being positioned over sensitive computer equipment , such that watering the plant may result in water overflow that damages the equipment ; sensitive equipment being stored in a basement that is prone to flooding ; etc . language , environmental and cultural issues — besides issues such as language barriers ( e . g ., supplying an english qwerty keyboard to a user who writes in a cyrillic - based language ), other cultural , language and environmental issues may also arise , particularly in third world countries . for example , power outages in third world countries are often common . if unaddressed ( e . g ., by a long - term uninterruptable power supply ( ups ) such as a diesel - powered generator ), these power outages may cause repeated problems . similarly , a third - world environment may be particularly sandy , dusty , humid , etc ., which will impact on computer components if not protected against . furthermore , citizens of any country may adhere to religious / cultural practices that may raise a conflict with how a computer system is to be used / maintained , such as prohibitions against working at certain times or on certain days , etc . note that the team , which is referenced in block 202 , is made up of multiple team members , which have been qualified by ecso 148 according to each person &# 39 ; s experience , training and performance grades . note again , however , that while team members performs some of the overseeing duties required by the present invention , most of the processes must be performed by a computer , due to a requirement to automatically process and analyze pain point signals ( e . g ., flags ), process extremely complex and numerous signals from a large number of components in the ecs 152 being evaluated , etc . with reference to block 204 of fig2 , the computer 100 ( and , alternatively , members of the team ) then researches and documents the pain points of the system ( including , but not limited to , those pain points described above ). for example , the computer 100 can crawl databases , e - mails , alarm points , etc . to quickly identify all components that are underperforming or nonperforming . this process leads to a pinpoint identification of which component within the ecs 152 is causing or experiencing ( or may cause or experience in the future ) the pain point ( s ) identified in the process depicted in block 204 . as depicted in block 206 , once the candidate components that are causing / experiencing or may in the future cause / experience the pain points are identified , a simulation of the ecs 152 is launched using simulated replacement components for the candidate components that have been identified as pain producers / experiencers . this simulation is a software simulation of all components , both hardware and software , found in the ecs 152 . as depicted in block 208 , the computer and / or team then review the software simulation to determine if the pain points have been removed . this review includes using new components , preferably in a hands - on manner by team members if technically feasible , in order to confirm that the new components do not violate any concern or cause any of the pain points described above . after the team and computer 100 fine tune the selection process for the new components ( block 210 ), actual hardware / software that was modeled by the simulated replacement components are then installed into the physical ecs 152 . at that point ( block 212 ), the computer 100 finalizes the replacement components by relabeling them and their subcomponents ( which may not be new ). computer 100 then monitors the ecs 152 to determine if any new pain points ( which were not previously recognized and / or defined ) have occurred , or if any old pain points still remain in the originally troublesome component or any other component ( which was previously not experiencing pain ). thereafter , computer 100 creates an improved framework for ecs 152 that uses the new components . that is , by populating an original architecture framework with the new components , a new architecture framework is defined according to the functionality of , features of and new interrelationships created by the new components . as described herein , the present invention defines a novel approach to defining an improved framework using a “ bottom up ” approach , in which the new components in the architecture set the definition for the new architecture framework . this allows a monitoring computer to automatically upgrade the architecture framework of a system that is under review , thus allowing a system engineer to focus on root causes of pain points and to be involved in the selection of needed upgrade components . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . having thus described the invention of the present application in detail and by reference to preferred embodiments thereof , it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims . | 6 |
hereinafter , the present invention will be explained in more detail with reference to examples . 7 . 96 ml ( 58 mmol ) of triethylaluminum is dissolved in 24 ml of tetrahydrofuran to obtain a 25 vol % solution thereof . with stirring the solution at - 20 ° c . is added into a solution of 8 . 825 g of m - anisic acid and 8 . 222 g of 3 - ethoxy propionic acid ( epa ) in 40 ml of tetrahydrofuran dropwise in a nitrogen atmosphere . after completion of the addition , the solution is kept stirred for about 1 hr at room temperature . the system is cooled again to - 20 ° c ., and a solution of 1 . 044 g of water in 10 . 6 ml of tetrahydrofuran is added in it dropwise under agitation . after completion of the addition , the solution is kept stirring at room temperature for a few hours . thereafter , the products formed are precipitated in a large excess of hexane , filtrated , and dried in vacuo , to give a high polymer . the high polymer thus obtained is dissolved in xylene containing 10 wt % of methanol to form a thick solution of 30 wt % of the solute . the thick solution is taken into a 5 ml injector made of polyethylene , and left for a few hours for deaeration . the injector is fitted with a short severed injection needle of about 3 mm in length and about 0 . 7 mm in inner diameter . subsequently , the thick high polymer solution is extruded from the injector through the injection needle , and the extrudate was wound at room temperature to obtain a continuous fiber of about 100 μm in diameter . by drying the fiber in vacuum , the solvents are completely removed from the fiber . from the data of dta and tga , the thermal decomposition of the polymer begins around 220 ° c . then , the fiber is cut into a length of about 10 cm , inserted in an insulative tube of aluminum oxide of an inner diameter of 0 . 8 mm and a length of 10 cm , and pyrolyzed to 600 ° c ., 800 ° c ., 1 , 000 ° c ., or 1 , 200 ° c . in nitrogen atmosphere at a temperature raising rate of 10 ° c ./ min . on the alumina fibers thus obtained , temperature dependency of electrical conductivity σ ( s · cm - 1 ) is measured by four terminals method as a function of temperatures ranging from room temperature to 380 ° c . by applying an alternating current of 100 khz . the results are shown in the following table 1 and the attached fig1 . table 1______________________________________electrical conductivity of aluminous fiber measuring temperature (° c . ) firing electrical conductivitytemperature σ ( s · cm . sup .- 1 )(° c .) 30 100 200 300 380______________________________________ 600 0 . 07 0 . 07 0 . 07 800 2 . 88 4 . 58 7 . 48 11 . 6 15 . 01 , 000 3 . 75 4 . 41 6 . 17 13 . 4 30 . 01 , 200 14 . 1 14 . 8 10 . 6 11 . 4 78 . 3______________________________________ not measured as seen clearly from the above table 1 , the electrical conductivity of the fibers corresponds to that of a semiconductor at any pyrolysis temperatures . the electrical conductivity of the alumina fibers obtained by the pyrolysis up to the temperatures not exceeding 800 ° c . increases monotonously with the increase of the measuring temperature . however , the alumina fibers obtained by pyrolysis up to 1 , 000 ° c . or 1 , 200 ° c . show rapid increases of the electrical conductivity at measuring temperatures of 300 ° c . or higher . when compared the case ( symbol in fig1 ) of the alumina fiber obtained from a precursor poly [( acyloxy ) aloxane ] comprising epa and aliphatic carboxylic acid as ligands with the case ( symbol ∘ in fig1 ) of the alumina fiber obtained from a precursor poly [( acyloxy ) aloxane ] comprising epa and aromatic carboxylic acid as ligands , the fiber of the latter case obtained from poly [( acyloxy ) aloxane ] having the incorporated aromatic ring at the side chain shows always an effective improvement of the electrical conductivity even when prepared by pyrolysis at the same conditions . from these facts , it is understood that a phase of carbon resulting from the organic side chains is existent in the matrix of aluminum oxide . 7 . 96 ml ( 58 mmol ) of triethylaluminum is dissolved in 24 ml of tetrahydrofuran to obtain a 25 mol % solution . to the solution agitated at - 20 ° c . is added dropwise a solution of 8 . 825 g of p - anisic acid and 8 . 222 g of 3 - ethoxy propionic acid in 40 ml of tetrahydrofuran in nitrogen atmosphere . after completion of the addition , the solution is agitated for about 1 hr at room temperature . the system is cooled to - 20 ° c . again , and a solution of 1 . 044 g of water in 10 . 6 ml of tetrahydrofuran is added dropwise under a stirring . after completion of the addition , the mixed solution is kept stirred for a few hours at room temperature under agitation . thereafter , the product formed is precipitated in a large excess of hexane , filtered , and dried in vacuo to give a high polymer . the high polymer thus obtained is dissolved in toluene containing 10 wt % of methanol to form a thick solution of 30 wt % of the solute . the thick solution is used as a spinning solution and a continuous fiber of a diameter of about 100 μm is prepared by a dry spinning method , in which a good spinnability is shown . the fiber is pyrolyzed to 600 ° c ., 800 ° c ., 1 , 000 ° c . or 1 , 200 ° c . in nitrogen atmosphere under the same conditions with those of example 1 , to give alumina fibers . the electrical conductivity of the alumina fibers thus obtained are substantially same with the values of example 1 . 7 . 96 ml { 58 mmol ) of triethylaluminum is dissolved in 24 ml of tetrahydrofuran to obtain a 25 vol % solution . with stirring the solution at - 20 ° c . is added dropwise a solution of a mixture of 8 . 825 g of p - anisic acid and 6 . 852 g of 3 - ethoxy propionic acid in 35 ml of tetrahydrofuran in nitrogen atmosphere . after completion of the addition , the solution is agitated for about 1 hr at room temperature . the system is cooled to - 20 ° c . again , and a solution of 1 . 044 g of water in 10 . 6 ml of tetrahydrofuran is added dropwise under agitation . after completion of the addition , the solution is kept stirring at room temperature for a few hours . then , the system is heated to 70 ° c ., and a solution of 1 . 370 g of 3 - ethoxy propionic acid in 10 ml of tetrahydrofuran is added dropwise in it under agitation . after completion of the addition , the mixture is agitated for a few hours at room temperature . thereafter , the product formed is precipitated in a large excess of hexane , filtered , dried in vacuo , to give a high polymer . the high polymer thus obtained is dissolved in xylene containing 10 wt % of methanol at room temperature to obtain a thick solution of 30 wt %. the thick solution is used as a spinning solution to easily obtain a continuous fiber of a diameter of about 100 μm by a dry spinning method , in which a good spinnability is shown . the fiber is pyrolyzed to 600 ° c ., 800 ° c ., 1 , 000 ° c . or 1 , 200 ° c . in nitrogen atmosphere under the same conditions with those of examples 1 and 2 , to give alumina fibers . the electrical conductivity of the alumina fibers thus obtained is substantially the same values as those of example 1 . 7 . 96 ml ( 58 mmol ) of triethylaluminum in 24 ml of tetrahydrofuran to obtain a 25 vol % solution . with stirring the solution at - 20 ° c . is added dropwise a solution of 17 . 75 g of p - anisic acid in 40 ml of tetrahydrofuran in nitrogen atmosphere to form white precipitates . after completion of the addition , the solution is agitated for about an hour at room temperature . the system is cooled to - 20 ° c . again , and a solution of 1 . 044 g of water in 10 . 6 ml of tetrahydrofuran is added dropwise under agitation . the system turns gelatinous and after completion of the addition , the mixture is left at room temperature for a few hours . subsequently , the product is precipitated in a large excess of hexane , filtered , dried in vacuo , to give a high polymer . the high polymer thus obtained is insoluble in organic solvents , and incapable of preparing a thick solution thereof having a good spinnability . 7 . 96 ml ( 58 mmol ) of triethylaluminum is dissolved in 24 ml of tetrahydrofuran to obtain a 25 vol % solution . with stirring the solution at - 20 ° c . is added dropwise a solution of a mixture of 4 . 292 g of propionic acid not having an aromatic ring and 8 . 222 g of 3 - ethoxy propionic acid in 14 ml of tetrahydrofuran in nitrogen atmosphere . the system is cooled to - 20 ° c . again , and a solution of 1 . 044 g of water in 10 . 6 ml of tetrahydrofuran is added under agitation . after completion of the addition , the mixture is kept stirring at room temperature for a few hours . thereafter , the product formed is precipitated in a large excess of hexane , filtered , and dried in vacuo , to give a high polymer . the high polymer thus obtained is dissolved in toluene containing 10 wt % of methanol to obtain a thick 30 wt % solution . the thick solution is used as a spinning solution , and a continuous fiber of a diameter of about 100 μm is spun by dry spinning , in which a good spinnability is shown . the fiber is pyrolyzed to 800 ° c . in a nitrogen stream at a temperature raising rate of 10 ° c ./ min . the electrical conductivity of the alumina fiber thus obtained is 1 / 100 of that of the alumina fiber obtained by pyrolysis up to 800 ° c . in example 1 . as apparent from the foregoing descriptions , the electrically conductive alumina fiber can be used as an electric or electronic material for connection of electric or electronic circuits at critical limited states , particularly at elevated high temperature state , which are hitherto impossible to use such material for the electrical connection . in addition , the alumina fiber does not show an increase of the electric resistance at high temperatures which is an electric property of metals , so that it is an excellent electric or electronic material . moreover , the alumina fiber is derived from a precursor which is soluble in organic solvents , so that it can be produced to various shapes not limited to fibers . although the present invention has been explained with specific embodiments and numeral values , it is of course apparent to those skilled in the art that various changes and modifications are possible without departing from the broad spirit and aspect of the present invention as defined in the appended claims . | 2 |
as previously indicated , the present invention constitutes an improvement upon the compact , portable and lightweight opaque projectors particularly shown in u . s . pat . no . 4 , 468 , 105 and pending u . s . pat . app . ser . no . 704 , 398 ( the latter disclosure being incorporated by reference herein ). while the following detailed description of an embodiment of the invention is taken in regard to such an opaque projector , it will be understood that the present invention is not necessarily so limited in application , but may find utility in other image projection systems where it is desired to dissipate heat from an enclosed illumination chamber in a controlled manner . referring to fig1 the opaque projector 10 is shown in an open ( operation mode ) configuration . the projector has a rectangular base 11 , a pair of lateral side panels or sidewalls 12 , 13 ( which extend generally perpendicularly to the plane of the base 11 when in a closed configuration ), a rear or back side 15 , a front side 16 , and a top panel 18 . the structural housing for the projector 10 , which is formed of sheet aluminum , is essentially comprised of the base 11 , top panel 18 , lateral sidewalls 12 , 13 and a back sidewall 15a and front sidewall 16a ( fig2 ). this structural housing for the projector generally defines an illumination chamber 20 therein . when closed ( transport mode ), the projector has a rectangular box shape , and is of a compact size having a vertical height of about twenty inches , a length ( front to back ) of about fifteen inches , and a width ( side to side ) of about eight and a half inches . the side panels 12 , 13 are pivotally connected to the top 18 of the projector to permit the panels to be pivoted between closed and open positions . as shown in fig3 the projector 10 includes a graphic platen 22 which is located above the base 11 . the platen 22 includes two platen extension members 23 , 24 which are connected by hinges to respective lateral sides of the platen 22 . the platen 22 and its extension members are covered with a dark colored fabric layer 21 . in the operation mode , these extension members 23 , 24 are folded down ( i . e ., outwardly ) to thereby increase the effective size of the graphic platen . it will be noted that the side panels 12 , 13 pivot outwardly to accommodate this increased platen surface , while still serving to enclose the interior 20 of the projector . in use , access to the platen 22 to place a graphic 27 thereon , for example , is obtained through access panels 25 , 26 which are provided in side panels 12 , 13 , respectively , proximate the platen . these access panels 25 , 26 are hinged to open outwardly , such that they can be raised to gain access to the platen 22 , and then closed to prevent light from escaping from the projector interior . the light source for illuminating a graphic placed on the platen 22 comprises a plurality of lamps 30 , such as general electric enx360w , 82v lamps . four lamps are used herein which are arranged in sets of two lamps . the sets of lamps 30 are mounted proximate the joint between the top 18 of the projector and the front and rear sidewalls 15a , 16a ( fig3 and 4 ) in respective lamp housings 32 , 33 made of sheet metal . the bottom of each of the housings 32 , 33 is open to permit the lamps 30 to shine onto the graphic platen 22 . it will be noted that the lamps 30 are slightly angled ( fig4 ) to better focus the light onto the platten &# 39 ; s surface , with less spill toward the adjacent sidewall 15a , 16a . the general illumination pattern for the lamps is diagrammatically illustrated by the straight broken arrows . the lamp housings 32 , 33 also have an outboard facing opening 35 , 36 , respectively , for air circulation through the lamp housing in a manner which will be described in further detail hereinafter . it will , however , be noted that airflow about the lamps 30 is from air drawn through the lower openings in the lamp housings as well as through outboard openings 35 , 36 . this air flow is generated by fans 40 , 41 . fans 40 , 41 are mounted in the top 18 of the projector immediately above the lamps 30 , with one fan used in connection with each set of lamps . the fans 40 , 41 serve to withdraw heated air from the illumination chamber 20 of the projector as well as from the immediate vicinity of the lamps , where it is then exhausted to atmosphere through vents 42 , 43 provided in the top 18 of the projector housing . a sprite fan available from rotron , inc . of woodstock , n . y . is used herein for each of the fans 40 , 41 . light from the lamps 30 illuminates the graphic 27 on the graphic platen 22 . the image of the illuminated graphic is then magnified by projection lens 44 , which projects the light upwardly to a reflecting mirror structure 45 , which in turn reflects the image to a receiving surface , such as a screen , for viewing . the mirror structure 45 is removably mounted to the top 18 of the projector , and its structure and manner of mounting are more particularly described in the aforementioned patent application ser . no . 704 , 398 . in this regard , it will be understood that reference can be made to that application , as well as u . s . pat . no . 4 , 468 , 105 , for further and more specific detail concerning the general structure and operation of the opaque projector of this particular embodiment . as previously noted , an enclosed interior illumination chamber 20 is generally defined within the projector housing by the front and rear sidewalls 15a , 16a , side panels 12 , 13 , base 11 and top 18 . when the projector is operated , a fairly substantial amount of heat is generated by the lamps 30 in the form of heat generated directly by the lamps ( e . g ., resistive heating of the lamps ) as well as from the light energy which is absorbed by the interior of the housing . it is the objective of this invention to dissipate this heat in a controlled manner which neither disturbs the graphic being displayed , nor renders the projector housing uncomfortable to the touch . with reference to fig3 and 4 , heat dissipation within the interior chamber 20 is primarily effected through the use of a pair of air cooled heat sinks 50 , 51 . the heat sinks 50 , 51 comprise thin sheet aluminum panels that are coated with a flat black anodized finish which is highly absorptive of infrared and visible radiation . heat sink panel 50 is mounted to the inboard side of rear sidewall 15a by fixing it with screws 54 to a channel member 53 . the channel member 53 is located approximately in the middle of the back sidewall and extends generally vertically along substantially its entire length . the channel member 53 serves to space the heat sink panel 50 approximately 5 / 8 of an inch from the adjacent rear sidewall 15a . this forms an air channel or air plenum between the heat sink panel 50 and back sidewall 15a ; this plenum is effectively divided by the channel member 53 . it will be noted that this air plenum formed between the heat sink panel 50 and the back sidewall 15a is laterally open to permit the free movement of air from the interior illumination chamber 20 around the backside of the heat sink 50 to dissipate heat from the heat sink , as detailed below . the lateral sides of the heat sink panel 50 are slightly indented along a substantial portion of its height to ensure this free flow of air . it will be understood that heat sink panel 51 is substantially identical to heat sink panel 50 , and is mounted to front sidewall 16a in a like manner through the use of a channel member 55 . also , the channel members 53 , 55 serve a dual function as conduits for electrical wiring used in the projector . heat generated by the lamps 30 within the illumination chamber 20 , by both the air heated by the lamps as well as from the radiation from the lamps , is preferentially absorbed by heat sinks 50 , 51 rather than by the projector housing . heat is removed and dissipated from the heat sink panels 50 , 51 by air cooling of the back sides of the heat sinks panels 50 , 51 . more specifically , the fans 40 , 41 draw air through the lamp housings 32 , 33 through both the lower lamp housing openings as well as the outboard openings 35 , 36 . as indicated by the solid arrows in fig3 and 4 , air is caused to flow from the illumination chamber 20 around the lateral sides of the heat sink panels 50 , 51 where it then passes through the outboard lamp housing openings 35 , 36 , and is then exhausted through the vents 42 , 43 in the top 18 of the projector . this air flow around the back sides of the heat sinks 50 , 51 serves to dissipate the heat absorbed by the heat sinks , maintaining them at an acceptable temperature ( i . e ., around 150 to 160 degrees ). this in turn maintains the temperature of the illumination chamber 20 and the projector 10 as a whole within acceptable operating limits . formation of this open - sided extended air plenum with the heat sinks 50 , 51 also does not disturb the graphic placed on the graphic platen 22 . that is , the airflow previously described is gentle enough to obviate need of any anchor or the like for the graphic , even in a compact opaque projector such as this . the function of the heat sinks 50 , 51 is further enhanced by coating the interior of the side panels / sidewalls 12 , 13 with a matte finish reflective surface . as a result , much of the incident radiation on these side panels is reflected back into the chamber 20 , where it can be absorbed by the heat sinks 50 , 51 . this serves to prevent the side panels 12 , 13 from becoming objectionably warm during operation . it further permits the use of a thin single sheet of aluminum for these side panels 12 , 13 without need for additional cooling means or insulation for these side panels , contributing to the light weight structure of the projector . at the same time , the matte finish prevents strong extraneous reflections which would interfere with the image projecting capability of the projector . the side panel finish , therefore , works in conjunction with the heat sinks 50 , 51 to keep the projector housing at a manageable temperature . it will be further noted that the fans 40 , 41 draw heated air from the vicinity of the bottom of lens 44 thereby preventing heated air from collecting in this area . in this regard , lens 44 has a tubular plastic housing 44a within which the main lens structure 44b is carried in threaded engagement ( lens structure 44b being screwed in or out of the tubular housing to focus the projected image ). the tubular housing 44a is fixed to a lens support plate 46 , which in turn is fixed to the projector housing . elongated arcuate shaped cut - outs ( not shown ) are provided in the support plate 46 around the lens 44 through which air is drawn by the fans and then exhausted . in its preferred form , the projector 10 also includes a passive air cooling system for the exterior or outboard sides of the front and rear sidewalls 15a , 16a . this comprises a pair of rigid plastic panels 60 , 61 which respectively cover substantially all of the outboard sides of the front and back sidewalls 15a , 16a . an abs plastic commonly available has been used herein for the panels 60 , 61 , which are formed by extrusion . the inboard facing surface of each plastic panel 60 , 61 is provided with a plurality of vertically extending ribs 63 ( best seen in fig2 ) which are laterally spaced apart across the panel . these ribs 63 serve to space the main portion of the panel 60 , 61 about 3 / 32 of an inch away from the exterior ( outboard ) surface of the respective adjacent sidewall 15a , 16a . the ribs 63 define passive air spaces or channels 64 between the outboard side of the front and rear sidewalls 15a , 16a and the main portion of the plastic panels 60 , 61 . it will be understood that the front and rear sidewalls 15a , 16a become warm during operation by virtue of heat conduction through the aluminum housing , as well as from the heated air which circulates through the plenum formed between the heat sink panels 50 , 51 and the inboard side of the front and rear sidewalls 15a , 16a . air in the channels 64 heated by the front and rear sidewalls 15a , 16a rises out of the open upper end of the channels 64 , with cooler air entering the open lower end of the channels . this provides convective cooling for the outboard side of the front and rear sidewalls 15a , 16a . the plastic panels 60 , 61 further provide a degree of thermal insulation for the exterior of the sidewalls 15 , 16 . a combination of this passive cooling and the insulative feature of the plastic panels 60 , 61 serves to maintain the exterior of the sidewalls 60 , 61 within a temperature range which is not uncomfortable to the touch during operation . in making the projector 10 as compact as possible , the fans 40 , 41 are located adjacent and directly above a respective set of lamps 30 in this embodiment . because of the proximity of the fans 40 , 41 to the lamps , a certain amount of direct heat transfer can occur from the lamps to the fans , and particularly the fan motors 40a , 41a , which can impede the operation of the fans and reduce fan life . to prevent this direct heat transfer to the fan motors 40a , 41a , a disk - shaped heat shields 68 , 69 ( fig3 and 4 ) are mounted in the air gap between the bottom of a respective fan 40 , 41 and the tops ( or fixtures ) of the adjacent lamps . the disks 68 , 69 are stamped from thin sheet aluminum in a diameter about equal to that of the fan motor , and have a pair of bent ears or brackets 70 which extend from opposite sides of the disk . the brackets 70 are fixed by screws to the frame / housing of a respective fan , with a disk 68 , 69 suspended beneath the respective fan motor 40a , 41a the manner described . an air gap of about 1 / 2 of an inch between the disk and the fan motor bottom is used herein . the disk heat shields 68 , 69 serve to absorb a substantial portion of the direct heat from the lamps 30 , with the disks being cooled by heat dissipation through conduction to the projector housing , as well as by the airflow around the disks caused by the fans . it will thus be seen from the foregoing that a thermal management system for a compact , lightweight opaque projector is provided primarily through the use of specialized air cooled heat sinks adjacent the front and back sidewalls 15a , 16a of the enclosed interior illumination chamber 20 , which absorb and dissipate the majority of the heat generated by the lamps 30 in this chamber in a controlled fashion . the controlled dissipation is achieved by causing air to flow from the interior chamber through an air plenum formed between the back sides of the heat sink panels 50 , 51 and the adjacent sidewall ; which draws heat from the heat sinks and exhausts it out of the top of the projector . the side panels 12 , 13 of the projector are further covered with a matte finish to direct stray radiation from the lamps onto the heat sinks for absorption and dissipation . operating in conjunction with the heat sinks 50 , 51 are passive air channels 64 formed by plastic panels 60 , 61 mounted on the outboard sides of the front and back sidewalls , which serve to provide a cooling convective flow of air over the exterior of the sidewalls 15a , 16a . the plastic panels 60 , 61 also thermally insulate these portions of the projector . disk heat shields 68 , 69 are additionally provided to deflect and dissipate direct heat transfer which would otherwise occur from the lamps 30 to the adjacent fans 40 , 41 . thus , while one embodiment of the present invention in a thermal management system for an opaque projector has been described herein , modifications of structure , elements , materials , components and the like will be recognized by , those skilled in the art without departing from the scope of the invention claimed herein , and all such modifications , refinements and the like are intended to be covered by the following claims . | 6 |
a first embodiment of this invention is shown in fig3 , 5 , 6 and 7 in which reference numeral 30 designates a gong . the gong 30 is made of iron in the form of a cup or a semisphere . a mounting section 31 protruding from the central portion of the inner wall of the gong 30 is formed in such a shape as it receives around its top edge protrusion 32 a perpendicularly bended plate 33 and a supporting plate 34 , the plates 23 and 34 being fixedly mounted on the top edge protrusion 32 as by a screw 35 which is threaded into a threaded bore 36 formed in the mounting section 31 . the top edge protrusion 32 of the mounting section 31 has substantially rectangular cross section so that it may associate with the corresponding rectangular opening 37 of the bended plate 33 . the supporting plate 34 has a base wall 38 attached to the edge protrusion 32 as by the screw 35 , an adjusting wall 39 made integral with the base wall 38 and formed thereon with an adjusting hole 40 , a supporting wall 41 susceptible of engaging with a supporting plate 42 for supporting the bell assembly to an appropriate location , and a motor mounting wall 43 on which a motor 44 is disposed in proximity arrangement with the bell striking extension 45 formed at the inner surface of the gong 30 . the adjusting hole 40 is adapted to engage with a bolt 46 which passes through hole 47 formed at the corresponding position of the bended plate 33 , and the bolt may be fixed properly as by a nut 48 . the motor 44 mounted on the mounting wall 43 as by a screw 49 has around its shaft 50 , referring to fig7 in detail , a washer 51 , a hammer 52 , and a collar 53 , respectively in assembly order . the motor shaft 50 is fixedly connected to the collar 53 as by the insertion of the shaft 50 in an elongated bore 54 offset from the center of the collar 53 . the hammer 52 is disposed around the collar 53 separated from the collar 53 by in a predetermined space distance ( d ). the hammer 52 is prevented from moving in its position relative to the collar 52 by a rim 55 integrally made at the top edge thereof . the space distance ( d ) together with the offset of the elongated bore 54 is designed to get the maximum volume sound . the operation of the gong striking mechanism thus constructed will be described . upon energization of the motor , its shaft 50 is rotated , and the collar 53 is therefore rotated around its offset bore 54 . as a result , the hammer 52 strikes the gong 30 each time the lobe portion of the eccentric collar 53 i . e ., that portion of the collar furthest away from the offset bore 54 , comes adjacent to the bell striking extension 45 of the gong 30 . upon movement of the hammer 54 away from the extension 45 , the force imparted on the hammer during striking is absorbed in the space distance ( d ), thereby causing no damage to the motor shaft 50 by eliminating the possible bending force applied to the shaft . another embodiment of the invention will be described with reference to fig8 in which reference numeral 80 designates a gong which is made of iron in the form of a cup or a semi - sphere to the first embodiment described above . attached to the motor shaft 81 , of a motor 82 , is a cylindrical cam 83 . around the surface of the cam 83 there is a groove 84 of predetermined size into which the base of a cam follower rod 85 rests . the width of the base of follower rod 85 is narrower than the width of the groove 85 by a preselected amount ( d ). a hammer 86 , fixed to the other end of the rod 85 is used to strike the gong 80 . the bell thus constructed will absorb the striking impact force exerted on hammer 86 and rod 85 by the spaced distance between the base of the rod 85 and the groove 84 . as a result , the impact force imparted to the rod 85 during the bell striking motion is absorbed and causes no damage against the motor shaft 81 , thereby preventing the motor shaft from bending . an another embodiment of the invention is shown in fig9 and 10 . in this embodiment , a motor 91 is secured at the center of an inner wall of a gong 92 as by a fixing plate 93 . fixedly attached to the motor shaft 94 is a bevel gear 95 which engages with a second bevel gear 96 to transmit the rotational movement of the motor shaft 94 to a pivotting shaft 97 perpendicular to the axial direction of the motor shaft 94 . the pivoting shaft 97 is rotationally held between supporting plates 98 , 99 . a speed changing gear 100 mounted around the pivoting shaft 97 is urged to rotate so as to further rotate another speed changing gear 101 mating with the gear 100 . a driving shaft 102 , to which the gear 101 is fixed , forces pivoting plates 103 to rotate circular hollow hammers 104 , 105 are held symmetrically apart from shaft 102 and adjacent to the both ends of the plates 103 . the hammers 104 , 105 are held to pivoting plates 103 by means of central cores 106 which are offsset by distance ( d ) from the inner wall 107 of each of hollow hammers 104 , 105 such that the space distance ( d ) between their central core 106 and the inner wall 107 of the hammers may absorb impact force exerted on the hammers 104 , 105 during bell striking operation . as is described above , it is a feature of the invention to provide a bell striking mechanism in which driving power for a hammer to strike a gong is supplied from a motor by a conversion means rotationally connected directly or indirectly to the motor shaft . the conversion means preferably comprises an eccentric cylinder fixed to the motor shaft , and the hammer made of hollow cylinder in spaced arrangement with this eccentric cylinder so that impact force imparted on the hammer during bell striking operation may be absorbed to some extent , thereby causing no damages to the motor shaft . having described our invention as related to the embodiment shown in the accompanying drawings , it is our intention that the invention is not limited by any of the details of description , unless otherwise specified , but rather is construed broadly within its spirit and scope as set out in the accompanying claims . | 6 |
referring now to fig1 of the drawings , the machine there illustrated comprises a stand 1 on which the remaining parts including the moulding press 16 , 17 , 18 , clay blank extruder 2 , 3 , 4 , 5 , 6 , a buffer storage platform 7 , 9 , guiding structure for foil and clay blanks 12 , clay blank feeding mechanism 11 and a path for mould clay products and foil which is to be disposed of 19 , of the machine are mounted . these include an extrusion cyclinder 2 provided at one end with an extrusion nozzle 3 , the opposite end of the cylinder at flange 4 , on that side which is opposite to the side visible in the drawing , being hinged to a backing flange 5 through which passes the piston rod of the displacement piston for forcing clay in the extrusion cylinder towards the nozzle . this piston rod is driven by a piston of the hydraulic piston cylinder device 6 . the hinging at 4 permits the cylinder to be swung open sideways for the purpose of being charged with a premoulded , closely fitting , cylindrical block of clay ( not shown ). the block of clay is preferably moulded by a vacuum pressing device not forming part of the present apparatus . the piston - cylinder device 6 is actuated to extrude clay through nozzle 3 in the form of a strand of suitably selected cross section , which strand is deposited on the collecting chute 7 ( see also fig2 ) of a collecting and storing ( buffer ) device for the extruded clay . appropriate lengths of clay strand deposited on collecting platform 7 are cut off manually and are stored ( as indicated in dotted lines 8 ) on the inclined storage chute 9 of the device , ( see fig2 ). such strands are then transferred manually as required to the feeder chute 10 which in the preferred embodiment takes the form of a roller conveyor chute by virtue of its surface being composed of a large number of plastics rollers ( not shown ) on which the clay strands can easily be moved in the direction of further travel , i . e . now in the right hand direction . this further travelling is brought about by a feeder device 11 to be described in greater detail further below , which is adapted to advance the strand of clay discontinuously , but in synchronisation with the operating cycle of subsequently following moulding means by predetermined distances during any stroke of the device 11 . the strand then passes through a guide device 12 which will be described below with reference to fig5 . this guide device 12 simultaneously acts as a guide for a ribbon 13 of plastics foil fed from a reel 14 and which in the guide device 12 is formed into a channel embracing the strands of clay . the next item of the machine is the moulding press 15 , parts of which will be described in greater detail with reference to fig6 to 9 . the moulding press comprises two accurately balanced and synchronised pneumatic cylinders 16 , provided respectively above and below the pressing mould 17 , consisting of two mould sections in the form of metal dies movable towards one another by the jacks 18 driven by the pneumatic cylinders 16 , the dies sliding on one side along a backplate as illustrated in fig6 to 9 . in the open position of the mould 17 , the clay strand together with the plastic foil embracing it , is forwarded by a distance adapted to bring an adequate body of clay into register with the dies . the mould is then closed under pressure resulting in the moulded body being formed between layers of plastics foil , excess clay being squeezed out of the way into appropriate cavities provided for that purpose in the mould . the mould is then opened and the moulded article , excess clay and plastics foil all advance together from the mould on the conveyor belt 19 , from where an operator picks up the moulded articles , and puts these on a tray for further processing . the excess clay may be recycled , whereas the plastics ribbon goes to waste . referring now particularly to fig3 and 4 of the drawings , the feeding device 11 is mounted on a bracket 20 from which project in the direction of feeding two parallel sliding rails 21 on which a carriage 22 is slidably mounted . the sliding movement of the carriage 22 on the sliding rails 21 is brought about by a pneumatic cylinder 23 ( not shown in fig4 ). the carriage 22 , on one side thereof carries a pair of brackets 24 . the lowermost of these brackets 24 , as shown in fig3 carries the adjustable lower jaw 25 of a gripping device , whereas the upper bracket carries a pneumatic cylinder 26 for actuating the upper jaw 27 of the gripping device . separate from and passing between the brackets 24 , parallel to and on either side of the path of travelling of the strand of clay , are guide baffles 28 . in operation , the carriage 22 at the end of each clay advancing cycle is returned to its starting position close to bracket 20 , actuated by pneumatic cylinder 23 . in order to advance the clay , the jaw 27 is moved downwards by the pneumatic cylinder 26 so as to grip the strand of clay between the jaws 25 and 27 . the carriage is then moved forward by the pneumatic cylinder 23 by a predetermined distance corresponding to the stroke for each cycle , whereupon the pneumatic cylinder 26 is actuated to release the strand , and the carriage is returned to its starting position . this operation is synchronised with the action of the moulding press 15 , 16 , 17 , 18 . the clay advance takes place whilst the mould is open . referring now to fig5 of the drawings , the guide device 12 comprises an outer guide member 29 mounted on a bracket 30 which in turn is slidably mounted in a passage 31 of a mounting base 32 . an inner guide member 33 is mounted on a second bracket 34 , stationarily mounted on the machine table . the inner guide member 33 has a convex shape which , save for a clearance 35 , is complementary to a concave cavity 36 of the outer guide member 29 . in the operating position of the two guide members , their contours combine to form a gap of parabolic outlines serving as a guide passage for the ribbon of plastic foil , thereby to deform the plastic foil into a continuous , u - shaped channel which ( at its open end ) is widest where the ribbon enters the guiding device ( i . e . on the side facing the observer ) and which is narrowest ( dotted line 36a ) on the opposite side where the plastic ribbon leaves the guide device . the inner guide device 33 is provided with a passage 37 of rectangular cross section for the guidance therethrough of the extruded clay strands which , on leaving the guide device is wrapped into the channel formed by the plastic foil . in order to introduce the foil into the guide device , the bracket 30 is slidably moved to the left hand side in the base 32 , whereby the outer guide member 29 is moved away from the inner guide member 33 , thereby opening up the passage 36 , 35 for the easy introduction of the plastic ribbon . referring now to fig6 to 9 of the drawings , the pressing mould consists of a lower mould section in the form of the metal die 39 and an upper mould section similarly in the form of a metal die 40 . these dies are shaped to define the outlines of a mould cavity 41 by means of narrow ridges 42 outside which there are cavities 43 for the accommodation of excess clay left over after the moulding operation . in the example shown the mould is designed for the moulding of handles for crockery such as cups . for that purpose , one side of the mould is defined by the machined surface 44 of stationary back plate 45 . as shown more clearly in fig7 and fig9 the machined surface 44 , in the region of an opening 46 left on one side between the dies 39 , 40 has a convex curvature . this convex curvature corresponds to the convex curvature of the cup to which the handle is to be fitted . accordingly , the moulded handle is given a contact face of a concave curvature complementary to the convex curvature of the cup and can thus be fitted to the cup directly without further shaping . the plastic foil ensures a ready release of the moulded articles and contributes to a long life of the steel dies . heating of the dies is no longer necessary . the plastic ribbon simultaneously serves to transport the clay and subsequently the moulded article through the machine . with this comparatively simple construction , throughputs of 60 pressing strokes per minute have been attained . a single operator can operate the machine , although two operators are to be employed if very high throughput capacities are aimed at . in a manner known per se , the machine may be provided with safety switches , which automatically switch off the machine and let it return to its starting position in the event of operating faults . also , in the preferred embodiment the moulding press 15 is provided with a cover ( not illustrated ) which , unless it is properly in position , will cause the automatic switching off of the machine . | 1 |
a preferred embodiment of the present invention will now be described in detail with reference to fig1 ( a )-( e ). ( a ) referring to fig1 ( a ), a field oxide film 2 is first formed on a si substrate 1 to provide an isolation region 2 and an active region 3 . the field oxide film 2 is formed to about 5000 - 6000 å thick using the well - known locos technique at a temperature , for example , 1050 ° c . in the presence of h 2 and o 2 . subsequently , a thin sio 2 layer 4 is formed to about 200 - 300 å thick over the active region 3 by thermal oxidation of silicon at , for example , 1050 ° c . in o 2 atmosphere , or a cvd process using , for example , sih 4 and o 2 , at 800 °- 850 ° c . and 0 . 5 - 2 . 0 torr . ( b ) a first channel doping is performed by implanting p - type ions 5 such as b ( boron ) ions or in ( indium ) ions into the si substrate 1 using the thin sio 2 layer 4 as a screening layer . the implantation is effected orthogonally to the substrate 1 but shallowly , thereby defining the doping depth and the impurity atoms concentration at the center of the channel ( p 1 in fig1 ( e )). conditions for the implantation are selected depending on the characteristics of an intended device . usually the acceleration energy is set to about 30 - 40 kev ; the dosage is set to about 1 - 5 × 10 12 cm - 2 . ( c ) the thin sio 2 layer 4 is removed by , for example , wet etching ( 1 % hf aqueous solution ), and then as shown in fig1 ( b ), a gate oxide dielectric film 6 is grown to a predetermined thickness by thermal oxidation . for example , in a 0 . 5 μm channel process , the gate oxide dielectric film 6 is grown to about 100 - 130 å thick by heating at about 900 °- 1000 ° c . for 0 . 5 - 1 hour . next , as shown in fig1 ( b ) a gate electrode 7 is formed in the following typical manner . a polysilicon layer is first deposited to about 1000 - 4000 å thick by lpcvd process using , for example , sih 4 , at 600 °- 650 ° c . and 0 . 5 torr ; subsequently the polysilicon layer is doped with n - type ions such as phosphorus ions ( acceleration energy : 60 - 80 kev ; dosage : 1 × 10 15 cm - 2 ) so as to lower the resistance of the layer , and ; the thus obtained polysilicon layer is patterned and etched by rie technique ( cl 2 + o 2 + hbr , 20 mtorr ) to form the gate electrode 7 . ( d ) subsequently a second channel doping is performed by implanting p - type ions 8 such as b ions or in ions ( acceleration energy : 30 - 40 kev , dosage : 1 × 10 12 - 10 13 cm - 2 ), using the gate electrode 7 as a mask . the second channel doping together with the first channel doping defines the doping depth and the impurity atoms concentration at the extremes of the channel ( p 2 and p 3 of fig1 ( e )). the doping depth and the impurity atoms concentration can be optimized to reduce short - channel degradation . ( e ) referring to fig1 ( c ), a thin polysilicon layer 9 is depositing to about 200 - 500 å thick by , for example , lpcvd process using sih 4 or the like , at 600 °- 650 ° c . and about 0 . 5 torr . ( f ) on the thin polysilicon 9 , a sio 2 layer is deposited to about 1000 - 2000 å thick by , for example , cvd process using sih 4 + o 2 , at 800 °- 900 ° c . ( g ) referring to fig1 ( d ), the above sio 2 layer and the polysilicon layer 9 are etched , while retaining a portion of them so as to form side walls on opposite sides of the gate electrode 7 , the side wall extensions 10 ( the retained portion of the polysilicon layer 9 ) and the retained sio 2 layer 11 . the etching in this process may be performed as follows . first , the sio 2 layer is etched by rie technique ( chf 3 + cf 4 + ar , 1 torr ) to form the retained sio 2 layer 11 near the gate electrode 7 . subsequently the polysilicon layer 9 is etched by rie technique ( cl 2 + o 2 + hbr , 20 mtorr ) to form the side wall extensions 10 . ( h ) as shown in fig1 ( d ), implantation of n - type ions 12 is performed using the side wall extensions 10 and the gate electrode 7 as a mask to form a source region 13 and a drain region 14 , followed by thermal treatment . in the implantation p ions or as ions , for example , are used as the n - type ions 12 , with acceleration energy : 30 - 50 kev , dosage : 1 - 3 × 10 15 cm - 2 . the thermal treatment is performed at about 800 °- 850 ° c . for 0 . 5 - 1 hour . ( i ) referring to fig1 ( e ), another sio 2 layer 15 as an isolation layer is deposited by , for example , cvd process , followed by thermal treatment ( 850 °- 950 ° c . for 0 . 5 - 1 hour ). then , contact holes are formed and filled with a metal layer 16 to form devices interconnection according to well - known techniques . according to the process of the invention , a mos transistor structure shown in fig1 ( e ) is obtained . by the first and second channel dopings the central portion ( p 1 of fig1 ( e )) is lightly doped so as to enhance the mobility , while the extreme portions ( p 2 and p 3 of fig1 ( e )) of the channel are heavily doped , thereby reducing the depletion areas of the source 13 and the drain 14 . such non - uniform doping is shallowly performed so that the parasitic drain junction capacitance will not increase unnecessarily , whereby the device speed is not lowered . thus , the process of the present invention makes it possible to fabricate mos transistors with a higher yield and low cost in a simpler manner than the prior art methods . as a variation of the technique of the present invention , the ldd mosfet with shallow non - uniformly doped channel can be obtained by using a disposable side - wall spacer . furthermore , the optimization of the device of the present invention can be achieved by varying a thickness of the oxide film of the disposable side - wall spacer of the above ldd mosfet . ( a ) a si substrate was patterned with a resist and heated at 1000 ° c . for 2 hours under oxygen atmosphere to form an isolation region , which was constituted by a field oxide film of about 6000 å thick , and an active region . on the active region a thin sio 2 layer was deposited to about 250 å thick by cvd process using sih 4 + o 2 at 850 ° c . ( b ) a first channel doping was performed by implanting b ions into the active region orthogonally to the substrate with acceleration energy : 30 kev , dosage : 1 × 10 12 cm - 2 , using the thin sio 2 layer as a screening layer . ( c ) the thin sio 2 layer was removed using 1 % hf aqueous solution . thereafter , a gate oxide dielectric film was grown to 120 å thick on the substrate by thermal oxidation ( heating at 900 ° c . for 18 min under oxygen atmosphere ). next , a polysilicon layer was deposited to 2500 å thick over the gate oxide dielectric film by lpcvd process using sih 4 at 600 °- 650 ° c ., 0 . 5 torr . the polysilicon layer was implanted with phosphorus ions ( acceleration energy : 70 kev , dosage : 1 × 10 15 cm - 2 ) to be become n type . the polysilicon layer thus obtained was patterned and etched by rie technique ( cl 2 + o 2 + hbr , 20 mtorr ) to form a gate electrode . ( d ) a second channel doping was performed by implanting b ions orthogonally to the substrate ( acceleration energy : 30 kev , dosage : 1 × 10 13 cm - 2 ), using the gate electrode as a mask . ( e ) a thin polysilicon layer was deposited to 350 å thick by lpcvd process using sih 4 at 620 ° c ., 0 . 5 torr , to form a thin polysilicon layer . ( f ) a sio 2 layer was deposited to 1500 å thick to cover the thin polysilicon layer by cvd process using sih 4 + o 2 at 850 ° c . ( g ) the sio 2 layer was etched but retained near the gate electrode by rie technique ( chf 3 + cf 4 + ar , 1 torr ) to form the retained portion of the sio 2 layer 11 , then the thin polysilicon layer was also etched but retained near the gate electrode by rie technique ( cl 2 + o 2 + hbr , 20 mtorr ) to form l - shaped gate extension 10 . consequently side walls composed of the portions 10 and 11 were formed . ( h ) arsenic ions were implanted ( acceleration energy : 40 kev , dosage : 3 × 10 15 cm - 1 ) to form the source and drain using the electrode and the gate extensions as a mask , followed by heat treatment at 800 ° c . for 1 hour . ( i ) another sio 2 layer was deposited to 6000 å thick by well - known process , followed by heat treatment at 900 ° c . for 0 . 5 hours . contact holes were formed , then filled with metal to form devices interconnection . thus , a mos transistor having a half - micrometer channel length was obtained , which exhibited satisfactory electrical characteristics . the manufacturing process of the ldd mosfet is now described below with reference to fig2 ( a )-( e ). source 13 and drain 14 regions were formed by the same method of the above example 1 , using the gate electrode 7 , the side wall extension 10 and the retained sio 2 layer 11 as a mask ( fig2 ( a ) to ( d )). after the retained sio 2 layer 11 was removed , for example , by anisotropic etching , n - type ions ( as + or p +) were implanted with about 30 to 40 kev energy for p + and a dose of about 1 × 10 14 ions / cm 2 , thereby forming the lightly doped source 19 and drain 20 . the lightly doped source / drain junctions are completely under the polysilicon side wall gate extensions , this results in the fully overlapped structure like gold . in the mosfet having the lightly doped source / drain junction shown in fig2 ( e ), the capacitive coupling between gate and drain can be varied by changing a thickness of the layer of oxide layer 6a located just beneath the side wall extension 10 as shown in fig3 . namely , by changing a thickness of the layer , the resistance caused by the lightly doped drain 20 can be reduced and deterioration of driving ability can be prevented . for example , as is shown in fig4 when t ox is 80 å and t ox is 120 å , a driving current increases in accordance with shortening the channel length . with reference to fig5 buried - channel pmosfet is described as below . in the present example , the gate electrode 7 and the side wall extension 10 are formed on n - type silicon substrate 1a which is provided with p - type source 13a and drain 14a thereon . to a channel region p1 located just beneath the gate electrode 7 , conductive ions different from that implanted to the silicon substrate 1a are implanted , and to the regions p2 and p3 located just beneath the side wall extension 10 , the same conductive ions as implanted to the silicon substrate 1a are further implanted . according to the process of the invention , a non - uniformly and lightly doped channel was formed . this results in reduced degradation of transistor characteristics by short - channel effects , increased effective mobility and drive current , and no increase of the parasitic drain junction capacitance . thus , a mos transistor having a sub - half micrometer channel length can be fabricated in a simplified manner with a high yield . while only certain preferred embodiments have been described in detail , as will be apparent with those familiar with the art , certain changes and modifications can be made without departing from the scope of the invention as defied by the following claims . | 7 |
fig1 illustrates an in - the - ear hearing aid 10 that is generally conventional in much of its construction but that has been modified so that it constitutes one of the preferred embodiments of the present invention . the hearing aid 10 of fig1 includes a shell - like housing 11 having a shape that affords a conformal fit within the ear of the intended user . the portion 12 of housing 11 projects into the user &# 39 ; s ear canal . the outer portion 13 of housing 11 , generally referred to as the faceplate , is usually located somewhere between the entrance of the ear canal and the entrance of the concha , depending upon the space available in the ear of the user and the skill of the hearing aid builder . within the housing or shell 11 , hearing aid 10 includes an amplifier and battery assembly 14 , usually equipped with at least one external control 15 , in this instance mounted immediately behind the faceplate 13 . a microphone 16 is mounted within housing 11 . an acoustical connection comprising a tube 17 extends from microphone 16 through faceplate 13 to provide access to microphone 16 for externally arriving sound . an acoustic transducer 18 , sometimes referred to as a receiver , is mounted within housing 11 in communication with a sound outlet passage 22 that emerges from the hearing aid housing portion 12 . transducer 18 includes a small housing or acoustic chamber 21 within which an acoustic driver device 25 is mounted . this acoustic drive means 25 , which is electrically actuated by signals from amplifier 14 , is mechanically connected to a diaphragm 26 that extends across and divides the receiver housing 21 into an outer acoustic chamber portion 19a and an inner acoustic chamber portion 19b . drive means 25 is located within the inner acoustic chamber portion 19b . as thus far described , the in - the - ear hearing aid 10 is essentially conventional in its construction and in its operation . thus , sound impinging upon the hearing aid reaches microphone 16 through the acoustical connection tube 17 . microphone 16 generates an electrical signal representative of the sound and supplies that signal to the amplifier / battery assembly 14 . in amplifier 14 , the amplitude for its output signal may be adjusted by control 15 . other characteristics ( e . g ., frequency response ) may also be controlled in a similar manner . amplifier 14 supplies an electrical drive signal to the acoustic drive means 25 in transducer 18 . drive means 25 may be of conventional electromechanical construction ; the driver could also be a piezoelectric device or other type of driver . in response to the received signals from amplifier 14 , driver 25 actuates diaphragm 26 to generate acoustic ( sound ) signals that are supplied to the ear canal of the user through sound output passage 22 . in most hearing aids , a small vent is provided between the two acoustic chamber portions 19a and 19b within receiver housing 21 to equalize changes in atmospheric pressure . this venting is usually necessary because the pressure differential acting on diaphragm 26 , due to atmospheric pressure variations , may be sufficient to cause driver 25 to become inoperative . no such vent is shown in hearing aid 21 because other venting arrangements are employed as described hereinafter . in some instances , an acoustic resistance or damper may be mounted in the sound output duct or passage 22 to modify the frequency response characteristics of hearing aid 10 . a resistance of this kind is preferably omitted in hearing aid 10 . the usual excretions of the ear , constituting ear wax or cerumen , may enter the open end of sound outlet passage 22 from the user &# 39 ; s ear canal . indeed , this is quite common because the outer end of passage 22 must be open in order to transmit sound to the ear canal of the user . these excretions tend to migrate into channel 22 to an extent such that the passage is eventually blocked , preventing hearing aid 10 from operating properly . attempts to remove the cerumen may be partially successful , but eventually some of the ear wax is likely to move inwardly far enough to block the small passages leading from the acoustic chamber portion 19a into the sound outlet passage 22 . indeed , enough of the cerumen may enter acoustic chamber portion 19a to impede the vibrations of diaphragm 26 , effectively stopping operation of the hearing aid . if there is an acoustic resistance , filter , or damping element in passage 22 , the likelihood of blockage is increased . hearing aid 10 , fig1 incorporates a cleaning passage 32 that extends through faceplate 13 into housing 11 in direct communication with the innermost end of sound outlet passage 22 . actually , the cleaning duct 32 is connected to the outer acoustic chamber portion 19a through a port 31 ; chamber 19a provides communication between diaphragm 26 and sound outlet passage 22 . thus , cleaning passage 32 , port 31 , acoustic chamber portion 19a , and sound outlet passage 22 comprise a continuous conduit that extends from faceplate 13 through housing 11 and out the tip end 12 of the housing , with one wall of the central part of that continuous conduit constituting diaphragm 26 . a plug 33 normally closes the end of conduit 32 projecting through faceplate 13 . housing 21 of transducer 18 is vented by a small vent 34 into the interior of hearing aid housing 11 , which in turn is vented to the atmosphere by a small opening 36 in faceplate 13 . vents 34 and 36 afford the necessary compensation for atmospheric pressure changes for acoustic chamber 19a , 19b . the manner in which accumulated ear wax or cerumen can be cleaned from hearing aid 10 is best illustrated in fig2 . initially , plug 33 ( fig1 ) is removed . the tip 41 of a syringe 40 filled with a solvent for the cerumen is then inserted into the outer end of cleaning passage 32 . when the plunger 43 of syringe 40 is depressed , the solvent flows through hearing aid 10 and is discharged from the outer , open end of sound outlet passage 22 as indicated at 42 in fig2 . the path of the solvent is illustrated , in fig1 by arrows a . in order to maintain sound outlet passage 22 unrestricted , it is preferable , as previously noted , that no filter , acoustic resistance , or other such element be mounted within the sound outlet passage . if acoustic damping or filtering is desired , an appropriate damping element may be installed in vent 34 or in acoustic chamber 19b , as indicated by reference numeral 35 . location of the damping means in this position has the additional beneficial effect of increasing the low frequency sensitivity of hearing aid 10 , and also increases the maximum output sound pressure deliverable by receiver 18 . venting of the hearing air shell or housing 11 can also be achieved through unsealed openings associated with amplifier 14 , control 15 , tube 17 , or microphone 16 ; the vent openings need not be located directly in faceplate 13 as indicated by vent 36 . the location of vent opening 34 into the interior of receiver housing 21 may also be modified from that shown . as previously noted in connection with fig2 an ordinary syringe 40 may be utilized to pump a quantity of a cleaning solvent through hearing aid 10 . this action is effective to clean cerumen and other debris from the outer portion 19a of the acoustic chamber , from the face of diaphragm 26 , and from all of outlet passage 22 . after the ear wax and other debris is cleared the same syringe 40 ( or another syringe ) can be utilized to force drying air through the continuous conduit comprising passage 32 , acoustic chamber portion 19a , and passage 22 . in hearing aids and like transducers where it will not adversely affect the materials used for construction , an intermediate flush of alcohol or other rapidly evaporating solvent may be a substantial aid in the drying process . fig3 illustrates another construction for implementation of the invention that functions in essentially the same manner as the embodiment of fig1 . in the construction shown in fig3 a hearing aid 110 of the same construction as the previously described hearing aid 10 is provided , except that cleaning passage 32 and plug 33 ( fig1 ) are eliminated . in hearing aid 110 there is a cleaning passage 132 which enters housing 11 through a side wall 113 and connects directly to the innermost end of portion 19a of the acoustic chamber , the end opposite outlet passage 22 , through a port 131 . no plug is necessary for channel 132 because its opening through wall 113 is effectively sealed off by contact with the surface of the user &# 39 ; s ear canal . clean - out operation for hearing aid 110 is the same as for hearing aid 10 of fig1 in all respects , including effective cleaning of the surface of diaphragm 26 that is exposed to cerumen accumulation . fig4 illustrates the sound output portion of a hearing aid 210 which constitutes another embodiment of the invention . in this instance , for purposes of illustration the receiver transducer 118 of the hearing aid is rotated ninety degrees as compared with receivers 18 illustrated in the previous embodiments , so that the outer portion 119a of the acoustic chamber faces outwardly of the drawing . chamber housing 121 for transducer 118 may be as previously described ; the vent for housing 121 is on the opposite side of the drawing and hence is not shown . in hearing aid 210 there are two sound outlet passages 122a and 122b segregated from each other by a central divider 123 in portion 12 of the hearing aid housing 11 . in this instance , the solvent for ear wax is pumped into one of the two sound outlet passages 122a , 122b , flows throughout the length of that passage and into portion 119a of the acoustic chamber , where it washes off the exposed face of diaphragm 126 . the solvent then flows out the other of the two sound outlet passages , flushing the ear wax and other debris with it . in this construction , one part of the sound outlet passage functions as the cleaning passage . in all other respects , operation may be as described above for the other embodiments . | 7 |
the present invention will described referring to the drawings of the preferred embodiments shown below . fig1 is a schematic cross section of mtj elements connected to the meter , which shows the structure and electronic measurement principle mtj element . mtj 1 comprises a pinning layer 2 , a tunnel barrier layer 5 , and the ferromagnetic layer 6 , also called sense layer 6 . pinned layer 2 comprises a ferromagnetic layer 4 , also known as the pinned layer 4 and an antiferromagnetic layer 3 , ferromagnetic exchange coupling pinned layer 4 and antiferromagnetic layer 3 determines the direction of magnetization of the ferromagnetic layer 4 . the tunnel barrier layer 5 is typically made of mgo or al 2 o 3 deposited on top of ferromagnetic layer 4 . ferromagnetic layer 6 is located on top of tunnel barrier 5 . arrows 8 and 7 , respectively , represent the magnetization directions of the pinned layer 4 and the sense layer magnetization vectors . pinned layer 4 magnetization vector 8 is fixed in place and does not respond to moderate magnetic fields , whereas the sense layer 6 magnetization vector 7 is free to rotate with respect to the pinned layer 4 magnetization vector 8 . in order to reduce the hysteresis effect , you can add a cross bias field h bias in the direction perpendicular to the sense direction ( for detailed description see paragraph 34 ). for reducing hysteresis effect , the magnetization vector 7 of the sense layer needs to coherently rotate . a typical thickness of the antiferromagnetic layer 3 , the ferromagnetic layer 4 , the tunnel barrier layer 5 , and ferromagnetic layer 6 ranges from 0 . 1 nm to 100 nm . bottom and top electrodes , 16 and 17 , are in direct electrical contact with their respective layers 3 and 6 . the electrodes 16 , 17 are usually a non magnetic conductive metal , and must be suitable for carrying electrical current to the inputs to ohmmeter 18 . the ohmmeter 18 applies a known electric potential ( or current ) across the entire stack , and measures the resulting electrical current ( or voltage ) that results to calculate the resistance . ordinarily , the tunnel barrier 5 is the majority of the resistance in such a device , say 1000 ohms and all of the rest of the lead resistance is 10 ohms . bottom conducting layer , 16 , is supported by an insulating substrate material , 9 , whose edges extend beyond those of layer 16 . insulating substrate material 9 may , in turn , be supported by other body substrate materials , 10 . the body substrate materials are most commonly silicon , but can be glass , pyrex , gaas , aitic , or any other material that provides adequate wafer integrity . silicon is prized for its ease of processing into circuits , though such circuits are not always needed for magnetic sensors . fig2 shows a cross section of mtj elements connected in series to form a magnetoresistor . because of their small size , mtj elements can be connected together in a string in order to increase sensitivity , reduce 1 / f noise , and improve resistance to electrostatic discharge as shown in fig2 . the mtj elements 40 are sandwiched between bottom 41 and top 42 electrodes , and interconnected such that the current 43 flows vertically through the mtj 40 and horizontally through alternating conductors patterned from the top and bottom conducting layers . bottom electrode 41 is supported on insulating layer 9 and possibly additional substrate body 10 . in the bridge circuit of the sensor , there is a reference arm and the sensor arm , the resistance value of the reference arm does not change with the applied magnetic field changes , and the resistance value of the induction arm varies with changes in the external magnetic field . it is advantageous to keep the same size mtj junctions in the reference and sensor arms of the bridge , because it makes the device less sensitive to etch bias during fabrication , so a further advantage of these strings of mtj elements is the number of elements in each string can be varied in order to set the optimal resistance ratio between the reference and sensor arms of the bridge . here is described a preferred method for providing h bias mentioned above . this method is illustrated in fig3 . here , a magnetoresistive sensor 70 is situated between two on - chip magnets 71 . the top surface of the underlying semiconductor substrate on which they are formed is not shown for clarity . the magnets are separated by a “ gap ” 72 ; have width “ w ” 73 , thickness “ t ” 74 , and length “ ly ” 75 . the magnets are designed to provide a cross - bias field in the direction perpendicular to the sensitive axis , or y axis 76 of the bridge sensor , but largely in the plane of the substrate . this axis will be called the cross axis or x axis , 78 . magnetoresistive element , 70 , has an elliptical shape having width w mr , 82 , and length l mr , 83 . the cross section of mr element 70 is shown in fig3 . the permanent magnets are initialized using a large magnetic field , such that their remanent magnetization m pm , 77 is largely perpendicular to the sense axis or y axis , 76 of the bridge sensor , and largely parallel to the cross axis or x axis , 78 , and within the x - y plane . here the x and y axes are the standard orthogonal cartesian coordinate axes , the z axis is normal to the substrate surface . the x - y plane is also called the “ sensing plane .” shown in fig4 , when the external magnetic field 20 is parallel with the magnetic pinned layer 2 and the applied magnetic field strength is greater than h1 , the orientation of the magnetic free layer 4 shown as dashed lines is also parallel with the external magnetic field 20 . therefore , it is parallel with the magnetic pinning layer 2 . under this circumstance , the mtj structure demonstrates the minimum resistance . when the external magnetic field 20 is anti - parallel with the magnetic pinned layer 2 and the applied magnetic field strength is greater than h2 , the orientation of the magnetic free layer 4 is also anti - parallel with the external magnetic field 20 . therefore , it is anti - parallel with the magnetic pinning layer 2 . under this circumstance , the mtj structure demonstrates the maximum resistance . the magnetic field range between h1 and h2 is the measuring range of the mtj . when as shown in fig4 ( a ) the pinned layer magnetization is rotated by 180 ° the magneto resistance response to the same magnetic field is as shown in 4 ( b ). if two such resistors are combined in series to form a half - bridge circuit , wherein one of the resistors is rotated 180 ° degrees about the axis normal to the sensing plane , its resistance curve will have the opposite polarity , as shown in fig4 ( a ) and 4 ( b ). when two resistance legs of a half - bridge have opposite polarity response to an applied field , they are called a “ push - pull ” half - bridge because when the value of one resistor increases , the value of the other resistor decreases . the output of this magnetoresistive push - pull flip die half - bridge is shown as curve 21 in fig5 . this is a plot of bridge voltage output ( v ) vs . applied magnetic field h curve 20 . for large positive values of h (+ h ) the bridge output voltage is at a maximum value 25 , v max . for large negative values of h (− h ) the output voltage is at minimum value 23 , v min . in zero applied field , the bridge output voltage is at a middle value 24 , v mid , approximately half - way between v max and v min . the bridge output can be measured by a voltmeter , or it can be used as the input to higher level electrical circuitry such as a magnetoresistive switch product fig6 shows a circuit block diagram of the magnetoresistive switch of the present invention composed of a push - pull half - bridge sensor chip and asic . the push - pull half - bridge , the output of which is shown in fig5 , can be used as 87 , ( mr sensor ). it has three electrical interconnections , the power supply v bias , the ground gnd , and the half - bridge output voltage v bridge . v bridge is the same signal as curve 21 in fig5 . fig6 shows a push - pull half - bridge switches includes in addition to the mr sensor part of the circuit an asic is used for converting the output signal of a push - pull half - bridge to a switching signal . the asic includes a voltage regulator circuit 83 , an internal reference circuit 86 , a multiplexer 88 , a low pass filter 91 , and a comparator circuit 61 followed by the connection , the digital control circuit 92 and a latch driving circuit 93 and the like . the mr sensor structure will be described later ; fig1 shows the connection in this switching circuit chip and chip . the following will first describe the physical layout of the magnetic sensor chip of the present invention . each magnetic magnetoresistor is comprised of a large number of mtj elements . the magnetoresistors are located on a substrate 10 , the substrate material is typically silicon , but it may also be glass , printed circuit boards , alumina , ceramics and other materials . many identical magnetoresistors may be fabricated using lithographic methods and other manufacturing process , in a rectangular area on a silicon wafer , these chips may then be singulated by wafer sawing , laser cutting , or other methods which do not damage the chip . from the same wafer a large number of devices may be fabricated , each device after the separation is called a magnetic sensor chip . the cutting process determines the shape of the magnetic sensor chip , normally , the chip shape is rectangular . if the design has different types of sensors chips on the wafer , it will increase the difficulty of production , testing and packaging of chips . therefore , in order to achieve better economic efficiency , a single design should be built on a wafer . the present invention is a push - pull half - bridge circuit using two magnetic sensor chips preferably using the same design , thereby simplifying the manufacturing steps and improving economic efficiency . however , in the application , there is a need to address the following two difficulties : how to match the example shown in fig6 switches other circuits , such as a linear amplifier , a / d conversion circuit , a power supply circuit , a control circuit , so as to constitute a working switch ; and how to mechanically arrange two identical magnetic sensor chips into a mr sensors that each has the opposite polarity response . according to the present invention , one of the two magnetic sensor chips will be rotated and connected in series to form a push - pull half - bridge circuit . fig7 ( a ) and ( b ) show the mtj magnetoresistive elements connected in series to form a magnetoresistor on the magnetic sensor chip , and a circuit diagram of a top view of a representative magnetoresistor electrically interconnected in series . a block diagram of a circuit schematic of magnetic and magnetic sensor chip 102 is shown , it contains a magnetoresistor 108 that has two terminals , and depending on the orientation of the device , the pinned layer magnetization vector 8 may point to the terminals named ‘ top ’ 1 . 1 ; the terminal at the other end is named ‘ bottom ’ 2 . 1 . each side has two electrically interconnected terminals connected to the electrical terminals top 1 . 1 1 . 2 , the bottom of the electrical terminals 2 . 2 and 2 . 1 are connected at each end and electrically interconnected terminals is represented by a square or a circle , in which round terminal is associated with the top , and corresponds to the circular pad 104 , the pad with the circle is used to identify the polarity of the magnetoresistor . the direction of black arrow 8 represents the magnetization vector of the pinned layer ; the direction of arrow 7 is a magnetic field ( 20 in fig5 ) that aligns the sense layer magnetization vector , the sensing axis 76 and the pinned layer magnetization vector 8 are parallel . in fig7 ( b ) the rectangular chip 101 is a magnetic sensor chip , and the physical layout of fig7 ( b ) is a preferred embodiment of the present invention . the chip has four pads 103 - 106 , corresponding to the terminals in fig7 ( a ) numbered 1 . 1 , 1 . 2 , 2 . 1 , 2 . 2 . the pad 104 is circular , while the other three pads are square . this arrangement provides a means for determining the sensing polarity of the chip . permanent magnet 71 provides cross - axis bias field h bias . a magnetoresistor 108 comprises a plurality of mtj elements 40 connected in series . the top electrode 42 is used for wirebonding and electrically connecting magnetoresistors , that is , interconnecting magnetoresistor strings . fig8 shows an enlarged schematic view of fig7 ( b ). the solid - line ovals 40 are mtj elements , rectangle 41 is a bottom electrode , and rectangular shape 42 is the top electrode . fig7 and 8 together constitute a top view of one embodiment of the invention the magnetic sensor chip . the following embodiments utilize these features , and the description will not be repeated . fig9 - 12 show a 2 cases of the implementation and 5 example arrangements , in which the number of magnetoresistive elements string may be different , mtj element size can be different , the size and location of the pads may be different . fig9 is a rectangular chip magnetic sensor chip 101 , having the physical layout of embodiment 2 according to the present invention . the chip has four pads 103 - 106 , for providing electrical connections according to the implementation . for example , the pad 104 , the corresponding terminal 1 . 2 , has a circular shape , while the other three pads are square . permanent magnet 71 provides cross - axis bias field h bias . the magnetoresistor 108 comprises serially connected mtj elements 40 . the top electrode 42 is used to achieve electrical connection between the pad and the magnetoresistive element string , between the individual magnetoresistive elements , and between the magnetoresistor strings . fig1 is a rectangular chip magnetic sensor chip 101 , having the physical layout of the embodiment 3 according to the present invention . the chip has four pads 103 - 106 , electrical connections according to the present implementation . for example , the pad 104 , the corresponding terminal 1 . 2 , a circular shape , while the other three pads are square . permanent magnet 71 provides cross - axis bias field h bias . the magnetoresistor 108 comprises a number of serially connected mtj elements 40 . the top electrode 42 is used to achieve electrical connection between the pad and the magnetoresistive element string , between the individual magnetoresistive elements , and between the magnetoresistor strings . fig1 is a rectangular chip magnetic sensor chip 101 , having the physical layout of the embodiment 4 according to the present invention . the chip has four pads 103 - 106 , electrical connections according to the present implementation . for example , the pad 104 , the corresponding terminal 1 . 2 , a circular shape , while the other three pads are square . permanent magnet 71 provides cross - axis bias field h bias . the magnetoresistor 108 comprises a number of serially connected mtj elements 40 . the top electrode 42 is used to achieve electrical connection between the pad and the magnetoresistive element string , between the individual magnetoresistive elements , and between the magnetoresistor strings . fig1 is a rectangular chip magnetic sensor chip 101 , having the physical layout of the embodiment 5 according to the present invention . the chip 101 has two pads , with respect to each of the above embodiments , each of the chip pads in example 5 in this embodiment is elongated to accommodate two electrical connection points . for example , the pad 109 comprising terminals 1 . 1 and 1 . 2 corresponding welding point , the pad 110 includes terminals 2 . 1 and 2 . 2 corresponding welding point . permanent magnet 71 provides cross - axis bias field h bias . the magnetoresistor 108 comprises a number of serially connected mtj elements 40 . the top electrode 42 is used to achieve electrical connection between the pad and the magnetoresistive element string , between the individual magnetoresistive elements , and between the magnetoresistor strings . fig1 ( a ) and 13 ( b ) are ‘ half - bridge flipped die ’ circuits formed according to the present invention . the first type and the second type of circuit diagram , shows two magnetic sensor chips 101 and 101 ′ in which the magnetization is rotated 180 degrees within the plane , and two methods of placing the chips . both configurations of the relationship between the chip center axis vector direction and sense to describe . in configuration 118 , the connection of two magnetic sensor chips is such that the sensing axis is parallel to the line running through the center of both chips . in configuration 119 , the sensing axis is perpendicular to the line running through the center of both chips . like the above , the sensing axis 76 is parallel to the black arrows on each of the magnetic sensor chip . configurations 118 and 119 , respectively , are configured with three electrical terminals : gnd 111 , v + 112 , and v bias 113 . in addition , some electrical lines 114 - 117 , these lines may also be referred to as wire bonds , can be used to connect the pads of the devices within the chip . by connecting line 117 , the two chips 101 and 101 ′ constitute a series arrangement , located in the lower end of the half - bridge circuit of the magnetic sensor chip is connected to the gnd via the connection line 114 . located half - bridge circuit high magnetic sensor chip is connected to the power supply through a cable 116 v bias , the output of the half - bridge circuit is connected to the output terminal v bridge via a connection 115 . fig1 is a circuit block diagram of the concept in fig6 for an improved half - bridge push - pull magnetic switch sensor , which adds the flip - chip half - bridge circuit shown in fig1 . in fig1 boundary 87 represents the flip - chip half - bridge sensor in the circuit diagram ; boundary 130 is the asic circuit diagram shown in fig6 . the asic circuit diagram has gnd connection point 111 , v bridge 112 and v bias 113 , respectively the corresponding half - bridge circuit connected to the terminal , permitting the interconnection of the bridge circuit and the asic circuit . the asic external terminals are : v cc 81 , v out 85 and the gnd 111 ′ located on the right side of fig1 . gnd 111 and gnd 111 ′ can be connected on chip through a long bond wire , or the two grounds gnd 111 and gnd 111 ′ may be connected to a large pad . fig1 is a top view schematic of two methods for distributing the pads in fig1 . fig1 ( a ) is formed asic 130 first way , it has the following pads : v cc 81 , v out 85 , gnd 111 , gnd 111 ′, v bridge 112 , and v bias 113 . fig1 ( b ) is formed in the second way , denoted asic 130 ′. it has the following pads : v cc 81 , v out 85 , gnd 111 , gnd 111 ′ ( two separate pads ), v bridge ( two ) 112 , and v bias 113 . both chips have similar functions , but each version supports different interconnection schemes . to form a complete magnetic switch the package needs to include an integrated circuit such as an asic and two magnetoresistive sensors into a single three - terminal package . some possible encapsulation methods to achieve this goal will be described in fig1 - 19 below . shown in the left side of fig1 is a lead frame chip and wire bond diagram . rectangle 143 is a leadframe - based chip paddle , made from copper or other conductive material , and paddle 143 is connected to ground terminal 140 . the magnetic sensor chips 101 and 101 ′ in the upper part of paddle 143 , asic 130 is located in the lower part of paddle 143 , the chip can be bonded to the paddle using adhesive such as epoxy . magnetoresistive sensor chips 101 and 101 ′ are arranged such that the external magnetic field has in the same direction produces polarity response , e . g ., the pinned layer magnetization vector is rotated by 180 degrees relative to each other , and so placed as shown in the figure . the sensing axis of the device 76 is shown at the bottom . in addition to connecting magnetic chips 101 and 101 ′ with the asic 130 using wire bonds 114 - 117 , there is another three interconnections : interconnection line 118 connected to the asic gnd 111 ′ to the base of paddle 143 gnd terminal 140 , formed gnd terminal ; interconnect 119 is connected asic v out into the pin 141 , to form the output terminal output . interconnect 120 is connected v cc to pin 142 , to form v cc terminal . when the wire bonding is completed , the paddle and terminals are enclosed in a plastic case 145 , and the external pins extend outside the plastic case . the outline of the plastic case 145 for a magnetic switch product is shown on the right side . shown in the left side of fig1 is a lead frame chip and wire bond diagram . rectangle 143 is a leadframe - based chip paddle , made from copper or other conductive material , and paddle 143 is connected to ground terminal 140 . the magnetic sensor chips 101 and 101 ′ in the upper part of paddle 143 , asic 130 is located in the lower part of paddle 143 , the chip can be bonded to the paddle using adhesive such as epoxy . magnetoresistive sensor chips 101 and 101 ′ are arranged such that the external magnetic field has in the same direction produces polarity response , e . g ., the pinned layer magnetization vector is rotated by 180 degrees relative to each other , and so placed as shown in the figure . the sensing axis of the device 76 is shown at the bottom . in addition to connecting magnetic chips 101 and 101 ′ with the asic 130 using wire bonds 114 - 117 , there is another three interconnections : interconnection line 118 connected to the asic gnd 111 ′ to the base of paddle 143 gnd terminal 140 , formed gnd terminal ; interconnect 119 is connected asic v out into the pin 141 , to form the output terminal output . interconnect 120 is connected v cc to pin 142 , to form v cc terminal . when the wire bonding is completed , the paddle and terminals are enclosed in a plastic case , and the external pins extend outside the plastic case . the outline of the plastic case 146 for a magnetic switch product is shown on the right side . shown in the left side of fig1 is a lead frame chip and wire bond diagram . rectangle 143 is a leadframe - based chip paddle , made from copper or other conductive material , and paddle 143 is connected to ground terminal 140 . the magnetic sensor chips 101 and 101 ′ in the upper part of paddle 143 , asic 130 is located in the lower part of paddle 143 , the chip can be bonded to the paddle using adhesive such as epoxy . magnetoresistive sensor chips 101 and 101 ′ are arranged such that the external magnetic field has in the same direction produces polarity response , e . g ., the pinned layer magnetization vector is rotated by 180 degrees relative to each other , and so placed as shown in the figure . the sensing axis of the device 76 is shown at the bottom . in addition to connecting magnetic chips 101 and 101 ′ with the asic 130 using wire bonds 114 - 117 , there is another three interconnections : interconnection line 118 connected to the asic gnd 111 ′ to the base of paddle 143 gnd terminal 140 , formed gnd terminal ; interconnect 119 is connected asic v out into the pin 141 , to form the output terminal output . interconnect 120 is connected v cc to pin 142 , to form v cc terminal . when the wire bonding is completed , the paddle and terminals are enclosed in a plastic case , and the external pins extend outside the plastic case . the outline of the plastic case 146 for a magnetic switch product is shown on the right side . shown in the left side of fig1 is a lead frame chip and wire bond diagram . rectangle 143 is a leadframe - based chip paddle , made from copper or other conductive material , and paddle 143 is connected to ground terminal 140 . the magnetic sensor chips 101 and 101 ′ in the upper part of paddle 143 , asic 130 is located in the lower part of paddle 143 , the chip can be bonded to the paddle using adhesive such as epoxy . magnetoresistive sensor chips 101 and 101 ′ are arranged such that the external magnetic field has in the same direction produces polarity response , e . g ., the pinned layer magnetization vector is rotated by 180 degrees relative to each other , and so placed as shown in the figure . the sensing axis of the device 76 is shown at the bottom . in addition to connecting magnetic chips 101 and 101 ′ with the asic 130 using wire bonds 114 - 117 , there is another three interconnections : interconnection line 118 connected to the asic gnd 111 ′ to the base of paddle 143 gnd terminal 140 , formed gnd terminal ; interconnect 119 is connected asic v out into the pin 141 , to form the output terminal output . interconnect 120 is connected v cc to pin 142 , to form v cc terminal . when the wire bonding is completed , the paddle and terminals are enclosed in a plastic case , and the external pins extend outside the plastic case . the outline of the plastic case 146 for a magnetic switch product is shown on the right side . the preferred embodiments of the present invention have been described in detail , but the present invention is not limited thereto . those skilled in the art may make various modifications according to the principles of the present invention . therefore , any modifications that do not deviate from the principles described herein are to be understood to fall within the scope of the present invention . | 7 |
referring to fig1 , an internetwork such as the global internet 10 comprises the interconnection of multiple networks such as internet service provider ( isp ) networks 11 , 12 , and 13 , which each may be comprised of a lan , man , ran , wan , or other network type . an internetwork backbone 13 provides interconnectivity to carry traffic between remote networks . with regard to streaming of multicast traffic , a source ( i . e ., origin ) server 15 in isp 11 transmits multicast datagrams into internet 10 via a router 16 in isp 11 which interfaces to backbone 14 . isp 12 has a router 17 interfacing end users 18 to the rest of internet 10 . likewise , a router 20 in isp 13 routes traffic between end users 21 and internet 10 . in addition , isp &# 39 ; s may be directly connected separately from the backbone , as shown by the direct connection between routers 17 and 20 . end users become a destination client when receiving the streamed multicast traffic from source server 15 . each respective network may comprise a specific domain within the addressing scheme of the internetwork . as used herein , domain also refers to subdomains within a domain . for example , a particular host identified using a respective subdomain name ( e . g ., source server 15 ) is included in the meaning of domain . thus , the monitoring and accounting of multicasting traffic of the present invention is adaptable to aggregating information for any domain or subdomain level desired . various protocols have been defined for establishing multicast traffic distribution , and the present invention is useful no matter what multicast protocols or standards are employed . by way of example , a typical multicasting process requires each end user desiring to receive certain multicast traffic to inform its neighboring router ( s ) of the multicast group it is interested in ( e . g . via a join message ). the router checks whether it is currently receiving traffic according to the multicast group number . if not currently receiving it , then further neighboring routers are contacted until a complete path is created back to the multicasting source . fig2 shows a first embodiment of the invention wherein a ledger application runs on a ledger application host 25 for monitoring usage of multicast traffic feeds and for aggregating usage according to domains of multicasting sources and multicasting destinations , thereby providing a mechanism for domains supporting multicast reception by their users to be compensated by the multicasting sources . host 25 can be located anywhere in internet 10 , but may preferably reside in a computer within the central backbone . host 25 receives messages itemizing individual multicasting transaction events ( e . g ., joins and leaves ) to be processed by the ledger application . when end user 18 sends a join message to router 17 , the destination ip address of end user 18 is added to a local group database 26 along with the multicast group number . known protocols may be used ( e . g ., pim ) to establish a chain of routers for forwarding multicast datagrams of the multicast group from source server 15 , through routers 27 and 28 , and to router 17 . one or more of the multicast - enabled routers ( or intermediary devices ) are programmed according to the present invention for notifying the ledger application of multicasting activities . in a preferred embodiment as shown in fig3 , a user browses in step 30 ( e . g ., using a world wide web browser ) to a web page representing the multicast source server in order to request reception of a particular stream of multicast traffic ( e . g ., a video and / or audio stream for display by a multimedia player ). the web page need not be located on the same server as the stream source . unless the source server does not charge an access fee and gives access to any anonymous requestors , the user may be authenticated in step 31 . the user may be required to supply a user id and password or provide billing information as part of the authentication process . thus , it is expected that the domain of the source server derives revenue from the transmission of the multicast traffic ( e . g ., directly from the user or indirectly through advertising ). once a user is authenticated , the source server sends the multicast group id of the requested stream to the end user in step 32 . this information is sent as a unicast message and provides the information needed by the end user client to construct a join message which it sends to its router in step 33 . the source server may also send stream control commands to the streaming source . in connection with digital rights management , a decoding key may also be sent to the end user to be used in decoding a content stream where an encrypted stream is to be sent via multicasting . in step 34 , the content source may be authenticated to ensure proper identification of the bill paying entity . in some instances , the content source authentication might not occur until multicast traffic is actually received ( thereby identifying the source ip address or domain ). in step 35 , a router responds to the joining of the end user ( or the end user &# 39 ; s domain ) by notifying the ledger application of the join . the notification can take place immediately when the join occurs , later after the join is terminated , or later as part of periodic batch updates to the ledger application . it may also be desirable to defer notification until multicast traffic is actually received and forwarded to the end destination . in step 36 , the router servicing the end user ( destination client ) employs a multicast routing protocol to create a multicast router chain back to the stream from the source server or other closer point receiving the stream ( if the router is not already receiving the multicast group on behalf of other destinations ). thereafter , the router receives and forwards multicast datagrams within the multicast group to the requesting destination client in step 37 . if desired , the router may update the ledger application with elapsed time status as the destination client continues to participate in the multicast group . the status update should be periodic , based either upon elapsed time interval since the last update or the amount of transported data . updating for each received packet would result in excessive overhead . when a user terminates reception of the multicast stream ( e . g ., by closing their media player or other action to terminate the stream ), their client application sends a leave message to the router in step 38 . the router notifies the ledger application of the leaving of the particular end user in step 39 . in a prior version of a multicasting protocol that did not use “ leave ” messages , the router periodically polled the users in the local group database to determine if any were still interested in the multicast content . once any interested destination responded , others would see the first user &# 39 ; s response and then would drop their own response in order to reduce network congestion . thus , the router would not know the identities of all the destinations still interested in the multicast traffic . for the present invention , the destination clients would have to be modified to answer a poll regardless of answers from other clients . due to the increased network congestion , however , the use of explicit leave messages is preferred . the ledger application stores and accumulates transaction events over a predetermined period ( e . g ., a one month billing cycle ). preferably , each transaction event may correspond to an individual multicast session between a user ( as identified by a reception domain ) and a stream source ( as identified by a sending domain , the time , and the group id ). multiple copies of the ledger application may be deployed , each handling separate regions within the internetwork , for example . in step 40 , the ledger application aggregates its stored transaction events , preferably sorted according to sending domains and reception domains . using the aggregated events , payments are collected from the sending domains and disbursed to the reception domains and intermediate domains that transported the multicast traffic ( e . g ., the backbone network ) in step 41 . in an alternative embodiment , the present invention can be used within an internal business enterprise for allocating costs between subdivisions of the enterprise . thus , individual groups or cost centers can be charged back for bandwidth taken up by multicasting traffic within a private network . the ledger application can be located at any convenient location within the private network . operation of the source server is shown in greater detail in fig4 . the server is initialized in step 45 so that it can advertise its content streams via browsable web pages in step 46 . eventually , a request for a content stream is received in step 47 . the source server attempts to authenticate the requesting user in step 48 ( e . g ., determining requestor id and a billing account id ). a check is made in step 49 to determine whether the user has been authenticated . if not , then an error may be logged in step 50 and a return is made to step 47 for handling further requests . if the user is properly authenticated and their request is valid , then a unicast message is sent from the source server to the end user destination client in step 51 informing it of the multicast group id being used for the requested stream . a check is made in step 52 to determine whether the requested stream is already being transmitted . if it is , then a return is made to step 47 . if not already streaming that multicast group then the stream is initiated in step 53 . router operation is shown in greater detail in fig5 . although the operation is shown primarily in the context of a neighboring router directly servicing a destination network , some or all of the same functions may be performed in routers or other devices at other locations in the multicast distribution chain . after initialization in step 60 , the router receives multicast - related packets . in step 61 a check is made to determine whether a join message is being received . if so , then any necessary authentication is performed and the ledger application is notified of the join in step 62 . the notification includes identifying information of the multicasting destination ( e . g ., the domain where the end user resides ) and an identification of the multicasting source ( e . g ., the domain where the source server resides or the multicast group number and timestamp which may be subsequently correlated with the correct domain by the ledger application ). in step 63 , the router checks to determine whether the multicast stream identified by the multicast group id is already available to the router . if so , then a return is made to step 61 ; otherwise the router sets up a multicast routing chain of the multicast group id in step 64 before returning to step 61 . if a join message is not detected in step 61 then a check is made in step 65 to determine whether a leave message is being received ( or if periodic polling of destinations is being used then whether a time - out has occurred after polling a user identified in the group database ). if yes , then the router notifies the ledger application of the leave in step 66 . the notification of the leave message may include a duration of time between a join message and a corresponding leave message and a transmission count or error count , for example . a check for other users of the stream is made in step 67 . if other users exist in the group database for the particular multicast group id then a return is made to step 61 ; otherwise the multicast routing chain is pruned in step 68 prior to returning to step 61 . if a leave message is not detected in step 65 , then a check is made in step 70 for a multicast datagram being transmitted in the stream . if the packet is not a datagram , then an error may be logged in step 71 before returning to step 61 . if a datagram is present , then the router looks up the multicast group id in step 72 . if database entries are found , then the datagram is replicated and sent to each interested destination ( e . g ., end users or further routers in a chain ) in step 73 . if desired , the ledger application can be updated of the ongoing usage of the multicast traffic by the identified users ( i . e ., domains ) in step 74 , and a return is made to step 61 . preferably , any updates occur at predetermined intervals of time or predetermined amounts of data transported . in an alternative embodiment of the present invention , network protocols other than the multicast protocols themselves can be used to identify the reception of multicast traffic . for example , protocols for monitoring use of copyrighted content can be employed since such content is frequently distributed in multicast streams . thus , a user may enroll to receive a copyright restricted feed ( by generating a license acknowledgement message or payment authorization , for example ), and the ledger application is notified of the enrollment ( together with the source and destination domains , the duration of the transmission , and an action identifier , for example ). | 7 |
referring first to fig1 to 3 of the accompanying drawings , there is illustrated a thermal head according to a first embodiment of the present invention . the thermal head mainly comprises a metallic support plate 1 ( see fig3 ) made for example of aluminum to serve also as a heat sink , an elongate head circuit board 2 made of an insulating material such as ceramic , and a flexible connector board 8 reinforced by a backing 3 . the head circuit board 2 and the backing 3 ( with the flexible connector board 8 ) are fixed to the support plate 1 . the head circuit board 2 has a surface which carries a heating resistor line 4 extending along one longitudinal edge of the board . the surface of the head circuit board also carries an array of drive ic &# 39 ; s 5 for divisionally actuating the resistor line 4 , thereby providing a line of heating dots . the surface of the head circuit board further carries a printed conductor pattern which includes individual electrodes 6 ( see fig2 ) connected to the resistor line 4 , a wiring conductor pattern 9 , and other conductors ( not shown ). as shown in fig2 and 3 , the individual electrodes 6 and the wiring conductor pattern 9 are connected to the respective drive ic &# 39 ; s 5 through wires 7 . thus , selected spots or dots of the resistor line 4 are heated by supplying electric power through selected ones of the individual electrodes 6 . the wiring conductor pattern 9 has a connection terminal portion 9a arranged centrally adjacent to a longitudinal edge of the head circuit board 2 which is located opposite to the resistor line 4 . the flexible connector board 8 projects beyond the backing 3 . the underside of the connector board 8 is formed with a printed conductor pattern ( not shown ) in corresponding relation to the connection terminal portion 9a of the head circuit board 2 , and the connector board is overlapped partially on the head circuit board 2 at the connection terminal portion 9a thereof . the backing 3 may be made for example of a glass - fiber - reinforced epoxy resin . in assembly , the flexible connector board 8 together with the backing 3 is fixed to the support plate 1 by means of bolts 10 ( only one shown in fig3 ) screwed in the support plate 1 through a presser member 11 , the connector board 8 and the backing 3 . further , the flexible connector board 8 is held in intimate contact with the head circuit board 2 by a elastic rod 12 arranged between the pressure member 11 and the connector board 8 . thus , the connector board 8 ( namely , the unillustrated conductor pattern thereof ) is electrically connected to the head circuit board 2 ( namely , the wiring pattern 9 ). further , the underside of the backing 3 carries a connector ( or connectors ) 13 for connection to external circuitry through a flexible cable ( not shown ) for example . according to the present invention , the array of drive ic &# 39 ; s 5 is enclosed in an antistatic resinous package 14 . specifically , according the embodiment of fig1 - 3 , the package 14 is entirely made of a synthetic resin which is electrostatically conductive but electrically non - conductive . preferably , the package 14 should additionally enclose the wires 7 connecting the respective drive ic &# 39 ; s 5 to the individual electrodes 6 and the wiring pattern 9 . the antistatic resinous package 14 may be formed for example by the following procedure . first , electrically non - conductive matrix resin ( e . g . polyetheramide resin or epoxy resin ) in paste form is mixed with electrically conductive substance ( e . g . about 20 wt . % of carbon ) and kneaded . then , the mixture paste is applied to the head circuit board 2 to completely enclose the drive ic array 5 and the wires 7 . finally , the applied paste is allowed to harden . when polyetheramide resin or epoxy resin is used as the matrix resin for mixture with about 20 wt . % of carbon as the conductive substance , the resulting resinous package 14 will have a volume resistivity of about 10 5 ( ω · cm ). the volume resistivity will further decrease as the carbon content increases . in general , the resinous package 14 is considered to be electrostatically conductive but electrically non - conductive when the volume resistivity thereof is within a range of 10 4 - 10 10 ( ω · cm ), preferably 10 5 - 10 9 ( ω · cm ). thus , the resinous package 14 formed as above can work effectively as antistat . in addition to carbon , examples of electrically conductive substances for mixture with the non - conductive matrix resin include silver powder , copper powder , various surfactants , and so forth . examples of applicable surfactants include anionic surfactants ( such as alkyl sulfonate type , alkyl aryl sulfonate type , alkylamine sulfonate type ), cationic surfactants ( such as quaternary ammonium salt type , quaternary ammonium resin type , pyridinium salt type ), non - ionic surfactants ( such as ether type , amine or amide type , etanolamide type ), and ampho - ionic surfactants ( such as betaine type ). in operation , a platen 15 ( see fig3 ) is disposed in opposition to the resistor line 4 of the head circuit board 2 , and paper 17 and a thermosensitive ink ribbon 16 are passed between the platen 15 and the resistor line 4 in the direction of an arrow a in fig3 . the respective drive ic &# 39 ; s 5 are actuated in response to externally supplied signals to heat selected spots or dots of the resistor line 4 , thereby performing intended printing onto the paper 17 . during the operation , the ink ribbon 16 and / or the paper 17 generate static electricity due to friction relative to each other and / or the platen 15 . however , the antistatic resinous package 14 , which is electrostatically conductive , continuously allows the generated static electricity to escape along its surface . thus , it is possible to effectively prevent the drive ic &# 39 ; s 5 and the resistor line 4 from being electrostatically disturbed or damaged . fig4 shows a thermal head according to a second embodiment of the present invention which differs from that of the first embodiment only in one point . specifically , the thermal head of fig4 incorporates an antistatic resinous package 14a which consists of an inner portion 18 entirely enclosing the drive ic &# 39 ; s 5 and the wires 7 , and a surface portion or layer 19 covering the inner portion 18 . the inner portion 18 is made for example of thermosetting epoxy resin which is highly non - conductive electrically ( electrostatically non - conductive as well ), whereas the antistatic surface layer 19 is made of a resinous material similar to that of the first embodiment to become electrostatically conductive but electrically non - conductive . the thickness of the surface layer 19 may be relatively small or relatively large . because of the high insulating ability of the inner portion 18 , the antistatic resinous package 14a of fig4 is capable of more reliably preventing the drive ic &# 39 ; s 5 from electrostatic disturbances ( noises and / or operation failures ) and damages even if the surface layer 19 is electrostatically charged to a greater extent than normally expected . obviously , the resistor line 4 is also prevented from electrostatic damages similarly to the first embodiment . it should be appreciated that electrostatic charging occurs only at the surface of the resinous package 14a , so that it suffices to provide an antistatic layer only at the surface of the package . fig5 represents an antistatic resinous package 14b according to a third embodiment of the present invention . similarly to the first embodiment , the package 14b of the second embodiment has a double structure which consists of an inner portion 20 entirely enclosing the drive ic &# 39 ; s 5 and the wires 7 , and a surface portion or layer 21 covering the inner portion 20 . the inner portion 20 is made of relatively soft resin such as silicone resin which is electrostatically and electrically non - conductive , whereas the antistatic surface layer 21 is made of a resinous material similar to that of the first embodiment to become electrostatically conductive but electrically non - conductive . preferably , the thickness of the antistatic surface layer 21 is rendered sufficiently large to prevent the inner portion 20 from being mechanically deformed by external forces . due to the soft nature of the inner portion 20 , the antistatic resinous package 14b of the third embodiment allows thermal expansion and contraction of the drive ic &# 39 ; s 5 . thus , the drive ic &# 39 ; s are prevented from mechanically damaged by such expansion and contraction . obviously , the antistatic surface layer 21 provides the same advantages as already described . according to a fourth embodiment shown in fig6 an antistatic resinous package 14c has a triple structure . specifically , the package 14c consists of an inner portion 22 entirely enclosing the drive ic &# 39 ; s 5 and the wires 7 , an intermediate portion or layer 23 enclosing the inner portion 22 , and a surface portion or layer 24 covering the intermediate layer 23 . the inner portion 22 is made of relatively soft resin such as silicone resin which is electrostatically and electrically non - conductive , whereas the intermediate layer 23 is made for example of thermosetting epoxy resin which is relatively hard and highly non - conductive electrically ( electrostatically non - conductive as well ). further , the antistatic surface layer 21 is made of a resinous material similar to that of the first embodiment to become electrostatically conductive but electrically non - conductive . obviously , according to the fourth embodiment of fig6 the thermal expansion and contraction of the drive ic &# 39 ; s 5 are allowed by the soft inner portion 22 , while the mechanical strength against external forces is provided by the hard intermediate layer 23 . further , the antistatic surface layer 24 prevents adverse influences which might be caused by electrostatic charging , as already described . thus , the antistatic resinous package 14c of this embodiment is advantageous in various respects . fig7 shows a thermal head according to a fifth embodiment of the present invention which differs from the first embodiment only in that a flexible connector board 8 is electrically connected to the head circuit board 2 by soldering or by using an electrically conductive adhesive . thus , in this embodiment , no presser member and no mounting means therefor are required , thereby simplifying the overall arrangement of the thermal head . the invention being thus described , it is obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to those skilled in the art are intended to be included within the scope of the following claims . | 7 |
the following discussion describes in detail one embodiment of the invention ( and several variations of that embodiment ). this discussion should not be construed , however , as limiting the invention to those particular embodiments , practitioners skilled in the art will recognize numerous other embodiments as well . for definition of the complete scope of the invention , the reader is directed to appended claims . referring to fig1 , shown is prior art wherein signs that are posted for public viewing , such as real estate signs , typically are not illuminated at night limiting their usefulness to daylight viewing . the present invention provides that night time illumination would allow potential buyers that have free time only during the night time hours to be able to locate prospective properties thereby aiding the growth of the real estate business with more satisfied clients who do not get lost trying to find the property . referring to fig2 , shown is an illustrative view of the present invention in use . the present invention 10 is a solar sign - light that is attached to a sign for night visibility . the solar sign - light charges during daylight hours and illuminates during the night time hours . it allows potential buyers that only have free time during the night time hours to be able to locate prospective properties . the solar sign - light will aid in the growth of the real estate business with more satisfied clients who did not get lost trying to find the property . referring to fig3 , shown is a perspective view of the present invention . the solar sign - light 10 of the present invention consists of an electronic components housing 30 , clamp 34 for mounting to a sign support , elongated bulb supports 38 and a pair of lamps 36 for illuminating both sides of a double - faced sign . the electronic components housing 30 having electronic components compartment 32 is capped with a plurality of solar cells 42 for charging at least one rechargeable battery 44 used to energize the illuminable elements 54 via electrical leads 52 situated in bore 40 of the elongated bulb supports 38 extending from housing 30 at interface 56 . actuation of the solar sign - light 10 is controlled through circuit of circuit board 50 whereby the solar panel 42 receiving uv light goes into charge mode and in the absence of uv light goes into battery mode to illuminate leds 54 . clamping member 34 provides for mounting to a sign support by straddling the sign support through clamp top 62 and sides 58 , 60 . it is optionally provides for in other illustrations that the clamping member may include a fastener or movable jaw ( s ) to engage the sign support . referring to fig4 , shown is a perspective view of the solar sign - light being mounted to a sign support . the solar sign - light 10 of the present invention consists of an electronic components housing 30 , clamp 34 for mounting to a sign support 14 , elongated bulb supports 38 and a pair of lamps 36 for illuminating both sides of a double - faced sign 12 . the electronic components housing 30 having electronic components compartment 32 is capped with a plurality of solar cells 42 for charging at least one rechargeable battery 44 used to energize the illuminable elements 54 via electrical leads 52 situated in bore 40 of the elongated bulb supports 38 extending from housing 30 at interface 56 . actuation of the solar sign - light 10 is controlled through circuit of circuit board 50 whereby the solar panel 42 receiving uv light goes into charge mode and in the absence of uv light goes into battery mode to illuminate leds 54 . clamping member 34 provides for mounting to a sign support 14 by placement on the sign - support 14 whereby clamp top surface 62 engages sign support top surface 24 and clamp sides 58 , 60 engage sign support side surfaces 20 , 22 respectively . fig5 is a perspective view of the solar sign - light mounted on a sign support . as illustrated , the portable solar sign - light 10 provides a clamp 34 as means for mounting to an existing sign support 14 furnishing illumination 55 for a double - faced sign 12 . the solar sign - light 10 incorporates mounting means , solar cells , rechargeable power source and illuminable elements into a portable lighting module for night illumination of a desired sign . the solar sign - light 10 comprises electronic components housing 30 , clamp 34 for mounting to a sign support 14 , elongated bulb supports 38 and a pair of lamps 36 for illuminating both sides of a double - faced sign 12 comprising sides 16 , 18 . the electronic components housing 30 having electronic components compartment 32 is capped with a plurality of solar cells 42 for charging at least one rechargeable battery 44 used to energize the illuminable elements 54 via electrical leads 52 situated in bore 40 of the elongated bulb supports 38 extending from housing 30 at interface 56 . actuation of the solar sign - light 10 is controlled through circuit of circuit board 50 whereby the solar panel 42 receiving uv light goes into charge mode and in the absence of uv light goes into battery mode to illuminate leds 54 . clamping member 34 provides for mounting to a sign support 14 by placement on the sign - support 14 whereby clamp top surface 62 engages sign support top surface 24 and clamp sides 58 , 60 engage sign support side surfaces 20 , 22 respectively . fig6 is an end view of the solar sign - light of the present invention . shown is the solar sign - light 10 comprising an electronic components housing 30 that has a clamp 34 downwardly extending from the housing so the lighting module 10 can be mounted to a sign support 14 . the electronic components housing 30 has a solar cell module 42 mounted on the top surface in electrical communication through appropriate circuitry 50 to charge at least one rechargeable battery 44 also incorporated into circuitry 50 is a uv detector causing the circuit to switch between a charging mode in the presence of uv radiation and to energizes a pair of leds 54 in the absence of uv radiation with each led positioned on the end of a curvilinearly extending elongated stem 38 depending from opposing sides of the electronic components housing 30 illuminating both sides 16 , 18 of a double - faced sign 12 . fig7 is a side view of the solar sign - light . in the illustrated embodiment of the present invention , the solar sign - light 10 consists of a solar panel 42 , eight “ aa ” rechargeable batteries 44 , two led lights 54 , a circuit board 50 , housing unit 30 and mounting bracket 34 . the solar panel 42 is located on top of the housing 30 , which contains appropriate circuitry 50 for the solar cells 42 to charge rechargeable batteries 44 and circuitry 50 for the rechargeable batteries 44 to selectively energize through electrical leads 52 each led 54 located on the ends of two electrical conduits 38 extending out of opposing housing sides with the led 54 and beam reflector 64 ( see fig9 ) elements located on respective conduit 38 ends . fig8 is a top view of the present invention . the solar panel 42 is positioned on top of the housing 30 as the sole source of recharge for the batteries within the electronic components housing 32 used for illuminating two bulbs located on the ends of elongated bulb - support stems 38 having bore 40 for electrical leads 52 . the stems divergently extend from housing 30 with the bulbs converging toward opposing sign sides . fig9 is an enlarged view of the solar sign - light illuminable element . depicted is illuminable member 36 positioned on the end of elongated bulb - support stem 38 having led 54 and reflector 64 for illuminating the copy on a targeted sign . fig1 is a perspective view of an alternate clamp of the present invention . at the bottom of housing 30 is mounting clamp 34 as means for attaching the solar sign - light to a sign support that additionally provides fastener 68 and threaded bore 66 whereby 68 is selectively moved into engagement with the sign support crimping the solar sign - light 10 to the sign support . fig1 is a perspective view of another alternate clamp of the present invention . the present invention additionally provides that the clamp 34 having sides 58 , 60 which are movable in respect to each other that can be adjusted to accommodate sign supports of varying thickness . while the invention has been described in connection with a preferred embodiment , it is not intended to limit the scope of the invention to the particular form set forth , but on the contrary , it is intended to cover such alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims . | 8 |
the foregoing aspects , features and advantages of the present invention will be further appreciated when considered with reference to the following description of exemplary embodiments and accompanying drawings , wherein like reference numerals represent like elements . in describing the exemplary embodiments of the invention illustrated in the appended drawings , specific terminology will be used for the sake of clarity . however , the invention is not intended to be limited to the specific terms used . according to an aspect of the present invention the data packet processing is performed by maintaining the required information for the sdus , pdus and sdu segments in their respective information queues . according to an aspect of the present invention , in case where the pdu processing does not require retransmission , three different information queues may be created and maintained to enable virtual data packet processing as shown in fig4 . next , each of the information queues is described in detail . start address of an sdu total size of an sdu remaining length after an sdu has been segmented previous pointer and next pointer to form bidirectional link between each element in the siq for fast traversal through the elements in the queue . pdu sequence number total size of a pdu total number of sdu segments packed into a pdu pointer to sdu segment information queue ( ssiq ). each sdu segment in a pdu has an element in the ssiq . siq index for an sdu to which a sdu segment belongs . this index is required to link the sdu segment information element directly to the siq when providing the transmission completion status for the application or upper layer and to release the memory of the sdu . sdu segment address offset sdu segment length sdu segment offset previous pointer and next pointer to form bidirectional link between each element in the ssiq for fast traversal through the elements in the queue . the relationship among the three queues is illustrated in fig5 . according to another aspect of the present invention the following are steps performed in the packet data processing at the transmission side . whenever an sdu is received from an application or higher layer , the siq is updated as follows . start address of the sdu is set to the start address of the sdu in the system memory total size of the sdu is set to the size of the entire sdu remaining length of the sdu is set to the size of the entire sdu previous pointer may point to the siq index for a previously received sdu next pointer may point to the next free siq index where the next sdu information may be stored when a pdu is prepared for transmission , the siq , the piq and the ssiq are updated as follows . pdu sequence number is set to the next sequence number to be given for the pdu under preparation . the sequence number is a running number from 0 to n − 1 ( where n could be implementation dependent parameter , for example n may be 2048 ). total size of the pdu is set to the entire pdu size prepared for transmission . this pdu may carry one or more sdus or sdu segments . total number of sdu segments packed into the pdu is set to total number of whole sdus or sdu segments that are packed to form the current pdu . pointer to ssiq is set to the index of the ssiq which is to be updated with the information about the sdu segment under preparation for transmission . this indexing forms a logical link between the piq and the ssiq . the ssiq information element selected in previous step is updated with the siq index of the sdu or the segment of an sdu packed in the current pdu . this index is required to link the ssiq information element directly to the siq when providing the transmission completion status for the application or the upper layer and to release the memory of the sdu . if a full sdu or the first segment of an sdu is packed in a pdu , the sdu segment address offset is set to the start address of the sdu . if a non - first sdu segment is packed in a pdu , the sdu segment address offset is set to start address +( total size − remaining length ). sdu segment length is set to the size of the sdu or sdu segment that is packed in the pdu . sdu segment offset is set to the memory address of the pdu in which the sdu or the sdu segment is packed . previous pointer points to the most recently formed ssiq index prior to the current one . next pointer points to the next free ssiq index where the next sdu segment information may be stored . after an sdu has been segmented , the remaining length field is updated as follows : if a full sdu is packed then it is set to 0 if a segment of an sdu is packed and remaining sdu segments are to be left unpacked then this field may be set to the remaining size of the sdu that may be considered for next transmission . when a pdu is successfully transmitted , the piq is first checked and then through the link from the piq to the ssiq and from ssiq to the siq , the siq is traversed and the sdu transmission completion notification is provided to the application or to the upper layer for the relevant sdu as follows . at the successful transmission completion of a pdu , the pdu sequence number may be given as an indication to traverse the information queues . from the pdu sequence number the piq may be traversed and the information element for the pdu may be identified . from the pointer to the ssiq stored in the piq , the associated information element in the ssiq may be identified . from the siq index stored in the ssiq of the selected information element the siq information element may be indexed . if transmission completion status is received for all the sdu segments of an sdu , then the sdu memory may be released and the bi - directional link may be formed with the previous and next link of the current siq information element . the ssiq information element may be released and the bi - directional link may be formed with the previous and next link of the current ssiq information element . the piq indexed with the pdu sequence number may be set to free . the transmitter side processing aspects of the present invention are illustrated in the flow diagram contained in fig6 . at processing stage 602 , the siq , piq and ssiq data structures are created . at processing stage 604 , a transmitter side protocol entity waits for a new sdu from an application or upper layer . if a new sdu is received , the processing flow continues at processing stage 606 , where the various fields of the siq are updated . the start address is updated with the system memory address of the newly received sdu . the total size field is set equal to the size of the newly received sdu . the remaining length field is also set equal to the size of the newly received sdu . the previous pointer is set to the index of a previously received sdu . in case of a very first sdu , the previous pointer is set to null to indicate the end of the queue . the next pointer is set to the next free element in the siq . the processing then continues at processing stage 607 . returning to processing stage 604 , if no new sdu is received from an application or upper layer , the processing continues at processing stage 607 . at processing stage 607 , determination is made whether transmission resources are allocated or not . if transmission resources are not allocated , the processing returns to processing stage 604 . if transmission resources are allocated , the processing continues at processing stage 608 where a pdu is prepared for transmission . next at processing stage 610 , the next free element in piq is updated . the pdu sequence number field is updated by the next sequence number in the range 0 to n − 1 as described earlier . the total size field is updated according to the size of the allocated resources . the number of sdus packed field is updated with the total number of sdus or sdu segments packed to form the current pdu . the pointer to ssiq field is updated with the index of the ssiq which is to be updated with the information about the sdus or sdu segments that are packed in the current pdu . next the processing continues at processing stage 612 , where the ssiq is updated . at processing stage 612 , the siq index field is updated with the siq index of the sdu or the sdu segment that is packed in the current pdu . at processing stage 614 , a determination is made whether a complete sdu or a first segment of an sdu is packed in current pdu . if it is the complete sdu or the first segment of the sdu , the processing continues at processing stage 616 where the sdu segment address offset field in the ssiq is updated with the sdu start address . returning to processing stage 614 , if it is not the full sdu or the first segment of the sdu , the processing continues at processing stage 618 where the sdu segment address offset field of the ssiq is updated with the value ( sdu start address +( total size − remaining length )). the further processing after stages 616 or 618 continues at processing stage 620 where the remaining fields of the ssiq are updated . the sdu segment length field is updated with the size of the sdu or sdu segment packed . the sdu segment offset is updated with the memory address of the pdu in which the sdu or sdu segment is packed . the previous pointer is updated with the index of the most recently formed entry in the ssiq . the next pointer is updated with the index of the next free element in the ssiq . the processing then continues at processing stage 622 where the remaining length field in the siq index for the sdu that is packed in the current pdu is updated as remaining length = remaining length − sdu segment length . at processing stage 624 , determination is made whether all the sdus in the queue are transmitted or not . if not all the sdus are transmitted then the processing continues at processing stage 604 . if all the sdus are transmitted then the processing suitably terminates at stage 626 . the transmitter side processing aspects of the present invention when a transmission completion status is received from the peer entity are illustrated in the flow diagram contained in fig7 . the processing relevant to the present invention begins at processing stage 702 , where the transmitter entity waits for receiving transmission completion status from peer entity . at processing stage 704 , indication of transmission completion status for a pdu with a particular pdu sequence number is received from a peer entity . at processing stage 706 , the piq is searched to find the element corresponding to the sequence number of the successfully transmitted pdu . from the found piq element , the pointer to ssiq field is used to identify the associated element in the ssiq . at processing stage 710 , from the identified ssiq information element , the siq index field is used to identify the siq information element to which the received transmission completion status corresponds . at processing stage 712 , determination is made whether transmission completion status is received for all the sdu segments of an sdu . if the transmission completion status is not received for all the sdu segments of an sdu , the processing returns to the processing stage 702 . if the transmission completion status is received for all the sdu segments of an sdu , the processing continues at processing stage 714 . at processing stage 714 , the siq is updated by freeing the information element for the sdu whose transmission is completed successfully . the previous and next pointers are updated to maintain the bidirectional link in the siq for the remaining elements in the queue . at processing stage 716 , the information elements from ssiq corresponding to the successfully transmitted sdu segments are freed . the previous and next pointers are updated to maintain the bidirectional link in the ssiq for the remaining elements in the queue . at processing stage 718 , the information element from piq corresponding to the successfully transmitted pdu sequence number is freed . at processing stage 720 , determination is made whether all the sdus are transmitted successfully . if not all the sdus are transmitted successfully , the processing returns to stage 702 . otherwise , the processing suitably terminates at stage 722 . for the packet data processing at the reception side , similar method as that of the transmission side may be used . however , in this case pdus are inputs and sdus are formed as an output by the protocol entity . according to an aspect of the present invention , if the pdu processing does not require retransmission then two different information queues are created and maintained in the receiving side to enable virtual data packet processing as shown in fig8 . next , each of the information queues is described in detail . pdu sequence number total size of the received pdu pdu memory address pdu status which indicates whether a complete pdu or only a segment of a pdu is received previous and next pointers to form bidirectional link between each element in the roiq for fast traversal of the elements in the queue the address where the sdu or sdu segment is present in the pdu memory sdu segment size sdu status sdu_complete : the sdu is non - segmented sdu_first_seg : the sdu is segmented and is the first part of its parent sdu sdu_last_seg : the sdu is segmented and is the last part of its parent sdu sdu_middle_seg : the sdu is segmented and is an intermediate part of its parent sdu previous and next pointers to form bidirectional link between each element in the raiq for fast traversal of the elements in the queue the relationship among the three queues is illustrated in fig9 . according to another aspect of the present invention , the following are the steps performed in the packet data processing at the reception side when a pdu is received without a retransmission : 1 . detect and discard duplicate pdu and do reordering of the received pdus a . if the sequence number of the newly received pdu already has an entry in the roiq then discard the recently received pdu as duplicate 2 . whenever a pdu is received that is not a duplicate , create an entry in the roiq and update the following information : a . pdu sequence number with the received pdu sequence number b . pdu status set to complete pdu if the pdu is complete pdu else the pdu status is set to pdu segment c . pdu memory address is set to the start memory address of the received pdu stored in the system memory d . total size of the pdu is set to the complete pdu size that is received e . the previous and next pointer are updated to maintain the bidirectional link 3 . after the pdu information is stored in roiq , check if there is a possibility for sdu reassembly and if the reassembly is possible , update the entry in the raiq . a . if there is no missing pdu sequence number up to the newly received pdu sequence number then reorder the pdus to start the sdu reassembly b . if an sdu is considered for reassembly then store the following information in the raiq : i . the address where the sdu or sdu segment is present in the pdu memory ii . sdu or sdu segment size received in the pdu iii . sdu status set to either one of the following based on the information received in the pdu header sdu_complete : the sdu is non - segmented sdu_first_seg : the sdu is segmented and is the first part of its parent sdu sdu_last_seg : the sdu is segmented and is the last part of its parent sdu sdu_middle_seg : the sdu is segmented and is an intermediate part of its parent sdu iv . when a complete sdu is received and when the sdu status is set to sdu_complete then deliver the complete sdu to the application or upper layer with the list consisting of memory offset and the size for each of the sdu segment that forms the complete sdu the receiver side processing aspects of the present invention are illustrated in the flow diagram contained in fig1 . at processing stage 1002 , the roiq and raiq data structures are created . at processing stage 1004 , a determination is made whether a new pdu is received from a peer entity . if a new pdu is not received , the processing stays at the same stage . if a new pdu is received , the processing continues at processing stage 1006 , where the sequence number is extracted from the received pdu . the roiq is scanned to check whether there exists an entry with the same sequence number . at processing stage 1008 , determination is made whether the newly received pdu is a duplicate or not . if a duplicate pdu is received , the processing continues at stage 1010 , where the newly received pdu is discarded and the processing returns to the stage 1004 . if the received pdu is not a duplicate , the processing continues at processing stage 1012 , where a new entry is added in roiq and updated as follows . the sequence number field is updated with the sequence number of the received pdu . the pdu status field is updated as either complete pdu or pdu segment depending on the received pdu headers . the pdu memory address field is updated with the received pdu system memory address . the total size field is updated with the size of the received pdu . the previous pointer field is updated with the roiq index of the previously received pdu . the next pointer is updated with the index of the next free element in the roiq . the processing then continues at stage 1014 , where determination is made whether there are any missing pdus up to the sequence number of the newly received pdu . if there are any missing pdus , the processing returns to the stage 1004 . if there are no missing pdus , the processing continues at stage 1016 , where the received pdus are reordered for reassembly . at processing stage 1018 , the reassembly of the pdus to form an sdu is started by updating the raiq as follows . the address field of the raiq is updated with the system memory address of the received pdu . the segment size field is updated with the size of the sdu or sdu segment received in the pdu . the sdu status field is updated with one of the four possible values : sdu_complete , sdu_first_seg , sdu_last_seg or sdu_middle_seg . at processing stage 1020 , the sdu status in the raiq is checked . if the sdu status of none of the elements in raiq is set to sdu_complete , the processing returns to the stage 1002 . if the sdu status is set to sdu_complete for at least one of the elements , the processing continues at processing stage 1022 , where the complete sdu is delivered to an application or upper layer by providing the list of memory address and segment size pairs from the raiq . the processing then suitably terminates at stage 1024 . according to the aspects of the present invention , the packet data processing at any layer may be performed without using any memory copy operation for transmitted or received payload data . this reduces the required clock cycle for memory copy operation either from a processor or a direct memory access ( dma ) controller . furthermore , not performing copy operation eliminates the need for allocation of multiple memories for the same packet data . reduced copy operations and reduced storage requirements lead to reduced power consumption . aspects of the present invention may be applied to all types of mobile communications systems and the like , such as systems based on 3rd generation partnership project ( 3gpp ) long term evolution ( lte ) of wireless communication standard , systems based on 3gpp wideband code division multiple access (“ wcdma ”) standard , systems based on an ieee 802 . 16 wireless communication standard , etc . typically , as shown in fig1 , a wireless communication system , which is a type of data communication system , comprises elements such as client terminals or mobile stations and one or more base stations . other network devices may also be employed , such as a mobile switching center ( not shown ). as illustrated in fig1 , the communication path from the base station ( bs ) to the client terminal or mobile station ( ms ) is referred to herein as a downlink ( dl ) direction or downlink channel , and the communication path from the client terminal to the base station is referred to herein as an uplink ( ul ) direction or uplink channel . in some wireless communication systems , the ms communicates with the bs in both the dl and ul directions . for instance , such communication is carried out in cellular telephone systems . in other wireless communication systems , the client terminal communicates with the base stations in only one direction , usually the dl . such dl communication may occur in applications such as paging . as used herein , the terms “ base station ” and “ network ” are used interchangeably . by way of example only , the above - described method may be implemented in a receiver , e . g ., a user device such as a wireless mobile station ( ms ) 12 as shown in fig1 . as shown in fig1 , ms 100 may include an application processor subsystem 101 , baseband subsystem 102 and a radio frequency ( rf ) subsystem 104 for use with a wireless communication network . a display / user interface 106 provides information to and receives input from the user . by way of example , the user interface may include one or more actuators , a speaker and a microphone . in some mobile devices , certain combination of the application processor subsystem 101 , the baseband subsystem 102 and the rf subsystem 104 are all integrated as one integrated chip . the application processor subsystem 101 as shown in fig1 may include a controller 108 such as a microcontroller , another processor or other circuitry . the baseband subsystem 102 as shown in fig1 may include a controller 118 such as a microcontroller or other processor . the rf subsystem 104 as shown in fig1 may include a controller 128 such as a microcontroller , another processor or other circuitry . the controller 108 desirably handles overall operation of the ms 100 . this may be done by any combination of hardware , software and firmware running on the controller 108 . such a combination of hardware , software and firmware may embody any methods in accordance with aspects of the present invention . peripherals 114 such as a full or partial keyboard , video or still image display , audio interface , etc . may be employed and managed through the controller 108 . aspects of the present invention may be implemented in firmware of the controller 108 of the application processor and / or the controller 118 of the baseband subsystem . in another alternative , aspects of the present invention may also be implemented as a combination of firmware and hardware of the application processor subsystem 101 and / or the baseband subsystem 102 . for instance , a signal processing entity of any or all of the fig1 may be implemented in firmware , hardware and / or software . it may be part of the baseband subsystem , the receiver subsystem or be associated with both subsystems . in one example , the controller 118 and / or the signal processor 110 may include or control the protocol entity circuitry . the software may reside in internal or external memory and any data may be stored in such memory . the hardware may be an application specific integrated circuit ( asic ), field programmable gate array ( fpga ), discrete logic components or any combination of such devices . the terms controller and processor are used interchangeably herein . the consumer electronics devices that may use the aspects of the invention may include smartphones , tablets , laptops , gaming consoles , cameras , video camcorders , tv , car entertainment systems , etc . although aspects of the invention herein have been described with reference to particular embodiments , it is to be understood that these embodiments are merely illustrative of the principles and applications of the aspects of the present invention . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the aspects of the present invention as defined by the appended claims . aspects of each embodiment may be employed in the other embodiments described herein . | 7 |
according to the invention , the article is inserted into an oven for carrying out the method . it has been found that oxygen and water residues especially interfere with the surface hardening . for excluding these disruptive factors , the article is heated up to a temperature which is above the boiling temperature of water . herein , a temperature comprised between 110 ° c . and 140 ° c . is preferred and 120 ° c . is most preferred . furthermore , according to the invention , the oxygen containing atmosphere in the oven will be replaced by a first gas mixture . therefore , the oven advantageously comprises gas inlets and gas outlets . according to a preferred manner of carrying out the process , it can be provided to flood the oven with an inert gas before introducing the first gas mixture . herein , the oxygen displacement will be advantageously accelerated and a possible hazard potential resulting from the contact of the standard atmosphere containing oxygen with the first gas mixture will be reduced . known chemically unreactive gases such as in particular nitrogen or argon will be preferably used as inert gas . non - rusting stainless steels inter alia comprise chrome as an alloying element . due to the contact with atmospheric oxygen , a passivating and corrosion resistant chromium ( iii ) oxide layer is formed on the material surface . during the carburization it is of enormous importance to remove or depassivate this passivating chromium oxide layer , in order to enable a homogenous diffusion of the carbon into the surface zone of the stainless steel . if this is not assured due to lacking depassivation , the diffusion will be impeded in the area having an intact chromium oxide layer and the consequence will be an inhomogeneous hardness distribution in the resulting surface layer . furthermore , a lacking depassivation in the areas having an intact chromium oxide layer leads to the formation of defect sites in the surface area . these defect sites ultimately lead to an undesired reduced corrosion resistance of the steel . according to a preferred feature of the invention , the first gas mixture therefore has reducing characteristics , in order to avoid a further oxidation of the chrome . furthermore , this gas mixture already initiates the depassivation of the surface . according to another preferred feature of the invention , the first gas mixture is at least composed of a hydrogen containing gas and a nitrogen containing gas and especially preferred are h 2 and n 2 . it has been found that this gas mixture , in particular in connection with the mild temperature of the first process step , has an especially mild and advantageous effect on the chromium oxide layer without having a detrimental effect on the morphology of the surface of the filigree articles . according to a preferred feature of the invention , the oxygen concentration will be measured continuously or at intervals by means of a sensor . herein , a control unit connected to the sensor compares the actual value continuously or at intervals to a freely selectable set point and in case of an identity between the actual value and the set point , the control unit enables the oven to carry out the second process step . the method according to the invention is advantageously highly simplified hereby and minimizes possible sources of error for the user in this manner . according to the invention , a second process step is provided , in which the article is heated up to the target temperature , the second temperature , for the carburization . the second temperature is preferably selected such that this one is clearly beneath the recrystallization temperature of highly cold formed iron alloys ( 680 ° c .). herein , a possible modification of the morphology of the surface is effectively prevented , whereby the formation of a homogenous surface layer is promoted . the second temperature is preferably comprised between 450 ° c . and 550 ° c . and is most preferably 500 ° c . the heating up phase especially serves to the gentle and complete depassivation of the chromium oxide layer . it is advantageous to select the heat - up rate , at least in certain temperature ranges , as low as possible , in order to assure a uniform depassivation . in this connection , the applicant has discovered that the quality of the resulting surface layer of thin - walled deep - drawn parts significantly suffers from a high heat - up rate . in a certain temperature range , the heat - up rate is preferably comprised between 0 . 5 and 1 ° c ./ min , more preferably between 0 . 5 and 0 . 7 ° c ./ min and most preferably 0 . 5 ° c ./ min . the temperature range , in which this low heat - up rate is selected , is preferably comprised between 420 ° c . and 550 ° c ., more preferably between 450 ° c . and 500 ° c . and most preferably between 480 ° c . and 500 ° c . according to a feature of the invention , the first gas mixture will be replaced by a second gas mixture in the second process step . herein , it has been found that a mild depassivation of the thin - walled deep - drawn parts during the heat - up phase to the second temperature will be preferably realized by a gas mixture that is at least composed of a hydrogen containing gas , a nitrogen containing gas as well as a carbon containing gas . in particular in connection with the low heat - up rate , an especially slow and thus mild and well controllable depassivation of the chromium oxide layer can be preferably achieved . according to an advantageous feature of the invention , the article will be treated with additives which selectively or entirely dissolve the passive layer . these additives especially refer to salt compounds and / or organic substances and acidifiers which are applied to the good or in the oven in solid or liquid form . herein , the application takes preferably place before the article is inserted into the oven or during the second process step . for this purpose , solids and / or liquids are used which form acid reaction products in connection with the reaction gases , which reaction products would result in a ph value of & lt ; 7 if they were introduced into water . herein , the application of the substances directly onto or into the article surface has proved to be especially advantageous . hereby , local depassivation processes which early initiate and promote a uniform depassivation will be initiated already at low temperatures . as carbon containing component , preferably carbon oxides , saturated , unsaturated , aliphatic , cyclic , heterocyclic and / or aromatic hydrocarbons can be added to the second gas mixture . herein , the use of unsaturated hydrocarbons , such as especially ethyne , is highly preferred . as nitrogen containing component , preferably elementary nitrogen , ammonia , amines , amides , imides , nitriles and / or nitrogen oxides can be added to the second gas mixture . herein , it has been found that the use of elementary hydrogen as a constituent of the second gas mixture , in particular in connection with the depassivation additives , leads to the formation of especially homogenous surface layers . according to a preferred feature of the invention , the temperature will be measured continuously or at intervals by means of a sensor . herein , the control unit connected to the sensor compares the actual value continuously or at intervals to a freely selectable set point for the second temperature and in case of an identity between the actual value and the set point , the control unit enables the oven to carry out the third process step . the method according to the invention is advantageously highly simplified hereby and minimizes possible sources of error for the user in this manner . according to the invention , a third process step is provided , in which the deep - drawn part is constantly kept on the second temperature . in this connection , the third process step serves to the carburization of the thin - walled deep - drawn part . it has been found that the second temperature advantageously enables a gentle formation of the surface layer to be hardened . the diffusion of the carbon into the surface area of the deep - drawn part takes place slowly at these temperatures , can thus be easily controlled and causes a homogenous surface layer that is rich in carbon to form . a too high temperature has to be avoided in any case , since due to the high diffusion speed and the high kinetic energy of the involved molecules , uneven layers and carbide particles will be formed . according to the invention , the second gas mixture will be replaced by a third gas mixture which is especially suitable for a gentle carburization under mild conditions . in this connection , the use of a gas mixture which is at least composed of a hydrogen containing gas , a nitrogen containing gas as well as a carbon containing gas has proved to be advantageous . it can be preferably provided to add another carbon containing component to this gas mixture , whereby the formation of a homogenous surface layer which is rich in carbon will be promoted in a synergetic manner by the two different carbon components . as a first carbon containing component , preferably carbon oxides , saturated , unsaturated , aliphatic , cyclic , heterocyclic and / or aromatic hydrocarbons can be added to the third gas mixture . herein , the use of unsaturated hydrocarbons , such as especially ethyne , is highly preferred . as a second carbon containing component , preferably carbon oxides , saturated , unsaturated , aliphatic , cyclic , heterocyclic and / or aromatic hydrocarbons can be added to the third gas mixture . herein , the use of carbon oxides , such as especially carbon monoxide , is most preferred . as nitrogen containing component , preferably elementary nitrogen , ammonia , amines , amides , imides , nitriles and / or nitrogen oxides can be added to the third gas mixture . according to a preferred feature of the invention , the individual concentrations of the gas components will be measured continuously or at intervals by means of respective sensors . herein , the control unit connected to the sensors compares the respective actual values continuously or at intervals to freely selectable set points for the respective concentration of the gas component and compensates deviations within a fault tolerance continuously or at intervals . the process control is advantageously simplified hereby and allows providing constant process conditions , which is of decisive importance for the formation of a homogenous surface layer rich in carbon . herein , the layer thickness of the surface layer rich in carbon can be set by means of the duration of gassing . advantageously , a period of time comprised between 2 and 10 hours is required for generating a surface layer having a thickness of 10 - 40 μm . according to a preferred feature of the invention , the control unit , which comprises a corresponding device for measuring the time , will enable the oven to carry out the fourth process step after a freely selectable carburization time has elapsed . the method according to the invention is advantageously highly simplified hereby and minimizes possible sources of error for the user in this manner . according to the invention , a fourth process step is provided , in which the deep - drawn part is cooled down to a third temperature . herein , it is preferably provided to cool down the deep - drawn part to a temperature comprised between 50 ° c . and 80 ° c . and most preferably to 60 ° c . herein it has been found that the selection of the atmosphere in which the cooling down process takes place is of decisive importance for the formation of a homogenous surface layer . it is therefore provided according to the invention to replace the third gas mixture by a fourth gas mixture . the selection of a slightly reducing gas mixture is especially considered to be advantageous . according to a preferred embodiment of the invention , the fourth gas mixture is composed of at least a hydrogen containing gas and a nitrogen containing gas . herein , it is especially preferred that the fourth gas mixture is composed of h 2 and n 2 . in order to assure a weak reduction potential , the composition of the fourth gas mixture advantageously contains 5 % to 25 % h 2 and 75 % to 95 % n 2 , more preferred 5 % to 10 % h 2 and 90 % to 95 % n 2 and especially preferred 5 % h 2 and 95 % n 2 . it has been shown that the cooling down according to the invention of the deep drawn part effectively prevents an escape of the carbon from the hardened surface layer . the invention furthermore relates to a surface hardened deep - drawn article having very small wall thicknesses . for the first time it has become possible by means of the method according to the invention to harden thin - walled stainless steel articles , especially deep - drawn articles having a high length diameter ratio and a small wall thickness in an industrially reproducible manner and with excellent quality . the deep - drawn article according to the invention comprises a soft elastic core having a hardness comprised between 350 and 400 hv1 and a hard surface layer rich in carbon . according to a feature essential for the invention , the surface layer is free of defect sites and / or particles , completely closed over the circumference and comprises an essentially flat surface . as a result , the thin - walled deep - drawn article according to the invention comprises mechanical properties of a hitherto unattained quality . thus , the deep - drawn article according to the invention comprises a surface area comprising a layer rich in carbon and having a hardness of 700 to 1000 hv0 . 01 and a layer thickness comprised between 10 and 40 μm . according to another feature essential for the invention , the corrosion and the abrasion resistance of the deep - drawn article are better than the ones of the starting product . in particular the first aspect is surprising in so far as a carburization usually deteriorates the corrosion properties of a steel product . | 2 |
a detailed description of the floss dispensers of the invention will now be provided with specific reference to figures illustrating various embodiments of the invention . it will be appreciated that like structures will be provided with like reference designations . the embodiments of the present invention are generally directed to improved floss dispensers that include a body and a support arm protruding away from the body . the body is configured to hold and dispense floss and the support arm is configured to provide support while dispensing the floss . the support arms can also be configured with cutting devices for cutting the floss once dispensed . reference is first made to fig1 which illustrates a perspective view of one embodiment of the floss dispenser of the invention . as shown , the floss dispenser 10 includes a body 12 and a gripping arm 14 . the body 12 and gripping arm 14 can be manufactured out of any suitable material including , but not limited to , plastic , ceramic or metal . in one embodiment , the body 12 and the gripping arm 14 are integrally connected at the time of manufacture such as , for example , during casting or molding . the gripping arm 14 can also be attached to the body 12 subsequent to manufacture such as , for example , by a welding process , using an adhesive , or by means of a set screw ( not shown ). the body 12 is specifically configured for holding and dispensing dental floss 16 . the dental floss 16 may be dispensed , for example , from a spool 18 that is attached within a hollow cavity 20 of the body 12 . the spool 18 is preferably mounted on a spool rod 22 , which enables the spool 18 to freely rotate within the body 12 , such as when the dental floss 16 is pulled through a dispensing hole 42 through the body . the spool 18 can be placed within the hollow cavity 20 of the body 12 at any appropriate time during manufacture of the body 12 . for example , the spool 18 can be placed within the body 12 after manufacture by providing a cover 24 on the body 12 that can be opened and closed . according to one embodiment , the cover 24 can be hingedly attached to the body at a first side 26 and frictionally closed at a second side 28 . the cover 24 can be opened by prying the cover 24 away from the body 12 at the second side 28 . to assist in the opening of the cover 24 , a recess may be provided , such as recess 30 , for inserting a tool that can pry open the cover 24 . although the previous example has gone into some detail regarding how the cover 24 can be opened , it will be appreciated that any suitable means can be used for opening and closing the cover 24 , when necessary , for placing the spool 18 of floss 16 within the body 12 . for example , a set screw may be provided that locks and unlocks the cover 24 to the body 12 . in other embodiments , the cover 24 may be permanently closed once the spool 18 has been placed within the body 12 . as shown in fig1 the gripping arm 14 extends away from the body 12 of the floss dispenser 10 , which enables it to be used for gripping or support during use . in particular , the gripping arm 14 can be held or gripped by the user during use for providing additional support and stability while the floss 16 is pulled and cut away from the dispenser 10 . it will be appreciated that this is an improvement over other small floss dispensers that can be difficult to use , particularly for people suffering joint and dexterity disorders . some existing floss dispensers are also so small that they can be easily misplaced , overlooked and lost . the floss dispensers of the present invention generally overcome this problem by providing a body 12 configured with a hole 31 for being attached to a key chain , a necklace , or any other object that is not likely to be misplaced . it will be appreciated that this generally facilitates carrying the floss dispenser throughout the day , which can be useful for enabling a person to floss between meals to maintain good personal hygiene and good breath . according to one embodiment , the gripping arm 14 may be configured in the shape of a key . this is useful for disguising the floss dispenser 10 as a key , thereby enabling a person to carry the floss dispenser 10 discretely , when desired , thereby enabling surreptitious flossing of the person &# 39 ; s teeth . the key shape of the gripping arm 14 can also be useful when the gripping arm 14 is composed of a metal . in particular , teeth 32 can be cut into the support arm 14 , thereby enabling the support arm 14 to be utilized as a working key . methods and devices for cutting teeth in keys are well known in the art . it will be appreciated , however , that the operable key function of the gripping arm 14 is not limited to opening mechanical locks . in particular , the gripping arm 14 may also comprise electronic or magnetic codes configured to open electronic and magnetic locks . the gripping arm 14 may be entirely decorative if desired . according to one embodiment of the invention , the gripping arm 14 may include a cutting groove 40 configured for cutting the floss 16 once it is pulled from the body 12 through the floss dispensing hole 42 . the cutting groove 40 may be configured to hold the floss 16 in place after it is cut , as shown or , alternatively , the gripping arm 14 may simply comprise a sharp edge that is used only to cut the floss 16 . for example , teeth 32 formed in the gripping arm 14 can comprise a cutter used to cut the floss 16 . when the cutting groove 14 is not configured to hold the main floss strand 16 in place upon being cut , it may be useful , according to one embodiment , for the floss - dispensing hole 42 to be very small so that the floss 16 can be frictionally held in place by the walls of the hole 42 . this is useful , for example , to prevent the floss 16 from retracting through the hole 42 into the cavity 20 of the floss dispenser 10 . turning now to fig2 it is shown how the floss dispenser 10 can include other useful components . for example , the floss dispenser 10 can include a light 50 ( e . g ., an led or incandescent light ), which is illuminated when a button 52 is depressed . the light 50 can be particularly useful for illuminating a lock when the gripping arm 14 comprises a workable key that is being inserted into a lock ( not shown ). the light is also useful for illuminating other objects , even when the support arm 14 does not comprise a workable key . a toothpick 60 is yet another object that can be included with the floss dispenser of the invention . for instance , according to the embodiment shown in fig2 the body 12 of the floss dispenser 10 is configured to hold a toothpick 60 therein that may be used to remove food particles from between the teeth , either before or after flossing to complete the dental hygiene process . the body 12 of the floss dispenser 10 can also be configured with a floss cutter 62 . the floss cutter 62 can be integrally formed into the body 12 at the time of manufacture or , alternatively , as shown , the floss cutter 62 may comprise a separate device that is affixed to the body 12 . the floss cutter 62 can be affixed to the floss dispenser 10 with adhesives , by welding , or by any other suitable means . turning now to fig3 it is shown how , according to one embodiment , the gripping arm of the floss dispenser 80 comprises an actual key 70 that is partially inserted within the body 82 of the floss dispenser 80 . according to this embodiment , the body of the floss dispenser 80 comprises two body halves 84 , 86 that are hingedly connected together , such as with a plastic hinge 88 . the floss dispenser 80 also includes latching mechanisms 90 configured for holding the two body halves 84 , 86 closed , although other closure means can also be used . when the body halves 84 , 86 are closed , the floss dispenser 80 appears similar to the floss dispenser 10 shown in fig1 . the floss dispenser 80 generally includes the basic components that are described above in reference to fig1 namely , a spool 18 of floss 16 , a floss - dispensing hole 42 , holes 89 configured for attaching the floss dispenser 80 to a key chain ( not shown ), and a floss cutter 62 . the floss dispenser 80 also includes a key retention pin 92 . the key retention pin 92 generally operates as an axle for holding the key 70 securely in place once the two body halves 84 , 86 have been closed together . the key retention pin 92 also operates as rotation axle about which the spool 18 of floss 16 can rotate during use . as shown , body half 84 includes walls 94 configured to receive and mechanically engage the sides of the key 70 , which is useful for holding the key 70 in place until the two body halves 84 , 86 are closed together . once the floss dispenser 80 is closed , the walls 94 of body half 84 , the key retention pin 92 , and the front wall 96 of body half 92 hold the key 70 securely in place so that the key can function as a gripping arm , as generally described above . turning now to fig4 another embodiment of the floss dispenser 100 of the invention is shown . in this embodiment , the body 102 of the floss dispenser 100 is configured with a sheath 104 suitable for securing the support arm 106 in place against the body 102 . in the present embodiment , the support arm 106 comprises a key that is securely held in place when the head 108 of the key is placed within the body 102 of the floss dispenser 100 and covered with sheath 104 . the sheath 104 is preferably composed of a material with a high coefficient of friction . this is generally useful for holding the support arm 106 in place . the sheath 104 may , for example , be composed of rubber or other elastomers . although other materials can also be used , rubber is a particularly good material because it can stretch when the head 108 of the key is placed between the sheath 104 and body 102 , thereby enabling keys with differently shaped heads to be incorporated within the floss dispenser 100 of the invention . the floss dispenser 100 , as in previous embodiments , also includes a floss - dispensing hole 42 and a floss cutter 62 configured for cutting the floss 16 once dispensed , and a hole 31 for connection with a key ring . although not shown , the floss dispenser 100 also includes a spool of floss that is housed within the body 102 of the floss dispenser 100 . although specific embodiments of the floss dispensers of the invention have been illustrated and described herein , it will be appreciated that the present claimed invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative , not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope . | 0 |
fig1 shows a graph 100 of an example relationship between interceptor maneuverability and cost . modern weapons systems make use of highly maneuverable targets , such as missiles , guided munitions , or maneuverable reentry vehicles , to attack vulnerable assets . defending assets against such moving targets can be technically challenging and expensive . for example , in order to increase the probability of successfully intercepting a target , an interceptor typically must be more maneuverable than the target . the interceptor can then respond more easily to movement of the target , which facilitates intercepting the target before the target reaches its intended destination ( e . g ., a defended asset such as a building , a ship , an aircraft , or a person ). however , as shown in the graph 100 , increasing the maneuverability of an interceptor can cause the cost of the interceptor to increase exponentially . other characteristics , such as the size and weight of the interceptor , may also scale exponentially with interceptor maneuverability . in some instances , interceptor maneuverability and cost may not have an exponential relationship . for example , cost may instead scale linearly with maneuverability . however , as a general rule , increased maneuverability cannot be achieved without increased cost , and as a result the graph of the relationship between maneuverability and cost is an increasing function for the vast majority of weapons systems . in some cases , the engineering challenges and increased costs associated with producing highly maneuverable interceptors may be prohibitive for reliably intercepting targets . furthermore , once such an interceptor has been produced and deployed on the battlefield , further increasing its maneuverability ( e . g ., in response to increased enemy target capability ) can also be prohibitively expensive . thus , in some implementations , the costs associated with developing a sufficiently maneuverable interceptor , as shown in the graph 100 , can make it difficult or impossible to field an effective defense system using a single interceptor . however , in some implementations , it may be possible to develop a system including two or more interceptors , each of which may be less maneuverable or may have only a marginal maneuverability advantage relative to the moving target , that can intercept the moving target as reliably as a single highly maneuverable interceptor . the interceptors can be used collaboratively to intercept the moving target . because the costs of an interceptor can scale exponentially with its maneuverability , a system having many less maneuverable interceptors can also be significantly cheaper than a system having a single highly maneuverable interceptor . therefore , the cost to intercept a moving target using a group of individually less maneuverable interceptors can be substantially cheaper . moreover , increasing the effectiveness of such a system can also be done more easily , for example by adding additional low - cost interceptors . therefore , the system is less likely to become obsolete due to enhanced target maneuverability . fig2 shows a diagram 200 of three interceptors 202 a , 202 b , and 202 c ( generally referred to as interceptors 202 ) used collaboratively to intercept a moving target 205 . the interceptors 202 are used as part of a defensive system to protect an asset 210 from being damaged or destroyed by the moving target 205 . for example , in some implementations , the moving target 205 can be an enemy missile or other projectile launched with the intention of striking the asset 210 . the asset 210 can be any vulnerable resource , such as a building , a ship , a piece of equipment , or a person . the interceptors 202 can be missiles , rockets , guided munitions , or any other type of guided projectile . the diagram 200 shows the relative positions of the interceptors 202 , the target 205 , and the asset 210 at a time after the target 205 and the interceptors 202 a and 202 b have been deployed . the interceptor 202 c has not yet been deployed . in the diagram , arrows formed from solid lines represent paths already traversed in the past , while arrows formed form broken lines represent potential paths that may be traversed in the future . for example , the solid line 207 represents the path traversed by the target before the time at which the interceptors 202 and target 205 are shown in fig2 . similarly , the solid lines 209 a and 209 b represent the paths traversed by the interceptors 202 a and 202 b , respectively , prior to the time at which the interceptors 202 and target 205 are shown in fig2 . the lines 207 and 209 are solid to indicate that these paths are known with certainty , because they represent past positions of the target 205 and the interceptors 209 . several potential paths 212 a - 212 d ( generally referred to as paths 212 ) that the target 205 may follow in the future are shown in broken lines . similarly , several potential paths 214 a - 214 d ( generally referred to as paths 214 ) of the interceptor 202 a , potential paths 216 a - 216 d ( generally referred to as paths 216 ) of the interceptor 202 b , and potential paths 218 a - 218 d ( generally referred to as paths 218 ) of the interceptor 202 c are shown in broken lines . the broken lines indicate that that , while any of the paths 212 , 214 , 216 , and 218 are possible , the actual paths to be traversed by the interceptors 202 and the target 205 in the future are uncertain as of the time at which the interceptors 202 and the target 205 are shown in fig2 . it should be understood that the potential paths 212 , 214 , 216 , and 218 are illustrative only , and many other potential paths for each of the interceptors 202 and the target 205 may be possible . each of the potential paths 212 , 214 , 216 , and 218 are generally contained within an envelope representing the manifold of future states for the respective interceptor 202 or target 205 . in some implementations , the shape of each respective envelope can be a function of the maneuverability of each of the interceptors 202 and the target 205 . for example , increasing the maneuverability of the target 205 can increase the angles at which the target 205 may turn at a given time , thereby increasing the size of its respective envelope . the same is true for the interceptors 202 . as shown , the potential paths 212 of the target 205 diverge at a wider angle than the potential paths 214 and 216 of the interceptors 202 a and 202 b , respectively . therefore , in this example , the target 205 is more maneuverable than the interceptors 202 . as discussed above , to reliably intercept a moving target with a single interceptor , an interceptor must maintain a maneuverability advantage over the moving target . however , in some implementations , by using two or more interceptors 202 collaboratively , the target 205 may be reliably intercepted despite the fact that each of the interceptors 202 is less maneuverable than the target 205 . for example , in some implementations , each interceptor 202 may be configured to intercept the target 205 under the assumption that the target 205 will choose a particular subset of its potential paths 212 . the subsets of potential target paths 212 assigned to each interceptor 202 may be substantially non - overlapping , so that the interceptors can together be configured to reliably intercept the target 205 regardless of the potential path 212 actually traversed by the target 205 . for example , hypotheses relating to the potential paths 212 most likely to be traversed by the target 205 can be computed . in some implementations , the hypotheses may be generated based on information relating to the state of the target 205 , such as its size , weight , current position , and maneuverability , as well as the shape and position of the path 207 already traversed by the target 205 . sensors ( e . g ., radar systems ) may be used to collect such information . in some implementations , the hypotheses may be evaluated , and the most likely hypotheses may be assigned to the interceptors 202 to improve the probability of successfully intercepting the target 205 . in some implementations , a system for defending the asset 210 may include additional interceptors 202 . three interceptors 202 are shown in fig2 for illustrative purposes , but any number of interceptors 202 may be used . each of the interceptors 202 may be assigned a different subset of hypotheses for potential maneuver strategies or paths 212 of the target 205 . for example , in implementations in which the interceptors 202 do not maintain a significant maneuverability advantage over the target 205 , it may be advantageous to increase the number of interceptors 205 used to intercept the target 205 . each interceptor may be capable of defending the asset 210 from only a relatively small subset of potential paths 212 to be traversed by the target 205 , and therefore increasing the number of interceptors may be necessary to cover a sufficiently broad range of the potential paths 212 . on the other hand , if the interceptors 202 are more maneuverable , fewer interceptors 202 may be required to reliably intercept the target 205 because each interceptor 202 can cover a larger subset of the potential paths 212 that the target 205 might take towards the asset 210 . in some implementations , the hypotheses of the most likely potential paths 212 to be traversed by the target 205 can be generated before any of the interceptors 202 are launched . for example , a fire control system may collect data relating to target 205 , such as its position , velocity , and acceleration , as it moves toward the asset 210 . based on this data , the fire control system can determine a set of hypotheses for the movement of the target 205 in the future . in some implementations , a subset of hypotheses is assigned to each interceptor 202 , and the interceptors 202 are launched according to their respective subsets of hypotheses . in some implementations , the fire control system can determine that some of the interceptors 202 should not be launched . as shown in fig2 , interceptors 202 a and 202 b may be launched , while interceptor 202 c is not . in some implementations , the interceptors 202 may be launched at different times . for example , interceptors 202 a and 202 b can be launched while interceptor 202 c remains on the ground . subsequently , if the fire control system determines that another interceptor is required to achieve a desired probability of intercepting the target 205 , a subset of hypotheses can be assigned to the interceptor 202 c , and the interceptor 202 c can be launched towards the target 205 . in some implementations , the hypotheses of the most likely potential paths 212 to be traversed by the target 205 may be updated while the interceptors 202 are in flight . for example , sensors may be used to track the target 205 and interceptors 202 to provide additional information that can be used to more accurately predict the potential path 212 to be traversed by the target . in some implementations , instructions relating to the updated hypotheses may be transmitted to each of the targets 202 during flight , so that the targets 202 may alter their flight paths to increase the probability of successfully intercepting the target 205 . fig3 shows a block diagram of a system 300 for deploying multiple interceptors to intercept a moving target , according to an illustrative implementation . the system includes a fire control system 301 in communication with the interceptor 202 via a prelaunch data link 345 and an in - flight data link 348 . both the fire control system 301 and the interceptor 202 are also configured to receive information about the target 205 , for example through the use of sensors configured to detect the motion or the target 205 . the fire control system 301 includes a fire control targeting sensor 305 , a target state estimator 310 including a plurality of filters 312 and a blending / selection module 314 , a plurality of predictive target models 315 , a battle - space manager 322 , a weapon tasking logic module 324 , a launch system 330 , a fire control tracking sensor 335 , and an interceptor state estimator 340 . the interceptor 202 includes an interceptor sensor 350 , a target state estimator 351 including a plurality of filters 352 and a blending / selection module 354 , a predictive target model 355 , and a control system 360 . the modules making up the system 300 may be implemented in hardware , software , or a combination thereof . for example , the modules may include sensors , memory devices , and processors configured to perform the tasks discussed below . the fire control system 301 includes a fire control targeting sensor 305 that can receive information about the target 205 . in some implementations , the fire control targeting sensor 305 can be a radar system . the fire control targeting sensor 305 can receive or determine information such as the velocity , position , and size of the target 205 . the fire control targeting sensor 305 can also communicate target information to the target state estimator 310 . in some implementations , the fire control targeting sensor 305 can track the target 205 over a period of time , and can continuously collect target data by tracking the target 205 during the period of time . the target state estimator 310 can use the target information received from the fire control targeting sensor 305 to determine state information of the target at a particular time . in some implementations , the target state estimator 310 can determine several possibilities for the current state of the target 205 , each of which can be based on a filtering technique applied by one of the plurality of filters 312 . for example , the filters 312 may use raw data received from the fire control targeting sensor 305 , such as radar or sonar data , to determine a velocity , acceleration , and / or maximum maneuverability of the target 205 . in some implementations , the targeting state estimator 310 also can determine the type of target 205 tracked by the targeting sensor 305 . for example , the targeting state estimator 310 may determine that the target 205 is a missile , a guided munition , or a maneuverable reentry body based on information relating to the target &# 39 ; s size or velocity received from the targeting sensor 305 and processed by the filters 312 . information from the filters 312 is delivered to the blending / selection module 314 . the blending / selection module 314 can use the output of the filters 312 to determine the current state of the target 205 . in some implementations , the blending / selection module 314 can make this determination by selecting the output of one of the filters 312 and discarding the outputs of the others . in other implementations , the blending / selection module 314 can determine the current state of the target 205 based on a composite of the outputs of two or more of the filters 312 . the targeting state estimator 310 can communicate this information to the predictive target models 315 . each of the predictive target models 315 can use the information received from the targeting state estimator 310 to generate hypotheses relating to the paths that may be traversed by the target 205 in the future . for example , the predictive target models 315 may compute hypotheses relating to the potential paths 212 shown in fig2 . in some implementations , the predictive target models 315 may generate hypotheses based on a maximum maneuverability of the target 205 . in some implementations , the predictive target models 315 may generate hypotheses based on common flight patterns of targets similar to the target 205 . for example , the predictive target models 315 may generate a hypotheses indicating that the target 205 is likely to weave at particular frequencies and amplitudes that are within the range of capability of the target 205 . many other hypothesis scenarios may be possible based on the state of the target 205 and the relative position of the asset that the target 205 is attempting to strike . an arbitrary number of predictive target models 315 can be included in the fire control system 301 the battle - space manager 322 can evaluate the hypotheses generated by the predictive target models 315 . for example , the battle - space manager 322 may determine that the target 205 is more likely to follow the trajectories associated with some hypotheses than with others . in some implementations , the battle - space manager 322 may assign greater weight to the hypotheses that make use of the maximum maneuverability of the target 205 , as it may be likely that the target 205 will attempt to use its maneuverability to avoid interception . the battle - space manager 322 may also group the hypotheses into hypothesis families . for example , a hypothesis family could include a subset of trajectory hypotheses that are spatially close to one another . in some implementations , the battle - space manager 322 can use the hypothesis information to determine how to deploy any available interceptors 202 to intercept the target 205 . for example , the battle - space manager 322 may determine a number of interceptors 202 to be deployed in a mission to intercept the target 205 , based on the hypotheses . in some implementations , the hypotheses may indicate that the target 205 has a very high probability of following one of a limited number of potential paths . therefore , the battle - space manager 322 may determine that relatively few interceptors 202 are needed to reliably intercept the target 205 . in other implementations , the battle - space manager 322 may determine that many interceptors 202 are required to provide a sufficiently high probability of successfully intercepting the target 205 . the battle - space manager 322 can transmit this information to the weapon tasking logic module 324 , which can assign a hypothesis or subset of hypotheses to each of the interceptors 202 to be deployed via the prelaunch data link 345 or the in - flight data link 348 . the weapon tasking logic module can also transmit to the launch system 330 an instructions indicating the time at which each of the respective interceptors 202 should be launched . the interceptor 202 includes an interceptor sensor 350 that can receive information about the target 205 . in some implementations , the interceptor targeting sensor 350 can be similar to the fire control targeting system 305 . for example , the interceptor targeting sensor 350 can include a radar system or a sonar system for tracking the target 204 . the interceptor targeting sensor 350 can determine information such as the velocity , position , and size of the target 205 . information from the control system 360 can also be transmitted to the interceptor sensor 350 through the summing junction 370 , thereby allowing the interceptor sensor 350 to determine the relative motion between the interceptor 202 and the target 205 . the interceptor sensor 350 can communicate this information to the target state estimator 351 . in some implementations , the interceptor sensor 350 can track the target 205 over a period of time , and can continuously collect target data during the period of time . the target state estimator 351 can use the target information received from the interceptor sensor 350 to determine state information of the target at a particular time . in some implementations , the target state estimator 351 can determine several possibilities for the current state of the target 205 , each of which can be based on a filtering technique applied by one of the plurality of filters 352 . for example , the filters 352 may use raw data received from the interceptor sensor 350 to determine information relating to the current state of the target 205 , in a manner similar to the filters 352 discussed above . information from the filters 352 is delivered to the blending / selection module 354 . the blending / selection module 354 can use the output of the filters 352 to determine the current state of the target 205 , and the targeting state estimator 351 can communicate this information to the predictive target model 355 . before the interceptor 202 has been launched , the predictive target model 355 can receive information from the weapon tasking logic module 324 through the prelaunch data link 345 . the prelaunch data link 345 can be any form of wired or wireless communications typically used in projectile communication systems . the predictive target model 355 can use the information received from the weapon tasking logic 324 and the target state estimator 351 to generate a hypothesis for the future trajectory of the target 205 , and can communicate the hypothesis to the control system 360 . the control system 360 can receive a launch command from the launch system 330 . after the interceptor 202 has been launched , the control system 360 also can receive information from the weapon tasking logic module 324 via the in - flight data link 348 and can control the interceptor 202 to execute the intercept solution provided by the predictive target model 355 . during flight , the weapon tasking logic module 324 can provide updated flight instructions to the control system 360 . in some implementations , the instructions received from the predictive target model 355 can be subordinate to instructions received from the weapon tasking logic 324 . therefore , the fire control system 301 can re - task the interceptor 202 based on an update to the hypothesis subset assigned to the interceptor 202 . referring again to the fire control system 301 , the fire control tracking sensor 335 can track the motion of each interceptor 202 after deployment . for example , the fire control tracking sensor 335 can be a radar system or a sonar system . information obtained by the fire control tracking sensor 335 can be transmitted to an interceptor state estimator 340 , which can determine state information relating to each interceptor 202 . for example , the interceptor state estimator 340 may determine a velocity and position for each interceptor 202 . this information can then be provided to the battle - space manager 322 , which can update the intercept solution based on the new information . the battle - space manager 322 can relay this information to the weapon tasking logic module 324 , which can in turn provide updated commands to each interceptor 202 via the in - flight data link 348 . fig4 shows a flow chart of a process 400 for intercepting a moving target , according to an illustrative implementation . the process 400 includes receiving target information at a first time ( stage 405 ), determining hypotheses for trajectories of the target ( stage 410 ), assigning hypotheses to respective interceptors ( stage 415 ), and controlling the interceptors to maneuver to intercept the target , based on their respective hypotheses ( stage 420 ). in some implementations , the process 400 also includes receiving target information at a second time ( stage 425 ), updating at least one target trajectory hypothesis ( stage 430 ), and controlling the respective interceptor to maneuver to intercept the target based on the updated hypothesis ( stage 435 ). referring again to fig4 , the process 400 includes receiving target information at a first time ( stage 405 ). in some implementations , the target information can include bearing , range , size , velocity , acceleration , and position information . the target information may be determined , for example , by a radar system . in some implementations , sensor data ( e . g ., radar or optical sensor data ) may be used to ascertain other information relating to the target , such as the type of target ( e . g ., a missile , a guided munition , a maneuverable reentry vehicle , etc .) and its maximum maneuverability . the process 400 includes determining hypotheses for trajectories of the target ( stage 410 ). in some implementations , the hypotheses may be based in part on the target state information determined in stage 405 . for example , it may be hypothesized that the target will accelerate according to its maximum maneuverability as it moves toward a vulnerable asset . the hypotheses may be evaluated based on their probabilities . in some implementations , the hypotheses may be grouped into hypothesis families . for example , a hypothesis family may include all of the hypotheses that describe target trajectories within a given volume of space . the process 400 includes assigning hypotheses to respective interceptors ( stage 415 ). in some implementations , the only hypotheses whose probability meets a predetermined threshold are assigned to interceptors . other hypotheses may be discarded . in some implementations , each interceptor may be assigned more than one hypothesis . for example , each interceptor may be assigned a family or families of hypotheses . in some implementations , the hypotheses are assigned to interceptors based on the capability of the interceptors to intercept targets that may move according to the hypotheses . thus , more highly maneuverable interceptors may be assigned a greater number of hypotheses , while less maneuverable interceptors may be assigned fewer hypotheses . the hypotheses assigned to each interceptor may be non - overlapping , so that the interceptors can collaborate to cover a broad range of hypotheses for target trajectories . the process 400 includes controlling the interceptors to maneuver so as to intercept the target , based on their respective hypotheses ( stage 420 ). launch commands can be sent to the interceptors that have been chosen to be deployed for a particular mission . guidance commands can be sent to each respective deployed interceptor to cause the interceptor to move in such a way as to intercept the target under the assumption that the target will maneuver according to the hypothesis or hypotheses assigned to the interceptor . in some implementations , the process 400 can include receiving target information at a second time ( stage 425 ). for example , the system ( e . g ., a radar system ) used to track the target at the first time ( stage 405 ) may also be used to track the target at the second time . additional information may therefore be collected at the second time that can help to determine the path of the target as it moves toward a targeted asset . in some implementations , target information can be received at additional times as well . for example , the system used to track the target can be configured to collect target information at regular or semi - regular time intervals . updating the target information over time can allow the system to improve the hypothesis of future target trajectory . the process 400 can also include updating at least one target trajectory hypothesis based on the target information received at the second time ( stage 430 ). for example , as additional target information is received ( stage 425 ) at the second time , the likely trajectories of the target may be known with greater certainty , and the probabilities assigned to certain of the hypotheses may be altered . in some implementations , hypotheses not considered based on the target information received at the first time may be generated based on the target information received at the second time . the process 400 can also include controlling the respective interceptor to maneuver so as to intercept the target based on the updated hypothesis ( stage 435 ). in some implementations , guidance commands may be sent to the respective interceptor whose target trajectory hypothesis information has been updated . for example , guidance commands may be sent to the interceptor wirelessly while the interceptor is in flight . the interceptor may then respond to the guidance commands by altering its flight path in response to the updated hypotheses . various modifications to the implementations described in this disclosure may be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other implementations without departing from the spirit or scope of this disclosure . thus , the claims are not intended to be limited to the implementations shown herein , but are to be accorded the widest scope consistent with this disclosure , the principles and the novel features disclosed herein . certain features that are described in this specification in the context of separate implementations also can be implemented in combination in a single implementation . conversely , various features that are described in the context of a single implementation also can be implemented in multiple implementations separately or in any suitable subcombination . moreover , although features may be described above as acting in certain combinations and even initially claimed as such , one or more features from a claimed combination can in some cases be excised from the combination , and the claimed combination may be directed to a subcombination or variation of a subcombination . similarly , while operations are depicted in the drawings in a particular order , this should not be understood as requiring that such operations be performed in the particular order shown or in sequential order , or that all illustrated operations be performed , to achieve desirable results . further , the drawings may schematically depict one more example processes in the form of a flow diagram . however , other operations that are not depicted can be incorporated in the example processes that are schematically illustrated . for example , one or more additional operations can be performed before , after , simultaneously , or between any of the illustrated operations . in certain circumstances , multitasking and parallel processing may be advantageous . moreover , the separation of various system components in the implementations described above should not be understood as requiring such separation in all implementations , and it should be understood that the described program components and systems can generally be integrated together in a single software product or packaged into multiple software products . additionally , other implementations are within the scope of the following claims . in some cases , the actions recited in the claims can be performed in a different order and still achieve desirable results . | 6 |
fig1 shows the complete electro - chemical - thermal cell system in vertical cross - section view . the ect cell consists of a main cell 1 and an oxidizer tank 2 . the main cell 1 contains both the charge and discharge sections of the cell . a reaction chamber 30 is located at the top of the main cell 1 . a set of electrodes 28 , for recharging , are located in the lower center of the main cell 1 . all of the fuel , sodium metal , is stored in the main cell 1 above the reacted salt in a sodium region 6 . the main cell 1 contains a sodium chloride region 8 which is shown in the middle of the cell as a dry powder . the salt is a chemical compound consisting of a metal , preferably a light metal , and a non - metal , preferably a strong oxidizer . a quantity of metal is shown floating on the sodium chloride region 8 in the sodium region 6 . the level of the metal / salt interface depends on the level of charge in the system . an argon gas region 17 is shown above the sodium region 6 . the interface between the metal and inert gas also moves up and down depending on the level of charge in the system . the lower region of the main cell 1 contains the set of electrodes 28 and a low melting point liquid salt mixture 15 . the lower region has a sodium chloride holder plate 51 which separates the powdered sodium chloride region 8 above the plate and the sodium chloride , calcium chloride , and barium chloride salt mixture 15 below the plate . an insulator float plate 50 floats on the liquid salt mixture 15 , during charging , and acts as a valve controlling the amount of sodium chloride allowed into the lower salt mixture . in the charge cycle , one of the oxidizer components , chlorine , is separated from the salt during electrolysis and is ducted into the oxidizer tank 2 where it combines with the iodine to form iodine chloride and iodine trichloride . an oxidizer recharge valve 21 is used to control the flow from the electrodes 28 to the oxidizer tank 2 . an oxidizer flow valve 20 is used to control the flow of oxidizer from the oxidizer tank 2 to the reaction chamber 30 during cell discharge . the main cell 1 is surrounded by an evacuated thermal cover . the thermal cover is made of multilayer sheeting , such as a thin reflective foil 46 , spaced inside an evacuated region 27 . the main cell 1 is shown , in fig1 with a 430 stainless steel shell for a main cell inner container 7 surrounding the working fluids . the container is coated on the inside with an electrically insulating ceramic which is also non - wetting and chemically inert relative to the salts and liquid metal . the ceramic coating consists of first a layer of chromium carbide applied over the stainless steel surface , then a layer of boron nitride . a main cell outer container 5 is also made from the 430 stainless steel . the outer shell is thicker to prevent buckling of the container due to the pressure differential caused by the vacuum . the outer container 5 has a set of evacuated couplings 4 located where tubes or electrodes connect across the inner and outer container wall . the extensions reduce the conduction losses for each coupling by providing a longer connector path inside the evacuated region 27 . an electrode housing 3 is a structural container which holds the electrodes 28 in place . the electrode housing 3 is also made of 430 stainless steel and is coated both inside and outside with chromium carbide and boron nitride . the electrodes 28 are fitted between the electrode housing 3 walls and held in place with a set of ceramic spacers 37 shown in fig2 . a left electrode feed line 24 , shown in fig1 is attached to a left molybdenum end plate 10 . a right electrode feed line 25 is attached to a right molybdenum end plate 9 . the current design uses molybdenum for the two electrode feed lines 24 and 25 due to its corrosion compatibility with the working fluids . the two electrode feed lines 24 and 25 are insulated from each other , inside of the main cell 1 , by a ceramic insulation 47 . the molybdenum end plates 9 , 10 are attached so as to provide an electrically conducting current path through the electrodes 28 and the salt mixture 15 . referring also to fig4 a , the electrode housing 3 has a set of tailored holes 64 located in the top 62 of the housing which allow the liquid sodium to float up out of the box through the liquid salt mixture 15 . the tailored holes 64 allow the sodium to escape from each electrode 28 as individual droplets which rise through the liquid salt mixture 15 preventing electrical shorting between electrodes 28 . referring to fig4 b , in and alternate embodiment , electrode housing 3 has a movable cover 66 located above the electrodes . cover 66 has a set of individual pockets 68 , one above each electrode , which allow the liquid metal to collect and be electrically isolated after leaving the electrodes . the cover 66 is huge so that after a quantity of liquid metal has collected in the individual pockets 68 , the buoyancy forces caused the cover 66 to pivotally rotate upwards about pivot 70 , thereby releasing the metal accumulated in the pockets 68 . preferably , the cover 66 is electrically connected with the electrodes so that the electrodes are energized when the cover 66 is down , and when the cover rotates upward the electric circuit is interrupted to deenergize the electrodes until it rotates back down into position . the electrodes 28 have an oxidizer outlet 39 which connects the electrodes 28 to an oxidizer outlet line 19 . the oxidizer outlet line 19 is connected to the oxidizer tank through the oxidizer recharge valve 21 . the main cell 1 has the reaction chamber 30 located at the center region . the reaction chamber 30 is constructed of 430 stainless steel and is coated with the chromium carbide and boron nitride . a heat pipe 14 is located outside of the reaction chamber 30 and transmits the generated heat . the heat pipe 14 is connected to a heat engine such as a stirling or brayton engine , not shown . the heat engines can be heated directly from the heat pipe 14 or a secondary heat conduit can be used to move the heat from the heat pipe 14 to the heat engine . an oxidizer input line 18 is connected from the bottom of the reaction chamber 30 to the oxidizer flow valve 20 . the bottom of the reaction chamber 30 has a sodium inlet and sodium chloride outlet 33 which allows the various working materials to enter and leave . the sodium inlet and sodium chloride outlet 33 consists of a carbon spacer 35 which is connected to the reaction chamber 30 . the outlet also has a liquid sodium wick 31 which starts in the sodium region 6 and ends inside the reaction chamber 30 . the outlet also has a wick spacer 34 which holds the sodium wick 31 in position . the oxidizer input line 18 holds the inlet wick spacer in position . a wick holder 32 holds the sodium wick 31 against the reaction chamber 30 walls . a reaction chamber temperature probe 13 is used to measure the reaction chamber 30 temperature during operation . a fill line and temperature probe holder 16 is located in the top of the main cell 1 . a sodium temperature probe 55 is used in the main cell 1 during operation . a vent and pressure probe holder 11 is located in the top of the main cell 1 . a main cell pressure probe 56 is used in the main cell 1 during operation . a lower argon gas region 29 is located at the bottom of the main cell 1 . the lower argon gas region 29 is attached to the argon gas region 17 by an argon gas line 36 . the lower argon gas region 29 is enclosed by a bottom plate 53 from the rest of the main cell 1 . a salt mixture heater 48 is located on the lower side of the bottom plate 53 inside of a heater conduit 23 . the heater conduit 23 is a closed tube which connects through the right evacuated coupling 4 . a salt mixture temperature probe 49 is located in the right evacuated coupling 4 . the probe is located inside of the main cell inner container 7 . the oxidizer tank 2 , shown in fig1 stores an oxidizer 12 separate from the main cell 1 . the tank is constructed from stainless materials and covered with chromium carbide and boron nitride . a heater for oxidizer region 22 is attached to the bottom of the oxidizer tank 2 . an oxidizer tank thermal cover 26 surrounds the oxidizer tank 2 . a cooling system 52 is also attached to the bottom of the oxidizer tank 2 and is used during recharge mode . the cooling system could use water as a heat transfer source . the oxidizer recharge valve 21 is an automatic one way flow valve which allows flow from the main cell 1 into the oxidizer tank 2 during charging . an oxidizer temperature probe 54 is located inside of the oxidizer tank 2 . referring to fig2 the electrode housing 3 is shown surrounding the graphite electrodes 28 . the electrode housing 3 is constructed of 430 stainless steel with a chromium carbide and boron nitride ceramic coating inside and out , chemically and electrically isolating all of the components . the molybdenum end plates 9 , 10 are attached to the electrode feed lines 24 , 25 . the molybdenum end plates 9 , 10 are covered with hexagonal boron nitride on the sides which are exposed to the liquid salt . ceramic spacers 37 are used to hold the spacing between the individual graphite electrodes 28 . the oxidizer outlet 39 connects the individual graphite electrodes 28 to the oxidizer outlet line 19 . the number of electrodes used is determined by the charging voltage requirements . the oxidizer outlet line 19 is connected to the oxidizer recharge valve 21 . the oxidizer recharge valve 21 is shown with an adjustable bolt 59 on the outside of the left evacuated coupling 4 . the oxidizer recharge valve 21 has a spring 60 attached from the adjustable bolt 59 to a valve body 58 . the valve body 58 has four o rings located at either end of the cylindrical body . a set of vent holes are located between the mid two o rings and are connected to a central hole which runs out the right side of the cylindrical body . the oxidizer recharge valve 21 vents into the oxidizer tank through a side hole which runs from the oxidizer recharge valve 21 through the evacuated coupling 4 . an argon control line 57 is mounted to the oxidizer recharge valve 21 between the adjustable bolt 59 and the valve body 58 . the argon control line 57 is also attached to the argon region below the bottom plate 53 . fig3 is a cross - sectional view of an individual graphite electrode 28 . the graphite electrode 28 consists of a dense graphite 41 shell which is hollowed out and machined to have a slotted cavity 42 for the oxidizer flow . the slotted cavity 42 consists of a series of channels which run the length of the graphite electrode 28 . the channels converge to the oxidizer outlet 39 . a porous graphite 40 layer is fitted into the graphite electrode 28 and is coated with a ceramic layer to form the ‘ valve electrode ’ 38 . a ceramic layer 43 consists of boron carbide which is created by infiltration of boron atoms into the outer surface of the porous graphite 40 structure . the resulting boron carbide coating extends part way through the porous graphite 40 and has almost the same porosity as the original porous graphite 40 . a coating of turbostratic boron nitride is added over the boron carbide to increase the electrical resistance of the ceramic layer . the electro - chemical - thermal cell provides a significant increase in specific energy storage and specific power release rate relative to existing electrically charged / discharged cells . this is due to the thermal output design which provides approximately 4 to 10 times the energy density of electrical discharge systems for equivalent reactants . the cell has the further benefit of not producing carbon dioxide during operation , which is known to contribute to global warming . the system charges using electrical input through a series of graphite electrodes 28 . the molten salt is broken into its elements using electrolysis at each graphite electrode 28 . one side of the graphite electrode 28 produces the constituent metal which floats to the top of the sodium chloride region 8 . the other side of the graphite electrode 28 produces the oxidizer 12 which is internally ducted into the graphite electrode 28 and out of the main cell 1 into the oxidizer tank 2 . when the main cell 1 is discharged a small quantity of liquid metal remains above the salt . the excess metal provides the preheat fuel required to heat the cell to a temperature which melts both the metal and the salt , prior to charging . an alternate heating method is to use the salt mixture heater 48 . when the main cell 1 is charged , a small amount of salt remains which covers the graphite electrodes 28 preventing them from electrically shorting . the use of thermal output allows the main cell 1 to be constructed as a single cell independent of size . this is due to the ability to separate the metal and oxidizer away from the graphite electrodes 28 after electrolysis . cell discharge occurs in the reaction chamber 30 where the output heat is generated . the reaction chamber 30 is isolated so that a high localized temperature can be maintained . the high temperature is necessary to provide an efficient operation of an external combustion engine ; such as a stirling , brayton , or rankine cycle engine . the external heat pipe 14 transfers the energy from the reaction chamber 30 to the engine with minimal losses . the heat transfer can be directly from the heat pipe 14 or through a heat conduit or thermosyphon located between the ect cell and the engine . the rate of oxidizer addition to the reaction chamber 30 determines the heat flux available to the heat pipe 14 . the heat output rate is significantly higher than an equivalent electrical output cell due to the ease of sizing the heat pipe 14 to significantly higher power rates . the system is ready for charging when the quantity of salt mixture 15 is liquefied in the main cell 1 . the salt mixture temperature probe 49 measures the salt mixture temperature . the heating of the salt mixture can be accomplished electrically with the salt mixture heater 48 on the outside of the bottom plate 53 . the two containers , the oxidizer tank 2 and the main cell 1 , are insulated to minimize losses from the containers . the oxidizer tank 2 operates at temperatures which are significantly lower than the main cell 1 . the lower temperature minimizes the heat losses from the oxidizer tank 2 allowing a fiber type insulation shown as the oxidizer tank thermal cover 26 . the main cell 1 contains the majority of the working fluids at a moderately high temperature . since heat losses through the main cell outer container 5 are the largest direct efficiency loss , it is beneficial to insulate this main cell outer container 5 using a multi - layer foil vacuum container . this allows the main cell 1 to remain hot , with the metal and salt in a molten state , for several weeks without the need to preheat the system . the vacuum container consists of the main cell inner container 7 which holds the liquid metal and salts . the region between the inner and outer containers 5 and 7 contains the evacuated region 27 . a multi - layer set of thin metal reflective foil 46 is used to improve the insulation . once the system is up to temperature a pressure differential is created between the main cell 1 and the oxidizer tank 2 . the oxidizer tank 2 pressure is reduced by the amount tolerated by the ‘ valve electrode ’. the pressure can be reduced in the oxidizer tank 2 by reducing the temperature of the oxidizer tank by using the cooling system 52 . the oxidizer recharge valve 21 is set to the desired pressure difference between the main cell and the oxidizer tank , which is approximately 1 to 2 pounds per square inch pressure . once the system starts charging , the pressure differential will be maintained by the cooling rate of the oxidizer in the oxidizer tank 2 . oxidizer recharge valve 21 is allowed to move oxidizer from the graphite electrodes 28 to the oxidizer tank 2 . oxidizer recharge valve 21 is an automatic one - way valve which opens when the pressure in the main cell 1 is above the oxidizer tank 2 pressure . the oxidizer recharge valve 21 operates using the argon pressure as a reference pressure source . the argon control line 57 is located on one side of the valve body 58 . the spring 60 is tied between the valve body 58 and the adjustable bolt 59 . the spring 60 provides the pressure differential capability by applying a pulling force to the valve body 58 . when the pressure differential is within 0 to 2 psi , the valve body 58 allows oxidizer 12 flow from the electrodes 28 to the oxidizer tank 2 . at higher and lower pressures the valve body 58 seats at a left or right position and closes off the oxidizer flow . the higher pressure forces the oxidizer into the oxidizer tank 2 where the cooling system 52 cools the mixture and lowers the vapor pressure . the main cell 1 is pressurized using a inert gas such as argon or helium . the argon gas region 17 is increased by the lower argon gas region 29 which it connects to by the argon gas line 36 . this allows the main cell 1 to remain at approximately constant pressure during charging while the volume in the main cell 1 is changing . the total system argon pressure can also be raised , by the vent 11 , to allow more rapid charging rates . the charging process uses the graphite electrodes 28 which are held by the electrode housing 3 . the graphite electrodes 28 are set - up in series which allows an increase in the voltage used for input into the electrode feed lines 24 , 25 . the feed lines are isolated from the main cell 1 using ceramic insulation 47 . this allows the current to be less for a given wattage input . the two electrode feed lines 24 , 25 are connected to an outside direct current charging source . the electrode feed lines 24 , 25 supply power to the end electrodes through the molybdenum end plates 9 , 10 located outside of the two end electrodes . the molybdenum end plates 9 , 10 are sealed from fluids to minimize corrosion and electrical leakage . the graphite electrodes 28 function by electrolysis of the salt which surrounds them . the current path is set - up to be the least resistance while passing through the graphite electrodes 28 series . this minimizes losses from electrolysis occurring outside of the graphite electrodes 28 stack . each graphite electrode 28 is designed so that on one side of the graphite electrode 28 , the sodium metal is formed and released . the metal floats up into the electrically isolated sodium region 6 . the electrode housing 3 has a top 62 which has a well defined set of holes 64 to allow a controlled rate of liquid sodium to float up through the salt mixture 15 as a series of small droplets ; each droplet electrically separate from the rest . the sodium passes through the insulator float plate 50 where it is wicked up through the dry sodium chloride region 8 to the sodium region 6 . the oxidizer is formed on the opposite face of a given graphite electrode 28 and is ducted inside of the graphite electrode 28 through the “ valve electrode ” 38 . the oxidizer moves through a small electrode chlorine outlet 39 located at the end of the graphite electrode 28 into the oxidizer outlet line 19 . the oxidizer then travels through oxidizer recharge valve 21 and into the oxidizer tank 2 . upon entering the oxidizer tank 2 , the oxidizer is cooled to ambient temperature conditions . the chlorine mixes with the iodine and iodine chloride to form iodine trichloride and iodine chloride . both of these compounds are extremely stable and form a liquid in the oxidizer tank 2 . the electrode 28 , in fig3 has dense graphite 41 on five of the six sides . the ‘ valve electrode ’ side has a porous graphite 40 . the ceramic coating 44 electrically insulates the electrode . the conductive coating 45 , consisting of chromium carbide , increases the conductivity and wetting on the electrode face . the ceramic layer 43 provides the wetting surface for the ‘ valve electrode ’ to function . the oxidizer side of the graphite electrode 28 functions using a ‘ valve electrode ’ technique . the ‘ valve electrode ’ 38 is designed to prevent the salt from migrating past the porous graphite 40 and ceramic layer 43 interface . this is accomplished using surface tension forces which allow a pressure differential between the main cell 1 and the oxidizer tank 2 without the salt moving across the barrier . the ‘ valve electrode ’ 38 works by having a porous , conducting , nonwetting medium located inside the electrode near the oxidizer face . graphite is chosen for this material . a porous , nonconducting , wetting layer of material is covering the porous graphite . the salt wets the nonconducting material and forms the interface where the electrolysis occurs for the oxidizer . the size of the maximum pressure differential which the interface can support is related to the viscosity of the salt and the pore size of the interface . a small pore size is beneficial for supporting larger pressures between the main cell 1 and the oxidizer tank 2 . a process was developed for producing the small pore size on the graphite . the first step is to machine a porous electrode to the shape desired . the next step involves using a chemical vapor process which causes a ceramic compound to be form from the existing graphite . boron is chosen as a material for formation of the ceramic compound . the boron forms boron carbide on the surface with nearly identical porosity as the initial graphite surface . a final layer of turbostratic boron nitride is vapor deposited over the boron carbide to further increase the electrical resistance of the ceramic layer 43 . the salt mixture 15 is chosen to be a low melting point salt mixture . calcium chloride and barium chloride are mixed with the sodium chloride to lower the melting point . the liquid salt is required for the electrodes to function . the two added salts were also chosen due their ability to remain compounds during the electrolysis so that only sodium is formed . as the sodium chloride is used up in the electrolysis reaction at the electrodes 28 , the insulator float plate 50 slowly settles and allows dry sodium chloride powder to replace the sodium chloride which was separated out . the sodium chloride flows through holes in the sodium chloride holder plate 51 . a path through the holder plate and float plate is formed when the float plate settles slightly . the insulator float plate 50 is shown constrained by limiters 72 to move only a small amount . the electrolysis process can continue until all of the sodium chloride has been separated into its components . when the powdered sodium chloride region 8 is used up the quantity of sodium chloride in the salt mixture 15 will drop . the melting point of the salt mixture 15 will slowly rise as the sodium chloride is removed . the salt mixture 15 will then solidify around the electrodes 28 and stop the electrolysis from proceeding further . this offers a fail - safe technique in case the electrical circuit is not turned off . what should happen under normal operation is the current will drop and a charging circuit will detect the drop - off and stop the charging completely . the main cell 1 can be stored almost indefinitely with the temperature of all the components at ambient conditions . for cell start - up , the salt mixture heater 48 is activated and allows heatup to 120 degrees centigrade in the main cell 1 . the heater conduit 23 holds the heater 48 and seals it from the rest of the cell . the ect battery uses thermal discharge to obtain very high energy density and discharge rates . the ect battery is designed for very rapid start - up once the sodium is in the liquid state . the main cell 1 can be fully operational with the temperature in the main cell 1 above 120 centigrade . the main cell 1 temperature and pressure are measured using the probes 55 and 56 . the probes are located inside the vent and fill lines 11 and 16 . the oxidizer tank 2 is heated using the heater 22 to bring the oxidizer to a slightly higher pressure relative to the main cell pressure . the oxidizer temperature is measured using the probe 54 . once the system is up to temperature the oxidizer flow valve 20 can be used to control the heat output through the reaction chamber 30 . the use of a small reaction chamber allows faster start - up rates and provides a locally hotter reaction chamber 30 temperature which can be transferred to the external combustion engine for higher efficiency . the temperature in the reaction chamber 30 is monitored using the temperature probe 13 . the probe can be tied to a feedback system with the oxidizer flow valve 20 so that the desired temperature in the reaction chamber 30 can be maintained . the sodium enters the reaction chamber 30 using a wicking action in a stainless mesh sodium wick 31 which runs from the liquid sodium region 6 up inside the heat pipe 14 . the wick holder 32 and the wick spacer 34 help hold the wick in position inside the reaction chamber 30 . the carbon spacer 35 is used to help insulate the reaction chamber 30 and to improve the heat transfer between the liquid salt and the incoming reactants . the reaction chamber 30 has a region , the sodium inlet and sodium chloride outlet 33 , where the liquid metal and oxidizer input line 18 are ducted past the outflowing salt . the salt is moving in the opposite direction as the metal and oxidizer and transfers the higher temperature heat from the salt into the metal and oxidizer preheating them prior to entering the reaction chamber 30 . the main cell 1 is surrounded by a multilayer foil evacuated region which minimizes the heat loss from the main cell 1 . the connecting fittings to the main cell 1 are also insulated so that the main cell 1 can remain liquid for several days without operation . the evacuated coupling 4 reduces the losses at the fittings . if it is desired to maintain the main cell 1 at operating temperature then a small supply of oxidizer can be added to the oxidizer input line 18 using a temperature feedback system to monitor flow rates . the electro - chemical - thermal cell can operate with a wide number of variations in its components . the only features which are specific to the cell are : 1 . the use of electricity and / or thermal energy to reverse the process and effectively recharge the ect cell . 2 . the storage of energy mainly in the form of a chemical change . a combination of chemical and thermal storage is also available . 3 . the output is mainly thermal . electrical output could be produced by wicking the liquid metal down to , each / or some , of the electrode faces . the output could then allow combinations of thermal and electrical energy such as thermal only , thermal and electrical , or electrical only . the general arrangement can vary considerably over what is currently shown in fig1 : it is possible to have the liquid metal heavier than the salt in which case the electrodes would be on top ; also the liquid metal feed line would be reversed and connected to the lower metal region . it would be possible to store the liquid metal in a separate container . the metal could be wicked into individual containers ; one for each electrode . it would also be possible to move the reaction chamber out of the main cell . feed lines to the reaction chamber would be required and a salt drain to move the salt to the main cell once the metal and oxidizer have reacted . it may be possible to use a metal and oxidizer which can both be stored in the main cell . for instance if both , metal and oxidizer , were liquids at the operating temperatures then one could be heavier and one could be lighter than the salt . this would allow the salt to keep the two reactants apart . with this system , the separate oxidizer tank 2 would not be required . it may be possible to use preferential wicking regions to separate the salt and liquid metal . by wicking the liquid metal away from the electrodes in may be possible to make the main cell orientation independent or even gravity independent ; i . e . zero gravity . the main cell could also be put in some type of cradle arrangement where it would orient itself with gravity and the outer container could move independently . the main cell could be made into any shape required . for instance , it could be taller or wider in any direction . it could also be tapered in any direction to meet requirements . another arrangement of the main cell is to spin the cell about an axis . centrifugal force could be used to separate components . the main cell and / or oxidizer tank could be made of carbon / carbon or boron nitride / boron nitride . the ceramic liner , in the main cell , could be any individual layer or combination layers of boron carbide , cubic boron nitride , turbostratic boron nitride , chromium carbide , and hexagonal boron nitride . the tank can be changed in size and shape to meet requirements . for instance , it can be round or cylindrical with flat or rounded ends . the tank can be made of a variety of material , including metals , ceramics , composites . liners or coatings can also be applied to the tank to prevent corrosion ; multiple layers or single layers can be used . the oxidizer tank can be placed in any orientation relative to the main cell . it can be above , below or next to the main cell . the use of a binary , or higher multiple , oxidizer for the ect system is unique , i . e . iodine and chlorine . using two components which combine to form a third compound allows an improvement in system safety and can ease storage . for instance , two substances combining to create a liquid or solid stores at lower pressure and with possibly a smaller tank size . other oxidizers which could be considered include : 1 . fluorine and chlorine , 2 . fluorine and iodine , 3 . fluorine and bromine , 4 . fluorine and sulphur , 5 . chlorine and sulphur , 6 . chlorine and bromine , 7 . fluorine and oxygen , 8 . hydrogen and chlorine , 9 . hydrogen and fluorine , 10 . phosphorus and chlorine , 11 . phosphorus and bromine , 12 . phosphorus and fluorine , 13 . arsenic and chlorine , 14 . arsenic and bromine , 15 . chlorine and iodine , or 16 . tin and chlorine . single oxidizer substances could include : sulphur , selenium , tellurium , tin , arsenic , antimony , chlorine , fluorine , iodine or bromine . the electrode housing consists of a box for holding the electrodes and conduits for bringing the oxidizer and electrode feed lines out of the main cell . the oxidizer outlet line 19 can be attached to any part of the electrode housing and can project through the main cell in any orientation . the electrode housing can be curved or fabricated in any shape as long as it serves to hold the electrodes . multiple housings could be used with batches of electrodes . the oxidizer outlet line 19 can be used for charging where the oxidizer flows away from the electrodes or it can used for discharging , producing electricity where the oxidizer flows toward the electrodes . the electrode housing could be eliminated if the electrodes were mounted directly in the main cell with electrode end holders mounted on the main cell walls . spacers could also be used to hold the electrodes in place inside of the main cell . the end electrodes could be mounted directly in the main cell wall . this could keep the electrode feed lines 24 , 25 completely outside of the main cell . the electrode feed lines 24 , 25 could be made retractable and touch the electrode end plates only when required for charging . this would reduce the thermal conduction path . one possibility is to have the electrode feed lines 24 , 25 change shape from heating to a certain temperature , or from an external electrical input . the use of a bimetallic strip , for the electrode feed lines 24 , 25 , could expand differentially with temperature and touch only at the charging temperature . the oxidizer outlets 39 could be designed to pass though the main cell wall and connect with a common oxidizer outlet or mixing chamber on the main cell outer wall . the oxidizer lines 18 , 19 , could be combined into a single line . temperature sensitive or 1 way valves could be used to direct the flow inside of the main cell . for instance , the oxidizer flow could be designed to only flow away from the electrodes when the main cell pressure is higher than the oxidizer tank . if the main cell is hotter for charging , possibly to melt the salt , then a thermal expansion type valve could be used to block flow to the reaction chamber 30 . for start - up , an automatic expansion type valve could be closed in the oxidizer input line 18 when the main cell temperature is too low and open once it reached a certain temperature . a cooling system could be required for system operation to maintain a given temperature . cooling lines could be put into the main cell 1 . a system similar to the bimetal power bus could be used for cooling . if the temperature exceeded a certain amount the metal strip would touch the outside of the main cell 1 and significantly increase the heat transfer rate through the metal strip . the electrode housing 3 could be fabricated from a number of materials . different types of conducting and / or nonconducting fibers could be used . metal conduits could be used for the oxidizer if corrosion did not occur . combinations of metal and ceramic could be used to minimize heat loss . the baseline design uses a metal structure but a carbon / carbon or boron nitride / boron nitride structure which is coated with a nonconducting and nonwetting layer could also be used . hexagonal boron nitride can serve as the coating . additions of boron carbide and cubic boron nitride , as base layers , may add to the life of the coating . the main cell system could be designed with or without any of the couplings . the couplings could have multiple layers of foil inside to aid heat loss . the couplings could be any shape or size . the container serves to keep the working fluids inside at operating conditions with minimal losses . the baseline design is to use a stainless steel container . the container can be made from any fiber or metal or combination of both . fittings or openings are used to access the various hardware that go in and out of the main cell . the container can be any shape or size depending on requirements . the metal region can contain a porous felt or wicking material to keep the metal from splashing . boron nitride or carbon fibers would work for this purpose . all metals and metal combinations could be used , for the system , as fuel . some of these would include : sodium , calcium , lithium , and magnesium . the inner walls are pressure formed into a mold after heating to forming temperature . the container can be any shape to accommodate the battery requirements . the container can be metal or a combination of fibers and binders . a porous felt material could be used to prevent sloshing . boron nitride or carbon felt could be used for this purpose . the end plates serve to spread the electrical current uniformly across the end electrodes . other materials could be used besides the molybdenum such as certain stainless steels or conductive ceramics ; such as chromium carbide . the end plate could be placed against the main cell container wall with a single electrode feed line 24 , 25 going through the wall on each end . sealing would be required where the electrode feed line 24 , 25 goes through the main cell wall . the end plates could be eliminated by using the electrode feed line 24 , 25 directly against the end electrodes . the electrode feed line 24 , 25 could be flattened to improve contact to the electrodes . this probe is for monitoring cell performance . the probe could be tied into the control system or they could be removed once the complete system is operational . the heat pipe is sized based on the heat flow rate requirements . other forms of heat transfer systems could be used including boilers and metallic conductors . single or multiple pipes can be bundled together to form the heat transfer mechanism . the heat pipe could be any shape or size . the current configuration shows a hollow tubular shape . a variation would have a central tube shape which is located inside the reaction chamber and which protrudes down from the top . the wick could be attached to this center region . the heat pipe could enter the main cell 1 at any location . the heat pipe could be welded or attached directly into the main cell 1 . a number of salt combinations could be used for this region . the salts planned for use allow the sodium chloride to electrolyze first . partial combinations of salt reactions could be beneficial . a single salt could also be used . other types of mediums would work if they allowed a reduced temperature for electrolysis relative to the pure salt . the line could be made from stainless steel or other non reactive materials . the region can vary in size depending on quantities of salt and metal . the use of an inert gas with a low boiling point is ideal . various gases could be used to equalize the pressure between the two containers . argon , nitrogen , or helium should also work but the pressure is going to vary with the level of fluids and the initial charge pressure . hastaloy c should work for this pipe up to the reaction chamber . other types of metallic alloys or alloy with internal coatings could be used . chromium carbide could be added to the metal surface . a carbon or graphite pipe should be used for the high temperature area . hexagonal or cubic boron nitride could be used as a sealer . various molybdenum alloys could also be used . various stainless alloys could also be used . the line is sized for maximum flow requirements for charging . chromium carbide and / or hexagonal or cubic boron nitride would work as a sealer . the line could be carbon or a stainless material such as hastaloy c or molybdenum alloys . the valve controls the oxidizer output for discharging . the valve can be manual or automated . it can be tied directly to temperature probe 13 for oxidizer flow rates . the valve can be hastaloy c , stainless steel , or carbon . coatings with hexagonal boron nitride can be used as a sealer . varying types of teflon coatings could also be used . this valve is set to prevent the pressure between the two tanks from exceeding a specified value . it also controls whether the oxidizer is moving in or out of the main cell . the valve can be hastaloy c or carbon . coatings with hexagonal boron nitride or teflon can be used as a sealer . other types of metal and / or ceramics can be used for the valve . this heater controls the temperature and pressure of the oxidizer tank . heating will be required for output and cooling required for charging . the pipe can be heated by the heat pipes from the reaction chamber . a closed water loop can also be used for heating and cooling . electrical heating of the oxidizer tank with water cooling could be used . the power rods can be made of any electrically conducting material . molybdenum matches expansion with carbon . the rods are sized for maximum current flow on charging . the rods are sealed inside of the main cell to prevent corrosion and shorting to the main cell walls . combinations of ceramic , turbostratic , or hexagonal boron nitride provide seals . insulation around the oxidizer tank can be from a number of materials such as rigid or blanket silica insulation or an evacuated region . leaving the insulation off may be possible based on flow rates . thermal cover for the main cell could be rigid or blanket silica insulation . a multilayer reflective foil evacuated container is preferred for size and insulating benefits . extended evacuated tubes may be used surrounding fittings . single layer evacuated containers could also be used . the number of electrodes is based on charging voltage requirements and type of salt used . electrodes can be flat or have faces which are shaped to maximize area . shaping can also be used to maintain a uniform electrical field on the electrode face . the spacing between electrodes can vary depending on salts used and metal contamination to adjacent electrode . the shape and size will vary depending on requirements . the reaction chamber is formed from 430 stainless steel . carbon / carbon can also be used or molybdenum alloys . the chamber can be rounded in any direction . the various heat pipes , inlets and drains can enter or leave the chamber from any side . coatings can be applied such as cubic boron nitride , turbostratic boron nitride , hexagonal boron nitride , chromium carbide , and boron carbide . combinations of these coatings can also be applied . a coating of lithium carbide can be used to protect the inner surface of the reaction chamber . the holder could be any shape or size . the holder could be used to support various spots inside the reaction chamber . the opening can be located anywhere on the reaction chamber . the opening can be any number of sizes and quantity . the design is used to act as a heat exchanger between the outgoing hot fluids and the incoming cooler fluids . the spacers can be machined as separate pieces such as graphite or hexagonal boron nitride . if graphite is used the spacers should be coated with hexagonal boron nitride or a combination of boron ceramics including cubic boron nitride and boron carbide . the spacers could also be made from rigid silica board and coated with hexagonal boron nitride . the spacers could be machined directly on the electrode housing 3 . ceramic coatings could be applied when the electrode housing 3 is coated with ceramics . the spacers could be machined onto a separate rail . the rail could fit directly into the main cell 1 . the rail and spacers could use any combination of ceramic coatings including : boron carbide , hexagonal boron nitride , or cubic boron nitride . the valve electrode can be made from any combination of a conducting and nonwetting substrate , relative to the salt , and a wetting and nonconducting outer layer . the baseline uses porous graphite as the substrate or inner layer . the coating can consist of combinations or individual layers of boron carbide , cubic boron nitride , magnesium oxide , or beryllium oxide . the outlet can be machined or manufactured as a separate piece or it can be made directly from the dense graphite 41 piece . carbon / carbon tubing of any shape could be used . a machined piece of hexagonal boron nitride could also be used ; with any desired shape . if a conducting material is used then an insulator , such as boron nitride is needed over the surface to prevent shorting to the electrode housing . the graphite can have any number of variations in porosity and pore size distribution . any conductive porous material which is compatible with the oxidizer could be used for this application . the basal plane in the graphite should be aligned with the current direction to minimize resistance . a conductive paste could be applied between the graphite 40 and the dense graphite 41 . the porous graphite could be used for the whole electrode with coatings on various faces to prevent leakage . the oxidizer slots could be made by drilling at varying angles throughout the oxidizer outlet 39 . if the oxidizer is kept inside the main cell then a nonporous conductive material could be used . the dense graphite is used to keep the oxidizer from flowing though its surface . the graphite could be machined or made from a carbon / carbon piece which is baked to convert the material to graphite . the cavity can be made from any type of material which is not affected by the oxidizer . the cavity could be machined directly into the dense graphite 41 . the cavity could be machined from the porous graphite 40 . the cavity could be made from a metal such as a stainless alloy . the cavity should be made with an even distribution of channels to duct the oxidizer from the porous graphite 40 to the oxidizer outlet 39 . this distribution helps to maintain a uniform electric field through the electrode . if a prescribed electric field is beneficial , such as one which is located mainly in the center of the electrode , then the cavity could be machined around the inner rim of the electrode 28 . this layer is described in the section on the ‘ valve electrode ’ for an internally ducted oxidizer . if the oxidizer is kept inside of the main cell 1 then the surface layer would be conducting and wetting similar to the conductive coating 45 . an oxidizer that could work for this could include sulphur , selenium , arsenic , antimony , tin , or tellurium which would sink in the main cell 1 after electrolysis . the salt would be used to separate the liquid metal and the oxidizer . for this arrangement , the electrodes 28 would help keep the metal and oxidizer apart . this coating is a nonwetting and nonconducting layer of ceramic . the material could use any combination of ceramic coatings including , but not limited to : boron carbide , hexagonal boron nitride , or cubic boron nitride . this coating provides a wetting and conducting layer for the electrode 28 . materials for this could include : chromium carbide or titanium carbide or other types of metallic carbides . the coating could also be a stainless steel or molybdenum material which is applied directly to the electrode 28 or pressed onto the surface as a porous gauze of mesh . this plate is made from a nonconducting material which floats on the salt mixture layer . it should be heavier than the liquid metal with small holes across the surface to allow the sodium to pass through . the hole pattern should also prevent the dry sodium chloride from moving into the region of the salt mixture 15 when the plate is near the sodium chloride holder plate 51 . the plate can be fabricated from a metal or fiber material . the hole pattern is variable depending on design and salt flow rate requirements . the plate is anchored to either the main cell wall or the electrode housing . other ceramic materials could be used instead of the boron ceramics . the compatability of the metal and oxidizer could be used to determine which ceramic is appropriate . other metals or conducting or nonconducting ceramics , used as appropriate , could replace the carbon or graphite if they were compatible with the metal or oxidizer used . other metals or conducting ceramics can be used to replace the molybdenum parts . if the system is used as a heater where focusing the heat was not required , then the following parts could be eliminated : 14 , 30 , 31 , 32 , 33 , and the coupling extension at the eat pipe region . while the above description contains may specificities , these should not be construed as limitations on the scope of the invention , but rather as an exemplification of one preferred embodiment thereof . many other variations are possible . the electro - chemical - thermal cell represents a unique combination of electrical and thermal systems . the combination provides 10 fold increases in both power and energy densities relative to the best electrical battery system . this makes this cell ideal as an energy storage and delivery system for vehicles . the individual elements can be used as a whole unit or as sub - assemblies on new or existing battery designs . accordingly , the scope of the invention should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents . | 2 |
referring now to fig1 there is shown a two - dimensional gas chromatography apparatus having parallel dual secondary columns constructed in accordance with the present invention . preferably , the apparatus includes an oven 10 , an inlet 12 leading to a primary column 14 . a valve 16 provides fluid communication between an outlet 18 of the primary column and a secondary inlet 20 . the secondary inlet 20 communicates with a y union 22 having a first 24 and a second 26 secondary column that are arranged in a parallel relationship . preferably , the outlets 28 , 30 of the first 24 and second 26 secondary columns communicate with first 32 and second 34 flame ionization detector . still referring to fig1 the inlet 12 to the primary column 14 is a split inlet having a 20 : 1 split ratio in 0 . 05 μl quantities . the primary column 14 is preferably non - polar . for example , in testing , it was found that a 15 m db - 624 capillary column ( 6 % cyanopropylphenyl , 94 % dimethyl polysiloxane , 1 . 4 μm film thickness ), available from j & amp ; w scientific ( folsom , calif .) was able to perform quite adequately . the split inlet 12 allows part of the voc to be vaporized and fed into capillary primary column 14 , such that 95 % is exhausted from the system and 5 % goes to the column 14 . the oven 10 heats the sample at an upwards ramping temperature using a heating coil ( not shown ). this allows for staggered volatilization of the sample . thus the 20 : 1 ratio in the examples . this allows relatively concentrated samples to be tested ( 10 ppb voc ). where more dilute voc are to be tested ( i . e . breath samples ; 1 ppb voc ) then the ratio can be 1 : 1 , such that 50 % is fed to the column 14 . the balance is achieved so as to obtain peak widths which are usable and so that there are separations between the peaks as detected by the flame ionization detectors 32 and 34 . the carrier gas for the voc is usually h 2 or he . while h 2 can be explosive in air , it is cheaper . in any event , because of the small size of these gases and low viscosity , high diffusion coefficients and flow rates can be maintained . preferably , the valve 16 of the apparatus 10 is a high - speed six - port diaphragm valve fitted with a 20 μl sample loop that collects effluent from the primary column and periodically injects the effluent into the secondary columns as described below . one particular example of a diaphragm valve used in the present invention is available from valco ( houston , tex .) ( model no . dv22 - 2116 ). a secondary inlet 20 extends from the valve 16 and terminates at a y union 22 . extending from each arm 36 of the y union 22 are the first 24 and second 26 secondary columns . preferably , these secondary columns are polar and have selectivities that differ between themselves and the primary column . one example particular of suitable first secondary column is a 5 m db - wax column ( polyethylene glycol , 0 . 25 μm film thickness ) available from j & amp ; w scientific . likewise , a suitable example of a second secondary column is a 5 m db - 210 column ( trifluoropropylmethyl polysiloxane , 0 . 50 μm film thickness ), which is also available from j & amp ; w scientific . preferably , each of the secondary columns communicates with a separate flame ionization detector 32 , 34 . however , other types of detectors are well known in the art and may be easily interchanged with flame detectors 32 , 34 of the apparatus 10 . the dual secondary columns 24 , 26 of the above - described apparatus 10 permit comprehensive two - dimensional gas chromatography that produces a pair of two - dimensional chromatographs in a single run . using the above - described apparatus 10 , a sample is first injected into the split inlet 12 and communicated into the primary column 14 , where it is separated into a first dimension . preferably , ultra high purity hydrogen is used as a carrier in both the primary 14 and secondary columns . additionally , the preferred flow of the sample through the primary column is 0 . 75 ml per minute . from the primary column 14 , the sample enters the diaphragm valve 16 where it is subsequently injected into the secondary inlet 20 and partitioned at the y union 22 into the parallel secondary columns 24 , 26 . notably , the preferred flow of the sample through the secondary columns 24 , 26 is 20 ml / min . effluent from the secondary columns is monitored by a flame ionization detector 32 , 34 . the use of dual secondary columns increases resolution and qualitative information supplied by traditional comprehensive two - dimensional gas chromatographic analysis . furthermore , using different secondary columns it should be appreciated that the range , resolution and scope of the present invention may be greatly expanded . this example examines the use of a nonpolar primary column coupled to two polar secondary columns in the instrument of fig1 . one secondary column interacts strongly with compounds possessing high levels of hydrogen bond acidity , whereas the other secondary column interacts strongly with dipolar compounds . differential flow modulation has been used to couple the primary column to the secondary columns . a collection of 130 volatile organic compounds were analyzed using the gc × 2gc instrument . the observed secondary retention times form distinct clusters according to the functional groups present and greatly facilitate compound identification . the data demonstrate that the dual secondary column configuration increases separation efficiency for mixtures containing organic compounds with electronegative functional groups ( e . g ., alcohols , aldehydes , ketones , esters , and oxygen containing compounds ). this example uses the gc × 2gc instrument described previously with the six - port diaphragm valve 16 fitted with a sample loop to couple the primary 14 and secondary columns 24 and 26 . this technique , called differential flow modulation gc × gc , provides high - speed , high - resolution , and high - sensitivity while maintaining a simple experimental design . differential flow modulation passes 90 % of the effluent exiting the primary column 14 to the secondary columns 24 and 26 . although this is not 100 % transfer ( like that produced by most thermal modulation systems ), the technique is classified as a comprehensive technique because the primary column effluent is sampled throughout a chromatographic run at a frequency ( 1 hz ) high enough to retain the chromatographic separation produced by the primary column . differential flow modulation was used to create a gc × gc instrument that splits the effluent leaving the diaphragm valve 16 into two secondary columns 24 and 26 . the resulting technique , dual - secondary column comprehensive two - dimensional gas chromatography ( gc × 2gc ), produces a pair of two - dimensional chromatograms in a single run . this example shows the use of a 6 % cyanopropylphenyl , 94 % dimethyl polysiloxane primary column coupled to a polyethylene glycol secondary column 24 and a trifluoropropylmethyl polysiloxane secondary column 26 . each column 24 and 26 has a unique selectivity . the primary column 14 interacts largely through dispersive forces , whereas the polyethylene glycol column exhibits strong hydrogen bonding interactions and the trifluoropropylmethyl polysiloxane column exhibits strong dipole — dipole interactions ( li , j ., et al ., j . chromatogr . 517 103 ( 1990 )). this work evaluates the efficacy of using gc × 2gc to analyze complex voc mixtures . a perkin - elmer ( norwalk , conn ., usa ) autosystem xl gas chromatograph with electronic pneumatics and dual flame - ionization detectors ( fids ) 32 and 34 was used as the experimental platform . two alterations were made to the gas chromatograph : the 6 - port diaphragm valve 16 ( described below ) was mounted in the location normally reserved for a second sample inlet , and a 100 nf filtering capacitor on each fid electrometer was replaced by an 8 nf capacitor . the filtering capacitor is used for amplification of the peaks . with the 100 nf capacitor , the peak widths are 1 second to 10 seconds . with the nf capacitor , the peak widths are 50 milliseconds wide . in some instances the amplifier capacitor may not be necessary with very low concentration samples . neat voc mixtures were injected into the primary column 14 through a split inlet ( 20 : 1 split ratio ) in 0 . 05 μl quantities . the oven temperature in inlet 12 was ramped according to the following program : 40 ° c . for 0 . 4 mm , ramp to 60 ° c . at 40 k min − 1 , ramp to 120 ° c . at 30 k min − 1 , ramp to 200 ° c . at 22 . 5 k min − 1 , hold for 1 . 0 mm . all capillary columns 14 , 24 and 26 were purchased from j & amp ; w scientific ( folsom , calif ., usa ). a 15 m × 250 μm db - 624 capillary column ( 6 % cyanopropylphenyl , 94 % dimethyl polysiloxane , 1 . 4 μm film thickness ) was used as the primary column 14 . a 5 m × 250 μm de - wax column ( polyethylene glycol , 0 . 25 μm film thickness ) and a 5 m × 250 μm db - 210 column ( trifluoropropyl - methyl polysiloxane , 0 . 50 μm film thickness ) were used as the secondary columns 24 and 26 . ultra - high purity hydrogen was used as the carrier gas in the primary and secondary columns . the primary column 14 flow was 0 . 75 ml min − 1 , and the flow leading to the secondary columns 24 and 26 was 20 . 0 ml min − 1 . at 40 ° c ., the inlet pressure of the secondary columns was 76 kpa gauge . the high - speed 6 - port diaphragm valve 16 ( dv22 - 2116 , valco , houston , tex ., usa ) fitted with a 20 μl sample loop was used to collect effluent from the primary column 14 and periodically inject the effluent into the secondary columns 24 and 26 . the valve 16 temperature was maintained at 130 ° c . secondary injections were performed at a frequency of 1 hz ; the sample loop in valve 16 was filled with primary column 14 effluent for 0 . 9 s and flushed for 0 . 1 s into a short transfer line 20 leading to the secondary columns 24 and 26 . the 20 . 0 ml min − 1 flow passing through the transfer line 20 was split between the two secondary columns with a fused silica “ y ” union 22 . measurements of the flow exiting from each secondary column 24 and 26 indicated that the flow was evenly split to within 2 %. effluent from each secondary column 24 and 26 was monitored by flame - ionization detectors 32 and 34 , respectively . fid signals were monitored at 200 hz by an apple macintosh computer equipped with a data acquisition board and custom software . a collection of 130 vocs was divided into 20 simple mixtures , each containing 5 to 10 compounds . the gc × 2gc system was used to analyze the mixtures . each run produced a pair of fid signal arrays that were converted into 2 - dimensional chromatograms as previously described ( seeley , j . v ., et al ., anal . chem . 72 4346 ( 2000 ). retention times , peak areas and peak widths were determined as previously described ( seeley , j . v ., et al ., anal . chem . 72 4346 ( 2000 )) for each 2 - dimensional chromatogram using software written in - house . peaks in the db - wax 2 - dimensional chromatogram were matched with their respective peaks in the db - 210 2 - dimensional chromatogram by correlating primary retention times and peak areas . the observed retention times for the entire set of vocs are compiled in table 1 . the primary retention times are the average of the values obtained from the db - wax and db - 210 chromatograms . the two values agreed to within 0 . 1 s . most of the compounds had db - wax and db - 210 secondary retention times between 1 . 90 s and 2 . 90 s . the absolute values of the secondary retention times were verified for a selected set of compounds by changing the secondary injection period from 1 s to 3 s . the unretained retention time was approximately 1 . 8 s for both secondary columns . peak areas obtained from the db - 210 chromatogram were consistently 3 % larger than the db - wax peak areas . peak widths - at - half - maximum along the primary retention time axis were approximately 1 . 5 s for all the compounds analyzed . peak widths along the secondary retention axis were dependent upon the secondary retention times . a linear least - squares fit of the db - wax peak widths resulted in the following equation : where w ½ is the width - at - half maximum ( in seconds ) along the secondary retention axis and t 2 is the secondary retention time . thus , poorly retained compounds ( e . g ., alkanes ) had widths of approximately 0 . 040 s , and highly retained compounds ( e . g ., 1 - alcohols ) had widths of approximately 0 . 060 s . a linear least - squares fit to a plot of the db - 210 peak widths - at - half - maximum resulted in the following equation : poorly retained compounds ( e . g ., alkanes ) had widths of approximately 0 . 046 s , and highly retained compounds ( e . g ., 2 - ketones ) had widths of approximately 0 . 070 s . the 40 % larger broadening rate observed for the db - 210 secondary column is most likely a result of the db - 210 stationary phase being twice as thick as the db - wax stationary phase ( gaspar , g ., et al ., anal . chem . 50 1512 ( 1978 )). the method used to transform a one - dimensional signal array into a two - dimensional chromatogram ( seeley , j . v ., et al ., anal . chem . 72 4346 ( 2000 )) assumed that all compounds had secondary retention times between 1 . 90 and 2 . 90 s . however , several of the vocs had secondary retention times greater than 2 . 9 s , but less than 3 . 9 s . upon transformation , such compounds appeared as peaks with secondary retention times 1 . 0 s less ( i . e ., the secondary injection period ) than that their actual value and primary retention times 1 . 0 s greater than their actual value . fortunately , the peak width along the secondary retention axis can be used to detect compounds originating from previous injection cycles . for example , methyl benzoate had a primary retention time of 309 . 3 s , db - wax retention time of 3 . 00 s , and a db - 210 retention time of 2 . 73 s . thus , the db - 210 2 - dimensional chromatogram had the methyl benzoate peak in the “ proper ” position because the secondary retention time was between 1 . 90 and 2 . 90 s . in contrast , the db - wax 2 - dimensional chromatogram showed the methyl benzoate peak at a primary retention time of 310 . 3 s and a secondary retention time of 2 . 00 s . however , the peak width along the db - wax retention time axis was 60 % greater than those of nearby peaks . thus , the peak was determined to be “ wrapped - around ” from a previous injection cycle , and 1 . 0 s was added to the secondary retention time and 1 . 0 s was subtracted from the primary retention time . to demonstrate the performance of the gc × 2gc system , several mixtures were combined to produce a 55 - component sample containing the following compounds : c 5 - c 13 n - alkanes , c 1 - c 8 1 - alcohols , c 3 - c 8 2 - alcohols , c 4 - c 7 2 - methyl - 2 - alcohols , c 3 - c 8 and c 10 acetates , c 3 - c 11 aldehydes , c 3 - c 8 2 - ketones , and c 6 - c 10 alkyl aromatics . compounds within each functional class ( e . g ., alkanes , 1 - alcohols , etc .) differed only by the length of their straight - chain alkyl group . the chromatogram for this mixture is shown in fig2 . the data are also represented in fig3 as two - dimensional scatter plots organized according to functional group . fig2 and fig3 demonstrate the complementary nature of the db - wax and db - 210 secondary columns for analyzing the 55 - component mixture : the db - wax 2 - dimensional chromatogram easily distinguishes the alkanes , primary alcohols , secondary alcohols , and tertiary alcohols , but the aldehydes , ketones , acetates , and aromatic compounds all display similar secondary retention times . the db - 210 2 - dimensional chromatogram easily distinguishes the alkanes , acetates , aldehydes , and ketones , but the primary , secondary , and tertiary alcohols , and aromatic compounds display similar secondary retention times . the approximate secondary retention times observed for a wide variety of compound classes is shown in fig4 . compounds that are nonpolar and not highly polarizable ( e . g ., alkanes , monounsaturated hydrocarbons , and saturated cyclic hydrocarbons ) have minimal retention on both columns . highly polarizable compounds having neither large dipole moments nor hydrogen bonding functional groups ( e . g ., dienes , unsaturated cyclic hydrocarbons , and aromatic compounds ) display moderate retention on both secondary columns . compounds with high levels of hydrogen bond acidity but moderate dipole moments ( e . g ., primary and secondary alcohols ) have high retention on the db - wax column and moderate retention on the db - 210 column . compounds with large dipole moments but with low hydrogen bond acidity ( e . g ., ketones and aldehydes ) display high retention on the db - 210 column and moderate retention on the db - wax column . high levels of retention is observed on both secondary columns for compounds that are both highly polarizable and have large dipole moments ( e . g , oxygenated aromatics ). all of these observations are in agreement with the established selectivities of the db - 624 , db - wax , and db - 210 stationary phases ( li , j ., eta l ., j . chromatogr . 517 103 ( 1990 )). fig5 is a scatter plot of the secondary retention times obtained for the 130 vocs . the compounds have been categorized as either hydrocarbons or compounds containing one or more electronegative atoms ( o , n , or cl ). hydrocarbons have db - 210 secondary retention times that are highly correlated with their db - wax retention times . a linear fit to the hydrocarbon data produces a correlation coefficient of 0 . 942 , indicating that any separation or qualitative information provided by the db - 210 column is largely redundant with that produced by the db - wax column . this is not surprising , as the retention of hydrocarbons on standard liquid stationary phases is primarily dictated by size and polarizability , and not by hydrogen bonding or dipole — dipole interactions ( abraham , m . h ., et al ., j . chem . soc . perkin trans . 2 1777 ( 1994 )). thus , the data generated by the dual secondary column configuration should aid in the identification of vocs containing electronegative functional groups . the measured retention times and peak widths were used to compare the separation efficiency of single - column gc analysis , gc × gc analysis , and gc × 2gc analysis for the compounds and conditions of this study . a pair of compounds was classified as unresolved by the primary column if the calculated value of primary column resolution was less than 1 . 0 . primary column resolution , r 1 , was calculated ( giddings , j . c ., unified separation science . j . wiley new york ( 1991 )) by r 1 = 0 . 59 δ t 1 〈 w 1 / 2 〉 1 ( 3 ) where δt 1 is the difference in tabulated primary retention times , and & lt ; w ½ & gt ; 1 is the average peak width - at - half maximum along the primary retention time axis . a primary peak width - at - half maximum of 1 . 5 s was assumed for all of the compounds . the voc data indicate that 174 of the 8385 possible pairs of compounds have a primary resolution less than 1 . 0 . in addition , 112 of the 130 compounds are members of at least one of the 174 overlapping pairs . thus , if all 130 vocs were injected into the primary column at the same time , only 18 compounds would be expected to be fully resolved at the exit of the db - 624 column . a pair of compounds was classified as unresolved by gc × gc analysis if the calculated value of two - dimensional resolution was less than 1 . 0 . the db - 624 / db - wax data and db - 624 / db - 210 data were analyzed separately . the two - dimensional resolution , r 2 , was calculated ( murphy , r . e ., et al ., anal . chem . 70 1585 ( 1998 )) by r 2 = 0 . 59 ( δ t 1 〈 w 1 / 2 〉 1 ) 2 + ( δ t 2 〈 w 1 / 2 〉 2 ) 2 ( 4 ) where δt 2 is the difference in secondary retention times , and & lt ; w ½ & gt ; 2 is the average width - at - half maximum along the secondary retention axis . equations ( 1 ) and ( 2 ) were used to calculate secondary peak widths for the db - 624 / db - wax configuration and db - 624 / db - 210 configuration , respectively . compounds with a secondary retention time greater than 2 . 9 s had 1 . 0 s added to their primary retention time and 1 . 0 s subtracted from their secondary retention time , thus placing the peak in the experimentally observed position . for the db - 624 / db - wax configuration , 34 of the 8385 possible compound pairs produce overlapping peaks and 46 of the 130 compounds are members of at least one overlapping pair . thus , if all 130 vocs were injected at the same time , 84 compounds would be predicted to be resolved in the db - 624 / db - wax chromatogram . for the db - 624 / db - 210 configuration , 29 of the 8385 possible pairs produce overlapping peaks and 45 of the 130 compounds are members of at least one overlapping pair . thus , if all 130 vocs were injected at the same time , 85 compounds would be predicted to be resolved in the db - 624 / db - 210 chromatogram . compounds were classified as unresolved by gc × 2gc analysis if they were unresolved in both two - dimensional chromatograms . under this assumption , only 6 of the 8385 possible pairs are unresolved . when considering mixtures with more than two compounds , it is important to note that the interfering compounds need not be the same . for example , compound a can be pair - wise resolved by gc × 2gc with both compound b and compound c , but be unresolved when a mixture of a , b , and c is examined . this is possible if a overlaps with b in one chromatogram and a overlaps with c in the other chromatogram . the simulation results show that 21 of the 130 compounds are members of overlapping pairs in both column configurations . thus , if all 130 vocs were injected at the same time , 109 compounds would be predicted to be resolved by gc × 2gc analysis ( i . e ., the number of unresolved compounds decreases by a factor of two when going from gc × gc analysis to gc × 2gc analysis ). these results indicate that in addition to increased qualitative information , gc × 2gc analysis can increase separation efficiency . the results demonstrate that dual secondary columns can increase the resolution and qualitative information supplied by comprehensive two - dimensional gas chromatographic analysis . the largest improvement in performance is expected for mixtures containing compounds with a wide range of dipole moments and hydrogen bond acidities . thus , our gc × 2gc configuration is well suited for analyzing samples containing oxidized or halogenated compounds ( such as environmental and biomedical samples ) ( helmig , d ., et al ., chemosphere 38 2163 ( 1999 ); phillips , m ., et al ., j . chromatogr . b 729 75 ( 1999 ); and helmig , j ., et al ., j . geophys . res . 103 22 ( 1998 )), but not as useful for samples dominated by hydrocarbons ( such as most petrochemical samples ). it is possible that other column configurations can be developed to extend the scope of gc × 2gc analysis . in the following example the comprehensive two - dimensional gas chromatograph with dual secondary columns ( gc × 2gc ) as shown in fig1 was used to characterize gaseous mixtures of volatile organic compounds ( vocs ). samples were collected on multi - layer sorbent tubes and introduced into the gas chromatograph using a thermal desorption apparatus . differential flow modulation by sample accumulation was used to couple the primary column 14 to the secondary columns 24 and 26 . each gc × 2gc analysis produced a pair of two - dimensional gas chromatograms . the chromatograms provided complementary information due to the unique selectivities of the secondary columns . the additional information was especially useful in separating and identifying oxygenated and aromatic compounds . samples of outdoor air , indoor air , and exhaled breath were analyzed with the gc × 2gc system . more than 100 volatile organic compounds could be separated in less than 10 minutes . the identities of approximately 50 peaks were determined for each sample . the following example examined the use of a non - polar primary column , a polyethylene glycol secondary column , and a trifluoropropylmethyl polysiloxane secondary column . each column has a unique selectivity . the primary column interacts largely through dispersive forces , the polyethylene glycol column exhibits strong hydrogen bonding interactions , and the trifluoropropylmethyl polysiloxane column exhibits strong dipole — dipole interactions ( li , j . j ., et al ., j . chromatogr . 517 103 ( 1990 )). mixtures containing compounds with a wide range of dipole moments and hydrogen bond acidities such as alcohols , ketones , and chlorinated compounds were separated . the gc × 2gc of fig1 was used to analyze indoor air , outdoor air , and exhaled breath . such samples are known to contain numerous vocs with a wide variety of functional groups ( helmig , d ., et al ., chemosphere 38 2163 - 2187 ( 1999 ); phillips , m ., et al ., j . chromatogr . b 729 75 - 88 ( 1999 ); lewis , a . c ., et al ., nature 405 778 - 781 ( 2000 ); and helmig , d ., et al ., j . geophys . res . 103 22397 - 22414 ( 1998 )). the oven temperature was ramped according to the following program : 40 ° c . for 0 . 50 min , ramp to 95 ° c . at 33 ° c . min − 1 , ramp to 140 ° c . at 23 . 7 ° c . min − 1 , ramp to 200 ° c . at 16 . 5 ° c . min − 1 , hold for 1 . 00 mm . all capillary columns were purchased from j & amp ; w scientific . the primary column 14 was a 15 m × 250 μm db - 624 capillary column ( 6 % cyanopropylphenyl , 94 % dimethyl polysiloxane , 1 . 4 μm film thickness ). the secondary columns 24 and 26 were a 5 m × 250 μm db - wax capillary column ( polyethylene glycol , 0 . 25 μm film thickness ) and a 5 in × 250 μm db - 210 capillary column ( trifluoropropylmethyl polysiloxane , 0 . 50 μm film thickness ). ultra - high purity hydrogen was used as the carrier gas in the primary 14 and secondary columns 24 and 26 . the primary column 14 flow was approximately 0 . 75 ml min − 1 , and the flow leading to the secondary columns 24 and 26 was 20 . 0 ml min − 1 . the high - speed 5 - port diaphragm valve 16 fitted with a 20 μl sample loop was used to collect effluent from the primary column and periodically inject it into the secondary columns . secondary injections were performed at a frequency of 1 hz : the sample loop was filled with primary column 14 effluent for 0 . 9 s and flushed for 0 . 1 s into a short transfer line leading to the secondary columns 24 and 26 . the 20 . 0 ml min − 1 flow passing through the transfer line 30 was split between the two secondary columns 24 and 26 with a fused silica “ y ” union 22 . effluent from each secondary column 24 and 26 was monitored by a flame - ionization detector . gaseous samples were collected on multi - layer sorbent tubes containing 200 mg of carbotrap c , 200 mg of carbotrap , and 100 mg carbosieve adsorbents . similar sampling tubes have been shown to effectively trap vocs within the volatility range of c 3 - c 15 alkanes ( helmig , d ., et al ., j . geophys . res . 103 22397 - 22414 ( 1998 )). gaseous vocs were collected by drawing air through sorbent tubes at 100 ml min − 1 . sorbent tubes were heated to 45 ° c . during sampling to reduce water accumulation . air samples were drawn directly through the tubes for 30 min . exhaled breath samples were collected in 2 - l tedlar bags , then drawn through the sorbent tubes for 15 min . vocs collected on the sorbent tubes were injected into the gc × 2gc system with a perkin - elmer atd 400 thermal desorption unit . the split flows on the atd were adjusted such that 33 % of the desorbed vocs were transferred to the gc × 2gc system . the quantitative performance of the atd / gc × 2gc system was evaluated by analyzing sorbent tubes containing known amounts of toluene . a dilution system containing a toluene permeation tube was used to make gaseous standards . seven sorbent tubes were loaded with 3 . 0 ng to 10 . 0 ng of toluene . the tubes were analyzed with the atd / gc × 2gc system . peak areas determined from the db - 210 chromatogram were consistently 3 % larger than the areas determined from the db - wax chromatogram . a plot of toluene peak area versus the mass of toluene displayed an excellent linear correlation ( r 2 = 0 . 999 ). a 0 . 3 ng detection limit for toluene was calculated from the regression parameters ( felinger , a ., data analysis and signal processing in chromatography , elsevier : amsterdam ( 1998 )). thus , it was estimated that the atd / gc × 2gc system can detect toluene at concentrations down to approximately 20 parts - per - trillion when 3 . 0 l of air is sampled . this experiment was repeated for hexane , and similar results were observed . the reproducibility of the atd / gc × 2gc system was tested by analyzing six different sorbent tubes loaded with 6 . 0 ng of toluene . the area of the resulting toluene peaks had a relative standard deviation of 3 %. this rsd is similar to values previously reported for conventional gc / fid analysis of air samples collected on sorbent tubes ( woolfenden , e ., j . air waste manage . 47 20 - 36 ( 1997 )). the gc × 2gc retention times of over 150 volatile organic compounds were determined . as expected , primary retention is largely determined by compound size , whereas secondary retention times are dictated by functional group . the secondary retention times observed with the atd / gc × 2gc for several functional group classes are shown in fig6 . the db - wax secondary column displays high levels of retention for compounds with large hydrogen bonding acidities ( such as alcohols ) and the db - 210 column displays high levels of retention for compounds with large dipole moments ( such as carbonyls ). the dual secondary column configuration is particularly well suited for differentiating oxygenated compounds and aromatic compounds : ketones , aldehydes , esters , and aromatics all have similar secondary retention on the db - wax column , but vastly different retention on the db - 210 column . in contrast , primary alcohols , secondary alcohols , tertiary alcohols , and aromatics have similar db - 210 retention but vastly different db - wax retention times . all of these compound classes are known to be important constituents in air and in breath ( phillips , m ., et al ., j . chromatogra . b 729 75 - 88 ( 1999 ); and helmig , d ., et al ., j . geophys . res . 103 22397 - 22414 ( 1998 )). table 2 contains a list of compounds that have been identified in our outdoor air , indoor air , and breath chromatograms . fig7 contains a set of 2 - d chromatograms typical of those obtained for outdoor air in suburban and rural locations . the chromatograms are displayed with a full - scale signal intensity of 250 ( arbitrary units ). the peaks with greatest intensity appear to be elongated because they are off - scale for the chosen plotting parameters ( e . g ., toluene has a maximum peak height of 900 but the full - scale signal intensity is 250 ). over 80 peaks are observed in each chromatogram . several of the major peaks are labeled in fig7 . the largest peaks represent compounds with concentrations near 1 part - per - billion . the main vocs present are saturated hydrocarbons , aromatic hydrocarbons , ketones , and aldehydes . the db - wax 2 - d chromatogram produces a distinct band of peaks with secondary retention times near 2 . 0 s . these peaks originate from saturated and monounsaturated hydrocarbons with carbon numbers ranging from 4 to 14 . a second peak band is observed at a secondary retention time of approximately 2 . 35 s . these peaks originate from aromatic hydrocarbons , saturated ketones , and saturated aldehydes . the db - 210 chromatogram produces a distinct band of saturated and monounsaturated hydrocarbon peaks with low secondary retention ( approximately 2 . 15 s ). in contrast to the db - wax chromatogram , the aromatic hydrocarbons , ketones , and aldehydes have significantly different secondary retention times in the db - 210 chromatogram . thus , several sets of compounds that overlap in the db - wax chromatogram can be fully resolved in the db - 210 chromatogram ( e . g ., acetone and propanol ). fig8 contains a set of 2 - d chromatograms obtained from air in the chemical stockroom at oakland university , rochester , mich . the full - scale intensity is 500 . as expected , the chromatograms contain a multitude of high intensity peaks . the gc × 2gc system can fully separate over 100 peaks ; however , some regions of the chromatogram are particularly congested ( such as near a primary retention time of 140 s ). fig9 contains a set of 2 - d chromatograms obtained from the breath of a healthy non - smoking individual . the full - scale signal intensity is 20 , 000 ( i . e ., a factor of 20 greater than that of fig3 ). acetone and isoprene were observed in quantities greater than 20 ppb and produced off - scale peaks . phenol was observed at a primary retention time of 321 s . this compound is highly retained by the db - wax column ( 8 . 06 secondary retention time ). in fact the peak is wrapped - around from several previous secondary injection cycles . in contrast , phenol is only moderately retained by the db - 210 column ( 2 . 40 s secondary retention time ). fig1 contains the same chromatograms shown in fig9 but with a full - scale signal intensity of 500 . nearly 100 peaks are fully resolved in the breath chromatograms . the ability of the db - wax column to separate alcohols is demonstrated in the clear distinction of methanol , ethanol , and isopropanol , whereas the db - 210 column is useful at separating the numerous ketones and aldehydes found in breath . the results indicate that gc × 2gc is particularly useful in characterizing the vocs found in indoor air , outdoor air , and breath . it is important to note that the separations described here were performed in approximately 15 % of the time normally required to analyze similar samples with gc / ms ( phillips , m ., et al ., j . chromatogr . b 729 75 - 88 ( 1999 ); and helmig , d ., et al ., j . geophys . res . 103 22397 - 22414 ( 1998 )). this example relates to the application of a dual - secondary column comprehensive two - dimensional gas chromatograph ( gc × 2gc ) of fig1 to quantitate chemical exposure levels . gc × 2gc provides high resolution , high sensitivity , and short analysis times for a fraction of the cost of conventional gas chromatography / mass spectrometry techniques . a retention database is developed to allow peaks to be identified under a wide range of chromatographic conditions . volatile organic compound profiles of breath are obtained with the gc × 2gc system . the data is analyzed to determine if this novel technique can be used to detect and quantitate the levels of exposure to cigarette smoke . voc levels in breath may also be a sensitive marker for exposure to other hazardous pollutants : mathews , et al ( mathews , j . m ., et al ., toxicology and applied pharmacology 146 , 255 - 260 ( 1997 )) have recently shown that rats exposed to trans - 1 , 2 - dichloroethylene exhibited greater than 100 % increases in breath acetone , hexane , and 2 - butanone . elevated levels were maintained for several hours after exposure . similar increases in breath vocs have been observed for individuals exposed to cigarette smoke ( euler , d . e ., et al ., clinical chemistry 42 , 303 - 308 ( 1996 ); and lin , y ., et al ., clinical chemistry , 41 , 1028 - 1032 ( 1995 )). lipid peroxidation brought on by oxidant stress has been cited as the cause for increases of voc production ( risby , t . h ., et al ., free radical biology and medicine , 27 , 1182 - 1192 ( 1999 ); and steinberg , f . m ., et al ., american journal of clinical nutrition , 69 , 319 - 327 ( 1999 )). the non - invasive nature of breath voc analysis makes it a promising candidate for quantitative exposure assessment . unfortunately , conventional gc / ms breath analysis is very time consuming ; a single breath assay requires the analysis of a breath sample and a room air sample , with each taking approximately 1 hour to complete ( phillips , m ., et al ., journal of chromatography b , 729 , 75 - 88 ( 1999 )). this greatly limits the quantity of samples that can be analyzed . gc × 2gc methods are used for analyzing vocs in air , water , and breath . in each case , the vocs are trapped on multi - layer sorbent tubes and then injected into the gc × 2gc system of fig1 with a perkin - elmer atd 400 thermal desorption unit . atmospheric samples are collected by pulling air directly through the sorbent tube . aqueous samples are analyzed by purging with inert gas and collecting the vocs in a sorbent tube . breath samples are collected in tedlar bags then passed through a sorbent tube . the data acquisition and analysis software is provided with ( helmig , d ., et al ., journal of geophysical research , 103 , 22397 - 22414 ( 1998 )) multiple run automation that allows the thermal desorption unit to be loaded with up to 50 samples and run overnight , ( phillips , m ., et al ., journal of chromatography b , 729 , 75 - 88 ( 1999 )) sample data entry that allows sample collection data to be merged with the chromatographic data , and ( phillips , j . b ., et al ., journal of chromatography a , 856 , 331 - 347 ( 1999 )) standardized data output that allows the chromatographic data to be imported into pattern recognition software . a portable breath collection apparatus ( bca ) produced by menssana research is used ( phillips , m ., analytical biochemistry 247 , 272 - 278 ( 1997 )). the bca was developed by michael phillips over the last 10 years and is now being used in clinical studies throughout the united states and europe . this system allows breath samples to be collected easily . subjects breathe into the bca via a disposable mouth piece while the vocs are trapped in a heated sorbent tube . the bca is constructed so that alveolar breath is sampled and not dead space breath . after sample acquisition , the sorbent tubes can be stored for weeks without significant artifact formation . while gc × 2gc produces greater separation efficiencies than gc / ms , unknown identification is much more advanced on gc / ms systems . the mass spectrum of an unknown compound can be compared to a library of 100 , 000 mass spectra . fully resolved , high - intensity chromatographic peaks can be identified with high levels of confidence . on the other hand , if two components elute simultaneously they produce an overlapped spectrum that results in erroneous matches . unknown identification in gc × 2gc is done by the peak position in the 2 d chromatogram . as gc × 2gc is just beginning to be explored , extensive chromatographic libraries do not exist . conclusive matching requires standard mixtures are analyzed . artificial neural networks are used to predict retention times . neural networks have previously been shown to approximate nonlinear multivariable functions with high accuracy ( gasteiger , j ., et al ., angew . chem . 105 , 510 ( 1993 )). their results indicate that standard 1 - dimensional retention time libraries for each of the three columns can be used to predict primary retention time to within 3 s and the secondary retention times to within 0 . 02 s . this level of accuracy allows a short list of possible matches to be generated for each unknown peak . the neural network / 1 - d library approach is preferable to simply creating a library of 2 - d chromatograms as it can be used to predict retention times under a wide range of experimental conditions ( e . g ., column dimensions , temperature programs , flow - rates , etc .). comprehensive breath measurements of individuals with varying levels of exposure to cigarette smoke are made . cigarette smoke has been shown to increase breath vocs through direct exposure to vocs ( jordan , a ., et al ., international journal of mass spectrometry and ion processes , 148 , l1 - l3 ( 1995 )) and by promoting the endogenous production of vocs ( lin , y ., et al ., clinical chemistry 41 , 1028 - 1032 ( 1995 ); risby , t . h ., et al ., free radical biology and medicine 27 , 1182 - 1192 ( 1999 ); and steinberg , f . m ., et al ., american journal of clinical nutrition 69 , 319 - 327 ( 1999 )). approximately 50 volunteers are recruited from each of the following groups : ( 1 ) non - smokers who live and work in essentially smoke - free environments , ( 2 ) heavy smokers who smoke over 20 cigarettes per day , and ( 3 ) passive smokers , non - smokers who are exposed to smokers at work and / or reside with at least one heavy smoker . the oxidant status of each individual is determined by measuring the isoprostane levels in urine and plasma . isoprostanes are known to increase dramatically under conditions of oxidative stress ( roberts , l . j ., et al ., free radical biology and medicine 28 , 505 - 513 ( 2000 )). it is necessary to know the oxidant stress status of the individuals as lipid peroxidation is known to produce many vocs , including alkanes , alkenes , alcohols , aldehydes , and ketones ( frankel , e . n ., lipid oxidation ; oily press : dundee ( 1998 )). breath compounds that correlate with the exposure categories and the isoprostane measurements are searched . statistical algorithms , such as forward stepwise discriminant analysis ( phillips , m ., et al ., “ volatile organic compounds in breath as markers of lung cancer : a cross - sectional study , lancet , 353 , 1930 - 1933 ( 1999 )), are used to identify the vocs that are the best markers of exposure . a diverse pool of individuals is obtained . it may be necessary to travel to selected locations to further promote the study . interested individuals are provided with information regarding the procedures to be employed . after obtaining informed participants are asked to complete a questionnaire . each questionnaire includes a cover page requesting the name and telephone number of the respondent that can be conveniently removed after coding . the questionnaire is a modified form of one which has been used for over 20 years by the oakland university &# 39 ; s meadow brook health enhancement institute . each questionnaire solicits information regarding age , sex , race , and medical history . it also solicits information regarding dietary habits , exercise regimen , smoking history , average number of cigarettes smoked per day , passive smoking , alcohol consumption , and medications taken ( including antioxidant vitamins ). volunteers are paid for their initial responses . participants are selected based on questionnaire responses . the goal is to assemble a diverse distribution of age and sex matched participants . volunteers selected for further participation in this study are contacted by telephone and scheduled for specimen collection . they are reminded of the purpose of the study and their right to withdraw at anytime . individuals expecting to continue are instructed to refrain from eating or smoking for 12 hours prior to sample collection . the questionnaire responses are evaluated by designating three levels ( low , medium , high ) for several parameters , including smoking , exercise , anti - oxidant vitamin supplementation , and age . these parameters are then assigned a letter code , and the levels for each parameter code transferred to a table containing randomly assigned donor codes . after encoding , the cover sheet of the questionnaires , containing the names of volunteers , are removed and destroyed . sample donors will be paid $ 25 . breath : volunteers are fitted with a nose clip and instructed to breathe into the breath collection apparatus for 5 minutes . 10 l of alveolar breath vocs is collected on a sorbent tube . a room air sample is collected simultaneously on a second sorbent tube . upon completion of breath sampling , each tube is placed in a labeled , hermetically - sealed container . the gc × 2gc system is used to analyze the breath and air samples . an internal standard is added to each tube . each chromatographic peak is integrated and tabulated . the alveolar gradient of each compound is calculated by subtracting the relative peak area of the room air sample from the relative peak area of the breath sample . the concentrations of selected compounds are determined from standard calibration curves . blood : 50 cc of peripheral blood is obtained by venipuncture into a vacutainer containing edta as an anticoagulant , with precautions to avoid transmission of blood borne pathogens . following low speed centrifugation , the plasma is separated and aliquoted . a known quantity of isoprostane is added to two fractions ( spiked samples ) to control for potential losses during extraction . aliquots of blood is treated with 5 mg lipase obtained from the yeast , candida cylindraccae , at 37 ° c . for 1 hr to hydrolyze esterified isoprostanes . multiple coded aliquots are then frozen at − 80 ° c . for subsequent analyses . this minimizes differences in isoprostane levels that can result from ex vivo peroxidation in plasma samples . the levels of free and total isoprostanes are determined using the obr commercial elisa kit . urine : participants donate a urine sample during their visit to the collection facility . the sample is marked with a coded label . to normalize for variations in urinary output , creatinine levels in urine is measured using a calorimetric procedure described previously ( 19 ). urinary cotinine is also measured using a standard calorimetric method ( 20 ) to provide a quantitative measure of nicotine metabolism and to confirm levels of smoking reported on questionnaires . the levels of free and total isoprostanes are determined using the obr commercial elisa kit . the results are normalized to the creatinine level . the dual secondary columns can be fed by other standard switching means such as thermal modulation of the sample . obviously there can be more than two secondary columns which are fed from a common source . all of these variations will produce the improved resolution and compound resolution of the present invention . while the present invention is described herein with reference to illustrated embodiments , it should be understood that the invention is not limited hereto . those having ordinary skill in the art and access to the teachings herein will recognize additional modifications and embodiments within the scope thereof . therefore , the present invention is limited only by the claims attached herein . | 6 |
in a non - deformed state , the grip 2 has a generally spherical shape , as shown in fig1 . it is sized to comfortably fit in a user &# 39 ; s palm 4 and preferably weighs from three to five ounces . as can be seen from the cross - sectional view of fig4 the grip 2 includes a core 6 that is surrounded by an elastic covering 8 such as a plurality of balloons 10 , 12 , 14 , 16 , and 18 . the core of the grip 6 is essentially non - resilient and is formed from a mixture 20 of powder , liquid , and a preservative (&# 34 ; the mixture &# 34 ;) having a doughy consistency . the core 6 also contains small beads 22 which have a lower density than the mixture 20 thereby advantageously decreasing the weight of the grip 2 compared to a core comprised entirely of the mixture 20 . a preferred embodiment of the contents of the mixture 20 includes starch , water , and salt , and expanded rigid polystyrene plastic , such as that sold under the trademark styrofoam , beads . the doughy mixture 20 is preferably made by mixing equal parts of starch , salt , and boiling water . the hot water contributes to the thorough combining of the salt and the starch . the proportions specified create a dough that is not runny but is easily squeezed into a different shape by the user &# 39 ; s hand . the mixture 20 is mixed with the beads 22 , but still retains its doughy consistency . the ratio of the volume of the mixture 20 to the beads 22 is about 1 : 1 , but may be altered to attain the desired weight of the grip 2 . the core 6 may be comprised of any materials having a similar viscosity , weight , and frictional characteristics to the mixture 20 described above . each of the balloons 10 , 12 , 14 , 16 , 18 is very thin and is preferably round in shape when inflated . as the core material 6 is inserted , the balloon 10 stretches to retain a spherical shape although other shapes can be used . to allow for the insertion of the core 6 , each balloon includes a single hole 24 . the exterior surface of balloon 18 may be textured to facilitate the grasping of the grip 2 and to improve user comfort . to construct the grip 2 , the dough like core 6 is inserted through hole 24 of the first balloon 10 . the entering material 6 stretches the balloon in a manner somewhat similar to when water is forced into a balloon to make a water balloon . sufficient material is inserted to create a round core 6 that has a diameter of approximately two and one - quarter inches . the grip can be made larger or smaller than that , but that size is convenient for most people . once the first balloon 10 has been filled , the single wrapped core 6 is then inserted through hole 24 of the second balloon 12 thereby causing it to stretch to a similar diameter . during the latter insertion process , the hole 24 in the balloon 10 is located so that it is spaced approximately ninety to one - hundred - eighty degrees apart from the hole 24 in the encircling balloon 12 . this procedure is then repeated with the remaining balloons 14 and 16 until the grip &# 39 ; s core 6 is enveloped by a plurality of balloons , preferably four . once the core 6 has been inserted within the final balloon 16 , glue is placed around the perimeter of hole 24 of balloon 16 to fix the surrounding of the hole 24 to the underlying balloon 14 . it should be noted that in receiving the core 6 , each succeeding balloon is stretched , thereby causing a constant inward force to be exerted on the core by the balloons . in this manner , the balloons urge the grip to assume the shape the balloons originally had . in an alternate mode of manufacture , the core material 6 is first placed within a balloon 10 . the enveloped core is then dipped into molten rubber to thereby form an outer resilient layer that does not have an opening . in another alternate mode of manufacture , the core can be received within a single , thick balloon ( not shown ) that is then plugged to prevent the escape of the core material . the covering is resilient and is round in an undeformed state . the core 6 made of the mixture 20 and beads 22 provides a device with unique characteristics and capabilities . when the pliable grip 2 is initially deformed by a user &# 39 ; s hand with a moderate amount of squeezing force , the user must overcome the core &# 39 ; s resistance to deformation and cause the resilient covering to stretch . when the user ceases compressing the grip 2 , the balloons readily and substantially resume a spherical , inflated shape , that is , at least about 90 % of the original shape . in this manner , the grip 2 is resilient . in fig1 the grip 2 is shown prior to deformation and as such , it has a substantially spherical shape . it is being held in a user &# 39 ; s hand 4 atop the palm portion of the hand . the user is exerting no pressure on the grip . fig2 shows the grip 2 at a point when the user &# 39 ; s fingers and palm have deformed its shape . the grip 2 has become compressed into a disc shape ( labeled 2 &# 39 ;) and depressions have been formed on its surface that partially receive / surround the contacting portion of the user &# 39 ; s fingers . at the stage shown , the user &# 39 ; s hand 4 is still exerting a compressive pressure on the grip 2 . fig3 shows the next stage wherein the user &# 39 ; s hand 4 has relaxed and is no longer exerting compressive forces on the grip 2 . the grip 2 has readily sprung back to most of its original shape . the phantom lines show the previously deformed shape of the grip 2 &# 39 ;. the user can now apply compressive pressure to the grip 2 and mold it again . fig4 . shows a cross - sectional view of the invention with the core 6 visible with the mixture 20 and beads 22 . the embodiment disclosed herein has been discussed for the purpose of familiarizing the reader with the novel aspects of the invention . although a preferred embodiment of the invention has been shown and described , many changes , modifications and substitutions may be made by one having ordinary skill in the art without necessarily departing from the spirit and scope of the invention as described in the following claims . | 0 |
the description above and below plus the drawings contained herein merely focus on one or more currently preferred embodiments of the present invention and also describe some exemplary optional features and / or alternative embodiments . the description and drawings are presented for the purpose of illustration and , as such , are not limitations of the present invention . thus , those of ordinary skill in the art would readily recognize variations , modifications , and alternatives . such variations , modifications and alternatives should be understood to be also within the scope of the present invention . fig2 and fig3 are perspective top and bottom views respectively of a semiconductor package of the present invention . as shown in fig3 , a source pad 52 , a gate pad 51 and two drain pads 61 , which are separated from each other , are exposed on a bottom surface of the package , and a top source terminal 12 , a top gate terminal 11 and a bottom drain terminal 13 of the mosfet 10 ( fig4 ) are electrically connecting to the other external devices ( such as another semiconductor chip or integrated circuit board and the like ) by these pads respectively . meanwhile , the bottom surface of a lead frame 40 ( fig9 ) in connection with the bottom drain terminal 13 of the chip 10 is exposed on a top surface of the package ( fig2 ) for improving the heat dissipation of the device . fig4 to fig1 illustrate a fabrication method of the semiconductor package according to a first embodiment of the present invention . fig4 is a perspective view of one of a plurality of semiconductor chips 10 formed on a top surface of a semiconductor wafer ( not shown ). in the embodiment as shown in fig4 , each chip 10 is a mosfet chip including a top gate terminal 11 and top source terminal 12 separated from each other and formed on the top surface of the chip , and a bottom drain terminal 13 formed on the bottom surface of the chip . as shown in fig5 , conductive contact bodies 21 and 22 , such as metal balls or metal bumps , formed on the top gate terminal 11 and the top source terminal 12 of each chip 10 for electrically connecting with the external devices . certain common materials in current technologies can be used for forming the contact bodies 21 and 22 , such as copper , tin , lead , and the likes . as shown in fig6 , a first plastic package body 31 with a big enough thickness h is formed for covering the top surface of each chip 10 and completely encapsulating the contact bodies 21 and 22 on the top surface of the chip 10 . as shown in fig7 , the first plastic package body 31 is ground from its top surface to a smaller thickness h until the top surface of the contact bodies 21 and 22 is exposed . at this time , the top surfaces of the contact bodies 21 and 22 are flush with the top surface of the first plastic package body 31 . alternatively , after the contact bodies 21 and 22 are exposed , the top surfaces of the first plastic package body 31 and the contact bodies 21 and 22 can be further ground until reaching a predetermined thickness . as shown in fig8 , the molded wafer or the chip 10 with an original semiconductor substrate thickness y is ground from its bottom surface to a smaller thickness y , for example , the thickness y of the ground wafer may be 1 mil or thinner , which can be considered as a substrate - less level without the concern of mechanical deformation in following processes due to the mechanical support of the first plastic package body . at this stage , the molded wafer is singulated into a plurality of individual molded chips 10 , each of which includes a semiconductor chip , as shown in fig8 . the top surface of the chip is covered with the first plastic body while the sidewalls of the chip are exposed and flush with the sidewalls of the first plastic body . alternatively , a metal deposition can be carried out on the bottom surface of the ground wafer before singulation . fig9 is a perspective view of a conductive lead frame 40 made of a metal , such as copper and the like or metal alloy material . the lead frame 40 includes a die paddle 41 and two contact parts 42 relatively connected to two opposite edges bent upward at the first side and the third side corresponding to the left side and the right side of the die paddle 41 , where the top surface of the two contact parts 42 is higher than the top surface of the die paddle 41 . in addition , the lead frame 40 also includes notches 43 at the bottom surface of four corners of the lead frame 40 formed by a half - etch process . as shown in fig1 , the bottom surface of the molded chip 10 is attached on the top surface of the die paddle 41 by a conductive adhesive 70 . as such , the bottom drain terminal 13 of the molded chip 10 is directly electrically connected to the top surface of the die paddle 41 of the lead frame 40 , and therefore electrically connected to the two contact parts 42 through the die paddle 41 . the surface area of the die paddle 41 of the lead frame 40 needs to be larger than that of the molded chip 10 , therefore there is a space between the edge of the molded chip 10 and that of the die paddle 41 . as shown in fig1 , a second plastic package body 32 is formed on the top surface of the lead frame 40 to cover the side surface of the molded chip 10 . the material of the second plastic package body 32 may be the same as that of the first plastic package body 31 or different . in this figure , the edge line of the molded chip 10 is only displayed for showing the position of the molded chip 10 in the package . specifically , refer to fig1 , the space between the edges of the molded chip 10 and the edges of the dies paddle 41 is filled by the second plastic package body 32 . the second plastic package body 32 also covers the bottom surface of the contact parts 42 , the side surfaces of the second side and the fourth side of the lead frame 40 and fills the notches 43 with the contact bodies 21 and 22 at the top source terminal 12 and the top gate terminal 11 of the molded chip 10 being exposed outside of the second plastic package body 32 . the top surface and the side surface of the two contact parts 42 on the first side and the third side of the lead frame 40 are also exposed from the second plastic package body 32 for electrically connecting with the external devices . in this packaging step , the top surface of the molded chip 10 is covered with an adhesive tape before forming the second plastic package body 32 to control the thickness of the second plastic package body 32 during packaging and to protect the top surface of the contact bodies 21 and 22 and the contact part 42 that need to expose after forming the second plastic package body 32 . after forming second plastic package body 32 , the adhesive tape is removed , and second plastic package body 32 at the top surface of the packaging structure is de - flashed or slightly ground to remove the residual packaging material , so that the top surface of the packaging structure is flat and the top surfaces of the contact bodies 21 and 22 and the contact part 42 are exposed from the second plastic package body 32 . at this time , the top surfaces of the contact bodies 21 and 22 , the contact part 42 and the second plastic package body 32 are preferably coplanar but not strictly required . in addition , as shown in fig2 , the second plastic package body 32 covers the bottom surfaces of the two contact parts 42 of the lead frame 40 . the bottom surface of the die paddle 41 can be completely or partially exposed from the second plastic package body 32 by covering the bottom surface of the die paddle 41 with an adhesive tape before forming the second plastic package body 32 or grinding the bottom surface of the second plastic package body 32 after packaging . as such , the bottom surfaces of the die paddle 41 and the second plastic package body 32 are also coplanar . the exposed bottom surface of the die paddle 41 improves the heat dissipation of the devices or can be used for the electrical connection between the drain terminal 13 at the bottom of the chip 10 to the external devices . solderable metal pads are plated on the top surface of the packaging structure at the top surfaces of contact bodies 21 and 22 and the contact part 42 to re - pattern the package external connection between the corresponding terminal on the chip 10 and the external device . the location of the plated metal pads on the top surface of the packaging structure depends on the desired application of the device . in the example shown in fig1 , a metal pad 52 is plated on top of the contact bodies 22 on the two top source terminals 12 of the chip 10 and can be used as a source contact pad 52 . similarly , a metal pad 51 is plated over the contact body 21 on the gate terminal 11 of the chip 10 and can be used as a gate contact pad 51 , and the metal pads 61 are plated on the contact parts 42 and can be used as a drain contact pads 61 , where the drain contact pads 61 extend to the edges of the first side and the third side of the lead frame . in addition , the gate contact pad 51 covers a portion of the top surface of the first and / or second plastic body and extends to the edge of the second side of the packaging structure but terminates far away from the edges of the first side and the third side of the lead frame , and the source contact pad 52 covers a portion of the top surface of the first and / or second plastic body and extends to the edge of the fourth side of the packaging structure but terminate far away from the edges of the first side and the third side of the lead frame , where the contact pads 51 , 52 and 61 are electrically separated from each other . the plastic package body 32 surrounds four side surfaces of the molded chip 10 and extends to and covers the side surfaces of the second side and the fourth side of the lead frame 40 , and the gate contact pad 51 and the source contact pad 52 respectively covers parts of top surface of the plastic package body 32 and extends to the edges of the second side and the fourth side of the packaging structure beyond the corresponding edges of the lead frame while the contact pad 61 terminates at a distance away from both the edges of the second side and the fourth side of the packaging structure . fig1 to fig2 are perspective schematic diagrams showing a second fabrication method of the packaging structure of the invention . fig1 to fig1 are similar to fig4 to fig6 , in which a plurality of mosfet chips are formed on a front surface of the wafer and the contact bodies 21 and 22 are formed on the top gate terminal 11 and the top source terminal 12 of each chip 10 respectively , then a first plastic package body 31 is formed with a big enough thickness h to cover the top surface of the chip 10 with contact bodies 21 and 22 being completely encapsulated . in this process , as shown in fig1 , the top surface of the first plastic package body 31 is not ground to exposed the contact bodies 21 and 22 . the wafer or the chip 10 with an original semiconductor substrate thickness y is ground from its bottom surface to a smaller thickness y , which can be considered as a substrate - less level . the thickness y of the ground wafer is 1 mil or thinner . and then , the wafer is cut into individual molded chips 10 , each of which includes a semiconductor chip with top surface of the chip covered by the first plastic package body while the sidewalls of the chip are exposed and flush with the sidewalls of the first plastic body , as shown in fig1 . back metal deposition to the ground molded wafer bottom surface is optional before cutting the wafer . fig1 shows a lead frame similar as that shown in fig9 . as shown in fig1 , the bottom surface of the molded chip 10 is attached on the top surface of the die paddle 41 by a conductive adhesive 70 . as such , the bottom drain terminal 13 of the molded chip 10 is directly electrically connected to the external devices by the die paddle 41 and the contact part 42 of the lead frame 40 . as shown in fig1 , a second plastic package body 32 is formed to cover the molded chip 10 and the lead frame 40 , including at least the side surface at the second side and fourth side of the lead frame and the bottom surface of the two contact parts 42 , where only the side surfaces of the two contact parts 42 and the bottom surface of the die paddle of the lead frame 40 are exposed . as shown in fig2 , the top surface of the packaging structure is ground until the contact bodies 21 and 22 at the top gate terminal 11 and the top source terminal 12 on the chip 10 and the top surfaces of the two contact parts 42 on the lead frame 40 are exposed outside of the second plastic package body 32 . the grinding process also forces the top surfaces of the contact bodies 21 and 22 and contact parts 42 into coplanar without the strict alignment requirement in mounting the semiconductor chip of prior arts . as shown in fig2 , the bottom surface of the die paddle 41 connecting to the drain terminal 13 at the bottom of the chip 10 is exposed for heat dissipation . fig2 is similar to fig1 , in which solderable metal pads are plated on the top surface of the packaging structure at the top surfaces of contact bodies 21 and 22 and the contact part 42 to re - pattern the package external connection between the corresponding terminal on the chip 10 and the external device . the location of the plated metal pads on the top surface of the packaging structure depends on the desired application of the device . the volume of the packaged device with the wafer level substrate - less mosfet chip made by the methods of the present invention is effectively reduced . the packaged device include a semiconductor chip 10 with a top source terminal 12 electrically connected to the contact body 22 and the source contact pad 52 , a top gate terminal 11 electrically connected to the contact body 21 and the gate contact pad 51 , a drain 13 terminal at the bottom of the chip 10 electrically connected to a die paddle 41 and the contact part 42 of the lead frame 40 as well as a drain contact pad 61 formed on the contact part 42 . the gate contact pad 51 , the source contact pad 52 and the drain contact pad 61 are insulated and separated by the first plastic package body 31 and the second plastic package body 32 . the top surfaces of the packaging structures with these contact pads are flush and used as the back side ( fig3 ) of a power device facing downward in the actual application for electrically connecting to the external devices . the re - pattern circuit on the surface of the packaging structure can be formed by changing the locations of the contact pads . the bottom surfaces of the packaging structures with the bottom surface of the die paddle 41 of the lead frame 40 being exposed is used as the top side ( fig2 ) of the power device facing upward in the actual application for the electrical connection to the external devices and also for improving the heat dissipation of the device . the above detailed descriptions are provided to illustrate specific embodiments of the present invention and are not intended to be limiting . numerous modifications and variations within the scope of the present invention are possible . the present invention is defined by the appended claims . | 7 |
the above described drawings illustrate a visual understanding of the preferred embodiments , preferred positioning and preferred materials of the invention . these drawings , while not to scale , do depict a dimensional view of preferred embodiments of the invention e . g ., a preferred depth and style of invention , fig1 ; a top view of a preferred placement and shape of layers , fig2 ; a cross - sectional view depicting the preferred embodiments and layers , fig3 ; and a complete cross - sectional view depicting further embodiments of the invention in their preferred positions , fig4 . preferred materials for mats of the present invention include those made of anti - static air cellular “ bubble ” shaped polyethylene based material , anti - static closed cellular polyethylene based foam material , and anti - static closed cellular polypropylene based foam material . these materials are utilized in a variety of layered constructions . a preferred laminating material 80 , 82 , 84 and 86 is utilized to bond the various layers together and a preferred low tack adhesive material 28 with a carrier sheet 26 form a laminated construction to create the first layer 20 . the preferred low tack adhesive material has a removable liner ( preferably a silicon coated paper ) 29 so that the liner 29 can be easily removed and discarded before use and the floormat can be temporarily affixed to a typical flooring surface . the preferred material also allows for repositioning prior to use . [ 0029 ] fig1 illustrates , dimensionally , a generally rectangular floormat 10 ( topside visible ) and the possible “ pyramiding ” effect of the layering construction which provides a truncated pyramidal shape to the mat . as best illustrated in fig1 and fig2 the mat comprises several layers and starting with the base layer 20 each successible layer 30 , 40 , 50 , is centered one layer on top of another to give a gradual elevation and create a symmetrical appearance on the length and width of the mat . as best shown in fig1 and fig2 this preferred “ pyramid ” effect begins with the “ floor side ,” base layer 20 , shown as having an overall rectangular shape , with a length 22 and width 24 of the finished mat . layers 30 , 40 , and 50 , preferably decrease in overall length and width in each direction with respect to those of layer 20 , e . g . layer 30 has a length 32 and a width 34 , each of which is respectively dimensionally less than 22 and 24 , layer 40 has a length 42 and a width 44 , each of which is respectively less than 32 and 34 , and layer 50 has a length 52 and a width 54 , each of which is respectively dimensionally less than 42 and 44 . as best shown in fig3 and fig4 mat 10 has a top , cover layer 60 affixed to the next layer 50 thereunder and cover layer 60 is also preferably affixed to all subsequent lower exposed layers to appear to be “ shaped ” to these layers and to totally cover the complete top side of the mat . mats of the present invention can , of course , be constructed in different sequences , eliminating or adding layers of the preferred embodiments shown and describe herein for different performance results and costing advantages . it will also be appreciated that mats of the present invention also can be of any desired shape . for example , in addition to a rectangular shaped construction , mats can be of an oval construction , a circular construction , a hexagonal construction , an octahedral construction , etc ., to name but a few other shapes . turning to fig4 base layer 20 comprises an adhesive material that is a low - tack adhesive with preferred adhesive ranges of from about 5 to about 100 ounces per inch of width ( nominal ), based on astm testing method ( of adhesion to steel ). preferably base 20 is constructed from a polyethylene or co - extruded polymer as a carrier sheet 26 having a thickness of about 0 . 002 to about 0 . 004 inches to which the low - tack adhesive 28 is attached . carrier sheet 26 provides mat 10 with added durability during its limited use and also acts as a carrier for the low tack adhesive 28 . the adhesive material 28 and carrier sheet 26 , are protected by a removable liner sheet 29 . this removable liner sheet 29 is preferably a silicone coated paper , for example 25 # to 40 # basis weight or other adequate material which either inherently provides or is nominally coated enough for a clean release from low tack adhesive 28 while still able to remain on the adhesive prior to use . liner sheet 29 can be easily removed prior to use and is used to protect the adhesive layer 20 during fabrication , storage and shipping . the liner sheet 29 can be perforated , secured or otherwise constructed to facilitate removal of the liner sheet item desired . layer 30 is preferably comprised of a material that is an air “ bubble ” shaped closed cellular material with an inner air protection polymer barrier ( preferred nylon or co - extruded polymer ) layer to minimize the loss of air from the air cell . more preferably layer 30 has anti - static properties . the preferred material is manufactured from , or to have , about a 0 . 002 - 0 . 003 inch thickness for the “ flat ” side 36 of the bubble material ( bottom overall sheet thickness ) and about a 0 . 004 - 0 . 005 inch thickness for the “ bubble ” side 38 of the bubble material ( top overall sheet thickness ). other thicknesses of this air “ bubble ” cellular material may be employed as well . in the preferred construction of mat 10 , bubble side 32 is positioned upward to face the bottom of layer 40 . the air “ bubble ” shaped cellular material comprising layer 30 preferably has less than a 10 % thickness loss , based on a 0 . 5 pounds per square inch loading over 15 days utilizing a static test method of 10 ″× 10 ″ material samples . commercially available air “ bubble ” shaped cellular materials useful in the present invention include those offered by sealed air corp . under the trademarks , bubble wrap , air cap , poly cap , poly cap lite and bubble mask ; those offered by pactiv ( formerly astro - valcour ) under the trademarks , astrosupra bubble , astro - cell and astro - cell plus ; and those offered by poly air under the trademark dura bubble . as shown in fig4 mat 10 includes a laminating adhesive 80 to affix layer 20 to layer 30 . the preferred adhesive 80 is a synthetic elastomer , 22 - 24 % solids , with adhesion to the polymer substrates of 2 - 10 pounds per inch , based on astm test methods for adhesives . the preferred method of construction is to apply the laminating adhesive 80 to both the top of layer 20 and the bottom of layer 30 for proper bonding . additional laminating techniques may be used such as , by way of example and not limitation , heat bonding of the polymer layers and utilizing laminating polymers to bond layers 20 and 30 together . in an alternative embodiment of the invention , low - tack adhesive 28 can be applied directly to the bottom of layer 30 without the use of carrier sheet 26 . in yet another alternative embodiment of the invention , layer 20 can be eliminated and or replaced with anti - static friction inducing ribs , nubs or the like to impede movement of mat 10 when in use . layer 40 is preferably comprised of a material that is closed cellular polyethylene foam with a preferred nominal density of about 1 . 7 to 2 . 2 pounds per cubic foot and a preferred nominal thickness of about 0 . 125 inches . more preferably the closed cellular polyethylene foam of layer 40 has anti - static properties and the anti - static surface resistivity properties would preferably have less than 10 13 ohms / square at 73 ° f ., 15 % r . h . based on testing method astm - d - 257 and static decay properties of a maximum of 2 seconds under testing method 4046 of fed . test method std 101c . commercially available closed cellular polyethylene foam materials useful in the present invention include those offered by sealed air under the trademarks cellu cushion , cellu plank and cell aire ; those offered by pactiv under the trademarks astro foam and stratocel ; and those offered by poly air under the trademark star foam . preferably a laminating adhesive 82 is used to affix layer 30 to layer 40 in a similar manner as adhesive 80 secures layer 20 to layer 30 . preferably adhesive 82 , similar to adhesive 80 , is a synthetic elastomer , 22 - 24 % solids , with adhesion to the polymer substrates of 2 - 10 pounds per inch , based on astm test methods for adhesives . the preferred method of construction is to apply laminating adhesive 82 to the top of layer 30 and the bottom of layer 40 for proper bonding . additional laminating techniques may be used such as , by way of example and not limitation , heat bonding of the polymer layers and utilizing laminating polymers to bond layers 30 and 40 together . layer 50 is preferably comprised of an air “ bubble ” shaped closed cellular material with an inner air protection polymer barrier ( preferred nylon or co - extruded polymer ) layer to minimize the loss of air from the air cell . more preferably layer 50 has anti - static properties . layer 50 is similar to layer 30 . as for layer 30 , the preferred material for layer 50 is manufactured from , or to have , about a 0 . 002 - 0 . 003 inch thickness for the “ flat ” side 56 of the bubble material ( bottom overall sheet thickness ) and about a 0 . 004 - 0 . 005 inch thickness for the “ bubble ” side 58 of the bubble material ( top overall sheet thickness ). other thicknesses of this air “ bubble ” cellular material may be employed as well . in the preferred construction of mat 10 , bubble side 58 is positioned downward to face the top of layer 50 . this air “ bubble ” shaped cellular material would preferably have less than 10 % thickness loss , based on a 0 . 5 pounds per square inch loading over 15 days utilizing a static test method of 10 ″× 10 ″ material sample . mat 10 also preferably includes a laminating adhesive 84 to affix layer 40 to layer 50 in a manner similar to the use of adhesive 82 to secure layers 30 and 40 , and adhesive 80 to secure layers 20 and 30 . preferably adhesive 84 , similar to adhesive 80 and 82 , is a synthetic elastomer , 22 - 24 % solids , with adhesion to the polymer substrates of 2 - 10 pounds per inch , based on astm test methods for adhesives . the preferred method of construction is to apply laminating adhesive to the top of layer 40 and to the bottom of layer 50 for proper bonding . additional laminating techniques may be used such as , by way of example and not limitation , heat bonding of the polymer layers and utilizing laminating polymers to bond layers 40 and 50 together . mat 10 preferably includes a cover layer 60 . cover layer 60 is preferably comprised of an anti - static polypropylene closed cellular foam , with a preferred nominal density of about 0 . 5 - 0 . 7 pounds per cubic foot and a preferred nominal thickness of about 0 . 0625 inches . more preferably the material also exhibits a heat resistance of up to 310 ° f . ( melting point ) and has an inherent high coefficient of friction , offering a non - slip surface for the mat . the anti - static surface resistivity properties would preferably have less than 10 13 ohms / square at 73 ° f ., 15 % r . h . based on testing method astm - d - 257 and static decay properties of a maximum of 2 seconds under testing method 4046 of fed . test method std 101c . commercially available polypropylene closed cellular foam materials useful in the present invention include those offered by pactiv under the trademark microfoam . as best shown in fig3 and fig4 cover layer 60 preferably not only covers layer 50 but also covers intermediate layers 40 and 30 and base layer 20 , especially in the preferred embodiment where layers 50 , 40 and 30 , and optionally 20 , are in a pyramid construction and provide mat 10 with one or more beveled edges . mat 10 also preferably includes a laminating adhesive to affix layer 60 to layer 50 and , were appropriate to layers 40 , 30 and 20 . similar to adhesives 80 , 82 , and 84 , adhesive 86 is preferably 60 a synthetic elastomer , 22 - 24 % solids , with adhesion to the polymer substrates 2 - 10 pounds per inch , based on astm test methods for adhesives . in the preferred construction of mat 10 , laminating adhesive 86 is applied to the bottom of cover 60 and to the top of and / or sides of the other surfaces facing cover 60 for proper bonding . additional laminating techniques may be used such as , by way of example and not limitation , heat bonding of the polymer layers and utilizing laminating polymers to bond cover layer 60 to layer 50 and to other underlying surface sought to be covered . while the preferred embodiments of the invention have been shown and described it will be apparent to those skilled in the art that changes and modifications may be made thereto without departing from the spirit of the invention . for example , variations in the number of layers , the thickness of one or more of the layers , proportion and properties of the materials of the layer , and overall design of the mat may vary without departing from the spirit of the invention , the scope of which is defined by the appended claims . | 8 |
the present invention now will be described more fully hereinafter with reference to the accompanying drawing , in which a preferred embodiment of the invention is shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . with reference to fig1 bales of cotton fibers are opened in a conventional manner . the fibers can optionally go through an initial carding process to provide some alignment at this stage of the process . in the process according to the instant invention , cotton fibers are dyed to achieve a predetermined color , using conventional fiber dyeing methods such as batch dyeing . ( for purposes of this application , the term “ cotton fibers ” is meant to describe batches of fibers in which a major portion of the fibers are the seed hairs from the seeds of cotton plants . the batches may also include other types of fibers conventionally used in combination with cotton fibers , within the scope of the instant invention .) the dyed yarns are then carded according to conventional carding methods , and may go through an initial drawing stage as well , although not required . the fibers are then combed using commercially available combing machinery , such as the saco - lowell ca comber . in a preferred form of the invention , a combing machine set up with approximately 1420 teeth per square inch ( as opposed to the industry standard of about 1002 teeth per square inch ) has been found to perform well in combing the dyed fibers . such a high tooth gauge is particularly surprising , since one would expect that the tangled state of the fibers which are input to the comber would necessitate the use of a less aggressive combing arrangement . in addition , in a preferred form of the process of the invention , the air suction on the comber is increased from conventional levels to optimize the condition of the fiber output , and top combs which are in pristine condition are desirably used . while one would expect such conditions to be too aggressive even for natural fibers , the inventor has surprisingly discovered that the combed fibers are in excellent condition and that the tangled fiber input does not damage the comber , as one might expect . in a preferred form of the invention , the combing of the dyed fibers is performed to remove about 21 - 22 % noils ( as compared with about 17 % noil removal from a “ world class ” combing of natural fibers ). in one form of the invention , fibers of two or more colors ( one of which may be the color of the natural cotton fibers in their undyed form and at least one of which is dyed ) are blended together , then all of the fibers are combed . in this form of the invention , it has surprisingly been found that the color of yarn which would be expected from conventional yarn processing methods of like - colored fibers is achieved , while the individually - colored fibers are more intimately blended together than with the conventional processing methods , so as to result in a more consistent color throughout the yarn . in another form of the invention used to produce mixed - color yarns ( e . g ., heather yarns ), the manufacturer determines which of the colors to be blended in the yarn will be the dominant fiber color . for example , grey heather yarns generally include about 9 % black fibers and the rest natural - colored fibers . in such yarns , black is the dominant fiber color and in fabrics produced from the grey heather yarns , the black neps therefore have a tendency to show up more prominently than the naturally - colored neps . therefore , in this embodiment of the invention , the manufacturer combs the dyed fibers which it has been determined will present the most dominant visual appearance ( i . e ., in the example , the black fibers ), such that fewer irregularities exist in that fiber color . as a result , blended yarns spun from the dominantly - colored dyed combed fibers and the other colored fibers have a slightly lower overall nep count as compared with prior art yarns formed from likecolored fibers . ( as will be understood , the reduction in overall nep count will depend somewhat on the percentage of the fibers forming the yarn which have been combed subsequent to dyeing . however , by strategically selecting which of the fiber inputs are to be combed , and by the inventor &# 39 ; s development of a process for combing fibers subsequent to the dyeing process , marked improvements in yarn quality can be achieved through the use of only a small percentage of the dyed - then - combed fibers relative to the overall yarn composition .) therefore , when the thus - produced yarns are formed into a piece of fabric , the overall appearance is that of a dramatic reduction in yarn neps . thus , with only a minimal processing adjustment , a surprisingly remarkable increase in fabric quality can be realized . in addition , the thus - produced yarns have a dramatically reduced coefficient of variation , a reduced number of thick and thin places , increased breaking factor , and increased tenacity . furthermore , the thus - produced yarns have a readily visible increase in luster , which greatly enhances the appearance of the yarn . in fact , in many of the yarns , and particularly those in which a dyed fiber quantity is combed prior to blending with a second quantity of fibers , and the blended fibers are then combed together , the resulting yarns are substantially free of visual irregularities , and fabrics produced from the yarns are substantially free of neps and visual irregularities . thus , the instant invention enables the achievement of dramatic functional as well as aesthetic improvements . in an alternative form of the invention , fibers are dyed then combed , then blended with fibers of another color . the blended fibers are then combed together , and spun into a yarn . the thus - produced yarns have enhanced luster over that of their conventionally - spun counterparts , and while the color is substantially the same as that which is achieved by conventional comb - then - dye methods of spinning blended yarns ( as described above ), the colors are significantly more intimately blended . the result is a yarn having a much lusher appearance than that of conventional yarns . in addition , the yarns have been found to be much softer , particularly when spun using ring spinning methods . it is to be noted , however , that fibers processed according to the instant invention can be formed into yarns using any conventional method , including but not limited to ring spinning , open end spinning , and air jet spinning methods . in fact , the fiber preparation process enables the production of finer - size open end spun yarns than have heretofore been achievable at commercially acceptable levels of production , since the improved consistency of the dyed fiber input results in fewer ends down during the spinning process . in a particularly preferred method of the invention designed to achieve virtually nep - less heather yarns , the dyed fibers are combed , blended with natural fibers , and the blended fibers are combed together . as a result , the dyed fibers have thus undergone two combing operations . in this way , extremely high quality , soft yarns are produced which have more intimate fiber blending . because the dyeing process often has a tendency to strip some of the natural oils from the fibers , it has also been found to be desirable in some cases to add one or more conventional types of lubricant to the fibers prior to combing them , particularly where the ginning process has removed more than an optimal level of the fibers &# 39 ; natural oils . the amount and types of such lubricants can be readily selected depending on the particular batch of cotton fibers being processed without undue experimentation by someone having ordinary skill in the art . a variety of yarns were prepared according to various embodiments of the instant invention , and the results are outlined below for purposes of comparison with the physical characteristics of conventionally - produced yarns . for purposes of description below , the term “ scratch combed ” is used to describe the combing of fibers which was performed at a machine set - up designed to remove approximately 2 - 4 % of the fiber noils . as noted above , scratch combing is a common level of aggressiveness at which fibers are combed . also for purposes of the examples , the term “ process 2 combing ” is intended to describe combing using a more aggressive machine set - up , to remove about 17 % or greater of fiber noils . in all of the examples , the highest quality 1 - ⅛ ″ staple length cotton fibers were used . each of the samples was then measured to determine the average yarn size , and four 400 yard lengths of each yarn sample were analyzed using a uster evenness tester to determine the coefficient of variation of each , number of thick and thin places , and the number of neps ( i . e ., piece of fiber which breaks and balls up , forming a pill on the outer surface of the yarn .) it is noted that the terms “ thick ” and “ thin ” places are recognized terms of art detected by the uster evenness tester , as will be readily appreciated by those having ordinary skill in the art . the averages of each of these criteria were then calculated . elongation , force to break and yarn tenacity were then measured on twenty - five single ends of each yarn using a statimat m single end tester in its conventional manner , as will be readily understood by those having ordinary skill in the art . the gauge length was set at 254 mm , the load cell at 10 n , the preload was 0 . 50 cn / tex , and the test speed was 5000 mm / min . again , the average of each of these measurables was calculated , as was the break factor for each of the yarns . samples a , b and c of forest green yarns including 80 % dyed fibers and 20 % natural fibers were produced as follows . a twist test was conducted for each of the yarns to determine the average turns per inch ( tpi ) and average twist multiple ( tm ), as noted below : a . 18 / 1 ne 100 % cotton yarns were produced from 80 % dyed fibers and 20 % natural fibers which were carded together , but not combed . the yarn had an average twist of 15 . 9 tpi and an average twist multiple of 3 . 8 . b . 18 / 1 ne 100 % cotton yarns were produced from a blend of 20 % natural fibers which were combed according to process 2 and 80 % dyed ( uncombed ) fibers . the yarn had an average twist of 16 . 2 tpi and an average twist multiple of 3 . 9 c . 18 / 1 ne 100 % cotton yarns were produced from a blend of 80 % dyed fibers and 20 % natural fibers which had been combed according to process 2 , with the blended fibers being combed together according to process 2 . the yarn had an average twist of 16 . 2 tpi and an average twist multiple of 3 . 9 . the results of the measurements of samples a , b , and c are listed in the table labeled as fig2 . as illustrated , the yarns prepared according to the instant invention ( i . e ., sample c ) had dramatically reduced numbers of thick and thin places , as well as a dramatic reduction in the number of neps . furthermore , the fiber evenness is dramatically improved , as illustrated by the significant reduction in the coefficient of variation of the yarns of sample c as compared with those of samples a and b . in addition , the spread between the highest coefficient of variation and the lowest coefficient of variation for the product made according to the instant invention ( sample c ) is also substantially smaller than the spread between the highest and lowest coefficients of variation of the yarns made according to conventional processes ( i . e ., samples a and b .) this indicates that yarns made according to the instant invention are consistently more uniform than those which are made according to prior art methods . furthermore , the tenacity , the elongation , and the force to break were substantially improved . samples d , e and f of dark grey yarns including 50 % dyed fibers and 50 % natural fibers were produced as follows . a twist test was conducted for each of the yarns to determine the average turns per inch ( tpi ) and average twist multiple ( tm ) as noted below : d . 18 / 1 ne 100 % cotton yarns were produced from a blend of 50 % scratch combed natural fibers and 50 % fibers which were scratch combed , then dyed black . the thus - prepared fibers were then carded together and spun into a yarn . the yarn had an average twist of 16 . 0 tpi and an average twist multiple of 3 . 8 . e . 18 / 1 ne 100 % cotton yarns were produced from 50 % natural fibers which were combed according to process 2 and 50 % fibers which were scratch combed , then dyed black . the thus - processed fibers were then spun into a yarn having an average twist of 16 . 5 tpi and an average twist multiple of 3 . 9 . f . 18 / 1 ne 100 % cotton yarns were produced from 50 % natural fibers which were combed according to process 2 and 50 % fibers which were dyed black , then combed according to process 2 . the fibers were blended and combed together according to process 2 . the yarn had an average twist of 16 . 9 tpi and an average twist multiple of 4 . 0 . the results of the measurements of samples d , e and f are listed on fig3 which follows . as illustrated , the average coefficient of variation for the yarns made according to the instant invention ( sample f ) was substantially lower than that for the conventionally produced yarns ( samples d and e ), as was the average number of thick and thin places . for example , the sample f yarns had an average of 22 thick places per 400 yards , as compared with 1291 in the sample d yarns . furthermore , the sample f yarns averaged only a single thin place per 400 yard length , as compared with 355 for the sample d yarns , and the average number of neps for the sample f yarns was a mere 7 per 400 yard length of yarn . furthermore , increases in the average break factor , force to break and tenacity were realized . samples g , h , i , and j of light grey yarns including 9 % black dyed fibers and 91 % natural fibers were produced as follows : g . 18 / 1 ne 100 % cotton yarns were produced from 9 % fibers scratch combed as natural , then dyed black and 91 % carded natural fibers , with the blended fibers being carded together prior to spinning . the yarn had an average twist of 16 . 6 tpi and an average twist multiple of 3 . 9 . h . 18 / 1 ne 100 % cotton yarns were produced from a blend of 9 % fibers which were dyed black , then combed according to process 2 and 91 % natural uncombed fiber stock . the yarn had an average twist of 16 . 1 tpi and an average twist multiple of 3 . 7 . i . 18 / 1 ne 100 % cotton yarns were produced from 9 % fibers which were dyed black , then combed according to process 2 . the dyed combed fibers were blended with 91 % natural fibers which had also been combed according to process 2 , and then the blend was combed together according to process 2 . the yarn had an average twist of 16 . 7 tpi and an average twist multiple of 3 . 9 . j . 18 / 1 ne 100 % cotton yarns were produced from 9 % fibers which were dyed black , then combed according to process 2 and 91 % carded natural fibers , and the blended fibers were then combed together according to process 2 . the yarn had an average twist of 15 . 8 tpi and an average twist multiple of 3 . 8 . the results of the measurements of samples g , h , i and j are listed in fig4 . as indicated in the tables , the yarns made according to the instant invention ( i . e ., samples h , i , and j ) had lower coefficients of variation ( particularly those of samples i and j , where the blend including the dyed fiber component was combed together .) as indicated , the average number of thick and thin places in samples i and j was reduced to zero . furthermore , as indicated by a comparison of samples g and h , the combing of the dyed fibers after the dyeing process rather than before it produced dramatic reductions in the number of thin and thick places as well as the number of neps . thus , yarns made according to the instant invention were found to be more consistently uniform and had reduced thick and thin regions , as well as reduced number of neps . because the neps are generally readily visible when the yarn is knit or otherwise formed into a fabric , the reduction in neps achieved by the instant invention results in the ability to produce higher quality fabrics with dramatically fewer neps . in addition , the yarns produced according to the instant invention had improved luster , with the blending of the fiber colors being more intimate throughout the yarn . furthermore , the yarns were stronger than those produced by prior art methods ( as illustrated by the increase in force required for break ), and the yarns were more consistent in strength , as illustrated by the smaller spread between the highest and lowest forces required for break of the yarn . many modifications and other embodiments of the invention will come to mind to one skilled in the art to which this invention pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawing . therefore , it is to be understood that the invention is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation . | 3 |
referring now to the drawings and , in particular , fig1 fused or molten masses of plastics material or similar plastic compositions are extruded through the apertures in a perforated plate 1 and are cut to form granules by means of a rotary cutter tool 2 . the plate 1 has portions ( not shown ) which are not perforated . in the initial phase of the operation of the apparatus , the cutter blades of the cutter tool are rotated into the perforation - free regions of the perforated plate 1 , so that the extruded material can pass through the perforations in the plate in an unhindered manner . until the extrusion device is operating at full power and strands 4 of extruded material of full thickness are extruded at an appropriate pressure through all of the perforations in the plate 1 , the cutter blades are maintained in their initial position . the strands 4 therefore pass unhindered to a base plate 3 of the apparatus , from which they may be easily removed , without disrupting the subsequent granulation operation . the cutter tool 2 is then actuated . the rotation of the blades of the cutter tool not only granulates the material but also supplies a centrifugal force thereto , as shown by the arrows 5 . this centrifugal force directs the granules onto the lower wall 6 of an annular channel 7 and not onto the base plate 3 . this wall 6 also forms the upper wall of a collection chamber 10 for the granules , which chamber 10 will be described in greater detail hereinafter . the lower wall 6 is wetted by a film of coolant water which is produced in the annular channel 7 . for this purpose , water is fed tangentially into the annular channel 7 through a coolant water inlet apeture 8 . as the water circulates in the annular channel 7 , the portion thereof having the highest speed of angular rotation will move outwardly and upwardly to the upper , outer peripheral region of the channel 7 . such fastest flowing water then passes into a plate - like annular acceleration chamber 9 formed in the upper region of the channel 7 . in the chamber 9 , the water is forced to move inwardly from the outer to the inner periphery of the annulus by the pressure of the water flow . due to the restricted diameter of the chamber 9 compared with that of the channel 7 , the water is subjected to substantial angular acceleration in the acceleration chamber 9 . accordingly after emerging from the chamber 9 , the water is no longer constrained to move radially inwardly and , on entering the interior of the chamber 10 , tends to remain close to the wall 6 . the film of water having this high centrifugal acceleration will circulate around the wall 6 . the granules cut by the cutter tool 2 are impelled into this film of water and are removed from the apparatus through an outlet aperture 11 . the recess for receiving the initial uncut strands 4 is formed concentrically with the chamber 10 and located radially inwardly thereof and defined by a cylindrical sleeve 12 which comprises the radially inner wall of the collection chamber . the sleeve 12 is , in the above embodiment , cylindrical , but it could equally be conical , as shown in dashed lines in fig1 . however , it is highly desirable that the smallest cross - sectional area of the cylinder or of the cone is selected so as to be at least equal to the surface area of the perforated plate . this is to ensure that , when the cutter tool 2 is not rotating , all of the emergent strands 4 passing through the plate 1 are discharged downwardly into the recess . elliptical , rectangular or any other suitably shaped perforated plates may also be utilised . the recess is , in such circumstances , adapted to the shape of the plate . in fig2 an embodiment of an apparatus in accordance with the present invention is shown which is particularly suitable for granulating highly adhesive materials . for this purpose , a second annular channel 14 is provided , the radially inner wall of which forms the wall of the sleeve 12 . the channel 14 has a downwardly and outwardly inclined outer wall 16 which forms a wall portion of the chamber 10 . water is caused to enter the channel 14 through an inlet opening 13 . this water then overflows from the top of the channel 14 into the chamber 10 , the overflow edge of the channel being referenced 15 . the water entering the chamber 10 circulates and will remain adjacent the wall 16 due to gravity . such water therefore prevents highly adhesive granules from adhering to the internal wall 16 of the chamber 10 . fig3 is a cross - sectional view of the embodiment shown in fig1 and illustrates , in particular , the circulation of the water streams in both the acceleration chamber 9 and in the chamber 10 in the region of the wall 6 . more particularly , the arrows 17 indicate the direction travel of the water in the chamber 9 due to the centrifugal acceleration caused by the relative dimension of the chamber 9 and the channel 7 being overcome by the upstream water pressure and the arrows 17a indicate the centrifugal acceleration of the water onto the wall 6 of the chamber 10 when freed from the contraints of the chamber 9 . | 1 |
referring now to fig2 , a logic gate array 10 of a programmable pluggable transceiver is illustrated . the internal logic 24 of the logic gate array 10 allows the transceiver to insert new frames or loopback , filter , process and / or terminate incoming traffic frames on either datapath 16 , 18 . multiplexer logic 26 , 28 intersects each datapath 16 , 18 respectively . each multiplexer logic 26 , 28 may receive frames from internal logic 24 to be inserted into the datapaths 16 , 18 for example during idle periods in traffic . selection of which source the multiplexer logic 26 , 28 passes through the datapath 16 , 18 is controlled by internal logic 24 . the internal logic 24 can inspect incoming frames on either datapath 16 , 18 for filtering , looping - back , processing and / or terminating incoming frames . the internal logic 24 can also generate control frames , or any other new frames , which are inserted in between regular traffic frames in either datapath 16 , 18 as shown in fig2 . frame buffering and scheduling logic within the internal logic 24 may handle hitless transitions between frames from different sources . multiplexer logic 26 , 28 controlled by internal logic 24 manage the insertion of frames from the internal logic 24 into the datapaths 16 , 18 and ultimately through the transceiver host interface 30 or transceiver line interface 32 respectively . the transceiver host interface 30 and transceiver line interface 32 interface data between the logic gate array 10 and the rest of the transceiver 8 . these interfaces 30 , 32 may perform data conversions , if any are necessary between the transceiver and the logic gate array 10 . the logic gate array 10 illustrated in fig2 can be divided into three parts : internal logic 24 , core logic and connectivity logic . as above , internal logic can be any functionality that one could desire in a programmable pluggable transceiver . core logic performs the basic hitless pass - through functionality of a transceiver . core logic comprises the transceiver host interface 30 and the transceiver line interface 32 . connectivity logic combines the outgoing data from the two other parts onto datapaths 16 , 18 . in fig2 , connectivity logic comprises the multiplexor logic 26 , 28 but is controlled by the internal logic 24 . u . s . patent application ser . no . 13 / 783 , 871 owned by the applicant , filed mar . 4 , 2013 , entitled “ layer 2 and 3 latching loopbacks on a pluggable transceiver ”, and incorporated herein by reference , provides an example application of programmable pluggable transceivers in communication networks . it would be advantageous for a programmable pluggable transceiver such as the one suggested in fig2 to be upgradeable using existing traffic datapaths ( in - band ) with minimal effect , or without effecting , traffic and be secure to prevent erroneous , unintentional or malicious upgrades . the present disclosure describes how to upgrade the internal logic of the programmable logic gate array of a programmable pluggable transceiver while the programmable pluggable transceiver remains in service using existing datapaths and without degrading the basic hitless pass - through functionality of the core logic of the transceiver . referring now to fig3 , a programmable pluggable transceiver 300 is illustrated . the transceiver 300 includes datapaths 16 , 18 for relaying frames in a packet based network ( or other data in any network ) in both directions through the transceiver 300 , a line interface conversion 12 for performing optical to electrical or electrical to electrical conversions of data on datapaths 16 , 18 and a host interface conversion 14 for performing any necessary conversions of data on datapaths 16 , 18 between the transceiver 300 and a network element 2 , 4 , 6 into which the transceiver is plugged . each of these components has been previously described and is well understood in the art . the transceiver 300 further includes a programmable logic gate array 302 intersecting both datapaths 16 , 18 between the line interface conversion 12 and the host interface conversion 14 . the datapaths 16 , 18 may include host two - wire interface datapaths which may not necessarily pass through the transceiver line interface 306 or transceiver host interface 308 as these serial datapaths are separate physical connections in the transceiver 300 for a host port connection . different from the transceiver of fig2 , the logic gate array 302 may be divided into four parts : the upgradeable internal logic 304 , core logic , connectivity logic 26 , 28 and control logic 301 . each of these parts is described below . the upgradeable internal logic 304 can receive data from both datapaths 16 , 18 , and can send data over both datapaths 16 , 18 through the control logic 301 and the connectivity logic 26 , 28 . the upgradeable internal logic 304 can signal the connectivity logic 26 , 28 through the control logic 301 as to whether to select output from the core logic or the upgradeable internal logic 304 for the datapaths 16 , 18 . otherwise , the upgradeable internal logic 304 may perform any functions that can be coded into its associated reprogrammable gates of the logic gate array 302 . similar to fig2 , the core logic of the transceiver 300 enables basic transceiver functionality which is to pass - through data in a transparent , hitless manner on the datapaths 16 , 18 performing any data conversions , if necessary , while maintaining any minimum throughput requirements for the transceiver . the basic pass - through functionality of the core logic would not be changed during a partial upgrade according to the present disclosure to ensure that the transceiver 300 would continue to operate in service during the upgrade . core logic comprises the transceiver line interface 306 , transceiver host interface 308 and the datapaths 16 , 18 connecting through these two interfaces . data received on datapath 16 after line interface conversion 12 passes into the logic gate array 302 through transceiver line interface 306 , along datapath 16 , out the logic gate array 302 through transceiver host interface 308 , through host interface conversion 14 and out the transceiver 300 . the opposite order of operations occurs with data received on datapath 18 . in operation , whether or not a partial upgrade is occurring , the basic transceiver functionality of the core logic allows the programmable pluggable transceiver 300 to operate as any commonly known pluggable transceiver . if a full upgrade of the logic gate array 302 is performed , the core logic is affected , thus a full upgrade of the transceiver &# 39 ; s logic gate array 302 may still be service effecting on the transceiver 300 . the connectivity logic 26 , 28 is the third part of the logic gate array 302 of the transceiver 300 . the connectivity logic is provided for receiving frames from the upgradeable internal logic 304 , the core logic and the control logic 301 on either of the first and second datapaths and for sending the received frames on the corresponding datapaths in accordance with selection signals received from the control logic 301 . in fig3 , the connectivity logic comprises the multiplexer logic 26 , 28 as described in fig2 . other logic structures for selecting between multiple sources to output may be equally applied to the connectivity logic . the connectivity logic may also ensure that a transition from outputting data from one source completes transmitting all frames of the data prior to switching to output data from another source . for example , if a service traffic datum comprising twenty frames is in the midst of being forwarded on datapath 16 when the upgradeable internal logic 304 changes the selection signal to the multiplexer logic 26 indicating the upgradeable internal logic 304 wants to transmit a datum , the multiplexer logic 26 could wait until all twenty frames of the service traffic datum were transmitted on datapath 16 prior to switching to output the upgradeable internal logic datum . this ensures that the transceiver 300 would not affect service traffic data . the control logic 301 is the last part of the logic gate array of the transceiver 300 . this control logic is absent from fig2 and prior art programmable pluggable transceivers . in fig3 , components of the control logic are illustrated within the diagonally - hashed region 301 . the control logic 301 receives frames on the first and second datapaths 16 , 18 , receives frames from the upgradeable internal logic 304 , manages upgrading the upgradeable internal logic 304 , sends frame to the connectivity logic 26 , 28 on either of the first and second datapaths 16 , 18 and sends selection signals 303 to the connectivity logic 26 , 28 for controlling which frames received by the connectivity logic 26 , 28 should be output on the first or second datapaths 16 , 18 . in response to the control logic 301 receiving a frame that contains upgrade data , the control logic 301 stores the upgrade data in the memory . in some embodiments , upgrade data may be discarded and re - downloaded if , for example , the crc checksum , decryption or authentication measures fail . crc checksum , decryption and authentication logic may be provided in the upgrade logic 312 . these additional logic components may be part of verifying the authenticity of a partial upgrade command and / or upgrade data 313 before upgrading the upgradeable internal logic 304 or part of verifying the encryption of frames containing portions of the upgrade data 313 to be stored in the memory 314 . the logic gate array 302 may provide additional verification logic for verifying the entire upgrade data 313 prior to performing an upgrade . in response to the control logic 301 receiving a frame that is a partial upgrade command , the control logic disconnects the internal logic from the connectivity logic , then reprograms the internal logic from upgrade data 313 in the external memory 314 while the core logic remains running , then reconnects the reprogrammed upgradeable internal logic 304 to the connectivity logic . the control logic manages isolating the upgradeable internal logic 304 from the core logic and upgrading the upgradeable internal logic 304 while the core logic remains operational and unchanged . in the embodiment illustrated in fig3 , the control logic 301 comprises upgrade frame processing 310 , upgrade logic 312 , selection signals 303 and isolation logic which , in fig3 , comprises logic gates 316 , 318 and an associated mask signal 320 from the upgrade logic 312 . in other embodiments , isolation logic may comprise more complex masking / unmasking logic like multiple gates , multi - step state machines , buffer flushing and disabling , etc . in order to disable any control , status or data signals originating from the upgradeable internal logic 304 . the control logic 301 ensures seamless transitions in the logic gate array 302 when the upgradeable internal logic 304 is disabled and enabled . accordingly , a mask signal 320 overrides the operations of the upgradeable internal logic 304 sending data or selection signals 303 to the multiplexer logic 26 , 28 . in operation when a partial upgrade is occurring , the control logic 301 isolates the upgradeable internal logic 304 from the core logic so that the reprogramming of the upgradeable internal logic 304 , whether successful or not , does not affect the basic transceiver functionality in the core logic . isolation can be achieved through the logic gates 316 , 318 and mask signal 320 . for example , if the logic gates 316 are simple and gates , a zero - value mask signal 320 can block any data ( spurious during upgrade or otherwise ) from the upgradeable internal logic 304 . the mask signal 320 may be differently interpreted for the logic gates 318 which may force the selection signals 303 to each multiplexer 26 , 28 into a pass - through mode where the connectivity logic 26 , 28 always outputs frames of the core logic , or the mask signal 320 and the logic gates 316 may force the selection signals 303 to prevent selecting to output frames from the upgradeable internal logic 304 . in operation when a full upgrade is occurring , the control logic may also be upgraded , consequently the full upgrade is service effecting . in operation when upgrades are not occurring , the control logic 301 acts passively permitting control of the multiplexer logic 26 , 28 to be managed by the upgradeable internal logic 304 and permitting data from the upgradeable internal logic 304 to pass through logic gates 316 unimpeded . referring now to fig3 and 4 , a partial upgrade or method 400 for upgrading the upgradeable internal logic 304 is now described in greater detail . the control logic 301 includes upgrade frame processing 310 . upgrade frame processing 310 monitors incoming data on one or both datapaths 16 , 18 for frames ( which includes data on two - wire host - controlled datapaths ) related to upgrading the upgradeable internal logic 304 . incoming frames marked or tagged for upgrades are processed and terminated by the upgrade frame processing 310 . the payload of these frames is extracted and may contain commands such as triggers for a full or partial upgrade , upgrade data , locations to download upgrade data , security credentials , handshaking commands such as acknowledgment and request signals , and the like . when the upgrade frame processing 310 receives upgrade data , it stores the data in memory 314 which is contained in the transceiver 300 . when the upgrade frame processing 310 receives the location from which to download upgrade data , it schedules download of upgrade data from that location through the transceiver 300 . when the upgrade frame processing 310 receives a command to trigger a partial or a full upgrade , it may verify that the memory 314 contains the complete upgrade data 313 and verify that the proper , security clearances and authorizations have been acquired to perform the upgrade before informing upgrade logic 312 to commence the upgrade . when a partial upgrade is triggered 401 , the upgrade logic 312 sets 418 the mask signal 320 on the selection signal line to effectively disconnect the upgradeable internal logic 304 from sending data or selection signals 303 to the multiplexer logic 26 , 28 of the connectivity logic . in some embodiments , immediately disconnecting the upgradeable internal logic 304 , may be permitted ; however , the upgradeable internal logic 304 may be in the middle of outputting frames or other data , for example looping - back frames or inserting frames into one or both of the datapaths 16 , 18 . accordingly , in some embodiments , when the upgrade logic 312 receives a command from the upgrade frame processing 310 to trigger 401 a partial upgrade , the upgrade logic 312 may determine 402 if the upgradeable internal logic has loopback currently active on one of the datapaths , and if not , loopback can be immediately disabled 406 , but if loopback is active , the upgrade logic 312 waits 404 until the first possible idle period in loopback activity then disables loopback . the upgrade logic 312 also determines 408 if the upgradeable internal logic 304 is currently inserting frames such as control frames or other frames . if so , the upgradeable logic 312 waits 410 until frame insertion completes , then disables 412 the frame generation process . other data output scenarios than just looping back frames and frame insertion are also possible given that the upgradeable internal logic 304 may perform any different functions that can be programmed into it . instead of waiting 404 for the next idle period or waiting 410 for the end of the current frame , the method 400 may cleanly abort the activity of the upgradeable internal logic 304 . cleanly aborting a currently outputting frame of the upgradeable internal logic 304 includes appending a bad checksum to the last portion of the currently outputting frame so that the recipient drops the frame . in some embodiments , the decision between waiting 404 , 410 and cleanly aborting the currently outputting frame is determined based on the relative importance of the currently outputting frame . if the currently outputting frame is of greater importance , the upgrade logic 312 may wait 404 , 410 . if the currently outputting frame is of less importance , the upgrade logic 312 may cleanly abort . for example , a loopback frame that is part of a test that will shortly be interrupted would be low importance and cleanly aborted ; however , a modified service frame would be of higher importance and could cause the upgrade logic 312 to wait . once all data output scenarios from the upgradeable internal logic 304 have been disabled 414 , the isolating of the upgradeable internal logic 304 by blocking or disconnecting it may proceed . when all forms of data output from the upgradeable internal logic 304 have been safely concluded 414 , the upgrade logic 312 sets 416 the selection signals 303 to switch the multiplexer logic 26 , 28 to “ pass - through ” mode to re - enable frame forwarding with the next buffered or incoming frame to the transceiver 300 . in a simple sense , “ pass - through ” mode means the transceiver will operate as an ordinary transceiver without any of its additional functionality from the upgradeable internal logic 304 ; however , the “ pass - through ” mode may also permit frames and data from the control logic to be transmitted on the datapaths 16 , 18 . if the upgradeable internal logic 304 was not outputting data when the partial upgrade was triggered , the connectivity logic 26 , 28 may already be in a frame forwarding mode equivalent to “ pass - through ” mode . now that the upgrade logic 312 has confirmed the upgradeable internal logic 304 is not trying to output any frames , the upgradeable internal logic 304 may be isolated by driving 418 the mask signal 320 masking the data and selection signals 303 from the upgradeable internal logic 304 and effectively disconnecting and isolating the upgradeable internal logic 304 at the logic gates 316 , 318 . in this manner , the upgrade logic 312 has disconnected the upgradeable internal logic 304 from the core logic . accordingly , the core logic may continue to operate unhindered by the partial upgrade reprogramming that will be applied to the upgradeable internal logic 304 . after isolating the upgradeable internal logic 304 , the upgrade logic 312 reprograms 420 the upgradeable internal logic 304 using the upgrade data 313 stored in memory 314 , such as a reconfiguration file or an image . the upgrade logic 312 points to the upgrade data 313 in the memory 314 and triggers an upgrade in the programmable logic gate array 302 . the programmable logic gate array 302 reprograms the upgradeable internal logic 304 according to the upgrade data 313 . in some embodiments , the programmable logic gate array 302 provides feedback on whether or not the partial upgrade was successful or if an error occurred . for example , some programmable logic gate arrays have status registers to report about the upgrade process and embedded backup - and - revert functionality in case an upgrade fails . if the programmable logic gate array 302 detects that a reconfiguration error or other problem occurred while it was upgrading , the programmable logic gate array 302 may automatically revert the upgrading to a backup image . the backup image may be a default , initial or known good configuration of the upgradeable internal logic 304 , a copy made immediately prior to triggering the partial upgrade or some other image of the upgradeable internal logic 304 stored in memory 314 . where the programmable logic gate array 302 can report on the status of the upgrade but does not include this backup - and - revert functionality , the upgrade logic 312 may monitor the upgrade status and if a problem is detected , trigger another reprogramming from a newly selected upgrade data corresponding to the default , initial , known good configuration or other image . alternatively , when a problem is detected during the upgrading , the transceiver may simply continue to operate in “ pass - through ” mode and the upgrade logic 312 may send a message or otherwise indicate the problem and may disable the upgradeable internal logic 304 . when the upgrade logic 312 determines the upgrade process completed successfully , the mask signal 320 may be removed 422 and / or internal frame processing may be re - enabled 424 reconnecting the reprogrammed upgradeable internal logic 304 to the core logic . the reprogrammed upgradeable internal logic 304 may again control 426 the selection signals 303 and transmit data on either datapath 16 , 18 . embodiments of the present disclosure use specific sequencing and logic partitioning to upgrade a programmable pluggable transceiver &# 39 ; s logic gate array without affecting traffic . the control logic specifically sequences disconnecting , upgrading and reconnecting the upgradeable internal logic 304 so that the core logic may operate unaffected by the partial upgrade . logic partitioning permits the core logic to remain operational , unchanged and unaffected by the upgrading of the upgradeable internal logic 304 . remote upgrade may also be adapted in embodiments of the present disclosure to use an existing ethernet channel to carry upgrade data and commands for the control logic instead of using a dedicated programming mechanism . the datapaths 16 , 18 may also include host - controlled datapaths such as two - wire interface lines described in the msa specification for sfps for exchanging information through a host port to read and / or write data into the programmable logic gate array 302 , albeit , at slower speeds than the in - band datapaths . two - wire host interfaces include the i 2 c bus interface ( i 2 c bus trade - marked by nxp semiconductors ). where the features of the present disclosure have been described in respect of the two datapaths 16 , 18 , it is readily understood that the features of the present disclosure may equally be applied to a transceiver having only one datapath or having more than two datapaths ( such as transceiver 8 ). the memory 314 stores upgrade data 313 and may include previous , back - up , default or other images or configurations for full upgrades of the programmable logic gate array 302 or partial upgrades of the upgradeable internal logic 304 . the memory 314 may comprise any rewriteable processor or logic array readable non - transient memory that can be stored within the mechanical constraints of a programmable pluggable transceiver . in some embodiments , the memory 314 may form part of the logic gate array 302 ; however , it is generally more efficient for the memory to be external to the logic gate array 302 . the memory 314 is connected to the upgrade frame processing 310 to receive upgrade data 313 and to the upgrade logic 312 or directly to the upgradeable internal logic 304 to reprogram the upgradeable internal logic 304 . in one embodiment of the present disclosure , a pluggable transceiver for relaying frames in a packet based network is provided . the transceiver comprises a downstream data path for relaying frames in a first direction through the transceiver ; an upstream data path for relaying frames in a second direction through the transceiver ; and a reprogrammable logic gate array connected in - band through both the downstream and upstream data paths . the reprogrammable logic gate array for monitoring and testing the network from the pluggable transceiver using data loop back and control frame insertion . upgrade frame processing logic is provided within the reprogrammable logic gate array and is connected in - band in the downstream and upstream data paths . the upgrade frame processing logic is provided for identifying and processing a frame containing full or partial upgrade information . a memory is also provided in the transceiver for storing the full or partial upgrade information . upgrade logic within the reprogrammable logic gate array is connected to the frame processing logic and the memory for controlling full or partial upgrading of the reprogrammable logic gate array . the upgrade logic includes logic for : verifying the integrity of the full or partial upgrade information stored in the memory ; isolating the reprogrammable logic gate array from the downstream and upstream data paths , including : disabling data loop back , if any is active ; completing then disabling control frame insertion , if any is active ; and switching output multiplexers on each of the downstream and upstream data paths to a pass - through mode . in response to isolating the reprogrammable logic gate array , the upgrade logic triggers partially upgrading the reprogrammable logic gate array from the partial upgrade information stored in the memory . in response to partially upgrading the reprogrammable logic gate array , the upgrade logic reconnects the upgraded reprogrammable logic gate array to the downstream and upstream data paths including : re - enabling data loop back ; re - enabling control frame insertion ; and releasing the pass - through mode of the output multiplexers on each of the downstream and upstream data paths . in some embodiments of the present disclosure , multiple upgradeable internal logic sections may be provided in the programmable logic gate array 302 . the upgrade logic 312 , could select one or several of the sections to upgrade while the other upgradeable internal logic sections are kept running in some embodiments of the present disclosure , the programmable logic gate array 302 is connected to the datapaths 16 , 18 and not connected inline through the datapaths 16 , 18 . accordingly , the programmable logic gate array 302 may monitor or inspect traffic on the datapaths 16 , 18 . in such embodiments , the core logic of the transceiver 300 may remain in the programmable logic gate array 302 or it may be extracted from the programmable logic gate array 302 and , for example , be hardwired in the transceiver 300 . hardwiring the core logic is less advantageous because it cannot be upgraded by a full upgrade of the programmable logic gate array 302 ; however it is advantageous because it cannot be corrupted by any upgrade of the internal logic . where features of the present disclosure have been described as different embodiments , it is understood that a single embodiment may combine any number of these features unless the present disclosure indicates otherwise . | 7 |
fig1 shows an x - ray machine suitable for obtaining stereographic x - ray negatives of the breast . like any other x - ray machine , this machine includes an x - ray tube 1 emitting x - rays along a main axis 2 towards a breast 3 to be x - rayed , which breast is supported on a support tray 4 . the tray 4 is fixed to a frame 5 of the machine . after passing through the breast 3 , the x - rays produce an image on a photosensitive plate 6 placed in a cassette 7 . the cassette is held in place relative to the x - ray tube 1 . a stereographic breast x - ray machine is also capable of making an image at different locations , on the same plate 6 , e . g . on the left 8 or on the right 9 depending on whether the x - ray tube 1 is in a first orientation 10 or a second orientation 11 relative to the breast 3 . these different orientations are made possible by carrying the tube 1 on a boom which rotates about a center of rotation . the images of the breast 3 are then projected respectively at locations 12 and 13 on the plate 6 . on the basis of the two images 12 and 13 which are thus preferably to be found side by side on a single negative , and which correspond to a known difference of angle of incidence 14 , it is possible to point to matching characteristic regions , respectively 15 and 16 , in each of these images and to use a computer to determine the position in three dimensions ( e . g . above the breast - supporting tray 4 ) of a portion of the breast 3 whose shadows correspond to said matching regions . under these conditions , it is possible to use a needle - carrying tray 17 including a biopsy needle 18 driven by a motor 19 to insert the needle into the breast 3 at the particular location from which tissue is to be taken for the purpose of analysis . fig2 shows a light box implementing the invention . the special feature of the light box of the invention is that it includes a graphics screen 20 which , in the preferred embodiment , comprises a transparent slab 21 placed over a plane grid 22 of light - emitting diodes ( leds ). the graphics screen 20 is controlled by a microprocessor 23 so that all of the leds in the grid 22 emit light . when the screen 20 is a plasma screen or a cathode ray screen , then the microprocessor generates a video signal such that all of the points on the screen are illuminated prior to any index marks being put into place . a control box 24 is coupled to the microprocessor and has a set of knobs such as 25 to 28 for enabling one of the available index marks , e . g . i 25 , to be selected . once selected , the index marks i 25 to i 28 can be moved over the surface of the screen 20 by means of a set of potentiometers 29 and 30 for controlling x and y displacements . the control box 24 is shown here merely by way of example . in particular , it may comprise control means which are more ergonomic , for example a mouse or a trackball . when the control box 24 is manipulated , instructions are sent to the microprocessor which cause it to display an index mark . as it does this , the microprocessor naturally stores in its memory the addresses of the positions of the index marks in terms of x and y offsets relative to a reference mark 31 on the screen . thereafter , given the pitch of the image points ( pixels ) on the graphics screen , it is easy to compute the co - ordinates of the positions of these index marks . the accuracy of the device of the invention depends only on the linearity of the pixel pitch . the resolution with which the index marks can be put into place depends only on the pixel pitch of the graphics screen itself . for a given graphics screen , these two parameters are fixed by construction . given the production technology for graphics screen masks , these positions are thus very accurate and easily reproducible from one screen to another . in one example , using 10 cm × 20 cm screens , suitable for stereotaxy in mammography , it is easy to find screens having a pixel pitch of about 0 . 25 mm to 0 . 3 mm . this is sufficiently accurate . it can immediately be seen that a device made in this way cannot go out of adjustment . its accuracy is obtained by construction and not by ( frequently repeated ) adjustments of a mechanical linkage . in addition , there is no wear , and thus very little maintenance , thereby ensuring that the apparatus is very reliable . finally , the falling prices of electronic components make it possible to anticipate production costs which are considerably lower than present costs . however using a graphics screen together with a microprocessor also provides much greater operator comfort . in particular , a character generator 34 can be used for distinguishing various types of associated pairs of corresponding index marks . for example , index marks i 25 and i 26 may be represented by small crosses , whereas index marks i 27 and i 28 may be represented by small crosses within respective circles . it can immediately be seen that by selecting a different type of character in this way , the index marks can be associated in as many pairs as desired , and also that by using a microprocessor associated with a graphics screen , it is possible to displace the index marks without worrying about possible mechanical linkage overlaps . the characters displayed as index marks may also be distinguished from each other by brightness : e . g . by being brighter than the background . they may also be distinguished by color , if the graphics screen is a color screen . an index mark may therefore correspond to a single pixel or to a plurality of pixels on the screen . similarly , by reserving a region 32 at the periphery of the screen 20 , the character generator can be used to write messages such as &# 34 ; confirm pointing &# 34 ;, thereby informing the operator who is manipulating the control box 24 how to perform the next expected operation . in addition , the light box of the invention makes all sorts of improvements possible . for example , the positioning of the film 6 on the surface of the slab 21 can be replaced by injecting a digital representation of the image of the film 6 . transforming an x - ray image into a digital image is common practice . the digital image can then be stored via the microprocessor 23 in an image memory 33 . the image memory 33 is read by the microprocessor 23 and is displayed on the graphics screen 20 simultaneously with its display of the index marks i 25 to i 28 . as mentioned above , it is known how to perform the processing required for computing the co - ordinates of a lesion . the microprocessor 23 may be capable of running a program 35 for performing this processing . when processing is completed , it can deliver data representative of the position in three dimensions of the point specified by combined examination of the two stereographic images together . this information may be displayed on a display monitor 36 . this information may also be used for controlling the motor 19 for displacing the biopsy needle 18 . in order to make this chain more effective , the film 6 contained in the cassette 7 may be replaced by an x - ray image intensifier screen . the video signal delivered by this intensifier screen can be processed and transformed into a digital image which can be displayed directly on the graphics screen 20 . the operator who performs the stereographic examination can then manipulate the control box 24 to inform the microprocessor 3 of the corresponding positions of the points to be treated . the microprocessor 23 then runs the program 35 and can control the motor 19 , almost in real time . this can accelerate therapy which a patient always finds arduous . | 0 |
the present invention now will be described more fully herein with reference to the accompanied figures , in which embodiments of the invention are shown . this invention may , however , be embodied in many alternate forms and should not be construed as limited to the embodiments set forth herein . accordingly , while the invention is susceptible to various modifications and alternative forms , specific embodiments thereof are shown by way of example in the drawings and will herein be described in detail . it should be understood , however , that there is no intent to limit the invention to the particular forms disclosed , but on the contrary , the invention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as defined by the claims . like numbers refer to like elements throughout the description of the figures . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ” used in this specification do not preclude the presence or addition of one or more other selectivity features , steps , operations , elements , components , and / or groups thereof . and the term “ and / or ” includes any and all combinations of one or more of the associated listed items . unless otherwise defined , all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms defined in commonly used dictionaries will not be interpreted in an idealized or overly formal sense unless expressly so defined herein . to attain the objectives of the invention , the invention provides method for producing surface enhanced raman spectroscopy ( sers ) substrate having at least one metal nanopillar structure . the method first involves on the rotating substrate making metal nanopillar structure and / or dielectric nanopillar structure by oblique angle deposition technique collocating with rotating substrate . the nanopillar structure has a configuration in which the nanopillar structure is about parallel to the substrate &# 39 ; s normal line . in the electron gun evaporation system , as shown in fig1 , the invention utilizes oad ( oblique angle deposition ) collocating with rotating substrate , forming multiple silver nanopillars structure 106 of structure diameter d and height ( or thickness ) l on silicon wafer substrate 101 ( or 107 ) or glass substrate 101 ( or 107 ). oblique angle deposition technique is a physical vaporization deposition by which , during the formation of membrane deposition , the substrate 101 in the electron gun evaporation system is tilted by a deposition angle θ v of substrate normal line with respect to the incoming vapor flux . in the initial deposition , the random nucleation centers are formed on the substrate and the later deposited flux causes preferential growth of nanopillars towards the direction of deposition due to the influence of shadowing effect . incoming evaporation deposition source 102 ( flux ) will impinges obliquely through various different directions making nano structure , during the growing process , orients to the substrate normal line z . and the nanopillars 106 ( d , l ) are then formed . in other words , while oblique angle deposition , the substrate 101 rotates along the rotation axis 100 , and the rotation direction is denoted as 103 . in the meanwhile , the evaporation flux comes in along the incoming direction 105 , wherein the deposition angle is θv . in a preferred embodiment , the manufacturing parameters are ( a ) deposition angle is between 0 ˜ 90 degree , and / or ( b ) deposition speed is between 0 . 01 nm / s ˜ 100 nm / s , and / or ( c ) substrate rotation speed is between 0 . 01 rpm ˜ 1000 rpm . as shown in fig3 ( a ), fig3 ( b ), fig3 ( c ), fig3 ( d ), fig3 ( e ), fig3 ( f ) respectively , the nano - pillars structure configuration may be ( a ) metal nanopillar 301 / substrate 302 , or ( b ) metal nanopillar 303 / dielectric nanopillar 304 / substrate 305 , or ( c ) metal nanopillar 308 / dielectric nanopillar 307 / metal nanopillar 306 / substrate 309 , or ( d ) a first metal material nanopillar 310 / a second metal material nanopillar 311 / substrate 312 , or ( e ) metal nanopillar 313 / dielectric nanopillar 314 / metal nanopillar 315 / dielectric nanopillar 316 / substrate 317 , or ( f ) metal nanopillar 318 / metal nanopillar 319 / periodical structures of seed layer 320 / substrate 321 . or , it also can be ( g ) metal nanopillar / dielectric nanopillar / periodical structures of seed layer / substrate ( not shown ). the metal nanopillar 318 , or 319 may be nanopillars of identical or distinct metal material . the metal material is selected from a group consisting of group of material capable of enhancing raman signals including gold ( au ), silver ( ag ), copper ( cu ), aluminum ( al ), lithium ( li ), palladium ( pd ), and platinum ( pt ). the nanopillars structure is made on substrate of periodical or nonperiodical structures , or periodical structures of seed layer / substrate . therefore the substrate 101 , 107 , 302 , 305 , 309 , 312 , 317 , 321 might be substrate which is flat or has periodical patterns . the seed layer 320 is selected from a group consisting of dielectric or photo resist material . the substrate 101 , 107 , 302 , 305 , 309 , 312 , 317 , 321 might be selected from a group of good adhesive property materials to metal / dielectric consisting of silicon wafer , acrylic ( pmma ), glass , pet , al2o3 , pc etc . the metal or dielectric nanopillar structure has following properties : ( a ) nanopillar diameter ( d ): 10 nm ˜ 1 . 5 μm , ( b ) distance of center to center of two adjacent nanopillars : 10 nm ˜ 1 . 5 μm , ( c ) total height of pillar : 10 nm ˜ 5 μm . from the above recitations , it is known that a surface enhanced raman spectroscopy ( sers ) sensing substrate produced includes a substrate ; at least one single layer of metal nanopillar structure formed on the substrate , the nanopillar structure has a configuration in which the nanopillar structure is about parallel to the substrate &# 39 ; s normal line . the configurations are illustrated in fig3 ( a ), fig3 ( b ), fig3 ( c ), fig3 ( d ), fig3 ( e ), or fig3 ( f ). the raman instrumentation embodied by above methodology includes ( a ) irradiation source ; ( b ) raman sensor including the above mentioned sensing substrate as shown in fig3 ( a ), fig3 ( b ), fig3 ( c ), fig3 ( d ), fig3 ( e ), fig3 ( f ); and ( c ) detector . wherein the raman sensor generates localized plasmonic field after being exposed by the irradiation source , and the plasmonic field enhances raman signals of the specimen to be sensed . the above irradiation source might be laser devices capable of producing single mode wavelength , which includes solid state - laser , semiconductor ( diode ) lasers , he — ne laser , and gas laser . the fig3 ( a ) is used again for following reiterations . in an exemplified manufacturing process , the silver particles of 3 mm diameter of purity 99 . 999 % are adopted as evaporation source 102 and the electron beam gun evaporation system is maintained at base pressure of 4 × 10 − 6 pa . during deposition , the substrate is rotated about the axis of substrate normal line at a constant speed . the lengths of the pillars are controlled by using a quartz thickness monitor placed next to the substrate . the deposition rate is maintained and the deposition angle is kept at θ v . fig2 ( a ), ( c ), ( e ), ( g ) are respectively the top view diagrams taken by scanning electron microscope ( sem ) for deposition speed = 1 . 2 nm / s , θ v = 89 degrees , collocating with four types of substrate rotation speed of 20 rpm , 10 rpm , 1 rpm and 0 . 1 rpm , wherein in fig2 ( a ), ( c ), ( e ) nanopillar l = 120 nm , and in fig2 ( g ) the nanopillar is l = 250 nm . fig2 ( b ), ( d ), ( f ), ( h ) respectively shows , at deposition speed = 1 . 2 nm / s , θ v = 89 degrees collocating with four rotation speeds of substrate 20 rpm , 10 rpm , 1 rpm and 0 . 1 rpm , the corresponding distribution of nanopillar diameter d . from fig2 ( b ), ( d ), ( f ), it is found that while the deposition speed is unchanged , lowering of substrate rotational speed will result in the distribution of diameter d of nanopillars moving to direction of larger dimension . in addition , increase of nanopillar &# 39 ; s height l ( fig2 ( g )) also results in larger of diameter d of nanopillar . other than single layer of metal nanopillar , pillars of different materials may be formed in a stack by same process . as shown in fig3 and above recitations , the substrate 302 ( or 305 , 309 , 312 , 317 , 321 ) might be substrate having periodical structure patterns , the dimensions of seed layer 320 and substrate of periodical structure are in nano - scale as well . other than the substrate , this configuration may further extend to a configuration which is formed by further upward periodical stacks . fig4 ( a ) shows the top view diagram taken by sem on the specimen of single layer of silver nanopillars of l = 230 nm obtained by process under the deposition speed 1 . 2 nm / s , θ v = 89 degrees collocating with rotational substrate speed of 10 rpm . fig4 ( b ) shows diameter d distribution of single layer of silver nanopillars . fig5 and fig6 respectively shows the transmissivity ( t ), reflectivity ( r ) and adsorbtivity ( a ) spectroscopy for structure of fig4 while x polarized incidence light and y polarized incidence light are respectively used . from fig5 and fig6 , the spectroscopy property of this single layer of silver nanopillar structure is not correlated with polarization , wherein the adsorbtivity ( a ) exceeds 78 % in range of 400 nm ˜ 850 nm . fig7 shows raman spectroscopy at different locations ( p0 , p1 , p2 , p3 ) of surface while configuration of fig3 ( a ) is used as sers substrate . the 532 nm laser of 100 mw is used for the excitation light source , the measurement are made at above locations for rhodamine ( r6g ) of 10 − 4 m concentration . in particular , the excitation light source laser has light - spot size of 1 μm over the nano structure . rhodamine can be obtained by diluting of de - ionized water to needed 10 − 4 m concentration . the p0 distribution is raman spectroscopy of reference point , the p1 distribution is raman spectroscopy for location distant from the reference point p0 by 100 μm , the p2 distribution is raman spectroscopy for location distant from the reference point p0 by 200 μm , the p3 distribution is raman spectroscopy for location distant from the reference point p0 by 2000 μm . from fig7 , compared to raman spectroscopy of silver aligned nanopillar arrays , it is observed that the raman signals of the silver nanopillars shown in fig3 ( a ) configuration are stronger than that of the silver aligned arrays . in the followings , the triple layers of metal 306 / dielectric 307 / metal 308 / substrate 309 shown in fig3 ( c ) is used for explaining the advantage or benefit of the invention . fig8 ( a ) shows the top view diagram taken by sem on the specimen of single layer of silver nanopillars of l = 250 nm obtained by process under the deposition speed 1 . 2 nm / s , θ v = 89 degrees collocating with rotational substrate speed of 10 rpm . fig8 ( b ) shows diameter d distribution of single layer of silver nanopillars . fig9 and fig1 respectively shows the transmissivity ( t ), reflectivity ( r ) and adsorbtivity ( a ) spectroscopy for structure of fig8 ( a ) while x polarized incidence light and y polarized incidence light are respectively used . from fig9 and fig1 , the spectroscopy property of this single layer of silver nanopillar structure is not correlated with polarization , wherein the adsorbtivity ( a ) exceeds 57 % in range of 400 nm ˜ 850 nm . fig1 shows raman spectroscopy at different locations ( s0 , s1 , s2 ) of surface while configuration of silver nanopillar / sio 2 nanopillar / silver nanopillar multiple layers of is used as sers substrate . the 532 nm laser of 100 mw is used for the excitation light source , the measurement are made at above locations for rhodamine ( r6g ) of 10 − 4 m concentration . in particular , the excitation light source laser has light - spot size of 1 μm over the nano structure . rhodamine can be obtained by diluting of de - ionized water to needed 10 − 4 m concentration . the p0 distribution is raman spectroscopy of reference point , the p1 distribution is raman spectroscopy for location distant from the reference point p0 by 100 μm , the p2 distribution is raman spectroscopy for location distant from the reference point p0 by 200 μm . from fig7 , compared to raman spectroscopy of tilting silver nanopillars array , it is observed that stronger and stable sers signals are resulted by nanopillars structure shown in fig3 ( c ) configuration . the scope of protection is limited solely by the claims , and such scope is intended and should be interpreted to be as broad as is consistent with the ordinary meaning of the language that is used in the claims when interpreted in light of this specification and the prosecution history that follows , and to encompass all structural and functional equivalents thereof . | 8 |
the present invention is directed towards a solid state controller for a cooking appliance . this controller provides the electronic control of cooking temperature while also providing visual and / or audio indication of trouble situations . furthermore , in certain trouble situations the controller provides corrective action . the controller is intended to provide accurate temperature control and high reliability at a low cost . a block diagram of this invention is illustrated in fig1 . the user provides a temperature input via block 19 that consists of temperature adjust information . this input is the designated temperature for cooking or the set temperature . this information is input into block 18 which represents the gas valve control circuitry . the gas valve control circuitry compares the set temperature with the actual cooking temperature provided by the temperature probe 10 input through the temperature sense circuit 12 . if there is a difference between the set temperature and the temperature sensed then the gas valve 20 is adjusted accordingly . in the preferred embodiment the user may control the cooking temperature between the values of 200 ° f . to 375 ° f . in a preferred embodiment , the controller is fabricated for use with a gas fired deep fat fryer in which the cooking medium is cooking oil or shortening . in that application a melt cycle is provided to allow for the proper melting of a shortening or cooking oil in the cooking appliance . the melt timing cycle is five seconds with heat on and twenty seconds with heat off . this melt cycle is provided by the melt cycle circuitry 15 of the controller in fig1 . the melt cycle is initiated by the user from the melt cycle switch 21 or if the temperature of the cooking oil in the cooking appliance falls below a low limit temperature . the controller display 17 displays the presence of power , the presence of a heat signal to the gas valve , an indication of either the melt cycle or the occurence of the second high temperature limit , and a general trouble indication . in the preferred embodiment , the trouble indication represents the existence of a high temperature condition or the absence of the pilot light flame which is provided by the flame indicator 11 through the flame monitor circuit 13 . the power supply for the controller 14 provides in the preferred embodiment a dc ( direct current ) voltage of 12 volts . fig1 a is a pictorial view of a cooking appliance including a cooking vat 82 containing cooking oil 81 . vat 82 includes the temperature probe 10 to sense the temperature of the oil 81 . the vat 81 is heated by flame 11 from a gas line 83 controlled by valve 20 and including flame monitor 13 . a partial schematic of the controller of fig1 is illustrated in fig2 a . referring to fig2 a , a precision voltage divider is provided by resistences r6 , r5 , r4 , r3 , r2 , and r1 that are connected between the regulated power supply voltage and the circuit ground . in the preferred embodiment the value of these resistences are selected to correspond to the resistance of a temperature probe at the selected control temperatures of a 135 ° f ., 200 ° f ., 375 ° f ., and 410 ° f . the temperature probe 10 of fig1 is illustrated as the temperature sensing resistor 53 connected across the filter compacitor c7 in fig2 a . the temperature probe resistor 53 and compacitor c7 are connected to a constant current source consisting of a field effect transistor q2 and an operational amplifier 51 . this circuit configuration insures that the same current that flows through the temperature probe 10 is the same as the current that flows through the precision voltage divider network of resistors r1 through r6 previously discussed . the gas valve control circuitry 18 of fig1 is illustrated in fig2 a as including the operational amplifier 55 , the light emitting diode ( led ) cr15 ( the heat indicator ) and the regulating transistor q1 that is connected to the gas burner valve 20 ( of fig1 ). this circuitry senses the difference between the temperature probe resistor 53 and the temperature designated from potentiometer r27 to operate the burner valve according , unless overridden by a high limit test switch . the temperature potentiometer r27 is adjusted by the user to select a cooking temperature between 200 ° and 375 ° f . the gas valve control circuitry 18 also includes a temperature rate of change anticipation circuit . the anticipation circuit is provided to accurately maintain the temperature when the temperature of the cooking appliance is being altered over a wide temperature range . such a temperature adjustment would occur during melt cycle or when food that is to be cooked is placed into or removed from the cooking appliance . the problem arises when heat is applied to the cooking appliance to compensate for a lowering of temperature caused by the uncooked food being placed in the appliance for cooking . the temperature normally rises after a time delay from the time that the heat is applied . once the set point temperature is reached and the heat is removed the temperature lag time results in the temperature continuing to rise and overshooting the set temperature point . the anticipation circuit in the present invention prevents the overshoot by modulating the amount of heat that is added to the cooking appliance when the set point is approached . this modulation is , in fact , the turning off and on of heat as the temperature approaches the set temperature point . therefore , abrupt changes in the temperature of the cooking appliance can be moderated . in fig2 a the temperature rate of change anticipator circuitry includes operational amplifier 52 which is connected to the gas valve controller operational amplifier 55 . operational amplifier 55 is connected to the network of r26 , r21 , and c1 . this network in combination with the feedback resistor r14 effectively lowers the set temperature input to operational amplifier 55 causing the gas valve to cut off before the actual set temperature is reached . operational amplifier 52 starts the intermittent operation of the gas valve through operational amplifier 55 from the time constants of the network of r19 , r20 , c5 and c6 . this intermittent operation continues until the actual set temperature is reached . the result of the operation of this ancipation circuitry is that the rate of temperature change is variably reduced at as the temperature measured approaches the actual set temperature . the timing network of resistors r19 and r20 capacitors c5 and c6 are also included to provide for a minimum burn time . in the preferred embodiment , resistor r19 is 10m ohms and resistor r20 is 100k ohms and capacitor c5 and c6 are of 1 microfarid to provide a 10 second minimum burn time . the melt cycle circuitry is provided by operational amplifier 57 and the connected components . the melt cycle circuitry is basically a user selectable timer consisting of a square wave oscillator including components r11 , r12 , cr6 , and c2 . the melt cycle circuitry provides for an intermittent operation of the gas burner valve . in the preferred embodiment , the gas burner valve is on for five seconds and off for twenty seconds . c2 and r11 provides the off time of twenty seconds and c2 , r11 , r12 , and cr6 provide the on time of five seconds . this cycle remains constant while the melt cycle timer is active . additionally , operational amplifier 56 is provided to shut off the melt cycle timer when the temperature probe detects that the temperature has reached a 180 ° f . in the melt cycle mode diode cr7 controls the gas valve controller operational amplifier 55 . operational amplifier 54 is provided as part of the trouble detection circuitry 16 in fig1 . operational amplifier 54 provides a signal to the trouble light emitting diode cr14 when the temperature sensed by the temperature probe exceeds 410 ° f . furthermore , operational amplifier 54 is connected by diode cr8 to the input of the operational amplifier 52 to turn off the gas control circuitry when the temperature of 410 ° f . has been reached . fig2 b illustrates the flame monitor circuit 13 of fig1 . the flame monitor circuitry 13 includes an operational amplifier 63 that is connected to the pilot light thermocouple ( not shown ). the thermocouple input is on terminal 64 and is compared with the voltage provided by the voltage divider network of r22 and r25 . an output from operational amplifier 63 indicates that the pilot flame has been extinguished or in a system that is equipped with an ignitor that the ignitor has been locked out . the output of operational amplifier 63 includes line 61 that is connected to the trouble light emitting diode cr14 through cr10 ( shown in fig2 a ) and also to cr5 of the circuit in fig2 c . fig2 c illustrates a partial schematic of the controller circuitry that includes the input from the flame monitor circuit 13 on line 62 as discussed . in addition , line 65 originates from a switch s1 shown in fig2 d and connects to switch s2 which provides for one of two options . the first option provides the user with the ability to terminate the melt cycle . the second option provides a second high temperature limit indication and the means to force the burner to heat through both high temperature limits . in the first option r8 and r29 are provided and diodes cr5 and cr16 together with resistor r30 are excluded . in the first option the melt cycle is terminated when the line 65 is connected to node 66 from node 67 . note that in the melt cycle mode when line 65 is connected to node 67 that the light emitting diode 68 is illuminated to signify the melt cycle . in the second configuration or the second high limit indication , resistors r8 and r29 are removed and diodes cr5 , cr16 and resistor r30 are provided . the second high limit option provides an indication when the temperature of the cooking appliance exceeds 425 ° f . also included in fig2 c is the diode cr12 which provides the indication when power is present . power is provided to the system by the power supply 14 of fig1 illustrated in the schematic form in fig2 d . an alternating current source is provided on lines 70 and 71 to the full wave bridge rectifier circuit consisting of diodes cr1 , cr2 , cr3 , and cr4 . a filter capacitor c3 and a voltage regulator 66 is provided with bypass capacitors c4 and c11 . in the preferred embodiment , the voltage regulator is a 12 volt regulator which will operate in voltages ranging from 10 - 16 volts rms with 12 volts rms the nominal point . voltage for appliance switching relays is taken at node 72 and provided to vrel . the regulated voltage is provided at node 73 which when switch s1 is set , provides the voltage to line 65 previously discussed . in the preferred embodiment the temperature controller is part of a deep fat apparatus consisting of a vat containing cooking oil that is heated by a natural gas combustion controlled by a gas burner valve . the controller provides an output from q1 that controls the burner valve and thus controls the amount of heat provided to the cooking oil . although the preferred embodiment has been disclosed in detail above in terms of a deep fat fryer , it should be obvious to one skilled in the art that applications to an electric deep fat fryer or other cooking appliances such as gas or electric ovens are also appropriate . it maybe then appropriate that various modifications and changes may be made to the instant invention without departing from the spirit and the scope of the invention . | 0 |
fig1 , and 3 illustrate a rear - opening , rigid - shelled ski boot 1 provided with an internal foot retainer comprising transverse tongues ( 3 ), ( 3 &# 39 ;) for holding the foot in place . said transverse tongues ( 3 ), ( 3 &# 39 ;) are connected to shell base ( 6 ) on each of its inner sides ( 7 ), ( 7 &# 39 ;) and extend over both sides of the skier &# 39 ; s foot ( 8 ), more or less covering the top of the foot . according to the invention , the tongues ( 3 ), ( 3 &# 39 ;), considered in the longitudinal direction of the boot ( 1 ), lie between two secant planes ( 9 ) and ( 10 ) that intersect the plane ( 11 ) of the sole ( 12 ) of the boot . fig1 shows that said planes ( 9 ) and ( 10 ) pass through the foot at the heads of the malleolian bones ( 13 ), ( 13 &# 39 ;) and of the metatarsal bones ( 14 ), ( 14 &# 39 ;), respectively in this embodiment of the invention , tongues ( 3 ), ( 3 &# 39 ;) can be drawn down with respect to the corresponding wall of the shell base ( 6 ) beyond a delimiting line ( 15 ), ( 15 &# 39 ;), below which the bony areas of the calcaneum ( 16 ) and the metatarsal heads ( 14 ), ( 14 &# 39 ;) of the foot ( 8 ) are housed within said shell base ( 6 ), such that said tongues ( 3 ), ( 3 &# 39 ;) exert no tightening effect on said bones . fig3 is a schematic representation , along plane ( 10 ), of the contour ( 18 ) of the foot showing the position of the heads of the first metatarsal bone ( 14 ) and of the fifth metatarsal bone ( 14 &# 39 ;) with respect to the corresponding lines of delimitation ( 15 ), ( 15 &# 39 ;). it will be noted that these lines are located at different distances above the plane of the sole (- 2 ) and correspond essentially to the positions of each of the external metatarsal heads of the foot . the connection of the tongues ( 3 ), ( 3 &# 39 ;) to the shell base ( 6 ) welding , stitching , or some other fastening means . in the construction of the boot ( 1 ), the shell of the boot consists of three major rigid parts : an oversleeve ( 20 ) and a rear cover ( 21 ), which together constitute the boot upper ( 19 ), and a lower section , or shell base ( 6 ), which contains the elements which form the object of the invention and which have just been described . an axis ( 22 ) consisting in practice of rivets serves as a hinge for the rear cover and / or the oversleeve . known means ( see fig1 ) for adjusting tongues ( 3 ), ( 3 &# 39 ;), such as lacing , tension buckles , etc ., are provided on the exterior of the boot in order to enable the free ends of said tongues ( 3 ), ( 3 &# 39 ;) to be drawn down against the top of the foot , as shown in fig3 by the direction of the arrows ( 23 ), ( 23 &# 39 ;), thereby ensuring the actual retention of the foot . fig4 through 6 illustrate various embodiments of the connection of a tongue to the sides of the shell base . in these figures , each tongue consists of an extension of the material forming the surface of the shell base into the space formed by the latter . thus , in the example of fig4 tongues ( 25 ), ( 25 ) and formed and emerge beyond delimitation lines ( 15 ) and ( 15 &# 39 ;), respectively . said lines ( 15 ), ( 15 &# 39 ;) divide the lateral walls of the shell base ( 6 ) into two longitudinal sections of which the one ( 26 ), ( 26 &# 39 ;), adjacent to sole ( 12 ) is designed to house the base of the foot in a rigid enclosure capable of withstanding the directional forces of skiing , while the other ( 27 ), which joins lines ( 15 ) and ( 15 &# 39 ;) above the foot , is designed to envelop the top of the foot and , if necessary , to share in absorbing the stresses exerted on the boot top by the bending movements of the skier &# 39 ; s leg . advantageously , the upper section ( 27 ) is also non - deformable but divides above said lines ( 15 ), ( 15 &# 39 ;) into two lateral portions forming said transverse tongues ( 25 ), ( 25 &# 39 ;). the tongues are made of the same material as the walls of the shell base ( 6 ) but are generally thinner than sections ( 26 ) and ( 27 ) of the shell base in order to enable them to bend and / or to conform to the top of the foot under the effect of an actuating means . in fig5 a constructional variant shows the tongues ( 28 ), ( 28 &# 39 ;) that likewise consist of an extension of material within a shell base ( 30 ) above drop lines ( 15 ) and ( 15 &# 39 ;). the bending and flexing capacity of said tongues ( 28 ), ( 28 &# 39 ;) with respect to the wall ( 29 ), ( 29 &# 39 ;) of said shell base ( 30 ) is obtained in this embodiment through grooves ( 31 ), ( 31 &# 39 ;) that constitute a zone of articulation on each of the inner walls ( 32 ), ( 32 &# 39 ;) of the lower , rigid section of the shell base . in fig6 the shell base ( 33 ) comprises tongues ( 34 ), ( 34 &# 39 ;) which consist , as in the construction shown in fig4 of extensions of the material of walls ( 35 ), ( 35 &# 39 ;) of the shell base above drop lines ( 15 ), ( 15 &# 39 ;). however , in fig6 the ends ( 36 ) ( 36 &# 39 ;) of the tongues ( 34 ), ( 34 &# 39 ;) extend toward each other and partially overlap . the embodiment shown in fig7 involves a shell base ( 37 ) comprised of two parts ( 38 ) and ( 39 ). the lower part ( 38 ), ( 38 &# 39 ;) comprises tongues ( 40 ), ( 40 &# 39 ;), while the upper part ( 39 ) forms a rigid closable cover . the two shell pieces are joined by assembly means consisting of snap - in edges ( 41 ), ( 41 &# 39 ;) cooperating with grooves ( 42 ), ( 42 &# 39 ;) of complementary shape formed in parts ( 38 ) and ( 39 ), respectively . preferably , the area of the seam is in the immediate proximity of drop lines ( 15 ), ( 15 &# 39 ;), thus delimiting the bend zone of the transverse tongues as an area of reduced thickness ( 43 ), ( 43 &# 39 ;). to meet the operational needs of this internal foot - retention system , the tongues are thin enough to ensure good flexibility , thereby facilitating their conformation to the shape of the top of the foot . fig8 illustrates a variant of the internal foot - retention means which applies to a shell base ( 44 ) having only one tongue ( 45 ). the latter extends far enough to cover , at least partially , the upper surface ( 46 ) of the foot . obviously , tongue ( 45 ) yields to the effect of the tightening means only with respect to wall ( 47 ) of the shell base ( 44 ). here , too , the drop line ( 15 ) above which tongue ( 45 ) may bend is located at a level that is noticeably higher than that of the heads of the metatarsal bones ( 14 ), ( 14 &# 39 ;). again with respect to a design involving a single tongue ( 55 ), fig9 illustrates a variant along the lines of fig7 in which the shell base ( 48 ) is constructed of two parts . in this case , the top cover ( 49 ) is articulated at one side ( 52 ) of the lower section ( 50 ) of said she ) 1 bottom adjacent to sole ( 12 ). the articulation is effected by means of a hinge ( 51 ). a catch device ( 53 ) or the like is provided on the other side ( 52 &# 39 ;) of the lower section of the shell base so as to snap over a rim ( 54 ) forming the edge of cover ( 49 ) and so lock said cover over the skier &# 39 ; s foot . however , the invention is not limited to tongues that are connected to the shell base through a molded extension of a piece with the sides of the shell base . embodiments also exist using various means of assembling said transverse tongues within the shell base . fig1 shows one such system for anchoring the tongues in which a sort of hinge is formed along the drop lines ( 15 ), ( 15 &# 39 ;) that separate the flexible tongues from the shell base . in this case , tongues ( 58 ), ( 58 &# 39 ;) are connected to the shell base ( 60 ) by means of cylindrical stops ( 61 ), ( 61 &# 39 ;) functioning in conjunction with correspondingly shaped recesses formed in each of the walls ( 66 , 66 &# 39 ;) of said shell base . at the bottom of said recesses , which are provided with seals ( 63 ), ( 63 &# 39 ;), are slots ( 59 ), ( 59 &# 39 ;) sized to match the thickness of the tongues so that said tongues may be removably inserted into the shell base from the outside of the boot . in order to limit the insertion of the tongues into the shell , the slots must obviously be smaller than the recesses into which the cylindrical stops may be clipped and from which they may be removed , thus allowing interchangeability if repairs are needed . advantageously , the slots will be formed at a certain angle so as to guide insertions into the shell base in such a way that , when at rest , the tongues will be oriented upward within the shell base . so arranged , the tongues ( 58 ), ( 58 &# 39 ;) are provided with a certain degree of mobility in the direction of the top of the foot , as indicated by arrows ( 65 ). in this example , the drop line ( 64 ), ( 64 &# 39 ;) of the tongues may be located above the limit line ( 15 ), ( 15 &# 39 ;) below which lie the heads of the metatarsal bones ( 14 ), ( 14 &# 39 ;). fig1 illustrates a shell base ( 67 ) consisting of two sections : a lower portion ( 68 ), ( 68 &# 39 ;) and an upper portion or cover ( 69 ). seal lips ( 70 ), ( 70 &# 39 ;) are formed from extensions of the sides of the lower section ( 68 ), ( 68 &# 39 ;) and cooperate with cover ( 69 ). a seal ( 71 ), ( 71 &# 39 ;) placed at the joint between the two lower sections ( 68 ), ( 68 &# 39 ;) and the cover ( 69 ) of the shell base reinforces its leakproof qualities and / or the strength of the assembly . in this example , the tongues ( 72 ), ( 72 &# 39 ;) are connected to the lower section ( 68 ), ( 68 &# 39 ;) of the shell base and are fastened to it by various assembly means known per se and hence omitted from the drawing for the sake of clarity . according to the invention , the tongues adhere to the inner wall of the shell base at least up to the drop line ( 73 ), ( 73 &# 39 ;), which be coextensive with or offset from the line ( 15 ), ( 15 &# 39 ;) delimiting the rigid zone that houses the heads of the bones ( 14 ), ( 14 &# 39 ;) of the foot which serve as points of reference for the structure which is the object of the invention . fig1 to 16 illustrate various embodiments of the tongues as well as several possible arrangements of the latter along a drop line extending laterally along various types of ski boot shell bases . in fig1 each side of the shell base ( 74 ) comprises three tongues ( 75 ), ( 75 &# 39 ;) situated , in the longitudinal direction of the boot , between planes ( 9 ) and ( 10 ) that intersect plane ( 11 ) of sole ( 12 ). their points of attachment ( 17 ) to the shell ( 74 ) are noticeably lower than the drop line ( 15 ), ( 15 &# 39 ;) below which are housed the metatarsal bones and the calcaneum ( not shown ). the foot is therefore held within the shell base in at least three gripping zones distributed over the top of the foot . these correspond the tongues ( 75 ), ( 75 &# 39 ;), with each tongue adapting to the shape of the area of the foot it covers . in fig1 , shell base ( 77 ) includes a vertical extension over the area corresponding to the skier &# 39 ; s leg . this extension forms the oversleeve of the boot top . as in the case of the preceding figure , three tongues ( 79 ), ( 79 &# 39 ;) are fastened to both sides of the shell base ( 77 ) at attachment points (- 7 ). in order to encourage the tongues ( 79 ), ( 79 &# 39 ;) to conform to the shape of the top of the foot they cover , said tongues are formed in the shape of flattened half - rings , each of which is capable of at least partial deformation as it is drawn down over the corresponding area of the top of the foot . in the example illustrated in fig1 , the shell base ( 82 ), designed for a rear entry boot , comprises an antero - superior opening ( 83 ) designed to be closed over the forefoot with a top cover that is not shown but that may be similar to the structure described in relation to fig9 or 11 . two pairs of tongues ( 84 ), ( 84 &# 39 ;) are connected to both sides of the shell base ( 82 ) in an area of the boot situated , according to the invention , within the limits of attachment of said transverse tongues to the shell base . in this example , tongues ( 84 ), ( 84 &# 39 ;) are so mounted that each is pivotable on an axis ( 85 ) provided in each of the lateral walls of the shell base , thus allowing the tongues to adjust morphologically to different types of feet . it will be noted that , in this figure , the end of the plane is situated behind ( toward the heel ) the metatarsal heads of the foot . fig1 illustrates a shell construction intended for a front entry boot provided with a rear top ( 89 ) that is unitary with said shell base ( 87 ). as in the construction shown in fig1 , this boot is designed to have a cover ( not shown ) intended to form an antero - superior opening ( 88 ) of the shell base . inner transverse tongues ( 90 ), ( 90 &# 39 ;) for holding the foot are connected to both sides of the shell base . provided with a number of flexible indentations ( 91 ), ( 91 &# 39 ;), said tongues are designed to conform to that portion of the top of the foot that they each cover , bending approximately along limit line ( 15 ), ( 15 &# 39 ;). the means ( 17 ) for attaching said tongues are placed under that line . fig1 illustrates another embodiment of the invention . the shell base ( 92 ), having a top opening ( 93 ), comprises two vertical extensions ( 94 ), ( 94 &# 39 ;) that extend laterally as approximate extensions of the malleoli , along the axis of the lower leg . each of these extensions ( 94 ), ( 94 &# 39 ;) supports tongues ( 95 ), ( 95 &# 39 ;) the free ends of which cover , at least partially , the anterior portion of the skier &# 39 ; s lower leg ( 96 ). tongues ( 95 ), ( 95 &# 39 ;) and ( 97 ), ( 97 &# 39 ;), designed to hold the lower leg and the foot , respectively , are connected , in this case , to the vertical lateral extensions ( 94 ), ( 94 &# 39 ;) of the shell base in an area included within the limits defined by the plane ( 9 ) passing through the heads of the malleoli , and to both sides of the shell base ( 92 ). said tongues ( 95 ), ( 95 &# 39 ;) and ( 97 ), ( 97 &# 39 ;) are flexible and pliable with respect to the walls of the shell base , both along limit line ( 15 ), ( 15 &# 39 ;) and within the space formed between planes ( 9 ) and ( 10 ), with the result that neither the heads of the metatarsal bones ( 14 ), ( 14 &# 39 ;) nor those of the calcaneum ( 16 ) are subjected to pressure or constraint when the tongues are adjusted to hold the foot . tongues of a size or shape different from those set forth above fall within the scope of the invention . likewise , said tongues may or may not be arranged symmetrically on the sides of the shell base . any system of adjustment or tightening may be used to draw the tongues against the foot so as to retain it . such systems may include those using cords and levered clasps , winders , or guided lacing . similarly , a single tongue may be connected at one of its ends to the shell base and may include appropriate fittings and / or have a structure capable of ensuring its adaptability to the morphology of the foot within a given foot - retention zone lying between planes ( 9 ) and ( 10 ) intersecting plane ( 11 ) of the sole . finally , said internal foot - retention means is easily adaptable to all types of boot regardless of how the boots are to be put on . | 0 |
fig1 is a presentation of a standardized elementary file ( ef ) in the subscriber identity module ( sim ) for a gsm session . the etsi ts 100 977 v8 . 2 . 0 ( 2000 – 05 ) standard defines the requirements for the physical characteristics of the sim , the electrical signals and the transmission protocols , the model for the logical structure of sim , the security features , the interface functions , the commands , the application protocol and the contents of the files required for the gsm applications . the logical structure of files in sim is hierarchical and there are three types of files , i . e . elementary files ( ef ), dedicated files ( df ) and master files ( mf ), the last mentioned ones being highest in the hierarchy . the files are administrative or application specific . they contain a header part and , with respect to the elementary files , also a body part containing data . a file id used to identify each file consists of two bytes and shall be coded in hexadecimal notation . the type of the file is identified by the first byte , and for example “ 6f ” means that it is an elementary file under the 1 st level dedicated file . the elementary files ( ef ) for the gsm session defining access conditions , data items and coding . a data item is a part of an ef , which represents a complete logical entity , e . g . the alpha tag in an ef adn record . efs are mandatory ( m ) or optional ( o ). the file size of an optional ef may be zero . all efs with a file size greater than zero shall contain all mandatory items . ef adn is an elementary file containing abbreviated dialing numbers ( adn ) and / or supplementary service control strings ( ssc ). in addition it contains identifiers of associated network / bearer capabilities and identifiers of extension records . it may also contain an associated alpha - tagging . the ef adn file is colloquially called the “ phone book ” file since the mobile phone user use it for fetching the right telephone number by name when trying to contact someone by calling or sending an sms . with respect to elementary files , three different structures are used , namely efs with a transparent structure , linear fixed efs and cyclic efs . an ef with a linear fixed structure consists of a sequence of records all having the same ( fixed ) length . the length of a record , as well as this value multiplied by the number of records , are indicated in the header field of the ef . the maximum length of an ef adn file is according to the field represented in fig1 by reference number 4 , x + 14 bytes , each byte consisting of 8 bits . fig1 also defines the access conditions , data items and coding of an ef adn . a data item is a part of an ef , which represents a complete logical entity . in fig1 , the data items of the elementary file , ef adn , are described by means of a field presentation . thus field 1 is the identifier of a given sim file , i . e . describes what sim file it is question about , which in fig1 is the ef adn file coded as 6f3a and shown by reference number 1 in fig1 . the field represented by reference number 2 shows that the file is a linear fixed ef file . according to the field represented by reference number 3 , the ef adn file is optional and the length of it may thus be zero . all efs with a file size greater than zero shall contain all mandatory data items . the field represented by reference number 5 indicates that the file can be updated . every file has its own specific access condition for each command . there are different access condition levels , such as always (= the action can be performed without any restriction ), card holder verification 1 ( chv 1 ) and card holder verification 2 ( chv 2 ) (= the action is possible if a correct chv 1 / chv 2 value already has been presented to sim during the current session , the chv 1 / chv 2 enabled / disabled indicator is set to “ disabled ” or unblock chv 1 / chv 2 has been successfully performed during the current session ), adm (= allocation of these levels and the respective requirements for their fulfillment are the responsibility of the appropriate administrative authority ) and never (= the action cannot be performed over the sim / me interface , but the sim may perform the action internally ). different functions may act on the files on a sim . it is mandatory for all sim cards in accordance with standard etsi ts 100 977 v8 . 2 . 0 ( 2000 – 05 ) to support the functions select , status , read binary , update binary , read record , update record , seek , increase , invalidate and rehabilitate . as appears in fig1 , field 6 , the functions read ( record ), update ( record ), invalidate and rehabilitate can be performed on the ef adn file , the functions having the access conditions chv 1 , chv 1 , chv 2 and chv 2 , respectively . for example the read record function can only be performed if the read access condition for this ef is satisfied and so on with respect to the other functions . each record consists of a row of data items represented by fields 7 a – 7 f , the maximum length of each data item being indicated in column 8 , the sum of which is x + 14 bytes . column 9 indicates whether the field is optional or mandatory , column 10 describes the data item information included in each row and column 11 defines the order of each data item in one row . thus , each row contains as its first item an alpha identifier ( indicated in field 7 a in fig1 ) according to column 10 , such as a name associated with a given abbreviated dialing number ( adn ) indicated in field 7 d . field 7 d can also contain a supplementary service control string ( ssc ) consisting of e . g . a character string for an abbreviated transfer call code . column 8 indicates the length of field 7 a to be x bytes , column 9 that this data item is optional . column 11 tells that this data item is the first item in a row represented by the x first bytes . the value of x maybe from zero to 241 and depends on the settings in the individual mobile terminals . the second data item described in field 7 b informs the coding method , i . e . length of the bcd ( binary coded decimal ) number and possible ssc content . field 7 c describes the type of number ( ton ) and numbering plan identification ( npi ). field 7 d presents the dialing number associated with the alpha identifier in field 7 a or a possible transfer code for transferring the call to another number . field 7 e presents the capability / configuration identifier containing associated capability / configuration parameters required for the call , and field 7 f is an extension 1 record identifier containing an associated called party subaddress or additional data . according to column 9 , all data items 7 b – 7 f except the alpha identifier 7 a are mandatory . in the invention it has found out that the alpha identifier field 7 a gives the possibility to add additional information in it . fig2 shows an example of an embodiment of the sim card of the invention , wherein additional information has been included in the alpha identifier field 7 a of the ef adn file . the content of the fields represented by reference numbers 1 – 6 and 7 b – 7 f remain intact in the invention compared to the standard ef adn file . field 7 a indicates that this is john smith &# 39 ; s telephone number , and minus (−) indicates that he is not available for the time being and will be so until the time and date indicated , here 5 o &# 39 ; clock , 12 th dec ., 2002 . of course other information can be informed and other ways to code than the minus (−) for absent in the example above . fig3 is an architecture view of a network in which the invention can be implemented . when in the invention data in a central data base 12 phone book is updated , the updated information is forwarded to pre - selected sim phone books 13 a , 13 b and 13 c and updated there , too . information about to which mobile terminals the updated information shall be forwarded to is in the central database 12 . in the updating , standardized sim toolkit commands for remote file management can be used ( etsi ts 101 181 v 8 . 3 . 0 ( 2000 – 08 )). the central data base 12 containing phone book data can be e . g . a company &# 39 ; s internal data base which is integrated with the phone book of the mobile phones of the persons working in the company . the central data base can in the invention also be the operators data base 12 b containing the phone book data of all subscribers or defined groups of subscribers . the message from the central database 12 to the sims 13 a , 13 b and 13 c are forwarded through a public network , such as internet 14 with the tcp / ip protocol used in internet . so that the message could be forwarded to the sims 13 a , 13 b and 13 c of the mobile phones 15 a , 15 b and 15 c respectively via the gsm network 16 it goes via an sms - center 17 , wherein the message is converted to an sms message using the ss7 protocol . the sms gateway 20 is technically an optional component but in practice it is used by many operators for administrative purposes for e . g . charging , routing and access control purposes . the requests to the central database 12 for updating phone book information can come from e . g . a company &# 39 ; s physical access control system 19 or via an sms gateway 21 and sms - center 23 from an employee &# 39 ; s mobile phone 22 . the sms gateway 21 converts the message from the mobile phone 22 into the tcp / ip protocol so that it can be received by the central database 12 . the requests to the central database 12 b can come directly from any mobile phone ( from 15 a in fig3 ) in the gsm network but are updated by the central database 12 b , which has the access information about who is entitled to send such messages and which has the information about to which mobile phones 15 a , 15 b and 15 c and further to the sims 13 a , 13 b and 13 c the updating information shall be sent . the signals performing the updating are explained in connection with fig4 and 5 . fig4 presents an example of a method embodiment of the invention , in which a company &# 39 ; s access control system is connected to the contact information to be updated in a mobile phone . the updating is initiated by a request signal 1 from the access control system to a central database . the request signal is in this example assumed to be from a person with the name john smith in accordance with fig2 . the information that john smith wish to update is that he will be absent until 2 o &# 39 ; clock 12 th dec ., 2002 . the message can be written e . g . in the form “− 2 . 00 , 12 . 12 . 2002 ”. in the central database , there is an internal database containing phonebooks of sims , which are thus updated whenever certain data in the central database phonebook changes . therefore , after receiving the request , the central phone book updates its data in step 2 . to update this information also in the sims , the central phone book sends updating information including information about to which mobile phones the information should be sent to via the internet ( by using the tcp / ip protocol ) to the sms gateway in signal 3 . the sms gateway is not technically necessary , but important in practice , since it also handles e . g . charging and other administrative tasks . the update information then proceeds to the sms center in signal 4 , where it is converted to an sms message using the ss7 standard format for sending it to selected mobile phones ( only one illustrated in fig4 ) through the gsm network in signal 5 . the mobile phone sends the update information to its sim card in signal 6 and the sim phone book is updated in step 7 in a way presented in fig2 . fig5 presents an example of a method embodiment of the invention , in which sim phonebook files are updated from a mobile phone . in this embodiment , a request to update sim phonebook information is sent in signal 1 from a mobile phone with an sms message to a local sms - center handling all sms messages in that area in the gsm network . the sms - c converts the message and sends it in signal 2 with the tcp / ip protocol to the sms - gateway usually handled by the operator and taking care of charging and other administrative tasks . the sms gateway then sends the request in signal 3 to a central sim phonebook to be updated there at first . thereafter the process exceeds as in fig4 . | 7 |
compounds of the formula i may be prepared according to the following reaction schemes and discussion . unless otherwise indicated , r 1 through r 8 , x , y and a in the reaction schemes and discussion that follow are as defined above . scheme 1 illustrates a method of synthesizing compounds of the formula i , wherein “ a ” is — o — and r 3 is ( c 1 - c 6 ) alkyl , ( c 3 - c 10 ) cycloalkyl or ( c 1 - c 9 ) heterocyclic . referring to scheme 1 , compounds of formula i can be prepared from the compounds of formula ii by reaction with a compound of the formula r 3 l , wherein l is a leaving group in the presence of a base in a suitable solvent . suitable leaving groups include halides , such as chloride or bromide , or ester or ester equivalents . examples of compounds of formula r 3 l include halo , ester or ester equivalents ( such as acylimidazole and dialkylamide ), preferably halo ester and acylimidazole . potassium iodide may also be added to the reaction mixture . suitable bases include sodium hydride , potassium carbonate and triethylamine . suitable solvents include dmso , dmf , thf , dioxane , and acetonitrile . this reaction is generally carried out at a temperature from about 0 ° c . to about 140 ° c ., preferably at about 50 ° c . to about 80 ° c . for a period from about 1 hour to about 24 hours . the compounds of formula ii can be prepared from compounds of formula iii by reaction with a compound of the formula wherein r is ( c 1 - c 6 ) alkyl such as 4 , 4 , 4 - trifluoro - 3 - oxo - butyric acid methyl ester , in a suitable solvent under acidic , neutral or basic conditions . suitable solvents include methanol , dmf , dmso , water or a mixture of them . suitable acids include hydrochloric acid , trifluoroacetic acid . suitable bases include sodium hydroxide , potassium hydroxide , and potassium carbonate . this reaction is generally carried out at a temperature from about 0 ° c . to about 140 ° c ., preferably at about 20 ° c . to about 100 ° c . for a period from about 1 hour to about 24 hours . compounds of formula iii are commercially available or can be made by methods well known to those of ordinary skill in the art or according to scheme 3 . compounds of formula iii can be prepared by the method described in vavrina , et al ,. collection czechoslov . chem . commun ., vol . 37 , 1721 ( 1972 ) and which are incorporated by reference . the regio isomeric pyrazole ( la ′) can be also prepared from the corresponding 1 , 3 - diketone and heteroarylhydrazine according to other methods well known in the art . scheme 2 refers to an alternate preparation of compounds of the formula i . referring to scheme 2 , compounds of the formula i are prepared from compounds of the formula iv , wherein l is a leaving group such as a chloride or bromide , by reaction with a compound of the formula r 3 ah in the presence of a base and a polar solvent . suitable bases include sodium hydride , potassium carbonate , and triethylamine . suitable solvents include alcohols , such as ethanol , methanol , propanol or butanol ; dimethyl sulfoxide ( dmso ), n , n - dimethylformamide ( dmf ), n , n - dimethylacetamide ( dma ) or n - methyl - 2 - pyrrolidinone ( nmp ), preferably an alcohol , most preferably ethanol . this reaction is generally carried out at a temperature from about 0 ° c . to about 140 ° c ., preferably at about 20 ° c . to about 100 ° c . for a period from about 1 hour to about 24 hours . compounds of the formula iv are prepared from compounds of the formula ii by reaction with a halogenating reagent in a polar solvent . suitable halogenating reagents include oxalyl chloride , poci 3 , pobr 3 , soci 2 or pci 5 , preferably poci 3 . suitable solvents include n , n - dimethylformamide ( dmf ), n , n - dimethylacetamide ( dma ) or n - methyl - 2 - pyrrolidinone ( nmp ), preferably dmf . this reaction is generally carried out at a temperature from about 20 ° c . to about 140 ° c ., preferably at about the reflux temperature of the polar solvent for a period from about 1 hour to about 48 hours . compounds of formula ii are prepared according to the methods of scheme 1 . scheme 3 refers to the preparation of compounds of the formula iii which are intermediates used in scheme 1 . referring to scheme 3 , compounds of the formula iii are prepared from compounds of the formula v by reaction with hydrazine in the presence of a polar solvent . suitable solvents include alcohols , such as ethanol , methanol , propanol or butanol ; dimethyl sulfoxide ( dmso ), n , n - dimethylformamide ( dmf ), n , n - dimethylacetamide ( dma ) or n - methyl - 2 - pyrrolidinone ( nmp ), preferably an alcohol , most preferably ethanol . this reaction is generally carried out at a temperature from about 0 ° c . to about 140 ° c ., preferably at about the reflux temperature of the polar solvent . preferably the product is isolated as a salt , such as a hydrochoride salt . the compound of formula v is prepared from a compound of the formula vi by reaction with an oxidizing reagent in the presence of a solvent . suitable oxidants include meta - chloroperbenzoic acid , hydrogen peroxide , sodium perborate , or oxone ® ( oxone ® is preferred ). suitable solvents or solvent mixtures include methanol - water , dioxane - water , tetrahydrofuran - water , methylene chloride , or chloroform , preferably methanol - water . suitable temperatures for the aforesaid reaction range from about 0 ° c . to about 60 ° c ., preferably the temperature may range from about 20 ° c . to about 25 ° c . ( i . e . room temperature ). the reaction is complete within about 0 . 5 hours to about 24 hours , preferably about 16 hours . the compound of the formula vi is prepared from a compound of formula vii by reaction with a disulfide or methyl alkylthiolsulfonate of the formula r 1 s - l , wherein l is alkylthio or methylsulfonate , in the presence or absence of a base in a polar solvent . suitable bases include , alkyllithium such as n - butyllithium , and suitable solvents include ether , benzene and thf . this reaction is generally carried out at a temperature from about − 78 ° c . to 0 ° c . for from about 1 to 8 hours . compounds of formula vii are commercially available or can be made by methods well known to those of ordinary skill in the art . unless indicated otherwise , the pressure of each of the above reactions is not critical . generally , the reactions will be conducted at a pressure of about one to about three atmospheres , preferably at ambient pressure ( about one atmosphere ). the compounds of the formula i which are basic in nature are capable of forming a wide variety of different salts with various inorganic and organic acids . although such salts must be pharmaceutically acceptable for administration to animals , it is often desirable in practice to initially isolate a compound of the formula i from the reaction mixture as a pharmaceutically unacceptable salt and then simply convert the latter back to the free base compound by treatment with an alkaline reagent , and subsequently convert the free base to a pharmaceutically acceptable acid addition salt . the acid addition salts of the base compounds of this invention are readily prepared by treating the base compound with a substantially equivalent amount of the chosen mineral or organic acid in an aqueous solvent medium or in a suitable organic solvent such as methanol or ethanol . upon careful evaporation of the solvent , the desired solid salt is obtained . the acids which are used to prepare the pharmaceutically acceptable acid addition salts of the base compounds of this invention are those which form non - toxic acid addition salts , i . e ., salts containing pharmacologically acceptable anions , such as hydrochloride , hydrobromide , hydroiodide , nitrate , sulfate or bisulfate , phosphate or acid phosphate , acetate , lactate , citrate or acid citrate , tartrate or bitartrate , succinate , maleate , fumarate , gluconate , saccharate , benzoate , methanesulfonate and pamoate [ i . e ., 1 , 1 ′- methylene - bis -( 2 - hydroxy - 3 - naphthoate )] salts . those compounds of the formula i which are also acidic in nature , e . g ., wherein r 2 , r 4 , r 5 or r 6 include a — cooh , tetrazole or other acidic moiety , are capable of forming base salts with various pharmacologically acceptable cations . examples of such salts include the alkali metal or alkaline - earth metal salts and particularly , the sodium and potassium salts . these salts are all prepared by conventional techniques . the chemical bases which are used as reagents to prepare the pharmaceutically acceptable base salts of this invention are those which form non - toxic base salts with the herein described acidic compounds of formula i . these non - toxic base salts include those derived from such pharmacologically acceptable cations as sodium , potassium , calcium and magnesium , etc . these salts can easily be prepared by treating the corresponding acidic compounds with an aqueous solution containing the desired pharmacologically acceptable cations , and then evaporating the resulting solution to dryness , preferably under reduced pressure . alternatively , they may also be prepared by mixing lower alkanolic solutions of the acidic compounds and the desired alkali metal alkoxide together , and then evaporating the resulting solution to dryness in the same manner as before . in either case , stoichiometric quantities of reagents are preferably employed in order to ensure completeness of reaction and maximum product yields . the activity of the compounds of the formula ( i ) of the present invention was demonstrated by the following assays . human peripheral blood obtained from healthy volunteers was diluted to { fraction ( 1 / 10 )} volume with 3 . 8 % sodium citrate solution . the platelet - rich plasma immediately obtained was washed with 0 . 14 m sodium chloride containing 12 mm tris - hcl ( ph 7 . 4 ) and 1 . 2 mm edta . platelets were then washed with platelet buffer ( hanks buffer ( ca free ) containing 0 . 2 % bsa and 20 mm hepes ). finally , the human washed platelets ( hwp ) were suspended in platelet buffer at the concentration of 2 . 85 × 10 8 cells / ml and stored at room temperature until use . the hwp suspension ( 70 μl aliquots , final 2 . 0 × 10 7 cells / ml ) was placed in a 96 - well u bottom plate and 10 μl aliquots of 12 . 6 mm calcium chloride added . platelets were incubated with a23187 ( final 10 μm , sigma ) with test compound ( 0 . 1 - 100 μm ) dissolved in dmso ( final concentration ; less than 0 . 01 %) at 37 ° c . for 15 minutes . the reaction was stopped by addition of edta ( final 7 . 7 mm ) and t × b2 in the supernatant quantitated by using a radioimmunoassay kit ( amersham ) according to the manufacturer &# 39 ; s procedure . the human cell based cox - 2 assay was carried out as previously described ( moore et al ., inflam . res ., 45 , 54 , 1996 ). confluent human umbilical vein endothelial cells ( huvecs , morinaga ) in a 96 - well flat bottom plate were washed with 80 ml of rpmi1640 containing 2 % fbs and incubated with hil - 1 β ( final concentration 300 u / ml , r & amp ; d systems ) at 37 ° c . for 24 hr . after washing , the activated huvecs were incubated with test compound ( final concentration ; 0 . 1 nm - 1 μm ) dissolved in dmso ( final concentration ; less than 0 . 01 %) at 37 ° c . for 20 minutes and stimulated with a23187 ( final concentration 30 mm ) in hanks buffer containing 0 . 2 % bsa , 20 mm hepes at 37 ° c . for 15 minutes . 6 - keto - pgf 1α , stable metabolite of pgi2 , in the supernatant was quantitated by using a radioimmunoassay method ( antibody ; preseptive diagnostics , spa ; amersham ). the following canine cell based cox 1 and cox - 2 assays have been reported in ricketts et al ., evaluation of selective inhibition of canine cyclooxygenase 1 and 2 by carprofen and other nonsteroidal anti - inflammatory drugs , american journal of veterinary research , 59 ( 11 ), 1441 - 1446 . test drug compounds were solubilized and diluted the day before the assay was to be conducted with 0 . 1 ml of dmso / 9 . 9 ml of hank &# 39 ; s balanced salts solution ( hbss ), and stored overnight at 4 ° c . on the day that the assay was carried out , citrated blood was drawn from a donor dog , centrifuged at 190 × g for 25 minutes at room temperature , and the resulting platelet - rich plasma was then transferred to a new tube for further procedures . the platelets were washed by centrifuging at 1500 × g for 10 minutes at room temperature . the platelets were washed with platelet buffer comprising hank &# 39 ; s buffer ( ca free ) with 0 . 2 % bovine serum albumin ( bsa ) and 20 mm hepes . the platelet samples were then adjusted to 1 . 5 × 10 7 / ml , after which 50 μl of calcium ionophore ( a23187 ) together with a calcium chloride solution were added to 50 μl of test drug compound dilution in plates to produce final concentrations of 1 . 7 μm a23187 and 1 . 26 mm ca . then , 100 μl of canine washed platelets were added and the samples were incubated at 37 ° c . for 15 minutes , after which the reaction was stopped by adding 20 μl of 77 mm edta . the plates were then centrifuged at 2000 × g for 10 minutes at 4 ° c ., after which 50 μl of supernatant was assayed for thromboxane b 2 ( txb 2 ) by enzyme - immunoassay ( eia ). the pg / ml of txb 2 was calculated from the standard line included on each plate , from which it was possible to calculate the percent inhibition of cox - 1 and the ic 50 values for the test drug compounds . a canine histiocytoma ( macrophage - like ) cell line from the american type culture collection designated as dh82 , was used in setting up the protocol for evaluating the cox - 2 inhibition activity of various test drug compounds . there was added to flasks of these cells 10 μg / ml of lps , after which the flask cultures were incubated overnight . the same test drug compound dilutions as described above for the cox - 1 protocol were used for the cox - 2 assay and were prepared the day before the assay was carried out . the cells were harvested from the culture flasks by scraping , and were then washed with minimal eagle &# 39 ; s media ( mem ) combined with 1 % fetal bovine serum , centrifuged at 1500 rpm for 2 minutes , and adjusted to a concentration of 3 . 2 × 10 5 cells / ml . to 50 μl of test drug dilution there was added 50 μl of arachidonic acid in mem to give a 10 μm final concentration , and there was added as well 100 μl of cell suspension to give a final concentration of 1 . 6 × 10 5 cells / ml . the test sample suspensions were incubated for 1 hour and then centrifuged at 1000 rpm for 10 minutes at 4 ° c ., after which 50 μl aliquots of each test drug sample were delivered to eia plates . the eia was performed for prostaglandin e 2 ( pge 2 ), and the pg / ml concentration of pge 2 was calculated from the standard line included on each plate . from this data it was possible to calculate the percent inhibition of cox - 2 and the ic 50 values for the test drug compounds . repeated investigations of cox - 1 and cox - 2 inhibition were conducted over the course of several months . the results are averaged , and a single cox - 1 : cox - 2 ratio is calculated . whole blood assays for cox - 1 and cox - 2 are known in the art such as the methods described in c . brideau , et al ., a human whole blood assay for clinical evaluation of biochemical efficacy of cyclooxygenase inhibitors , inflammation research , vol . 45 , pp . 68 - 74 ( 1996 ). these methods may be applied with feline , canine or human blood as needed . male sprague - dawley rats ( 5 weeks old , charles river japan ) were fasted overnight . a line was drawn using a marker above the ankle on the right hind paw and the paw volume ( v0 ) was measured by water displacement using a plethysmometer ( muromachi ). animals were given orally either vehicle ( 0 . 1 % methyl cellulose or 5 % tween 80 ) or a test compound ( 2 . 5 ml per 100 g body weight ). one hour later , the animals were then injected intradermally with λ - carrageenan ( 0 . 1 ml of 1 % w / v suspension in saline , zushikagaku ) into right hind paw ( winter et al ., proc . soc . exp . biol . med ., 111 , 544 , 1962 ; lombardino et al ., arzneim . forsch ., 25 , 1629 , 1975 ) and three hours later , the paw volume ( v3 ) was measured and the increase in volume ( v3 - v0 ) calculated . since maximum inhibition attainable with classical nsaid &# 39 ; s is 60 - 70 %, ed 30 values were calculated . the gastric ulcerogenicity of test compound was assessed by a modification of the conventional method ( ezer et al ., j . pharm . pharmacol ., 28 , 655 , 1976 ; cashin et al ., j . pharm . pharmacol ., 29 , 330 - 336 , 1977 ). male sprague - dawley rats ( 5 weeks old , charles river japan ), fasted overnight , were given orally either vehicle ( 0 . 1 % methyl cellulose or 5 % tween 80 ) or a test compound ( 1 ml per 100 g body weight ). six hours after , the animals were sacrificed by cervical dislocation . the stomachs were removed and inflated with 1 % formalin solution ( 10 ml ). stomachs were opened by cutting along the greater curvature . from the number of rats that showed at least one gastric ulcer or hemorrhaging erosion ( including ecchymosis ), the incidence of ulceration was calculated . animals did not have access to either food or water during the experiment . canine whole blood ex vivo determinations of cox - 1 and cox - 2 activity inhibition the in vivo inhibitory potency of a test compound against cox - 1 and cox - 2 activity may be evaluated using an ex vivo procedure on canine whole blood . three dogs were dosed with 5 mg / kg of the test compound administered by oral gavage in 0 . 5 % methylcellulose vehicle and three dogs were untreated . a zero - hour blood sample was collected from all dogs in the study prior to dosing , followed by 2 - and 8 - hour post - dose blood sample collections . test tubes were prepared containing 2 μl of either ( a ) calcium ionophore a23187 giving a 50 μm final concentration , which stimulates the production of thromboxane b 2 ( txb 2 ) for cox - 1 activity determination ; or of ( b ) lipopolysaccharide ( lps ) to give a 10 μg / ml final concentration , which stimulates the production of prostaglandin e 2 ( pge 2 ) for cox - 2 activity determination . test tubes with unstimulated vehicle were used as controls . a 500 μl sample of blood was added to each of the above - described test tubes , after which they were incubated at 37 ° c . for one hour in the case of the calcium ionophore - containing test tubes , and overnight in the case of the lps - containing test tubes . after incubation , 10 μl of edta was added to give a final concentration of 0 . 3 %, in order to prevent coagulation of the plasma which sometimes occurs after thawing frozen plasma samples . the incubated samples were centrifuged at 4 ° c . and the resulting plasma sample of ˜ 200 μl was collected and stored at − 20 ° c . in polypropylene 96 - well plates . in order to determine endpoints for this study , enzyme immunoassay ( eia ) kits available from cayman were used to measure production of txb 2 and pge 2 , utilizing the principle of competitive binding of tracer to antibody and endpoint determination by colorimetry . plasma samples were diluted to approximate the range of standard amounts which would be supplied in a diagnostic or research tools kit , i . e ., { fraction ( 1 / 500 )} for txb 2 and { fraction ( 1 / 750 )} for pge 2 . statistical program packages , systat ( systat , inc .) and statview ( abacus cencepts , inc .) for macintosh were used . differences between test compound treated group and control group were tested for using anova . the ic 50 ( ed30 ) values were calculated from the equation for the log - linear regression line of concentration ( dose ) versus percent inhibition . most compounds prepared in the working examples as described hereinafter were tested by at least one of the methods described above , and showed ic 50 values of 0 . 001 μm to 3 μm with respect to inhibition of cox - 2 in either the canine or human assays . cox - 2 selectivity can be determined by ratio in terms of ic 50 value of cox - 1 inhibition to cox - 2 inhibition . in general , it can be said that a compound showing a cox - 2 / cox - 1 inhibition ratio of more than 5 has good cox - 2 selectivity . the compounds of the formula ( i ) of this invention can be administered via oral , parenteral , anal , buccal or topical routes to mammals ( including humans , dogs , cats , horses and livestock animals ). in general , these compounds are most desirably administered to humans in doses ranging from 0 . 01 mg to 100 mg per kg of body weight per day , although variations will necessarily occur depending upon the weight , sex and condition of the subject being treated , the disease state being treated and the particular route of administration chosen . however , a dosage level that is in the range of from 0 . 1 mg to 10 mg per kg of body weight per day , single or divided dosage is most desirably employed in humans for the treatment of above - mentioned diseases . these compounds are most desirably administered to said non - human mammals , e . g . dogs , cats , horses or livestock animals in an amount , expressed as mg per kg of body weight of said member per day , ranging from about 0 . 01 mg / kg to about 20 . 0 mg / kg / day , preferably from about 0 . 1 mg / kg to about 12 . 0 mg / kg / day , more preferably from about 0 . 5 mg / kg to about 10 . 0 mg / kg / day , and most preferably from about 0 . 5 mg / kg to about 8 . 0 mg / kg / day . the compounds of the present invention may be administered alone or in combination with pharmaceutically acceptable carriers or diluents by any of the above routes previously indicated , and such administration can be carried out in single or multiple doses . more particularly , the novel therapeutic agents of the invention can be administered in a wide variety of different dosage forms , i . e ., they may be combined with various pharmaceutically acceptable inert carriers in the form of tablets , capsules , lozenges , trochees , hard candies , powders , sprays , creams , salves , suppositories , jellies , gels , pastes , lotions , ointments , aqueous suspensions , injectable solutions , elixirs , syrups , and the like . such carriers include solid diluents or fillers , sterile aqueous media and various nontoxic organic solvents , etc . moreover , oral pharmaceutical compositions can be suitably sweetened and / or flavored . in general , the therapeutically - effective compounds of this invention are present in such dosage forms at concentration levels ranging 5 % to 70 % by weight , preferably 10 % to 50 % by weight . for oral administration , tablets containing various excipients such as microcrystalline cellulose , sodium citrate , calcium carbonate , dipotassium phosphate and glycine may be employed along with various disintegrants such as starch and preferably corn , potato or tapioca starch , alginic acid and certain complex silicates , together with granulation binders like polyvinylpyrrolidone , sucrose , gelatin and acacia . additionally , lubricating agents such as magnesium stearate , sodium lauryl sulfate and talc are often very useful for tabletting purposes . solid compositions of a similar type may also be employed as fillers in gelatin capsules ; preferred materials in this connection also include lactose or milk sugar as well as high molecular weight polyethylene glycols . when aqueous suspensions and / or elixirs are desired for oral administration , the active ingredient may be combined with various sweetening or flavoring agents , coloring matter or dyes , and , if so desired , emulsifying and / or suspending agents as well , together with such diluents as water , ethanol , propylene glycol , glycerin and various combinations thereof . a preferred composition for dogs comprises an ingestible liquid peroral dosage form selected from the group consisting of a solution , suspension , emulsion , inverse emulsion , elixir , extract , tincture , and concentrate , optionally to be added to the drinking water of the dog being treated . any of these liquid dosage forms , when formulated in accordance with methods well known in the art , can either be administered directly to the dog being treated , or may be added to the drinking water of the dog being treated . the concentrate liquid form , on the other hand , is formulated to be added first to a given amount of water , from which an aliquot amount may be withdrawn for administration directly to the dog or addition to the drinking water of the dog . a preferred composition provides delayed -, sustained -, and / or controlled - release of said anti - inflammatory selective cox - 2 inhibitor . such preferred compositions include all such dosage forms which produce ≧ 80 % inhibition of cox - 2 isozyme activity and result in a plasma concentration of said inhibitor of at least 3 fold the cox - 2 ic 50 for at least 4 hours ; preferably for at least 8 hours ; more preferably for at least 12 hours ; more preferably still for at least 16 hours ; even more preferably still for at least 20 hours ; and most preferably for at least 24 hours . preferably , there is included within the above - described dosage forms those which produce ≧ 80 % inhibition of cox - 2 isozyme activity and result in a plasma concentration of said inhibitor of at least 5 fold the cox - 2 ic 50 for at least 4 hours , preferably for at least 8 hours , more preferably for at least 12 hours , still more preferably for at least 20 hours , and most preferably for at least 24 hours . more preferably , there is included the above - described dosage forms which produce ≧ 90 % inhibition of cox - 2 isozyme activity and result in a plasma concentration of said inhibitor of at least 5 fold the cox - 2 ic 50 for at least 4 hours , preferably for at least 8 hours , more preferably for at least 12 hours , still more preferably for at least 20 hours , and most preferably for at least 24 hours . for parenteral administration , solutions of a compound of the present invention in either sesame or peanut oil or in aqueous propylene glycol may be employed . the aqueous solutions should be suitably buffered ( preferably ph & gt ; 8 ) if necessary and the liquid diluent first rendered isotonic . these aqueous solutions are suitable for intravenous injection purposes . the oily solutions are suitable for intra - articular , intra - muscular and subcutaneous injection purposes . the preparation of all these solutions under sterile conditions is readily accomplished by standard pharmaceutical techniques well - known to those skilled in the art . additionally , it is also possible to administer the compounds of the present invention topically when treating inflammatory conditions of the skin and this may preferably be done by way of creams , jellies , gels , pastes , ointments and the like , in accordance with standard pharmaceutical practice . the compounds of formula ( i ) may also be administered in the form of suppositories for rectal or vaginal administration of the active ingredient . these compositions can be prepared by mixing the active ingredient with a suitable non - irritating excipient which is solid at room temperature ( for example , 10 ° c . to 32 ° c .) but liquid at the rectal temperature and will melt in the rectum or vagina to release the active ingredient . such materials are polyethylene glycols , cocoa butter , suppository and wax . for buccal administration , the composition may take the form of tablets or lozenges formulated in conventional manner . for transdermal administration , transdermal patches prepared in accordance with well known drug delivery technology may be prepared and applied to the skin of a mammal , preferably a human or a dog , to be treated , whereafter the active agent by reason of its formulated solubility characteristics migrates across the epidermis and into the dermal layers of the skin where it is taken up as part of the general circulation , ultimately providing systemic distribution of the active ingredient over a desired , extended period of time . also included are implants which are placed beneath the epidermal layer of the skin , i . e . between the epidermis and the dermis of the skin of the patient being treated . such an implant will be formulated in accordance with well known principles and materials commonly used in this delivery technology , and may be prepared in such a way as to provide controlled -, sustained -, and / or delayed - release of the active ingredient into the systemic circulation of the patient . such subepidermal ( subcuticular ) implants provide the same facility of installation and delivery efficiency as transdermal patches , but without the limitation of being subject to degradation , damage or accidental removal as a consequence of being exposed on the top layer of the patient &# 39 ; s skin . the following examples contain detailed descriptions of the methods of the preparation of compounds of formula ( i ). these detailed descriptions fall within the scope of the invention and serve to exemplify the above described general synthetic procedures which form part of the invention . these detailed descriptions are presented for illustrative purposes only and are not intended to restrict the scope of the present invention . the invention is illustrated in the following non - limiting examples in which , unless stated otherwise : all operations were carried out at room or ambient temperature , that is , in the range of 18 - 25 ° c . ; evaporation of solvent was carried out using a rotary evaporator under reduced pressure with a bath of up to 60 ° c . ; reactions were monitored by thin layer chromatography ( tlc ) and reaction times are given for illustration only ; melting points ( m . p .) given are uncorrected ( polymorphism may result in different melting points ); structure and purity of all isolated compounds were assured by at least one of the following techniques : tlc ( merck silica gel 60 f - 254 precoated plates ), mass spectrometry , nuclear magnetic resonance ( nmr ) or infrared spectroscopy ( ir ). ir data were obtained on a ftir 8200 ( shimazu spectrometer ). yields are given for illustrative purposes only . flash column chromatography was carried out using merck silica gel 60 ( 230 - 400 mesh astm ). low - resolution mass spectral data ( el ) were obtained on a automass 120 ( jeol ) mass spectrometer . liquid chromatography data was collected on a hewlett packard 1100 liquid chromatography / mass selective detector ( lc / msd ). analysis was performed on a luna c - 18 column with dimensions of 3 . 0 × 150 mm . the flow rate was 0 . 425 ml / minute running a gradient of 50 % 0 . 1 % aqueous formic acid and 50 % acetonitrile to 100 % acetonitrile in 15 minutes . the ionization type for the mass detector of the mass spectrophotometer was atmospheric pressure electrospray in the positive ion mode with a fragmentor voltage of 50 volts . nmr data was determined at 270 mhz ( jeol jnm - la 270 spectrometer ) using deuterated chloroform ( 99 . 8 % d ), methanol ( 99 . 8 % d ) or dimethylsulfoxide ( 99 . 9 % d ) as solvent unless indicated otherwise , relative to tetramethylsilane ( tms ) as internal standard in parts per million ( ppm ); conventional abbreviations used are : s = singlet , d = doublet , t = triplet , q = quartet , m = multiplet , br = broad , etc . thf : tetrahydrofuran ch 2 cl 2 : dichloromethane nahco 3 : sodium bicarbonate hcl : hydrogen chloride mgso 4 : magnesium sulfate na 2 so 4 : sodium sulfate dme : dimethoxyethane n - buli : n - butyllithium dmf : dimethylformamide 2 -( 5 - methanesulfonyl - pyridin - 2 - yl )- 5 - trifluoromethyl - 2h - pyrazol - 3 - ol ( 616 mg ) was dissolved in dimethyl formamide ( dmf ) ( 7 . 5 ml ), followed by the addition of potassium carbonate ( k 2 co 3 ) ( 1 . 1 g ) and isopropyl iodide ( 510 mg ). the reaction mixture was then stirred at 75 ° c . for 1 . 5 hours . after cooling to room temperature , the reaction mixture was then diluted with 50 ml of 2 : 1 ethylacetate : benzene solution . the organic layer was washed with 0 . 5 n sodium hydroxide solution ( 50 ml ), dried with sodium sulfate , and the solvent was evaporated in vacuo to give the crude product which was purified by recrystallization from 10 ml of 2 : 1 isooctane : dichloromethane to yield the title compound ( 308 mg ). the compounds of table 1 were prepared according to the method of example 1 , substituting the appropriate alkyl or cycloalkyl halide . the compounds of examples 3 - 13 and 17 - 24 were prepared using the alkyl or cycloalkyl iodide , and the reaction time is between 1 . 5 hours to about 24 hours . the compounds of examples 14 - 16 and 26 - 31 were prepared using the alkyl or cycloalkyl bromide or chloride . when alkyl bromide or alkyl chloride was used , 2 equivalents of potassium iodide were also added to the reaction mixture . table i example formula lc ms 2 6 . 494 350 3 9 . 73 390 . 1 4 4 . 318 322 5 5 . 454 336 6 7 . 064 350 7 8 . 486 364 8 10 . 034 378 . 1 9 8 . 504 364 . 1 10 7 . 89 364 11 9 . 151 378 . 1 12 8 . 456 376 . 1 13 6 . 249 348 14 7 . 047 362 15 7 . 439 362 . 1 16 9 . 011 376 17 9 . 753 432 18 8 . 483 416 . 1 19 10 . 036 466 . 1 20 8 . 369 398 . 1 21 4 . 576 399 . 1 22 2 . 525 399 . 1 23 8 . 563 399 . 1 24 10 . 404 448 . 1 25 7 . 675 449 . 1 26 9 . 528 412 . 1 27 9 . 756 432 28 9 . 474 412 . 1 29 8 . 472 416 30 9 . 897 432 31 8 . 846 428 . 1 2 - fluoro - 4 -( 5 - hydroxy - 3 - trifluoromethyl - pyrazol - 1 - yl )- benzenesulfonamide ( 163 mg ) and potassium carbonate ( 276 mg ) were mixed in dimethyl formamide , followed by the addition of isopropyl iodide . the reaction mixture was stirred at 50 ° c . for 1 . 5 hours . after cooling to room temperature , 0 . 5 n sodium hydroxide solution ( 10 ml ) was added , and the product was extracted with ethyl acetate ( 50 ml ) and benzene ( 25 ml ). the organic layer was dried with sodium sulfate , and the solvent was evaporated in vacuo to give the crude product , which was purified by preparative silica gel plate using 5 : 2 of hexane : ethyl acetate to afford the title compound ( 32 mg ). the title compound was characterized by tandem high pressure liquid chromatography / mass spectrometry and yielded a retention time of 7 . 523 minutes and had a parent ion at 368 amu . the compounds of table 2 were prepared according to methods analogous to example 32 substituting the appropriate pyrazole and halide . 2 -( 5 - isopropoxy - 3 - trifluoromethyl - pyrazol - 1 - yl )- 5 - methanesulfonyl - pyridine ( 105 mg ) and ncs ( n - chlorosuccinimide ) ( 200 mg ) were dissolved in dmf under nitrogen , and the reaction mixture was stirred at room temperature for 2 . 5 days . the reaction mixture was then diluted with 2 : 1 ethyl acetate : benzene solution ( 100 ml ), and washed with 0 . 5 n sodium hydroxide solution ( 100 ml ), water ( 100 ml ), and brine ( 100 ml ). the organic layer was dried with sodium sulfate , and the solvent was evaporated in vacuo to give the crude product which was purified by recrystallization from 2 : 1 of isooctane : methylene chloride to afford the title compound ( 13 mg , 11 %, ms : 384 . 1 ). to a solution of the chloro aldehyde pyrazol ( 40 mg , 0 . 113 mmol ) in dry dichloromethane ( 1 ml ) was treated sequentially with the isopropyl amine ( 11 ul , 1 . 1 equiv ) and triethyl amine ( 19 ul , 1 . 2 equiv ) and stirred vigorously at room temperature for 2 hours . the reaction mixture was taken up in water ( 15 ml ) and extracted with dichloromethane ( 10 ml × 3 ), dried , and concentrated in vacuo to give crude product . purification by flash chromatography gave 6 mg ( 14 %) of product as pale white solid . liquid chromatography / mass spectral detection , as defined above , were 8 . 12 minutes and 377 amu respectively . to a solution of the chloro aldehyde pyrazole ( 40 mg , 0 . 113 mmol ) in dry dichloromethane ( 1 ml ) was treated sequentially with the thiophenol ( 13 μl , 1 . 1 equiv ) and triethyl amine ( 19 μl , 1 . 2 equiv ) and stirred vigorously at room temperature for 2 hours . the reaction mixture was taken up in water ( 15 ml ) and extracted with dichloromethane ( 10 ml × 3 ), dried , and concentrated in vacuo to give 47 mg ( 98 %) of the product as a pale white solid . structure confirmed by lcms ( retention time 8 . 32 minutes , parent ion 428 ). the compounds of table 3 were prepared according to the methods of examples 39 - 40 substituting the appropriate pyrazole , thiol and amine . a solution of the aldehyde ( example 46 ) ( 50 mg ) in dry methanol ( 3 ml ) was cooled to 0 ° c . and treated with sodium borohydride ( 1 . 2 equiv ). the reaction mixture was allowed to warm to room temperature and stirred for 45 minutes . the reaction mixture was poured into 1 n hcl ( 10 ml ) and extracted with ethyl acetate ( 3 × 15 ml ), dried and concentrated in vacuo . the crude product was purified by preparative tlc ( 2 % methanol / methylene chloride ) to provide 30 mg ( 60 %) of the desired product as a white solid . liquid chromatography / mass spectral detection , as defined above , were 6 . 98 minutes and 405 amu respectively . a solution of the aldehyde ( example 46 ) ( 50 mg ) in dry methanol ( 3 ml ) was treated with phenyloxyamine ( 1 . 2 equiv ) and the resulting mixture heated at 50 ° c . for 2 hours . the reaction mixture was diluted with water 3nd extracted with ethyl acetate ( 3 × 15 ml ), dried and concentrated to provide the intermediate oxime . this intermediate was immediately taken up in tetrahydrofuran and treated with sodium hydride ( about 2 equivalents ) and heated to 50 ° c . after completion of reaction by thin layer chromatography ( tlc ), the crude mixture was taken up in water and extracted with ethyl acetate , dried and concentrated to give crude product . purification with preparative tlc ( 2 % methanol : methylene chloride ) gave 4 mg ( 8 %) the desired nitrile as a white solid . liquid chromatography / mass spectral detection , as defined above , were 10 . 36 minutes and 400 . 1 amu respectively . a solution of the aldehyde ( example 46 ) ( 20 mg ) in dry dichloroethane ( 2 ml ) was treated with methoxyamine ( 5 . 7 ul , 1 . 5 equiv ) and the reaction mixture stirred at 80 ° c . for 7 hours . the reaction mixture was poured into water ( 15 ml ) and extracted with ethyl acetate ( 3 × 15 ml ), dried and concentrated in vacuo . the crude mixture was purified by preparative tlc ( 35 % etoac / hexane ) to provide 8 mg ( 36 %) of product as a white solid . liquid chromatography / mass spectral detection , as defined above , were 12 . 8 minutes and 432 amu respectively . the compounds of table 4 were prepared according to the methods of examples 39 , 40 and 48 - 50 substituting the appropriate pyrazole , thiol and amine . 2 - mercapto - 5 - nitro pyridine ( 20 . 0 g , 128 mmol ) was suspended in water / ethanol ( 43 ml / 13 ml ). sodium carbonate monohydrate ( 17 . 49 g , 141 mmol , dissolved in 86 ml of water ) was added to the above slurry dropwise . methyl iodide ( 20 . 0 g , 141 mmol ) was added to the above mixture and the mixture was stirred at room temperature for one hour . the solid was filtered and washed with water and ethanol to provide the title compound in quantitative yield . 3 - nitro - 6 -( methylthio ) pyridine ( 22 . 0 g , 129 . 3 mmol ) was dissolved in acetone ( 140 ml ). sulfuric acid ( 2n , 230 ml ) was then added dropwise to above solution to form a slurry . potassium permanganate ( kmno 4 ) ( 26 . 5 g , 168 . 1 mmol , dissolved in 500 ml of h 2 o ) was added to the above mixture dropwise . the mixture that resulted was stirred at room temperature overnight . the solid was filtered and stirred with a warm mixture of ethanol / methanol ( 10 / 1 ). the insoluble salt was filtered , the filtrate was concentrated to provide a pale yellow solid . the crude product was recrystallized from ethanol to furnish the title compound ( 17 . 8 g , 70 %). 3 - nitro - 6 -( methylsulfonyl ) pyridine ( 10 g , 49 . 5 mmol ) was suspended in water ( 200 ml ). iron powder ( 5 . 0 g , 89 . 3 mmol ) and acetic acid ( 0 . 5 ml ) were added to the above mixture . the mixture , which resulted , was heated to reflux for 2 hours . the reaction was monitored by thin layer chromatography ( ethyl acetate / hexane , 1 / 1 ). the reaction mixture was then cooled to room temperature and a saturated solution of sodium bicarbonate ( nahco 3 ) ( 100 ml ) was added to the mixture . ethyl acetate ( 200 ml ) was added to the above mixture and the mixture , which resulted , was stirred at room temperature for 30 minutes . the mixture was filtered through celite ® and the organic layer was collected . the aqueous layer was extracted with ethyl acetate ( 200 ml × 3 ). the organic extractions were combined and dried over sodium sulfate . the solvent was removed under reduced pressure to provide the 3 - amino - 6 -( methylsulfonyl ) pyridine ( 6 g , 70 . 5 %). to a solution of 3 - amino - 6 -( methylsulfonyl ) pyridine ( 3 . 72 g , 21 . 6 mmol ) in concentrated hydrochloric acid ( 30 ml ), sodium nitrite ( 1 . 78 g , 25 . 7 mmol ) in water ( 20 ml ) was added dropwise at − 10 ° c . to − 15 ° c . and the mixture was stirred for 2 hours at − 10 ° c . to − 5 ° c . ( note : the reaction was monitored by thin layer chromatography to make sure all the starting material was consumed ). tin ( ll ) chloride dihydrate ( 20 g , 88 . 6 mmol ) in concentrated hydrochloric acid ( 30 ml ) was added dropwise at − 5 ° c . the mixture was stirred 1 hour at − 5 ° c . and then left overnight . the mixture was basified with aqueous sodium hydroxide ( ph = 9 ) with ice cooling and tetrahydrofuran ( 200 ml ) was added and stirred for 30 minutes . the mixture was filtered by celite ® and the filtrate was extracted with tetrahydrofuran ( 200 ml × 3 ). the organic extraction was combined and dried over magnesium sulfate and concentrated under reduced pressure to provide the title compound ( 3 . 2 g , 78 . 8 %). 5 - hydrazino - 2 -( methylsulfonyl ) pyridine was dissolved in hcl - methanol ( 10 %, 30 ml ) and volatiles were removed under reduced pressure . the residue was washed with ether and employed directly to next step without further purification . [ 0520 ] 1 h - nmr ( dmso - d 6 ) δ : 8 . 40 - 8 . 37 ( m , 1h ), 7 . 96 ( d , j = 8 . 6 hz , 1h ), 7 . 55 - 7 . 45 ( m , 1h ), 3 . 19 ( s , 3h ). to a solution of 2 , 5 - dibromopyridine ( 23 . 4 g , 0 . 099 mol ) in ether ( 500 ml ), n - butyl lithium ( 1 . 52 m in n - hexane , 68 ml , 0 . 10 mmol ) was added dropwise at − 78 ° c . and the mixture was stirred for 1 hour at the temperature . dimethyldisulfide ( 9 . 8 ml , 0 . 11 mol ) was added slowly at − 78 ° c . and the mixture was stirred for 1 hour at that temperature and further 1 hour at 0 ° c . the mixture was quenched with aqueous 1 n hydrochloric acid ( 200 ml ) and extracted with ether ( 100 ml × 2 ) , dried over magnesium sulfate ( mgso 4 ), and concentrated in vacuo gave the title compound ( 18 . 9 g , 94 %). [ 0524 ] 1 h - nmr ( cdcl 3 ) δ : 8 . 24 ( dd , j = 0 . 8 , 2 . 5 hz , 1h ), 7 . 43 ( dd , j = 2 . 8 , 8 . 4 hz , 1h ), 7 . 38 ( dd , j = 0 . 8 , 8 . 4 hz , 1h ), 2 . 50 ( s , 3h ). to a solution of 5 - methylthio - 2 - bromopyridine from step 1 ( 18 . 9 g , 0 . 093 mol ) in methylene chloride ( 600 ml ), m - chloroperbenzoic acid ( 48 g , 0 . 19 mol ) was added portionwise at 0 ° c . and the mixture was stirred for 2 hours at room temperature . aqueous saturated na 2 so 3 ( 200 ml ) was added and stirred for 15 minutes and organic phase was separated and washed with aqueous saturated sodium bicarbonate ( nahco 3 ) ( 200 ml ), dried over magnesium sulfate ( mgso 4 ), and concentrated in vacuo gave the title compound ( 20 . 9 g , 96 %). [ 0527 ] 1 h - nmr ( cdcl 3 ) δ : 8 . 91 ( d , j = 2 . 6 hz , 1h ), 8 . 06 ( dd , j = 2 . 6 , 8 . 4 hz , 1h ), 7 . 73 ( d , j = 8 . 4 hz , 1h ), 3 . 12 ( s , 3h ). a mixture of 5 - methylsulfonyl - 2 - bromopyridine from step 2 ( 20 . 9 g , 0 . 088 mol ) and anhydrous hydrazine ( 5 . 6 ml , 0 . 18 mol ) in ethanol ( 200ml ) was refluxed for 4 hours . after cooled to room temperature the mixture was concentrated . the residual solid was washed with aqueous saturated nahco 3 ( 100 ml ) and water ( 100ml ) and collected by filtration to give pale yellow solid ( 9 . 6 g ). the solid was treated with 10 % methanolic hcl ( 80 ml ) and the precipitate was collected by filtration to give the title compound ( 9 . 8 g , 50 %). [ 0530 ] 1 h - nmr ( dmso - d 6 ) δ : 8 . 54 ( s , 1h ), 7 . 99 ( d , j = 8 . 9 hz , 1h ), 6 . 94 ( d , j = 8 . 9 hz , 1h ), 3 . 20 ( s , 3h ). ( hydrazine proton was not detected ). chlorosulfonic acid ( 200 ml , 3 mol ) was added in a 3 - necked 1 liter flask , followed by the portionwise addition of n -( 3 - fluoro - phenyl )- acetamide ( 91 . 8 g , 600 mmol ) in an ice - water bath . the reaction mixture was then heated at 70 ° c . for 5 hours , and then cooled down to room temperature . the reaction mixture was diluted with methylene chloride ( 300 ml ), and the resulting mixture was poured into 1 liter of crushed ice . the aqueous layer was extracted with methylene chloride ( 2 × 400 ml ), and the combined organic layers were concentrated to about 300 ml in vacuo . the residue was cooled in an ice - water bath , and 28 % ammonia ( 120 ml ) was slowly added over 1 hour , and the temperature in the reaction flask was maintained between 0 ° c . to 10 ° c . the white precipitate was formed , and it was collected by filtration drying under high vacuum ( 71 . 0 g , 51 %). to a stirred solution of sodium hydroxide ( 120 g , 3 mol ) in water ( 500 ml ) was added n -( 3 - fluoro - 4 - sulfamoyl - phenyl )- acetamide ( 69 . 7 g , 300 mmol ). the reaction mixture was stirred at reflux temperature for 3 hours . the solution was then cooled to room temperature , and the ph was adjusted to 6 by addition of 5n hcl solution . most of the solvent was removed in vacuo , and the product precipitated out . the product was collected by filtration and drying under vacuum at 60 ° c . ( 32 g , 56 %). to a stirred suspension of 4 - amino - 2 - fluoro - benzenesulfonamide ( 15 . 2 g , 80 mmol ) in concentrated hydrochloric acid solution ( 180 ml ) was slowly added nano 2 ( 5 . 8 g , 84 mmol ) in water ( 180 ml ), while maintaining the internal temperature between − 15 ° c . and − 20 ° c . in a dry ice / acetonitrile bath . after the reaction mixture was stirred at − 20 ° c . for 30 minutes , a solution of tin chloride ( sncl 2 ) hydrate ( 90 . 3 g , 400 mmol ) in concentrated hydrochloric acid solution ( 100 ml ) was added dropwise , and the reaction mixture temperature was maintained between − 5 ° c . and − 10 ° c . with an ice / methanol bath . the stirring was continued at − 10 ° c . for 1 hour and then at room temperature for 4 hours . the ph of the solution was adjusted to 8 by addition of 5 n naoh solution at 0 ° c ., and the precipitate was removed by filtration through celite . the aqueous layer was extracted with tetrahydrofuran ( 3 × 600 ml ), and the combined organic layers were washed with brine , dried over magnesium sulfate ( mgso 4 ), and concentrated in vacuo . the residue was dissolved in 10 % methanolic hcl solution , followed by stirring at room temperature for 1 hour . the title compound was collected by filtration ( 12 . 5 g , 65 %). n -( 6 - mercapto - pyridin - 3 - yl )- acetamide ( 30 g , 17 . 3 mmol ) was dissolved in cold concentrated hydrochloric acid solution ( 225 ml ), followed by the addition of ice water ( 50 ml ). chlorine was bubbled into solution , and the temperature was kept below 10 ° c . the solution became dark brown first , and the chlorination was complete after 3 hours when the temperature no longer rose and the color of the solution lightened . the reaction was diluted with ice and water ( 1 . 2 kg ) while keeping the temperature below 10 ° c . the product , 5 - acetylamino - pyridine - 2 - sulfonyl chloride , was collected by filtration and air - dried . this was then suspended in chloroform ( chcl 3 ) ( 200 ml ), followed by the addition of 30 % ammonia solution ( 100 ml ), and the resulting reaction mixture was stirred for 2 hours . the solvent was removed in vacuo to give a black solid , 2 - sulfamyl - 5 - acetylamino - pyridine . 2 - sulfamyl - 5 - acetylamino - pyridine was dissolved in 0 . 85 n naoh solution ( 500 ml ), and the resulting solution was stirred at refluxing temperature for 3 . 5 hours . after cooled down to room temperature , the reaction mixture was extracted with 3 : 1 of chcl 3 / meoh solution ( 3 × 200 ml ). the aqueous layer was neutralized to ph 7 , and water was removed in vacuo to give the crude product , which was recrystallized from water to afford the title compound ( 21 . 6 g , 70 %). to a stirred solution of 2 - sulfamyl - 5 - amino - pyridine ( 3 g ) in concentrated hydrochloric acid solution ( 23 ml ) was added nano 2 ( 1 . 4 g , 20 mmol ) in water ( 23 ml ) while maintaining the temperature between − 5 ° c . and 0 ° c . after the reaction mixture was stirred at 0 ° c . for 1 . 5 hours , sncl 2 ( 19 g ) in concentrated hydrochloric acid solution ( 25 ml ) was added , and the resulting reaction mixture was stirred at 0 ° c . for 1 hour , then room temperature overnight . the ph of the reaction solution was adjusted to 8 by addition of naoh ( 24 g ) in water ( 30 ml ), followed by the addition of thf ( 200 ml ). after stirred at room temperature for 30 minutes , the reaction mixture was filtered through celite ®. the aqueous layer was extracted with thf ( 3 × 200 ml ) and ethyl acetate ( 2 × 200 ml ). the combined organic layers were dried with sodium sulfate ( na 2 so 4 ), and concentrated in vacuo . the product was dissolved in 10 % hcl in methanol ( 50 ml ), and the solvent was removed in vacuo to give title compound ( 2 . 5 g ). ( 5 - methanesulfonyl - pyridin - 2 - yl )- hydrazine ( 4 . 48 g , 20 mmol ) was mixed with methanol ( 20 ml ), followed by the addition of trifluoroacetic acid ( 3 . 05 ml , 40 mmol ), and the resulting mixture was stirred at room temperature for 10 minutes . 4 , 4 , 4 - trifluoro - 3 - oxo - butyric acid methyl ester ( 3 . 40 g , 20 mmol ) was then added , and the reaction solution was refluxed for 5 hours . after cooled to room temperature , 5 n naoh solution ( 18 ml ) was added , and the resultant reaction mixture was heated at 70 ° c . for 1 . 5 hours to convert all the 2 -( 5 - methanesulfonyl - pyridin - 2 - yl )- 3 - methoxy - 5 - trifluoromethyl - 3 , 4 - dihydro - 2h - pyrazol - 3 - ol ( 2 ) to 2 -( 5 - methanesulfonyl - pyridin - 2 - yl )- 5 - trifluoromethyl - 2h - pyrazol - 3 - ol . this was then cooled down to room temperature , and diluted with ethyl acetate ( 250 ml ). the ph of the aqueous layer was adjusted to 5 . 5 by addition of 5n hcl solution . the organic layer was dried with sodium sulfate , and the solvent was removed in vacuo to give the title compound ( 4 g ). 2 - fluoro - 4 - hydrazino - benzenesulfonamide hydrochloride ( 2 . 42 g ) was suspended in methanol ( 10 ml ), followed by the addition of trifluoroacetic acid ( 1 . 53 ml ), and the resultant reaction mixture was stirred at room temperature for 10 minutes . 4 , 4 , 4 - trifluoro - 3 - oxo - butyric acid methyl ester ( 1 . 7 g ) was added , and the reaction mixture was then refluxed overnight . this was then diluted with etoac ( 150 ml ) and saturated nahco 3 solution ( 100 ml ). after separation , the organic layer was dried with sodium sulfate , and the solvent was evaporated in vacuo to give the crude product which was purified by recrystallization from methanol ( 50 ml ) and water ( 25 ml ) to afford the title compound ( 1 . 2 g ). a mixture of the hydrazine ( 4 . 47 g , 20 . 0 mmol ) and ethyl trifluoromethyl acetoacetate in dry ethanol ( 20 ml ) was heated at reflux ( 90 ° c . bath temp .) for 4 hours . the reaction mixture was cooled to room temperature and 1 n naoh ( 40 ml , 2 equiv ) was added to the reaction mixture and stirred at room temperature for 10 minutes and at 60 ° c . for ten minutes . the mixture was cooled to room temperature and ph adjusted to 2 with addition of 6 n aqueous hcl . upon addition of the acid , the product precipitated out of the solution as a pale reddish solid which was collected by filtration to provide 4 . 89 g ( 80 %). a 3 - hydroxy pyrazole ( 1 . 0 g , 3 . 25 mmol ) was suspended in dry phosphorous oxychloride ( 5 ml ) at room temperature and dimethylformamide ( dmf )( 1 . 51 ml , 6 equivalents ) was added slowly via dropwise addition . the resulting mixture was heated at 80 ° c . for 2 . 5 hours . the reaction mixture was cooled to room temperature and quenched with saturated sodium acetate solution ( 5 ml ) and water ( 5 ml ). this mixture was extracted with ether ( 20 ml × 3 ). the ether layer was washed with saturated bicarbonate ( 10 ml × 3 ), and the ether layer dried ( mgso 4 ) and concentrated in vacuo to provide 911 mg ( 79 %) of the desired product as a white solid . a 3 - hydroxy pyrazole ( 500 mg , 1 . 63 mmol ) was mixed with phosphorous oxychloride ( 5 ml ) and heated to 120 ° c . for 48 hours . the reaction mixture was cooled to room temperature , diluted with dichloromethane ( 10 ml ) and washed with water ( 10 ml × 3 ), dried ( mgso 4 ), and concentrated in vacuo to give crude white solid . this solid was redissolved in saturated bicarbonate ( 40 ml ) and extracted with dichloromethane ( 10 ml × 3 ), dried and concentrated in vacuo to give 88 mg ( 17 %) of pure product as a white solid . | 2 |
in one aspect , the present invention comprises risk manager software that preferably has two major components : credit at risk ( car ) and value at risk ( var ). var is a software component whose user interface portion resides in risk analyzer ( the client ) and whose analytics portion resides in riskengine ( the server ). it pulls intermediate measures out of the riskengine onto a user &# 39 ; s desktop , computes the final measures , and displays a report based on the user &# 39 ; s selection criteria . car is a near real - time reporting tool that monitors broker account credit risk — for example , car preferably computes net asset value and margin requirement on each account based on a broker dealer &# 39 ; s margin rule settings ; derives account buying power ; and warns risk managers when an account violates the broker dealer &# 39 ; s credit policy . if the account user violates the broker dealer &# 39 ; s margin rules severely , the risk manager may use margin calls and / or forced liquidation . in an embodiment , the var implementation of one aspect of the present invention is real - time , while prior art var implementations are overnight batch jobs . to enable real - time responses , the var embodiment preferably uses a variance - covariance model , parkinson &# 39 ; s volatility approximation with intraday adjustments , every - minute batch option revaluation based on black scholes model , a 19 - point risk array for intermediate measures for theoretical prices , a multivariate model to estimate correlations , and quadratic regression for delta / gamma estimation . in one aspect , the invention comprises stages of : ( 1 ) background data acquisition ; ( 2 ) pre - calculation for intermediate measures ; ( 3 ) client request and data loading ; and ( 4 ) report creation . background data acquisition , in certain embodiments , comprises the following steps : ( a ) risk manager connects with order managements systems to maintain data regarding real - time positions ; ( b ) risk manager connects with market data services to obtain real - time pricing data for all security types ; and ( c ) risk manager loads high - low volatility data based on past 10 days &# 39 ; data . pre - calculation for intermediate measures , in certain embodiments , comprises the following steps : ( a ) use a black - scholes formula and market prices to compute implied volatility and greeks for options ; and ( b ) use option implied volatility and stock high - low volatility to compute 19 - point risk arrays . client request and data loading , in certain embodiments , comprises the following steps : ( a ) client configures portfolios using portfolio manager and upload to server ; ( b ) client requests var ( report ; and ( c ) intermediate measures ( e . g ., positions , volatilities , and risk arrays ) are received by risk analyzer . report creation , in certain embodiments ; comprises the following steps : ( a ) positions are grouped by underlying securities and risk arrays are aggregated ; ( b ) risk arrays are future aggregated across portfolio and correlation coefficients are applied ; ( c ) final measures are computed ; and ( d ) the report is sent to the user interface . more details on the above and other embodiments are provided below . the embodiments described herein are intended to be exemplary only . it is not believed to be possible or practical to describe every embodiment encompassed by the invention . those skilled in the art will recognize that many other embodiments , not described herein , are encompassed by the invention and within the scope of the appended claims . 1 ) historical and monte carlo simulations , which are more time consuming than variance - covariance models . 2 ) historical volatility , which is based on time consuming regression analysis , and is incapable of intraday correction . 3 ) binomial option pricing model , which is more time consuming than black scholes . 4 ) on - demand option revaluation , which has higher resource requirements than storing risk arrays . 5 ) pair - wise correlation coefficient matrix , which is 1000 times more resource consuming than multivariate models . 6 ) weighted average on delta , which is less accurate than quadratic regression . a risk - based margin embodiment is real - time , while prior art products are overnight batch jobs . an implementation takes an active approach in order to identify hedged positions to improve performance . this approach takes full advantage of the real - time trading and pricing infrastructure built for the realtick system , and works as well for systems with similar features . competing products tend to be stand alone products , which have problems taking advantage of a real - time quoting and trading system . the term “ var ” is used herein to refer to both the concept described below and to inventive software that calculates and uses that concept . value at risk ( var ) is a projected ( with a certain level of probability ) amount of money a financial portfolio may lose over a period of time . for instance , ($ 100 , 1 day , 95 %) means a portfolio has a 95 % chance of not losing more than $ 100 during a 1 day period . in the united states , the 1 - day 95 % standard is published by riskmetrics ™. in europe , a more conservative 10 - day 99 % standard is published by the basle committee on banking supervision . software of an embodiment of the present invention , referred to herein for convenience as “ risk manager ,” provides both measures , as well as two more intermediate levels , 1 - day 99 % and 10 - day 95 %. any var reporting is based on historical data , thus its forecast is always considered valid under “ normal circumstances .” overnight positions supplied by clearing companies via morning files preferably are uploaded to a risk database every trading day , prior to market open , by mfimporter . trade executions are uploaded to the risk database by the tradestuffer process near real - time . the server component of risk manager , riskengine , queries the risk database for a list of securities and queries price servers to obtain real - time price information as well as additional attributes . having near real - time price loads is not only an important feature for reporting equity risk , but also an essential element of estimating theoretical prices for derivatives . the system assumes a semistrong form of market efficiency , which means that all public information is reflected in the pricing of the assets . thus , it uses the real - time prices to estimate hard - to - obtain economic measures , such as the risk - free interest rate and implied volatility of options underliers . the primary historical data required to compute var is the historical volatility information for each security . many methods are used in the industry to estimate volatility . the most popular methods include the simple moving average ( sma ), exponentially weighted moving average ( ewma ), and the more general garch method . preferably , risk manager uses parkinson &# 39 ; s high - low range volatility as its primary estimation method . the parkinson number , or high - low range volatility , developed by the physicist michael parkinson in 1980 , aims to estimate the volatility of returns for a random walk , using the high and low in any particular period . parkinson &# 39 ; s volatility number is computed as follows , where h t is the period high and l t is the period low ( t being the period ). v , parkinson &# 39 ; s volatility , is an estimate of standard deviation of the rate of return on a particular security . the rate of return , r , is a continuously compound rate for the period defined as follows , where p 1 is the closing price in period 1 , and p 0 is the closing price for the previous period . n is the total number of observations , and t = 0 , 1 , 3 , . . . , n are individual observations . parkinson showed that the extreme value method is far superior to the traditional method and much more sensitive to variations of dispersion . using the parkinson method to estimate volatility can be of particular importance in studies of time and price dependence on volatility , as less data is needed to derive a given accuracy compared to the much larger amount of data required when using regression - based traditional methods . the risk manager standardizes all rates of return to a compounded daily percentage . since volatility is a measure of the daily rate of return based on daily highs and lows , during the trading day , this number can only be estimated . riskengine will start its estimates one hour after trading begins on the security to minimize impact of random factors in the marketplace . the estimation formula is as follows : h and l are high and low , t d is the total time of the trading day , and t 0 is the time period that has lapsed since the security started its trading for the day . intuitively , this method computes the parkinson &# 39 ; s volatility using the high and low of the trading hours . then , it applies a “√{ square root over ( t )} rule ” to estimate the volatility of the trading day , assuming asset prices are log - normally distributed and serial independent . the intraday estimate captures the volatility during the trading hours , yet contains significant abnormal short - term volatilities , such as those associated with information dispersion . to address this problem , the risk database keeps 10 to 15 trading days of parkinson &# 39 ; s volatility as history . the squared average for the past trading days and intraday number is the final volatility number being used by the application . the following formula is used to compute squared average , where v i are daily parkinson &# 39 ; s volatilities . while theoretical values of stocks , bonds , and futures may be computed using volatility data , derivatives require non - linear models , including black - scholes and pseudo - american . thus , other economic measures , such as risk free interest rates and underlier volatility , must be estimated . risk manager preferably uses 5 % as the risk free interest rate , regardless of the holding period , in order to simplify the process , but it can be adjusted as needed . the underlier volatility is estimated using a black - scholes model ( i . e ., newton - raphson estimation for implied volatility ). the detailed process is explained in the risk array for derivatives section below . the var calculation is computationally intensive , especially when derivatives are involved . there are several approaches on the market that make the process manageable . some systems , such as riskmetrics ™, use delta - gamma estimation to compute option theoretical values . the drawback is that the method can deal only with situations when underlier movement is relatively small , thus undervaluing the risk on derivatives on volatile securities . span and tims , on the other hand , use a full valuation model , which is the most resource consuming . to limit the burden on user systems , they conduct most of the complex computations on the server side in an overnight batch job and store the resulting theoretical prices based on different scenarios in risk arrays . this way , client desktops only need to act as reporting tools that apply basic arithmetic to the risk arrays to form final reports . risk manager preferably uses a method similar to those of span and tims for options valuation , but it improves and expands on that approach by estimating intraday volatility and conducting risk array computations every two minutes , due in large part to the advantages of using parkinson &# 39 ; s method . when an account is flagged as tims - compliant , risk manager preferably triggers a calculation that applies tims methodology , using an extension library to the above - described software , which in an embodiment is part of the server side of risk analyzer . the risk array preferably stores price indices relative to the current trading price in a 19 element array . the middle position is 1 , representing the current price itself , and other positions are theoretical prices as a ratio to the current price based on different scenarios . table 1 illustrates a risk array for a stock . since volatility is the standard deviation of return , we use the standard deviation symbol σ to represent volatility . in the above example , we assume the stock has a daily volatility of 2 , 5 %, and z is the standard normal random variable . at position − 5 , for instance , the theoretical value of the stock is 0 . 96 times current price . since z − 1 . 65 at this point , there is a n ( z & lt ;− 1 . 65 )= 5 % chance that the stock value will be below this number , where n ( x ) is the standard normal cumulative distribution . for a 1 day forecast , positions − 6 to 6 are sufficient . however , when we need to expand the forecast to 10 days , we need to apply the √{ square root over ( t )} rule ( i . e ., σ 10 =√{ square root over ( t )} σ , where t = 10 ). since value = e zσ this is equivalent to applying the √{ square root over ( t )} rule to z . thus , for a 10 day forecast , positions − 9 , − 8 , 8 , and 9 are used . risk arrays for derivatives preferably have the same format as those of stocks . table 2 shows a risk array for an option . the key difference is that volatility and z are now for the underliers rather than the derivatives themselves . the values preferably are now based on a more complex black - scholes model , which makes them non - linear . let &# 39 ; s assume the black - scholes model has the following form , where p = option price , p u = underlier price , r f = risk free interest rate , t = time to expiration , and v = underlier volatility : p = bs ( p u , r f , t , v ) the system first uses current option price to solve for implied volatility ( v 0 ) using newton - raphson estimation . then it computes the risk array for the option , where i =− 9 , − 8 , . . . , 0 , . . . , 8 , 9 , and r ui is the risk array for the underlier : the simulated price index points now carry exactly the same probability as those of the underliers , representing perfect correlation . this allows us to easily construct the market value risk arrays for a group of positions with the same underlier . the following greeks preferably are computed for each option , while their definitions are extended to cover all securities . delta : change of option price per unit value change of the underlier . it is the first derivative of the black scholes formula . gamma : change of delta per unit value change of the underlier . this is the second derivative of the black scholes formula . vega : change of option price per percentage change of the underlier &# 39 ; s annualized volatility . lambda : percentage change of option price per percent change in underlier value . these greeks are computed and reported to users . delta and lambda are available for aggregation to a group of assets with the same underlier ( i . e ., the “ underlier group ”). for each position in a portfolio , a market value risk array preferably is computed as follows , where r , is the risk array for the security and mv i , is market value : then a portfolio is first divided into underlier groups ( groups of positions that have the same underlier ). a market value risk array then is aggregated as follows : intuitively , since all positions in an underlier group have the same underlier , their market value movements are perfectly correlated . since each position of the risk array represents one possible scenario of underlier movement , the underlier group market value risk array contains the possible market value of the group for each scenario . the z value and the cumulative probability of each scenario is exactly the same as the risk array of the underlier . therefore , for the underlier group , in the meantime , the simulated 18 scenarios allow us to estimate two other important risk measures , the delta and the lambda ( elasticity ), for the underlier group . we take the middle three data points ( umv − 1 , pr − 1 ), ( umv 0 , pr 0 ) and ( umv 1 , pr 1 ) to conduct a quadratic regression : umv ( pr = apr 2 + bpr + c , and thus , delta is the first derivative , or the slope , at current market value umv 0 . therefore , the following risks in underlier groups are addressed by provision of the above measures : there is no perfect way to aggregate var to a portfolio , especially when the portfolio contains multiple types of assets and derivatives . risk manager preferably makes the following assumptions during its aggregation process . the system preferably first uses underlier group market value risk arrays to estimate standard deviations by applying the following formula , where p ( x ) is the probability of value x and u is the arithmetic average : σ =√{ square root over ( σ p ( x i )( x i − u ) 2 )}{ square root over ( σ p ( x i )( x i − u ) 2 )}=√{ square root over ( σ p ( x i ) x i 2 − u 2 )} since we assume that the portfolio is diversified , market value of the portfolio , as the sum of market values of all underlier groups , is normally distributed . therefore , the standard deviation of the portfolio market value is calculated as follows , where δ i is the standard deviation of an underlier group market value and p ij is the correlation coefficient between underlier group i and j : thus , var values are computed as follows based on an assumption of normal distribution of the portfolio market value : to assist users in comparing portfolio risk levels , the system also provides var as a percentage of the portfolio net asset value , which includes cash equivalents in the portfolio . although var calculation is a complex process , the reporting of var preferably is based on simple spreadsheet - like data grids . users have the freedom to arbitrarily define portfolios , choose var measure sets , and navigate through the reporting hierarchy . a portfolio , generally defined , is a set of investment assets . to assist the user with efficiently creating specific portfolios , the risk manager preferably provides a portfolio manager feature . it allows users to arbitrarily create portfolios that tie into a firm - bank - branch - customer - deposit hierarchy . it also offers the flexibility to add a user &# 39 ; s own positions , which also can be used as a tool to analyze what - if scenarios associated with var reporting . a var report may contain multiple portfolios , allowing users to compare risk exposures on different portfolios or to create hypothetical portfolios to assess impact of certain trading activities . a var report has three levels : portfolio , underlier group , and position . the report is presented in a spreadsheet format , while users can navigate through the reporting hierarchy . more details on a preferred gui are provided below . certain levels of market efficiency are assumed in the design philosophy . 1 . it is assumed that the fundamental securities , such as stocks , bonds , foreign exchanges , and futures exhibit a random walk , with a short - term growth expectation of 0 . thus , prices of these fundamental securities exhibit a log normal ( delta - normal ) distribution . 2 . it is assumed that the price movement is serial independent in the short - term ( i . e ., the time autocorrelation approaches 0 ). therefore , the rate of return on these securities are independently identically normally distributed ( iind ). 3 . it is assumed that the prices of derivatives fully capture market expectation on holding cost ( risk free interest rates ), underlier volatility during the holding period , and rationality of time premium ( no early exercise ). thus , a black - scholes model is valid for computing theoretical values of derivatives . all of the above assumptions are commonly made by industry practitioners and academia . the term “√{ square root over ( t )}” rule refers to the following : given δ as the standard deviation of an identical independent random variable , the sum of the t experiments have a standard deviation of √{ square root over ( t )} σ . in a time series , if σ is the standard deviation for one period , and assuming iid , √{ square root over ( t )} σ is the standard deviation of t periods . the √{ square root over ( t )} rule is preferably used in several ways in risk manager . it is used to estimate daily volatility intraday . for instance , for an 8 hour trading day , if on hour 5 we observe a volatility of v , we project the whole day volatility to be √{ square root over ( 8 / 5 )} v . when we report the annualized volatility , we use √{ square root over ( 225 )} v , where v is the daily volatility ( there are typically 225 trading days per year ). and finally , we use √{ square root over ( 10 )} v as 10 day volatility for var calculations , and to estimate 10 day standard deviation of portfolio market value , where v is the daily volatility and δ is the daily standard deviation of portfolio market value . short - term time series for financial securities have a very low autocorrelation . thus , the √{ square root over ( t )} rule provides an excellent approximation . however , long - term autocorrelations of time series on financial securities are much larger . therefore , a √{ square root over ( t )} rule may result in significant error for a long time horizon . the annualized volatility √{ square root over ( 225 )} v does not suffer from such problems because the v we use is a square average of 10 - 15 trading days . a horizon of 20 - 30 time periods is considered a short - term time series . the risk manager system preferably does not carry correlation values for any asset classes . the correlation computation is purely rule based . 1 . derivatives with the same underlier and the underlier itself are perfectly correlated . this is the basis of risk array computation . this assumption is made due to the fact that an underlier &# 39 ; s price movement is the dominant factor for its derivative &# 39 ; s price movement . this is a strong assumption , however , since in reality derivative prices are also influenced by interest rates , expectation of volatility , and sometimes , liquidity . 2 . correlation coefficients between securities in the same asset ( class , i . e ., stock vs . stock and bond vs . bond ), are estimated at 0 . 5 . studies show that the vast majority of the correlation is between 0 . 4 and 0 . 7 . they also show that the market value standard deviation of a moderately diversified portfolio is not very sensitive to the correlation coefficients , especially when a portfolio is reasonably diversified . in an embodiment , this strong assumption is made to maintain a reasonable level of system performance . those skilled in the art will recognize that the invention is not limited to a correlation of 0 . 5 . indeed , one could use a correlation coefficient matrix without deviating from the present invention or the scope of the appended claims . 3 . correlation coefficients between futures contracts with the same root are assumed to be 0 . 95 . futures contract value is influenced by both its underlying commodity and interest rates , but the commodity value dominates the influence . the forward interest rates between the holding periods of two futures contract also influence the prices . the strong assumption is made that underlying commodity price movement has 95 % of the influence on a futures contract . 4 . zero correlation is assumed for securities in different asset classes . for most cases , this assumption is reasonable . however , in some cases there is a high correlation ( for instance , an s & amp ; p mini futures contract has a very high correlation with an s & amp ; p based index fund and statistically significant correlation with any stocks ). preferably , risk manager does not recognize such correlations and will treat them as independent assets . most of the strong assumptions made in risk manager &# 39 ; s var calculation are insignificant in a fairly diversified portfolio . a portfolio is more diversified when : investments are in multiple securities investment are in multiple industry sectors investment are in multiple asset classes investments include both long and short positions investments include futures or derivatives for hedging purposes in most cases , if the portfolio holds positions in more than 8 non - correlated sectors , the portfolio is considered moderately diversified . if , the portfolio is less than moderately diversified , underlier groups within the portfolio should be individually examined . the underlier groups that create the most var within the portfolio should be scrutinized . we recommend against the use of portfolio var on a non - diversified portfolio to assess overall risk . the following description “ credit risk based margin in realtick ” describes a software component which preferably is part of the server side ( riskengine ) of the risk analyzer . realtick may use it to conduct real - time pre - trade margin calculation on the user &# 39 ; s trading account . riskengine preferably uses it to periodically compute margin requirements on over 20 , 000 trading accounts and flags risky accounts based on the calculations . 3 . portfolio - based : examines the entire portfolio ( account ) to determine credit worthiness and margin requirements . 4 . cross security types : handles portfolios with mixed investment vehicles ( cash equivalents , stocks , indexes , mutual funds , bonds , futures , options , fx , etc .). the preferred measure used for risk - based margining is real - time buying power : buying power = net liquidation value − margin requirements net liquidation value = cash trade day balance + net market value for investments margin requirements = initial margin requirements for day positions + maintenance margin requirements for overnight positions real - time net liquidation value , portfolio margin requirements , portfolio buying power , and incremental margin requirements are computed for incoming orders . an embodiment will report an account &# 39 ; s real - time net liquidation value ( risk_excess_equity ) via an account summary screen . should a trade be rejected due to insufficient buying power , a message box will be displayed to notify a user of the trade rejection . account manager pro ( ampro ) and web account manager ( wam ) provide gui and batch update methods to set up margin rules for their accounts . see ampro & amp ; wam user manuals . note that a separate feature , suitability rules , such as not allowing short , naked , etc . for specific accounts , supersedes margin rules . currently , ampro is used by tal supporting staff , while wam is used by broker dealers . the functionality of the two applications is very similar , but there are subtle differences . certain intraday changes to the margin rules must be conducted by tal staff upon request . broker dealers must work with tal staff to determine proper protocols and procedures to handle such cases . an embodiment obtains the margin rule setup from ampro and pass it on to a margin engine to compute appropriate margin requirements based on these rules . 1 . group rules in margin rule sets and assign them to accounts . 4 . can be based on symbol wildcard pattern matching : / esh5 and / esm5 can both match to / es *, for example . 5 . for equities and futures : initial long , initial short , maintenance long , maintenance short and cut - off price for marginable stock . 6 . for municipal and corporate bonds : market value percent and face value percent ; for government bonds : long - term bond percent and short term percent . 7 . for options : underlier percent , and underlier minimum percent for deeply out of money options . 8 . each margin rule can be a percentage of the market value or a fixed amount . 1 . government bonds — typically 5 % of face for short term and 10 % for long term . 2 . municipal bonds — typically 15 % of market value or 10 % of face , whichever is higher . 3 . corporate bonds — typically 30 % of market value or 15 % of face , whichever is higher . 1 . stocks — typically $ 5 + to be marginable , long / short initial / maintenance are house specific . 1 . stock options — long positions are not marginable , 25 % underlier value for naked , 10 % for deeply out of money naked , and margin breaks for recognized hedging positions . 1 . futures — fixed dollar amount for depending on the contract ; calendar and inter - commodity spreads receive margin credits depending on house rules . cash balance ( trade day balance ) includes beginning cash position plus all payment and proceeds from longing and shorting securities . no margin is accessed on cash . money market funds and fx spot are margined based on margin rules similar to equity . stock is purchased and cash is paid . stocks with prices greater than or equal to $ 5 are marginable . marginable stock positions preferably are used as collateral to obtain margin loans . non - marginable stock positions have no impact on account margin . the $ 5 cutoff on marginable stocks is configurable in ampro . the 30 % margin requirement in this example is configurable as an initial margin requirement or a maintenance margin requirement depending on whether it is an overnight position or a day position . ampro &# 39 ; s margin rule management capability can handle more complex scenarios . a list of stocks may be created as the hard - to - borrow list so that they are not marginable . although embodiments can handle all of the scenarios , a broker - dealer may need to create such a setup . cash proceeds are included in the cash balance , which in turn provides buying power , and market value is negative , which reduces buying power . taking advantage of this offset , margin requirements on these positions are computed consistent with long positions . by the same token , the $ 5 cutoff and the 30 % initial or maintenance margin requirements numbers are configurable in ampro . risk - based margin for options preferably is designed to follow the following philosophy : 1 . option price ( full premium ) has two components : intrinsic value ( in - the - money )+ time premium . 2 . time premium is always required at 100 %, as it will go away with time and volatility change . 3 . if in - the - money , the intrinsic value provides a matching stock position with additional value for margining . 4 . in case of an option - to - option matching , additional margin is required for maximum loss that may occur at the expiration date , based on an option payoff matrix . 5 . unlike span or tims , the system of an embodiment does not automatically include stock volatility into its computation . however , broker dealer may research stocks on their own and set margin requirement based on a pattern matching on option roots . hybrid stock options require the delivery of cash in addition to shares of stock on the settlement date . corporate actions , including mergers & amp ; acquisitions and stock splits , give rise to these derivatives . to effectively calculate margin requirements on hybrid equity options , an effective strike price is required . the effective strike price is calculated as follows : default values : cash settlement ( 0 ), settlement quantity ( 100 ), and basis value ( 100 ) basis value will not always be 100 . for example , a 3 - for - 2 stock split will change the basis value of the stock option to 150 . ( a 2 - for - 1 stock split will ordinarily increase the number of outstanding options by 2 and the basis value will remain 100 ). if settlement quantity = 0 , then the formula preferably is calculated without the settlement quantity : ** use effective strike price in all calculations for ‘ strike price ’ outright long option positions are margined at 100 % of the premium . no ampro margin rule is required , but ampro can overwrite the built - in rules . short 1 c march 35 call ; margin = orq calculation is specified in the orq requirement short 1 c march 35 put ; margin = orq calculation is specified in the orq requirement 10 % of the underline stock plus 100 % of premium . for instance , if c is trading at 20 , situation 1 ) will require $ 200 plus the time premium 25 % of the underline stock plus 100 % of premium . for instance , if c is trading at 36 , in 1 ) $ 900 plus the time premium is required . if the intrinsic value ( in - the - money value ) is greater than b , the full premium is required . ( full premium = market price = in - the - money + time premium ). for instance , if c is trading at 50 while march 35 call is trading at 16 , the full 1600 premium is required . ( because itm = 15 & gt ; 25 %* 50 .) the 10 % deeply out - of - money option requirement and the 25 % option requirement are both configurable in ampro margin rules . short 100 lu at $ 4 ; margin = 450 ( some house rules require $ 500 as minimum ) stock is shorted and a call is purchased to cover the short stock . in a synthetic put , a long in - the - money option position provides a margin credit to offset the short stock position &# 39 ; s margin requirements . therefore , a short stock position &# 39 ; s margin requirement is based on the strike price of the option rather than the stock &# 39 ; s market price . in the meantime , the intrinsic value of the option provides margin relief to the portfolio . no margin rule is required in ampro . stock is bought and a put is purchased . no specific algorithm is required , as this is a non - conventional trading strategy . the following example is to illustrate an algorithm that may be used . in a synthetic call , along in - the - money put position provides additional margin as it extends the value of the combination beyond the stock &# 39 ; s market value even if the stock price drops . therefore , the margin requirements are computed on the strike price of the option rather than the stock &# 39 ; s market price . in the meantime , the intrinsic value of the option provides margin relief to the portfolio . no margin rule is required in ampro . a put and a call with the same underlying stock , strike price , and expiration date are bought together . no specific algorithm is required for this strategy . the long straddle may be treated as two unrelated long option positions , thus their premium is traded as the margin requirement . when the stock stays at 32 . 5 on expiration , both options will have a value of 0 . thus , the maximum loss can be their market value , and the margin requirement should be set so . no margin rule is required in ampro . a put and a call with the same underlying stock , strike price , and expiration date are sold together . the straddle structure guarantees that only one side of the straddle will have a down side risk at any time . thus , the margin requirement is the naked orq on the leg that is in the money . no margin rule is required in ampro . an option is sold , and the same type option with the same underlying symbol , strike price , and longer expiration date is bought . short 1 c march 35 call ; margin = the difference of the pair &# 39 ; s market value ( premium ). short 1 c march 35 put ; margin = the difference of the pair &# 39 ; s market value ( premium ). before the expiration of either option in a calendar spread , their risk is perfectly hedged . no additional margin is required for the short . however , the net market value of the pair is withheld as they may go away with time . after the first option expires , the account ends up with a long position of the remaining option and the long side of the premium becomes the margin requirement . an option is bought , and the same type of option with the same underlying symbol , same strike price , and longer expiration date is sold . before the expiration of either option in a calendar spread , their risk is perfectly hedged . after the first option expires , the account ends up with an uncovered short position of the remaining option . thus , margin must be assessed to address the risk . under the current orq requirement , this type of spread is not recognized as a spread . thus , the short position is considered naked , taking the most conservative approach . a pair of options of the same type with the same underlying stock and expiration date are longed and shorted , respectively . the maximum loss for the bear spread strategy is the difference of the strike prices , which is the ceiling for its orq . if the difference between their strike prices is greater than the orq for the naked option , the naked orq should be used . there should be no downside risk for a bull spread . this part of the requirement addresses the maximum loss upon expiration . a long strangle is an option strategy in which an out - of - the - money call and an out - of - the - money put of the same month and stock are purchased . margin is the full premium paid . no specific algorithms . a short strangle is an option strategy in which an out - of - the - money call and an out - of - the - money put of the same month and stock are sold . orq should be the same as a short straddle . long butterfly will never lose money upon expiration . thus , no additional margin requirement will be accessed . however , it can and will lose its time premium while it approaches expiration . thus the margin requirement is the net sum of time premium of each position . the margin requirement for a long butterfly is the net premium paid . the margin requirement for a short butterfly is the difference of the lower two strikes . the premium received from a short butterfly may be applied to meet the margin requirement . this is based on the following payoff table ( table 5 ), which assumes that the left wing has the lowest strike price . it is clear that the maximum loss on a short butterfly is the difference of the lower two strike prices ( i . e . the margin requirement for short butterfly ). in addition , the net different of time premiums is required for both long and short butterflies . an asymmetric butterfly has two different sized wings , balanced by the opposite difference in strike prices . this strategy has no specific algorithm and is processed as two separate spreads . an example : if a spread is neither a calendar spread nor a bull / bear spread , the following generic formula applies : a collar is an option strategy in which stock is purchased , an out - of - the - money call is sold , and an out - of - the - money put is purchased . no specific algorithm for this strategy . all positions are processed independently . futures margin requirements are governed by two sets of setup options : ampro margin requirements for outright , and file - based parameters for spreads . all margin requirement features in ampro are available for futures . as a general practice , single stock futures requirements typically are set up as a percentage of the contract value , say 20 %. other future contracts typically are set up as fixed amount . in many cases , a regular expression pattern matching can be applied to the symbols . these rules are house rules . if the broker - dealer wants to use exchange default rules , they must request tal to set up the house rule identical to exchange rules . a file containing future spread match parameters is required to process future spreads . following is an example of a typical file : months : blank for inter - commodity spreads . for calendar spreads , if left blank , it means all months . it is a semicolon - delimited list of month numbers that can form a calendar spread . ratio : if left blank , it means a default of 1 . this is the ratio between the contract numbers of the two legs in a spread . release : required field 0 - 100 . this is the percentage of outright margin requirement to credit back when a spread is determined . remark : optional field that can contain any string for documentation purposes . an outright position can be long or short on a number of contracts . ampro contains a set of rules ( margin rule set ) governing the margining . the lookup algorithm is detailed in the ampro user manual . here is a summary : 2 . exact match : if the rule with / esh5 tag is found , it will be applied . otherwise , 3 . commodity pattern : if the rule with / es * tag is found , it will be applied . otherwise , 4 . date pattern : if the rule with /* h5 tag is found , it will be applied . otherwise , 5 . blanket pattern : if the rule with /* tag is found , it will be applied . otherwise , if a rule is found , it will say if it is a fixed amount or a percentage of the contract value . the outright requirement will thus be computed . assume the margin rule says : imr for / esh5 is 1000 . imr for / esm5 is 1100 . pending orders are orders that are submitted to the trading system but not yet filled . limited orders are the most common form of pending orders . the following example illustrates how the system deals with pending orders . if a pending order is ( 1 ) an stock , bond , mutual fund , and index , and ( 2 ) the limited price is within 5 % of the market price , it can be used to cover other derivative positions . for instance , if the pending xyz buy i executed , the following positions are safe . if the pending xyz buy is not executed due to cancellation , the following positions also are safe : if the pending order is not an equity order , or the limited price is more than 5 % away from the market price , it cannot be used to cover other positions . the following two examples illustrate the scenarios : if a cover is allowed , the short call will be charged 200 margin and the trade would go through . then , after the buy xyz order is canceled , we have : therefore , the following computation is required so that the short option order is rejected : similarly , the following example illustrates that pending option trades cannot be considered a cover : the reason for not allowing the long call limited order to be a cover is apparent . if it is canceled in the future , the account will not be in good standing . there is one exception to the above rules . if an order is determined to liquidate an existing position , it will have a zero margin charge . the following four types of compound orders are supported in an embodiment : 1 . order cancel order : a group of orders are submitted together ; one of the orders is executed , and the rest of the orders are canceled . margin requirement for this type of compound is the greatest margin requirement of individual orders . 2 . order trigger order ( sequential order ): a group of orders is submitted and one order goes live . when the live order is executed , it triggers another order , etc ., until all orders are executed . user can cancel any pending order before it is executed . the margin requirement for this order is the greatest margin requirement for the sequence of executions . 3 . all or none : a group of orders is submitted . the lead order is a limit or market order , and all other orders are conditional market orders that are triggered only when the lead order is executed . therefore , either all orders are executed or none of them are executed . the margin requirement of this type is the overall margin requirement for the group . 4 . basket orders . a group of independent orders is submitted . margin is computed as if they are submitted one by one . however , if the account buying power is insufficient , the entire basket is rejected . an embodiment will not allow partial submission of the basket . currency conversion is fully handled . each user account has a home currency . each security has a quoted currency on its real - time price . in an embodiment , all other currency specifications , especially in the ampro margin rules , are overwritten with these two currency figures . thus , all margin and risk calculations are conducted on the home currency , while an exchange rate is applied if the security is quoted in a different currency . the exchange rates preferably applied are overnight exchange rates . however , this may be modified to , e . g ., 10 minute refreshes . an objective of risk - based margin is to achieve the lowest possible margin requirement for a portfolio . while every effort is made , there is no way to guarantee that the optimum is achieved . in complex cases , to achieve the optimal low margin requirements requires significant computing power — not feasible for a real - time application . however , an embodiment should achieve an optimal margin requirement in most cases , and “ good enough ” requirements in highly complex cases . the following is the high - level pseudo code . 1 . divide a portfolio into two parts : ( a ) stock and option part ( b ) futures part . 3 . each position in the underlier group is matched with other position to look for match for 5 . for each root group , match one position to another to form calendar spreads . portfolio manager is a gui dialog box used in an embodiment ( risk analyzer ). it allows a user to define portfolios of investment positions by arbitrarily pulling together accounts predefined in an account hierarchy . riskanalyzer can then produce value - at - risk reports using the portfolio definitions . because a typical account hierarchy contains thousands of items , a challenge is to allow a user to select and remove many items from a large and complex tree structure without getting lost through browsing . the portfolio manager preferably comprises two main components : ( 1 ) a tree control with checkboxes for an entire account hierarchy ; and ( 2 ) a grid control of applicable hierarchy properties for selected items . when an item is selected in the tree control , it is added to the grid with its hierarchical properties . when an item is selected in the grid , an instant search is performed on the tree control and a corresponding item is displayed to user . ( 1 ) left pane 110 contains a large tree structure with many levels . see fig1 . ( 2 ) while navigating within the tree in left pane 110 , user selects items via the checkboxes 120 . each selected item is added to the right side grid 130 for easy viewing . user can easily lose his view of all checked items on the left because the tree structure is so large . see fig2 . 3 ) each time the user clicks a row on the right grid 130 , the software will instantly find the corresponding item on the tree structure in left pane 110 and take the user there . this way , the user doesn &# 39 ; t need to browse through the large tree structure again to find selected items . see fig3 . it will be appreciated that the present invention has been described by way of example only and with reference to the accompanying drawings , and that improvements and modifications may be made to the invention without departing from the scope or spirit thereof . | 6 |
turning now to fig1 a , 1b , fig1 a is a perspective illustration , and fig1 b is a side elevational view , of a code plate 1 . the code plate 1 , described hereat , is a linear encoder having optical based grid patterns . code plate 1 comprises a first grid pattern 11 and a second grid pattern 12 , wherein items of information are stored as &# 34 ; 1 &# 34 ; and &# 34 ; 0 &# 34 ; by portions which are transparent or opaque , respectively , and periodically disposed at a pitch p 1 and p 2 , respectively . pitch p 1 is slightly different from pitch p 2 , as shown . in this example , the first grid pattern 11 has n items of information &# 34 ; 1 &# 34 ; and &# 34 ; 0 &# 34 ; disposed at pitch p 1 within the range of a predetermined length . the second grid pattern 12 has n + 1 items of information &# 34 ; 1 &# 34 ; and &# 34 ; 0 &# 34 ; disposed at pitch p 2 ( wherein p 1 & gt ; p 2 ) within the same range . a first sensor array 21 is placed in the vicinity of first grid pattern 11 , in order to detect the first grid pattern 11 . a second sensor array 22 is placed in the vicinity of second grid pattern 12 , in order to detect the second grid pattern 12 . first and second sensory arrays 21 and 22 each comprises at least three photodiodes disposed within a length p 3 ( for array 21 ) and a length p 4 ( for array 22 ). in fig1 there are depicted for each array 21 and 22 , five photodiodes , to show that the invention is not limited to three . the front of code plate 1 is irradiated with a parallel light , and each light receiving surface of sensors 21 and 22 is irradiated with light passing through the transparent portions of the grid pattern 11 , 12 ( thus forming a stripe light pattern ), respectively . code plate 1 is given a shift , which is to be measured , and is moved relative to each sensor array in the direction indicated by arrow a or arrow b . the stripe light pattern , with which each sensor array 21 , 22 , is irradiated , are moved in accordance with that relative movement . in fig2 each of the first and second sensor arrays 21 , 22 comprises an arrangement of a plurality of silicon photodiodes 1 , 2 , 3 , . . . , . first and second switch circuits 31 , 32 are respectively connected to the photodiodes in first and second sensor arrays 21 , 22 . first and second switch driving circuits 41 , 42 successively turn on and off the switches in each switch circuit 31 , 32 , at a constant time interval . a timing circuit 40 generates different timing signals . a first signal processing circuit 51 is fed signals from the first switch circuit 31 and amplifies and filters these signals and then changes the signals into rectangular waves through a wave form shaping process . a second signal processing circuit 52 is fed signals from the second switch circuit 32 and amplifies and filters these signals and then changes the signals into rectangular waves through a wave form shaping process . these signal processing circuits 51 , 52 output alternating signals v 1 and v 2 , respectively , which have periods which respectively correspond to each scanning period of switch circuit 31 , 32 , respectively . a phase measurement circuit 6 is supplied from signal processing circuits 51 , 52 with the alternating signals v 1 and v 2 , and from timing circuit 40 with an alternating reference signal v s and measures the difference φ a between the phase angles of the alternating signals v 1 and v 2 , and the differential phase φ i between the alternating reference signal v s and the alternating signal v 1 or v 2 . a computation circuit is fed with signals from the phase measurement circuit 6 and carries out given calculations so as to obtain a signal relative to the absolute shift position . a display means 8 displays the result of the calculation . the operation of the illustrative embodiment will be explained with reference to the wave form charts of fig3 and 4 . assume that the number of transparent slits of the first grid pattern 11 , formed in the code plate 1 , is na and the number of transparent slits of the grid pattern 12 formed in code plate 1 is nb ( wherein na ≠ nb ). also , assume that code plate 1 is fixed to an object , for example , a table whose shift position is to be measured , and that it is moved with the table . assume further that the shift position of code plate 1 is x , and that each of the switch circuits 31 , 32 is scanned by the reference wave signal vs ( angular velocityω ). the light passed through the first grid pattern and the second grid pattern is projected on the respective sensory arrays 21 and 22 as grid patterns . each of the sensor arrays 21 and 22 functions as a moving grid shifting at a predetermined speed in correspondence to the reference wave signal vs ( an angular velocityω ) and even when any photodiode that is not exposed to the light passed through the transparent patterns is selected on these sensor arrays 21 and 22 by the switch , no output signal generates from the diode but when one that is exposed to that light is selected , a signal corresponding to the amount of light received generates from the photodiode . if the transparent pattern shifts , it is received by another photodiode at a different position and a signal shifted in timing ( phase ) is generated therefrom . in this case , the switches adopted to select the diodes are activated in sequence in a predetermined cycle period and from the sensor arrays 21 and 22 the signals va and vb as expressed by the formulae ( 1 ) and ( 2 ) and each having a correspondence to the position x of the code plate and a predetermined cycle period ( angular velocityω ). the first and second signal processing circuits 51 and 52 shape the signals va and bv to rectangular waves and impress them upon the phase measuring circuit 6 . ## equ1 ## this step of obtaining the signals represented by formula ( 1 ) and formula ( 2 ) pertains to a prior art process . fig3 and 4 , on the other hand , show the inventive operaional steps . fig3 shows respective signal wave forms of the signals v 1 , v 2 and v sr obtained through wave form shaping processes mentioned above with respect to fig2 . phase measurement circuit 6 measures both phase angles φ 1 and φ 2 of the alternating signals v 1 ( v a ) and v 2 ( v b ) and measures the difference φ a between the phase angles of the signals v 1 and v 2 . the phase angles φ 1 , φ 2 and φ a are represented by the following formulas . ## equ2 ## fig4 shows wave form charts illustrating the relationship between shift position and phase angles φ 1 , φ 2 and φ a . it is assumed here that na - nb = 1 . then , the difference φ a , between the phase angles of the signals v 1 and v 2 , represents the absolute position x ; and φ 1 and φ 2 represent positions between the transparent slits . that is , the value obtained by dividing the phase angles by 2π / na ( or 2π / nb ) is equal to that obtained by adding an integral number j to a position value δ within the pitch p 1 ( or p 2 ) of the transparent slit . ## equ3 ## accordingly , the shift position x is represented by below formula ( 7 ). a signal representing absolute position x can be obtained by calculator circuit 7 through calculation using the formula ( 7 ). the results of this calculation are displayed on display means 8 . ## equ4 ## when value δ is in the vicinity of 0 in formula ( 6 ), there is a possibility of the integral number being increased by + 1 . in such a case , the calculation may be done by assuming that j - 1 is the real value when φ 1 & lt ; π . fig5 through 8 illustrate other types of sensor arrays 21 , 22 and first and second grid patterns 11 , 12 on code plate 1 . fig5 shows an embodiment wherein magnetized portions n , s , s , n . . . are formed to represent items of information &# 34 ; 1 &# 34 ; and &# 34 ; 0 &# 34 ; in a grid pattern 11 ( or 12 ). the sensor array 21 ( or 22 ) may comprise hall elements for detecting magnetic flux from the magnetized portions . fig6 shows another embodiment wherein items of information &# 34 ; 1 &# 34 ; and &# 34 ; 0 &# 34 ; are represented by a conductor pattern forming conductive and non - conductive portions on grid pattern 11 ( or 12 ). a coil pattern is formed on sensor array 21 ( or 22 ) so as to detect voltage signals caused by magnetic induction . the conductor pattern may also be made of a magnetic substance and the variations of inductance may be detected by a coil pattern array . fig7 shows a further embodiment wherein an electrically conductive flat plate forms slits therein as the grid pattern 11 ( or 12 ). an electrode array facing the flat plate is used as sensor array 21 ( or 22 ) and detects variations of capacitance at the electrode array . the information is stored as presence or absence of capacitance or as variations in capacitance . fig8 shows another embodiment wherein grid pattern 11 ( or 12 ) has electrically conductive electrode portions and non - conductive portions . a contact point array , for contacting the conductive electrode , is formed as sensor array 21 ( or 22 ). the information is stored as presence of absence of electrical conductivity . these embodiments have been described assuming that the first and second switch circuits 31 , 32 are scanned by reference signals having the same frequency . the first and second switch circuits 31 and 32 , however , may be scanned by signals having different frequencies , sin ωat and sin ωbt . in such a case , formulas ( 1 ),( 2 ) and ( 5 ) can instead be represented by below formulas ( 8 ),( 9 ) and ( 10 ) respectively . ## equ5 ## the above embodiments have been described with respect to arrangements providing linearly disposed grid patterns adapted to linear encoders . however , the invention may be equally applied to rotary type encoders wherein first and second grid patterns may be formed around the circumference of a code plate which forms a disk . the absolute angle is then measured . in the above description , the relationship between lengths p 3 and p 4 ( being the distance between which the sensors in the first and second sensor arrays 21 , 22 are disposed ) and pitches p 1 and p 2 of the two sets of slits in which each item of information &# 34 ; 1 &# 34 ; and &# 34 ; 0 &# 34 ; is disposed , has not been specifically limited . the relationship between the pitches p 1 and p 2 of the two sets of slits can be of any value provided that pitch p 1 does not equal pitch p 2 . also , the relationship between length p 3 and p 4 of the sensor arrays 21 , 22 located behind the slits can be of any value provided that length p 3 does not equal length p 4 . although there are shown five photodiodes in each of sensor arrays 21 , 22 , the invention is not limited to five . there should be at least three photodiodes within each length p 3 and p 4 , but more can be used , as depicted in fig1 to be five . turning now to fig9 the value , indicating absolute position of a rotating shaft , is outputted as the number of rotations and the angle of rotation thereof . that is , code disk plate 1 , on which are formed first and second grid patterns 11 , 12 , each representing one full circuit around the circumference of the disk , is fixed to a rotating shaft 10 , to which is also connected a revolution detector 9 . computation circuit 7 calculates the angle of rotation , representing the absolute position , by using signals related to phases φ 1 , φ 2 and φ a which are supplied from phase measurement circuit 6 , and processes a signal supplied from revolution detector 9 , so as to calculate the number of revolutions , finally obtaining a signal indicating the number of rotations and the absolute position of rotating shaft 10 by adding the resultant values of these calculations . since it suffices for revolution detector 9 to be capable of detecting only one revolution of rotating shaft 10 , other known types of revolution counter , for example , an optical or magnetic type counter or a type of counter which uses magnetic bubble elements , are also applicable . one example of dimensions and the characteristics of an encoder having the structure of fig9 are as follows : diameter of the code disk , φ51 ; diameter of the rotary disk 10 , φ14 ; number of slits in the first grid pattern , 11 ( number of slits over one round of the grid pattern ); n = 199 . for the first and second sensory arrays 21 , 31 , 22 and 32 , those having eight photodiodes arranged in one slit pitch of the code plate and further , those including as many parallelly connected photodiodes as corresponding to five slit pitches , are use for increasing the light receiving power and equalizing photosensitivity , thereby achieving the encoder accuracy ( accuracy 6 . 5 arc - sec ) of 1 / 200 , 000 . fig1 depicts use of an encoder ec as a position signal feedback element . a servo apparatus capable of outputting the mechanical position with high accuracy and resolution is thereby realized . in this arrangement , a position setting signal e s is fed to an adding circuit ac as one input signal , and the output signal from adding circuit ac is fed to a motor mo and the motor outputs the mechanical position . the motor mo may be a linear motor , a stepper motor or a direct current servo motor . the encoder ec , according to the invention , is adapted for detecting the mechanical position and comprises a code plate and sensor array for detecting the grid pattern on the code plate . the output signal e f of this encoder is fed back to the adding circuit ac as another input signal thereof . a circuit loop comprising adding circuit ac , motor mo and encoder ec functions to make position setting signal e s equal to output signal e f of encoder ec , thus obtaining the mechanical position output x of motor mo relative to position setting signal e s . according to this application , it is assumed that the encoder ec performs through its computation circuit , calculations based on the absolute position method represented by formula ( 7 ). computation circuit 7 , however , may generally calculate either the phase angle φ 1 or φ 2 in accordance with the incremental method and feed back the results of the calculation so that calculation based on the absolute position method is carried out as desired in accordance with a mode changing signal during , for example , a checking process only . fig1 depicts a group of signal processing circuits 51 , 52 , and phase measurement circuit 6 . in this arrangement , signal processing circuits 51 , 52 , each comprises an i / v converting circuit 53a , 53b for converting the output current signals of switch circuits 31 and 32 into voltage signals , a comparator 55a , 55b , for changing sine wave signals v a and v b from band pass filters 54a , 54b into rectangular waves v 1 and v 2 . phase measurement circuit 6 comprises interval counters 61a , 61b . one interval counter 61a starts counting clock pulses clk when supplied with a starting pulse from timing circuit 40 , and stops counting the clock pulses clk when supplied with the output signal from comparator 55a . digital signals relative to the phase angle φ 1 of alternating signal v 1 , supplied from sensor array 21 , through switch circuit 31 , are thereby obtained from interval counter 61a . the other interval counter 61b starts counting clock pulses clk when supplied with the output signal from comparator 55a and stops counting the clock pulses when supplied with the output signal from comparator 55b . digital signals relative to the difference φ a between the alternating signal v 1 and the alternating signal v 2 fed from the sensor array 22 through the switch circuit 32 are thereby obtained from interval counter 61b . fig1 depicts details of the group of switch circuits 31 , 32 shown in fig1 . these circuits are described with respect to signal lines connected to sensor array 21 . each signal fed from photodiodes in the sensor array 21 is fed to an adder 37 through each of multipliers 35 for weighting the signals . the multiplier 35 is supplied with a given function signal from each of function generators fg 1 . . . fg n ( n corresponds to the number of photodiodes in the sensor array 21 ). the simplest form of the multiplier 35 is a switch element , which can pick up a signal from the sensor array 21 by scanning the sensor array in accordance with signals &# 34 ; 1 &# 34 ; and &# 34 ; 0 &# 34 ; supplied from the function dgenerator fg . fig1 depicts the group of switch circuits , signal processig circuit and phase measurement circuit of fig2 . to simplify description , these circuits are described with respect to only signal lines connected to the sensor array 21 . each of the signals supplied from the photodiodes in sensor array 21 is multiplied by cos ( 2πi / n ) ( wherein i is an integral number 1 , 2 , . . . n , and n corresponds to the number of photodiodes in sensor array 21 ) through action of multiplier 35 which also acts as a switch , and is added to to each other by adder 37 and then multiplied by sin ( 2πi / n ) through action of multiplier 36 which also acts as a switch , finally being added to each other by adder 38 . assuming that the output signal of sensor array ( e . g . 21 ) is p ( θ ), then a signal va output from adder 37 and a signal vb output from adder 38 are respectively represented by the following formula ## equ6 ## then , the output signal p ( θ ) from sensor array 21 may be assumed to be a fourier series , such as represented by the following formula . ## equ7 ## in formula ( 13 ), weight of the cosine corresponds to a 1 and weight of sine corresponds to b 1 with a 1 and b 1 being respectively weighted by adder 35 and multiplier 36 . a dividing circuit 65 is supplied with output signals va and vb , fed from the adders 37 , 38 , respectively , and carries out calculation vb / va , thus , obtaining a phase output φ 1 ( which is equal to arc tan ( b 1 / a 1 )). the above described signal processing circuit and phase measurement circuit are illustrative , and other circuit arrangements may be used instead . the calculated signal obtained by the computation circuit may be transmitted in the form of digital signals or may be remotely transmitted after conversion into pulse width signals . the foregoing description is illustrative of the principles of the invention . numerous modifications and extensions thereof would be apparent to the worker skilled in the art . all such modifications and extensions are to be considered to be within the spirit and scope of the invention . | 7 |
referring now more particularly to fig2 a and 2 b , in accordance with the principles of the present invention , a method and system is herein disclosed for visual servoing of a linear apparatus rotatable in a plane π about a fixed point e , utilizing the principle of cross - ratios . the cross - ratio is measured in the image , as defined by the projections of 3 successive positions of the linear apparatus ( l 1 , l 2 and l 3 ) and by the virtual 2d line l t =( et ) that would align the projection of the linear apparatus to the target in the image . from the cross - ratio , the system estimates the rotation θ t = ( l 3 , l t ) of the needle in three dimensional space necessary to achieve the visual alignment . referring to fig2 π is a plane in which the linear apparatus or object is rotatable , and e is fixed point around which or about which the rotation is done . the initial orientation line l 1 of the linear apparatus in plane π is arbitrary and may be thought of as a vector direction in 3 - dimensional space . t is a desired target for aiming thereat the linear apparatus to be servoed . the configuration is observed through an imaging device ( not shown ), at a fixed position , resulting in a 2 - dimensional image i . upon the taking of an image , the 3d line l 1 of the linear apparatus projects into image i as a ( 2 - dimensional line ) l 1 . line l 1 is detected using known image processing techniques and its position in the image i is stored in a memory . the linear apparatus is then rotated in plane n about fixed point e by an arbitrary angle θ 1 which brings it to a position l 2 . another image is now taken by which the 3d line l 2 projects into image i as a ( 2 - dimensional line ) l 2 . this position of 12 is detected and its position stored in memory . the linear apparatus is then rotated by an arbitrary angle θ 2 . this puts it into position l 3 . another image is now taken by which the 3d line l 3 projects into image i as a ( 2 - dimensional line ) l 3 . the position of l 3 is detected and its position stored in memory . throughout the foregoing steps , target t remains stationary and projects into image i as a fixed ( 2 - dimensional ) point t . the position of t is given interactively by the user or determined by image processing . the intersection point of l 1 , l 2 and l 3 denoted in fig2 b as e , is determined by the known method of least squares . the line l t =( et ) is then constructed . it is noted that l t is the 2d projection of the 3d position l t of the linear apparatus that achieves visual servoing and that it is desired to estimate . l 1 , l 2 , l 3 and l t form a pencil of 2d lines . the cross - ratio c =( l 1 , l 2 , l 3 , l t ) of these lines is calculated . this is done using an arbitrary line d that intersects all four lines . if q 1 = l 1 ∩ d , q 2 = l 2 ∩ d , q 3 = l 3 ∩ d and q t = l t ∩ d are the intersections of l 1 , l 2 , l 3 , l t with d , then c =( l 1 , l 2 , l 3 , l t )=( q 1 , q 2 , q 3 , q t )=( q 1 q 3 * q 2 q t )+( q 1 q t * q 2 q 3 ). it is noted that the value of c is invariant with respect to the choice of the line d . one of the properties of cross - ratios is that the cross - ratio of a pencil of 3d lines is equal to the cross - ratio of the pencil of 2d lines formed by the perspective projections of the 3d lines in an image . therefore the cross - ratio ( l 1 , l 2 , l 3 , l t ) of the four 3d lines l 1 , l 2 , l 3 and l t is equal to c , i . e . ( l 1 , l 2 , l 3 , l t ) =( l 1 , l 2 , l 3 , l t )= c . from ( l 1 , l 2 , l 3 , l t ), the angle θ t necessary to rotate the linear apparatus from position l 3 to l t is estimated . the formula for θ t comes from the relationship between the cross - ratio of four lines and the angle between these lines . this gives : ( l 1 , l 2 , l 3 , l t )=( sin ( θ 1 + θ 2 )* sin ( θ 2 + θ t ))/( sin ( θ 1 + θ 2 + θ t )* sin θ 2 ). using the fact that ( l 1 , l 2 , l 3 , l t )= c , the equation can be rewritten as follows : ( c - 1 ) sin θ 2 cos θ t + ( c sin θ 2 tan ( θ 1 + θ 2 ) - cos θ 2 ) sin θ t = 0 . this equation in θ t is solved using the change of variable g = tan θ t 2 . note that there are in general 2 solutions for θ t by this equation . however , these solutions are equal modulo pi ( π ), so that they define the same line l t without ambiguity . with θ t known , the linear apparatus is rotated by angle θ t from position l 3 to l t so as to visually bring it into alignment with a line to the target , which is the result sought . this achieves visual servoing . while the invention has been herein described in terms of its general applicability , the invention finds application in various different fields . one application , by way of example , is the automatic placement of needles for percutaneous procedures and biopsies , as shown in fig3 . this process gives a needle the right position and orientation in order to reach a particular anatomical site of a patient . it is typically performed under x - ray fluoroscopy before inserting the needle . in the aforementioned u . s . patent application ser . no . 08 / 722 , 725 , and in the aforelisted pending patent applications it is shown that needle placement can be achieved by visual servoing of the needle in several successive planes , until the desired position of the needle is reached . this visual servoing can be performed utilizing the method of the present invention . another application , by way of another example , is the visual servoing of industrial tools as illustrated in fig4 . a robot arm 10 attaches labels 12 to containers 14 which are on a conveyor 16 . the scene is viewed by a camera arrangement coupled to a computer 18 for processing and visual servoing of the robot arm activity in accordance with the present invention . the invention has been described by way of illustrative preferred embodiments but it will be understood by one of skill in the art to which it pertains that various changes and modifications may be made to the invention without departing from the spirit of the for example , various imaging devices may be utilized and linear apparatus may be any of a variety of shaped objects , cylindrical or otherwise , having a suitable characteristic such as an axis , even in silhouette form , admitting of an aim or alignment being recognizable . further , it is to be understood that needle placement can be achieved by visual servoing of the needle in several successive planes , until the needle is in the desired position and orientation to reach a particular anatomical site in a patient . the action is performed under x - ray fluoroscopy before insertion of the needle . a detailed description of the method is described in appendix a . the principles of the present invention are applicable to such visual servoing . these and similar changes and modifications are intended to be within the scope of the claims following which define the invention . an apparatus for positioning or aligning a biopsy needle for proper the body of a patient at a selected point on a surface of the body , so as to enter in a straight line passing through a designated target region within the body , comprises : a base including a circular measuring portion having a center point ; a planar semicircular measuring portion mounted onto the base portion such that the center of the diameter of the semicircular measuring , portion is concentric with the center point so that the semicircular measuring portion is rotatable about the center point , the semicircle portion being further rotatable about a straight line through the diameter ; and a straight pointing device having one point pivotably affixed to the center point and being constrained for movement within a plane defined by the planar semicircular portion . any or either of the circle portion and the planar semicircular portion is formed of a portion of a non - circular shaped bed wherein the circular and semicircular portions are not discernible as such . any of the circle portion and the planar semicircular portion is formed as an equivalent graduated scale in angle measure on a non - circular shaped portion . the first and second planar measuring portions are graduated in angle measure . the first and second planar measuring portions include a read - out device for reading out angles between the base , the first and the second planar measuring portions , and the pointing device . the base is adapted for being placed on the body of a patient . apparatus for positioning or aligning a biopsy needle for proper insertion into the body of a patient at a selected point on a surface of the body , so as to enter in a straight line passing through a designated target region within the body , comprises : a base including a planar full sector measuring portion having a center point ; a planar half sector measuring portion mounted onto the base portion such that the midpoint of the chord of the half sector measuring portion is concentric with the center point so that the half sector measuring portion is rotatable about the center , the half sector portion being further rotatable about a straight through the diameter ; and a straight guiding device having one point pivotably affixed to the center point and being constrained for movement within a plane defined by the planar half sector measuring portion . apparatus for positioning or aligning a biopsy needle for proper insertion into the body of a patient from a selected point on a surface of the body , so as to enter in a straight line passing through a designated target region within the body , in conjunction with an imaging system utilizing radiation from a first source position for deriving a first radiographic image on a first image plane of a portion of the body including a first image of the selected point and a first image of the target region , the first source position , the first image of the selected point , and the first image of the target region defining a first viewing plane π , the imaging system utilizing radiation from a second source position for deriving a second radiographic image on a second image plane of the portion of the body , including a second image of the selected point and a second image of the target region , the second source position , the second image of the selected point , and the second image of the target region define a second viewing plane π 1 , comprises : first measuring circle apparatus for establishing a first auxiliary plane at a first plane angle θ 1 with respect to a selected set of coordinates and for constraining a pointer for moving rotatably about the selected point and within the first auxiliary plane to a first angle of inclination φ 1 relative to the set of coordinates such that a projection or extension of an image of the pointer on the first image plane passes through the first image of the target region ; second measuring circle apparatus for establishing a second auxiliary plane at a second plane angle θ 2 with respect to the selected set of coordinates , the second plane angle being different from the first plane angle such that the first and second auxiliary planes form an intersection line and for constraining a pointer for moving rotatably about the selected point and within the second auxiliary plane to a second angle of inclination φ 2 relative to the set of coordinates such that a projection or extension of an image of the pointer on the first image plane passes through the first image of the tangent region , whereby the first viewing plane π is uniquely defined by the angles θ , θ 2 , φ 1 and φ 2 relative to the set of coordinates ; apparatus for setting the pointer for moving rotatably about the selected point and within the first viewing plane π , now uniquely defined , to a third angle of inclination φ 3 relative to the set of coordinates such that a projection or extension of an image of the pointer on the second image plane passes through further image of the target region , whereby the pointer points directly through the selected point toward the target region . a method for positioning or aligning a biopsy needle for proper insertion into the body of a patient from a selected point on a surface of the body , so as to enter in a straight line passing through a designated target region within the body comprises the steps of : utilizing radiation from a first source position for deriving a first radiographic image on a first image plane of a portion of the body including a first image of the selected point and a first image of the target region , the first source position , the first image of the selected point , and the first image of the target region defining a first viewing plane π ; establishing a first auxiliary plane at a first plane angle θ 1 with respect to a selected set of coordinates ; moving a pointer rotatably about the selected point and within the first auxiliary plane to a first angle of inclination φ 1 relative to the set of coordinates such that a projection or extension of an image of the pointer on the first image plane passes through the first image of the target region ; establishing a second auxiliary plane at a second plane angle θ 2 with respect to the selected set of coordinates , the second plane angle being different from the 1 first plane angle such that the first and second auxiliary planes form an intersection line ; moving the pointer rotatably about the selected point and within the second auxiliary plane to a second angle of inclination φ 2 relative to the set of coordinates such that a projection or extension of an image of the pointer on the first image plane passes through the first image of the tangent region , whereby the first viewing plane i is uniquely defined by the angles θ 1 , θ 2 , φ 1 and φ 2 relative to the set of coordinates ; utilizing radiation from a second source position for deriving a second radiographic image on a second image plane of the portion of the body , including a second image of the selected point angle second image of the target region , the second source position , the second image of the selected point , and the second image of the target region define a second viewing plane π 1 ; moving the pointer rotatably about the selected point and within the first viewing plane π , now uniquely defined , to a third angle of inclination φ 3 relative to the set of coordinates such that a projection or extension of an image of the pointer on the second image plane passes through the further image of the target region , whereby the pointer points directly through the selected point toward the target region . a method for positioning a guide for a biopsy needle for its proper insertion into the body of a patient from a selected point on a surface of the body , so as to enter in a straight line passing through a designated target region within the body , in conjunction with an imaging system utilizing radiation from flirts and second source positions for deriving first and second radiographic images , includes the steps of : ( a ) selecting a first auxiliary plane at an angle θ 1 ; moving the guide within the first auxiliary plane to an angle φ 1 so as to cause the guide image on the first image plane to be aligned in a straight line through the target region ; ( b ) storing the angle φ 1 ; ( c ) selecting a second , different , auxiliary plane at an angle θ 1 ; ( d ) moving the guide to an angle φ 2 within the second auxiliary plane so as to cause the guide image on the second image plane to be aligned in a straight line through the target region ; ( e ) storing values for the angles θ 2 and φ 2 ; ( f ) calculating , by utilizing values stored for the angles , rotations α and θ so as to derive a first viewing plane π ; and ( g ) moving the guide within the first viewing plane π to an angle φ 3 so as to cause the guide image on the second image plane to be aligned in a straight line through the tangent region , whereby the guide is properly aligned . where λ is the vector product defined in r 3 , 3 - dimensional space . apparatus for positioning or aligning a biopsy needle for proper insertion into the body of a patient from a selected point on a surface of the body , so as to enter in a straight line passing through a designated target region within the body , in conjunction with an imaging system utilizing radiation from a first source position for deriving a first radiographic image on a first image plane of a portion of the body including a first image of the selected point and a first image of the target region , the first source position , the first image of the selected point , and the first image of the target region defining a first viewing plane π , the imaging system utilizing radiation from a second source position for deriving a second radiographic image on a second image plane of the portion of the body , including a second image of the selected point and a second image of the target region , the second source position , the second image of the selected point , and the second image of the target region define a second viewing plane π 1 , comprises : measuring circle apparatus having a first position for establishing a first auxiliary plane at a first plane angle θ 1 with respect to a selected set of coordinates and for constraining a pointer for moving rotatably about the selected point and within the first auxiliary plane to a first angle of inclination φ 1 relative to the set of coordinates such that a projection or extension of an image of the pointer on the first image plane passes through the first image of the target region ; the measuring circle apparatus having a second position for establishing a second auxiliary plane at a second plane angle θ 2 with respect to the selected set of coordinates , the second plane angle being different from the first plane angle such that the first and second auxiliary planes form an intersection line and for constraining a pointer for moving rotatably about the selected point and within the second auxiliary plane to a second angle of inclination φ 2 relative to the set of coordinates such that a projection or extension bf an image of the pointer on the first image plane passes through the first image of the target region , whereby the first viewing plane π is uniquely defined by the angles θ 1 , θ 2 , φ 1 and φ 2 relative to the set of coordinates ; apparatus for setting the pointer for moving rotatably about the selected point and within the first viewing plane π , now uniquely defined , to a third angle of inclination φ 3 relative to the set of coordinates such that a projection or extension of an image of the pointer on the second image plane passes through the further image or the target region , whereby the pointer points directly through the selected point toward the target region . an apparatus for positioning or aligning a biopsy needle for proper insertion into the body of a patient at a selected point on a surface of the body , so as to enter in a straight line passing through a designated target region within the body , the apparatus comprises a base including a first planar measuring portion having a center point ; a second planar measuring portion mounted onto the base portion such that a center point of the second measuring portion is concentric with the center point of the first planar measuring portion so that the second planar measuring portion is rotatable about the center point , the second planar measuring portion being further rotatable about a straight line through its center ; and a straight pointing device having one point pivotably affixed to the center point and being constrained for movement within a plane defined by the planar semicircular portion . | 6 |
reference is now made to the drawings wherein like numerals refer to like parts throughout . as used herein , the terms “ client device ” and “ end user device ” include , but are not limited to , set - top boxes ( e . g ., dstbs ), personal computers ( pcs ), and minicomputers , whether desktop , laptop , or otherwise , and mobile devices such as handheld computers , pdas , video cameras , personal media devices ( pmds ), such as for example an apple ipod ™, or motorola rokr , lg “ chocolate ”, and smartphones such as the apple iphone ™, or any combinations of the foregoing . as used herein , the term “ computer program ” or “ software ” is meant to include any sequence or human or machine cognizable steps which perform a function . such program may be rendered in virtually any programming language or environment including , for example , c / c ++, fortran , cobol , pascal , assembly language , markup languages ( e . g ., html , sgml , xml , vxml ), and the like , as well as object - oriented environments such as the common object request broker architecture ( corba ), java ™ ( including j2me , java beans , etc . ), binary runtime environment ( brew ), and the like . as used herein , the term “ integrated circuit ( ic )” refers to any type of device having any level of integration ( including without limitation ulsi , vlsi , and lsi ) and irrespective of process or base materials ( including , without limitation si , sige , cmos and gaas ). ics may include , for example , memory devices ( e . g ., dram , sram , ddram , eeprom / flash , rom ), digital processors , soc devices , fpgas , asics , adcs , dacs , transceivers , memory controllers , and other devices , as well as any combinations thereof . as used herein , the term “ memory ” includes any type of integrated circuit or other storage device adapted for storing digital data including , without limitation , rom . prom , eeprom , dram , sdram , ddr / 2 sdram , edo / fpms , rldram , sram , “ flash ” memory ( e . g ., nand / nor ), and psram . as used herein , the terms “ microprocessor ” and “ digital processor ” are meant generally to include all types of digital processing devices including , without limitation , digital signal processors ( dsps ), reduced instruction set computers ( risc ), general - purpose ( cisc ) processors , microprocessors , gate arrays ( e . g ., fpgas ), plds , reconfigurable compute fabrics ( rcfs ), array processors , secure microprocessors , and application - specific integrated circuits ( asics ). such digital processors may be contained on a single unitary ic die , or distributed across multiple components . as used herein , the terms “ network ” and “ bearer network ” refer generally to any type of data , telecommunications or other network including , without limitation , data networks ( including mans , pans , wans , lans , wlans , internets , and intranets ), hybrid fiber coax ( hfc ) networks , satellite networks , and telco networks . such networks or portions thereof may utilize any one or more different topologies ( e . g ., ring , bus , star , loop , etc . ), transmission media ( e . g ., wired / rf cable , rf wireless , millimeter wave , optical , etc .) and / or communications or networking protocols ( e . g ., sonet , docsis , ieee std . 802 . 3 , atm , x . 25 , frame relay , 3gpp , 3gpp2 , wap , sip , udp , ftp , rtp / rtcp , h . 323 , etc .). as used herein , the term “ network interface ” refers to any signal , data , or software interface with a component , network or process including , without limitation , those of the firewire ( e . g ., fw400 , fw800 , etc . ), usb ( e . g ., usb2 ), ethernet ( e . g ., 10 / 100 , 10 / 100 / 1000 ( gigabit ethernet ), 10 - gig - e , etc . ), moca , serial ata ( e . g ., sata , e - sata , sataii ), ultra - ata / dma , coaxsys ( e . g ., tvnet ™), radio frequency tuner ( e . g ., in - band or oob , cable modem , etc . ), wifi ( 802 . 11a , b , g , n ), wimax ( 802 . 16 ), pan ( 802 . 15 ), or irda families . as used herein , the term “ serdes ” or serializer / deserializer refers to , without limitation , a process adapted for conversion of parallel data or signals to serial format , or serial data or signals to parallel . serdes devices facilitate the transmission of parallel data between two points over serial streams , reducing the number of data paths , and hence the number of connecting terminals or wires required . many serdes devices are capable of full - duplex operation . as used herein , the term “ signal pair ” refers generally to two conductors or buses used to pass data or signals . for example , a signal pair may comprise without limitation a transmit and receive signal pair within a port or bus transceiver . as used herein , the term “ wireless ” means any wireless signal , data , communication , or other interface including without limitation wi - fi , bluetooth , 3g , hsdpa / hsupa , tdma , cdma ( e . g ., is - 95a , wcdma , etc . ), fhss , dsss , gsm , pan / 802 . 15 , wimax ( 802 . 16 ), mwba ( 802 . 20 ), narrowband / fdma , ofdm , pcs / dcs , analog cellular , cdpd , satellite systems , millimeter wave or microwave systems , acoustic , and infrared ( i . e ., irda ). the present invention provides , inter alia , methods and apparatus for protecting a data bus port from experiencing transient damage such as may be incurred in a hotplug situation . such data ports may be used for example as network or data interfaces and reside in , e . g ., network or consumer electronic devices , client devices , personal computers , servers , and any number of myriad other applications . for instance , the present invention finds utility in protecting serial bus phy devices ( which may be rendered , for example , in the form of one or more integrated circuits ), from being damaged due to an accumulation or creation of an excessive voltage between one or more signal pairs of that phy . in an exemplary embodiment of the present invention , a circuit is provided which detects a high return voltage on a signal pair ( such as by comparing this voltage with a preset voltage level ), and responds by reducing or turning off the outgoing port power . additionally , a diode bleeds excess voltage on the signal pair to ground in order to prevent voltage from rising during the time necessary for the circuit to respond . in one variant of the invention , an rc circuit is used to detect excessive voltage between a signal pair . the rc time constant can be adjusted to a comparatively short value ( e . g ., 10 microseconds ), thus providing the circuit with a faster response time than prior art solutions . in another variant , a zener diode is used . the zener diode provides more robust handling of higher transient voltages when the outgoing power is turned off , significantly decreasing the likelihood that the zener will fail ( even over a significant number of transient events ). the zener bias levels and comparator voltage levels within the circuit are adjusted so that the comparator voltage level needed to turn off the power is as low as practicable . in some embodiments , an active current monitor / limiter is used to monitor outgoing current . in the case of shorts or near shorts , this limits the outgoing current , enabling the zener to drain the incoming current without itself being over - stressed and potentially failing . other features and advantages of the present invention will immediately be recognized by persons of ordinary skill in the art with reference to the attached drawings and detailed description of exemplary embodiments as given below . exemplary embodiments of the invention are now described in detail . it will be appreciated that while described primarily in the context of a serial bus port ( e . g ., ieee - std . 1394 , usb , serdes , or the like ), the present invention is in no way limited to such applications or architectures . moreover , while described in the context of particular circuit components and configurations , it will be appreciated by those of ordinary skill that equivalent components and configurations may be substituted or used in concert with those described herein . additionally , other types of functionality ( e . g ., signal processing , filtration , noise suppression , etc .) can be integrated or combined with the disclosed circuitry in order to expand its available capabilities or features . additionally , while described primarily in terms of wireline ( i . e ., cabled ) embodiments , the teachings of the invention may be applied to devices which utilize wireless communications or data interfaces over at least a portion of their signal path ( s ). fig1 is a block diagram presenting a high level illustration of one embodiment of the apparatus of the present invention . port 108 comprises a serial bus port adapted to interface with , e . g ., a serial bus cable 106 of the type well known in the art . outgoing power is supplied to the port 108 via a power source ( indicated as the cable power 112 in fig1 ). the port 108 receives signals transmitted over the serial bus cable 106 and transmits these signals to the phy 110 , which may comprise for example an integrated circuit , discrete logic , etc . similarly , the port 108 receives signals from the phy 110 and transmits these signals over the serial bus via the serial bus cable 106 . the active late - vg detection module 100 of the illustrated embodiment comprises logic for detecting voltage levels between one or more signal pairs associated with the port 108 during an intermitted connection , logic for comparing these voltages to a preset voltage level , and logic 102 for triggering the snapback and late - vg protection module 102 in case excess voltage between a signal pair is detected ( as measured relative to the predetermined voltage level ). when such excess voltage is detected , the snapback and late - vg protection module 102 shuts off the cable power 112 to the port 108 , thus abating return power and thereby protecting the phy device 110 from hotplug damage . while the exemplary embodiment of fig1 is described in the context of sensing voltages across a single signal pair , it will be appreciated that the detection or sending of voltage may be conducted according to other schemes , including for example sensing two or more pairs , and using the highest ( more conservative ) value to drive the circuit logic , using a coincidence - type logic ( e . g ., 1 - of - 2 , 2 - of - 3 , etc . ), using an averaging circuit or integrator , etc . moreover , the sensing or detection need not be continuous in nature , but feasibly can be implemented on a periodic or sampling basis , although such approach may expose windows of vulnerability . moreover , while described in the context of completely turning off power to the port , it will be appreciated that the power may merely be reduced rather than completely turned off ( e . g ., to a level sufficiently low as to mitigate the transient or any damage to the port components or phy ). this approach may advantageously reduce the cycle or recovery time of the port . the reduction of power may also be scaled according to the severity of the voltage transient / differential sensed by the circuit ; i . e ., a lower reduction of power for a smaller detected excess voltage . a stepped or other reduction profile may also be utilized , in effect implementing a looped control logic , such as where for example the power is reduced by a first amount during a first increment , the excess voltage again sampled , with a second and subsequent reductions being driven by the sampled value ( s ) of the excess voltage . any number of such variable control schemes will be appreciated by those of ordinary skill given the present disclosure . moreover , only portions of the port can be selectively affected by the power reduction / termination . for example , if the port comprises two or more signal pairs , each pair can be individually monitored and power selectively terminated or reduced only to those pairs affected by the transient . in some variants , the active late - vg detection module 100 further comprises at least one zener diode 114 adapted to bleed excess voltage to ground while the circuit is responding ( without it the voltage on the signal pair may continue to rise ). zener diodes advantageously allow for such bleeding of voltage by way of a controlled “ avalanche ” at the breakdown or zener voltage . zener diode construction and implementation is well known in the electronic arts , and accordingly not described further herein . in an exemplary variant , a 3 . 6v zener diode is used to provide a high degree of robustness against higher transient voltages that the zener diode may experience while the outgoing power is being turned off . however , it will be recognized that other voltage ratings , and in fact other types of mechanisms for maintaining a desired voltage across the diode in the reverse bias direction , may be used consistent with the invention . the outgoing current monitor 104 comprises additional logic for monitoring and limiting outgoing current . in the case of shorts ( effectively unlimited instantaneous current ) or near - shorts ( very high transient currents ), limiting the current in this manner enables the zener to drain incoming current without itself becoming overly stressed or failing . note that in many cases , bleeding excessive voltage to ground by means of a zener diode , coupled with cutting off or reducing outgoing power to the port 108 , will protect the phy ( chip ) 110 from hotplug damage in cases where the current is too low to trip the current limiter ( for example , in low - current , late - vg events ). fig2 a - 2 c are block diagrams presenting a low ( component ) level schematic illustration of an exemplary embodiment of the present invention , with each figure representing a separate portion of the same circuit . the circuit depicted by fig2 a - 2 c is implemented by a series of resistors 202 - 214 , capacitors 216 - 232 , diodes 234 - 254 , inductors 256 - 258 , a comparator 260 , a terminal device 262 , a controller 264 , a mosfet 266 , an inductive coil 268 , and a serial bus port 270 . note , however , that this embodiment is mainly illustrative ; the scope of the present invention also contemplates a large variety of alternate implementations using different components , component quantities , and / or component arrangements which will be recognized by those of ordinary skill in the electronic art for accomplishing the functionality described herein . the general principles of the embodiment illustrated in fig1 are also applicable to the embodiment shown in fig2 a - 2 c — i . e ., a voltage level is detected between a signal pair , compared against a predetermined voltage level , and if the voltage level between the signal pair exceeds the predetermined voltage level , excess voltage is bled to ground while outgoing power to the port is shut off . it will be appreciated that while the exemplary embodiment utilizes a fixed or predetermined voltage level for purposes of comparison , this level may be made variable as a function of time , operating mode , etc . or even deterministic ( i . e . a function of other sensed and / or predetermined variables or values ). in this fashion , the protection afforded by the circuit can be dynamically variable as a function of operating conditions , etc . as desired . additionally , certain salient features of the illustrated embodiment are also now described in greater detail . first , the embodiment shown in fig2 a - 2 c utilizes an rc circuit to detect the voltage levels across the signal pair . the exemplary configuration of the rc circuit comprises a single resistor 206 ( here , 10 kohm ) and a capacitor 216 ( 100 pf ). a circuit response time is achieved by adjusting the rc time constant of the rc circuit to approximately ten microseconds , although it will be appreciated that other values ( greater or lesser ) may be used depending on the desired attributes and particular application . moreover , more complex behavior ( e . g ., graded or stepped response time as a function of current , etc .) can be employed if desired . second , the circuit utilizes a zener diode 234 . the zener diode 234 ( rated at 3 . 6v in this embodiment ) is needed in order to attenuate the voltage levels during the time that the circuit is responding — without it , the voltage levels on the signal pair can still rise to an excessive ( damaging ) level while the circuit is in the process of responding . third , the zener bias levels ( of the zener diode 234 ) and the comparator voltage levels ( of the comparator 260 ) are adjusted such that the comparator output voltage level needed to turn off power is as low as practicable ( set at 2 . 96v in this embodiment ) while the comparator voltage level when hysteresis is applied is always higher than the electrostatic discharge ( esd ) “ rail ” 211 when there is no excessive voltage on the signal pairs ( i . e ., set at 2 . 82v , with the esd rail at a nominal 2 . 4v - 2 . 7v depending on the individual zener performance and tolerances ). fourth , a controller 264 ( in this embodiment , and active current monitor / limiter ) is used to monitor outgoing current . in the case of shorts or near - shorts , this device limits the outgoing current , enabling the zener diode 234 to drain the incoming current without itself being over - stressed . the exemplary maxim max5943 integrated circuit device with an external current sense resistor is used for this purpose , but alternatively a max5944 device can be used to protect two ports using one chip . it will be appreciated by those of ordinary skill that yet other devices and configurations can be used for this purpose . fig3 a and 3 b are flow diagrams illustrating one embodiment of the method of protecting a device ( e . g ., serial bus port ) from transient damage according to the present invention . note that even though these figures each depict separate sequences of steps , in many embodiments the sequences are adapted to run concurrently or in parallel within the same circuit . referring now to fig3 a , the voltage level is first detected across one or more signal pairs per step 302 . the detected voltage is then compared against a predetermined voltage level at step 304 . as previously noted , while the exemplary embodiment utilizes a fixed or predetermined voltage level for purposes of comparison , this level may be made variable as a function of time , operating mode , presence or lack of transient conditions , etc . or even deterministic . according to one variant , the predetermined or threshold voltage level is set at 2 . 96v . in this manner , voltage that is greater than this threshold voltage level is deemed to be an “ excess ” voltage , although other values may clearly be used . if no such excess voltage is detected , the process repeats from step 302 ( this may be a continuous sampling / detection process , as previously noted ). however , if excess voltage is detected , the circuit commences reduction or shutting off power to the outgoing port at step 306 . while awaiting the power to be adjusted / terminated , excess current is bled to ground per step 308 . in one embodiment , this is accomplished by means of the 3 . 6v zener diode previously described . this approach is used because the zener can handle higher transient voltages with a smaller chance of failure than other types of diodes , although it will be recognized that other types of devices may be used if desired . referring now to fig3 b , the generalized method of current protection is described . as shown , the voltage level is first detected across the signal pair ( s ) at step 352 . note that even though the logic for detecting voltage across the signal pair in step 352 is depicted ( fig2 a - 2 c ) as being independent from the logic for detecting voltage across the signal pair in step 302 , the scope of the present invention also includes those embodiments utilizing common logic . as can be seen in step 354 , the detection process of step 352 continues until there is sufficient voltage ( and hence current ) to activate the current limiter function . when the current limiter is tripped , the current is limited per step 356 . as previously noted , the exemplary embodiment of the circuit uses a maxim max5943 ic with an external current sense resistor is used for this purpose . however , if multiple ports require protection , a max5944 or comparable ic may be substituted for the max5943 device , or two 5943 devices used in parallel . fig4 is a flow diagram illustrating another variant of the embodiment of fig3 a . steps 402 - 408 of fig4 correspond generally to steps 302 - 308 from fig3 a . steps 410 - 414 are also included for restoring power to the outgoing port after the power has been sufficiently reduced or turned off . note that the methodology depicted in fig4 uses the lapse of a specified period of time as the trigger for restoring power to the outgoing port , although other criteria may be used ( e . g ., reduction of the excess voltage below the predetermined value or a second , lower “ floor ” or recovery voltage value , as in fig5 described below ; reduction of sensed current , etc . ), or even combinations of the foregoing . moreover , the aforementioned period of time may be made variable or deterministic ; i . e ., based on some parameter such as the magnitude of the sensed voltage excess ( knowing that larger transients will typically take longer to recover from ), magnitude of a sensed transient current , and so forth . additionally , the restoration of power may be scaled , or conducted according to a profile ( including optionally periodically sampling of the excess voltage or current ) if desired , analogous to that previously described with respect to reduction or termination of power . steps 402 - 408 generally proceed as steps 302 - 308 already described with respect to fig3 a . once the power has been reduced or shut off , this condition is detected at step 410 . the circuit then pauses for a specified period of time at step 412 . this delay period may be set in a variety of ways , as previously noted . however , in accordance with a first embodiment , the delay period is simply adjusted so that the circuit restores power within a one - half ( 0 . 5 ) second from the time that power has been terminated ( as measured e . g ., between the initiation of the event or signal to terminate power , and that used to restore power , or alternatively between actual sensed values of the applied voltage as it is reduced and restored ). at step 414 , power is restored , and the process then repeats per step 402 . fig5 is a flow diagram illustrating another variant of the methodology depicted in fig3 a . steps 502 - 508 of fig5 correspond generally to steps 302 - 308 from fig3 a . steps 510 - 516 are also included for restoring power to the outgoing port after the power has been reduced or turned off . note that the embodiment depicted in fig5 uses a voltage threshold as the trigger for restoring power to the outgoing port . steps 502 - 508 generally proceed as steps 302 - 308 already described with respect to fig3 . once the power has been shut off , this condition is detected at step 510 . at step 512 , voltage across the signal pair is again read . in one configuration , the logic that detects the voltage across the signal pair in step 512 comprises the same logic that detects the voltage across the signal pair in step 502 . as stated above , a certain voltage threshold is used as the trigger for restoring the power to the outgoing port . this threshold can be set to be the same level as the preset voltage level ( for example , 2 . 96v ) or alternatively , it may be set lower so as to help assure that undue cycling of the circuitry does not occur . once the voltage across the signal pair has decreased below the threshold at step 514 , the power is restored at step 516 . the process then repeats at step 502 . while the foregoing circuitry described with respect to fig1 - 5 comprises substantially discrete components ( e . g ., discrete resistors , capacitors , comparators , etc . ), it will be appreciated that some or all of the functionality of the circuit can be combined into an integrated circuit of a desired level of integration ( e . g ., vlsi , ulsi , soc ), which may be application - specific ( asic ) or otherwise . alternatively , the circuit disclosed herein may be rendered entirely from discrete components if desired . the circuitry ( whether in discrete or integrated form ) may also be incorporated within other components , such as for example within a portion of the aforementioned phy ic device , within or associated with a modular jack or connector ( e . g ., rj45 , including so - called 802 . 3af “ poe ” or power - over - ethernet devices ), serdes transceiver , plug - in cards or similar form factors , and so forth . the detection , reduction / shutdown , and restart logic previously described may also be controlled at least in part using a digital processor or microcontroller , which may also be integrated with the phy , soc , etc . previously described . to this end , the processor , microcontroller , etc . can utilize a software or firmware routine stored in memory ( e . g ., a program memory on the ic ) in order to implement the logic of the circuitry . logging functions may also be implemented in this fashion ; e . g ., such as wherein the microcontroller or processor logs transient protection events including optionally one or more parameters sensed during the transient ( and recovery ) such as excess voltage , current , duration , etc . this logged data can be subsequently extracted or read out of the storage device ( e . g ., via a network interface ), thereby allowing for remote diagnosis of network transient occurrences . myriad other applications and configurations of the circuit of the present invention will be readily apparent to those of ordinary skill when provided the present disclosure . it will be recognized that while certain aspects of the invention are described in terms of a specific sequence of steps of a method , these descriptions are only illustrative of the broader methods of the invention , and may be modified as required by the particular application . certain steps may be rendered unnecessary or optional under certain circumstances . additionally , certain steps or functionality may be added to the disclosed embodiments , or the order of performance of two or more steps permuted . all such variations are considered to be encompassed within the invention disclosed and claimed herein . while the above detailed description has shown , described , and pointed out novel features of the invention as applied to various embodiments , it will be understood that various omissions , substitutions , and changes in the form and details of the device or process illustrated may be made by those skilled in the art without departing from the invention . the foregoing description is of the best mode presently contemplated of carrying out the invention . this description is in no way meant to be limiting , but rather should be taken as illustrative of the general principles of the invention . the scope of the invention should be determined with reference to the claims . | 8 |
fig4 schematically illustrates a preferred system 30 and method of the present invention . specifically , as seen from fig4 , the system 30 comprises a pumpjack 32 , remotely situated , but in a region of cellular telephone transmission , having a plurality of monitoring sensors 34 a , 34 b thereon . in the embodiment shown in fig4 , sensor 34 a is a load cell sensor , effectively a strain gauge , located on the polish rod 35 of pumpjack 32 , which provides an electrical output [ which output is typically analog and is digitized to a digital output by digitizing means ( not shown ) internal to the load cell sensor 34 a or external to load cell sensor 34 a ], and which provides digital values for the force applied to polish rod 35 of the pumpjack 32 . sensor 34 b is a speed sensor , which provides , via digitizing means ( not shown ) a digital output of the speed of the motor 37 of pumpjack 32 . other similar sensors ( not shown ), together with sensors 34 a , 34 b , may be provided on pumpjack 32 to provide operational data of the pumpjack operating parameters , including but not limited to such typical and frequently monitored pumpjack operational parameters as polish rod upstroke travel distance , polish rod downstroke travel distance , pumpjack motor speed , polish rod speed , polish rod upstroke force , and polish rod downstroke force , which may then be used alone as an operational control and / or further used in a pump production equations for determining other operating conditions such as pumpjack volumetric pump output , pumpjack power consumption , stresses on pumpjack components ( eg stress equations ), and the like . digital operating data from sensors such as 34 a , 34 b , flow meter 34 c ( see fig7 ), and / or the current “ state ” of various on / off switches 34 ( f - g )— see also fig7 ) is communicated by lines 39 to controller 45 ( which may be a computer ), and thereafter transmitted wirelessly via first wireless modem ( modulating / demodulating ) device 40 over a cellular telephone network 60 . in an alternative embodiment ( not shown in fig4 ), each sensor 34 a , 34 b may transmit directly via lines 39 directly to a respective dedicated wireless modem 40 . in both scenarios , first modem 40 thereafter transmits the collected digital wirelessly via a wireless cellular telephone network , to a second modem 42 . digitized data received by second modem 42 is acquired on a network server 50 , such network server 50 operatively connected to a wan or internet . a user desiring to access the digitized data of the pumpjack operating conditions then uses a user computer 65 to log onto the internet 7 , and in particular to log onto and acquire access , typically through provision of a password , to the digitized data for the desired pumpjack 32 . fig5 shows a flowchart of the method of the present invention , for remotely monitoring the operating conditions of the pumpjack 32 . as noted in the flowchart shown in fig5 , digitized data of the operating parameters of the pumpjack , such as the position of switches ( eg . flush position switch , upper position switch , lower position switch , high pressure switch , and measurement of pump flow ) are obtained from sensors 34 d - 34 g and 34 c respectively ( see fig9 ). such data is digitized and provided to first modem 40 which transmits the digitized data over a wireless telecommunication system 60 . second modem 42 receives the digitized data , and such data is then acquired by network server 50 , and made accessible on the internet web 7 or a wan ( wide area network ). a user , or alternatively a computer software program for monitoring pumpjack 32 , such as that set out in fig8 , accesses the data on network server 50 via the internet 7 or wan . fig7 is a further elaboration of the method by which a user employing a user computer 65 may access the web to to display and use operational data which has been supplied to network server 50 . when a user desires to change or control the operational parameters of the remotely - located pumpjack 32 , the same components of the system 30 described above can be used . specifically , as may again be seen from fig4 , when a user desires to change or control the operational parameters of the remotely - located pumpjack 32 , user computer 65 is used by the user to access the internet 7 ( or a wan ) and log onto network server 50 . a graphical user interface 67 , ( accessible by the user on a web site hosted by the network server 50 , or instead operated by user computer 65 ) is used by the user to provide and select the desired operational condition for the desired pumpjack 32 . network server 50 thereafter , via second modem 42 and via telnet commands , transmits the desired pumpjack operating conditions over cellular telephone network 60 to the first modem 40 . thereafter , control means 45 , typically a printed circuit board 67 ( in one embodiment a p2290 controller board as shown in fig7 ) receives telnet commands , and regulates ( actuates / deactuates ) various pumpjack controls , for example switches 34 d , 34 e , 34 f , and / or 34 g ( see fig9 ) via wires 72 , 73 ( see fig4 ). again , the method by which a user ( or a computer software programs automatically controls a pumpjack ) is broadly set out in the flowchart depicted in fig6 . specifically , as may be seen from fig6 , a user via the internet 7 or a wan logs onto network server 50 , and selects the pumpjack 32 desired to be controlled , and changes one or more operating parameters of pumpjack 32 via a graphical user interface . network server 50 thereafter transmits , via telnet commands or such programming language as php , the selected operating parameters over a wireless cellular phone network 60 via wireless modem 42 . wireless modem 40 , situated at the remote location as pumpjack 32 , provides the commands to controller 45 , and specifically a printed circuit board 67 therewithin , a preferred embodiment of such circuit board being shown in fig9 . the controller then controls relays to thereby operate various switches , such as 34 d - 34 g , to thereby regulate pumpjack 32 operating conditions . fig8 shows a particular pump controller software flow diagram , making simultaneous use of both the monitoring and control aspects of this invention for monitoring and controlling remotely a pumpjack 32 . such pump controller software may be run on the network server 50 when access is given over the internet 7 to user computer 65 , or may be run on user computer 65 likewise when access is given over the internet 7 or a wan to network server 50 . fig9 , as indicated above , shows the various pump operational parameters which can be controlled , and which can be further determined as to their “ state ” by sensors 34 d - 34 g . various led indicators ( indicative of , for example , power being supplied ) are outputted , and may provide output which may be communicated to modem 40 and thereafter to modem 42 and to network server 50 in the manner described above , to allow a user to be aware of the “ state ” of these operational parameters for pumpjack 32 . fig1 is a terminal strip input / output description for the p2290 controller board 67 shown in fig9 , showing the various terminals 1 - 18 on the p2290 controller board which are used to control the various pumpjack operational parameters , such as the flush switch ( which is sensed by sensor 34 d — see fig9 ). although the disclosure describes and illustrates preferred embodiments of the invention , it is to be understood that the invention is not limited to these particular embodiments . many variations and modifications will now occur to those skilled in the art . for a complete definition of the invention and its intended scope , reference is to be made to the summary of the invention and the appended claims read together with and considered with the disclosure and drawings herein . | 7 |
a schematic diagram of the configuration of the system to effect lec transfer according to the present invention is shown in fig4 . as shown therein , a purchasing lec installs a remote purchasing lec switch 130 , and a purchasing lec interface 104 at a selling lec central office 100 . switch 130 is connected to the purchasing lec operation system station ( oss ) 102 . following installation , a frame attendant for the selling lec “ half - taps ” the purchasing lec interface 104 with the connection from a selling lec switch 106 into the same connector jack 110 of the cable and pair side of an df 108 , i . e ., cross connects 120 and 122 from both selling lec switch 106 and purchasing lec interface 104 overlap and connect with the same terminals of jack 110 . in the alternative , the purchasing lec can “ half - tap ” cross connects 120 and 122 during the initial installation of interface 104 . before transfer , purchasing lec switch 130 ( and / or interface 104 ) is inactive . thus , although both switch 106 and interface 104 physically connect to the same terminals of jack 110 , the subscriber &# 39 ; s telephone equipment only remains in active communication with selling lec switch 106 . when the purchasing lec oss 102 is ready to commence transfer , it contacts a selling lec oss 112 , which controls selling lec switch 106 , over an appropriate medium ( e . g ., telephone , direct connection , internet , intranet , etc .) to issue an appropriate deactivation request . selling lec oss 112 responds by disconnected selling lec switch 106 from df 108 ( e . g ., turning selling lec switch 106 off , disabling a communication relay , etc .). the purchasing lec then issues an appropriate activation command to connect purchasing lec switch 130 ( e . g ., turn switch 130 or interface 104 on , activate an appropriate relay , etc .). staff at the purchasing lec then initiate the necessary work and tests to confirm a proper connection with df 108 and the subscriber &# 39 ; s telephone equipment . if complications prevent the purchasing lec from establishing a proper connection within the allocated time period , then purchasing lec disconnects purchasing lec switch 130 and / or purchasing interface 104 , and requests selling lec oss 112 to reconnect selling lec switch 106 . purchasing lec can then attempt to correct the problem and reestablish a proper connection at its convenience . once the connection is established , the “ dead ” connections between selling lec switch 106 and df 108 can be removed by a frame attendant at his convenience . as can be seen by the above , the purchasing lec can connect with df 108 of a selling lec without the presence of a frame attendant . by placing the purchasing lec in total control of the transfer of service , the need for coordinating phone calls and / or to schedule personnel is eliminated . since the frame attendant can make any necessary connections and / or remove wires collaterally with other services at df 108 , the costs associated with this specialized service of the frame attendant are eliminated . further , the purchasing lec does not need to continually schedule transfer times to try to overcome complications in previous attempts to establish a proper connection . thus , not only does the transfer process take less time , the costs associated with the frame attendant are substantially reduced . although many ways exist for purchasing lec oss 102 to communicate with selling lec oss 112 , a preferred interactive voice response system with a graphical user interface set up by the selling lec is shown in fig5 . at step s 2 , the system provides a greeting to confirm that the purchasing lec has connected with selling lec oss 112 . the system then requests entry of an identification code at step s 4 , which is checked at step s 6 . if the code is invalid , then control returns to step s 4 to request a different code . if desired , the system may provide an “ incorrect access code ” message , and / or cut the user off if a correct code is not entered within a certain number of attempts . if the code is valid , then the system requests a purchase code , which corresponds to the particular transfer and / or time for transfer , at step s 8 . the code is checked at step s 10 . if the code is invalid , then control returns to step s 8 to request a different code . if desired , the system may provide an “ incorrect purchasing code ” message , and / or cut the user off if a correct code is not entered within a certain number of attempts . if the purchase code is accurate , then the system requests confirmation to proceed at step s 12 . this is primarily a customer service break , in that it provides a convenient step for the purchasing lec to obtain information about the subscribers that the service transfer will affect , or to abort the process . if the purchasing lec elects to proceed with the transfer , then control passes to step s 14 to determine whether selling lec switch 106 is connected or disconnected to df 108 . if connected , then selling lec oss 112 initiates the necessary procedures to disconnect selling lec switch 106 at step s 16 . the system provides a message saying that disconnection is in progress ( or complete ) at step s 18 . a closing “ thank you ” message is provided at step s 20 . if disconnected ( typically only if the purchasing lec previously disconnected the switch ), then the system indicates that the switch is disconnected at step s 22 , and requests authorization to reconnect the switch at step 24 . if reconnection is authorized , selling lec oss 112 then initiates the necessary procedures to reconnect selling lec switch 106 at step s 26 . the system provides a message saying that re - connection is in progress ( or complete ) at step s 28 , followed by the closing message at step s 20 . although not detailed herein , each of the above steps may provide additional customer service options , including returning to a main menu or requesting to speak to a customer service representative . by proceeding through the above steps s 2 - s 20 , a purchasing lec can transfer service with minimal interaction with employees of the selling lec and / or with a frame attendant . if the transfer is initially unsuccessful , then the purchasing lec oss 102 can relink with the selling lec oss 112 to execute steps s 2 - s 14 and s 22 - s 28 to return control to the selling lec until the problem is corrected , again with minimal interaction with employees of the selling lec and / or a frame attendant . in the above embodiment , the half - tap is positioned through cross connects 120 and 122 to connection jack 110 on the cable and pair side of df 108 . however , other orientations of the half - tap upstream from connection jack 110 are possible . for example , as shown in fig6 , the wires can overlap at the office equipment df 108 , thus only requiring a single wire on the cable and pair side . while the invention has been described with reference to several exemplary embodiments , it is understood that the words which have been used herein are words of description and illustration , rather than words of limitations . changes may be made , within the purview of the pending claims , without effecting the scope and spirit of the invention and its aspects . while the invention has been described here with reference to particular means , materials and embodiments , the invention is not intended to be limited to the particular disclosed herein ; rather , the invention extends to all functionally equivalent structures , methods and uses , such at all within the scope of the appended claims . by way of non - limiting example , a purchasing lec can stay connected with the selling lec at step s 18 until transfer is confirmed ; if a proper connection cannot be established , then the purchasing lec can return to steps s 4 or s 8 to initiate a re - connection procedure . similarly , a purchasing lec can stay connected with the selling lec oss 112 at step s 26 until any complications are overcome , and then return to steps s 4 or s 8 to restart the transfer . further , modifications to the above protocols , and the software / hardware for carrying out the same , are well within the skill in the art and fall within the scope and spirit of the present invention . still further , the automated protocol of the preferred embodiment is interactive voice response , in which the system provides audio messages to the second local exchange carrier and information ( e . g ., codes , option selection ) is entered by telephone keypad . however , the system may also be computer based , in which the messages and / or options are displayed on a monitor and information is entered through an computer peripheral , e . g ., keyboard and / or mouse . | 7 |
as used herein , the term &# 34 ; tuneability &# 34 ; means adjustment of the relationship between the magnitude of the direct electrical current flow through the initiator and the duration ( time ) of such current flow required to activate the initiator . referring to the drawings , there is shown in fig1 a printed circuit bridge initiator 10 according to the invention comprising a thin elongated base plate or substrate 12 made of electrically insulating or nonconducting material such as polyamide . provided on the surface 14 of the substrate 10 is a printed circuit bridge 16 that may be made of metal such as copper , aluminum , tungsten or platinum . the printed circuit bridge 16 may be deposited on the substrate 12 using conventional printed circuit methods and includes input terminals 17 and 19 and spaced electrically conducting strips 18 and 20 . a shaped bridge 22 in an initiating region 23 of the bridge 16 joins the distal ends of the strips 18 and 20 . the input terminals 17 and 19 are suitably adapted in known manner for connection to a source of direct electrical current ( not shown ). the shaped bridge 22 is in the form of two generally equilateral squares 22a and 22b , as seen in the drawing , that are positioned in contiguous relation with a corner portion of one square touching a corner portion of the other , thereby providing a necked down or narrowed portion between them , as shown . a printed or painted explosive charge of pyrotechnic material 24 may be provided in association with the shaped bridge 22 in the ignition region 23 . a protrusion 25 provided on strip 18 provides a spark initiation site to protect against electrostatic discharges that otherwise might fire the initiator 10 . in fig1 the initiator 10 is shown positioned in association with an air bag inflator 26 . inflator 26 , which may be of the solid fuel type , includes a housing 27 having a wall 28 provided with outer orifices 29 , and includes a base component 30 in which a slot 32 that extends into the interior of the inflator is formed , in which slot initiator 10 is positioned . by way of example only and not limitation , it is noted that the inflator 26 may be of the type illustrated in u . s . pat . no . 4 , 943 , 086 issued on jul . 24 , 1990 to donald j . cunningham , which patent is assigned to the assignee of the present invention . the printed circuit bridge initiator 10 heats up when the proper firing direct electrical current is passed through the bridge initiating region 23 . the arrangement is such that it will not fire if the current is less than a specific magnitude or level , irrespective of the duration of the current flow . once the initiating region 23 gets sufficiently hot , however , it ignites the printed or painted on explosive charge 24 . the charge 24 ignites an initiator output charge ( not shown in fig1 ) which , in turn , ignites the solid fuel ( not shown ) within the air bag inflator 26 . the protrusion 25 on strip 18 provides the shortest distance between the printed circuit bridge 10 and a wall 34 of the slot 32 in the base component 30 of the inflator 26 to direct a spark such that the initiating region 23 is not damaged by the electrostatic discharge , nor operation of the inflator 26 initiated . there is illustrated in fig2 an elongated printed circuit bridge 36 that is formed on a plate or substrate 38 made of a material such as polyamide . at a first end 40 thereof the substrate 38 is substantially wider than at a second end 42 thereof . this allows the use at the end 40 of the substrate 38 of wider segments 44 and 46 of deposited metal for facilitating connection to a source of electrical current for activating the bridge 36 . provided at the other end 42 of the substrate 38 are two opposed segments 48 and 50 of deposited metal each of which segments are in the shape of a square and are disposed with respect to each other such that a pointed edge of one segment 48 is in touching , that is , electrical contacting relation with a pointed edge of the other segment 50 , as shown . extending between the segments 44 and 46 at the first end 40 of the substrate 38 and the segments 48 and 50 at the second end 42 thereof are first and second strips 52 and 54 , respectively , the strips 52 and 54 being spaced from each other . each of the strips 52 and 54 , as shown , is substantially narrower than the segments 44 and 46 and also the segments 48 and 50 . a protrusion 55 is provided at an intermediate position along one of the strips , for example , strip 52 , as shown , to provide a spark initiation site and thereby guard against the deleterious effects of electrostatic discharges . in fig2 pyrotechnic material is not shown printed or painted on the surface of the substrate 38 in association with the segments 48 and 50 in the initiator region . it will be understood , however , that if so desired , pyrotechnic material may be so provided thereat . in the embodiment of the invention illustrated in fig3 and 4 , a printed circuit bridge 36 which may be similar to that illustrated in fig2 is shown inserted through an opening 56 in the base component 58 of an inflator 60 . the opening 56 includes a relatively large cutaway portion 62 adjacent the external surface of the inflator base component 58 and a narrow portion or slot 64 in an intermediate region of the base component 58 , which slot 64 leads to an inner cavity 66 in the base component 58 . the dimensions of the slot 64 in the side view as seen in fig3 are just sufficient to allow the printed circuit bridge 36 to be inserted comfortably therethrough without scraping and damaging the bridge . contained within the cavity 66 , which is closed by a foil seal 68 , is pyrotechnic material 70 in powder form which , for example , may be zirconium potassium perchlorate although other known pyrotechnic materials may also be employed . in order to guard against contact or grounding between the strips 52 and 54 of the printed circuit bridge 36 and the adjacent wall 72 of the inflator base component 58 , an epoxy seal 74 may be placed between the wall 72 and the metal forming the strips 52 and 54 of the bridge 36 . such an epoxy seal 74 may be formed either on the surface of the wall 72 or on the surface of the substrate 38 , the latter being shown in fig4 . in each case the bridge strips 52 and 54 are electrically insulated from the wall 72 . alternatively , a thin film 76 of electrically nonconductive material such as polyamide may be bonded to the surface of the printed circuit bridge 36 thereby encasing the strips 52 and 54 therein , as illustrated in fig5 . in accordance with the invention , the relatively large cutaway portion 62 adjacent the external surface of the inflator base component 58 is closed by seal means 78 which may comprise epoxy or molded seal or any other suitable sealing means , with an enlargement 80 internally of the cutaway portion 62 being provided to ensure retention of the seal means 78 therein . as best seen in fig4 a pyrotechnic material 82 is provided on the printed circuit bridge , at the initiator region 84 thereof which is located at the second end 42 of the substrate 38 , being printed or painted thereon . the pyrotechnic material may be composed of lead styphnate or any other suitable pyrotechnic material . a coating 86 of nichrome , an alloy of 60 % nickel , 24 % iron , 16 % chromium and 0 . 1 % carbon , as shown in fig4 may be applied by conventional electrostatic and other appropriate means to the metallic elements forming the segments 48 , 50 , 52 and 54 of the printed circuit bridge to avoid interaction , that possibly could be deleterious , between such metallic elements and the pyrotechnic material with which those elements come into contact . protection against electrostatic effects is provided by a pair of protrusions 88 and 90 that are provided in association with the elongated leg 54 and extends to the edge of the substrate 38 . it will be noted that the ends of the protrusions 88 and 90 remain exposed even though the thin film 76 , as shown in fig5 electrically insulates the legs 52 and 54 from the wall 72 of the slot 64 in the base component 58 of the inflator 60 . thus , the thin film 76 does not interfere with the protrusions 88 and 90 providing spark protection against extraneous electrostatic effects . in accordance with the invention , adjustment of the relationship between the magnitude of the direct electrical current flow through the printed circuit bridge of each of the embodiments herein illustrated and disclosed and the duration of such current flow that is required to activate , that is , fire the initiator may be effected by varying the thickness and width of the substrate and also by trimming , that is , varying the thickness and shape of the bridge that is printed or deposited on the substrate . such trimming may be effected by conventional laser means to get an accurate fire / no fire condition . as those skilled in the art will understand , the printed circuit bridge provides the following advantages over initiators currently used for air bag inflators . 1 . the ability to change the width and the thickness of the bridge and the shape of the bridge allows tuning of the improved initiator . the initiators known in the prior art allow only a change in the type employed and the diameter thereof whereby they have limited fire / no fire tuneability . 2 . in the prior art initiators , the glass - to - metal seal headers that are employed require lapping operations to create a flat surface for bridge attachment . the bridge is spot welded in place . the printed bridge replaces this complicated and expensive operation with a simple printed or disposition and etch operation . 3 . the printed circuit bridge could improve reliability due to its process simplicity . thus , there has been disclosed , in accordance with the invention , an improved initiator for an air bag inflator that may be fabricated by simpler methods of manufacture and is more adapted to being mass produced . the improved initiator is characterized in comprising an electrically conductive bridge that is deposited on an electrically nonconductive thin film plastic substrate of compact size in intimate contact therewith whereby the structure is resistant to damage tending to be caused by vibration , bending and handling . the improved initiator is further characterized in the ability to effect tuning thereof by adjustment of the width and / or thickness of the substrate and also the shape of the bridge . another feature of the improved initiator is the requirement thereof for only a very small feed through slot into the interior of the inflator in consequence of which , if there should be a structural failure of the initiator , the slot will be plugged by the larger products of combustion produced in the inflator . additionally , the inflator housing is strengthened because there is required only a slot of relatively small cross section for inserting the improved initiator into the interior of the inflator . by way of illustration and not limitation , it is contemplated that the printed circuit bridge initiator illustrated in fig2 may have dimensions indicated , as follows : distance from first end portion 40 to projection of 0 . 235 inch . with this description of the invention in detail , those skilled in the art will appreciate that modifications may be made to the invention without departing from the spirit thereof . therefore , it is not intended that the scope of the invention be limited to the specific embodiments that have been illustrated and described . rather , it is intended that the scope of the invention be determined by the scope of the appended claims . | 5 |
the motorized blind device 1 with orientable slats represented in fig1 comprises an orders transmitter 2 furnished with a first control interface 2 a and with a second control interface 2 b , an orders receiver 6 linked to a mechanical assembly 4 comprising horizontal slats 5 orientable about their axis , a motor 3 for orienting the slats and a motor 3 ′ for moving the slats vertically . the first control interface 2 a represented in fig2 a comprises three control buttons 11 , 12 and 13 . the buttons 11 and 12 make it possible , in a conventional manner , to raise and lower the blind respectively by activating the motor 3 ′. the button 13 makes it possible to deactivate the motor 3 ′ so as to halt the up or down motion of the blind . the orders transmitter 2 furthermore exhibits on one of its lateral faces a second control interface 2 b comprising a thumbwheel 14 . this thumbwheel , represented in fig2 a , is moveable in rotation with respect to the face of the orders transmitter 2 about an axis 15 . on its circumference it exhibits a boss 19 which makes it possible to actuate the electric contacts 20 a or 20 b according to the sense of movement of the thumbwheel . when the user turns the thumbwheel 14 in the clockwise sense s 1 , the boss 19 will act on the part 17 a of the contact 20 a so as to bring it into contact with its part 18 a and thus close the contact 20 a . when the user turns the thumbwheel 14 in the trigonometric sense s 2 , the boss 19 will act on the part 17 b of the contact 20 b so as to bring it into contact with its part 18 b and thus close the contact 20 b . the thumbwheel 14 is moveable between its two extreme positions in which the boss 19 abuts against a stud 16 a , respectively against a stud 16 b . alternatively , the contacts 20 a and 20 b may themselves serve as stops . the thumbwheel may possibly exhibit a shape 22 such as a portion of a heart cam cooperating with a spring leaf 23 acting on the latter so as to bring the thumbwheel into a position in which none of the contacts 20 a , 20 b is activated . this form of execution may be replaced by a system comprising one or more spiral springs for restoring to the rest position . the thumbwheel can be replaced as represented in fig5 by another element such as a slider 14 ′ moveable between two stops 16 ′ a and 16 ′ b in a groove made in the control interface 2 . one or more helical springs of low rigidity then make it possible to return the slider to its central rest position , in which the contacts 20 a or 20 b are not actuated . the advantage related to the embodiments of thumbwheel or slider type is their mode of actuation : specifically , to bring the element into a limit of travel position , the motion of the element must be made to glide and be accompanied by the user . this is especially intuitive for controlling the orientation of the slats insofar as the motion is slow and monitored by the user , throughout the maneuver of orienting the slats . in variant embodiments , the thumbwheel or the slider may remain in their limit of travel positions actuating the contacts 20 a and 20 b or the contacts themselves may remain in their closed position . in these cases , in addition to the angular actuation of the thumbwheel or the translation actuation of the slider , these elements may also be actuated along a second direction d 2 , for example , perpendicular to the first direction of movement d 1 described previously . the element then comes back to an intermediate position between its two limits of travel , in which position the contacts 20 a and 20 b are not actuated or the contacts regain their open position . in a second embodiment represented in fig2 b , the displacement of the thumbwheel 43 may also not be limited by two ends of travel , but the thumbwheel may be moved in rotation without stop . each displacement of the thumbwheel of a certain angle ( defining a displacement step of the thumbwheel ) in a direction , actuates an electric contact . the actuation of a contact causes , the displacement of a step of the actuator ( angle of rotation or time of actuation , for example , defined in the actuator ) in the direction corresponding to that of the movement of the thumbwheel . it is possible to transmit a control command for each displacement step of the thumbwheel . but preferably , the number of displacement steps of the thumbwheel is counted until it is stopped and then , a control command comprising the number of counted displacement steps is transmitted . the electric contacts 40 a , 40 b may then be actuated by teeth 44 on the thumbwheel 43 via the rotation of a lever 41 about an axis 42 . fig6 and 7 represent embodiments of orders transmitters in which the thumbwheel is disposed on the front face of the orders transmitter . in fig6 , the thumbwheel turns about a horizontal axis and , in fig7 , the thumbwheel turns about a vertical axis . the actuation of the contacts 20 a and 20 b makes it possible to define a control order for rotating the motor in one sense or the other , as shown diagrammatically in fig3 . an action a 1 by the user on the thumbwheel 14 in the clockwise sense s 1 closes the contact 20 a , an action a 2 in the trigonometric sense s 2 closes the contact 20 b . the contacts are connected to means of interpretation x which make it possible to differentiate between the translation orders and the rotation orders . the means of interpretation x then make it possible to transmit the orders directly to the corresponding actuator or actuators . this differentiation is important since it makes it possible to work a blind with two motors as well as a single - motor blind , while possibly reducing the latter &# 39 ; s speed of rotation for the orientation of the slats . the means of interpretation are generally composed of a microprocessor which makes it possible to analyze both the actuation of the electric contacts and possibly their actuation time . the interpretation means also comprise a memory . as a function of the various contacts and / or of the activation time of these contacts , the means of interpretation can determine whether it is an order to translate the slats that the user wishes to transmit or an orientation order . the control buttons 11 , 12 , 13 for the up and down control of the blind can actuate contacts 21 a and 21 b distinct from the contacts 20 a and 20 b . the various contacts then serve to differentiate between the actions on the first interface and on the second interface , corresponding respectively to translation and orientation orders for the slats . they may also actuate only the same contacts 20 a and 20 b as the thumbwheel 14 . in this case , other means are provided for differentiating between the translation and orientation orders for the slats . for example , the second interface comprises a third electric contact 20 c linked to the thumbwheel . this third contact 20 c can be actuated either by pressure on the thumbwheel 14 in the second direction d 2 , or by movement out of the rest position by manipulation of the thumbwheel 14 . this embodiment is shown diagrammatically in fig4 . the contact 20 c is connected to the means of interpretation x by way of a module 7 for ordering reduced speed . thus , the orders triggered by manipulating the thumbwheel contain information relating to the speed of the actuator , useful in the case of a single - motor blind . the electric contact 20 c makes it possible to differentiate between the commands input by way of the first interface and those input via the second interface . this electric contact 20 c may in addition have a function of controlling the stop of the rotation of the actuator and thus of controlling the stop of the up or down movement of the blind . if it is actuated when the actuator is off , it may have a function of setting the blind in an intermediate position . alternatively or in combination , the activation time of the control interfaces may serve to differentiate between the translation and orientation orders . in this case , the means of interpretation x comprise means 26 for differentiating between the orders comprising a detector of the activation time 24 of the control interfaces and a comparator 25 for comparing the activation time with one or more threshold values placed in memory at the level of the means of interpretation x . thus , even independently of the electric contacts of the two interfaces , a brief pulsed action on the first interface 2 a may be interpreted by the means of interpretation x as a translation command for the slats , while a short - duration sustained action on the second interface 2 b is interpreted as an orientation command for the slats . in the same way , a manipulation of the thumbwheel may also cause the transmission of a command of translation of the blind ( for example at fast speed ). each actuation of the contact 20 a or 20 b may generate a control command which is interpreted by the actuator as a rotation command of a defined step , even if the thumbwheel of the second interface 2 b has ends of travel . various alternatives and results of the manipulations of the two control interfaces 2 a and 2 b are summarized in the tables of fig8 to 11 . fig8 illustrates the results of the actions exerted on the various buttons of the control interfaces , in the case where the first control interface comprises electric contacts 21 a , 21 b and the second control interface comprises electric contacts 20 a , 20 b . the table of fig9 illustrates the results of the actions on the control interfaces , when the two interfaces are connected to the same electric contacts , and differentiation is effected by measuring the actuation time of these interfaces . this time is compared with a certain threshold placed in memory ( at the level of the means of interpretation x ). the result of the comparison makes it possible to differentiate between the translation and orientation orders . the table of fig1 illustrates the results of the actions on the control interfaces , when the two interfaces are connected to the same electric contacts and when the means of interpretation x comprise a third electric contact 20 c actuated as soon as the thumbwheel is actuated in a sense s 1 or s 2 , for example a contact normally open in the rest position . this third contact makes it possible to differentiate the orientation orders and to couple them with an order to reduce the speed of the actuator in the case of a single - motor device . the table of fig1 illustrates the results of the actions on the control interfaces , when the two interfaces are connected to the same electric contacts and when the means of interpretation x comprise a third electric contact 20 c actuated as soon as the thumbwheel is actuated in a second direction distinct from the first ( for example , by pressure on the thumbwheel ). a simultaneous action by pressure and movement of the thumbwheel distinguishes the control orders . a no - pressure movement of the thumbwheel corresponds to an actuation on the first control interface in the corresponding sense . the control interface may be a wire remote control such as described previously , but it may also consist of a wireless portable remote control , communicating for example by way of radio or infrared waves with a device for powering the motor . in this case , the various actions exerted on the various control buttons , sliders or thumbwheels are converted in the control interface by an electronic device into an electromagnetic signal . the interpretation of the control orders may be done either at the level of the control interface , or at the level of the device for powering the motor , that is to say , the means of interpretation are located at the level of the orders transmitter or at the level of the orders receiver . in the first case , the means of interpretation x differentiate the orders given by the user by action on one or other of the control interfaces 2 a , 2 b , and the orders transmitter 2 transmits a control order directly toward the orders receiver 6 of the actuator 3 or 3 ′ concerned . in the second case , the orders transmitter 2 transmits a set of data ( for example one or more identifiers of actuated contacts , a duration of actuation ) to the orders receiver 6 furnished with the means of interpretation x . these data are then analyzed by the means of interpretation x which determine therefrom the order to be given to the actuator 3 , 3 ′ concerned . in the case of a single - motor , it is possible to couple the means of interpretation with a module for ordering a reduction in the speed of the actuator . thus , the orientation commands for the slats may be effected at slow speed . in an exemplary embodiment , the means of interpretation x directly trigger a command for high - speed rotation of the actuator as soon as they detect a translation command for the slats , while they trigger a command for low - speed rotation of the actuator if they detect an orientation command for the slats , this low - speed command being sustained as long as the control interface is actuated , or at least for a duration equal to the time required for the slats to tilt from one extreme position to the other extreme position , if the control interface is actuated for a greater duration . the device according to the invention may obviously be applied to any type of blind or curtain with orientable slats . | 4 |
the following description is of the best - contemplated mode of carrying out the invention . this description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . fig1 and 2 show an audio interface 100 for a three - wire microphone , according to an embodiment of the invention . in fig1 , the three - wire microphone 130 is a digital microphone . in fig2 the three - wire microphone 150 is an analog microphone . the audio interface 100 comprises an audio jack connector 102 , an audio processing device 104 and a bias device 106 . the audio jack connector 102 has first to third contacts 102 a , 102 b and 102 c electronically connected with the three - wire microphone ( 130 or 150 ) plugged thereinto and the third contact 102 c is connected to a reference ground . the audio jack connector 102 may be an analog audio jack connector of three wires ( contacts ). in addition to receiving signals from the three - wire microphone 130 or 150 , the audio processing device 104 also detects the type of the three - wire microphone plugged into the audio jack connector 102 , and operates in response thereto . referring to fig1 , when the microphone is digital , the audio processing device 104 outputs a clock signal clk to the three - wire digital microphone 130 , then receives a digital audio signal data from the three - wire digital microphone 130 . referring to fig2 , when the microphone is analog , the audio processing device 104 receives analog audio signals from the three - wire analog microphone 150 and drives the bias device 106 to bias the first and second contacts 102 a and 102 b . the audio processing device 104 has a first terminal t 1 connected to the first contact 102 a to output the clock signal clk , a second terminal t 2 connected to the second contact 102 b to receive the digital audio signal data , a third terminal t 3 coupled to the first contact 102 a through capacitor c 1 to receive a left - channel signal l_ch of the analog audio signals , and a fourth terminal t 4 coupled to the second contact 102 b through capacitor c 2 to receive a right - channel signal r_ch of the analog audio signals . when the three - wire digital microphone 130 , is plugged into the audio jack connector 102 , the audio processing device 104 outputs a clock signal clk from the first terminal t 1 to activate the three - wire microphone 130 and subsequently receives a digital audio signal data from the three - wire digital microphone 130 through the second contact 102 b to a second terminal t 2 . the audio processing device 104 further disables the bias device 106 . in fig2 , the three - wire analog microphone 150 may comprise an analog microphone circuit 152 and a plug unit 134 as depicted in fig1 . the analog microphone circuit 152 comprises a microphone unit 152 a and an analog microphone unit 152 b to convert the analog audio signals from the microphone unit 152 a to the right - channel and left - channel signals r_ch and l_ch . when the three - wire analog microphone 150 is plugged into the audio jack connector 102 , the audio processing device 104 merely receives the analog audio signals of the left - channel signal l_ch and right - channel signal r_ch from the three - wire analog microphone 150 through the first and second contacts 102 a and 102 b to the third and fourth terminals t 3 and t 4 respectively . the audio processing device 104 further drives the bias device 106 to bias the first and second contacts 102 a and 102 b . also , the audio processing device 104 disables the first and second terminals t 1 and t 2 , for example by setting t 1 and t 2 to high impedance states . an exemplary embodiment of a three - wire digital microphone applicable with the disclosed audio interface is also provided . referring to fig1 , the three - wire digital microphone 130 comprises a microphone unit 132 and a plug unit 134 . the microphone unit 132 comprises a microphone 132 a , a digital microphone circuit 132 b to convert an analog audio signal from the microphone 132 a into the digital audio signal data , and a conversion device 132 c to convert the clock signal clk from the audio interface 100 into a power signal sp for the digital microphone circuit 132 b . the conversion device 132 c such as a rectifier receives and rectifies the clock signal clk to generate a dc voltage as the power signal sp . the rectifier can be implemented by half - bridge , full - bridge rectifiers and the likes which can convert ac signal to dc signal . the digital microphone circuit 132 b such as an analog - to - digital converter ( adc ) has a power terminal to receive the power signal sp , a clock terminal to receive the clock signal clk from the audio interface 100 , a data terminal to output the digital audio signal data and a ground terminal connected to reference ground . the digital microphone circuit 132 b is activated by the power signal sp and the clock signal clk to output the digital audio signal data through the data terminal to the second contact 102 b of the audio jack connector 102 . the plug unit 134 is a three - wire plug with a tip portion 134 a connected to the clock terminal c , a ring portion 134 b connected to the data terminal d and a sleeve portion 134 c connected to the ground terminal g . the tip , ring and sleeve portions 134 a to 134 c respectively are electrically connected to the first , second and third contacts 102 a to 102 c of the audio jack connector 102 when the three - wire digital microphone 130 is plugged into the audio interface 100 . as shown in fig1 and 2 , the bias device may be implemented by transistors m 1 and m 2 and resistors r 1 and r 2 , but is not limited thereto . the audio processing device 104 may output a logic control signal sc signal to control the bias device . for example , the audio processing device 104 may output the control signal sc with logic “ high ” to turn on the transistors m 1 and m 2 ( i . e ., enables the bias device 106 ) such that bias voltage vb is provided to the first and second terminals 102 a and 102 b when the three - wire microphone plugged into the audio interface 100 is analog type . otherwise , the audio processing device 104 outputs the control signal sc with logic “ low ” to turn off the transistors m 1 and m 2 thereby turning off the transistors m 1 and m 2 and disabling the bias device 106 . to detect type of the three - wire microphone plugged into the audio interface 100 , the audio processing device 104 may first assume the microphone is digital , then output the clock signal clk to the three - wire microphone and disables the bias device 106 . then , the audio processing device 104 awaits response of the digital audio signal data from the three - wire microphone . if the microphone is digital , the audio processing device 104 receives response of the digital audio signal data and functions accordingly . otherwise , the audio processing device 104 , not receiving an appropriate response of the digital audio signal data , enables the bias device 106 and sets the first and second terminals t 1 and t 2 to high impedance states , thereby receiving and processing analog audio signals form the three - wire analog microphone . it is noted that the type detection as described above is proposed as an example and the disclosure is not limited thereto . fig3 is a flowchart showing an audio interface method applying the disclosed audio interface , in which an audio jack connector is first provided to electronically connect with a three - wire microphone plugged thereinto , and further a three - wire digital microphone is configured to comprise a digital microphone circuit and a conversion device ( step s 1 ). the type of the three - wire microphone plugged into the audio jack connector is determined ( step s 2 ). finally , a clock signal is output to the three - wire microphone and a digital audio signal outputted from the three - wire microphone is received when the microphone is digital , or analog audio signals outputted from the three - wire microphone are received when the microphone is analog ( step s 3 ). in step s 1 , the digital microphone circuit of the three - wire digital microphone comprises a power terminal to receive a power signal , a clock terminal to receive the clock signal from the audio interface , a data terminal and a ground terminal , activated by the power signal and the clock signal to output the digital audio signal through the data terminal to the second contact of the audio jack connector into which the three - wire digital microphone is connected . the three - wire digital microphone is also configured to comprise a three - wire plug with a tip portion connected to the clock terminal , a ring portion connected to the data terminal and a sleeve portion connected to the ground terminal . in addition , the conversion device converts the clock signal from the audio interface into the power signal for the power terminal . the audio interface disclosed can use a common audio jack connector for plugging into a three - wire analog microphone or a three - wire digital microphone , and thus any electronic system such as notebook computer , cell phone , handheld devices , portable communication apparatus or other can utilize the audio interface to reduce dimension and production costs . also , the three - wire digital microphone according to the disclosure described above has a simpler configuration than conventional four - wire digital microphone . while the invention has been described by way of example and in terms of preferred embodiment , it is to be understood that the invention is not limited thereto . to the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 7 |
an embodiment of the present invention will be explained in greater detail below with reference to fig1 through 6 . tool 1 according to the present invention , which is shown in a perspective top view in fig1 , is composed of two segments 11 which are connected to one another , are positioned relative to one another with an exact fit , and which were connected to one another on the top side via a weld seam 12 . weld seam 12 was created using a laser welding method which results in a relatively minimal local development of heat , thereby largely preventing deviations in shape from occurring . tool 1 includes a tool shell 3 which , in this case , includes a bulged structure for manufacturing the desired fiber - reinforced components 2 , and it includes an edge region 15 having a receiving groove 16 to which process film 17 may be attached in an air - tight manner . loops 19 are used to carry tool 1 to the intended site , or to fasten tool 1 at the intended site . to manufacture a fiber - reinforced component 2 ( see fig6 ), top side 4 of tool shell 3 of tool 1 is covered with a fiber fabric or fiber mats or the like until the desired thickness of the fiber - reinforced plates is attained . next , process film 17 ( see fig5 ) is applied , and it is attached to receiving groove 16 in an air - tight manner . air is then suctioned out of the intermediate space between film 17 and top side 4 of tool shell 3 , and a relative vacuum is created which suctions in liquid resin that is injected via a resin inlet 24 , and which supports the distribution of the liquid resin on top side 4 of tool shell 3 . the applied vacuum may be monitored using a pressure display 28 , and it ensures that the liquid resin is distributed evenly and that the fiber mats , fiber plates , or layers of fiber fabric are wetted evenly . after tool 1 is heated and held at a constant temperature for a predetermined process time , tool 1 may be removed from the oven and cooled . after a sufficient hardening time , component 2 may be removed and its quality may be inspected before it is delivered for its intended use . to inspect the quality , sample regions 18 ( see fig1 ) may be provided which are taken from finished , fiber - reinforced component 2 in order to inspect the quality of the manufactured component at that point , and / or to forward it for storage so that the samples may be investigated later . a perspective underside view of the tool according to the present invention is shown in fig2 . as shown clearly , tool 1 has a ribbed structure 6 on underside 5 , which includes , in this case , a large number of reinforcing ribs 7 which are situated approximately perpendicular to one another , and which extend downward away from underside 5 of tool 1 in an approximately perpendicular manner . in this embodiment , structure 10 of reinforcing ribs 7 is rectangular . in another design , ribbed structure 7 may also include a surface structure that is not rectangular . for example , it is possible to design ribbed structure 6 to be honeycombed , or to include three , four , five , or six corners , so that the courses of individual reinforcing ribs 7 intersect one another not only at right angles , as shown in fig2 , but at any angle . reinforcing ribs 7 are integrally moulded on tool 1 and are designed as a single piece therewith , thereby resulting in a homogeneous material . this is attained by initially casting individual segments 11 of the tool in a casting process and then machining them in a material - removing manner on top side 4 and on underside 5 in order to create the desired surface structure . fig3 shows a perspective underside view of a raw segment 29 which is used to manufacture a segment 11 of tool 1 using a material - removing machine method . in this case , raw structure 21 on underside 5 includes cylindrical projections 22 and connecting segments 30 which are used in the subsequent processing step to form individual reinforcing ribs 7 . to prevent the formation of air inclusions or other flaws in the cast part , the shape of the cast part is calculated exactly in advance , and a structure is cast that contains all reinforcing ribs 7 while simultaneously and largely preventing the formation of flaws . segments 11 that have the desired surface structures on top side 4 and desired ribbed structure 6 on underside 5 are produced via the material - removing processing of underside 5 or top side 4 of raw segments 29 . at the same time , in particular , a wall thickness 8 of reinforcing ribs 7 and tool shell 3 is held largely constant across the entire surface of segment 11 . in a special design case , the wall thickness is approximately 10 millimeters , while a diameter of a segment may be one , two , three , or even four meters , thereby making it possible to manufacture segments 11 having a large surface area , a small wall thickness 8 , but high dimensional stability . by connecting a plurality of segments 11 , it is possible to manufacture a much larger tool . to connect a plurality of segments 11 to form a tool 1 , the segments are connected to one another at the connecting line via a weld seam 12 which is created using a laser welding method . fastening edges 23 along the contact line and both segments 11 are provided on underside 5 of tool 1 , which are used to fixedly connect the two segments 11 . the two segments 11 are held in position relative to one another using location pins 14 , while a form - fit connection is attained using screws 13 . in contrast , weld seam 12 on top side 4 is used essentially to join the two segments 11 , and to ensure that vacuum tightness exists when fiber - reinforced components 12 are manufactured . otherwise , air could be suctioned in during evacuation , through a gap between segments 11 , which could result in inadequate quality of fiber - reinforced components 2 that were manufactured . to influence a local expansion of tool shell 3 in a targeted manner , height 9 of reinforcing ribs 7 and their distance 31 to the next reinforcing rib may be adjusted accordingly and in a localized manner . thermal expansion is reduced locally by using a greater height 9 , while a lower height 9 or a greater distance 31 increases the local ductility . by using a suitable ribbed structure 6 having appropriate wall thicknesses 8 and heights 9 of ribs 7 , it is possible to adjust the desired ductility across the entire surface of tool shell 3 . furthermore , by calculating the thermal expansion in advance using a finite element model ( fem ), it is possible to exactly calculate the cad model and its thermal expansion in advance , thereby making it possible to account for the thermal expansions resulting from tool 1 in advance , so that tool shell 3 has a desired surface contour at a defined process temperature . the contour of a fiber - reinforced component 2 across the radius is shown in fig6 . graph 26 of the height plotted against the radius approximately corresponds to the ideal requirements in this case . curve 27 shows the local deviation . in a specific embodiment here , given a radius of approximately one meter , the maximum deviation from the ideal line is less than 0 . 4 millimeters , thereby making it possible to manufacture highly exact fiber - reinforced components 2 . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in a tool and method for manufacturing a tool , in particular for manufacturing fiber - reinforced components , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims . | 1 |
[ 0017 ] fig1 and 5 illustrate a preferred embodiment of the invention , and fig2 - 4 illustrate some of the many alternative embodiments . broadly , instead of a tab such as tab 42 in fig1 a or similar structure that requires a user to grip the end of the tearstrip between a finger and thumb ( or other digits on the user &# 39 ; s hands ), the invention provides an improved engagement structure for a user &# 39 ; s finger . the structure of the invention facilitates easier use for any given tearstrip structure , as compared to conventional tearstrips . among other things , the improved grippability of the invention permits lids to have thicker ( and therefore more rugged and sturdy ) tearlines as may be desirable for certain applications , while still permitting a user to remove the tearstrip without undue effort . certain basic concepts regarding tearstrips and related matters are disclosed in my u . s . pat . no . 5 , 617 , 968 , and the teachings of that patent are expressly incorporated by reference herein . for example , fig1 a illustrates a tearstrip 40 partially removed from a container lid 10 ( with lid 10 assembled with a container 12 ). this particular tearline pattern leaves a reclosable tab 70 on the lid . a user typically grasps the end 42 of the tearstrip to initiate tearing and removal of the tearstrip from the lid . although fig1 a illustrate a round lid with a sinuous tearline pattern , persons of ordinary skill in the art will understand that the invention is useful on a wide variety of lids and corresponding containers , including without limitation square , rectangular , hinged , non - hinged , recessed , and others . in the preferred embodiment of fig1 the end of the tearstrip 30 includes a pull ring or pull structure 32 molded at one end of said tearstrip . preferably , the pull structure 32 is integrally molded as part of the tearstrip . also preferably , the pull ring or structure 32 is formed in a downwardly - depending skirt 34 integrally molded at the periphery of the lid 36 , so that the pull ring is initially positioned within said skirt ( prior to removal of the tearstrip from the lid ). persons of ordinary skill in the art will understand that the preferred tearstrip 30 can function to provide tamper - indicating , and that the tearstrip 30 is preferably injection molded as an integral part of the lid . moreover , the preferred lid and tearstrip are fabricated by injection molding or similar process , to provide a suitably strong , lightweight closure for a corresponding container . persons of ordinary skill in the art will understand that the invention may be effectively practiced with a wide variety of materials and fabrication methods . frangible connector portions 38 are preferably provided to retain the pull ring or structure 32 in general alignment with the lid skirt 34 prior to removing the tearstrip . among other things , this provides tamper - evidencing and helps ensure stackability and nesting ( as discussed elsewhere herein ) as compared to embodiments without such portions ( in which the pull ring 32 might bend toward or away from the center of the lid 36 due to heat shrinkage or the like ). as with other preferred features discussed herein , however , the connector portions 38 are not required for practicing and receiving many of the benefits of the invention . reinforcing ribs 39 are preferably provided to improve the strength of the pull ring 32 . although the ribs 39 are illustrated as being generally vertical , they can be provided horizontally , angled , cross - hatched , or a wide variety of patterns , including not providing any ribs 32 at all . persons of ordinary skill in the art will understand that , as illustrated , the tearstrip 30 is preferably removed from the lid 36 by inserting a finger or other digit in the opening 37 , and pulling in the direction indicated by arrow a in fig1 . this is the opposite direction from that shown in fig1 a , but persons of ordinary skill in the art will understand that either direction can be effectively utilized . for many applications , the tearing direction will not be important . the opening 37 can be provided in any suitable shape . among the many alternative embodiments are those shown in fig2 ( oval shape 50 ), fig3 ( trapezoidal shape 52 ), and fig4 ( generally c - shaped structure 54 ). by way of further illustration and not by way of limitation , persons of ordinary skill in the art will understand that the finger gripping section on the tearstrip can be provided similarly to the generally c - shape of fig4 but inverted so that the uncompleted portion of the c - loop faces downwardly ( rather than upward and to the right , as shown in fig4 ). in all such embodiments , the tearline aspect of the tearstrip 30 and its removal from the lid 36 can be provided in any suitable manner , such as by a straight or generally horizontal tearline , a sinuous tearline ( see fig1 a ), or otherwise . by positioning the pull ring or structure 32 generally within the plane of a downwardly depending skirt 34 , the lid can be readily stacked and nested , before or after assembly on a container , and before or after removal of the tearstrip 30 from the lid 36 . for embodiments in which it is desirable to reuse the lid to cover the container opening after the tearstrip has been removed , the entire tearstrip can be located within the skirt 34 about the periphery of the lid 36 . a related preferred method of using the tearstrip of the invention involves providing a lid having the aforementioned characteristics , assembling the lid on a corresponding container , engaging at least one finger with the shaped portion of the pull structure , pulling with the at least one finger to tear the tearstrip from the lid , and removing the lid from the container . prior to the engaging step , the sealed container can be transported , stored , or otherwise handled and processed . persons of ordinary skill in the art will understand that the tearstrip can be torn from the lid or otherwise manipulated by things other than human fingers . although much of the description herein focuses on a user &# 39 ; s fingers and other digits on the user &# 39 ; s hands , the relevant tearstrip portion can also be considered to be shaped to at least partially wrap around a manipulator ( such as a finger , pencil , hook , etc .) to provide selective engagement with the manipulator to assist in tearing of the tearstrip from a lid . in other words , instead of engaging the shaped portion with your finger or fingers , you can hook it with a tool or other device . preferably , the manipulator - engaging portion ( such as illustrated in fig2 - 5 ) includes a return portion angled by more than 90 degrees with respect to a lengthwise axis of the tearstrip . by “ bending back ” in the direction of the tearstrip , the return portion provides an effective hook for engaging a manipulator ( again , such as a hook , screwdriver , finger , etc .). although the preferred embodiment of the invention has been described with some specificity , the description and drawings set forth herein are not intended to be delimiting , and persons of ordinary skill in the art will understand that various modifications may be made to the embodiments discussed herein without departing from the scope of the invention , and all such changes and modifications are intended to be encompassed within the appended claims . | 1 |
the following detailed description refers to the accompanying drawings which form a part of the specification . the drawings show , and the detailed description describes , by way of illustration specific illustrative embodiments in which the invention may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the invention . other embodiments may be used and mechanical and electrical changes may be made without departing from the scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense . like reference numbers refer to similar items in all the figures . in the following detailed description , the present system relates to the backshell assembly . the backshell assembly includes the connector , the cable end , and the housing in which the connector is encased . the connector of the backshell assembly mates with a matching connector affixed to an electronic circuit housing or circuit board . as used herein , references to the forward direction are understood to mean in a direction towards the matching connector . consequently , to engage the electrical connector , the backshell assembly is moved in the forward direction . the rearward direction is understood to denote in a direction away from the matching connector . consequently , to disengage the electrical connector , the backshell assembly is moved in the rearward direction . in embodiments shown herein , the connector is marketed under the trademark micropax ®. micropax ® is a registered trademark of berg technology , inc ., one east first street , reno , nev . 89501 . the micropax ® connector includes a conductive shell and paddleboards for making connection to a cable as well as a matching connecter . one embodiment of the micropax ® connector meets the standards of hippi - 6400 . other connectors , shells or components may also be utilized in the present system . the present system is suited for applications wherein emi is possible . one typical application entails a high frequency connector having high density . it is understood , however , that the present system is not so limited , and may be used , for example , with low density connectors and in applications where emi radiation is not a significant concern . fig1 a depicts one embodiment of the present subject matter , backshell assembly 100 , with the lid removed . backshell assembly 100 includes housing 110 . in one embodiment , housing 110 is fabricated of electrically conductive material , such as aluminum . alternatively , housing 110 may be fabricated of insulative material having a conductive layer , in which case , the conductive layer may be internal , external or elsewhere relative to housing 110 . housing 110 has mating face 115 adapted for mating with a conductive circuit housing , or a conductive circuit housing with a conductive gasket . housing 110 also has a back wall , the interior surface of which is designated as item 150 in fig1 , and the exterior surface of which is designated as item 175 in fig1 . in the embodiment shown , assembly 100 also includes electrical connector 120 . electrical connector 120 may include a high density connector shell , such as a micropax ® connector . connector 120 has forward end that mates with a matching connector assembly . connector 120 also has a rearward , or cable , end . in one embodiment , the cable end of connector 120 accepts two paddleboards , 180 and 185 . paddleboards 180 and 185 are adapted for connecting to electrical conductors of a cable . for sake of clarity , the cable is not shown in the drawing . the cable may include multiple copper , aluminum , or other conductors . the cable may be soldered to paddleboards 180 and 185 . the cable enters the backshell assembly via cable orifice 170 , shown here in the back wall of the housing . the cable may enter the backshell assembly on another wall of the assembly . in one embodiment , connector 120 is encircled with shell holder 125 . shell holder 125 is fabricated of insulative material . in one embodiment , shell holder 125 is plastic . in one embodiment , shell holder 125 is fabricated of delrin ® or teflon ®, both registered trademarks of e . i . du pont de nemours and company , 1007 market st ., wilmington , del . connector 120 is received in a cavity of shell holder 125 and , in the embodiment shown , paddleboards 180 and 185 extend in a direction opposite that of mating face 115 . paddleboards 180 and 185 provide a ground connection to maintain signal integrity pursuant to the standards of the hippi - 6400 specification . shell holder 125 provides physical spacing between the signal conductors of the cable and the connector relative to housing 110 sufficient to attenuate emi radiation through housing 110 . shell holder 125 also provides electrical isolation between the signal conductors and the housing to meet emi standards for hippi - 6400 connector assemblies . in one embodiment , shell holder 125 is coupled securely to shell holder base 145 . in one embodiment , base 145 is in slidable contact with the interior surface of the bottom of housing 110 . base 145 is shaped to fit within the bottom of housing 110 and allow shell holder 125 to slide linearly within housing 110 . in one embodiment , base 145 includes an ear 140 on each side . each ear 140 is in contact with an interior side wall of housing 110 . in one embodiment , mechanical stops provide limits to the forward and rearward movement of shell holder 125 within housing 110 . in one embodiment , the rearward limit is established by the compressed length of spring 135 . in one embodiment , the forward movement of shell holder 125 is limited by stop 190 securely attached to housing 110 . alternatively , the forward movement of shell holder 125 is limited by the spring in the relaxed position . in one embodiment , the forward and rearward limits of shell holder 125 are established by a slot in shell holder base 145 . a pin , stud , or screw engaging the slot prevents movement of shell holder 125 beyond the forward and rearward limits . in the embodiment shown in the figure , stop 190 provides a mechanical limit to the forward travel of shell holder 125 . in one embodiment , shell holder 125 travels on a longitudinal axis of housing 110 in a way . the way may include formed linear sections of housing 110 which are engaged by complementary elements of shell holder 125 . in another embodiment , shell holder 125 is captivated by , and moves in , ways formed by structure within housing 110 . such structure may include the springs 135 , clamping screws , or jackscrews , 230 , the interior sidewalls of housing 110 , or any other such structure . in one embodiment , a pair of jackscrews extend forward alongside connector 120 . each jackscrew has a thread end 130 , a head 165 , and a shoulder 160 positioned between thread end 130 and head 165 . in the embodiment shown , shoulder 160 is the underside of head 165 . in one embodiment , shoulder 165 is a larger diameter portion adjacent to a smaller diameter portion . the threads on thread end 130 correspond with threads on a standoff associated with a matching connector coupled to an electronic circuit housing . proper mating of connector 120 with a matching connector entails establishing electrical connection as well as engaging the threads of the jackscrew with the threaded standoff . in one embodiment , the jackscrews pass through the interior of housing 110 . in one embodiment , the jackscrews are external to housing 110 . in the embodiment shown , the jackscrews pass through the back wall of housing 110 . springs 135 provide a force urging shell holder 125 in the forward direction . in one embodiment , spring 135 is a wound tension spring threaded on a jackscrew . in the embodiment shown , spring 135 is captivated by structural elements within housing 110 . structural elements may include counterbores , studs , raised portions or other means of captivating spring 135 . in the embodiment shown , two jackscrews and two springs are depicted . the present system may include a single jackscrew or more than two jackscrews . in various embodiments , the present system includes a single spring or more than two springs . preloading of spring 135 urges a low impedance connection of connector 120 with the matching connector . alternatively , rearward movement of the shell holder 125 may be limited by a threaded fastener engaging the threads of the jackscrew . for example , in an embodiment having two jackscrews , a threaded nut on each jackscrew may be used to captivate , and restrict the movement of , shell holder 125 . other means of limiting the rearward movement of shell holder 125 are also contemplated . fig1 b depicts a view of the present system when mated to a matching micropax ® connector . the matching connector is represented by items 305 a and 305 b , shown herein associated with electrical housing 300 . housing 300 is electrically conductive . gasket 290 is positioned between mating face 115 of connector housing 110 and housing 300 . gasket 290 includes a center opening to allow coupling of connector 120 with matching connectors 305 a and 305 b . gasket 290 attenuates emi radiation and provides a low impedance electrical connection between housing 110 and housing 300 . in the figure , insulative shell holder 125 is encased by electrically conductive housing 110 . as shown , connector 120 mates with matching connectors 305 a and 305 b . in one embodiment , proper assembly of the connector 120 to matching connector 305 a and 305 b includes engagement of a jackscrew ( not visible in the figure ). gasket 290 is compressed by the force exerted by the jackscrew . compression of gasket 290 reduces the impedance between face 115 and housing 300 . compression also increases emi attenuation at the interface of face 115 and housing 300 . fig2 depicts an isometric view of a portion of one embodiment of the present system . in the embodiment shown , shell holder 125 is affixed to shell holder base 145 . shell holder 125 includes holes 195 on either side of paddleboards 180 and 185 . hole 195 receives a jackscrew . in addition , a spring ( not shown in this figure ) exerts a force on the rearward face of shell holder 125 . paddleboards 180 and 185 receive conductors of the cable and provide an interface with connector 120 . paddleboard 185 is shown herein as having a length less than paddleboard 180 , however the present system is not so limited and the relative lengths can be otherwise . in one embodiment , the cable includes copper conductors , each of which is bonded to conductors of paddleboard 180 or 185 . in one embodiment , bonding includes soldering conductors to the connector . cavity 200 receives paddleboards 180 and 185 and connector 120 . cavity 200 is shown herein as a rectangular hole in shell holder 125 , however , other configurations are also contemplated . as noted above , shell holder 125 is fabricated of insulative material . in one embodiment , shell holder 125 is fabricated of a material selected for having properties that reduces capacitive coupling between the connector and the backshell housing . base 145 includes cars 140 . ears 140 maintain alignment of shell holder 125 within housing 110 . shell holder base 145 also is shown herein having slot 210 aligned substantially parallel with the direction of movement of shell holder 125 . slot 210 maintains alignment of shell holder 125 and provides mechanical limits to the travel of shell holder 125 . fig3 depicts another view of one embodiment of connector 120 , shell holder 125 , paddleboard 180 , paddleboard 185 , and shell holder base 145 . the boundaries of cavity 200 are visible as a hidden line within shell holder 125 . ear 140 appears on the rearward portion of base 145 . in the embodiment shown , paddleboards 180 and 185 extend forward through shell holder 125 and are integral with connector 120 . fig4 depicts a view of another embodiment of present system 100 . in the embodiment shown , electrically conductive housing 110 provides a housing for connector 120 and various associated components . an electrical cable enters the housing at orifice 170 and terminates at the connector 120 . electrical connection to the connector 120 , in the embodiment shown , is established by means of a pair of paddleboards . paddleboard 185 is visible in the figure and a second paddleboard is obscured by the first . shell holder base 145 is coupled to shell holder 125 ( with connector 120 ) and moves fore and aft as limited by slot 210 and screw 215 . spring 135 exerts a forward force on shell holder 125 . a first end of spring 135 is in contact with shell holder 125 and a second end of spring 135 is in contact with standoff 225 . standoff 225 is in contact with an interior wall of housing 110 and spring 135 at face 220 . spring 135 , and standoff 225 are concentrically aligned with jackscrew 230 . jackscrew 230 includes head 165 for manual manipulation of jackscrew 230 . head 165 also contacts housing 110 and exerts a clamping force to secure face 115 of housing 110 to an electrical housing associated with a matching connector . fig5 illustrates another embodiment of the present system . housing 110 includes mating face 115 at a forward end and cable orifice 170 at a rearward end . connector shell 120 extends forward of shell holder 125 . electrical connections to electrical connector 120 are via paddleboard 185 and paddleboard 180 . shell holder base 145 extends rearward from shell holder 125 into housing 110 . base 145 , in the embodiment shown , includes ears 140 that slidably engage structure 220 of housing 110 to limit the forward movement of shell holder 125 and connector 120 . ears 140 also help maintain alignment of shell holder 125 in housing 110 . spring 135 is held captive on the shaft of jackscrew 230 and exerts an opposing force on shell holder 125 and housing structure 220 . engagement of thread end 130 of jackscrew 230 results in a clamping force applied to housing 110 at shoulder 160 . face 115 is forced against the gasket 290 by jackscrew 230 . in the embodiment shown in fig5 , the cable exits housing 110 at an angle relative to the longitudinal axis . the longitudinal axis is parallel with the direction of travel of connector 120 . in other embodiments , the cable exits the housing at an angle substantially parallel with the longitudinal axis . fig6 a , b and c illustrate another embodiment of the system of fig5 . in the figures , connector housing 110 b includes a metal housing having walls and a bottom surface . housing connector lid 110 a is fastened to housing 110 b . lid 110 a is fastened to housing 110 b by means of threaded fasteners , rivets , drive screws or other means . in the embodiment shown , shell holder 125 is depicted as a two - part assembly including shell holder 125 a and shell holder 125 b . shell holder 125 b includes a cavity shaped to receive connector 120 , herein depicted as including the micropax ® shell . shell holder 125 a includes a cover plate to secure shell 120 within holder 125 b . shell holder 125 a and shell holder 125 b each include two holes 310 for accepting threaded fasteners . in one embodiment , connector 120 is sandwiched between shell holder 125 a and 125 b using two machine screws and two nuts . fig7 illustrates another embodiment of the present system . fig7 a shows a connector housing lid 110 a having cable orifice 170 and mating face 115 . lid 110 a is of cast aluminum construction having raised webs , or ridges as indicated at items 320 and thickened sections as indicated at 325 . in addition to providing structural reinforcement and strength , the ridges and thickened sections , in conjunction with the walls of housing 110 b ( fig7 b ), provide an improved emi seal . also visible in fig7 a are cable sealing members 330 . cable sealing members 330 are further described with respect to fig9 and are captivated by the webs and thickened sections of lid 110 a . fig7 b illustrates housing 110 b having cable orifice 170 and mating face 115 . housing 110 b has wall sections including a plurality of threaded holes 340 for attachment of lid 110 a using machine screws . holes 345 are clearance holes for the shaft of jackscrew 230 . cable sealing members 330 are captivated by the walls of housing 110 b . in both fig7 a and fig7 b , ridge 350 is aligned transverse with respect to the longitudinal axis . ridge 350 provides reinforcement and prevents substantial movement of the connector 120 . connector 120 , and shell holder 125 a and 125 b are held securely relative to lid 110 a and housing 110 b . connector shell holder sections 125 a and 125 b are illustrated in fig7 c and 7d , respectively . sections 125 a and 125 b are adapted to fit within lid 110 a and housing 110 b , respectively . alignment groove 355 , visible as hidden lines in each of sections 125 a and 125 b , mates with ridge 350 in lid 110 a and housing 110 b . holes 360 accept mechanical fasteners for securing connector 120 in the assembled shell holder sections 125 a and 125 b . shell holder sections 125 a and 125 b are adapted to accept connector 120 in recess 370 . clearance for the wall section near the two forward holes 340 in housing 110 b and lid 110 a are provided by notches 365 . fig8 illustrates one embodiment of connector 120 , including a shell , suitable for use with the present system . fig8 a , 8 b and 8 c depict top view , end view and forward view , respectively of connector shell 120 . fig8 d depicts an isometric view of connector shell 120 . shell 120 includes a pair of mounting holes 375 for securing connector shell 120 to shell holder 125 . in one embodiment , connector shell 120 is fabricated of cast , or machined , metal . in one embodiment , connector shell 120 is available from berg technology , inc ., one east first street reno , nev . 89501 and is known in the trade as a micropax ® connector shell . fig9 illustrates alternative cable sealing means . fig9 a provides a forward view of the backshell assembly , as viewed from the rear . visible in the figure are jackscrew heads 165 . also visible is cable orifice 170 . in one embodiment , housing 110 includes a sealing surface 395 . in the embodiment shown , the sealing surface 395 is lined with cable sealing , or packing material 380 . cable packing material 380 may be a woven or non - woven conductive metal material in the form of a coiled strip . a rivet may be used to secure the cable packing material 380 to sealing surface 395 . in fig9 b , cable sealing members 330 are illustrated , each having semicircle 385 . sealing members 330 are fabricated of conductive metal and are adapted to fit securely in the webs and thickened sections of lid 110 a and housing 110 b of fig7 a and 7b , respectively . sealing material 380 is a woven or non - woven conductive metal material in the form of a coiled strip . although specific embodiments have been illustrated and described herein , it will be appreciated by those of ordinary skill in the art that any arrangement which is calculated to achieve the same purpose may be substituted for the specific embodiment shown . this application is intended to cover any adaptations or variations of the present invention . | 8 |
fig1 shows a vessel 10 having a steerable wing - type sail assembly 12 in accordance with the present invention mounted on a hull assembly 14 . as can be seen in fig2 , the hull assembly in the illustrated embodiment is a catamaran having first and second hull members 16 a , 16 b spanned by a bridge or deck structure 18 ; a catamaran ( or trimaran ) type hull assembly is an efficient and stable structure that is well suited to use with a wing - type sail , however , it will be understood that other multiple or mono - hull vessels may be used with the steerable wind assembly , as well as other types of craft or even wind powered vehicles . as can be seen with further reference to fig1 - 2 , the main wing - type sail 20 ( also referred to herein as simply the “ wing ”) of the steerable assembly 12 is itself of generally conventional form , with lower and upper spans 22 , 24 having a planform shape , the latter tapering upwardly to approximately half the maximum cord length . pivotable flaps 26 , 28 are in turn mounted at the trailing edges of the lower and upper spans . the flaps are joined together vertically and extend the full height of the wing ; in the illustrated embodiment , the flaps preferably comprise about 20 % of the total area of the planform , and are capable of being deflected in both directions by about 30 degrees . it will be understood that other shapes and forms of wing - type sails may also be used . a vertical mast 30 within the upper span of the wing is pivotably supported on a post 32 that is enclosed within the lower span . the main wing 20 is therefore free to pivot 360 ° about axis 34 relative to the hull assembly 14 . the axis 34 defined by the post and mast is preferably located at a point which is close to the center of balance of the wing when producing lift , which in the illustrated embodiment is about 25 % of the cord length from the wing &# 39 ; s leading edge . the support post 32 extends upwardly inside the wing 20 to a level close the vertical center of effort . the top of the post is fitted with a bearing ( not shown ) that matches a socket inside the main wing spar . the bearing is designed to support the dead weight load of the wing , plus the horizontal aerodynamic loads ; due to the proximity of the bearing to the center of effort , it absorbs approximately 110 % of the load . a bearing ( not shown ) is also provided at the bottom of the wing 20 , which experiences about 10 % of the horizontal load in the opposite direction . as noted above , in prior wing - type sails the force to pivot the wing - type sail is generated by one or more flaps that lie within the plane of the main wing itself . the present invention , however , provides a steering assembly 40 having at least one pair of secondary airfoils 42 a , 42 b that extend generally parallel , to but that are offset laterally from , the plane of the main wing . as will be described in later detail below , the secondary foils 42 a , 42 b are pivotably supported on the distal ends of booms 44 a , 44 b , the base ends of the booms being mounted to the main wing assembly proximate its base pivot axis 34 . as can be seen in fig1 and also fig3 , the length of the booms also serves to position the secondary airfoils 42 a , 42 b well behind the trailing edge of the main wing 20 . as will be described in greater detail below , the secondary airfoils are rigged to pivot the same direction simultaneously , preferably in conjunction with pivoting of the trailing edge flap 26 ; as this is done , the rotational force generated by the wind reacting against the angled secondary airfoils 42 a , 42 b is transmitted into the main wing through the elongate booms 44 a , 44 b . although only a single pair of secondary airfoils is shown in the illustrated embodiment , it will be understood that multiple pairs may be used in some instances , and also that the secondary airfoils in each set may be doubled up or otherwise increased in number from the two airfoils that are shown . the steering assembly of the present invention , having the secondary airfoils as described , provides several important advantages . firstly , the secondary airfoils ( also referred to from time - to - time herein as “ secondary wings ” or “ tails ”) are at an elevation close to the vertical center of effort of the main wing , and thus experience the same wind velocities and wind directions as the wing itself . in this respect , it should be noted that , due to friction and viscosity , the true wind velocity varies with its height above the water or ground , typically being significantly slower at lower levels . this , in turn , creates a difference in the apparent angle of the wind to the direction of the vessel &# 39 ; s movement at different heights above the water . by way of background , some designers have attempted to compensate for this phenomenon by incorporating twists or curves in the shapes of sails . an additional advantage is that the lateral displacement of the secondary airfoils removes them from the disturbed downwash air that results from the main wing producing lift . the secondary airfoils are therefore able to produce lift much more efficiently , thus permitting smaller and lighter airfoils to be used , and they are also able to produce a smoother , more consistent pivoting action . the location of the booms near of the mid - span height of the wing also provides vertical clearance above the hull assembly that allows communication antennae and the like to be mounted near the transom area without obstructing the booms ; this is an advantage over using a single secondary air foil mounted behind the wing on two vertically separated booms , where the lower of the two booms would sweep over the after portion of the vessel so that only small objects could be mounted in this area . moreover , the length of the booms also provides leverage that aid in turning the wing assembly . the two horizontal booms 44 a , 44 b are preferably mirror - image identical , and diverge rearwardly in a v - shaped configuration . the base ends of the booms are mounted in sockets ( not shown ) formed in rear face of the main wing spar . first and second struts or arms 46 a , 46 b extend laterally from the rearward part of the wing to support the booms in the horizontal plane . as can be seen fig4 , the booms 44 a , 44 b are drawn together behind the main wing by diagonal cables 48 a , 48 b , so that the booms are deflected resiliently from the unloaded positions indicated at 44 a ′ and 44 b ′. the forces of drawing the ends of the booms together are selected to be greater the anticipated wind loads , so that the cables will never develop slack during operation . the preloading provides a bracing that eliminates the flexing that might otherwise occur in a cantilever situation ; any flexing of the booms would tend to change the angle of attack of the secondary airfoils , resulting in serious control problems . the tensioned boom arrangement that has been described has the advantages of providing a lightweight and inexpensive have , however it will be understood that in some embodiments booms may be used that have sufficient rigidity to avoid flexing without requiring pretensioning . referring again to fig1 , the secondary airfoils 42 a , 42 b are mounted to pivot about vertical axes 50 that extend parallel to the vertical pivot axis 34 of the main wing 20 . the secondary airfoils are preferably symmetrical , with mirror - image identical upper and lower halves above and below the booms 44 a , 44 b , to avoid transmitting torsional loads to the booms . in the illustrated embodiment the secondary airfoils have a swept “ v ” shape , however , it will be understood that other symmetrical shapes ( e . g ., rectangular , diamond - shaped or oval ) may be used . the vertical shafts 52 ( see also fig5 ) that support the secondary airfoils 42 a , 42 b are located as near as possible to the aerodynamic centers of the airfoils , thus reducing steering cable tensions and motor control requirements . the pivot shafts are mounted to crossbars 54 a , 54 b , which have ends that extend generally laterally on either side of the airfoils 42 a , 42 b ; as can be seen in fig5 , the crossbars preferably extend perpendicular to the support booms 44 a , 44 b rather than to the secondary airfoils themselves , to simplify the arrangement of the cables and controls . pairs of outboard and inboard cables 56 a , 58 a and 56 b , 58 b are mounted to the projecting ends of the crossbars 54 a , 54 b , and are led forward over vertical - axis tensioner pulleys 60 a , 60 b that are mounted on the booms to the sides of the flap 26 . additional cables 62 a , 62 b are attached on opposite sides to the rearward edge of the flap , and are similarly routed over the vertical axis pulleys 60 a , 60 b . as can be seen in fig5 , the cables 62 a , 62 b are therefore aligned at a relatively steep , obtuse angle relative to the main plane 64 of the wing , tending slightly forward so that they will be generally perpendicular to the flap when it is the maximum angle of deflection ; similarly , the paired cables 56 a , 58 a and 56 b , 58 b are arranged more or less perpendicular to the transverse crossbars 54 a , 54 b when the secondary airfoils are in their neutral positions . all six of the control cables ( 54 a , 58 a , 56 a , 58 b , 62 a and 62 b ) are routed forwardly from the vertical axis pulleys over two sets of horizontal axis pulleys 64 a , 64 b , that are mounted to a boxed in wall 66 or other support constructed within the wing just behind the area of the post and mast 32 , 30 . the horizontal axis pulley sets 64 a , 64 b redirect the control cables vertically through the wing to linear actuators ( not shown ) or similar mechanisms mounted to the deck structure 18 , or within the hull assembly itself . by shortening / lengthening the control cables , the assembly therefore pivots both the trailing edge flap and secondary airfoils in one direction or the other simultaneously . for example , fig6 shows a configuration in which the right - side set of cables 56 a , 58 b and 62 a have been retracted , using the linear actuators or other mechanism , while the left - side cables 58 a , 56 b and 62 b have been paid out , thus pivoting the flap 26 and secondary airfoils 42 a , 42 b so that they are all inclined towards the left of the plane 64 of the main wing . as a result , the inclined members react with the wind ( assuming that the latter is generally from ahead of the main wing 20 ) to produce a force tending to pivot the wing in the opposite direction , i . e ., to the right ( clockwise direction ) in the view shown in fig6 . retracting and paying out the opposite sets of cables likewise pivots the flap and secondary airfoils in the opposite direction . in some embodiments the secondary airfoils may be pivoted by other mechanism , such as motors or hydraulic or pneumatic mechanisms operating directly or through linkages , rather than or in addition to the cables that are shown . the amount of the turning force exerted on the main wing can be adjusted by increasing or decreasing the angle of the secondary airfoils as desired , e . g ., a greater degree of inclination may be used to turn the wind rapidly to make major changes in alignment , or to overcome resistance due to environmental or mechanical conditions , while a lesser degree of inclination may be used for fine adjustments or minor corrections in alignment . the members can be constructed to provide any desired range of pivoting motion , however , a maximum inclination in a range from about 30 - 45 degrees will be satisfactory for a majority of applications . accordingly , by operatively linking the linear actuators , or other cable adjustment mechanism or mechanisms , to suitable controls on the vessel , the steering assembly of the present invention enables the direction and lift of the wing to be controlled with a high degree of efficiency and precision . the on board controls may include wind speed and direction sensors , as well as gps , gyrocompass , speed log and / or other mechanisms for determining vessel course , speed and position . the inputs from the sensors may be supplied to an on board computer or other processor , that provides commands to the linear actuators or other cable control mechanisms as appropriate , and possibly to the rudders or other steering mechanism of the hull assembly as well . moreover , the guidance system may include provisions for receiving commands from a remote location , such as a land station or mother vessel . fig7 shows the relationship of the mast 30 to the post 32 in greater detail . as can be seen , the post is preferably a vertically tapered member , to provide adequately strength without excessively elevating the center of gravity . the base portion 68 of the post is suitably formed as a plug or similar member that is received in a cooperating socket ( not shown ) or other receiver in the deck assembly 18 . as can be seen in fig3 and also fig7 , the socket or other receptacle for the post 32 may be formed in or mounted to a frame 70 of the deck assembly that is pivotable about a horizontal axis , in order to allow the main wing to be lowered to a horizontal orientation when desired . in the illustrated embodiment , the frame is t - shaped , having a longitudinally extending centerline platform member 72 and first and second laterally and forwardly extending leg members 74 a , 74 b . the outboard ends of the two leg members are mounted to a forward bridge piece 76 of the deck assembly by pivot connections 78 a , 78 b ; in the illustrated embodiment , the pivot connections are formed by tubular sleeves that fit over and engage cooperating portions of the bridge piece 76 . when the wing assembly is deployed to its vertical position ( e . g ., for normal operation of the vessel ), the rearward end of the longitudinal platform member 72 is supported on an aft bridge member 80 of the deck assembly , as is shown in fig3 and also fig1 . then it is desired to lower the wing assembly , the platform member is detached from the aft bridge member and the wing assembly is pivoted forwardly until the wing reaches the horizontal orientation , as indicated by dotted line images 12 ′, 20 ′ and 40 ′ in fig8 . in this position , antennae and / or sensors ( e . g ., radar ) mounted atop the wing assembly can be accessed for maintenance / repair , or the wing and steering assembly can be broken down for storage or transportation . it is to be recognized that various alterations , modifications , and / or additions may be introduced into the constructions and arrangements of parts described above without departing from the spirit or ambit of the present invention as defined by the appended claims . | 1 |
now referring to drawings in fig1 - 9 , wherein similar components are identified by like reference numerals , there is seen in fig1 , the device configured with a top planar surface 11 , having a central area 17 sized to accommodate both feet of a standing user 15 in a static position in the as - used mode of the device 10 , ready for contact of the feet with the planar surface 11 . shoes in the united states for adults range from approximately 8 inches to 15 inches in length depending on the respective shoe size of the individual . consequently a central area 17 of substantially 15 to 16 inches will accommodate most user &# 39 ; s shoed feet . a perimeter area 19 surrounding this central area 17 of planar surface 11 is also preferably provided such that the user 15 standing in the central area 17 is balanced on both feet , and comfortable , and the user 15 may tap or contact the planar surface 11 in the central area 17 during use , or if lateral movement is favored by the user 15 , they may contact the planar surface 11 in the perimeter area 19 . many users 15 may tap the planar surface 11 directly under their respective foot , however many may tend to tap in a lateral direction from the original position , or change for some types of music , and thus both the central area 17 and perimeter area 19 are preferred . a current total size configured to the disclosed purpose , which experimentation has shown to work well , is between a width of 19 to 30 inches along an imaginary line running through both feet of the user 15 , with a length dimension running perpendicular to the imaginary line , of between 10 to 20 inches . however , because users 15 come in all sizes , and have their own comfort zone for feet movement to impact the planar surface 11 with sufficient area of a planar surface 11 to maintain their balance , the device 10 may be provided in a plurality of sizes , for user choice depending on their own style of foot contact with the planar surface 11 during use . currently a central area 17 of at least the length of the user &# 39 ; s feet from heel to toe , as noted above as substantially 8 - 15 inches , would be a minimum size , and ideally at least a 4 - 6 inch wide perimeter area 19 can be provided . this sizing allows most users 15 to stand with feet apart in a normal upright stance , balanced in the central area 17 , while using a hand - operated instrument , and to move their feet to operate the device 10 by impacting the planar surface 11 with either or both feet and use the front , rear , or the entire foot surface of both feet individually , to contact the planar surface 11 and thereby communicate a vibration and sound therefrom to the underlying signal generating components . as seen in fig2 , the prior art in the area of employing a pedal to operate a drum while playing music with the hands is shown . such pedals have been employed by “ one man bands ” concurrently with the playing of a stringed instrument to provide for a drum sound . as can be seen , the pedal has an inclined surface which only accommodates one foot , and depressing the pedal with a foot already in an inclined position , tends to throw the user off balance . in addition the user is limited to a single sound . in a preferred mode of the device 10 shown in fig3 , signal generating components 21 which may be any electronic component which will generate an output electronic signal when vibration and / or sound is communicated thereto . such signal generating components 21 include but are not limited to , microphones , magnetic pickups such as for guitars , and piezoelectric force sensors , although others as would occur to those skilled in the art are considered within the scope of this patent . in fig3 - 5 , the electronic signal generating components 23 are depicted as piezoelectric force sensors 23 . in fig3 , the piezoelectric force sensors 21 are placed as a pair in a simple mode of the device 10 , although a single piezoelectric force sensor 23 would also work in this mode . the output signal from both piezoelectric force sensors 23 are routed to a common output signal to the electronic device such as an amplifier and loudspeaker , to produce sound relative to the user &# 39 ; s contact with the planar surface 11 . in fig4 is shown a mode of the device 10 , which allows the user to use each foot , by a respective contact with the planar surface 11 , to generate a different sound as the plurality of piezoelectric force sensors 23 is routed to a left and right output feed . a simple separation on the piezoelectric force sensors 23 in their positionings on the underlying section 18 will produce separate outputs . however , enhanced separation can be provided by a formed gap 20 between sections of the underlying section 18 . additionally enhanced separation of the signals from the respective right and left piezoelectric force sensors 23 can be achieved by the positioning of a vibration damping material 25 in the gap 20 which impedes communication of vibration and acoustics between the two halves of the underlying section 18 . such material may be any material suited to blocking vibration from contact with one side of the planar surface 11 from being communicated to electronic signal generation devices on the opposite side . such can include one or a plurality of materials from a group including such damping material as rubber , polymeric material , plastic material , ceramic material , fiberglass , metalized fiberglass , sorbethane , closed and open cell foam , or mixtures of these materials in combination , or other damping materials of differing durometer and damping effects to alter or reduce or increase the conductive properties for vibration and sound , in a space between sections of the top planar surface 11 and the signal generating components 21 which are all in a vibrational communication with the planar surface 11 . this two output mode of the device is a significant enhancement to the device 10 in that two different instruments , for example a bass drum , and a tom , can be controlled by the user 15 by using the right and left foot respectively . contact by the right and left foot with portions of the top planar surface 11 in vibrational communication with the piezoelectric force sensors 23 in an underlying section 18 , will thus produce separate independent signals , each of which may be routed electronically to play a separate sound . in the mode where separation is enhanced , such as with a gap 20 and / or damping material 25 , the acceleration of the user &# 39 ; s foot contact with the top planar surface 11 can be employed to impart differing tonal and volume characteristics to the sound generated . as shown in fig5 , the device 10 may employ multiple signal generators shown as piezoelectric force sensors 23 which are positioned in quadrants or sections 30 of the underlying component 18 . as shown , the device 10 has signal generating components 21 such as piezoelectric force sensors 23 , positioned in sections 30 formed by sectionalizing the surface of the underlying section 18 , and the top section 14 forming the top planar surface . this sectioning serves to partially or fully isolate the signal generating components 21 such as piezoelectric force sensors 23 , from each other and from the differing sections of the top section 14 if also separated . in any quadrant mode of the device , a tap from one foot on the top planar surface 11 overtop a quadrant would be sufficiently vibrationally isolated from other quadrants , such that the electronic signal would be generated by the signal generating component corresponding to the tapped quadrant . using software , or hardware adapted to the task of only communicating the strongest of a plurality of electronic signals from the signal generating components 21 , at a given time , the device 10 could employ each quadrant for switching separately . the sections 30 are not limited to four , and could be any number adapted to the task . further , the signal generating components 21 may be mixed or matched in the sectionalized mode by mounting any of the group including microphones , piezoelectric force sensors , and magnetic pickups in individual sections 30 , wired to generate distinct sounds . as noted above , fig6 is a schematic block diagram illustrating operatively constructed circuits to and through other electronic components of the device . components may include one or a combination of filters , signal gains , preamplifiers , noise reduction processes , signal limiters , analog or digital effects such as reverb or delay , or other signal processes and / or effects . the flow of the processing of the signal may be handled in any order and the depicted flow is for illustrative purposes and is not intended to limit the scope of the present invention . fig7 shows a digital mode of processing the generated electronic signals from the electronic signal generators , and employing midi processing for the device . fig8 depicts the device built directly into the surface of a live performance stage . the present invention could be devised and formulated into other objects as well , such as into a guitar case . fig9 depicts a schematic block diagram illustrating the signal generating component &# 39 ; s electronic signal , generated by either or both feet of the user on the top planar surface 11 , directed to an analog to digital signal conversion stage and a digital waveform storage and transmission component of the device . as shown , the output of the signal processing stage is conditioned to trigger the transmission of digitally synthesized and / or sampled sound waveforms . the output of the digital waveform storage and transmission component is a signal appropriate for input to a sound creation component such as a musical amplifier and / or speaker system . optionally , the outputted signal may be configured to be communicated by wired or wireless means from device 10 . as noted , any of the different configurations and components can be employed with any other configuration or component shown and described herein . additionally , while the present invention has been described herein with reference to particular embodiments thereof and steps in the method of production , a latitude of modifications , various changes and substitutions are intended in the foregoing disclosures , it will be appreciated that in some instance some features , or configurations , or steps in formation of the invention could be employed without a corresponding use of other features without departing from the scope of the invention as set forth in the following claims . all such changes , alternations and modifications as would occur to those skilled in the art are considered to be within the scope of this invention as broadly defined in the appended claims . further , the purpose of any abstract of this specification is to enable the u . s . patent and trademark office , the public generally , and especially the scientists , engineers , and practitioners in the art who are not familiar with patent or legal terms or phraseology , to determine quickly from a cursory inspection the nature and essence of the technical disclosure of the application . any such abstract is neither intended to define the invention of the application , which is measured by the claims , nor is it intended to be limiting , as to the scope of the invention in any way . | 6 |
referring more particularly to fig1 there is shown a circuit diagram of a prior art relay driving circuit comprising a control circuit 10 which provides a switching signal to the base of transistor 11 . the signal from circuit 10 alternately enables or disables the base - emitter junction of transistor 11 . when the base - emitter junction of transistor 11 is enabled , the collector - emitter path of transistor 11 is switched to an easy conduction state and current flows from positive voltage source 12 through relay winding 13 and the collector - emitter path of transistor 11 to ground . being thus energized , relay winding 13 operates relay contacts ( not shown ) to perform the desired control function . when control circuit 10 disables the base - emitter junction of transistor 11 , transistor 11 turns off , presenting a high impedance across its collector - emitter path . the interruption of the current flow through the conductive winding 13 induces a voltage across winding 13 with a polarity positive at the bottom end of winding 13 and negative at the top end of winding 13 . this voltage combines additively with the voltage from source 12 and might be large enough to cause secondary breakdown in transistor 11 , damaging the transistor . this problem is particularly acute for transistors fabricated in integrated form where secondary breakdown is likely to occur at moderate voltage levels . in order to control the reverse voltage , and in accordance with the prior art , a unidirectional conducting device or diode 14 is connected across relay winding 13 and poled in a direction to short - circuit voltages induced across winding 13 which are polarized in the easy conduction direction of diode 14 . since a moderate reverse voltage is desirable to speed up the release of the relay , a zener diode 15 is connected in series with diode 14 . zener diode 15 has a breakdown voltage sufficiently large to permit a moderate reverse voltage to develop across relay coil 13 . this zener voltage threshold is selected to guarantee the desired release time for the relay . the circuit arrangement of fig1 operates well as a relay driver circuit for high voltage transistors . unfortunately , however , many transistors fabricated in integrated circuit form are low level devices ( using buried collector technology , for example ) and subject to damage from secondary breakdown when excessive forward voltages are applied across the collector - emitter path . the combined winding induced reverse voltage and the voltage of source 12 applied directly across the collector - emitter electrodes of transistor 11 may well exceed the secondary breakdown voltage . in fig2 there is shown a circuit diagram of a relay driving circuit including a semiconductor isolating device 16 for protecting transistor 11 from secondary breakdown . the components of fig2 common to fig1 are identified by the same reference numerals as those used in fig1 . thus control circuit 10 alternately enables and disables the collector - emitter path of transistor 11 . when enabled , transistor 11 provides an easy conduction path from voltage source 12 through relay coil 13 and semiconductor device 16 to ground potential . as previously described , diode 14 and zener diode 15 permit a moderate reverse voltage when the relay coil is de - energized . semiconductor device 16 , however , is interposed between coil 13 and transistor 11 and isolates transistor 11 from large voltages in the forward direction . semiconductor device 16 might comprise , for example , a discrete silicon controlled rectifier having its anode connected to coil 13 and its cathode connected to the collector of transistor 11 . the control electrode of silicon controlled rectifier 16 is connected to a circuit including a controlled current source 17 and a plurality of diodes 18 through 19 connected in series to ground potential . source 17 provides a very small current , typically on the order of a few tens of microamperes , which flows through diodes 18 through 19 . when transistor 11 is enabled by a signal from control circuit 10 which forward biases the base - emitter junction of transistor 11 , a low impedance path is immediately created from the current source 17 through the cathode electrode of silicon controlled rectifier 16 and the collector - emitter path of transistor 11 . in response to this current to the electrode of device 16 , it becomes enabled and current is able to flow from source 12 through relay coil 13 , silicon controlled rectifier 16 and transistor 11 to ground potential . since the impedance of device 16 is very low when enabled , relay coil 13 is immediately energized to operate the relay contacts . when control circuit 10 turns transistor 11 off , the operating current for device 16 is terminated ( switched back to diodes 18 and 19 ) and device 16 is disabled . device 16 , however , has an extremely high impedance in this condition and isolates transistor 11 from the voltage at the bottom of winding 13 . in addition , diodes 18 and 19 form a clamp which limits the voltage on the collector of transistor 11 to less than the forward voltage drop of the diodes 18 and 19 . thus , in accordance with the present invention , a reverse voltage is allowed to assist in the rapid release of the relay while at the same time the driving transistor is isolated from this higher voltage . referring to fig3 there is shown a complete circuit diagram of another embodiment of the present invention in which the silicon controlled rectifier is replaced by a pair of complementary transistors which may be fabricated in integrated circuit form on the same chip as transistor 11 . again , the components of fig3 which are identical to those in fig1 or 2 are identified with the same reference numerals . thus , control circuit 10 is connected to the base of transistor 11 and alternately enables and disables the collector - emitter path of transistor 11 . a relay coil 13 is energized by a voltage source 12 when transistor 11 is enabled . diode 14 and zener diode 15 permit a modest reverse voltage across coil 13 to speed up relay release . in fig3 the silicon controlled rectifier 16 of fig2 has been replaced with a pair of complementary transistors 20 and 21 . transistor 20 is a low - gain lateral pnp device with a collector - emitter sustaining voltage approximately equal to its collector - base breakdown voltage . transistor 21 is a high - gain vertical npn device with a collector - emitter sustaining voltage much less than its collector - base breakdown voltage . the base of transistor 20 is connected to the collector of transistor 21 and the base of transistor 21 is connected to the collector of transistor 20 . the emitter of transistor 20 is connected to winding 13 while the emitter of transistor 21 is connected to the collector of transistor 11 . the combination of transistors 20 and 21 comprises a pnpn device which operates in the same manner as silicon controlled rectifier 16 in fig2 . the controlled current source 17 of fig2 is implemented in fig3 with a transistor 22 having its emitter electrode connected through resistor 23 to voltage source 12 and having its collector electrode connected to the base of transistor 21 . the base of transistor 22 is biased by the voltage drop across diodes 24 through 26 . diodes 24 through 26 , in turn , are energized by voltage source 12 through resistor 25 . of course , for a simpler current source , transistor 22 , diodes 24 through 26 and resistor 23 can be omitted , and resistor 25 can be directly connected to the anode of diode 18 . transistor 22 delivers a fixed small current , the value of which is determined by the value of resistors 23 and 25 . resistor 23 is chosen such that the value of this current is on the order of a few tens of microamperes , as discussed above . the balance of a circuit for fig3 operates identically to that shown in fig2 . when transistor 11 is initially enabled , current flow normally going through diodes 18 and 19 is switched to the base - emitter path of transistor 21 . when thus enabled , transistor 21 initiates conduction in the base - emitter path of transistor 20 . the feedback from the collector of transistor 20 to the base of transistor 21 rapidly saturates both of transistors 20 and 21 . relay coil 13 is therefore energized to operate the relay contacts . when transistor 11 is turned off , the base - collector path of transistor 21 can no longer sustain current flow . transistor 20 is thereby likewise disabled . the cross - connection feedback causes the rapid disablement of both of transistors 20 and 21 and the drive current from transistor 22 switches back to diodes 18 and 19 . diodes 18 and 19 , through the base - emitter junction of transistor 21 , limit the off voltage on the collector of transistor 20 to less than the forward diode drops of diodes 18 and 19 . in this way , the higher base - collector breakdown voltage of transistor 21 and the higher emitter - collector sustaining voltage of transistor 20 are substituted for the lower emitter - collector sustaining voltage of transistor 11 . therefore , as long as the sustaining voltage of transistor 20 is not exceeded , effective isolation occurs . it can be seen that the arrangements of the present invention protect integrated circuit semiconductor devices from excessive forward voltages when used as a relay driver . this protection can be obtained as shown in fig3 by means of devices which themselves can be fabricated in integrated circuit form . the entire relay drive circuit can therefore be fabricated in integrated circuit form to take advantage of the reduced size and cost afforded by this technology . in addition , since only very low currents are needed to initiate the turn - on of transistors 20 and 21 , the increase in drive current , compared to the drive current used in fig1 is negligible . finally , the circuits of the present invention can be used in other applications where low voltage integrated transistors are used to drive high voltage output devices or circuits . transistors 20 and 21 together comprise a pnpn device which provides excellent voltage isolation and yet requires a negligible drive current . | 7 |
fig1 shows a generally rectangular - shaped gas tight reaction vessel 1 divided into a low temperature compartment 2 and a high temperature compartment 3 by means of a hollow underflow partition wall 4 that allows flow of a molten bath from the low temperature compartment 2 to the high temperature compartment 3 and the addition of additional carbon material to the flow of molten bath as it passes under partition wall 4 . at the end of the high temperature compartment 3 opposite the low temperature compartment 2 there is arranged an outlet 5 for tapping or removing a layer of molten aluminum 31 . the molten bath flows from the low temperature compartment 2 to the high temperature compartment 3 by gravity . the flow is effected and regulated by the tapping of aluminum 31 at outlet 5 . when aluminum is tapped from the high temperature compartment , a corresponding amount of molten bath flows under the partition wall from the low temperature compartment to the high temperature compartment . the two compartments are not connected by separate ducting . in the low temperature compartment 2 there are arranged a plurality of electrodes 6 , usually two to four , extending through the roof of the reaction vessel 1 . the electrodes 6 are , during the operation of the reaction vessel 1 , intended to pass through the bath and to be submerged in the molten bath in the low temperature compartment 2 to supply energy by resistance heating . the electrodes 6 may have conventional means ( not shown ) for supply of electric current and conventional means ( not shown ) for regulating the electrodes 6 . the electrodes 6 are preferably consumable graphite electrodes , although any other material suitable for such use can also be employed . in the high temperature compartment 3 there are arranged a plurality of pairs of electrodes 7 along the sidewalls of the reaction vessel 1 . in fig1 the side view electrodes are depicted as circles as they protrude from one wall and so only one electrode of each set is shown . the electrodes 7 can be consumable graphite electrodes or non - consumable inert electrodes . each pair of electrodes 7 is individually supplied with electric current . by using a plurality of pairs of electrodes 7 in the sidewall of the reaction vessel 1 , an even temperature is reached in the molten bath in the high temperature compartment 3 . as shown , the electrodes 7 do not pass through the top of the bath and are disposed below the level of the aluminum layer 31 , providing advantages described previously . in the roof of the low temperature compartment 2 there is arranged supply means 8 for supply of alumina 32 from hopper 34 and carbonaceous reduction material 36 to the low temperature compartment 2 . the supply means 8 is preferably gas tight so that raw materials can be supplied without the escape of reactor off - gases through the supply means 8 . over the roof in the low temperature compartment 2 there is further arranged a first gas exit 9 . the gas exit 9 can pass to reactor 10 to recover al 4 c 3 . over the roof in the high temperature compartment 3 there is arranged a second gas exit 19 which is identical to the gas exit 9 arranged on the roof over the low temperature compartment 2 . off - gases from the high temperature compartment 3 can pass to another rector 10 to recover al 4 c 3 . gases flowing through exits 9 and 19 could also both pass through the same reactor 10 . hollow partition wall 4 has hopper 30 positioned on top to hold additional carbon material and to feed additional carbon material down through hollow partition wall 4 into the underflow molten bath . recovered al 4 c 3 from reactor 10 is preferably recycled to hopper 30 for use as additional carbon material . hopper 30 and hollow partition wall 4 are preferably gas tight so that additional raw material can be supplied to the reactor without the escape of reactor off - gases . fig2 illustrates a cross - sectional view of a preferred embodiment of hollow partition wall 4 ′ while fig3 shows a top view of the wall taken along line iii — iii of fig2 . wall 4 ′ comprises sides 4 ′ a and 4 ′ b and space 4 ′ c for holding carbon material and housing a screw 4 ′ d to transport additional carbon material down through space 4 ′ c and out opening 4 ′ e at the bottom of wall 4 ′. preferably , cooling system 4 ′ f is provided on the outside of wall 4 ′. cooling system 4 ′ f is a conventional cooling system operated in conventional manner . a rack and pinion system 4 ′ g is used to vertically move wall 4 ′. by moving wall 4 ′, the level of opening 4 ′ e varies thereby allowing for control of the height of addition of the additional carbon material into the underflow slag . the speed at which screw 4 ′ d is operated controls the amount of additional carbon material fed through opening 4 ′ e . rack and pinion system 4 ′ g is a conventional system operated in a conventional manner to move wall 4 ′ and adjust the height at which additional carbon material is fed to the slag . cooling system 4 ′ f also aids in guiding the movement of wall 4 ′. fig4 and 5 illustrate another embodiment wherein the hollow area has been divided into a plurality of conduits . such conduits can also be seen as circular spaces or hollows . partition wall 4 ″ has spaces 4 ″ c and screws 4 ″ d positioned therein to feed carbon material downward through space 4 ″ c to the underflow slag . the amount of additional carbon material added to the underflow slag is controlled by the speed at which screws 4 ″ d are turned in spaces 4 ″ c . the faster the speed , the more additional carbon material is added to the underflow slag . additional carbon material passes out of wall 4 ″ through openings 4 ″ e . cooling / protective layer 4 ″ f is also provided on wall 4 ″. screws 4 ′ c and 4 ″ c are conventional devices operated in a conventional manner to move the solid particulate additional carbon material down through spaces 4 ′ c , 4 ″ c and out openings 4 ′ e , 4 ″ e , respectively . preferably , the motors used to turn screws 4 ′ c , 4 ″ c are variable to provide for a change of speed and control of the amount of additional carbon material added to the underflow slag . a preferred embodiment providing an example for carrying out the process according to the present invention will now be described in connection with fig1 . a charge of alumina and carbon is supplied through the supply means 8 to the low temperature compartment 2 . electric energy is supplied through the electrodes 6 to provide and maintain a molten slag bath of alumina and al 4 c 3 at a temperature of about 2000 ° c . the electrodes 6 are submerged in the molten slag bath whereby the energy is transferred to the molten slag bath by resistance heating . the off gas from the low temperature compartment 2 , which usually will contain co 1 al 2 o and some al vapor , is withdrawn through an off gas duct and into the lower part of the off gas exit 9 . the al 4 c 3 which is recovered in reactor 10 is preferably recycled to the reactor through hopper 30 and hollow partition wall 4 . the molten slag consisting of aluminum carbide and alumina produced in the low temperature compartment 2 will continuously flow under hollow partition wall 4 and into the high temperature compartment 3 . additional carbon material from hopper 30 will flow down through hollow partition wall 4 and into the molten slag flowing under wall 4 . as shown in fig2 - 5 , screws 4 ′ d , 4 ″ d are rotated to transport additional carbon material through walls 4 ′, 4 ″ and out openings 4 ′ e , 4 ″ e , respectively . rack and pinion system 4 ′ g is employed to raise and lower wall 4 ′ thereby varying the height of opening 4 ′ e in the slag . the speed of screws 4 ′ d , 4 ″ d is varied to control the amount of additional carbon material that flows down from hopper 30 and into the underflow slag . in the high temperature compartment 3 the temperature of the molten slag is increased to 2100 ° c . or more by supply of electric current to the plurality of sidewall electrodes 7 , which heat the slag bath by resistance heating . by using a plurality of pairs of electrodes 7 arranged along the sidewalls of the high temperature compartment 3 , below rather than through molten aluminum layer 31 , very importantly , the temperature can be controlled in slag bath along the length of the high temperature compartment 3 , and localized superheating is reduced or avoided . this process involves essentially horizontal flow of the molten slag into high temperature compartment 3 , as shown by the arrows 38 in compartment 2 , without need of a separate heating duct or use of gases to effect slag flow . by maintaining the temperature in the slag bath in the high temperature compartment 3 at a temperature above about 2100c ., aluminum carbide will react with alumina to produce al and co gas . the additional carbon will replace carbon consumed during the al producing reaction . due to the high temperature , an appreciable amount of produced al will vaporize together with al 2 o and will leave the furnace with the off gas . the liquid al produced in the high temperature compartment 3 will , due to its low density , form a molten layer 31 on top of the molten slag bottom layer and it is tapped from the furnace through the overflow outlet 5 . there is no need to recirculate the remaining slag back into the low temperature compartment 2 by separate ducting , saving substantial costs and simplifying the process . during the reaction of aluminum carbide and alumina , the molten slag bath in the high temperature compartment will be depleted of carbon . additional carbon material is therefore supplied to the high temperature compartment 3 through hollow partition wall 4 . in addition to carbon material , solid alumina can be charged to the high temperature compartment 3 through hollow partition wall 4 . the aluminum produced in the high temperature compartment 3 will be saturated with molten aluminum carbide . the superheated aluminum in the high temperature compartment 3 is continuously tapped through the over / underflow outlet 5 and can be passed to downstream operations . the aluminum is then cooled to form a stream 40 , preferably by addition of aluminum scrap 42 in cooling vessel 44 , to a temperature above the melting point for aluminum . when the aluminum is cooled , a major part of the aluminum carbide dissolved in the aluminum will precipitate as solid aluminum carbide 46 and can be skimmed off from the cooled molten aluminum in purification vessel 48 . vessels 44 and 48 can be combined . the remaining aluminum carbide 50 can be removed by conventional means , such as by passing stream 49 through filter 52 . the aluminum carbide removed from the aluminum after tapping is preferably recycled to the low temperature compartment 2 and / or to hollow partition wall 4 . the cooling vessel , purification vessel and filter may be of any type useful to perform its function . the purified aluminum stream 54 may then be passed to any number of apparatuses , such as degassing apparatus 56 to remove , for example , h 2 , fluxing apparatus 58 to scavenge oxides from the melt and eventually to casting apparatus 60 to provide unalloyed primary shapes such as ingots 62 or the like of about 50 lb . ( 22 . 7 kg ) to about 750 lb . ( 341 kg ). these ingots may then be remelted for final alloying in a holding or blending furnace or the melt from fluxing apparatus may be directly passed to a furnace for final alloying and casting as alloyed aluminum shapes . elements such as cu , fe , si , mg , ni , cr , etc . may be added to the blending furnace as rich alloy ingots such as 82 % al / 18 % cu since addition in pure form may not be feasible . these operations are well known and described , for example , in aluminum , vol . iii , ed . kent r . van horn , amer . soc . of metals ( 1967 ), pp . 18 - 36 , herein incorporated by reference . the amount and location of carbon in the slag layer of the high temperature compartment 3 can be measured by sensor 70 or by measuring the electric resistance of the slag . this helps to determine both the amount of carbon present and whether the carbon is evenly distributed in the slag layer . sensor 70 is a conventional sensor operated in a conventional manner . sensor 70 communicates with screw motor 72 and rack and pinion system 4 ′ g to control the amount of carbon material added as well as the height in the slag layer where the carbon material is to be added . individual motors of each screw conveyor 4 ′ d , 4 ″ d are independently controlled to control the addition of carbon material in a third dimension . in particular , if additional carbon material is needed along the sides of the furnace , only screws 4 ′ d , 4 ″ d at the ends of walls 4 ′, 4 ″ are operated while the screws 4 ′ d , 4 ″ d in the middle of wall 4 ′, 4 ″ are stopped . as will be appreciated , independent control of each of screws 4 ′ d , 4 ″ d along with rack and pinion system 4 ′ g allows for three - dimensional control of the addition of carbon material through walls 4 ′, 4 ″. it will be understood that the claims are intended to cover all changes and modifications of the preferred embodiments of the invention herein chosen for the purpose of illustration which do not constitute a departure from the spirit and scope of the invention . having described the presently preferred embodiments , it is to be understood that the invention may be otherwise embodied within the scope of the appended claims . | 2 |
referring initially to fig1 and 2 , a conventional waterproof fabric awning 10 is shown mounted on the side of a recreational vehicle generally illustrated as 12 . it will be understood that while the present invention is designed especially for use in connection with awnings mounted on recreational vehicles , the protective awning cover may also be used with fabric awnings mounted on homes or other buildings . referring additionally to fig3 the awning 10 is connected to the recreational vehicle or the like by means of an awning rail 14 that is mounted on the side of recreational vehicle 12 or a building by means of clamps 16 or other conventional fasteners . awning rail 14 includes a mounting plate portion 18 that is adapted to be positioned against the wall of the recreational vehicle or building on which the awning is mounted , and a channel portion 20 in which the fabric awning 10 is held . channel 20 includes a longitudinal opening 21 through which the awning extends . as is best shown in fig3 awning 10 is held in the awning rail channel 20 by wrapping the end of the awning around a welt cord 22 or the like , and then sewing the awning back upon itself along line 24 to hold the welt cord in place to form a welt . the welt is typically inserted in the channel portion of the awning rail by sliding it into the open end of the channel . it has been found that sanding or flaring the end of the channel eases the positioning of the awning welt therein . as shown , the diameter of the welt is provided to be larger than the opening 21 in the awning rail channel through which the awning extends , and thus the welt cannot readily be pulled through this opening and the awning is held firmly in place and a waterproof connection between the awning rail and the awning is formed . a conventional roller tube 26 , typically formed of aluminum and including a spring wound core 27 , is shown connected to the outer end of the awning 10 . as illustrated , the connection between the awning and the roller tube is again by means of a welt cord 28 sewn into the edge of the awning and then slipped within open channel 30 formed in the surface of the roller tube . again , the welt is larger in diameter than the opening of the channel 30 , thus forming a firm connection between the awning and the roller tube . roller tube 26 is shown supported in its extended position by means of a pair of rafter arms 32 extending generally outwardly from the awning rail supports 16 and cooperating upwardly extending support arms 34 . the awning rafter arms and support arms are all conventional and will not be described in detail other than to indicate that they function to support the outer end of the awning when the awning is in its open or unrolled position and are mounted to pivot and slide with respect to each other to a generally vertical position adjacent the wall of the recreational vehicle 12 when the awning is rolled for storage . fig1 and 2 illustrate that the awning cover 36 of the present invention is positioned upon the fabric awning 10 adjacent its inner edge connection to awning rail 14 . referring additionally to fig3 the awning cover includes an awning guard portion 38 which preferably comprises a generally rectangular sheet of thin , flexible stainless steel . in one embodiment , it has been found satisfactory to use a sheet stainless steel formed of a no . 304 alloy and having a thickness of 0 . 005 inches . if desired , the surface texture of the metal may be embossed to better hide abrasions . since the purpose of an awning cover is to protect the stored fabric awning against not only the effects of sunlight , but also contact abrasions , it has been found that sheet stainless steel very satisfactorily protects the awning against abrasions or rips that may occur when the recreational vehicle mounted awning is driven into contact with tree branches or the like . it will be understood , however , that any material , including plastic of a flexible and durable nature , or interleaved aluminum panels may satisfactorily be employed in accordance with the teachings of the present invention . as illustrated in fig1 and 2 , awning guard 38 is generally rectangular and extends substantially from one lateral edge of the awning to the other such that when the awning is rolled , the entire width of the awning is covered by the awning guard in a manner to be described hereafter . referring also to fig4 it will be seen that the length of the awning guard is such that when the awning is rolled for storage , the awning guard substantially covers the exposed surface of the rolled awning . in fig4 the awning guard is shown as extending from immediately adjacent the awning rail 14 around the rolled awning to a point adjacent recreational vehicle wall 12 . it will be understood that the lateral length of the awning guard may be varied as desired to cover a greater or lesser portion of the circumference of the rolled awning . in general , however , it is preferred that the awning guard cover a substantial portion of the exposed surface of the fabric awning when rolled , such as is shown in fig4 . referring specifically to fig3 awning guard 38 is shown to include a first connector means 40 mounted along the inner edge of the awning guard and a second identical connector means 42 mounted along the outer edge of the awning guard . connectors 40 and 42 may be riveted to the awning guard by means of conventional stainless steel rivets 44 , but it will be understood that any conventional fastening means , including adhesive , may be used to join these connectors to the awning guard . since these fasteners do not perforate the fabric awning , watertight fasteners need not be used . however , it has been found desirable to place a foam pad or other soft material covering ( not shown ) on the surface of rivet 44 adjacent fabric awning 10 to protect the awning surface from wear . connectors 40 and 42 include a plate portion 46 through which the rivets 44 or other fastening means may be disposed and outwardly extending beads or rails 48 and 50 that are adapted to rest upon the upper surface of fabric awning 10 . as illustrated , rails 48 and 50 are integrally connected to plate 46 via narrowed neck portion 52 . as is best shown in fig3 rails 48 and 50 are adapted to be pressed into the fabric awning such that the awning conforms generally to the surface of the rails . retaining channels 54 and 56 are positioned on the opposite side of the fabric awning 10 from awning guard 38 and are adapted to slide over rails 48 and 50 , respectively , to capture a portion of the fabric awning therebetween . in this manner , the awning cover is releasably secured in place on the surface of fabric awning 10 without any perforation of the fabric material . retaining channels 54 and 56 are generally c - shaped and include a narrow opening adjacent the necks 52 of the connectors which thus prevent the rails 48 and 50 from being disengaged therefrom other than by sliding the retaining channel off of the end of the rail . while it is preferred to affix the rail connector to the awning guard in the manner illustrated in fig3 it is also contemplated that a retaining channel 54 &# 39 ; could be formed on a connector 40 &# 39 ; and that a rail 48 &# 39 ; could be positioned on the opposite side of the awning 10 to form the cooperating means for gripping the awning fabric as depicted in fig5 . it is also contemplated that other forms of interconnectible structures adapted to be positioned on opposite sides of the fabric awning to grip it and , thus , hold the awning guard in place may be used and are considered to be within the scope of this invention . although the present invention has been disclosed with respect to several preferred embodiments and modifications thereto , further modifications will be apparent to those skilled in the art . accordingly , it is not intended that the invention be limited by the disclosure or by such modifications , but instead that its scope should be determined entirely by reference to the claims which follow hereinbelow . | 4 |
the present invention provides a method of network resource release processing , which includes the following steps . after a ue using isr mechanism registers to two 3gpp communication networks , when the ue changes ( including being handed over ) from the 3gpp communication network to a non - 3gpp communication network ( particularly , the ue moves to the non - 3gpp network , the ue initiates a processing process of attaching to the non - 3gpp network in the non - 3gpp network , or the ue initiates the processing process of attaching to the non - 3gpp network in the 3gpp network ), a serving gw receives a message sent from a peer endpoint ne , and deletes network resources established by the two 3gpp communication networks for the ue according to information included in the message . the message sent from the peer endpoint ne received by the serving gw includes , but not limited to , the following two manners . in a manner 1 , when the peer endpoint ne is a pdn gw , the message sent from the peer endpoint ne is a delete bearer request message or a binding revocation indication message . in a manner 2 , when the peer endpoint ne is a mobility management ne of the 3gpp communication network , the message sent from the peer endpoint ne is the delete bearer request message or a delete packet data protocol ( pdp ) context request message . in manner 2 . 1 , an hss triggers the mobility management ne of the 3gpp communication network to send the delete bearer request message or the delete pdp context request message to the serving gw . in manner 2 . 2 , the non - 3gpp communication network triggers the mobility management ne of the 3gpp communication network to send the delete bearer request message or the delete pdp context request message to the serving gw . in the following , technical solutions of the method of resource release processing when the ue using the isr mechanism changes from the 3gpp communication network to the non - 3gpp communication network , the mobility management ne , and the serving gw are described in detail with accompanying drawings . in the manner 1 , when the peer endpoint ne is the pdn gw , the message sent from the peer endpoint ne is the delete bearer request message or the binding revocation indication message . fig2 is a flow chart of a first embodiment of the method of network resource release processing according to the present invention . referring to fig2 , in this embodiment , for mobility management nes of two 3gpp communication networks , a mobility management ne of a second 3gpp communication network is an old sgsn , and a mobility management ne of a first 3gpp communication network is an old mme . when a ue using isr mechanism in the 3gpp communication network moves from the 3gpp network to a non - 3gpp network , a pdn gw performs a resource release process . the method includes the following steps . in step s 1 , the ue performs a service process in the 3gpp network , and initiates an attach session negotiation procedure when moving from the 3gpp communication network to the non - 3gpp communication network . in step s 2 , the pdn gw sends a message to a serving gw , in which when interface protocol between the serving gw and the pdn gw is gprs tunneling protocol ( gtp ), the message is a delete bearer request message , and when the interface protocol between the serving gw and the pdn gw is proxy mobile internet protocol ( pmip ), the message is a binding revocation indication message . the pdn gw may include first indication information in the delete bearer request message or the binding revocation indication message , the first indication information is configured to indicate that a communication network of the ue changes from the 3gpp communication network to the non - 3gpp network , that is , the delete bearer request message or the binding revocation indication message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . a particular manner of processing the indication information is described as follows . a cause ie is set to a specific cause value ( for example , inter rat change from 3gpp to non - 3gpp ), so as to indicate that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a specific indication bit ie ( for example , inter rat change from 3gpp to non - 3gpp ) is set , so as to indicate that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a delete type or a revocation type ie is set to a specific value ( for example , 1 ), so as to identify that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . in step s 3 , after receiving the delete bearer request or the binding revocation indication message , according to the first indication information in the message , the serving gw judges that the ue changes from the 3gpp communication network to the non - 3gpp communication network , and the serving gw finds that the ue uses the isr mechanism , so the serving gw decides to deactivate the isr mechanism of the ue ( that is , the serving gw decides that the ue does not use the isr mechanism in the 3gpp communication network and the non - 3gpp communication network ), performs a session negotiation on the resource release process with the 3gpp communication network , and releases the resources of the ue in the 3gpp . it should be noted that when the pdn gw does not include the first indication information in the delete bearer request or the binding revocation indication message , and after the serving gw finds that all bearers of the ue are requested to be released by the pdn gw , the serving gw considers that the bearer release is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . in step s 4 , after completing the session negotiation with the 3gpp communication network , the serving gw releases the resources ( including user plane resources and control plane resources ) of the ue in the 3gpp communication networks on the serving gw , and returns a response message , for example , a delete bearer response message or a bind revocation acknowledgement message , to the pdn gw . after receiving the response message , the pdn gw releases the 3gpp network resources of the ue on the pdn gw , reserves the resources in the target non - 3gpp communication network , and at the same time reserves resources assigned by the pdn gw for the ue , such as an ip address . referring to fig2 , the attach session negotiation procedure in step s 1 particularly includes the following steps . in step s 101 , the ue registers to the old mme of the first 3gpp communication network and the old sgsn of the second 3gpp communication network , uses the isr mechanism between the old sgsn and the old mme , and performs the service process through the serving gw and the pdn gw . in step s 102 , the ue moves to the non - 3gpp communication network , and executes a specific attachment procedure , and authorization and authentication programs of the non - 3gpp communication network through the non - 3gpp communication network . in step s 103 , a non - 3gpp gw sends a gateway control and qos policy rules request message to a pcrf to acquire a policy and charging control ( pcc ) rule used by the ue in the non - 3gpp communication network . the pcrf returns a gateway control and qos policy rules response message to the non - 3gpp gw , in which the message includes the pcc rule used by the ue in the non - 3gpp communication network . in this step , for a wlan system , the non - 3gpp gw is an evolved packet data gateway ( epdg ), for a wimax system , the non - 3gpp gw is an access service network gateway ( asn gw ), for a cdma system , the non - 3gpp gw is an access gateway ( agw ), and for a high rate packet data ( hrpd ) network , the non - 3gpp gw is a packet data serving node ( pdsn ). note : the pdsn is described to be an hrpd serving gateway ( hrpd serving gw ) in some protocols . in step s 104 , the ue triggers a layer 3 attachment procedure . in step s 105 , if interface between the non - 3gpp gw and pdn gw uses the pmip protocol , the non - 3gpp gw sends a proxy binding update ( bu ) message to the pdn gw . if interface between the ue and the pdn gw uses a client mobile internet protocol ( cmip ), the ue sends a bu message to the pdn gw . in step s 106 , after receiving the message , the pdn gw acquires the pcc rule of the ue saved in the gw , and judges whether the pcc rule is relevant to an access type of an ip - connectivity access network ( ip - can ). if yes , the pdn gw sends an ip - can session modification request message to the pcrf to acquire the pcc rule used by the ue in the non - 3gpp communication network . the pcrf returns an ip - can session modification acknowledgement message to the pdn gw , in which the message includes the pcc rule used by the ue in the non - 3gpp communication network . in step s 107 , the pdn gw returns a proxy binding acknowledgement ( ba ) message to the non - 3gpp gw , or the pdn gw returns the ba message to the ue . in step s 108 , the non - 3gpp gw indicates the ue that the layer 3 attachment is completed . referring to fig2 , step s 3 particularly includes the following steps . in step s 301 , after the serving gw judges that the ue changes from the 3gpp communication network to the non - 3gpp communication network according to the first indication information in the message sent from the pdn gw , the serving gw sends the delete bearer request message or the delete pdp context request message to the old mme of the first 3gpp communication network and the old sgsn of the second 3gpp communication network . the serving gw may include the first indication information in the delete bearer request message or the delete pdp context request message , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . the particular manner of processing the first indication information is described as follows . a cause ie is set to a specific cause value ( for example , inter rat change from 3gpp to non - 3gpp ), so as to indicate that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a specific indication bit ie ( for example , inter rat change from 3gpp to non - 3gpp ) is set , so as to indicate that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a delete type ie is set to a specific value ( for example , 1 ), so as to identify that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . the serving gw may also include second indication information in the delete bearer request message or the delete pdp context request message , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the isr mechanism of the ue is deactivated . a particular manner of processing the second indication information is described as follows . a cause ie is set to a specific cause value ( for example , isr deactive ), so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the isr mechanism of the ue is deactivated . alternatively , a specific indication bit ie or an identity ie ( for example , isr deactive ) is set , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the isr mechanism of the ue is deactivated . alternatively , a delete type ie is set to a specific value ( for example , 2 ), so as to identify that the delete bearer request message or the delete pdp context request message is caused by that the isr mechanism of the ue is deactivated . in step s 302 , after receiving the delete bearer request message or the delete pdp context request message sent from the serving gw , the old sgsn and the old mme finds that the communication network of the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr mechanism of the ue is deactivated according to the first indication information or the second indication information , the old sgsn and the old mme release the resources of the ue in the 3gpp networks . the process is described as follows . the ue is detached , and a state of the ue is set to an “ emm - deregistered ” state . if the state of the ue is an activated state or a connected state in the old sgsn or the old mme , the old sgsn and the old mme notify the nes of the 3gpp communication networks to release the resources ( including a connection resource and a bearer resource ). alternatively , if the state of the ue is an idle state in the old sgsn or the old mme , the old sgsn and the old mme do not trigger a paging process , and directly delete the resources locally . the old sgsn and the old mme return the delete bearer response message or the delete pdp context response message to the serving gw . it should be noted that when the serving gw does not include the first indication information or the second indication information in the delete bearer request message or the delete pdp context request message , and after the old mme and the old sgsn find that all the bearers of the ue are requested to be released by the serving gw , the old mme and the old sgsn consider that the bearer release is caused by that the ue changes from the 3gpp communication network to the non - 3gpp network or the isr mechanism of the ue is deactivated . in the above steps , if the old sgsn or the old mme finds that the ue registers to a mobile switching center ( msc ), in which the msc mainly provides circuit switching calling function and mobility management function for mobile users , when the mme or the sgsn detaches the ue , and the detaching of the ue is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , the old sgsn or the old mme sends an international mobile user identity ( imsi ) detach indication message to the msc , so as to indicate the msc to detach the ue . fig3 is a flow chart of a second embodiment of the method of network resource release processing according to the present invention . referring to fig3 , in this embodiment , a mobility management ne of a second 3gpp communication network is an old sgsn , and a mobility management ne of a first 3gpp communication network is an old mme . after a ue using isr mechanism moves from the 3gpp network to a non - 3gpp network , the ue initiates an attachment procedure through the non - 3gpp network . then , a resource release process is performed . the method includes the following steps . in step s 1 , the ue performs a service process in the 3gpp communication network , and initiates an attach session negotiation procedure when moving from the 3gpp communication network to the non - 3gpp communication network . the step s 1 includes the following steps . in step s 101 , the ue registers to the old mme of the first 3gpp communication network and the old sgsn of the second 3gpp communication network , uses the isr mechanism between the old sgsn and the old mme , and performs the service process through the serving gw and the pdn gw . in step s 102 , the ue moves to the non - 3gpp communication network , and executes a specific attachment procedure , and authorization and authentication programs of the non - 3gpp communication network through the non - 3gpp communication network . the subsequent process is the same as steps s 103 - 108 of the first embodiment , so it is not described here . in step s 2 , the pdn gw sends a message to a serving gw , in which when interface protocol between the serving gw and the pdn gw is a gtp protocol , the message is a delete bearer request message , and when the interface protocol between the serving gw and the pdn gw is a pmip protocol , the message is a binding revocation indication message . the pdn gw may include first indication information in the message , the first indication information is configured to indicate that a communication network of the ue changes from the 3gpp communication network to the non - 3gpp network , that is , the delete bearer request message or the binding revocation indication message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . a particular manner of processing the indication information is the same as the description in step s 2 of the first embodiment , so it is not described here . in step s 3 , after receiving the delete bearer request or the binding revocation indication message , the serving gw judges that the ue changes from the 3gpp communication network to the non - 3gpp communication network according to the first indication information in the message ( when the pdn gw does not include the first indication information in the delete bearer request or the binding revocation indication message , and after the serving gw finds that all bearers of the ue are requested to be released by the pdn gw , the serving gw considers that the bearer release is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network ), the serving gw performs a session negotiation on the resource release process with the 3gpp communication network , and releases the resources of the ue in the 3gpp . the step particularly includes the following steps . in step s 301 , the serving gw sends the delete bearer request message or the delete pdp context request message to the old mme of the first 3gpp communication network or the old sgsn of the second 3gpp communication network . the serving gw may include the first indication information or second indication information in the delete bearer request message or the delete pdp context request message . the particular manner of processing the first indication information or the second indication information is the same as the description in step s 301 of the first embodiment , so it is not described here . it should be noted that in the embodiment of the present invention , the process that the serving gw sends the delete bearer request message or the delete pdp context request message to the old sgsn of the second 3gpp communication network is the same as the process that the serving gw sends the delete bearer request message or the delete pdp context request message to the old mme of the first 3gpp communication network . in this embodiment , only the process that the serving gw sends the delete bearer request message to the old mme of the first 3gpp communication network is set as an example for description . the situation that the serving gw sends the delete bearer request message to the old sgsn is not described here . in step s 302 , after receiving the delete bearer request message sent from the serving gw , according to the first indication information or the second indication information , the old mme of the first 3gpp communication network finds that the bearer delete is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr mechanism of the ue is deactivated ( when the serving gw does not include the first indication information or the second indication information in the delete bearer request , and after the old mme of the first 3gpp communication network finds that all bearers of the ue are requested to be released by the serving gw , the old mme of the first 3gpp communication network considers that the bearer release is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr mechanism of the ue is deactivated ), and the old mme of the first 3gpp communication network finds that the ue uses the isr mechanism , the old mme of the first 3gpp communication network deactivates the isr mechanism of the ue , and notifies the old sgsn of the second 3gpp communication network to detach the user and release the resources . the old mme may send a detach request message to the old sgsn of the second 3gpp communication network to notify the old sgsn to detach the user and release the resources . the old mme may include the first indication information or the second indication information in the detach request message . a particular manner of processing the first indication information is described as follows . a cause ie is set to a specific cause value ( for example , inter rat change from 3gpp to non - 3gpp ), so as to indicate that the detach request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a specific indication bit ie ( for example , inter rat change from 3gpp to non - 3gpp ) is set , so as to indicate that the detach request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a delete type ie is set to a specific value ( for example , 1 ), so as to identify that the detach request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . the second indication information is configured to indicate that the request message is caused by that the isr mechanism of the ue is deactivated . the particular process is described in detail as follows . the cause ie is set to a specific cause value ( for example , isr deactive ), so as to indicate that the detach request message is caused by that the isr mechanism of the ue is deactivated . alternatively , a specific indication bit ie or an identity ie ( for example , isr deactive ) is set , so as to indicate that the detach request message is caused by that the isr mechanism of the ue is deactivated . alternatively , the delete type ie is set to a specific value ( for example , 2 ), so as to identify that the detach request message is caused by that the isr mechanism of the ue is deactivated . it should be noted that the old mme may also send other messages to notify the old sgsn to detach the user and release the resources , for example , the old mme sends a delete resource request or a detach indication message to the old sgsn to notify the old sgsn to detach the user and release the resources . in step s 303 , after the old sgsn of the second 3gpp communication network receives the detach request message , the following process is performed . when the detach request message does not include the indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr is deactivated , the old sgsn sends the delete pdp context request ( or the delete bearer request ) message to the serving gw , and after receiving a pdp context response ( or a delete bearer response ) returned from the serving gw , the old sgsn locally detaches the user and deletes the bearer context resources , and sets a state of the ue to an “ emm - deregistered ” state . alternatively , when the detach request message includes the indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr is deactivated , and the serving gw releases all the resources without being notified by the old sgsn of the resource release , the old sgsn does not send the delete pdp context request ( or the delete bearer request ) message to the serving gw , but locally detaches the user and deletes the bearer context resources , and sets the state of the ue to the “ emm - deregistered ” state . alternatively , when the detach request message includes the indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr is deactivated , and the serving gw releases all the resources after being notified by the old sgsn of the resource release , the old sgsn sends the delete pdp context request ( or the delete bearer request ) message to the serving gw , and after receiving the pdp context response ( or the delete bearer response ) returned from the serving gw , the old sgsn locally detaches the user and deletes the bearer context resources , and sets the state of the ue to the “ emm - deregistered ” state . in step s 304 , the old sgsn sends a detach response message to the old mme . in step s 305 , after receiving the detach response message , the old sgsn locally detaches the user and deletes the bearer context resources ( the old sgsn may also release the bearer context resources after receiving the delete bearer request message sent from the serving gw ), sets the state of the ue to the “ emm - deregistered ” state , and returns a delete bearer response message to the serving gw . in step s 4 , after completing the session negotiation with the 3gpp communication networks , the serving gw releases the resources ( including user plane resources and control plane resources ) of the ue in the 3gpp communication networks on the serving gw , and returns the delete bearer response message or a bind revocation acknowledgement message to the pdn gw . after receiving the delete bearer response message or the bind revocation acknowledgement message , the pdn gw releases the 3gpp network resources of the ue on the pdn gw , reserves the resources in the target non - 3gpp communication network , and at the same time reserves resources assigned by the pdn gw for the ue , such as an ip address . in this embodiment , when the serving gw finds that the bearer delete is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , and the serving gw finds that the ue uses the isr mechanism , the serving gw has the following process manners . after receiving the delete bearer response message sent from the old mme , the serving gw releases all the resources of the ue in the serving gw , in which the resources include the user plane resources and the control plane resources ( for example , the bearer context , and the control plane resources of the serving gw towards the old mme and the old sgsn ), and the old sgsn needs not to notify the bearer resource release . alternatively , the serving gw deactivates the isr mechanism of the ue , deletes the resources ( for example , the control plane resource of the serving gw towards the old mme ) in the serving gw relevant to the old mme , but the serving gw does not delete the bearer context used by the ue , and does not delete the control plane resource of the serving gw towards the old sgsn . the serving gw releases all the resources ( for example , the bearer context and the control plane resource of the serving gw towards the old sgsn ) of the ue in the serving gw after receiving the delete bearer request message sent from the old sgsn . in the steps , if the old sgsn or the old mme finds that the ue registers to an msc , when the mme or the sgsn detaches the ue , and the detaching of the ue is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , the old sgsn or the old mme sends an imsi detach indication message to the msc , so as to indicate the msc to detach the ue . in the manner 2 . 1 , the hss triggers the mobility management ne of the 3gpp communication network to send the delete bearer request message or the delete pdp context request message to the serving gw . fig4 is a flow chart of a third embodiment of the method of network resource release processing according to the present invention . referring to fig4 , in this embodiment , a mobility management ne of a first 3gpp communication network is an old sgsn , and a mobility management ne of a second 3gpp communication network is an old mme . the method includes the following steps . in step f 1 , a ue performs a service process in the 3gpp communication network , and initiates an attach session negotiation procedure when moving from the 3gpp communication network to the non - 3gpp communication network . the step f 1 includes the following steps . in step f 101 , the ue registers to the old sgsn of the first 3gpp communication network and the old mme of the second 3gpp communication network , uses the isr mechanism between the old sgsn and the old mme , and performs the service process through a serving gw and a pdn gw . in step f 102 , the ue moves to the non - 3gpp communication network , and executes a specific attachment procedure , and authorization and authentication programs of the non - 3gpp communication network . the subsequent process is the same as steps s 103 - 108 of the first embodiment , so it is not described here . in step f 103 , the pdn gw or a non - 3gpp gw registers a radio access network type ( rat type ) of the non - 3gpp communication network used by the ue to an hss through an aaa server . in step f 2 , the hss finds that the rat type of the ue changes to the rat type of the non - 3gpp communication network , and the hss finds that the ue uses the isr mechanism , or the hss finds that the old sgsn of the first 3gpp communication network and the old mme of the second 3gpp communication network register to the hss , the hss decides to detach the ue from the old mme and the old sgsn ( that is , the hss decides that the ue does not use the isr mechanism in the 3gpp communication network and the non - 3gpp communication network ), and sends a cancel location message to the old mme of the second 3gpp communication network and the old sgsn of the first 3gpp communication network of the 3gpp communication networks . the hss may include first indication information in the cancel location message , in which the first indication information is configured to indicate that a communication network of the ue changes from the 3gpp communication network to the non - 3gpp communication network , that is , the cancel location message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . a particular manner of processing the first indication information is described as follows . a cause ie is set to a specific cause value ( for example , inter rat change from 3gpp to non - 3gpp ), so as to indicate that the cancel location is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a specific indication bit ie ( for example , inter rat change from 3gpp to non - 3gpp ) is set , so as to indicate that the cancel location is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a cancellation type ie is set to a specific value ( for example , 1 ), so as to identify that the cancel location is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . in step f 3 , after receiving the cancel location message , the 3gpp communication network judges that the ue changes from the 3gpp communication network to the non - 3gpp communication network according to the first indication information in the message , performs a session negotiation on the resource release process with the serving gw , and releases the resources of the ue in the 3gpp . in step f 4 , after the serving gw completes the session negotiation on the resource release process , if the releasing of the resources of the 3gpp communication network side in the pdn gw need to be notified by the serving gw , the serving gw performs the session negotiation with the pdn gw , so as to indicate the pdn gw to release the resources . in step f 3 , the process that the 3gpp communication network performs the session negotiation on the resource release process with the serving gw and releases the resources of the ue in the 3gpp particularly includes the following steps . in step f 301 , after receiving the cancel location message , the old sgsn of the first 3gpp communication network and the old mme of the second 3gpp communication network detach the ue , and send a delete bearer request message or a delete pdp context request message to the serving gw . the old sgsn and the old mme include the first indication information in the delete bearer request message or the delete pdp context request message , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . a particular processing manner is described as follows . the cause ie is set to a specific cause value ( for example , inter rat change from 3gpp to non - 3gpp ), so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a specific indication bit ie ( for example , inter rat change from 3gpp to non - 3gpp ) is set , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , the delete type ie is set to a specific value ( for example , 1 ), so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . in step f 302 , the serving gw returns a delete bearer response or a delete pdp context response message to the old mme and the old sgsn . after receiving the delete bearer request message or the delete pdp context request message sent from the old sgsn and the old mme , the serving gw finds that the communication network of the ue changes from the 3gpp communication network to the non - 3gpp communication network according to the first indication information , so as to release all the resources including user plane resources and control plane resources ( including the control plane resources of the serving gw towards the old sgsn and the old mme ) of the ue . in step f 4 , the process that the serving gw performs the session negotiation with the pdn gw , and indicates the pdn gw to release the resources particularly includes the following steps . in step f 401 , the serving gw sends a message including the first indication information to the pdn gw , in which when interface protocol between the serving gw and the pdn gw uses gtp protocol , the message is the delete bearer request , when the interface protocol between the serving gw and the pdn gw uses pmip protocol , the message is a proxy bu , and the serving gw sets a lifetime in the proxy bu message to 0 . the first indication information indicates that the delete bearer request or the proxy bu message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . a particular processing manner for the first indication information is described as follows . the cause ie is set to a specific cause value ( for example , inter rat change from 3gpp to non - 3gpp ), so as to indicate that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , a specific indication bit ie ( for example , inter rat change from 3gpp to non - 3gpp ) is set , so as to indicate that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . alternatively , the delete type or the revocation type ie is set to a specific value ( for example , 1 ), so as to identify that the process is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . in step f 402 , after receiving the message , the pdn gw deletes the resources of the ue in the old 3gpp communication networks ( for example , a binding cache entry resource or a bearer context of the old 3gpp communication network ), reserves the resources in the target non - 3gpp communication network , and at the same time reserves resources assigned by the pdn gw for the ue , such as an ip address . the pdn gw returns a response message ( for example , a delete bearer response or a proxy ba message ) to the serving gw . in the steps , if the old sgsn or the old mme finds that the ue registers to an msc , when the mme or the sgsn detaches the ue , and the detaching of the ue is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , the old sgsn or the old mme sends an imsi detach indication message to the msc , so as to indicate the msc to detach the ue . fig5 is a flow chart of a fourth embodiment of the method of network resource release processing according to the present invention . referring to fig5 , in this embodiment , a mobility management ne of a first 3gpp communication network is an old sgsn , and a mobility management ne of a second 3gpp communication network is an old mme . the method includes the following steps . in step f 1 , a ue performs a service process in the 3gpp communication network , and initiates an attach session negotiation procedure when moving from the 3gpp communication network to the non - 3gpp communication network . the particular process is the same as the third embodiment as shown in fig4 , so it is not described here . in step f 2 , the hss finds that an rat type of the ue changes to the rat type of the non - 3gpp communication network , the hss decides to detach the ue from the old mme of the second 3gpp communication network or the old sgsn of the first 3gpp communication network , and sends a cancel location message to the old mme of the second 3gpp communication network or the old sgsn of the first 3gpp communication network . the hss may include first indication information in the cancel location message . a particular manner of processing the first indication information is consistent with the description in step f 2 of the third embodiment , so it is not described here . it should be noted that the processing process of sending the cancel location message including the first indication information to the old mme of the second 3gpp communication network is the same as the process of sending the cancel location message including the first indication information to the old sgsn of the first 3gpp communication network . in this embodiment , the process of sending the cancel location message including the first indication information to the old sgsn of the first 3gpp communication network is set as an example for description . in step f 3 , after receiving the cancel location message , the old sgsn of the first 3gpp communication network judges that the ue changes from the 3gpp communication network to the non - 3gpp communication network according to the first indication information in the message , performs a session negotiation on the resource release process with the serving gw , and releases the resources of the ue in the 3gpp . the step f 3 particularly includes the following steps . in step f 301 , the old sgsn of the first 3gpp communication network sends a delete bearer request or a delete pdp context request message to the serving gw , and includes the first indication information in the message to indicate that the delete bearer request or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . the processing manner is the same as that in the third embodiment . after receiving the delete bearer request or the delete pdp context request message , according to the first indication information , the serving gw finds that the bearer delete is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , and the serving gw finds that the ue uses the isr mechanism , the serving gw then sends a delete bearer response or a delete pdp context response message to the old sgsn , and performs the following processes . the serving gw releases all the resources including user plane resources and control plane resources ( for example , the bearer context , the control plane resources of the serving gw towards the old mme of the second 3gpp communication network and towards the old sgsn of the first 3gpp communication network ) of the ue in the serving gw , and the old mme of the second 3gpp communication network needs not to notify the bearer resource release . alternatively , the serving gw deactivates the isr mechanism of the ue , and deletes the resources ( for example , the control plane resource of the serving gw towards the old sgsn ) relevant to the old sgsn of the first 3gpp communication network in the serving gw , but the serving gw does not delete the bearer context used by the ue , and does not delete the control plane resource of the serving gw towards the old mme of the second 3gpp communication network , and the serving gw releases all the resources ( for example , the bearer context , the control plane resource of the serving gw towards the old mme ) of the ue in the serving gw after receiving the delete bearer request message sent from the old mme of the second 3gpp communication network . in step f 302 , after receiving the cancel location message sent from the hss in step f 2 , if the old sgsn of the first 3gpp communication network finds that the ue uses the isr mechanism , the old sgsn of the first 3gpp communication network decides to deactivate the isr mechanism of the ue , and notifies the old mme of the second 3gpp communication network to detach the user , and the old sgsn sends a detach request message to the old mme of the second 3gpp communication network . the old sgsn may include the first indication information or second indication information in the detach request message . the particular manner of processing the first indication information is the same as the description in step s 302 of the second embodiment , so it is not described here . the second indication information indicates that the detach request is caused by that the isr mechanism of the ue is deactivated . the particular processing manner is the same as the description in step s 302 of the second embodiment , so it is not described here . it should be noted that the old sgsn may also send other messages to notify the old mme to detach the user or release the resources , for example , the old sgsn sends a delete resource request or a detach indication message to the old mme to notify the old mme to detach the user and release the resources . in step f 303 , after receiving the message , the old mme of the second 3gpp communication network locally detaches the user and deletes the bearer context resource , and sets a state of the ue to an “ emm - deregistered ” state . if the old mme finds that the ue uses the isr mechanism , the old mme performs the following processes . when the detach request message does not include the first indication information or the second indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr is deactivated , the old mme sends the delete pdp context request ( or the delete bearer request ) message to the serving gw . alternatively , when the detach request message includes the first indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr is deactivated , and the serving gw releases all the resources without being notified by the old mme of the resource release , the old mme does not send the delete pdp context request ( or the delete bearer request ) message to the serving gw . alternatively , when the detach request message includes the indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr is deactivated , and the serving gw releases all the resources after being notified by the old sgsn of the resource release , the old mme sends the delete pdp context request ( or the delete bearer request ) message to the serving gw . in step f 304 , the old mme of the second 3gpp communication network returns a detach response message to the old sgsn of the first 3gpp communication network . in step f 4 , after the serving gw completes the session negotiation on the resource release process , if the releasing of the resources of the 3gpp communication network side in the pdn gw need to be notified by the serving gw , the serving gw performs the session negotiation with the pdn gw , and indicates the pdn gw to release the resources . the step f 4 particularly includes the following steps . steps f 401 - f 402 are the same as steps f 401 - f 402 of the third embodiment , so they are not described here . in the steps , if the old sgsn or the old mme finds that the ue registers to an msc , when the mme or the sgsn detaches the ue , and the detaching of the ue is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , the old sgsn or the old mme sends an imsi detach indication message to the msc , so as to indicate the msc to detach the ue . fig6 is a flow chart of a fifth embodiment of the method of network resource release processing according to the present invention . referring to fig6 , in this embodiment , a mobility management ne of a second 3gpp communication network is an old sgsn , and a mobility management ne of a first 3gpp communication network is an old mme . the method includes the following steps . in step g 1 , a ue performs a service process in the 3gpp network , and initiates an attach session negotiation procedure when moving from the 3gpp communication network to the non - 3gpp communication network . the particular process is the same as the third embodiment as shown in fig4 , so it is not described here . in step g 2 , an hss finds that an rat type of the ue changes to the rat type of the non - 3gpp communication network , the hss decides to detach the ue from the old mme or the old sgsn , and sends a cancel location message to the old mme of the first 3gpp communication network or the old sgsn of the second 3gpp communication network in the 3gpp communication networks . the hss may include first indication information in the cancel location message . a manner of processing the first indication information is consistent with the description in step f 2 of the third embodiment , so it is not described here . it should be noted that the processing process of sending the cancel location message including the first indication information to the old mme of the first 3gpp communication network is the same as the process of sending the cancel location message including the first indication information to the old sgsn of the second 3gpp communication network . in this embodiment , the process of sending the cancel location message including the first indication information to the old mme of the first 3gpp communication network is set as an example for description . in step g 3 , after receiving the cancel location message , the old mme of the first 3gpp communication network judges that the ue changes from the 3gpp communication network to the non - 3gpp communication network according to the first indication information in the message , performs a session negotiation on the resource release process with the serving gw , and releases the resources of the ue in the 3gpp . the step g 3 particularly includes the following steps . in step g 301 , after receiving the cancel location message , the old mme of the first 3gpp communication network sends a delete bearer pdp context request message or a delete pdp context request message to the serving gw , and includes the first indication information in the message to indicate that the delete bearer request message or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . the processing manner is the same as the description in step f 301 of the third embodiment , so it is not described here . in step g 302 , after receiving the delete bearer request message or the delete pdp context request message , according to the first indication information , the serving gw finds that the bearer delete is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , and the serving gw finds that the ue uses the isr mechanism , the serving gw deactivates the isr mechanism , and notifies the old sgsn of the second 3gpp communication network to delete the bearer and detach the user . particularly , the serving gw sends the delete pdp context request message or the delete bearer request message to the old sgsn of the second 3gpp communication network , the serving gw may include the first indication information or second indication information in the message to indicate that the delete pdp context request message or the delete bearer request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr mechanism of the ue is deactivated . the particular process is the same as the description in step s 301 of the first embodiment , and it is not described here . after receiving the delete bearer request or the delete pdp context request message sent from the serving gw , the old sgsn of the second 3gpp communication network finds that the bearer delete is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the isr mechanism of the ue is deactivated according to the first indication information or the second indication information , the old sgsn may perform the following processes . the ue is detached , and a state of the ue is set to an “ emm - deregistered ” state . if the state of the ue is an activated state or a connected state in the old sgsn , the old sgsn notifies the ne of the access network to release the resources ( including a connection resource and a bearer resource ), and returns a delete pdp context response message or a delete bearer response message to the serving gw . alternatively , if the state of the ue is an idle state in the old sgsn , the old sgsn does not triggers a paging process , but directly locally deletes the resources , and returns the delete pdp context response message or the delete bearer response message to the serving gw . it should be noted that when the serving gw does not include the first indication information or the second indication information in the delete bearer request message or the delete pdp context request message , and after the old sgsn finds that all the bearers of the ue are requested to be released by the serving gw , the old sgsn considers that the bearer release is caused by that the ue changes from the 3gpp communication network to the non - 3gpp network . in step g 303 , the serving gw releases all the resources including user plane resources and control plane resources ( including the control plane resources of the serving gw towards the old sgsn of the second 3gpp communication network and towards the old mme of the first 3gpp communication network ) of the ue , and returns the delete bearer response message or the delete pdp context response message to the old mme . in step g 4 , after the serving gw completes the session negotiation on the resource release process , if the releasing of the resources of the 3gpp communication network side in the pdn gw need to be notified by the serving gw , the serving gw performs the session negotiation with the pdn gw , and indicates the pdn gw to release the resources . step g 4 particularly includes the steps . steps g 401 - g 402 are the same as steps f 401 - f 402 of the third embodiment , so they are not described here . in the steps , if the old sgsn or the old mme finds that the ue registers to an msc , when the mme or the sgsn detaches the ue , and the detaching of the ue is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , the old sgsn or the old mme sends an imsi detach indication message to the msc , so as to indicate the msc to detach the ue . in the manner 2 . 2 , the non - 3gpp communication network triggers the mobility management ne of the 3gpp communication network to send the delete bearer request message or the delete pdp context request message to the serving gw . fig7 is a flow chart of a sixth embodiment of the method of network resource release processing according to the present invention . referring to fig7 , in this embodiment , a mobility management ne of a first 3gpp communication network is an old mme , and a mobility management ne of a second 3gpp communication network is an old sgsn . after a ue using an isr mechanism changes from the 3gpp network mobile to a non - 3gpp network , the us initiates an attachment procedure through the 3gpp network . then , a resource release process is performed . the method includes the following steps . in step h 1 , the ue performs a service process in the 3gpp communication network , and initiates an attach session negotiation procedure . in step h 2 , after the attach negotiate is completed , a non - 3gpp gw or a non - 3gpp access ne of the non - 3gpp communication network sends a handover complete message to the old mme of the first 3gpp communication network or the old sgsn of the second 3gpp communication network of the 3gpp communication networks . the process that the non - 3gpp gw or the non - 3gpp access ne sends the handover complete message to the old mme of the first 3gpp communication network is the same as the process that the non - 3gpp gw or the non - 3gpp access ne sends the handover complete message to the old sgsn of the second 3gpp communication network . in this embodiment , the process that the non - 3gpp gw non - 3gpp access ne sends the handover complete message to the old mme of the first 3gpp communication network is set as an example for description . in step h 3 , after receiving the handover complete message , the 3gpp communication network performs a session negotiation on the resource release process with a serving gw by sending a delete bearer request message or a delete pdp context request message including first indication information or third indication information , so as to release the resources . the first indication information is configured to indicate that a communication network of the ue changes from the 3gpp communication network to the non - 3gpp communication network , and the third indication information indicates that the resource release process is caused by an optimized handover . in step h 4 , after the serving gw completes the session negotiation on the resource release process , if the releasing of the resources of the 3gpp communication network side in a pdn gw need to be notified by the serving gw , the serving gw performs the session negotiation with the pdn gw , and indicates the pdn gw to release the resources . in step h 101 , the ue registers to the old sgsn of the first 3gpp communication network and the old mme of the first 3gpp communication network , uses the isr mechanism between the old sgsn and the old mme , and performs the service process through the serving gw and the pdn gw . in step h 102 , the ue performs a specific attachment procedure , and authorization and authentication programs of the non - 3gpp communication network through the 3gpp communication network . if necessary , the ue executes an ip security protocol ( ipsec ) tunnel establishing procedure . in step h 103 , the non - 3gpp gw sends a gateway control and qos policy rules request message to a pcrf to acquire a pcc rule used by the ue in the non - 3gpp communication network . the pcrf returns a gateway control and qos policy rules response message to the non - 3gpp gw , in which the message includes the pcc rule used by the ue in the non - 3gpp communication network . in the step , for a wlan system , the non - 3gpp gw is an epdg , for a wimax system , the non - 3gpp gw is an asn gw , for a cdma system , the non - 3gpp gw is an agw , and for an hrpd network , the non - 3gpp gw is a pdsn . in step h 104 , the ue triggers a layer 3 attachment procedure through the 3gpp communication network . in step h 105 , the non - 3gpp communication network completes the process of the layer 3 attachment process , and returns a layer 3 attach complete message to the ue through the 3gpp communication network . in step h 106 , the ue moves to the non - 3gpp communication network , and sends an access message relevant to the non - 3gpp communication network to the non - 3gpp gw through the access ne in the non - 3gpp communication network . the process of steps h 107 - h 109 is the same as steps s 105 - s 107 in the first embodiment , so it is not described here . in step h 301 , after receiving the handover complete message sent from the non - 3gpp network , the old mme of the first 3gpp communication network sends the delete bearer request message or the delete pdp context request message including the first indication information to the serving gw . the first indication information indicates that the delete bearer request message or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . the particular process is the same as the description in step f 301 of the third embodiment , so it is not described here . it should be noted that the old mme of the first 3gpp communication network may include the third indication information in the delete bearer request message or the delete pdp context request message , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by the optimized handover . the particular processing manner is described as follows . a cause ie is set to a specific cause value ( for example , “ optimized handover ”), so as to indicate that the delete bearer request message or the delete pdp context request message is caused by the optimized handover . alternatively , a specific indication bit ie or an identity bit ie ( for example , “ optimized handover ”) is set , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by the optimized handover . alternatively , a delete type ie is set to a specific value ( for example , 3 ), so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the isr mechanism of the ue is deactivated . in step h 302 , after receiving the delete bearer request message or the delete pdp context request message , according to the first indication information or the third indication information , the serving gw finds that the bearer delete is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the optimized handover , and the serving gw finds that the ue uses the isr mechanism , the serving gw deactivates the isr mechanism , and notifies the old sgsn of the second 3gpp communication network to delete the bearer and detach the user . the serving gw sends the delete pdp context request message or the delete bearer request message including the first indication information to the old sgsn of the second 3gpp communication network . for the particular manner of processing the first indication information , please refer to the description in step s 301 of the first embodiment . if the serving gw does not include the indication information in the delete bearer request message or the delete pdp context request message , and after the old sgsn finds that all bearers of the ue are requested to be released by the serving gw , the old sgsn considers that the bearer release is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . it should be noted that the serving gw may include second indication information in the message , so as to indicate that the delete pdp context request message or the delete bearer request message is caused by that the isr mechanism of the ue is deactivated . for the particular processing manner , please refer to the description in step g 302 of the fifth embodiment . alternatively , the serving gw may also include the third indication information in the message , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by the optimized handover . the particularly manner is described as follows . the cause ie is set to a specific cause value ( for example , “ optimized handover ”), so as to indicate that the process is caused by the optimized handover . alternatively , a specific indication bit ie or an identity bit ie ( for example , “ optimized handover ” or “ optimized handover flag ”) is set , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by the optimized handover . alternatively , the delete type ie is set to a specific value ( for example , 3 ), so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the optimized handover . in step h 303 , after receiving the delete bearer request or the delete pdp context request message sent from the serving gw , according to the first indication information , the second indication information , or the third indication information , the old sgsn of the second 3gpp communication network finds that the bearer delete is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , or is caused by the optimized handover , or is caused by that the isr mechanism of the ue is deactivated . the process of the old sgsn is the same as the process of the old sgsn in step g 302 of the fifth embodiment , so it is not described here . it should be noted that when the serving gw does not include the first indication information , the second indication information , or the third indication information in the delete bearer request message or the delete pdp context request message , and after the old sgsn finds that all the bearers of the ue are requested to be released by the serving gw , the old sgsn considers that the bearer release is caused by that the ue changes from the 3gpp communication network to the non - 3gpp network . in step h 304 , the serving gw releases all the resources including user plane resources and control plane resources ( including the control plane resources of the serving gw towards the old sgsn and the old mme ) of the ue , and returns a delete bearer response message or a delete pdp context response message to the old mme . in step h 4 , the process that the serving gw notifies the pdn gw to release the resources particularly includes the following steps . in step h 401 , the serving gw sends a message including the first indication information or the third indication information to the pdn gw , in which when interface protocol between the serving gw and the pdn gw uses gtp protocol , the message is the delete bearer request , when the interface protocol between the serving gw and the pdn gw uses pmip protocol , the message is a proxy bu , and the serving gw sets a lifetime in the proxy bu message to 0 . the first indication information indicates that the delete bearer request or the proxy bu is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . a particular process of the indication bit is the same as the process in step f 4 of the third embodiment , step f 4 of the fourth embodiment , and step g 4 of the fifth embodiment , so it is not described here . the serving gw may also include the third indication information in the message , so as to indicate that the delete bearer request message or the proxy bu message is caused by the optimized handover . the particular processing manner is described as follows . the cause ie is set to a specific cause value ( for example , “ optimized handover ”), so as to indicate that the process is caused by that the optimized handover . alternatively , the specific indication bit or the identity bit ie ( for example , “ optimized handover ” or “ optimized handover flag ”) is set , so as to indicate that the delete bearer request message or the proxy bu message is caused by the optimized handover . alternatively , the delete type or the an update type ie is set to a specific value ( for example , 3 ), so as to represent that the delete bearer request message or the proxy bu message is caused by the optimized handover . in step h 402 , after receiving the message , the pdn gw deletes the resources of the ue in the old 3gpp communication network ( for example , a binding cache entry resource or a bearer context of the old 3gpp communication network ), reserves the resources in the target non - 3gpp communication network , and at the same time reserves resources assigned by the pdn gw for the ue , such as an ip address . the pdn gw returns a response message ( for example , a delete bearer response or a proxy ba message ) to the serving gw . in the steps , if the old sgsn or the old mme finds that the ue registers to an msc , when the mme or the sgsn detaches the ue , and the detaching of the ue is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , the old sgsn or the old mme sends an imsi detach indication message to the msc , so as to indicate the msc to detach the ue . fig8 is a flow chart of a seventh embodiment of the method of network resource release processing according to the present invention . referring to fig8 , in this embodiment , a mobility management ne of a first 3gpp communication network is an old mme , and a mobility management ne of a second 3gpp communication network is an old sgsn . after a ue using an isr mechanism changes from the 3gpp network mobile to a non - 3gpp network , the us initiates an attachment procedure through the 3gpp network . then , a resource release process is performed . the method includes the following steps . in step h 1 , the ue performs a service process in the 3gpp communication network , and initiates an attach session negotiation procedure through the 3gpp communication network . the particular processing procedure is the same as step h 1 in the sixth embodiment , so it is not described here . in step h 2 , after the attach negotiate is completed , a non - 3gpp gw or a non - 3gpp access ne of the non - 3gpp communication network sends a handover complete message to the old mme of the first 3gpp communication network or the old sgsn of the second 3gpp communication network of the 3gpp communication networks . the process that the non - 3gpp gw or the non - 3gpp access ne sends the handover complete message to the old mme of the first 3gpp communication network is the same as the process that the non - 3gpp gw or the non - 3gpp access ne sends the handover complete message to the old sgsn of the second 3gpp communication network . in this embodiment , the process that the non - 3gpp gw non - 3gpp access ne sends the handover complete message to the old mme of the first 3gpp communication network is set as an example for description . in step h 3 , after receiving the handover complete message , the old mme of the first 3gpp communication network performs a session negotiation on the resource release process with a serving gw by sending a delete bearer request message or a delete pdp context request message including first indication information or third indication information , so as to release the resources . the first indication information is configured to indicate that a communication network of the ue changes from the 3gpp communication network to the non - 3gpp communication network , and the third indication information indicates that the resource release process is caused by an optimized handover . in step h 4 , after the serving gw completes the session negotiation on the resource release process , if the releasing of the resources of the 3gpp communication network side in a pdn gw need to be notified by the serving gw , the serving gw performs the session negotiation with the pdn gw , so as to indicate the pdn gw to release the resources . the process is the same as the process in step h 4 of the sixth embodiment , so it is not described here . in step h 301 , after receiving the handover complete message , the old mme of the first 3gpp communication network sends the delete bearer request message or the delete pdp context request message to the serving gw . the old mme includes the first indication information in the message , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . the particular process is the same as the description in step f 301 of the third embodiment , so it is not described here . it should be noted that the old mme may include the third indication information in the message , so as to indicate that the delete bearer request message or the delete pdp context request message is caused by the optimized handover . for the particular process , please refer to the description in step h 301 of the sixth embodiment , so it is not described here . after receiving the delete bearer request message or the delete pdp context request message , according to the first indication information or the third indication information , the serving gw finds that the bearer delete is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network or the optimized handover , and the serving gw finds that the ue uses the isr mechanism , the serving gw then processes in the following manners . the serving gw releases all the resources including user plane resources and control plane resources ( including the bearer context , and the control plane resources of the serving gw towards the old mme of the first 3gpp communication network and the old sgsn of the second 3gpp communication network ) of the ue in the serving gw , and the old sgsn needs not to notify the bearer resource release . alternatively , the serving gw deactivates the isr mechanism of the ue , and deletes the resources ( for example , the control plane resource of the serving gw towards the old mme ) in the serving gw relevant to the old mme , but the serving gw does not delete the bearer context used by the ue , and does not delete the control plane resource of the serving gw towards the old sgsn . the serving gw releases all the resources ( for example , the bearer context and the control plane resource of the serving gw towards the old sgsn ) of the ue in the serving gw after receiving the delete bearer request message or the delete pdp context request message sent from the old sgsn . alternatively , in step h 302 , after receiving the handover complete message sent from the ne in the non - 3gpp communication network in step h 2 , when the old mme of the first 3gpp communication network finds that the ue uses the isr mechanism , the old mme decides to deactivate the isr mechanism of the ue , notifies the old sgsn of the second 3gpp communication network to detach the user , and sends a detach request message to the old sgsn of the second 3gpp communication network . the old mme may include the first indication information in the detach request message , so as to indicate that the detach request message is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network . for the particular process , please refer to the description in step s 302 of the second embodiment , so it is not described here . it should be noted that the old mme may include second indication information in the detach request message , so as to indicate that the detach request message is caused by that the isr mechanism of the ue is deactivated . for the particular process , please refer to the description of step s 302 in the second embodiment , so it is not described here . the old mme may also include the third indication information in the message , so as to indicate that the detach request message is caused by the optimized handover . the particular process may be described as follows . a cause ie is set to a specific cause value ( for example , “ optimized handover ”), so as to indicate that the detach request message is caused by the optimized handover . alternatively , a specific indication bit ie or an identity bit ie ( for example , “ optimized handover ” or “ optimized handover flag ”) is set , so as to indicate that the detach request message is caused by the optimized handover . alternatively , a delete type ie is set to a specific value ( for example , 3 ), so as to indicate that the detach request message is caused by the optimized handover . it should be noted that the old mme may send other messages to notify the old sgsn to detach the user and release the resources , for example , the old mme sends a delete resource request or a detach indication message to the old sgsn to notify the old sgsn to detach the user and release the resources . in step h 303 , after receiving the detach message , the old mme locally detaches the user and deletes a bearer context resource , and sets a state of the ue to an “ emm - deregistered ” state . if the old mme finds that the ue uses the isr mechanism , the old mme may perform the following processes . when the detach request message does not include the first indication information , the second indication information , or the third indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , or is caused by that the isr is deactivated , or is caused by the optimized handover , the old mme sends the delete pdp context request ( or the delete bearer request ) message to the serving gw . alternatively , when the detach request message includes the first indication information , the second indication information , or the third indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , or is caused by the optimized handover , or is caused by that the isr is deactivated , and the serving gw releases all the resources without being notified by the old mme of the resource release , the old mme does not send the delete pdp context request ( or the delete bearer request ) message to the serving gw . alternatively , when the detach request message includes the first indication information , the second indication information , or the third indication information indicating that the detach request is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , is caused by the optimized handover , or is caused by that the isr is deactivated , and the serving gw releases all the resources after being notified by the old mme of the resource release , the old mme sends the delete pdp context request ( or the delete bearer request ) message to the serving gw . in step h 304 , the old mme returns a detach response message to the old sgsn . in the steps , if the old sgsn or the old mme finds that the ue registers to an msc , when the mme or the sgsn detaches the ue , and the detaching of the ue is caused by that the ue changes from the 3gpp communication network to the non - 3gpp communication network , the old sgsn or the old mme sends an imsi detach indication message to the msc , so as to indicate the msc to detach the ue . based on the session negotiation on the resource release process between the serving gw and the 3gpp communication network triggered by the non - 3gpp network , the resources are released when the user using the isr mechanism in the 3gpp communication network is handed over to the non - 3gpp communication network , the existing relevant nes need to be modified , and functions need to be expanded . referring to fig9 , a serving gw according to the present invention is shown , which includes a first message receiving unit 1 and a processing unit 2 . the first message receiving unit 1 is configured to receive a message including indication information sent from a peer endpoint ne ( including a pdn gw , an old mme , or an old sgsn ). the processing unit 2 is configured to delete network resources established by 3gpp communication networks for a ue according to the message received by the first message receiving unit 1 . the processing unit 2 includes an indication bit analyzing unit 21 , a resource deleting unit 22 , and a session negotiation unit 23 . the indication bit analyzing unit 21 is configured to judge whether to delete the network resources established by the 3gpp access networks for the ue according to the indication information in the message received by the first message receiving unit 1 . the resource deleting unit 22 is configured to delete the network resources established by the 3gpp communication networks for the ue on the serving gw , when an analysis result of the indication bit analyzing unit 21 is yes . the session negotiation unit 23 is configured to notify mobility management nes of the 3gpp communication networks to release the network resources established for the ue when the analysis result of the indication bit analyzing unit 21 is yes . the session negotiation unit 23 includes a sending unit 231 and a receiving unit 232 . the sending unit 231 is configured to send a delete bearer request message or a delete pdp context request message to the mobility management nes of the 3gpp communication networks , so as to notify the mobility management nes to release the resources . the receiving unit 232 is configured to receive a delete bearer response message or a delete pdp context response message returned from the mobility management nes . in this embodiment , the indication information includes first indication information , second indication information , or third indication information . the first indication information is configured to indicate that a communication network of the ue changes from the 3gpp communication network change to a non - 3gpp communication network . the second indication information is configured to indicate that an isr of the ue is deactivated . the third indication information is configured to indicate an optimized handover . the message sent from the peer endpoint ne includes a delete bearer request message or a binding revocation indication message sent from a pdn gw ; or the delete bearer request message or the delete pdp context request message sent from the mobility management nes of the 3gpp communication networks . referring to fig1 , a mobility management ne according to the present invention is shown , which includes a second message receiving unit 31 , a resource releasing unit 32 , and a message sending unit 33 . the second message receiving unit 31 is configured to receive a cancel location message sent from an hss or a handover complete message sent from a non - 3gpp communication network , in which the cancel location message may include first indication information , so as to indicate that a communication network of a ue changes from a 3gpp communication network to the non - 3gpp communication network . the resource releasing unit 32 is configured to release resources established by the 3gpp communication networks for the ue after the second message receiving unit 31 receives the cancel location message or the handover complete message . the message sending unit 33 is configured to send a message including indication information to a serving gw , and notify the serving gw to release the resources . in another embodiment of the present invention , the mobility management ne further includes a resource release notification unit 34 . the resource release notification unit 34 is configured to notify a mobility management ne of the other 3gpp communication network to release the network resources established for the ue . a detach request message may include first indication information , second indication information , or third indication information . the first indication information is configured to indicate that the communication network of the ue changes from the 3gpp communication network to the non - 3gpp communication network , the second indication information is configured to indicate that an isr of the ue is deactivated , and the third indication information is configured to indicate an optimized handover . in this embodiment , the indication information includes the first indication information , the second indication information , or the third indication information . the first indication information is configured to indicate that the communication network of the ue changes from the 3gpp communication network change to the non - 3gpp communication network . the second indication information is configured to indicate that the isr of the ue is deactivated . the third indication information is configured to indicate the optimized handover . in this embodiment , the message including the indication information is a delete bearer request message or a delete pdp context request message . it should be noted that the mobility management ne according to the embodiments of the present invention is the mme or the sgsn . through the method of resource release processing and the relevant devices according to the embodiments of the present invention , the request message includes the indication information indicating that the ue using the isr mechanism changes or is handed over from the 3gpp communication network to the non - 3gpp communication network , so as to indicate the corresponding nes to perform the processes , such that the problem of the prior art that the user using the isr mechanism cannot perform processes after moving from the 3gpp communication network to the non - 3gpp communication network is solved , and the old network resources are released when the ue using the isr mechanism changes from the 3gpp communication network to the non - 3gpp communication network , thereby improving a system processing capability and ensuring a quality of service ( qos ) of the user . the above descriptions are merely preferred embodiments of the present invention . it should be noted by persons of ordinary skill in the art that modifications and improvements may be made without departing from the principle of the present invention , which should be construed as falling within the scope of the present invention . | 8 |
referring now to the drawings , fig1 to 7 illustrate a header assembly 10 according to the present invention comprising at least one pair of terminal blocks 12 and 14 partially surrounded by a molded polymeric header 16 connected to an implantable medical device 18 . the terminal blocks 12 , 14 provide for connecting a co - axial conductor 20 from the medical device to a body tissue . the implantable medical device 18 is exemplary of any one of a number of known assist devices such as cardiac defibrillators , cardiac pacemakers , drug pumps , neurostimulators , hearing assist devices , and the like . the implantable medical device 18 is contained in a housing 22 of a material such as of stainless steel , and is shown in an exemplary form comprising first and second main clam shell portions 24 and 26 . the clam shells 24 and 26 are mated together and hermetically sealed about their periphery to provide an enclosure for the medical device including its control circuitry 28 and a power supply 30 such as a battery ( fig3 ). the battery 30 is connected to the control circuitry 28 by electrical leads 32 and 34 . there may also be a capacitor for a medical device such as a defibrillator . in particular , the first clam shell 24 comprises spaced apart side walls 36 and 38 extending to and meeting with end wall 40 . the side walls 36 , 38 and the end wall 40 meet each other at rounded corners and extend to a front wall 42 . opposite the front wall 42 is a peripheral edge 44 of side walls 36 , 38 and end wall 40 while opposite the end wall 40 is an opening 46 . the second clam shell 26 comprises spaced apart side walls 48 and 50 ( fig3 ) extending to and meeting with end wall 52 . the side walls 48 and 50 and end wall 52 meet at rounded corners and extend to front wall 54 . opposite the front wall is a peripheral edge 56 of the side walls 48 and 50 and end wall 52 while opposite the end wall 52 is an opening 58 . the first clam shell 24 is sized to fit inside the periphery of the second clam shell 26 in a closely spaced , lap joint relationship . this assembly forms a container having an opening 60 leading therein where the coinciding openings 46 and 58 of the respective clam shells 24 and 26 reside . the container opening 60 has a generally rectangular shape . the benefit of having a lap joint construction for the mating clam shells 24 and 26 is that when they are hermetically sealed together , such as by laser welding , the laser beam is prevented from compromising the control circuitry 28 and power supply 30 of the medical device . with a coplanar or butted seam construction ( not shown ), it is possible for the laser beam to penetrate past the junction of the peripheral edges 44 , 56 of the clam shells 24 , 26 to compromise the internal device components or power supply housed therein . if a butt welded construction is used , a backing ring ( not shown ) is desired . an example of a backing ring for a butt weld construction is shown in fig1 of u . s . pat . no . 6 , 334 , 879 to muffoletto et al ., which is assigned to the assignee of the present invention and incorporated herein by reference . a lid 62 is hermetically sealed to the opening 60 of the mated clam shells 24 , 26 . the lid 62 consists of spaced apart upper and lower surfaces 64 and 66 extending to and meeting with a surrounding edge 68 ( fig3 ). the surrounding edge 68 includes an inverted step or rim 70 to assist in the sealing connection between the lid 62 and the mated clam shells 24 , 26 . preferably , the lid 62 is sealed in place , such as by laser welding ( not shown ), to create the hermetic housing 22 for the implantable medical device 18 . while the medical device is shown being contained inside a housing of mating clam shells 24 , 26 , the present invention is not intended to be so limited . other types of housings such as prismatic , deep drawn , cylindrical are also contemplated . as shown in fig1 and 3 , the upper surface 64 of the lid 62 includes a plurality of protruding anchors 72 which assist in joining the header 10 to the lid . internal protrusions 74 depend from the lower lid surface 66 and assist in positioning the lid on the mated clam shells . the lid 62 further comprises at least two openings 76 and 78 through which respective feedthrough wires 80 and 82 pass . the feedthrough wires extend from a distal end positioned inside the housing 22 connected to the control circuitry 28 for the medical device 18 to respective proximal ends disposed generally parallel to and spaced above the upper surface 64 of the lid 62 . the feedthrough wires 80 , 82 are electrically insulated from the lid 62 by respective ceramic - to - metal seals or glass - to - metal seals 84 and 86 . the proximal end of feedthrough wire 80 is connected to the first terminal block 12 supported thereon while the other feedthrough wire 82 is connected to a second terminal block 14 depending therefore . the terminal blocks 12 , 14 are ring - shaped members of different diameters , sized to be in electrical contact with matching portions of the lead 88 for a co - axial conductor 90 , as will be described in detail hereinafter . as shown in fig3 , the terminal blocks 12 and 14 are aligned in a co - axial relationship and encased in the molded header 16 having a bore 92 providing communication to both of them . the molded header 16 comprises spaced apart front and back walls 94 and 96 extending to a curved upper wall 98 and a generally planar bottom wall 100 . the bottom wall 100 is supported on the upper lid surface 64 and retained in place by encasing the lid anchors 72 . the bore 92 is sized to receive the co - axial conductor lead 88 . those skilled in the art will readily understand that the exact shape of the molded header is exemplary . in fact , the molded header can have a myriad of different shapes only limited by the design specifications of the associated medical device and its intended use . in that respect , the header assembly bore 92 has a first portion 102 of a first diameter sized to receive a distal portion 104 of the conductor lead 88 , a second , intermediate portion 106 of a second , greater diameter sized to receive a proximal portion 108 of the lead 88 and a third portion 110 of a still greater diameter than the intermediate portion . the terminal blocks 12 , 14 have lead openings of diameters somewhat larger than the first and second bore portions 102 , 106 so that the conductor lead 88 is received therein in a tight fitting , electrically stable connection . the front wall 94 of the molded header 16 is provided with a pair of passageways 112 and 114 aligned perpendicularly with the longitudinal axis of the bore 92 . passageway 112 extends to a threaded aperture 116 in the side wall of terminal block 12 to provide for communication with the first bore portion 102 . the passageway and aperture threadingly receive a set screw 118 that contacts the distal portion 104 of the conductor lead 88 to prevent loss of electrical contact between the lead and the terminal block 12 . similarly , passageway 114 extends to a threaded aperture 120 in the side wall of terminal block 14 to provide for communication with the second bore portion 106 . a set screw 122 is received therein to contact the proximal portion 108 of the conductor lead 88 , thereby maintaining electrical continuity between the lead and the terminal block 14 . an annular channel surrounds the third bore portion 110 for capturing an o - ring 124 therein . this helps to prevent body fluids and the like from contacting the conductor portions 104 and 108 received in the respective terminal blocks 12 and 14 . a raised seal 126 further helps prevent body fluids from contacting the co - axial conductor lead 88 . finally , the header assembly 10 is provided with a suture bore 128 adjacent to the conductor lead bore 92 . the suture bore 128 aids a physician in securing the medical device inside a body . as known in the art , the end ( not shown ) of the co - axial conductor 90 opposite that of the lead 88 is positioned in a body tissue , such as a heart muscle , for transmitting physiological information to the medical device and for administering a medical theory as needed . an example of this is in a cardiac defibrillator where the medical device may monitor the heart rate for extended periods of time . then , when a potentially fatal irregular , rapid heartbeat known as tachyarrhythmia is detected , the defibrillator delivers an electrical shock to the heart through the lead 88 and conductor 90 . fig8 and 9 show a further embodiment of a header assembly 150 according to the present invention . the header assembly 150 comprises a polymeric material supporting a first pair of terminal blocks 152 and 154 and a second pair of terminal blocks 156 and 158 . the terminal block pairs have lead openings aligned co - axially along respective conductor bores sized to receive the conductor leads 160 and 162 of co - axial conductors 164 and 166 . the lid 168 is provided with a ceramic - to - metal seal 170 that electrically insulates feedthrough wires 172 , 174 , 176 and 178 from the lid 168 . the feedthrough wires are in electrical contact with respective terminal blocks 152 , 154 156 and 158 . in this respect , the header assembly 150 is similar to the header assembly 10 of fig1 to 8 except there are two pairs of terminal blocks instead of one . those skilled in the art will understand that a header assembly according to the present invention can have terminal blocks in addition to the one or two pairs shown . there can be three , four or more pairs . additionally , it may be desired to have a header assembly where a bore only communicates with one terminal block which is not in a co - axial relationship with a second terminal block . however , the header assembly 150 differs from the header assembly 10 in that it is not secured to the housing lid 168 by anchors . instead , header assembly 150 is mounted to the lid 168 by an adhesive material 180 , and the like . as shown in fig9 , this necessitates that the header assembly 150 include passageways 182 and 184 extending from the lower surface 186 thereof to communicate with the terminal blocks . for the sake of clarity , this drawing only shows one set of passageways for one of the feedthrough wire pairs 172 , 174 . however , those skilled in the art will understand that there are as many passageways as there are terminal blocks and associated feedthrough wires . in that respect the feedthrough wires 172 , 174 are received in the passageways 182 , 184 to contact respective terminal blocks 152 , 154 when the header assembly 150 is supported on the lid 168 . a laser beam as a joining device is then directed through the side passageways 187 , 188 to weld the feedthrough wires in place , electrically contacted to the terminal blocks . other joining means are contemplated such as soldering , brazing , epoxy , and the like . a co - axial conductor 164 is then inserted into the header assembly 150 in electrical contact with the terminal blocks , as previously discussed with respect to header assembly 10 shown in fig1 to 7 . the lead of the co - axial conductor 164 is retained in place in the terminal blocks by respective set screws 190 extending through passageways 186 , 188 and apertures in the side walls of the terminal blocks to contact the conduction leads . another distinction between the header assemblies 10 and 150 is the method of closing the housing for the medical device in the latter embodiment . in the case of header assembly 150 , the feedthrough wires are connected to the terminal blocks before being connected to the medical device circuitry . this necessitates that the hermetic housing be constructed by first mounting the lid 168 on one of the clam shells 24 , 26 . the header assembly 150 is then secured to the lid 168 such as by adhesive , and the like . next , the feedthrough wires are connected to the internal components of the medical device . finally , the other clam shell is mated to the first clam shell and sealed thereto to complete the hermetic housing . a suture bore 192 is also provided . fig1 shows another embodiment of a header assembly 200 according to the present invention . this header assembly is similar to the header assembly 150 of fig8 and 9 in that it is not molded to anchors provided on the lid . rather , header assembly 200 is molded as a separate piece and later connected to a lid 202 having first and second upstanding lugs 204 and 206 . the lugs 204 , 206 are provided with through apertures 208 and 210 generally aligned parallel to the upper surface of the lid 202 . the header is provided with a pair of spaced apart inlets 212 and 214 sized and positioned to receive the lugs 204 , 206 . the header assembly 200 is further provided with through bores 216 and 218 which align with the apertures 208 , 210 when the header assembly is positioned on the lid 202 . as the header assembly 200 is positioned on the lid 202 , feedthrough wires 220 and 222 previously connected to the terminal blocks ( not shown ) by welding through setscrew passageways ( not shown ) are received in respective openings 224 , 226 in the lid . as in the other header assembly embodiments , the wires 220 , 222 are insulated from the lid by ceramic - to - metal seals 228 , 230 , and the like . pins 232 and 234 are then inserted into the respective through bores 216 , 218 and apertures 208 , 210 to complete the connection . preferably , the exposed ends of the pins are sealed by a polymeric plug , such as a silicon septum plug , and the like , to prevent them from working loose and to provide a smooth outer surface for the header assembly . fig1 and 12 show a book mold 250 for molding any one of the header assemblies 10 , 150 and 200 according to the present invention . the book mold 250 comprises first and second mold portions 252 and 254 connected together by a hinge 256 . the benefit of a book mold is that either or both of the first and second mold portions 252 , 254 can be changed to provide a header assembly having a desired shape without necessarily having to change the entire mold . the second mold portion 254 includes posts 258 and 260 on which respective terminal blocks 262 and 264 are supported . when the molding process is complete , the posts 258 and 260 coincide with the passageways through which the welds between the feedthrough wires and the terminal blocks are made for header assemblies 150 and 200 , and the apertures which receive set screws for securing the electrical connection between the lead of a co - axial conductor and the terminal blocks for all of the present invention header assemblies . a pin 266 having the shape of the lead of a co - axial conductor is positioned in the second mold portion 254 received in the respective terminal blocks 262 and 264 . inserts 268 and 270 are supported on the second mold portion 254 abutting the shaped pin 266 from the back of the mold portion , i . e ., that portion of the mold lying in the plane of the paper for fig1 and extending toward the reader . these inserts 268 , 270 coincide with passageways 182 , 184 for the header assembly 150 . the second mold portion 254 is then secured to the first mold portion 252 to provide a cavity having the shape of the to be manufactured header assembly . in that respect , the header assembly is formed laying on its side such that surface 272 of the second mold portion 254 forms the front wall 94 of header assembly 10 while surface 274 of the first mold portion 252 forms the back wall 96 thereof . mold structure 276 forms the suture openings of the various header assemblies . the closed book mold 250 is provided with a channel 278 which mates with the barrel of a molding machine ( not shown ) to inject a charge of polymeric material therein to form the header assembly . various polymeric materials are contemplated by the scope of the present invention including high durometer polyurethane or polysulfane resins . fig1 and 14 show another embodiment of a terminal sleeve 300 for connecting a feedthrough wire to the lead of a conductor according to the present invention . terminal sleeve 300 is a generally cylindrical member having a lead opening 302 disposed along its longitudinal axis and aligned along a bore 304 for the lead . a threaded aperture 306 receives a set screw ( not shown ) and the like , for securing the lead inside sleeve 300 . the sleeve is supported in a body 308 of polymeric material having a passageway 310 aligned with the aperture 306 . the passageway 310 serves to admit a joining device , such as a laser , for welding the feedthrough wire to the sleeve 300 and for positioning the set screw in the threaded aperture 306 . fig1 and 16 show another embodiment of a terminal 320 comprising a cylinder 322 supporting an internal coil spring 324 . the cylinder 322 and spring 324 have coincident openings aligned along a bore 326 for receiving the lead 328 of a conductor . the opposed ends 330 and 332 of the cylinder are curled inwardly to retain the coil spring in place . when the lead 328 is moved along the bore 326 and into the terminal 320 , the spring expands in a radial manner to capture the lead therein in a tight - fitting relationship . this terminal eliminates the need for a set screw , and the like , although one can be used if desired . a feedthrough wire 334 is connected to the terminal supported in a body of polymeric material 336 . fig1 to 19 illustrate another embodiment of a terminal 340 comprising a cylinder 342 supporting at least one leaf spring 344 . the cylinder 342 has an opening 346 aligned along a bore 348 for receiving the lead 350 of a conductor . the opposed ends 352 and 354 of the cylinder are crimped to retain the leaf spring in place , disposed parallel to the longitudinal axis of the bore 348 . when the lead is moved along the bore 348 and into the terminal 340 , the leaf spring 344 deflects to exert a biasing force on the lead captured therein . the ends of the leaf spring are captured in the cylinder such that the spring does not misalign as the lead moves into and out of the cylinder 342 and bore 348 . this terminal eliminates the need for a set screw , although one can be used if desired . a feedthrough wire 356 is connected to the terminal supported in a body of polymeric material 358 . now , it is therefore apparent that the present invention accomplishes its intended objects . while embodiments of the present invention have been described in detail , that is for the purpose of illustration , not limitation . | 0 |
the present invention has utility as a hypergolic fuel compound . the present invention is based on a finding that in the 2 - azido - n , n - dimethylethanamine lowest energy configuration the azide group sterically shields the lone pair electrons associated with the amine nitrogen . ( m . j . mcquaid , k . l mcnesby , b . m . rice , and c . chabawoloski , “ density functional theory characterization of the structure and gas - phase , mid - infrared absorption spectrum of 2 - azido - n , n - dimethylethanamine ( dmaz ).” journal of molecular structure ( theochem ), vol . 587 , pp . 199 – 218 , 2002 ). the present invention thus provides compounds that are tailored to either enhance or limit intramolecular interaction between an azide group and an amine nitrogen lone pair of electrons . the present invention relates to a class of cyclic compounds with amine and azide functional groups of the formula : where a is chr 1 , o , chr 1 chr 1 , chn ( r 2 ) 2 ch 2 , chr 1 chr 1 chr 1 , nr 2 ch 2 chr 1 , chr 1 ch 2 nr 2 , ch 2 nr 2 ch 2 , nr 2 , nr 2 ch 2 , ch 2 nr 2 , ch 2 o , och 2 , och 2 ch 2 , or ch 2 och 2 ; r 1 in each occurrence is independently h or n ( r 2 ) 2 ; r 2 in each occurrence is independently h , ch 3 , or ch 2 ch 3 ; r 3 is h , n ( r 2 ) 2 , where z is ch or n ; and a dashed bond denotes single bonds that when r 3 is n ( r 2 ) 2 , gives the compound a cis or trans orientation . as used herein , inventive compounds are defined to include a molecule including at least one azide group , at least one amine group , regardless of whether the amine is primary , secondary or tertiary , and also including a cyclic group including epoxy , cyclopropyl , cyclobutyl , cyclopentyl , azetidyl , aziridyl , and substituted forms thereof where hydrogen atoms are substituted by methyl or ethyl groups . it is appreciated that other three to five member cyclic structures having a core composed of carbon , nitrogen and oxygen atoms or carbon and oxygen atoms are also operative herein . preferably , the electron density associated with a cyclic group of an inventive compound increases the reactivity of an amine group lone pair of electrons . as a result , in formulating a hypergolic fuel propellant , ignition characteristics are optionally tailored by adjusting the ratio of cis to trans forms of a given inventive compound as well as mixing inventive compounds having different cyclic groups . for example , inventive azidocycloalkanamines can be tailored to be stoichiometrically similar to the prior art 2 - azido - n , n - dimethylethanamine ( dmaz ) structure . a propellant of the present invention includes a compound of formula ( i ) and an oxidant . oxidants illustratively include liquid oxygen , hydrogen peroxide , nitric acid , nitrogen dioxide , and inhibited red fuming nitric acid . optionally , a catalyst is present in either the inventive compound or oxidant prior to mixing . it is appreciated that the presence of an igniter facilitates exothermic molecular decomposition of an inventive compound independent of the presence of an oxidizer . inventive compounds are synthesized through a variety of conventional synthetic routes . the preparation of azide compounds is well known in the art . ( e . f . schriven et al . “ azides : their preparation and synthetic uses .” chemical reviews , vol . 88 , pp . 297 – 368 , 1988 ). a preferred synthesis of inventive compounds involves reacting a suitable amino alcohol with triphenylphosphorous , diethyl azodicarboxylate and hydrazoic acid . ( a . benalil et al . “ synthesis of 1 , 2 - aminoazides . conversion to unsymmetrical vicinal diamines by catalytic hydrogenation or reductive alkylation with dichloroboranes .” tetrahedron , vol . 47 , p . 8177 , 1991 ). this reaction is appreciated to be a modification of the mitsunobu reaction . ( h . loibner et al . “ reactions with organophosphorous compounds . 41 . new preparative methods using triphenylphosphine - diethyl azodicarboxylate - hydroxy - compound .” helvetica chemica acta , vol . 59 , pp . 2100 – 2113 , 1976 ). treatment of a suitable amino alcohol with ( pho ) 2 p ( o ) n 3 and triethylamine can be employed for precursors with acid sensitive rings . ( stevenson , w . h ., proceedings of the 30 th jannaf propellant development and characterization subcommittee meeting , cpia publication 708 , vol . ii , pp 95 – 102 , 2002 .) the synthesis of trans - 2 - hydroxy - n , n - dimethylcyclopropanamine is known to the art . ( p . d . armstrong et al . “ small ring analogs of acetylcholine . synthesis and configurations of cyclopropane derivatives .” journal of medicinal chemistry , vol . 13 , pp . 1037 – 1039 , 1970 ). this represents a suitable reagent for the creation of 2 - azido - n , n - dimethylcyclopropananamine . it is appreciated that other reaction schemes are operative to form an azide group including reaction of an organo halide with sodium azide . optionally , an existing amine group is protected with a protecting group such as diterbutyldicarbonate ( boc ). additionally , the synthesis of chiral aziridines is known . ( a ) z . li et al . j . am . chem . soc ., vol . 115 , p . 5326 , 1993 ; b ) d . a . evans et al ., j . am . chem . soc ., vol . 115 , p . 5326 , 1993 ; c ) p . dauban et al . j . org . chem ., vol . 60 , p . 2035 , 1995 ; d ) n . j . church et al . tetrahedron lett ., vol . 36 , p . 151 , 1995 ; e ) m . e . solomon et al ., tetrahedron lett ., vol . 36 , p . 4955 , 1995 ; f ) t . ibuka et al ., j . org . chem ., vol . 60 , p . 2044 , 1995 ; g ) s . patai . the chemistry of the azide group , interscience publishers , new york , 1971 ). in order to assess the properties of the present invention , a series of theoretical computations were conducted . theoretical structural and thermodynamic properties of inventive compounds attest to the utility of the present invention in designing a propellant . in formulating a rocket propellant from an inventive compound , compound isomer , compound racemic mixture , or mixture of multiple inventive compounds , it is appreciated that a propellant gel often has desirable handling properties . to form a propellant gel according to the present invention , 0 . 5 % to 10 % gellant is optionally added . gellants illustratively include silicon dioxide , clay , carbon , or any polymeric gellant that is nonreactive with an inventive compound . optionally , a propellant gel according to the present invention includes one or more additives to improve the specific impulse and density impulse of the propellant . such additives illustratively include amine - nitrate salts , quaternary ammonium salts such as tetramethyl ammonium azide , and nitro - substituted aromatics such as triamino trinitrobenzene , aluminum , silicon , boron , and tungsten . typically , a gelled propellant fuel includes such additives in from 1 to 90 total weight percent . in order to more fully demonstrate the advantages arising from the present invention , the following examples are set forth . it is to be understood that the following is by way of example only and not intended as a limitation on the scope of the invention . the gaussian 98 ( g98 ) suite of quantum chemistry codes ( m . j . frisch et al ., gaussian 98 , revision a . 4 ., gaussian , inc ., pittsburgh , pa . 1998 .) is employed to identify equilibrium 2 - azido - n , n - dimethylcyclopropanamine ( admcpa ) structures and characterize their normal modes . density functional theory utilizing the b3lyp exchange - correlation functionals ( a . d . becke “ density - functional thermochemistry . 3 . the role of exact exchange .” journal of chemical physics , vol . 98 , pp . 5684 – 5652 , 1993 ; c . lee et al . “ development of the colle - salvetti correlation - energy formula into a functional of the electron - density .” physical review b , vol . 37 , pp . 785 – 789 , 1988 ; b . miehlich et al . “ results obtained with the correlation - energy density functionals of becke and lee , yang and parr .” chemical physics letters , vol . 157 , pp . 200 – 206 , 1989 ) and 6 - 311 ++ g ( d , p ) atomic orbital basis set ( t . clark et al ., “ efficient diffuse function - augmented basis - sets for anion calculations . 3 . the 3 - 21 + g basis set for 1 st - row elements , li — f .” journal of computational chemistry , vol . 4 , pp . 294 – 301 , 1983 ; a . d . mclean et al . “ contracted gaussian - basis sets for molecular calculations . 1 . 2 nd row atoms , z = 11 – 18 .” journal of chemical physics , vol . 72 , pp . 5639 – 5648 , 1980 ; r . krishnan et al . “ self - consistent molecular - orbital methods . 20 . basis sets for correlated wave - functions .” journal of chemical physics , vol . 72 , pp . 650 – 654 , 1980 ) on a g98 - defined “ ultrafine ” grid is employed for this purpose based on the success achieved with it in characterizing dmaz ( m . j . mcquaid , k . l mcnesby , b . m . rice , and c . chabawoloski , “ density functional theory characterization of the structure and gas - phase , mid - infrared absorption spectrum of 2 - azido - n , n - dimethylethanamine ( dmaz ).” journal of molecular structure ( theochem ), vol . 587 , pp . 199 – 218 , 2002 ). in addition to the structural characterizations , gas - phase heats of formation at 298 k [ ah / 298 )] are estimated and used to predict ballistic performance . the results presented in table 1 are derived from the heats of reaction [ δh r ( 0 )] calculated for “ isodesmic ” reactions at 0 k in which the total number of each type of bond are equal in reactants and products . in an attempt to identify if the method generated systematic errors , a variety of reactions involving the formation of molecules of interest and xh 2 ( x = 1 or 2 ) from reactants with accepted δh f ( 298 ) values are constructed and the δh f ( 298 ) predictions compared . the zero - point corrected energies and enthalpy differences at 298 k and 0 k [ h ( 298 )— h ( 0 )] for the reactants and reference elements needed to derive δh f ( 298 ) from δh r ( 0 ) are completed at the same level of theory as that employed to characterize the amine azides of interest . fig1 and 2 show , respectively , the equilibrium trans - admcpa and cis - admcpa structures identified through the computations . the labeling scheme is chosen such that alphabetically adjacent conformers are nominally transformed into one another by a dihedral angle rotation about one bond . conformers t - a and t - b are more than 4 kcal / mol lower in energy than the other conformers . the six trans conformers identified are all of the structures that can be constructed from combinations of observed geometric preferences . based on a boltzmann distribution calculated from trans conformer zero - point corrected energies , t - a ( 58 %) and t - b ( 41 %) populations will dominate a trans - admcpa sample at room temperature . the six cis conformers identified are all of the structures that can be constructed from combinations of observed geometric preferences , and c - a and c - b are more than 4 kcal / mol lower in energy than the other four conformers . there is also a 1 . 0 kcal / mol difference between conformers c - a and c - b . based on a boltzmann distribution calculated from cis conformer zero - point corrected energies , c - a ( 82 %) and c - b ( 18 %) populations will dominate a cis - admcpa sample at room temperature . with 19 atoms and cs symmetry , all admcpa conformers have 51 normal modes . the predicted ir spectra based on modeling vibrational band contours ( due to rotational line structure ) with a lorentzian lineshape , i ( v ) = ∑ j a j γ / π ( v j - v ) 2 + γ 2 where a j is the integrated absorption for a transition to the j th normal mode and γ ( equal 10 cm − 1 ) is the lineshape width at half - maximum , is shown in fig3 for representative conformers c - a , c - b , t - a and t - b . the methods of example 1 are repeated with the substitution of 2 - azido - n - methylcyclobutanamine ( amcba ) for admcpa . equilibrium amcba structures are shown in fig4 . conformers shown in fig4 were obtained via geometry optimizations from starting structures expected to be energetically favored based on the admcpa optimal structures . the cis isomers of amcba include a configuration with interacting amine and azide groups that is 1 . 0 kcal / mol lower in energy than otherwise similar conformers . thus , a population dominated by a shielded configuration for the amine group is expected for the cis forms . trans amcba allows closer proximity between the azido and amine groups ( 0 . 371 nanometers from the amine nitrogen to the middle nitrogen of the azide group ) than in trans admcpa ( 0 . 429 nanometers for t - b ). the methods of example 1 are repeated substituting the structure of 2 - azidocyclopentanamine ( acpa ) for admcpa . an equilibrium acpa structure is shown in fig5 . trans acpa allows closer proximity between the azido and amine groups ( 0 . 316 nanometers ) as compared to trans admcpa ( 0 . 429 nanometers for t - b ). the method of example 1 was repeated with the substitution of the structure for 3 - azido - 2 - dimethyl - aminoaziradine ( admaa ) for that of admcpa . an equilibrium conformer for trans - 3 - admaa is shown in fig6 . in addition to the gas - phase properties detailed herein , condensed - phase densities and heats of vaporization for the representative inventive admcpa isomers are shown in comparison to prior art compounds in table 1 . coupled with the predicted gas - phase heats of formation , such property predictions are employed to predict fuel performance in a propulsion system . the molecular mechanics method employed to predict densities and heats of vaporization is known . table 1 compares the densities predicted for 2 - azido - n - methylethanamine ( mmaz ), dmaz , and 2 - azido - n - cyclopropylethanamine ( cpaz ) with the inventive cis and trans forms of admcpa . table 1 also presents estimates for the heats of vaporization predicted for mmaz , dmaz , and cpaz for comparison with the inventive cis and trans forms of admcpa . the potential error associated with this approach is expected to be less than ± 2 kcal / mol . with estimates for condensed - phase heats of formation and densities from example 5 , specific impulse ( i sp ) and density impulse ( d * i sp ) are calculated for mmaz , dmaz , cpaz , and the inventive admcpa isomers upon combination with an oxidizer . table 1 compares optimized i sp values from nasa - lewis rocket calculations ( b . j . mcbride et al . “ computer program for calculation of complex chemical equilibrium compositions and applications ii . users manual and program description .” nasa reference publication 1311 , nasa lewis research center , cleveland , ohio , 1996 ) for a system in which the oxidizer is an irfna “ mixture ”. it is observed that the optimized i sp values for the aliphatic amine azides are nearly identical to each other , and less than 1 % lower than the value obtained for mmh . moreover , with higher densities than mmh , the aliphatic amine azides &# 39 ; d * i sp values are predicted to be higher than that for mmh . those skilled in the art will appreciate from the foregoing description and examples that the broad teaching of the present invention can be implemented in a variety of forms . therefore , while this invention has been described in connection with particular examples thereof , the true scope of the invention should not be so limited since other modifications will become apparent to one skilled in the art upon review of the specification and the following claims . all patents and other publications cited herein are expressly incorporated by reference to the same extent as if each individual publication or patent were specifically and individually indicated to be incorporated by reference . | 2 |
referring to the drawings , wherein like reference numerals represent like parts throughout the various drawing figures , reference numeral 10 ( fig1 ) is directed to an implant assembly for implantation into an intervertebral space s between adjacent vertebrae v after a disk d has been removed from the intervertebral space s . a primary segment 20 and a secondary segment 60 are implanted along separate pathways but interlock together within the intervertebral space s to form a single implant assembly 10 . the resulting assembly 10 securely stabilizes the vertebrae v adjacent the intervertebral space s for spinal fusion of the vertebrae v together . in essence , and with particular reference to fig1 - 5 , the basic details of the implant assembly 10 are described . the implant assembly 10 includes a primary segment 20 ( fig2 ) and a secondary segment 60 ( fig4 ). the primary segment 20 is elongate in form extending along a primary axis a . the primary segment 20 is preferably higher than it is wide ( compare fig2 with fig3 ), thus having a rectangular cross - section . the primary segment 20 can thus be inserted on its side into the intervertebral space ( along arrow c of fig2 ) and then rotated within the intervertebral space ( along arrow f of fig3 ) to help spread vertebrae v adjacent the intervertebral space s away from each other . the primary segment 20 additionally includes a tunnel 30 ( fig2 ) passing laterally through the primary segment 20 . the secondary segment 60 ( fig4 ) is elongate and has a contour generally similar to that of the primary segment 20 . however , the secondary segment 60 includes a neck 70 rather than the tunnel 30 of the primary segment 20 . the secondary segment 60 has a cross - sectional size similar to a size of the tunnel 30 . this size allows the secondary segment 60 to be inserted along secondary axis b ( in the direction identified by arrow e of fig4 ) through the tunnel 30 in the primary segment 20 . the secondary segment 60 can later be rotated ( along arrow g of fig5 ) in a manner similar to the rotation of the primary segment 20 so that a height of the secondary segment 60 is oriented vertically and maximizes a spacing of vertebrae v adjacent the intervertebral space s . the segments 20 , 60 interlock together to form the implant assembly 10 with the segments 20 , 60 stabilizing each other and allowing the implant assembly 10 to stabilize the intervertebral spaces in which the assembly 10 is implanted . more specifically , and with particular reference to fig6 - 10 , details of the primary segment 20 according to a preferred embodiment of this invention are described . the primary segment 20 is an elongate substantially rigid construct formed from a top structure 22 and a bottom structure 24 which are pivotably joined together , such with a hinge 25 . the hinge 25 can take on many different forms to provide the basic function of allowing the top structure 22 and the bottom structure 24 to be pivoted relative to each other . the primary segment 20 extends from a distal end 26 to a proximal end 28 . a guide wire stop 27 can be optionally included with the bottom structure 24 at the distal end 26 and extend up beyond the top structure 22 . the tunnel 30 passes laterally through the primary segment 20 between a top surface and a bottom surface of the primary segment 20 . the tunnel 30 includes a top 32 preferably substantially parallel to a bottom 34 and sides 36 extending between the bottom 34 and the top 32 . the tunnel 30 preferably has dimensions similar to exterior dimensions of the primary segment 20 itself , but rotated 90 ° . the tunnel 30 is thus sized to allow secondary segments 60 with dimensions similar to the primary segment 20 to pass laterally through the tunnel 30 during formation of the implant assembly 10 of this invention within the intervertebral space s ( fig1 - 5 ). a passage 40 extends longitudinally within the primary segment 20 and between the top structure 22 and the bottom structure 24 . the passage 40 includes an entrance 42 at the proximal end 28 of the primary segment . the passage 40 additionally includes a roof 44 preferably substantially parallel to and spaced from a floor 46 . preferably , the passage 40 has a constant cross - section from the entrance 42 to a location where the passage 40 intersects the tunnel 30 . the passage 40 preferably continues beyond the tunnel 30 and toward the distal end 26 of the primary segment 20 . however , portions of the passage 40 on a distal side of the tunnel 30 preferably taper to form a tapering end 48 of the passage 40 . a step 49 is preferably located in the passage 40 directly adjacent the tunnel 30 . the passage 40 is configured to receive a shim 50 therein . the shim 50 ( fig9 ) preferably has a rectangular cross - section which generally fills the passage 40 ( fig8 ) so that the shim does not rotate . the shim 50 preferably includes a tip 52 which is of lesser height than a tail 54 . a central pathway 56 preferably passes through the shim 50 . a guide wire 58 can be passed entirely through the passage 40 up to the stop 27 ( along arrow h of fig9 ) and then the shim 50 threaded onto the guide wire 58 . the shim 50 can then be easily advanced along the guide wire 58 ( arrow j of fig9 ) and directed into the passage 40 . when the shim 50 reaches the tapering end 48 of the passage 40 , with the assistance of an appropriate shim pushing tool , the shim 50 causes the top structure 22 and bottom structure 24 of the primary segment 20 to be expanded away from each other ( about arrow k of fig1 ) and a height of the primary segment 20 to be enhanced at the distal end 26 of the primary segment 20 . such distal end 26 height expansion for the primary segment 20 is desirable in many cases to provide lordosis to the intervertebral space s . specifically , lordosis is a orientation for the intervertebral space s where an anterior edge of the intervertebral space s has a greater height than a posterior edge of the intervertebral space s . such lordosis can be provided to a varying degree depending on the desires of the medical practitioner . with this invention the shim 50 is advanced an amount desired through the passage 40 of the primary segment 20 to provide an amount of lordosis which is desirable in the judgment of the medical practitioner . the segment 20 can be custom designed to provide the lordosis desired or can be variably expandable for adjustment during implantation . with particular reference to fig1 - 14 , details of a preferred embodiment of the secondary segment 60 are described . the secondary segment 60 preferably has a general exterior contour similar to that of the primary segment 20 . also , the secondary segment 60 is preferably divided into a top jaw 62 and a bottom jaw 64 which are pivotably connected together , such as at a hinge 65 . as with the primary segment 20 , the hinge 65 can take on a variety of different configurations . the secondary segment 60 extends from a first distal end 66 to a second proximal end 68 . the secondary segment 60 includes a neck 70 with two preferably substantially parallel surfaces 72 and side walls 74 extending between the parallel surfaces 72 of the neck 70 and top and bottom surfaces of the secondary segment 60 . the side walls 74 can be perpendicular to the parallel surfaces 72 ( as depicted generally in fig4 ) or can be beveled ( as shown in fig1 ). the parallel surfaces 72 are located closer to each other than a distance between top and bottom surfaces of the secondary segment 60 . the parallel surfaces 72 need not be precisely parallel , but benefit from having a lesser height than that of the top and bottom surfaces of the secondary segment 60 so that the neck 70 of the secondary segment 60 is an open region then can reside within the tunnel 30 or other open region in the primary segment 20 after rotation of the secondary segment 60 into an orientation with the top surface and the bottom surface vertically aligned along with top and bottom surfaces of the primary segment 20 ( fig5 ). preferably , the neck 70 is located near a midpoint between the distal first end 66 and the proximal second end 68 of the secondary segment 60 . the width between lateral sides of the secondary segment 60 is preferably similar to a height of the neck 70 and a height of the tunnel 30 in the primary segment 20 for a tight fit within the tunnel 30 both before and after rotation ( about arrow g of fig5 ). the hinge 25 in the primary segment 20 , general slight flexibility of the segments 20 , 60 and possible slight additional clearances can provide the relief necessary to allow the secondary segment 60 to rotate with the neck 70 within the tunnel 30 . preferably , the secondary segment 60 tends to snap into its final position so that the segments 20 , 60 are securely interlocked together . to provide lordosis to the intervertebral space s , the secondary segment 60 is configured to allow height expansion , particularly at the distal first end 66 . specifically , the secondary segment 60 includes a bore 80 passing longitudinally from the proximal second end 68 , at least part of the way toward the distal first end 66 . the bore 60 includes a pin 82 therein which includes a threaded end 83 at an end thereof closest to the distal first end 66 of the secondary segment 60 . an access end 84 of the pin 82 is opposite the threaded end 83 and closest to the proximal second end 68 of the secondary segment 60 . a wrench 85 having one of a variety of different configurations ( fig1 ) can be utilized to cause the pin 82 to rotate by interaction of the wrench 85 with the access end 84 of the pin 82 . preferably , the bore 80 is slightly smaller adjacent the proximal end 68 to keep the pin 82 from sliding toward the proximal end 68 within the bore 80 . a wedge 86 is located within a tapering recess 87 in the bore 80 . the wedge 86 is preferably cylindrical and includes a threaded hole extending perpendicularly through curving sides of the wedge into which the threaded end 83 of the pin 82 is located . hence , when the pin 82 is rotated by rotation of the tool 85 ( along arrow l of fig1 ) the threaded end 83 of the pin 82 causes the wedge 86 to travel toward the distal first end 66 of the secondary segment 60 ( along arrow m of fig1 ). as the wedge 86 travels toward the distal first end 66 and through the tapering recess 87 , the top jaw 62 and bottom jaw 64 are spread vertically ( along arrow n of fig1 ), enhancing a height of the secondary segment 60 . while the primary segment 20 and secondary segment 60 are shown with unique systems for vertically expanding top and bottom portions of the segments 20 , 60 , it is noted that these systems are merely one currently most preferred embodiments of a vertical height enhancement system for the segments 20 , 60 . in fact , a variety of different systems could be utilized to enhance the vertical height of the segments 20 , 60 after implantation . most preferably , the segments 20 , 60 have a height between a top and bottom surface approximately twice a width between lateral sides of the segments 20 , 60 . a tongs 90 ( fig1 ) can be utilized to properly place the segments 20 , 60 within the intervertebral space s ( fig1 ). tongs 90 typically have fingers 92 which have tips 93 with a width similar to half of the lateral width of the segments 20 . in this way , the segments 20 , 60 could be grasped on lateral sides with the tips 93 of the fingers 92 of the tongs 90 and the segments 20 , 60 can be advanced through a tubular cannula with the tubular cannula having a diameter similar to a height of the segments 20 , 60 between top and bottom surfaces of the segments 20 , 60 . the tongs 90 might include a pivot 94 with handles 96 at ends of the tongs 90 opposite the fingers 92 for releasably grasping the segments 20 , 60 . alternatively , the segments 20 , 60 could be grasped at their proximal ends 28 , 68 through an appropriate attachment mechanism inboard of the top and bottom surfaces and lateral surfaces of the segments 20 , 60 so that the tongs 90 or other placement tool would not add to a cross - sectional diameter needed for the cannula through which the segments 20 , 60 would be passed . with particular reference to fig1 and 17 , details of an alternative offset hinge 102 are described . such an offset hinge 102 is shown on a first alternative primary segment 100 . however , the offset hinge 102 could similarly be located on a secondary segment such as a modification of the secondary segment 60 ( fig1 - 14 ). the offset hinge 102 advantageously allows a single pintle to pass through all leaves of the offset hinge 102 ( fig1 ). the offset hinge 102 thus avoids the necessity of two partial pintles on opposite sides of a passage 40 ( fig8 ) or bore 80 ( fig1 ). otherwise , the alternative primary segment 100 of fig1 and 17 is similar to the primary segment 20 of the preferred embodiment of the implant assembly 10 of this invention . [ 0062 ] fig1 shows a second alternative primary segment 110 featuring a split hinge 112 . this split hinge 112 on the second alternative primary segment 110 is generally similar to the hinge 25 of the primary segment 20 of the preferred embodiment ( fig8 ). however , the overlapping leaves place the pintles of the split hinge 112 in a slightly different position . the second alternative primary segment 110 and split hinge 112 of fig8 illustrate one of the many different hinge configurations which the segments 20 , 60 of the implant assembly 10 of this invention can have to effectively allow top and bottom portions of the segments 20 , 60 to move relative to each other . while the material forming the segments 20 , 60 would typically be some form of surgical grade bio - compatible stainless steel or other material , it is conceivable that the material forming the segments 20 , 60 could be a form of hydrocarbon polymer or other plastic material , or a metallic material which has some appreciable flexibility characteristics . if the segments 20 , 60 are made from such materials or can be machined to have sufficiently thin connection between the top and bottom portions of the segments 20 , 60 , the hinges 25 , 102 , 112 of the various embodiments of this invention could be replaced with the top and bottom portions of the segments 20 , 60 merely flexing relative to each other sufficiently to allow the height expansion at the distal ends 26 , 66 of the segments 20 , 60 so that an appropriate amount of lordosis can be provided to the intervertebral space s ( fig1 ). with particular reference to fig1 - 21 details of a third alternative primary segment are described . this third alternative primary segment 120 features an offset hinge 122 similar to the offset hinge 102 of the first alternative primary segment 100 ( fig1 ). the third alternative primary segment 120 additionally includes undulating overlapping tapering surfaces 124 for portions of the top and bottom structures of the third alternative primary segment 120 adjacent the distal end . these undulating overlapping tapering surfaces 124 can be spread apart by longitudinal advancement of a first alternative shim 126 which is preferably cylindrical and as wide as the entire segment 120 . as the first alternative shim 126 is advanced ( along arrow p of fig1 ) it passes through a series of steps corresponding with different stages of lordosis which can be provided to the intervertebral space s ( fig1 ). because the tapering surfaces 124 undulate , a series of locations are provided where the first alternative shim 126 can come to rest . varying degrees of height adjustment corresponding to various different degrees of lordosis can thus be provided to the intervertebral space s ( fig1 ). the first alternative shim 126 can be advanced by being pushed along through an access passage 128 with any appropriate form of pushing tool , or could be advanced with a threaded pin similar to the advancement of the wedge 86 along the pin 82 of the secondary segment 60 of the preferred embodiment . because the tapering surfaces 124 overlap , a greater amount of height increase at the distal end of the third alternative primary segment 120 is provided ( see fig2 ). this third alternative primary segment 120 height magnification system could be fitted on an alternative secondary segment having a neck rather than a tunnel in a relatively straightforward fashion due to the relatively low profile passage 128 which could pass through a neck without compromising a strength of the neck in such an alternative secondary segment . hence , this height magnification system is merely illustrated in the context of primary segment for convenience , but could be equally well incorporated into a secondary segment . with particular reference to fig2 - 27 , details of a fourth alternative primary segment are described . the fourth alternative primary segment 130 is configured to allow height adjustment both at a distal end of the fourth alternative primary segment 130 and at a proximal end of the fourth alternative primary segment 130 . specifically , the top and bottom portions of the fourth alternative primary segment 130 are preferably joined together with an expanding hinge 132 . function of the expanding hinge is shown in detail in fig2 - 27 . the expanding hinge 132 includes two separate pintles 134 on opposite sides of a longitudinal passage extending through the fourth alternative primary segment 130 . the pintles 134 reside within slots 136 . hence , the expanding hinge 132 allows both rotation and vertical expansion ( along arrow r of fig2 and 26 ) while still holding the top and bottom portions of the fourth alternative primary segment 130 together . a longitudinal passage passing through the fourth alternative primary segment includes a proximal recess 140 near a proximal end of the fourth alternative primary segment 130 . a proximal shim 142 can be advanced along a guide wire in a manner similar to the advancement of the shim 50 of the primary segment 20 of the preferred embodiment . the proximal shim 142 is preferably configured with a contour matching that of the proximal recess 140 . hence , as the proximal shim 142 is advanced into the passage ( along arrow q of fig2 ), the proximal shim 142 expands the top and bottom portions of the fourth alternative primary segment 130 away from each other until the proximal shim 142 rests within the proximal recess 140 . as an alternative to providing the proximal recess 140 , the proximal shim 142 could merely have a tapering contour ( shown in fig2 ) and the friction between tapering surfaces of the proximal shim 142 and upper and lower surfaces of the pathway within the fourth alternative primary segment 130 could allow the proximal shim 142 to remain in a position where it has been advanced unless specific forces are applied to the proximal shim 142 . as shown in fig2 , a shim similar to the shim 50 of the preferred embodiment would first be advanced along the guide wire into the tapering end of the passage within the fourth alternative primary segment 130 . the proximal shim 142 would then be advanced into the passageway . hence , the fourth alternative primary segment 130 experiences height magnification both adjacent a distal end and adjacent the proximal end of the fourth alternative primary segment 130 . the proximal shim 142 could similarly be used with an expanding hinge 132 fitted into the proximal second end 68 of the secondary segment 60 to give the secondary segment 60 proximal end 68 height adjustability . [ 0072 ] fig2 shows a fifth alternative primary segment 150 which uniquely includes beveled tunnel sides 152 . these beveled tunnel sides 152 allow a second alternative secondary segment 155 to pass through the tunnel in a non - perpendicular direction . specifically , the secondary segment 155 can be angled relative to the fifth alternative primary segment 150 by an angular amount ( arrow x of fig2 ) which can be less than or greater than 90 ° , rather than only exactly 90 °. angle x in fig8 is shown at approximately 60 ° but could be reduced to as little as 45 ° or less and still allow the secondary segment 155 to pass through the tunnel in the fifth alternative primary segment 150 without being blocked by the beveled tunnel sides 152 . the beveled tunnel sides 152 are shown angled approximately 45 ° away from an orientation perpendicular to a long axis of the fifth alternative primary segment 150 . however , the angles of the beveled tunnel sides 152 and the angle x that the secondary segment 155 shares relative to the fifth alternative primary segment 150 could be increased or decreased depending on the needs of the medical practitioner for the implant assembly 10 . the second alternative secondary segment 155 preferably includes a relief bevel 156 ( fig2 ) which allows a side wall of the neck in the second alternative secondary segment 155 to come into contact with a side surface of the first alternative primary segment 150 after the second alternative secondary segment 155 has been rotated into its final position . the relief bevel 156 thus allows the second alternative secondary segment 155 and the fifth alternative primary segment 150 to more completely stabilize each other in a fully interlocking fashion so that the implant assembly 10 stabilizes the intervertebral space s ( fig1 ) as completely as needed . a sixth alternative primary segment 160 is shown in fig2 which includes relief notches 162 in sides of the sixth alternative primary segment 160 adjacent the tunnel . the relief notches 162 are an alternative to the relief bevel 156 of the embodiment of fig2 . specifically , fig2 illustrates how either the relief bevel 156 can be provided on the second alternative secondary segment 155 or relief notches 162 can be provided as in the sixth alternative primary segment 160 so that complete rotation of the third alternative secondary segment 164 can be achieved without the necessity of the relief bevel 156 of the second alternative secondary segment 155 . of course a combination of the relief bevel 156 and the relief notches 162 could be resorted to so that abutting surfaces of the primary segment and the secondary segment could mesh together in a manner providing stability for the overall implant assembly 10 . a fourth alternative secondary segment 170 is shown in fig3 along with the fifth alternative primary segment 150 . this implant assembly shown in fig3 is shown with the first alternative primary segment 150 in section and clearly illustrating how the fourth alternative secondary segment 170 can fit through the tunnel in the fifth alternative primary segment 150 at an angle x ( fig2 ) other than perpendicular and be rotated , about arrow t , and to the final position such as that shown in fig2 . it can be seen from fig3 that not all of the beveled tunnel sides 152 are strictly necessary for the passage of the fourth alternative secondary segment 170 through the tunnel in the fifth alternative primary segment 150 . by providing the beveled tunnel sides 152 in two directions , the fifth alternative primary segment 150 becomes reversible . however , inclusion of both beveled tunnel sides 152 would not be absolutely necessary . rather , only one beveled tunnel side 152 could be provided on each side of the tunnel and other beveled tunnel sides 152 could be eliminated . particularly , and as shown in fig3 , the beveled tunnel sides 152 which include reference numerals thereon could be removed and the fourth alternative secondary segment 170 could still pass through the tunnel in the fifth alternative primary segment 150 successfully . selective relief bevels 172 similar - to the relief bevels 156 ( fig2 ) could be provided on some of the neck side walls , but would not need to be on all neck side walls . the selective relief bevels 172 would come to rest adjacent sides of the primary segment 150 after rotation about arrow t and provide enhanced stability between the segments 150 , 170 . this disclosure is provided to reveal a preferred embodiment of the invention and a best mode for practicing the invention . having thus described the invention in this way , it should be apparent that various different modifications can be made to the preferred embodiment without departing from the scope and spirit of this disclosure . for instance , while the primary segment 20 and the secondary segment 60 are described in the preferred embodiment as being expandable , a simplified variation of this invention would not require such expandability . when structures are identified as a means to perform a function , the identification is intended to include all structures which can perform the function specified . | 8 |
1 ) maize material : immature embryos of 17 days postpollination ( 17 dpp ) from maize variety qi 319 . 2 ) strains : e . coli dh5α , dh10b and jm109 , and yeast strains ywam2 ( leu − , his − , trp − ). 4 ) restriction enzymes and modifying enzymes : restriction endonuclease and modifying enzyme are purchased from promega corp ., new england biolab , inc . and gibco corporation . 5 ) chemical reagents : the reagents for yeast culture are purchased from sigma chemical company ltd . and oxford corporation ; the other chemical reagents are made in china ( analytical pure ). 6 ) kits : wizard ™ minipreps dna purification system and wizard ™ maxipreps dna purification system available from promega corp . are used to extract plasmid dna ; dna fragment quick purification / retrieve kit available from ding guo biotechnology ltd . is used to retrieve dna ; rnagents total rna isolation system kit and polyattract mrna isolation system available form promega corp . are used to extract rna ; and superscript ™ plasmid system for cdna synthesis and plasmid cloning kit available from gibcobrl company are used to construct the library . 7 ) synthesis of primers : performed by beijing sai bai sheng bioengineering company and shanghai bioasia biotechology co ., ltd . the total rna extraction and the mrna isolation are performed according to rnagents total rna isolation system kit and polyattract mrna isolation system available from promega corp ., respectively . weigh 1 g of maize 17dpp embryos , extract 2 . 834 mg of total rna , and isolate 43 . 7 μg of mrna . 2 ) construction of cdna library with mrna from maize 17dpp embryos . the construction is performed according to the protocol of superscript ™ plasmid system for cdna synthesis and plasmid cloning kit available from gibcobrl company . 5 μg of mrna extracted from 17dpp embryos was used to construct the cdna library . the primer used in reverse transcription is : sal i adapter was added and ligated to the double - strand cdna synthesized : digest the ligation products with not i and construct them into vector ppc86 ( trp + ). the vector was digested with sal i and not i , and purified . the construct was used to transform e . coli . dh10b and a cdna library with the library capacity of 5 . 2 × 10 6 cfu was obtained . prepare 4l of 2 × lb culture medium ( 20 g / l bacto - tryptone , 10 g / l bacto - yease extract , 10 g / l nacl , 3 g / l seaprep agarose , adjust to ph 7 . 0 ). autoclave at 121 ° c . for 30 min . incubate at 37 ° c . for 2 hours . add penicillin g to a final concentration of 200 mg / l . to the medium , add the library up to a concentration of 10 6 cfu / l . mix well and aliquot 20 - 30 ml into 50 - ml culture tubes . ice - bath for 1 hour . grow at 30 ° c . for 40 hours . centrifuge at 8000 rpm for 10 min to collect the cells . discard the supernatant . add 200 ml of 2 × lb ( 12 . 5 % glycerol ) to suspend the cells . aliquot into 10ml / each container and store at − 70 ° c . for later use . 4 ) construction of bait vector harboring 4mer abre and specificity - testing vector containing 4mer mutant abre ( mabre ): 5 ′ tcccacctccacgtggact3 ′. remove 20 μl ( 1 μg / l ) of abre (+) and abre (−) respectively , and mix well . add 4 μl of 3m naoac and 100 μl of absolute ethanol . place at − 20 ° c . for 30 minutes . centrifuge at 12000 rpm to pellet dna . wash once with 70 % ethanol and dry . add 6 . 5 μl of sterile h 2 o and 1 μi of 10 × t4 polynucleotide kinase buffer . then , anneal . the conditions for annealing are 88 ° c ., 2min ; 65 ° c ., 10min ; 37 ° c ., 10min ; 25 ° c ., 5min . add 1 . 5 μl of 20 mm atp and 1 μl of t4 polynucleotide kinase . react at 37 ° c . for 2 hours . extract with each of phenol - chloroform and chloroform once , respectively . precipitate dna with absolute ethanol . then add 2 μl of 10 × ligase buffer , 1 μl of ligase ( 5 units / μl ) and 17 μl of sterile h 2 o to ligate overnight . perform gel eletrophoresis with 2 % agarose and isolate the dna fragment of the size of about 80 bp . clone the fragment into vector pbsk + ( digestion with spe i and filling - in ) and carry out sequencing . obtain plasmid pa4 . mabre (−): 5 ′ tcccaccgaacatgttact 3 ′. by the similar method as above , obtain plasmid pma4 . double - digest vector prs315his ( leu + ) with bamh i and xba i and purified . similarly , digest plasmids pa4 and pma4 , and purified . clone 4mer abre and 4mer inabre into prs315his , and obtain bait vector prsa4 ( leu + ) and specificity - testing vector prsma4 ( leu + ), respectively . prepare ywam2 competent cells . transform prsa4 into yeast strain ywam2 ( leu − , his − , trp − ) and obtain the yeast strain ya4 ( his − , trp − ) containing prsa4 . the transformation may be performed according to two hybrid system trafo protocol . screen the library by the transformation of ya4 yeast with 17 dpp library dna . spread the transformed cells on his − selective medium and incubate at 28 ° c . for 3 - 5 days . when yeast colonies grow out , extract plasmid dnas . the extraction method refers to method i : quick plasmid dna preparations from yeast ( christine guthrie 1991 ). transform e . coli dh5α with the extracted plasmids and then extract plasmid dnas from the resultant transformants . analyse by enzyme - digestion . perform sequencing and obtain the dna sequences of the positive clones . then analyse the sequences . 6 ) acquirement of the full - length cdna sequences of abp2 , abp4 and abp9 : the full - length cdna sequences of abp2 , abp4 and abp9 are obtained by the method of 5 ′ race . it is operated according to 5 ′ race system for rapid amplification of cdna ends , version 2 . 0 kit available from gibcobrl company . auap fw : 5 ′- ggccacgcgtcgactagtac - 3 ′ abp2 rv3 : 5 ′- aggaactcctccagagtcat - 3 ′ abp4 rv3 : 5 ′- tcgtcgaacgtcaacgagtag - 3 ′ abp9 rv3 : 5 ′- aaccaatcctccgttctcacc - 3 ′ the conditions for pcr are 94 ° c . 3 min , 94 ° c . 30 sec , 60 ° c . 30 sec , 72 ° c . 1 min for 35 cycles , and then 72 ° c ., 5 min . isolate the amplified dna fragments with 1 % agarose gel and retrieve the target fragments . ligate it into pgem - t easy vector and transform e . coli . jm109 . identify clones by enzyme - digestion and then perform sequencing . obtain the full - length cdna sequences of the genes of abp2 , abp4 , and abp9 , respectively , which were named as sequences 1 , 3 and 5 in the sequence listing . based upon the cdna sequences , the predicted proteins have the amino acid sequences set forth by sequences 2 , 4 and 6 in the sequence listing . transform plasmids prsa4 ( leu + ) and prsma4 ( leu + ) respectively into ywam2 yeast and obtain ya4 and yma4 yeast strains . transform ya4 and yma4 yeast with each of the abp2 , abp4 and abp9 plasmids obtained through screening the library . incubate on his − selective medium for 3 - 5 days at 28 ° c . only ya4 yeast transformed with abp2 , abp4 or abp9 plasmid can grow while yma4 yeast transformed with abp2 , abp4 or abp9 plasmid cannot grow . the result means that abp2 , abp4 or abp9 is able to specifically bind to abre element in yeast and activate the expression of the reporter gene his3 , thereby having the ability of growing in his − selective medium ( fig1 b ). in contrast , because abp2 , abp4 or abp9 cannot bind to mabre and thereby cannot activate the expression of the reporter gene his3 that makes yeast not to grow on his selective medium ( fig1 a ). therefore , abp2 , abp4 and abp9 have the in vivo abre - binding specificity in yeast cells . analysis of in vitro abre - binding specificity of abp2 , abp4 and abp9 ( emsa test ). clone the full - length genes abp2 , abp4 or abp9 into prokaryote expression vector pgex4t - 1 and then transform into strain bl21 . induce the expression with 0 . 3 mm iptg at 37 ° c . for 2 - 3 hours . sds - page eletrophoresis shows the specific expression bands of abp2 , abp4 and abp9 . the purification of proteins abp2 , abp4 and abp9 is performed as microspin ™ gst purification module protocol available from pharmacia corporation . the purified proteins are used for the emsa test . use dna 5 ′ end - labeling system of promega corp to label probes . the reaction system is : 1 μl of abre ( or mabre ), 5 μl of t 4 pnk 10 × buffer , 3 μl of γ - 32 p - atp , 2 μl of t 4 pnk ( 10u / μl ), and 39 μl of h 2 o . react at 37 ° c . for 20 minutes . add 2 μl of 0 . 5m edta and stop the reaction at 68 ° c . for 10 minutes . then keep at 37 ° c . for 10 minutes . store at 4 ° c . for use . add 4 μl of 5 × binding buffer ( 125 mm hepes - koh ph7 . 6 , 50 % glycerol , 250 mm kc1 ). add 4 μg ( 9 μl ) of each of the proteins abp2 , abp4 , abp9 and gst . add 1 μl of 1m dtt , 1 μl of probe of the above - labeled abre ( or inabre ) and 4 μl of h 2 o . incubate on ice for 30 minutes . add 3 μl of sample buffer ( 0 . 025 % bromophenol blue in sterile h 2 o ) and perform polyacrylamide gel eletrophoresis analysis . set up the gel mixture of 9 ml of 30 % acrylamide , 5 ml of 10 × eletrophoresis buffer ( 142 . 7 g / l glycin , 3 . 92 g / l edta , 30 . 28 g / l tris ), 2 . 5 ml of 50 % glycerol , 33 ml of deionized water , 400 μl of 10 % aps , and 25 μl of temed . after completion of polymerization , perfom gel eletrophoresis with 1 × eletrophoresis buffer , including pre - running for 10 minutes ( 300v ), loading the samples and eletrophoresis for 1 hour ( 300v ). stick the gel with filter paper to peel off . seal the peeled gel with saran wrap and expose to x ray film for 1 hour . wash the film , develop for 2 minutes and fix for 5 minutes . the result shows that there exists a band of abre retarded significantly by proteins abp2 , abp4 and abp9 while there does not exist a band of mabre retarded by them ( fig2 ). this means that the products of the genes abp2 , abp4 , and abp9 also have the abre binding specificity in vitro . abre binding specificity and transcription activation function of abp2 , abp4 and abp9 in yeast and maize cells . construct the genes abp2 , abp4 and abp9 into yeast expression vector yepgap ( trp + ) to obtain plasmids yepgapabp - 2 , yepgapabp - 4 and yepgapabp - 9 containing the full - length cdna of the genes abp2 , abp4 , and abp9 , respectively . transform them into ya4 and yma4 yeast and incubate the transformed yeast in his − selective medium at 28 ° c . for 3 ˜ 5 days . the result shows that ya4 transformed by plasmid yepgapabp - 2 , yepgapabp - 4 , yepgapabp - 9 can grow ( fig3 b , d and f ) while yma4 transformed by them cannot grow ( fig3 a , c and e ). therefore , abp2 , abp4 and abp9 not only have the abre binding specificity in yeast cells , but also have the transcription activation function . in fig3 , the capital letter a stands for yma4 + abp2 , b for ya4 + abp2 , c for yma4 + abp4 , d for ya4 + abp4 , e for yma4 + abp9 and f for ya4 + abp9 . construction of reporter plasmid : pig46 vector is digested with xho i and filled in with t4 dna polymerase . digest 4mer abre in vector pbluescript ii sk + with sma i and ecl136 ii . retrieve the dna fragment of the size of about 80 bp used to ligate with the vector . transform e . coli dh5α and extract the plasmid . identify through enzyme digestion . the sequencing result shows that abre has been ligated upstream of 35s mini promoter . construction of effector plasmids of abp2 , abp4 and abp9 : the full - length cdna of the genes abp2 , abp4 and abp9 ( xba i , xho i ) is constructed into plant expression vector pbi221 and obtain plasmids pbi221 - abp2 , abp4 and abp9 . co - transform the reporter plasmid and effector plasmid into maize cells by bombardment . the materials for transformation are the maize suspension cells and the transformation method may refer to the practical methods of molecular biology and biotechnology in plant edited by b . r . greenter and j . e . tompson . the result shows that the reporter gene is not expressed when solely transformed with reportor plasmid ( fig4 a ) while it is significantly expressed when co - transformed with pig46 and pbi221 - abp2 , abp4 or abp9 ( fig4 b , c and d ). therefore , the proteins abp2 , abp4 and abp9 not only have the abre binding specificity in maize cells , but also have the transcription activation function . analysis of the expression specificity of abp2 , abp4 and abp9 under abiotic stresses 1 ) treatment of maize materials : take maize seed and imbibe water for 24 hours . after planting in pot , grow at 28 ° c . with 12 hours photoperiod for about 20 days . treat the plants at the development stage of three leaves with different conditions . i . cold treatment : place the maize seedling in a 2 ° c . chamber and grow for 48 hours with 12 hours phtoperiod . take out and wash off the soil on the root . freeze with liquid nitrogen and store at − 80 ° c . for use . ii . salt treatment : place maize seedling in 0 . 6 %, 0 . 8 % and 1 % nacl solution , respectively . grow with 12 hours photoperiod for 3 days . take out and wash off the soil on the root . freeze with liquid nitrogen and store at − 80 ° c . for use : iii . drought treatment : place maize seedling in the soil containing 8 % ( prepared by mixing 920 g of dry soil and 80 ml of water ), 10 % and 13 % of water , respectively . grow for 3 days , with 12 hours photoperiod . take out and wash off the soil on the root . freeze with liquid nitrogen and store at − 80 ° c . for use . iv . aba treatment : place maize seedling in the solutions of 10 − 4 m , 10 − 5 m , 10 − 6 m aba respectively ( weigh 5mg of aba and dissolve in 0 . 1n koh . add into 95 ml of water up to a final concentration of 10 − 4 m ). grow for 24 hours , with 12 hours photoperiod . take out and wash off the soil on the root . freeze with liquid nitrogen and store at − 80 ° c . for use . v . h 2 o 2 treatment : place maize seedling in the aqueous solutions of 10 mm h 2 o 2 ( 1 . 13 ml of 30 % h 2 o 2 / 1 ), 60 mm h 2 o 2 ( 6 . 78 ml of 30 % h 2 o 2 / 1 ), 150 mm h 2 o 2 ( 14 . 95 ml of 30 % h 2 o 2 / 1 ). grow for 24 hours , with 12 hours photoperiod . take out and wash off the soil on the root . deepfreeze with liquid nitrogen and store at − 80 ° c . for use . vi . water treatment : place maize seedling in water . grow for 24 hours with 12 hours photoperiod . freeze and store at − 80 ° c . vii . control : take the non - treated seedling and freeze at − 80 ° c . as the control group . i . take about 200 mg of the treated maize materials and ground under the protection of liquid nitrogen . the method of rna extract refers to rnagents total rna isolation system kit available from promega corp . ii . dissolve rna in 85 μl of water . add 10 μl of 10 × buffer and 5 μl of rq1 rnase free dnase ( 1u / μl ). incubate at 37 ° c . for 15 minutes to eliminate the dna contamination . iii . add 100 μl of phenol - chloroform to extract once . remove the supernatant and precipitate rna with equal volume of isopropanol . wash once with 70 % ethanol and dissolve in 50 μl of water . add 1 μl of oligo dt 18 ( 0 . 5 μg / μl ), 5 μl of rna ( 1 μg / μl ), 1 μl of dntp ( 10 mm ) and 27 μl of h 2 o . treat at 65 ° c . for 5 minutes and at 0c for 2 minutes . add 10 μl of 5 × buffer , 5 μl of dtt ( 100 mm ), and 10u of rnase inhibitor ( 40 u / μl ). treat at 42 ° c . for 2 - 5 minutes . add 1 μl of superscipt ii ( 200 u / μl ). react at 42 ° c . for 50 minutes . inactivate at 70 ° c . for 15 minutes for use . the relative quantification of cdna template and the design of interior label primers : based upon the dna sequence of maize actin gene ( maize actin1 gene : accession no . j01238 ) in genbank , design the following primers : use the primers to perform the amplification . if it is amplified from cdna , a 405 bp band will be amplified . and if it is amplified from genomic dna , a 512 bp band will be amplified ( containing a intron of 107 bp ). the reation mixture for pcr : 1 μl of template , 10 μl of 2 × pcr buffer , 1 μl of 10 mm dntp , 1 μl of 10 μm mact1 f , 1 μl of 10 μm mact1 r , 1u of taq and 6 μl of sterile h 2 o . the conditions for pcr are 94 ° c . 2 min , 94 ° c . 30 sec , 55 ° c . 30 sec , 72 ° c . 30 sec for 30 cycles , and 72 ° c . 5 min . based upon the eletrophoresis result of pcr product , dilute the template dna and adjust the amount of template dna to be used . when the bands to be amplified by using mact1 f and mact1 r primers are substantially consistent , the amount of template cdna in the samples is substantially consistent . i . abp2 : design the primers for pcr amplification as follows ( to amplify the fragment of 548 bp ): the pcr system : 1 μl of template , 10 μl of 2 × pcr buffer , 1 μl of 10 mm dntp , 1 μl of 10 μm mact1 f , 1 μl of 10 μm mact1 r , 1u of taq and 6 μl of sterile h 2 o . the pcr conditions are 94 ° c . 2 min , 94 ° c . 30 sec , 55c 30 sec , 72 ° c . 30 sec for 30 cycles , and 72 ° c . 5 min . ii . abp4 : design the primers for pcr amplification as follows ( to amplify the fragment of 632 bp ): the pcr system : 1 μl of template , 10 μl of 2 × pcr buffer , 1 μl of 10 mm dntp , 1 μl of 10 μm mact1 f , 1 μl of 10 μm mact1 r , 1u of taq and 6 μl of sterile h 2 o . the conditions for pcr are 94 ° c . 2 min , 94 ° c . 30 sec , 55 ° c . 30 sec , 72 ° c . 30 sec for 30 cycles , and 72 ° c . 5 min . iii . abp9 : design the primers for pcr amplification as follows ( to amplify the fragment of 937bp ): the pcr system : 1 μl of template , 10 μl of 2 × pcr buffer , 1 μl of 10 mm dntp , 1 μl of 10 μm mact1 f , 1 μl of 10 μm mact1 r , 1u of taq and 6 μl of sterile h 2 o . the conditions for pcr are 94 ° c . 2 min , 94 ° c . 30 sec , 55 ° c . 30 sec , 72 ° c . 50 sec for 30 cycles and 72 ° c . 5 min . the eletrophoresis result shows the expression of the genes abp2 , abp4 , and abp9 can be induced by salt ( fig5 a , b and c ), drought ( fig5 j and k ), aba ( l , m and n ), hydrogen peroxide ( f and g ). in fig5 , a stands for ck1 , b for 1 % nacl , c for 0 . 8 % nacl , d for 0 . 6 % nacl , e for 150 mm h 2 o 2 , f for 60 mm h 2 o 2 , g for 10 mm h 2 o 2 , h for h 2 o , i for 13 % h 2 o , j for 10 % h 2 o , k for 8 % h 2 o , l for 10 − 6 m aba , m for 10 − 5 m aba , n for 10 − 4 m aba , o for 4 ° c . and p for ck2 . 1 ) transformation of arabidopsis with the genes abp2 , abp4 and abp9 : vernalize arabidopsis seed at 4 ° c . for 2 - 3 day and plant 7 - 10 seeds in each pot ( the rate of nutritive earth to vermiculite is 2 : 1 ). grow in the greenhouse ( at 22 ° c . with 16 hours light - treatment ). after the arabidopsis grow out the primary bolting , snip off it . when the arabidopsis grow out many secondary boltings and a few of them begin to produce legumen , the plants can be used for transformation . pick a single colony of agrobacterium and inoculate into 3 ml of yeb ( 50 mg / l kan and 50mg / l refampicin ). incubate at 28 ° c . with rotation at 250 rpm for 30 hours . 1 : 400 inoculate the seed culture into 200 ml of fresh yeb ( 50 mg / l kan and 50mg / l refampicin ) and incubate at 28 ° c . with rotation at 250 rpm for about 14 hours until od 600 is about 1 . 5 . harvest the cells by centrifugation at 7500 rpm at 4 ° c . for 10 minutes . re - suspend the cells in two volumes of liquid ms ( 400 ml ) ( 1 / 2 ms salt + 5 % sucrose , ph5 . 7 . sterilized at 121 ° c . for 15 minutes ). immediately before use , add 6 - ba to a final concentration of 0 . 044 μm , vb6 to a final concentration of 1 mg / l , vb1 to a final concentration of 10 mg / l , and silwet to a final concentration of 0 . 02 %). construct genes abp2 , abp4 and abp into vectors pbi121 and pzp212 to obtain pzp212 - abp2 , pzp212 - abp4 and pbi121 - abp9 ( fig6 ), respectively . transform jm109 , extract the plasmids and identify with digestion of enzymes . pick out the desired clone , perform dna sequencing and transform it into agrobacterium lba4404 . dip the bud of arabidopsis into agrobacterium suspension under vacuum ( 25 in hg ) for 5 minutes . after the transformation is over , cover the pot with a plastic bag . place in horizontal direction . let it grow under low light intensity for 24 - 48 hours . then transfer to the normal conditions for further growth . weigh 25 - 30 mg of seeds collected from above transformation - treated plants and place into 1 . 5 - ml centrifuge tube . add 1 ml of 75 % ethanol ( containing 0 . 05 % tween 20 ) and shake in a shaker for 10 minutes ( 300 rpm ). centrifuge and discard the supernatant . add 1 ml of 95 % ethanol to wash one time , centrifuge and discard the supernatant . repeat once . add 0 . 3 ml of 100 % ethanol and place on sterile filter paper under hood and blow - dry . spread the blow - dried seeds on 1 / 2 ms plate ( 50 mg / l kan ) and place at 4 ° c . for 2 days . grow at 22 ° c . and with 16 hours photoperiod . transfer the antibiotics - resistant plants ( t 0 generation ) into pots for further cultivation and collect the seeds to perform the screening of t 1 generation . i . ground 0 . 1 - 0 . 2 g of plant leaves under liquid nitrogen and transfer into 1 . 5 - ml centrifuge tube . ii . add 0 . 7 ml of ctab ( 100 mm tris , 1 . 4 m nacl , 20 mm edta , 2 % ctab , 0 . 1 % mercaptoethanol ) and place at 60 ° c . for 30 minutes . note : turn over at an interval of 10 minutes . iii . add 0 . 7 ml of phenol : chloroform ( 1 : 1 ) and turn over for several times . centrifuge at 10000 rpm for 5 minutes . transfer the supernatant to a fresh centrifuge tube , add equal volume of chloroform : isopentanol ( 24 : 1 ), mix well , and centrifuge at 10000 rpm for 5 minutes . transfer the supernatant to another fresh centrifuge tube . iv . add equal volume of isopropanol and turn over to mix well . centrifuge at 10000 rpm for 10 minutes . discard the supernatant . wash once with 70 % ethanol . vacuum - dry . dissolve in 50 μl of sterile h 2 o for pcr assay . forward primer : 35s promoter : 5 ′- tctgccgacagtggtcccaa - 3 ′ reverse primer : abp2 rv3 : 5 ′- agg aac tcc tcc aga gtc at - 3 ′ abp4 rv3 : 5 ′- tcg tcg aac gtc aac gag tag - 3 ′ abp9 rv3 : 5 ′- aac caa tcc tcc gtt ctc acc - 3 ′ the reaction system ( 20μl ): 1 μl ( 20ng ˜ 50ng ) of dna from transgenic plant , 2 μl of 10 × buffer , 2 μl of mgcl 2 ( 2 . 5 mm ), 0 . 2 μl of taq enzyme , 2 μl of dntp ( 2 . 5 mm ). add 10 μm of each primer . add sterile h 2 o up to the volume of 20 μl . the reaction conditions are 94 ° c ., 5 minutes ; 94 ° c ., 45 second ; 60 ° c ., 45 second ; 72 ° c ., 45 second for 35 cycles . extend at 72 ° c . for 5 minutes . identify the pcr positive plants . survival analysis of transgenic plants of abp2 , abp4 and abp9 under stresses . 1 ) cold tolerance : place the transgenic plants and the non - trangenic plants at − 6 ° c . for 6 hours . then transfer into the normal growth conditions for recovery cultivation . the result shows that the survival rate of the transgenic plant is 80 % while that of the non - transgenic plant is 10 %. therefore , abp2 , abp4 , and abp9 are able to improve the cold tolerance of plants as shown in fig7 . 2 ) salt tolerance : place the transgenic plants and the non - transgenic plants in 600 mm nacl solution and immerse for 3 hours . grow at 22 ° c . for 24 hours , under light . transfer into the normal growth conditions for arabidopsis for recovery cultivation . the result shows that the survival rate of the transgenic plant is 80 % while that of the non - transgenic plant is 15 %. therefore , abp2 , abp4 , and abp9 are able to improve the salt tolerance of plants as shown in fig8 . 3 ) drought tolerance : place the transgenic plants and the non - transgenic plants under the normal growth conditions for arabidopsis . continuously cultivate for 15 - 20 days without supplying water . the result shows that the survival rate of the transgenic plant is 90 % while that of the non - transgenic plant is 5 %. therefore , abp2 , abp4 and abp9 are able to significantly improve the drought tolerance of plants as shown in fig9 , wherein the capital letter a stands for transgenic plant , b for non - transgenic plant . the invention has successfully cloned the genes encoding maize bzip transcription factors abp2 , abp4 , and abp9 , respectively . furthermore , the invention has successfully introduced the genes into arabidopsis and obtains novel arabidopsis with enhanced tolerance to abiotic stresses . the work will have important theoretic and practical significance to breed new plant varieties with improved tolerance to abiotic stresses . | 2 |
as can be seen from the figures , the line according to the invention comprises essentially a main leg indicated overally by 2 , and a plurality of branch legs arranged perpendicularly to the main leg and indicated overally by 4 . the line also comprises a feeder 6 which as in the case of the legs 2 and 4 is described in detail hereinafter . both the main leg 2 and the branch legs 4 comprise , on a frame 8 , an endless chain 10 extending horizontally between two end sprockets 12 , one of which is associated with a conventional electric motor ( not shown ) for its movement . to the links of the chain 10 there are fixed a plurality of upperly open parallelepiped boxes 16 , 16 &# 39 ; having their side walls slightly converging downwards and their base 18 formed in the manner of a trapdoor , i . e . hinged along one side to the lower edge of a side wall so as to lie substantially vertical by gravity if not otherwise retained , and so lowerly open the corresponding box . the box 16 , 16 &# 39 ;, which is projectingly fixed to the corresponding link of the chain 10 , is provided lowerly with a roller of vertical axis , which during the horizontal movement of the box rests against the vertical wall 22 of a section bar forming part of the frame 8 . a further roller 24 , 24 &# 39 ; of horizontal axis is applied to each box 16 , 16 &# 39 ; on the side opposite that which is hinged to the side wall of the box , to run along a horizontal guide 26 , 26 &# 39 ; consisting of a plurality of segments 28 placed one behind the other . the position of the guide 26 , 26 &# 39 ; is such that when the roller 24 , 24 &# 39 ; rests against it , the base 18 , 18 &# 39 ; of the corresponding box 16 , 16 &# 39 ; lies horizontal ( box closed ). in addition , each segment 28 is connected to an electromagnet 30 which when powered causes it to move rearwards , so that said roller 24 , 24 &# 39 ; no longer rests against it . the plane in which the boxes 16 of the main leg 2 move is higher than the plane in which the boxes 16 &# 39 ; of the branch legs 4 move , and more specifically the lowest level reached by the base 18 of the boxes 16 of the main leg 2 when said base is open is just higher than the level of the upper opening of the boxes 16 &# 39 ; of each branch leg 4 . in addition the position of each branch leg 4 compared with the main leg 2 is such that the position assumed by each box of this latter at an end position , i . e . when said box 16 &# 39 ; lies exactly in the longitudinal middle plane through said branch leg 4 , is exactly below the position of a box 16 of the main leg 2 ( see fig1 ). in a position below the main leg 2 and branch legs 4 there are provided a plurality of cabinets 32 , 32 &# 39 ; which extend horizontally following the horizontal extension of the main and branch legs and also vertically , to define a series of superimposed compartments 34 , 34 &# 39 ;. more specifically , each cabinet 32 , 32 &# 39 ; is divided horizontally into base modules 36 , 36 &# 39 ; each formed of a plurality of superimposed compartments 34 , 34 &# 39 ; ( four on the drawing ), associated with channels 38 , 38 &# 39 ; which open upperly in a position exactly below the path of the corresponding boxes 16 , 16 &# 39 ;. for the purpose of coordinating the various operating stages , the position of the upper opening of each channel 38 , 38 &# 39 ; corresponds with the position of the mobile segments 28 of the corresponding horizontal guide 26 , 26 &# 39 ;, so that , as will be apparent hereinafter , when the base 18 , 18 &# 39 ; of each box 16 , 16 &# 39 ; opens , the processing envelope 46 contained in it exactly enters a channel 38 , 38 &# 39 ;. again for the reasons which will be apparent hereinafter , those base modules of the cabinet 32 lying below the main leg 2 are provided only at those portions of said leg which are not involved with branch legs 4 , and thus in practice it can happen that only the branch legs 4 are provide with underlying cabinets 32 , 32 &# 39 ;. in the example shown in fig1 only one branch leg 4 is associated with the main leg 2 , and thus both these are provided with an underlying cabinet 32 , 32 &# 39 ;. it is however apparent that if further branch legs are provided parallel to and side by side with the branch leg 4 , the main leg 2 would be without an underlying cabinet , or at the most could be provided with cabinet portions only in the spaces between adjacent branch legs . each compartment 34 , 34 &# 39 ; of each cabinet 32 , 32 &# 39 ;, which is open frontally for accessibility reasons , houses a removable container , which according to the dimension of the compartment can be either a bag 40 or a box 42 . in addition in proximity to the lower part of each channel 38 , 38 &# 39 ; there is provided an optical sensor 44 the purpose of which is to sense both that correct passage of the processing envelope 46 has occured , as will be apparent hereinafter , and that the removable container placed in the corresponding compartment 34 , 34 &# 39 ; has been filled . the feeder 6 is situated at one end of the main leg 2 . it is located downstream of a conventional manual or automatic feed line indicated overally by 48 and comprises a tray elevator 50 which for a certain distance runs parallel to and at the same speed as a belt conveyor 52 . more specifically , the belt conveyor 52 runs parallel to the interior of the tray elevator 50 for the entire vertical lifting distance plus a subsequent horizontal distance which terminates at the longitudinal middle plane through the main leg 2 , exactly in a position above the box 16 which is passing along that plane . the tray elevator 50 and belt conveyor 52 are driven by a single electric motor , synchronized with the electric motors of the chains 10 , so as to ensure that when a box 16 &# 39 ; of the branch leg 4 is exactly in the longitudinal middle plane of the branch leg itself , there is a box 16 of the main leg 2 exactly above it . in addition the various electromagnets 30 which operate the segments 28 of the horizontal guides 26 , 26 &# 39 ; are connected to a computer ( not shown ) which controls the entire sorting line . the operation of the described sorting line is as follows : the already filled processing envelopes 46 reach the feed leg 48 one by one , where they undergo the conventional operations including the reading of the envelope identification data , the printing of a self - adhesive label and the application of this to the envelope . the identification data on the processing envelope , which also include data identifying its final destination , are generally contained in a number 54 written in bar code on the envelope . each envelope 46 is then fed between the trays of the elevator 50 and is raised thereby . when it reaches the upper end of the ascending vertical path and commences the horizonal path , it rests lowerly on the conveyor belts 52 , which advance synchronously with the trays 50 . on reaching the front end of said belt conveyor 52 , this no longer offers any support and the processing envelope 46 falls into a box 16 of the main leg 2 , which by virtue of the synchronization between the movement of the tray elevator 50 and the movement of the chain 10 of said main leg 2 , is correctly positioned to receive it . the envelope 46 thus inserted into the box 16 of the main leg 2 advances along this latter . assuming that the destination compartment 34 &# 39 ; pertains to the branch leg 4 , when the box 16 comes into proximity with that particular branch leg , a command is fed by the computer , which had previously memorized the identification data of that envelope and the identification data of the destination compartment , to cause the corresponding electromagnet 30 to retract the segment 28 associated with it , and consequently interrupt the horizontal guide 26 of the main leg 2 on the middle plane of the branch leg 4 . consequently when the roller 24 of the box 16 reaches this gap , it loses its support and allows the base 18 to open by gravity , so that the processing envelope 46 ( see fig1 ) falls onto the underlying box 16 &# 39 ; of the branch leg 4 , which is in an assured correct position because of the synchronization between the movements of the chains 10 of the two legs 2 and 4 . when the envelope 46 has entered the box 16 &# 39 ; of the branch leg 4 , it is carried by this box to the upper opening of that channel 38 corresponding to the destination compartment 34 &# 39 ;. here a command fed to the electromagnet 30 of that segment 28 of the guide 26a of this branch leg 4 which corresponds to that particular channel 38 &# 39 ; causes the base 18 &# 39 ; of the box 16 &# 39 ; to open and allow the processing envelope 46 to fall into said channel , at the lower end of which there has previously been placed a bag 40 or box 42 . after the box 16 of the main leg 2 or 16 &# 39 ; of the branch leg 4 has deposited the processing envelope 46 in the box 16 &# 39 ; of the branch leg 4 or in the channel 38 &# 39 ; respectively , it proceeds on its path until the end of the straight portion of the respective leg , where there is provided an inclined surface ( not shown ) against which the roller 24 , 26 &# 39 ; rests to again close the base 18 , 18 &# 39 ; of the box and arrange it to receive a new processing envelope . if the destination compartment 34 for the processing envelope 46 pertains not to the cabinet 32 &# 39 ; of a branch leg 4 but to the cabinet 32 of the main leg 2 , there will obviously be a direct transfer of the envelope 46 from the box 16 of the main leg 2 to the channel 38 of that compartment 34 . should the opening of the base 18 , 18 &# 39 ; of a box 16 , 16 &# 39 ; be impeded or should a processing envelope 46 become jammed during its travel along the channel 38 , 38 &# 39 ;, the lack of sensing by the sensor 44 results in the emission of an alarm signal to allow the supervising personnel to investigate . an analogous signal is also emitted when the container 40 or 42 is nearly full to enable the supervising personnel to replace this container with an empty one . from the aforegoing it is apparent that the sorting line according to the invention is considerably more advantageous than conventional lines , and in particular : it comprises a large number of installed compartments ; in practice for a surface area of about 140 m 2 , it is possible to install more than 1200 compartments against the approximately 500 compartments currently installable for a similar area ; it provides very high line flexibility , because of the possibility of covering any shape and size of surface ; it can be installed in an existing line with modifications and extensions of any kind and size ; it enables the entire sorting system to be totally automated , thus eliminating any manual redistribution work and also eliminating the manual sorting pigeon hole systems and the inconvenience of the space requirement and limited operability connected with them ; it provides complete protection for the processing envelopes as these are practically subjected to no handling during sorting ; it is of very safe and reliable operation and of low power consumption , being based on the simple horizontal movement of chains , electromagnetic on - off controls and opening by gravity ; it allows the capacity of each compartment to be chosen and hence the line to be adapted to the different volume requirements of the various customers ; it enables each compartment to be equipped with a space for professional material and specifically for other - format prints , or publicity material , and for stamps etc . for the subsequent despatch . | 8 |
now referring to fig1 set forth is the preferred drawing fluid reclamation process ( 10 ) having an inlet ( 12 ) shown with a 3 inch section hose and a shutoff valve ( 14 ). pressurized drilling fluid is directed through an inlet pipe ( 16 ) monitored by a pressure gauge ( 18 ) and inserted into conditioning tank ( 20 ) along a lower end ( 22 ) wherein the drilling fluid fills the conditioning container ( 20 ) on an upward flow . ultrasonic acoustic transducers ( 24 ) and ( 26 ) are depicted at different locations in the conditioning container , the ultrasonic transducers powered by a control panel ( 28 ) and monitored by a conductivity sensor ( 30 ). the ultrasonic sensors are operated by use of an air compressor ( 32 ) with pressurized air stored within a tank ( 34 ) monitored by a low pressure switch ( 36 ) and solenoid ( 38 ) for control of flow for production of the acoustic energy into the transducers ( 24 ) and ( 26 ). an ozone generator ( 40 ) is used to introduce ozone through an injector ( 42 ) in storage into an ozone contact tank ( 44 ) before introduction into the lower end ( 22 ) of the conditioning container ( 20 ) and inlet manifold ( 46 ). the preferred ultrasonic device is driven by silver braised magnetostrictive transducers , with all wetted surfaces being 316 stainless steel . the resonant frequency of the immersible is preferably between 16 khz or 20 khz . when multiple generators are used they can be synchronized to operate at a single resident frequency . the use of the immersible configuration allows placement within the conditioning container so as to allow for continuous treatment thereby placing an intense ultrasonic energy into the controlled volume of material as it passes by the multiple vibrating surfaces . by way of example , drilling fluid ( 16 ) introduced into the conditioning container is ozonated through the manifold ( 46 ) with the ozonated drilling fluid passing through the acoustic energy provided by the transducers ( 24 ) and ( 26 ) with conditioned drilling fluid removed from the conditioning container at outlet ( 48 ). a second outlet ( 50 ) is provided for removal of petroleum products such as oil that form along the surface and can be collected through the manifold ( 50 ) and directed to an oil outlet ( 52 ) for collection and disposal . the ozonated and ultrasonically treated drilling fluid that is directed through outlet ( 48 ) is placed into the inlet ( 54 ) of a centrifuge ( 56 ) which allows for solid waste removal ( 60 ). the slurry is the directed to an open container ( 62 ) for use in post treatment . post treatment is made possible by repressurization of the slurry by transfer pump ( 64 ) for introduction into a sand filter ( 66 ) at inlet ( 68 ). the sand filter permits removal of the remaining particulates into a micron level and the filtered slurry is passed through directional valve ( 70 ) to outlet ( 72 ) and introduction into parallel position activated carbon filters ( 80 ), ( 82 ) and ( 84 ). the activated carbon filters provide removal of any remaining organics as well as reduces and eliminates any excess ozone with the effluent collected by manifold ( 90 ) replacement into a clean water filter tank ( 92 ). the clean water tank is expected to have water with a specific gravity of approximately 8 . 34 making it available for environmental discharge or other uses with the utilities ( 94 ). the level float ( 96 ) provides operation of the transferred pump ( 64 ) from maintaining a level in the clean water tank for distribution to the utilities . the clean water tank further allows for use of the reclaimed water for regeneration of the activation carbon by use of transfer pump ( 96 ) wherein backwashing of the sand filter ( 66 ) and carbon filters ( 82 ) and ( 84 ) is made possible through directional valve ( 70 ), ( 81 ), ( 83 ), and ( 85 ). manifold collecting the backwashed water ( 100 ) is returned to the inlet pipe ( 16 ) for introduction in the conditioning container ( 20 ) for purposes of polishing and recycling of the fluid . the clean water tank ( 92 ) further provides ozonator makeup by use of booster pump ( 110 ) which draws from the clean water tank ( 92 ) placement into the conditioning container ( 20 ) wherein the clean water is injected with ozone as previously mentioned by injector ( 42 ) for storage and ozone contact tank ( 44 ). it should be noted that the use of drilling fluid is only an example . produced water from an oil or gas well , or even enhancement of potable water benefits from the process . now referring to fig2 set forth is a layout of a container depicting the conditioning container ( 20 ) having the ozone contact tank ( 44 ) and booster pump ( 110 ). following the conditioning container ( 20 ) the effluent is directed to the centrifuge ( 56 ) located outside of the container and placed in a water holding tank ( 62 ) not shown but also placed outside of the container . the water from the tank ( 62 ) is repressurized by booster pump ( 64 ) and directed through sand filter ( 66 ) followed by activated carbon filters ( 80 ) and ( 82 ). also placed within the shipping container ( 200 ) is the ozone generator ( 40 ) and ultrasonic generator ( 28 ). a central control panel ( 111 ) allows central control operation of all components . a repressurization pump ( 96 ) can also be placed within the container ( 200 ) for use in backwashing the activated carbon and sand filter . the conventional container has access doors on either end with a walkway ( 202 ) in a central location . the walkway allows access by either door ( 204 ) or ( 206 ). access to the activated carbon and sand filters as well as the pressurization pumps can be obtained through access doors ( 208 ) and ( 210 ). fig3 a , 3 b , and 3 c illustrate the frac water fluid treatment process . this apparatus used in this process is designed to be mounted within a standard shipping container or truck trailer such that it can be moved from location to location to treat the frac water on site . frac water enters frac water process tank 302 through inlet 304 . the effluent is removed from tank 302 by pump 306 through flow meter 308 and then through back wash filter 310 . filter 310 removes substances such as frac sands and foreign particles in the range of 25 to 50 microns . from the filter 310 , seventy percent of the effluent is saturated with ozone in ozone contact tank 316 , via line 315 , and the remaining thirty percent is introduced into main reactor tank 318 , via line 319 . reactor tank is maintained at an internal pressure greater than atmospheric . oxygen generator 312 feeds ozone generator 314 which in turn feeds into ozone contact tank 316 . line 317 feeds the effluent leaving ozone contact tank 316 to the main reactor tank 318 . the effluent from the ozone contact tank 316 is introduced through a manifold 321 within the reactor tank 318 . the manifold includes orifices designed to create hydrodynamic cavitations with the main reactor tank 318 . in addition the reactor tank 318 also includes ultrasonic transducers 322 positioned as various elevations within the reactor tank 318 . these ultrasonic transducers 322 are designed to create acoustic cavitations . aluminum sulfate from tank 326 is introduced to in line mixer 328 via line 327 . the effluent from pressurized main reactor tank 312 is carried by line 325 to in line 328 where it mixes with the aluminum sulfate . the effluent then flows through tanks 330 and 332 prior to entering disc bowl centrifuges 334 and 336 . to remove total organic carbon from the effluent it is passed through an ultraviolet light source having a wavelength 185 nm in vessel 338 . the total organic compound breaks down into co2 in the presence of hydroxyl radical present in the effluent . the effluent is then passed through three media tanks 342 each containing activated carbon . these filters will polish the effluent further and remove any leftover heavy metals . they will also break down any remaining ozone and convert it into oxygen . the effluent will then be conveyed to tank 344 prior to being introduced to micron filters 346 . each filter is capable of filtering material down to one to five microns . the effluent leaving the micron filters is then pressurized via pumps 348 prior to entering the reverse osmosis membranes 350 . each pump 348 can operate up to 1000 psi separating clean permeate and reject the brine . outlet 352 carries the concentrated waste product to be conveyed to a reject water tank for reinjection or other suitable disposal . outlet 354 carries the ro product water to be conveyed to a clean water frac tank for storage and distribution . fig4 a is a perspective side view of the containerized frac water purification apparatus with the side walls and top removed for clarity . container 400 is a standard container typically used to ship freight , and the like , by truck , rail or ship . each container will be brought to the well site by truck and installed to process the flowback frac water . the container is partitioned into two separate areas . one area includes the ozone generator 314 a main control panel 402 and an ultra sonic panel 404 . the other section includes the three media tanks 342 , the pressurized main reactor tank 318 , the air separation unit 312 , centrifuge feed pumps 333 and centrifuges 334 and 336 . fig4 b illustrates the ozone booster pump 309 , the reaction tank 330 , the air tank 313 , the air compressor and dryer 311 and the ozone booster pump 309 . fig4 c is a top view of the container 400 and shows control room 406 , and equipment room 408 . fig5 a shows a perspective view of a second container 410 that houses the reverse osmosis pumps 348 , the micron filters 346 and osmosis membrane filters 350 . fig5 b is a top view the second container that shows how the second container is partitioned into two separate areas ; an office / store room 412 and an equipment area 414 . fig6 a , 6 b , and 6 c illustrate an alternative frac water fluid treatment process . this apparatus used in this process is designed to be mounted within a truck trailer such that it can be moved from location to location to treat the frac water on site . frac water enters frac water process tank 602 through inlet 604 . the effluent is removed from tank 602 by pump 606 through flow meter 608 and then through back wash filter 610 . filter 610 removes substances such as frac sands and foreign particles in the range of 25 to 50 microns . from the filter 610 the effluent proceeds via line 615 to ozone treatment tank 616 where it is saturated with ozone . air enters compressor 613 through dryers 611 . oxygen generator 612 receives compressed air from compressor 613 and feeds ozone generator 614 which in turn feeds ozone to a high efficiency , venturi type , differential pressure injector 607 which mixes the ozone gas with the flowback water . the flowback water enters the injector at a first inlet and the passageway within the injector tapers in diameter and becomes constricted at an injection zone located adjacent the second inlet . at this point the flowback flow changes into a higher velocity jet stream . the increase in velocity through the injection zone results in a decrease in pressure thereby enabling the ozone to be drawn in through the second inlet and entrained into the flowback water . the flow path down stream of the injection zone is tapered outwards towards the injector outlet thereby reducing the velocity of the flowback water . within injector 607 ozone is injected through a venturi at vacuum of 5 inches of hg . the pressure drop across the venturi is approximately 60 psi which ensures good mixing of the ozone gas with the effluent and small ozone bubble generation . an ozone booster pump 609 feeds effluent and ozone into injector 607 . line 617 then conveys the output of ozone treatment tank 616 to an in line static mixer 628 . the inline static mixture 628 ensures that the bubbles are maintained at the 1 to 2 micron level . aluminum sulfate from tank 626 is introduced to in line static mixer 628 via line 627 . the inline static mixer 628 is comprised of a series of geometric mixing elements fixed within a pipe which uses the energy of the flow stream to create mixing between two or more fluids . the output of in line mixer 628 is then introduced into chemical mixing tank 630 . the alum is a coagulating agent with a low ph that coagulates suspended solids and also keeps iron in suspension . the output of mixing tank 630 is then conveyed via line 631 to main reactor tank 618 . the output is introduced through a manifold 621 within the main reactor tank 618 . the manifold 621 includes orifices designed to create hydrodynamic cavitations with the main reactor tank 618 . by way of example , the diameters of the holes within the manifold 621 are approximately 5 mm and the pressure difference across the manifold is approximately 20 psi . in addition , the main reactor tank 618 also includes four submersible ultrasonic transducers 622 a and 622 b positioned at various elevations within the reactor tank 618 . these ultrasonic transducers 622 a and 622 b are designed to create acoustic cavitations . each transducer includes a diaphragm that is balanced with the help of a pressure compensation system so that a maximum amount of ultrasonic energy is released into the effluent . the main reactor tank 618 includes a pair of 16 khz and a pair of 20 khz frequency ultrasonic horns ( 622 a and 622 b , respectively ). the ultrasonic horns 622 a and 622 b are installed around the periphery of the tank creating a uniform ultrasonic environment which helps to increase the mass transfer efficiency of the ozone . in addition , the 16 khz and 20 khz horns 622 a and 622 b are installed opposite to each other inside the tank to create a dual frequency filed that continuously cleans the internal tank surface . the acoustic cavitations generated by the ultrasonic generators 622 a and 622 b also greatly enhance the oxidation rate of the organic material with ozone bubbles and ensure uniform mixing of the oxidant with the effluent . as shown in fig6 a and 7 main reactor tank 618 also includes a plurality of anodes 619 within the tank that provides dc current to the effluent and thereby creates oxidants in the water . in this process the dc current drives the electro precipitation reaction for the hardness ions present in the effluent . during this treatment the positively charged cations move towards the electron emitting ( negative ) cathode which is the shell of the main reactor tank 618 . the negatively charged anions move towards the positive anodes 619 . in this process sulfate ions are fed to the cations which either form a scale or are transformed into a colloidal from and remain suspended in the effluent . some heavy metals are oxidized to an insoluble dust while others combine with sulfate or carbonate ion to make a precipitate under the influence of the electrode . the carbonate and sulfate salt precipitate on the return cathode surface . the ultrasound continuously cleans the precipitation on the return cathode surface and produces small flakes which are removed later in the process during centrifuge separation . the cations which precipitate with sulfate ions are in colloidal form have fewer tendencies to form any scaling and remain in colloidal form through out the process notwithstanding the temperature and pressure . the coagulated suspended solids are then removed in centrifuge separation later in the process . the anodes 619 are made of titanium and are provided with a coating of oxides of rh and ir to increase longevity . the anodes 619 are powered by a dc power supply whose power output can be up to 100 volts dc and up to 1000 amps current . the dc power supply can be varied according to targeted effluent . for example , for water effluent with a higher salt content the power supply output would provide less dc voltage and more dc current than water with low levels of salt . the main reactor tank 618 is maintained at an internal pressure greater than atmospheric . the effluent then flows through line 624 and into tank 632 and then through feed pump 633 into centrifuge 634 and then into intermediate process tank 636 . the effluent is then passed through three media tanks 642 each containing activated carbon . these filters will polish the effluent further and remove any leftover heavy metals . they will also break down any remaining ozone and convert it into oxygen . the effluent will then be conveyed to tank 644 prior to being introduced to micron filter 646 . the filter is capable of filtering material down to one to five microns . the effluent leaving the micron filter passes through an accumulator and is then pressurized via pump 648 prior to entering the reverse osmosis membranes 650 . the pump 648 can operate up to 1000 psi separating clean permeate and reject the brine . outlet 652 carries the concentrated waste product to be conveyed to a reject water tank for reinjection or other suitable disposal . outlet 654 carries the ro product water to be conveyed to a clean water frac tank for storage and distribution . fig8 illustrates a cut away view of a modified truck trailer 660 that is designed to transport the frac water processing equipment for the system such as the one disclosed in fig6 a - 6c . the trailer is partitioned into discrete areas . as shown , area 662 is designated as the area for the ro equipment and the centrifuge . area 664 is the area designated for the media and cartridge filters . similarly , area 666 would contain the ozone producing and treatment equipment as well as the main treatment tank . the control room is installed in compartment 668 and an electrical generator ( typically 280 kw ) is installed in compartment 670 . the equipment is assembled in a modular fashion . module 672 includes a centrifuge and ro and ancillary equipment mounted on a skid . module 674 includes the media and cartridge filters and ancillary equipment that is also mounted on a skid . a third module 676 includes the ozone producing and treatment equipment , the main treatment tank and other supporting equipment also mounted on a moveable skid . by configuring the processing equipment in a modular fashion and placing them on skids that are removable from the truck trailer the system components can be readily replaced . the ability to swap out system component modules substantially minimizes system down time and improves the ability to repair the processing equipment in a quick and efficient manner . fig9 shows data tables representing two samples of flow back water . each data table sets forth the contaminants within the flow back water prior to treatment in the main reaction tank as compared to the same contaminants subsequent to treatment in the main reaction tank . as can be seen from the tables , the main treatment tank will remove substantial amounts of contaminant from the flow back water . the theory of operation behind the main treatment is a s follows . the mass transfer of ozone in the flow back water is achieved by hydrodynamic and acoustic cavitations . in the pressurized tank the ozonated flow back water is mixed with incoming flow back water by a header having many small orifices . the phenomenon of hydrodynamic cavitations is created as the pressurized flow back water leaves the small orifices on the header . the dissolved ozone forms into millions of micro bubbles which are mixed and reacted with the incoming flow back water . as the flow back water flows upwards through the reaction tank ultrasonic transducers located around the periphery of the tank at different locations emit 16 khz and 20 khz waves in the flow back water . a sonoluminescence effect is observed due to acoustic cavitation as these ultrasonic waves propagate in the flow back water and catch the micro bubbles in the valley of the wave . sonoluminescence occurs whenever a sound wave of sufficient intensity induces a gaseous cavity within a liquid to quickly collapse . this cavity may take the form of a pre - existing bubble , or may be generated through hydrodynamic and acoustic cavitation . sonoluminescence can be made to be stable , so that a single bubble will expand and collapse over and over again in a periodic fashion , emitting a burst of light each time it collapses . a standing acoustic wave is set up within a liquid by four acoustic transducers and the bubble will sit at a pressure anti node of the standing wave . the frequencies of resonance depend on the shape and size of the container in which the bubble is contained . the light flashes from the bubbles are extremely short , between 35 and few hundred picoseconds long , with peak intensities of the order of 1 - 10 mw . the bubbles are very small when they emit light , about 1 micrometer in diameter depending on the ambient fluid , such as water , and the gas content of the bubble . single bubble sonoluminescence pulses can have very stable periods and positions . in fact , the frequency of light flashes can be more stable than the rated frequency stability of the oscillator making the sound waves driving them . however , the stability analysis of the bubble shows that the bubble itself undergoes significant geometric instabilities , due to , for example , the bjerknes forces and the rayleigh - taylor instabilities . the wavelength of emitted light is very short ; the spectrum can reach into the ultraviolet . light of shorter wavelength has higher energy , and the measured spectrum of emitted light seems to indicate a temperature in the bubble of at least 20 , 000 kelvin , up to a possible temperature in excess of one mega kelvin . the veracity of these estimates is hindered by the fact that water , for example , absorbs nearly all wavelengths below 200 nm . this has led to differing estimates on the temperature in the bubble , since they are extrapolated from the emission spectra taken during collapse , or estimated using a modified rayleigh - plesset equation . during bubble collapse , the inertia of the surrounding water causes high speed and high pressure , reaching around 10 , 000 k in the interior of the bubble , causing ionization of a small fraction of the noble gas present . the amount ionized is small enough fir the bubble to remain transparent , allowing volume emission ; surface emission would produce more intense light of longer duration , dependent on wavelength , contradicting experimental results . electrons from ionized atoms interact mainly with neutral atoms causing thermal bremsstrahlung radiation . as the ultrasonic waves hit a low energy trough , the pressure drops , allowing electrons to recombine with atoms , and light emission to cease due to this lack of free electrons . this makes for a 160 picosecond light pulse for argon , as even a small drop in temperature causes a large drop in ionization , due to the large ionization energy relative to the photon energy . by way of example , the instant invention can be used to treat produced water containing water soluble organic compounds , suspended oil droplets and suspended solids with high concentration of ozone and ultrasonic waves resulting in degrading the level of contaminants . objective : to increase the efficiency of mechanical centrifugal separation by treating effluent generated from oil drilling operation with ozone and ultrasonic waves . the main constituent of effluent is bentonite . bentonite consists predominantly of smectite minerals montmorillonite . smectite are clay minerals of size less than 2 ˜ 5 microns . mainly traces of silicon ( si ), aluminum ( al ), magnesium ( mg ), calcium ( ca ) salts found in the bentonite . the percentage of solids ( bentonite ) in effluent varies from 40 % to 60 %. also contaminants oil , grease , voc are found in the effluent . ozone 40 is introduced into the tank 20 in the form of micro bubbles which starts oxidation reactions where the organic molecules in the effluent are modified and re - arranged . the bonding between bentonite molecules with water is broken down by hydrodynamic cavitations caused by imploding micro bubbles of ozone with bentonite . the mass transfer of ozone into effluent is further enhanced by subjecting the effluent with ultrasonic submersible transducers 24 and 26 located at various elevations in the tank . the ultrasonic wave ( range from 14 khz to 20 khz ) propagates through water causing acoustic cavitations . this helps ozone to react with bentonite irrespective of temperature and ph , coverts into collided slimy sludge mass , suspended in water . the oxidation process of ozone improves color of the water from grey to white . during the process soluble organic compounds broke down into carbon dioxide and oxygen molecules . as water travels from bottom 22 to the top 23 of the tank 20 , volatile organic compounds are collected at the top of the tank , which can be drained out with the help of outlet 50 provided . main effluent is piped 48 to centrifuge where the efficiency of separation is expected to increase by 30 - 40 %. ozone 40 is introduced into the tank 20 in the form of micro bubbles which starts oxidation reactions where the organic molecules in the effluent are modified and re - arranged . the suspended solids are separated and are broken down by hydrodynamic cavitations caused by imploding micro bubbles of ozone . this helps suspended solids coagulate . the oxidation process of ozone improves the color , eliminate the odder and convert suspended solids into inert particle . the mass transfer of ozone into effluent is further enhanced by subjecting the effluent with ultrasonic submersible transducers 24 & amp ; 26 located at various elevations in the tank . greater mass transfer of ozone into effluent is achieved irrespective of temperature or ph of water . the ultrasonic wave ( range from 14 khz to 20 khz ) propagates through water causing acoustic cavitations . this helps ozone to react better separating volatile organic compounds , suspended solids from water molecule . during the process soluble organic compounds broke down into carbon dioxide and oxygen molecules . case iii : treatment of flowback or frac water with mobile equipment all of the contaminants are eliminated at various stages of the filtration system . during the pretreatment stage the frac , flowback water , is pumped through 50 micron filter 310 which includes an automatic backwash feature . this filter removes substances like frac sands , and foreign particles above 50 microns in size . approximately 70 percent of the frac water is then saturated with ozone in the ozone contact tank 316 with the remainder , approximately 30 percent , directed to the main reactor tank 318 . the effluent from the ozone contact tank 316 is introduced through a manifold 321 within the reactor tank 318 . the manifold includes orifices designed to create hydrodynamic cavitations with the main reactor tank . in addition the reactor tank 318 also includes ultrasonic transducers 322 positioned as various elevations within the reactor tank 318 . these ultrasonic transducers 322 are designed to create acoustic cavitations . the combination of both acoustical and ultrasonic cavitations causes the maximum mass transfer of ozone within the treatment tank in the shortest period of time . this process oxidizes all the heavy metals and soluble organics and disinfects the effluent . the process within the main reactor tank 318 also causes the suspended solid to coagulate thereby facilitating their separation during centrifugal separation . additionally , to coagulate all the oxidized metals and suspended solids aluminum sulfate ( alum ) is added after the main reactor tank 318 and before the centrifugal separation . all suspended solids are removed in the disc bowl centrifuge . the suspended solids are collected at the periphery of the disc bowl centrifuge 334 and intermittently during de - sludging cycles . at this point in the process the effluent is free from all suspended solids , heavy metals , and soluble organics . the effluent is then passed through an ultra - violet light 338 using 185 nm wavelength to remove all organic carbon . the total organic carbon ( toc ) is broken down into co2 in the presence of hydroxyl radical present in the affluent . the effluent is then passed through three media tanks 342 containing activated carbon . these filters serve to further polish the effluent and remove any left over heavy metals . in addition the media tanks also break down any remaining ozone and convert it into oxygen . at this stage of filtration the effluent is free from soluble and insoluble oils , heavy metals , and suspended solids . the effluent is then passed through reverse osmosis ( ro ) filtration . the ro feed pump passes the effluent through a 1 micron filter 346 which is then fed to five high pressure ro pumps . the ro pumps 348 can operate up to 1000 psi thereby separating permeate and rejecting the brine . to avoid scaling the ro membranes 350 anti - scalant material is fed into the suction inlet of the ro pump . the clean permeate has total dissolved salts in the range of 5 ˜ 50 ppm . by way of example , is the system is processing 45 , 000 ppm tds effluent the resultant tds in ro reject water will be approximately 80 , 000 ppm . it is to be understood that while certain forms of the invention is illustrated , it is not to be limited to the specific form or process herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and drawings . | 2 |
the apparatus as described herein will refer to two separate embodiments using an annular spring and a series of three inner and outer rods . the number of support rods and the various positioning thereof to achieve the desired spring effect is a matter of design choice . additionally the selection of the size of the spring and its stiffness to tune the spring to the appropriate critical frequencies is a choice of an individual designer for a specific machine . referring first to fig1 and 2 there may be seen a damper and spring shaft support assembly . shaft or journal 10 is shown in the center of the figures and is supported by bearing 14 shown as a solid fixed bearing . bearing 14 could , of couse , be a tilt shoe or other more complex bearing than the bearing shown . fluid film 12 is shown located between bearing 14 and journal 10 for supporting the journal during rotating movement . retainer 40 is in configuration and is located adjacent the exterior portion of fig2 as is the end of the turbomachine wall 60 . located in the void between the bearing and the retainer is spring 20 . spring 20 is annular in configuration and is made from any conventional spring material having an appropriate modulus of elasticity . support rods 22 , 24 , 26 are shown spaced equally about a void formed between the bearing and the spring . this void is labeled spring support cavity 18 . coacting support rods 32 , 34 , 36 are likewise shown equally spaced about the exterior surface of spring 20 to engage both spring 20 and retainer 40 . it can be observed from the figures that the outer support rods 32 , 34 and 36 are offset from the inner support rods such that the segment of spring defined between inner support rods is bisected by the outer support rod . the outer support rod is shown supported within spring support groove 41 in the retainer for securing the rod in position . additionally , grooves may be provided in the spring and the bearing for supporting the remaining rods in position . a bearing antirotation pin ( not shown ) is used to prevent rotation of the bearing and thereby to prevent rotation of the spring , retainer and the entire structure . oil inlet 52 is shown for supplying oil to squeeze film damper cavity 44 formed between the spring and the retainer . the outer support rods 32 , 34 and 36 are located within the squeeze film damper cavity . additionally oil inlet 16 is shown for supplying oil to the bearing - journal interface . fig2 is an axial , sectional view of the damper and spring shaft support assembly shown in fig1 . as may be seen in fig2 journal 10 is located at the center and supported by fluid film 12 . bearing 14 is shown supporting the fluid film . support rod 26 is shown connected between spring 20 and bearing 14 at the bottom half of fig2 . additionally oil inlet 52 is shown extending through side wall 48 to supply oil to the squeeze film damper cavity 44 . side walls 46 and 48 are shown on opposite sides of retainer 40 . o - ring seals 72 are shown for preventing fluid flow between adjacent cavities . additionally an end wall of the turbomachine referenced 60 is shown locating the turbomachine relative to the support structure . at the top portion of the view of fig2 it may be seen that there is a void between spring 20 and bearing 14 . additionally support rod 34 is shown mechanically connecting spring 20 and retainer 40 . a different embodiment of the herein invention is shown in fig3 and 4 . in this embodiment a separate spring support retainer is utilized to position the outer spring support rods and to provide a squeeze film damper cavity . otherwise the two embodiments are substantially similar . fig3 and 4 use the reference numerals of fig1 and 2 plus a one in the hundreds column to clearly point out similar components . in fig3 journal 110 is mounted for rotational movement within bearing 114 which defines a fluid film 112 therebetween . oil is supplied to form the fluid film through oil inlet 116 . mechanical spring 120 is shown having a series of inner support rods 122 , 124 , 126 located between the spring and the bearing and a series of outer support rods 132 , 134 and 136 located between the spring and spring support retainer 138 . spring support retainer 138 is annular in configuration and defines about the exterior surface thereof , a surface of a squeeze film damper cavity 144 to which oil is supplied through oil inlet 152 . retainer 40 is mounted about the squeeze film damper cavity and defines the opposite cavity surface . in addition two slots 62 are provided at the bottom of the assembly into which springs may be mounted for acting to center the entire assembly . fig4 is an axially extending sectional view of fig3 . again it may be seen that journal 110 is located in the center and supported via oil film 112 maintained between the journal and bearing 114 . located at the bottom portion of the drawing it may be seen that support rod 126 supports mechanical spring 120 from bearing 114 . additionally a spring retention cavity 139 is located between the spring and spring support retainer 138 . fluid from film damper cavity 144 is located between retainer 140 and the spring support retainer . oil inlet 152 for supplying oil to the squeeze film damper cavity is shown . at the top portion of fig4 it may be seen that there is a spring support cavity 118 between the bearing and spring 120 . between spring 120 and spring support retainer 138 is shown support rod 134 . additionally the fluid film damper cavity 144 is shown located between the spring support retainer and the retainer . the invention herein has been described with reference to a particular embodiment . it is to be understood by those skilled in the art that variations and modifications can be effected within the spirit and scope of the invention . | 5 |
the &# 34 ; process and apparatus for distributed wide range leak detection , location and alarm for pollutants &# 34 ; provides continual monitoring , direct detection and location of a wide range of all sizes of leaks , from small leaks to medium and large leaks . it provides quick detection time . it provides constant direct testing for the presence of pollutants from medium and large leaks in an uninterrupted flow of test media within one sensor tube , while concurrently and alternately performing periodic cycle testing for the presence of diffusion from medium and small leaks in the other sensor tube . the system provides continual testing of the flow of test media from one of the sensor tubes while concurrently , and alternately , continual testing for presence of small amounts of pollutants from diffusion . the subject invention uses two sensor tubes . two sensor tubes are arranged substantially parallel , along the path and in vicinity of the pipe line , tanks or fuel systems to be monitored . while one sensor tube is being continually pumped with its test media flowing past the sensing device , the other sensor is alternately lying dormant for selected periods of time , for receiving incoming diffusion of vapors from medium and low level leaks . each sensor tube is a hollow conduit , typically about one - half inch internal diameter , constructed to permit diffusion of liquid , vapors or gaseous substances to enter thereinto through the walls of the conduit . ordinary industrial conduit , such as polyvinyl chloride ( pvc ) or equivalent types well known in the industry , will be useful for this purpose and will be constructed to have openings in the walls to permit entrance of diffused gases , such as holes , slots or pores , and alternately may be of a sealed semipermeable membrane , such as ethylene vinyl acetate ( eva ) tubing . this type of membrane will allow vapors to pass through but blocks liquids . in a preferred embodiment , the sensor tube will be of a patented design constructed in three layers with a perforated inner support tube , covered by a layer of semipermeable membrane , and the two covered with an outer protective mesh sheath to inhibit physical damage to the tube . the elements of the subject invention include two sensor tubes ; a pump ; a sensor detector ; a control valve for alternately directing flow of test medium from either of the sensor tubes , and a system of instrumentation , controls and computer . the test medium in the preferred embodiment is standing air , and alternatively may be water or other inert liquid or gas to absorb vapors , gases or radiation from pollutants and convey them past a sensor for testing . the sensor detector is sensitive to the presence of pollutants that may be found in the test medium . the pump is used to displace and move the test medium through the sensor tubes ; and past the sensor detector . fig1 shows two sensor tubes 1 and 2 located along the path of the pipeline 3 to be monitored . the pump 4 and sensors 5 will be typically located at one end . although not essential , an intake filter and dryer 6 may be installed to prevent the entrance of moisture or other contaminants into the test medium . fig2 is a functional diagram of two sensor tubes 1 and 2 located along pipe line 3 , with pump 4 and sensor detector 5 located at one end , and with dryers 6 located at intakes of sensor tubes 1 and 2 . test medium 7 is contained within sensor tubes 1 and 2 . control valve 8 is shown for alternate , sequential direction of flow from , either one of the sensor tubes i and 2 to the sensor 5 . a small leak 9 and a small leak 10 are shown in the pipe line 3 , emitting gas , vapors or radiation from escaping pollutants . fig3 shows construction of a preferred embodiment of the sensor tube hollow conduit 16 , of a patented design , using semipermeable membrane 14 which allows vapors to pass through the walls and into the conduit but blocks liquids . the inner tube 12 , with perforations 13 in the walls thereof , is a hollow , perforated conduit 12 which transports the vapors of the suspected pollutant to the sensor detector after they pass through the membrane 14 . the outer layer 15 of the patented sensor tube 16 is a protective woven mesh sheath whose sole purpose is to protect the thin outer membrane . fig4 shows a typical application of the invention as installed in the field along a length of pipeline , tanks or other type of pollution source to be monitored . typically , a pipeline application will be in extended lengths of many miles or more , and a system to monitor the entire length will require installation of a number of units of this invention , shoulder to shoulder , to provide continual coverage along the path . while this invention may be constructed and operated in units of various lengths , the practical length will be determined by required response time and rate of flow of the test medium . while one of the dual sensor tubes is in constant , uninterrupted flow for immediate detection of medium and larger leaks , the other sensor tube is alternately lying dormant to allow diffusion of medium to small leaks , and is then cyclically pumped past the sensor detector for testing . the length of time to pump the test medium from the dormant sensor tube past the sensor detector will be determined by the length of the tube and rate of flow . thus the length of a unit of this invention for installation in the field will be designed to achieve desired maximum response time . in a preferred embodiment , a practical flow velocity of air as test medium has been found to be pumped at a velocity in the range of 2 . 7 to 3 . 0 feet per second . with nominal flow velocity of 2 . 7 feet per second , and recommended detection time of 30 minutes per cycle , the optimum length of installed sensor conduit between the intake filter and the pump / sensor detector unit will be less than 4 , 000 feet . thus , a pipeline of ten miles in length will normally require installation of approximately thirteen to fourteen systems or modules of this invention . thus , in fig4 typical units of this invention are shown installed , shoulder to shoulder , in lengths of approximately 4 , 000 feet each between the intake filter units 17 and the pump / sensor detector 18 . it will be seen that for a pipeline of ten miles length , i . e . 52 , 800 feet in length , 13 . 2 units of this invention will be required for coverage of the pipeline . fig5 shows a diagram of a typical detector sensor control unit for this invention . the detector sensor control unit as shown in fig5 contains the vacuum pump 59 , solenoid valve 53 , flow controller 58 , and sensor gas detectors 56 and 57 needed to analyze the contents of the two sensor tubes , lines i and 2 . in fig5 the pump 59 works under vacuum to draw the air , and alternatively any other suitable test medium , past the sensor detectors 56 and 57 . the flow control device 58 is used to maintain a constant flow rate through the system . a computer 62 is used to operate the electronic controls of the detector sensor unit and to gather , analyze and record data from each of the tests during the continual , on - going testing operations . the detector sensor control unit is enclosed and secured to a mounting skid , and opens up to the operator . a positive ventilation system in the enclosure , not shown here , runs continually to cool the vacuum pump 59 and other heat generating devices in the unit . in fig5 air test medium , from each of the sensor tubes lines i and 2 , as controlled by three - way select valve 53 , is ;/ alternately pulled into the system by the vacuum pump 59 . a filter 54 , as shown in fig5 is a conventional in - line air filter that is not necessary for this invention but is typically used here to remove any small dust particles or moisture that may have been trapped in the line . the air test medium first goes through a flash arrestor 51 , and then to a safety solenoid valve 52 that is normally closed . this valve 52 is open whenever the pump is running and closes if power is lost or the pump 59 is shut off . the three - way select solenoid valve 53 is used to select which of the two dual sensor lines 1 and 2 are to be used at any one time . from this valve 53 , the suction line goes through a line filter 54 , not necessary to this invention , to a vacuum switch gauge 55 used to monitor the operation of the system . from here the line goes to sensors 56 and 57 which are used to detect various specific substances or groups of substances . the number of required sensors is dependent upon the variety of substances to be detected at a specific type of application . from there the flow goes to the flow controller 58 , and finally to the vacuum side of the pump 59 . the exhaust port from the vacuum pump 59 then goes through another flash arrestor 60 , and out the side of the enclosure through a muffler not shown here . in fig5 the outputs of the flow controller 58 and the two sensor detectors 56 and 57 are analog inputs into the control computer 62 through any required sensor amplifiers 61 . the computer controller 62 analyzes the outputs from the sensor detectors 56 and 57 and compares them to pre - determined values that would be consistent with a leak in the pipeline . if the output signals exceed these values , an alarm condition will occur and the proper indicator / alarm relay will be closed . in fig6 it will be seen that , at time &# 34 ; 0 &# 34 ;, aspiration of previously dormant line # 1 begins . during the period 1a the contents of the line # 1 is passed by the sensor detector . as previously explained in fig5 please recall that this time interval for sensing the column of test medium located in line # 1 is dependent on the length of sensor line conduit installed and the rate of flow of the test medium . at the beginning of time 2a the test medium in the now active sensor tube # 1 is now tested for traces of any detectable substances . this continues to the end of 2a . time 3a is the total length of time during which conduit line # 1 is aspirated typically 12 hours , as explained in the sequence of operations below . at the end of time period 2a / 3a the selector valve is actuated and sequence b for aspiration of line # 2 begins at the beginning of 1b / 3b . the period 1b is the same as was test 1a . this duplicates the period 3a , for line # 2 . at the end of 2b / 3b the selector valve is reactivated , and the sequence of tests begins on line # 1 starting at point 1c / 3c . in fig6 during each of the 20 minute periods of 1 , i . e . 1a , 1b , and 1c , which is dependant on the line length and flow rate , the output of the detector / sensor is tested for the presence or any concentration of substances ; and the output contents of the sensor conduit have been examined and recorded in the control computer , based on the detector output and time of aspiration . fig7 shows detector output vs . time . the changes in output represent concentrations of detectable substances . these may be naturally occurring in origin , such as , for example , the presence of low levels of swamp gas or other ambient , local chemical , gas or radiation characteristics . on the first test of sensor line conduit # 1 , the test results are compared to a preset alarm level . the contents of the sensor line conduit on the first test does not represent the normal background . the second test on the sensor line conduit does represent normal background , and thus a &# 34 ; snapshot &# 34 ;/ recording of the results of test # 2 is made in computer memory , for comparison with operational tests . this snapshot recording becomes the master data used for comparison tests . in fig8 after recording the test results of test # 3 on the sensor line conduit # 1 , the results of test # 2 are compared to test # 3 . if the variance of the results exceed a limit , the computer recognizes a problem and causes an alarm to be given . each subsequent test of this sensor line conduit is compared in the same manner . in fig9 an excessive variance alarm condition is detected . the variance of this test &# 34 ; x &# 34 ; has exceeded the selected limit at a point in time . this point is equal in length from time point 0 based on : total test time divided by length of installed sensor line conduit . this produces the flow velocity . if the time to the variance is multiplied by this value , the location of the variance can be determined . using this method , very small occurrences of any detectable substance can be detected and located with reasonable accuracy . the second testing mode begins at the end of time period &# 34 ; a &# 34 ;. the contents of the sensor line conduit has been aspirated . the contents of the conduit now contains a new source of test medium that replaced the original . detection of low levels of substance requires longer diffusion periods . the recorded output of the sensor / detector remains at a constant background level . if an increase in the concentration of substance occurs in the medium under test , the output change is stored in computer memory . if this change from the value just previously recorded ( 1 minute data sample interval ) exceeds a preset limit , an internal alarm in the computer occurs . if in each of 4 subsequent tests , this level is also increased an external alarm occurs . normal operating value is seen in fig . # 10 , sample # 1 . an alarm condition is indicated by the result of sensor detector output of fig1 , sample # 2 . spacing of components of the sensor conduit , sensor detector and pump systems is determined by required speed of detection time and the flow rate of test medium . a normal flow velocity of 2 . 7 ft / sec and a required detection time of 30 minutes requires distance of installed sensor conduit between pump and filter to be less than 4000 ft . the present invention operates in two distinct modes ; each providing a different level of leak detection . the detection of small leaks requires a longer time for the small amounts of detectable vapor to diffuse and become trapped inside the sensor tube , sometimes called low level leak detection . the sensor line sits long enough for the vapors from the leak to reach a concentration level that can be detected by the combustible gas detector . the second mode , emergency response mode , is used to detect larger leaks as quickly as possible after the leak has occurred . larger leaks provide a source of gas vapors in a high concentration surrounding the sensor tube . after a short period of time , the gas vapors begin to saturate the sensor tube . in this mode , the tube is continually being pumped and the gas is continuously being tested for content of combustible gas and hydrogen sulfide . detection is determined by a rise in the normal background level of these materials . these changes are detected by both sensors , with the hydrogen sulfide detector taking 3 to 5 minutes longer . the dual action system combines the function of both detection techniques to give a wide range of operation . this is accomplished by using two separate sensor tubes buried together along the pipeline and by alternately pumping one tube while the other sits ( diffusing possible leak vapors ). every 12 hours ( or other interval ) later , lines are switched and the pump begins pumping the tube that was being allowed to diffuse . during the time it takes to pump one continuous length of the tube , the air inside the sensor tube is tested for low level leaks . after this time period , the air inside the tube has been replaced by clean air brought in through the dryer on the other end of the line . this is when the emergency response mode begins and continues until the sensor line is switched to the alternate line . each line goes through four steps of operation . first , it is in the low level leak mode when the air is sampled for any vapors that diffused through the tube while it was not being pumped . second , when the end of the air column inside the sensor tube is reached , the emergency response mode begins . third , the sensor line is switched to the alternate tube . following the change , the sensor tube is in a condition of relaxation . during this time the vacuum in the sensor tube is allowed to reach equilibrium with the normal outside air pressure . this return to zero vacuum can take as long as the time it took to move the entire contents of the tube . once stable , the last step or the diffusion mode of the sensor line begins and continues until the next time the sensor tubes alternate . the basic control logic of this dual system is that at any given time , one tube will be in the low - level and high - level mode , and the other tube will be in the dormant mode for receiving diffusion . the tubes are switched between the modes at a user - defined interval , typically required by environmental authorities to be 12 hours , controlled by a microprocessor - controlled solenoid valve . this enables the system to detect extremely small leaks over an extended detection period like the original system , yet also provide continuous monitoring and immediate alarming for relatively larger leaks . extremely small leaks cannot be detected in the high - level mode because of the dilution caused by the moving air in the tubing . as each analog sample is received , it is compared to an historical standard sample that defines the characteristics of the sample vapor over that length of the tube . if the new sample deviates from the historical sample by more than a user - defined amount , a leak alarm is generated in the form of a digital output . additionally , if a low air velocity of approximately 3 fps is maintained and the length of the buried sensor tube is known , small leaks can be detected and located . once the air is evacuated from the length of the tube , the control logic switches to the high - level leak detection mode as the pump continues to operate on the same tube . the analog inputs are averaged for a user - defined time period , usually 1 minute and compared for a deviation from the previous time period average . if the new value deviates from the previous average by more than the alarm limit and continues to ramp up at this rate for a selected consecutive number of times , usually five , a leak alarm is generated in the form of a digital output . this high - level mode runs continuously for the selected diffusion time ( 12 hr ) and then switches to the other tube and the sequence begins again . it should be explained and understood that the technique of this invention will work with excellent results for the detection of a number of substances , oil , gas , hydrogen sulfide , other hydrocarbons , nuclear radiation , and the like . it is not necessary that the test medium contained in the sensor conduit be air or any other particular gas . it could be distilled water or some solvent . liquid substances will likewise diffuse into other liquids and alternate test medium , which may require other type of detectors and fluid handler / pumps to be used . experimental tests with preferred embodiment has been underground and with gas vapors . it can be expected to work as well with liquids , above and below the water table , beneath rivers and reservoirs , as well as above ground . it is intended and understood that , while this application has described primarily the preferred embodiment , the techniques of this invention will work equally well and provide equivalent results on equivalent embodiments . | 6 |
the disclosed protocol architecture provides the capability of allowing the print controller to execute the installation commands after correctly receiving the file . unlike most popular file transfer protocols , the disclosed system update protocol is not limited to a single underlying transport . it is designed to run on , for example , tcp / ip ( transmission control protocol / internet protocol — a microsoft ® protocol suite ) and ipx / spx ( internet packet exchange / sequenced packet exchange — a novell ® communication protocol ). thus a client user may choose either transport protocol allowing the server program running on the print controller the capability of responding . the protocol consists of a reduced set of commands . the one or more target files are packed ( i . e ., compressed into a single large file ) into a packed file , and a signature is prepended to the packed file for security reasons . the packed file may be optionally encrypted with a special agreed - upon key for added security . referring now to fig1 there is illustrated a client / server protocol exchange flow diagram of the protocol . the horizontal lines between a client program flow diagram 100 and server program flow diagram 102 denote the direction and type of content of the network packets exchanged between the client program on a client and server program on the print controller ( also denoted as a peripheral output device ), while the vertical lines between the blocks of a flow diagram denote the flow of control . the disclosed protocol consists of the following commands : send , to transfer a chunk of the target file ; sendend , to signal the end of transferring ; action , to instruct the server what to do with the file ; status , to check the status of the action ; and statusreply , to return the status of the transfer or action . the server program 102 running on the printer controller is responsible for servicing these commands . the client program 100 running on a workstation ( or client ) is the driver of a task , i . e ., the client controls the processes on the printer controller . flow begins in a function block 104 where the client program 100 first “ packs ” all of the appropriate files into a single packed file , which single packed file includes a file header that contains a special signature recognized only by the printer controller ( i . e ., server program ) and trusted client programs . the signature may be encrypted by a variable key ( e . g ., based upon file size ) so that it cannot simply be copied to another file header . the client program 100 also appends a checksum to the end of the packed file . thus the integrity of the packed file can be ascertained by checking both the unique signature and the checksum . the server program 102 is currently in a “ listen ” mode , as indicated in a function block 106 , awaiting incoming commands from a client . flow is then to a function block 108 where the client program 100 performs a connect function by initiating a synchronization ( i . e ., also denoted as “ synch ”) operation over a flow line 110 to the function block 106 of the server program 102 in order to establish a reliable connection to the printer controller . the server program 102 responds with synch commands over a flow line 112 to the function block 108 . on the server side , two listening sockets will be opened ; one for tcp / ip traffic , and another for ipx / spx traffic . flow in the client program 100 is then to a function block 114 where the packed file is transmitted to the printer controller through a sequence of send commands . the client program 100 then issues the sequence of send commands to the server program 102 , as indicated by a signal flow line 116 to a function block 118 , to transfer the packed file to the printer controller . flow in the server program 102 is to the function block 118 where the send commands are received , and the received file segments associated with the sequence of the send commands are written as a single data file set . once the end of the file transfer from the client program 100 is reached , flow in the client program 100 is to a function block 120 where the client program 100 transmits a sendend command to the server program 102 , as indicated by a signal flow line 122 to a function block 124 . flow in the server program 102 is to the function block 124 where after the last file segment has been received , and the server program 102 closes the data file . when the server program 102 receives sendend command , it will have received the entire file . flow in the client program 100 is then to a function block 126 where the client program 100 queries the server program 102 for the status of the file transmission by sending the status command , as indicated by a signal flow line 128 to a function block 130 . flow in the server program 102 is to the function block 130 where the data file is unpacked , and a “ sanity ” check is performed to determine if the file was correctly transmitted , i . e ., by authenticating the signature , recalculating the checksum , etc . while the sanity check is being performed , flow in the server program 102 is to a function block 132 where the printer controller sends back a “ processing ” reply signal to the client program 100 , as indicated by a signal flow line 134 to a function block 136 . in the server program 102 , flow continues to a decision block 138 to determine if the received packed file passed the sanity check . if not , flow is out the “ n ” path to a function block 140 , where the packed file is deleted . flow then loops back to the input of the function block 118 to receive the next retransmission of the packed file . the server program 102 also signals the client program 100 in the reply signal of packed file failing the sanity check ( i . e ., a “ corrupted ” file ). flow in the client program 100 is to the function block 136 where the status reply is received . the client program 100 then interrogates the received status reply signal , as indicated in a decision block 142 . if the reply signal indicates that the server program 102 is in a state of “ processing ,” flow is out the “ p ” path back to the input of the function block 126 to continue querying the server program 102 . alternatively , if the reply signal indicates a “ failed ” or “ bad ” sanity check , flow is out the “ b ” path of decision block 142 back to the input of function block 114 where the client program 100 resends the packed file to the server program 102 in the sequence of send commands . if the sanity check by the server program 102 is “ ok ”, the reply signal to the function block 136 of the client program 100 indicates the same , and flow is out the “ o ” path of the decision block 142 to a function block 144 where the client program 100 sends an action command to the server program 102 instructing the server program 102 to unpack the file set and reconstruct the directory structure associated therewith . ( of course , to facilitate this directory structuring , the printer controller includes a readable storage medium , e . g ., hard disk drive , or a sufficient amount of ram memory to accommodate the unpacked files .) this is indicated by a signal flow line 146 from the function block 144 of the client program 100 to a function block 148 of the server program 102 . the action instructions can further include the actions of “ controller software update ,” “ run ,” or “ configure .” flow in the server program 102 is to the function block 148 where the action signal is received and processed . flow in the server program 102 is to a function block 150 where the received action is performed . the “ controller software update ” action initiates a predefined installation process in the printer controller to upgrade the existing software . for software installed utilizing the “ run ” command , the packed file includes at least one executable file . the “ run ” action simply causes execution of the one or more executable files of the unpacked file set , which is suitable for installing patches for a single module . the “ configure ” action initiates a special operating system process , e . g ., a system command associated with regedit , to add / change some system parameters of the printer controller , as specified in the unpacked file set . the client program 100 may optionally check the execution status of the action in the server program 102 . thus flow is to a function block 152 of the client program 100 where a status signal is transmitted to the server program 102 , as indicated by a signal flow line 154 from the function block 152 to the function block 150 . if the server program 102 is in the state of executing the action instruction , flow is to a function block 156 where the server program 102 transmits a “ processing ” reply signal to the client program 100 , as indicated by a reply signal flow line 158 to a status function block 160 of the client program 100 . note that where the print controller is undergoing an update , the processing time may take longer . after completion of the action instruction , the server program 102 may need to be rebooted . thus flow is to a decision block 162 to determine if the server program 102 needs to be rebooted , in accordance with the particular action instruction . if not , flow is out the “ n ” path of decision block 162 to a continue terminal 164 of the server , and therefrom signaling an “ ok ” status across a signal line 166 to the status function block 160 of the client program 100 to indicate that the action has been completed without a reboot . when a reboot is required , flow is out the “ y ” path of decision block 162 of the server program 102 to a function block 168 to terminate the connection to the client program 100 during the rebooting process . a “ reset ” signal is then transmitted from the server program 102 to the status function block 160 of the client program 100 , as indicated by a signal flow line 170 to the status function block 160 . flow is then to a reboot terminal 172 where the server program is rebooted to implement the software updates . note that the connection between the client and server will not automatically restore after the printer controller restarts . the client program 100 then takes the appropriate action in response to the signals received into the status function block 160 . thus flow is to a decision block 174 where the client program 100 interrogates the status signals received from the server program 102 . if the status is “ processing ,” flow is out the “ p ” path back to the input of the function block 152 to continue querying the server program 102 . if the status is either “ ok ” or “ reset ,” flow is out the “ o ” path to a continue terminal 176 of the client . the details of continue terminal 176 of the client are not shown in fig1 . the client program 100 may choose to start another transfer on the same connection , i . e ., the process associated with a new sequence of send commands in the function block 114 , or disconnect from the server program 102 ( printer controller ) and start a new connection to another printer controller . the details of the continue terminal 164 on the server side are not shown in fig1 . the server program 102 ( printer controller ) will delete the received file and go back to wait for a new sequence of send commands , as associated with function block 118 . if the connection is terminated by the client , the controller will return to the listening mode associated with function block 102 , to wait for a new connection . the disclosed protocol works well for a special - purpose printer controller running on top of the operating system having networking support . a general - purpose file transfer protocol ( e . g ., ftp ( file transfer protocol )) does not fit the need of issuing specialized commands . the berkeley socket interface can be used to implement both the client program 100 and server program 102 . except for the status command , all the other commands do not require an explicit acknowledgment - type of reply from the server . the underlying transport will ensure the correct delivery of the data . referring now to fig2 there is illustrated a block diagram of client / server system utilizing the disclosed protocol architecture . a client computer 200 is disposed on a network 202 , e . g ., a lan , wan , etc ., in communication with a first network peripheral output device 204 , which in this particular embodiment is a printer controller . note that the first network peripheral output device 204 is not restricted to a printer controller , but can be a variety of network - based equipment suitably configured to execute the disclosed protocol architecture , for example , a multi - function output device ( that includes capabilities of faxing , scanning , printing , etc .). the client computer 200 includes the client protocol program 100 , and the first peripheral output device 204 includes the server program 102 . both of the client and server protocol programs ( 100 and 102 ) can be implemented in firmware ( e . g ., eeprom ) in either or both of the client computer 200 and the first peripheral output device 204 . as indicated hereinabove , the first peripheral output device 204 opens two listening sockets to accommodate either or both tcp / ip traffic and ipx / spx traffic communicated across the network 202 . thus if the client computer 200 sends only ipx / spx traffic on the relatively local network 202 , the first peripheral output device 204 can communicate with the client computer 200 to receive the updated software , and execute the disclosed protocol to facilitate the installation of the software and ascertain the status of the updating process on the first peripheral output device 204 . it is appreciated that networks can extend great distances utilizing a global communication network ( gcn ) 206 , e . g ., the internet , over which communication is facilitated utilizing the tcp / ip protocol suite . thus a second peripheral output device 208 disposed on the gcn 206 and executing the disclosed server protocol 102 will also open the two listening sockets to accommodate either or both tcp / ip traffic and ipx / spx traffic communicated across the gcn 206 . thus the client computer 200 can be used to upload software to the second peripheral output device 208 , and monitor the software installation process . although the preferred embodiment has been described in detail , it should be understood that various changes , substitutions , and alterations can be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 6 |
fig1 shows and describes the guiding sleeve unit 1 for the guidance of telescoping cylindrical parts of a chair column . the chair column consists of a gas spring 8 whose downwardly directed piston rod 8 - 2 is axially fastened in a bottom portion of a base tube 9 but is movable in circumferential direction . at the upper end , the base tube 9 is provided with the guiding sleeve unit 1 ; the guiding sleeve unit 1 consists of one main sleeve body 2 and two guiding sleeve bodies 3a and 3b . the cylindrical outer face 10 of the gas spring cylinder 8 - 1 makes a sliding movement when the gas spring 8 is vertically adjusted or when it is elastically compressed . it is , as shown in fig1 easily possible to seccessively arrange a plurality of guiding sleeve bodies within the main sleeve body 2 . the main sleeve body 2 has in its two terminal portions recesses 5a and 5b into which projections 4a and 4b of the guiding sleeve bodies 3a and 3b engage . by means of the projections 4a , 4b and the recesses 5a , 5b , an axially coherent guiding sleeve unit 1 is obtained which cannot be disassembled after the mounting of the gas spring 8 ; in this guiding sleeve unit , the guiding sleeve bodies 3a , 3b are undetachably held in the main sleeve body 2 . fig2 to 4 show a guiding sleeve body 3a as a component part . in fig2 a plurality of projections 4a are peripherally distributed . as seen in fig2 and 4 , the projections may be arranged pairwise adjacent each other . fig3 shows the sloped face 6a which serves as entry help for the axial insertion into the main sleeve body 2 of fig1 the face 7 which is approximately perpendicular to the axis x serves to achieve axial lock when the recesses 5a in the main sleeve body 2 have been reached and the projections 4a have thereafter come to engagement . the rectangularly extending face 7 engages either behind a counterface of the main sleeve body 2 or of the flanged end portion of the base tube 9 so that disassembling or loosening of the guiding sleeve body 3 is not possible when the gas spring 8 is in the assembled state . fig5 to 8 show the main sleeve body 2 . the terminal portions of this main sleeve body 2 are provided with recesses 5a and 5b which correspond to the projections 4a of the guiding sleeve body 3a and the projections 4b of the guiding sleeve body 3b . although the main sleeve body 2 may be of uniform wall thickness over its entire circumference , except for the recesses described below , it is desirable , as in the embodiment shown in fig5 to 8 , for the main sleeve body 2 to include an inner sleeve portion and several circumferentially spaced apart ribs that extend radially out from and longitudinally along further details can be seen from fig9 and 11 in which the main sleeve body and the guiding sleeve bodies are shown in more detail . from fig9 one can see that the main sleeve body 102 comprises a radially inner shell 102 - 1 and a radially outer shell 102 - 2 . the shell 102 - 1 extends along the total axial length of the guiding sleeve unit 1 as shown in fig1 . the radially outer shell 102 - 2 extends only over an upper part of the guiding sleeve unit 1 as shown in fig1 and 8 . the radially inner shell 102 - 1 and the radially outer shell 102 - 2 are interconnected by ribs 102 - 3 which are substantially parallel to planes containing the axis x . the radially outer edges 102 - 4 of the ribs 102 - 3 are flush with the radially outer surface 102 - 5 of the shell 102 - 2 . the radially outer edges 102 - 4 of the ribs 102 - 3 and the radially outer surface 102 - 5 of the radially outer shell 102 - 2 are in centering contact with the radially inner circumferential surface 9 - 1 of the base tube 9 as shown in fig1 . at the upper end of the main sleeve body 102 the radially inner shell 102 - 1 and the radially outer shell 102 - 2 are bridged by an integral terminal ring 102 - 6 , which abuts by a face 102 - 14 the upper end of the base tube 9 . one can further see in fig9 an upper guiding sleeve body 103a . this upper guiding sleeve body 103a comprises a guiding tube 103al which is provided with radial projections 104a : the radial projections 104a are shaped for engagement into recesses 105a . these recesses 105a are provided in the radially inner shell 102 - 1 and in the terminal ring 102 - 6 of the main sleeve body 102 . the projections 104a are substantially u - shaped as shown in fig1 with two legs 104a - 1 and a middle portion 104a - 2 . the legs 104a - 1 are provided with sloped faces 106a . at the upper ends of the sloped faces 106a there are provided shoulder faces 107 . the upper guiding sleeve body 103a is inserted into the main sleeve body 102 in axial direction x from above with the projections 104a being angularly positioned such as to find into the respective recesses 105a . the sloped faces 106a are during this axial approach engaged with the edges 102 - 7 of the recesses 105a , which edges 102 - 7 are provided by the terminal ring 102 - 6 . when the guiding sleeve body 103a achieves its operational position with respect to the main sleeve body 102 as shown in fig1 , the shoulder face 107 snaps below the lower face 102 - 8 of the terminal ring 102 - 6 . the guiding sleeve body 103a is locked against upward movement with respect to the main sleeve body 102 . until this snapping effect occurs , either the sloped faces 106 are resiliently deflected in radially inward direction or the edges 102 - 7 are resiliently deflected in radially outward direction . when the shoulder face 107 is in contact with the lower face 102 - 8 of the terminal ring 102 - 6 , the lower ends 104a - 3 of the projection 104a are simultaneously in axial abutment with the lower edges 105a - 1 of the recesses 105a provided by the radially inner shell 102 - 1 . thus , the guiding sleeve body 103a is fixed in both axial directions along the axis x against axial movement . simultaneously , the guiding sleeve body 103a is prevented from rotation with respect to the main sleeve body 102 . one can see from fig9 and 11 that the geometrical shapes of the main sleeve body 102 and the guiding sleeve body 103a are simple shapes . this is particularly true for the guiding sleeve body 103a . it is therefore easy to manufacture the guiding sleeve body 103a with precise shaping which does not require a post - calibration after the guiding sleeve body 103a has been inserted and snapped into the main sleeve body 102 . in fig1 , one recognizes again the inner shell 102 - 1 of the main sleeve body 102 and the ribs 102 - 3 integrally moulded together with the inner shell 102 - 1 . one can further see that the ribs 102 - 3 are provided at their lower ends with sloped edge portions 102 - 9 which facilitate the insertion of the main sleeve body 102 into the base tube which is shown in fig1 at 9 . one can further recognize in fig1 the lower or second guiding sleeve body 103b which is inserted into the main sleeve body 102 by axial movement from below along the axis x . in fig1 , there is shown -- as in fig9 -- in the right half the guiding sleeve body 103b in engagement with the inner shell 102 - 1 , whereas in the left half of fig1 the shell 102 - 1 has been moved to the left for illustration purposes . one recognizes in fig1 that the lower guiding sleeve body 103b has a cylindrical guiding tube member 103b - 1 with integral radial projections 104b . these projections 104b are inserted into the recesses 105b provided at the lower end of the inner shell 102 - 1 of the main sleeve body 102 . between subsequent recesses 105b of the inner shell 102 - 1 the inner shell 102 - 1 is provided with conically sloped faces 102 - 11 . when the lower guiding sleeve body 103b is inserted into the lower end of the main sleeve body 102 , the projections 104b are angularly oriented such that they find into the recesses 105b . the projections 104b are provided with sloped faces 106b which facilitate the insertion of the guiding sleeve body 103b into the main sleeve body 102 . when the guiding sleeve body 103b is inserted from below into the main sleeve body 102 , the cylindrical guiding tube 103b - 1 engages the conically sloped face 102 - 11 which facilitates the introduction of the upper edge 103b - 3 of the guiding tube 103b - 1 . the conically sloped face segments 102 - 11 are elastically deflected in radially outward direction . only when the guiding sleeve body 103b has reached its operational position with respect to the main sleeve body 102 , the lower edge 103b - 2 of the guiding tube 103b - 1 snaps behind the shoulder face 102 - 12 so that the guiding sleeve body 103b is secured in downward direction with respect to the main sleeve body 102 . simultaneously , the upper end 104b - 3 of the projection 104b abuttingly engages the bottom edge 105b - 1 of the recess 105b such that the guiding sleeve body 103b is axially secured in both axial directions with respect to the main sleeve body 102 . simultaneously , the guiding sleeve body 103b is angularly secured with respect to the main sleeve body 102 by the engagement of the projection 104b into the recesses 105b . when both guiding sleeve bodies 103a and 103b have been inserted into the main sleeve body 102 , the guiding sleeve unit is completely preassembled and can be inserted into the base tube 9 as shown in fig1 . after insertion of the guiding sleeve unit 1 into the base tube 9 , the guiding sleeve bodies 103a and 103b are non - releasably fixed with respect to the main sleeve body 102 by contact of the main sleeve body 102 with the inner surface 9 - 3 of the base tube 9 . the guiding sleeve unit can be fixed as shown in fig1 with respect to the base tube 9 by a screw or bolt 20 . thereafter , the gas spring 8 can be inserted into the base tube 9 . the cylinder 8 - 1 of the gas spring 8 is now guided by its external cylindrical surface 10 at the upper end of the base tube 9 by the guiding sleeve unit 1 . the lower end of the piston rod 8 - 2 is rotatably supported by a ball bearing 21 on a support bottom 22 of the base tube 9 . the base tube 9 is provided with a conical section 9 - 1 for being fixed in a conical hole of a chair &# 39 ; s bottom plate or bottom cross . the cylinder 8 - 1 or a protection tube surrounding the cylinder is provided with a conical upper end 8 - 3 on which a seat plate may be secured . a control element 8 - 4 extends beyond the upper end of the cylinder 8 - 1 . this control element 8 - 4 can be moved downwards for permitting axial movement of the cylinder 8 - 1 with respect to the piston rod 8 - 2 as described in u . s . pat . no . 4 , 848 , 524 . after releasing the control element 8 - 4 , the desired length is selected and fixed . the gas spring 8 and the seat plate ( not shown ) fixed thereto can , however , rotate with respect to the base tube 9 . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the inventive principles , it will be understood that the invention may be embodied otherwise without departing from such principles . | 0 |
in accordance to the objects , the present invention provides a compound named 3s , 3ar , 7ar - 6 - isopropyl - 1 , 1 , 3 , 3a - tetramethyl - 1 , 3 , 3 , 9 , 4 , 7 , 7a - hexahydroisobenzofuran of formula ( 1 ). an embodiment of the present invention provides a compound having following characteristics : infrared : 2964 , 1377 , 1184 , 950 , 808 , 777 cm − 1 . [ 0020 ] 1 h nmr ( cdcl 3 ): δ 5 . 36 ( 1h , d , j = 6 . 12 hz ); 3 . 55 ( 1h , q , j = 7 . 2 hz ); 2 . 26 ( 1h , m ); 1 . 24 ( 3h , s ); 1 . 16 ( 3h , s ); 0 . 77 ( 3h , s ); 1 . 03 ( 6h , d , j = 7 . 92 hz ); 1 . 13 ( 3h , d , j = 7 . 2 hz ); 1 . 9 , 1 . 72 , 1 . 89 , 1 . 75 . [ 0021 ] 13 c nmr : 78 . 7 ; 81 . 2 ; 42 . 7 ; 37 . 7 ; 117 . 0 ; 143 . 4 ; 23 . 9 ; 54 . 3 ; 14 . 4 ; 12 . 6 ; 24 . 8 ; 30 . 6 ; 35 . 2 ; 21 . 4 ; 21 . 9 ppm . ms : 222 ( 14 ), 207 ( 30 ), 178 ( 14 ), 163 ( 32 ), 149 ( 10 ), 135 ( 75 ), 93 ( 100 ), 79 ( 18 ) still another embodiment of the present invention provides a compound having isobenzofuran ring responsible for olfactory characteristics . yet another embodiment of the present invention provides a compound used in fine perfumery , colognes , hygiene products , batch gels , hair care products , deodorants , air - freshener and cosmetic preparation . another embodiment of the present invention provides a compound as a single or as a mixture of isomers that can be used to impart fragrance to consumer products . still another embodiment of the present invention provides a process for the preparation of compound ( 1 ), the said process comprising steps of : a ) dissolving elemol in glacial acetic acid to obtain a solution , b ) adding perchloric acid to the step ( a ) solution at a temperature range of 20 to 30 ° c . to obtain a reaction mixture , c ) stirring the reaction mixture of step ( b ) at an ambient temperature for a period of 60 h to 80h , d ) diluting with water the reaction mixture of step ( d ) extracting with the aqueous solution an organic solvent , separating the organic and the aqueous layer , e ) washing the organic layer of step ( d ) with aqueous sodium bicarbonate followed by water , f ) drying the washed organic layer over anhydrous sodium sulphate , filtering , and removing the solvent from the filtrate to obtain crude product , and g ) purifying the crude product of step ( f ) over silica gel column eluting with a mixture of organic solvent to obtain the compound of formula ( 1 ). still another embodiment of the present invention provides a process , wherein in step ( b ), the peracid used is selected from a group consisting of peracetic acid , perchloric acid or perbenzoic acid . yet another embodiment of the present invention provides a process , wherein in step ( d ) the organic solvent used is selected from diethylether , methylene , chloride , chloroform or ethylacetate . still another embodiment of the present invention provides a process , wherein in step ( g ) the mixture of organic solvent used is ethylacetate petroleum ether ( 4 : 96 ). yet another embodiment of the present invention provides a process having isobenzofuran ring responsible for olfactory characteristics . still another embodiment of the present invention provides a process wherein the compound is used in fine perfumery , colognes , hygeine products , batch gels , hair care products , deodorants , air freshness or cosmetic preparation . this compound can be used as an additive and when used in the applications , the products accepted to the users and it has not shown any adverse effect . yet another embodiment of the present invention provides a synergistic composition containing an effective amount of compound ( i ) or mixture of its isomers , the said composition being useful in perfuming the soaps , shower or bath gels , hygiene products , hair care products such as shampoos , body deodorants , air fresheners or cosmetic preparation . still another embodiment of the present invention provides a composition that can be used alone or in combination with other perfuming agents , solvents or additives . yet another embodiment of the present invention provides a composition , wherein the mixture of isomers of compound ( i ) in the ratio 75 : 25 is a multiodorant being a combination of rhubarb , laurel , thyme and florex . the invention is illustrated with references to the examples , which should not be construed to limit the scope of the present invention . to a solution of elemol ( 3 . 5 - gm ) in glacial acetic acid ( 42 ml ) was added perchloric acid ( 0 . 7 ml , 60 %). the reaction mixture was allowed to stand at room temperature ( 25 - 27 ° c .) for 72 hours with continuous stirring , the reaction product was diluted with water and extracted with ether . the ethereal extract washed with sodium bicarbonate , then with water and dried over anhydrous sodium sulfate . removal of the solvent gave a crude product containing , besides elemenes ( major product of the reaction ) all the stereoisomers of sesquiterpene oxide . the preferred compound is a major component of the stereoisomeric mixture . the crude product was flash column chromatographed over silica gel with ethyl acetate in petroleum ether ( 4 : 96 ) to yield the preferred compound . rf of the compound in the same solvent system as the eluent is 0 . 6 . yield : 0 . 28 g . [ 0049 ] 1 h nmr ( cdcl 3 ): δ 5 . 36 ( 1h , d , j = 6 . 12 hz ); 3 . 55 ( 1h , q , j = 7 . 2 hz ); 2 . 26 ( 1h , m ); 1 . 24 ( 3h , s ); 1 . 16 ( 3h , s ); 0 . 77 ( 3h , s ); 1 . 03 ( 6h , d , j = 7 . 92 hz ); 1 . 13 ( 3h , d , j = 7 . 2 hz ); 1 . 9 , 1 . 72 , 1 . 89 , 1 . 75 . [ 0050 ] 13 c nmr : 78 . 7 ; 81 . 2 ; 42 . 7 ; 37 . 7 ; 117 . 0 ; 143 . 4 ; 23 . 9 ; 54 . 3 ; 14 . 4 ; 12 . 6 ; 24 . 8 ; 30 . 6 ; 35 . 2 ; 21 . 4 ; 21 . 9 ppm . ms : 222 ( 14 ), 207 ( 30 ), 178 ( 14 ), 163 ( 32 ), 149 ( 10 ), 135 ( 75 ), 93 ( 100 ), 79 ( 18 ) 2 . it is multi - odorant with the tonalities of rhubarb , laurel , thyme and florex . 3 . this compound can be used as an additive and when used in the applications , the products accepted to the users and it has not shown any adverse effect . | 2 |
a mixing device according to the invention is generally indicated in the drawing by 1 . this mixing device 1 has a mixing container 2 which is provided on the upper side with a container opening 3 which can be sealed with a container lid 4 , where in the case of the working example the container lid 4 can be screwed on ; a screw thread is indicated by 5 . as alternatives to the screw connection , a plug connection or a snap - action latch may also be provided . in the region of the container opening 3 , an insert 6 is placed on the container 2 ; this is curved out like a citrus press into the receiving chamber 7 of the container . this insert 6 can be removed from the container opening in order to fill the receiving chamber of the container 7 , then it can be replaced and then remains firmly positioned after the container lid 4 has been screwed on . the mixing device 1 designed in this way serves to receive a product 9 contained in a film sachet 8 which is soluble in a liquid solvent , said product preferably being a bleaching powder . besides the film sachet 8 filled with the product 9 , a liquid solvent which is able to dissolve the film sachet 8 is introduced into the receiving chamber 7 with an opened mixing container 2 . this liquid solvent is , for example , a hydrogen peroxide solution . this is introduced from a receiving container which is not shown into the receiving chamber 7 of the mixing container 2 . moreover , a further component , for example a bleaching cream , can also additionally be introduced from a likewise not shown further receiving container into the receiving chamber 7 . the citrus press - like insert 6 is then placed onto the container opening 3 and the container opening 3 is closed with the lid 4 . if the mixing device 1 is now shaken by the user , the film sachet 8 automatically comes into contact with the citrus press - like insert 6 and in so doing becomes mechanically strained to such an extent that it tears , at least in places . the pulverulent product 9 can then escape directly from the film sachet and mix with the liquid , the fill level for which in the resting state is indicated by 10 . as a result , the rate of the mixing operation is increased significantly , and , moreover , as a result of the comminution or disruption of the film sachet 8 , the latter can also be dissolved more quickly by the liquid solvent . after an adequate mixing time , which depends on the products to be mixed , the mixing container 2 is opened again by removing the lid 4 . the insert 6 is then removed and the finished product can be taken out . the embodiment according to fig2 differs from that according to fig1 only by virtue of a differently designed insert 6 ′. this insert 6 ′ is constructed like a sieve plate and is provided with tapered pins 11 pointing into the receiving chamber 7 . upon shaking the mixing device , the pins 11 penetrate into at least some areas of the film sachet 8 and lead to its partial destruction , meaning that the pulverulent product 9 can escape easily and mix with the liquid solvent . the invention is of course not limited to the working examples shown . further configurations are possible without departing from the basic concept . for example , instead of the inserts shown , it is also possible for other internal inserts to be provided for the mechanical action on the film sachet in the receiving chamber ; these may also be arranged in a fixed manner within the receiving chamber . furthermore , an additional liquid - tight cover can also be attached above the inserts which prevents liquid passing into the space above the inserts during the mixing operation . this cover is then removed together with the inserts when the mixing operation is complete . alternatively , it is to be provided that the insert and the lid consist of a single element , which can be produced , for example , in an injection molding process . as design simplest for the user , such a single - part design is also firmly attached to a seal configured as a sealing ring . in this simplest case , the closure required for using the mixing container requires only a single hand grip . moreover , the film sachet can be under superatmospheric pressure , which also informs the user acoustically of the destruction as a result of the mechanical strain by the internal inserts . after the expected pop , it can be assumed that the sachet is torn at least in some areas , and thus the contained product is ready for the mixing operation . in a further advantageous case , the product contained in the film sachet is a cosmetic preparation and the two together form a cosmetic portion . a portion according to the invention comprising a bleaching powder with the composition given in table 1 was prepared . square mean value for the roughness : 30 μm average thickness of the film : 20 μm film material : partially hydrolyzed polyvinyl acetate with a degree of hydrolysis of 96 %; cast film ; average molecular weight : 36 000 g / mol the outer and inner surfaces of the polymer film have a three - dimensional structure with a square - shaped pattern . the pattern is formed by a grid with square indentations , meaning that the grid lines are formed by the edges of the indentations . the depth of the indentation is 0 . 12 mm . the embossed squares have a diameter of 0 . 6 mm . the portion according to the invention comprises 25 g of the abovementioned bleaching powder . the portion was subsequently dissolved in a hydrogen peroxide dispersion with a composition according to table 2 , at 20 ° c . : it has been found that the portion according to the invention dissolves about 5 times as quickly as the portions known from the prior art with coating materials made of smooth water - soluble films of comparable thicknesses . the portion according to the invention is contained in a kit together with the following constituents : a ) a mixing device c ) a plastic bottle containing a hydrogen peroxide dispersion according to table 2 d ) a conditioner both components ( 1 and 2 ) were heated to 80 ° c . with stirring . at this temperature , clear , low - viscosity liquids formed in both cases which , upon cooling to room temperature , thickened to give clear , medium - viscosity gels . 0 . 75 g of dimethylaminobenzaldehyde 1 . 2 g of methocel ® e4m and 0 . 5 g of arginine 0 . 85 g of 1 , 2 - dihydro - 1 , 3 , 4 , 6 - tetramethyl - 2 - oxopyridinium chloride and 3 . 6 g of a c 8 - c 10 - fatty alcohol mixture liquid at room temperature ( 20 ° c .) cremophor rh 40 : castor oil , hydrogenated with 40 - 45 ethylene oxide units ( inci name : peg - 40 hydrogenated castor oil ) ( basf ) rheopearl ® kl : dextrin palmitate ex miyoshi kasei cetiol ® b : di - n - butyl adipate dehydol ® ls 3 : lauryl alcohol - 3 eo ex cognis methocel ® e 4 m : hydroxypropylmethylcellulose to prepare a portion according to the invention , component 1 and component 2 were in each case introduced separately into a water - soluble film sachet which has the specification as in example 1 , and then thermally sealed to be liquid - tight . portion 1 comprising component 1 and portion 2 comprising component 2 were stirred into 80 ml of water at 40 ° c . this gave a readily flowable emulsion . a hair tress ( kerling natural white ) colored with this formulation in the weight ratio 4 : 1 for 30 minutes at 32 ° c . was nuanced an intense magenta color . the gel was prepared as described in example 2 at 80 ° c . and cooling to room temperature . 1 . 2 g of tetraaminopyrimidine sulfate and 0 . 6 g of methylresorcinol and 2 g of sodium carbonate and 3 g of trisodium phosphate were homogeneously dispersed into the gel with the composition given in table 4 . the gel was introduced into a film sachet with the coating material specified in example 1 and sealed to be liquid - tight analogously to example 2 . a 5 g portion was prepared which was mixed with 20 g of a commercial 6 % strength developer emulsion ( poly color cream hair color ) and 20 g of a 2 % strength natrosol 250 hr swelling in which 0 . 5 g of ammonium sulfate were dissolved , at room temperature ( 20 ° c .). this emulsion was used to dye a blond hair tress ( kerling natural white ) ( 30 minutes , 32 ° c .). the nuancing of the tress was a luminous red . natrosol 250 hr : hydroxyethylcellulose ex aqualon viscosity ( 1 % in h 2 o ): 1 . 5 - 2 . 5 pas ( 20 ° c .) viscosity ( 2 % in h 2 o ): 30 pas ( 20 ° c .) the constituents of component 1 were heated to 80 ° c . 0 . 6 g of n - allylisatin was dissolved in the hot mixture . then , with stirring , the mixture was cooled to room temperature . the formulation was packaged in a tubular sachet as in example 2 . after dissolving the portion in component 2 , the coloring of a blond hair tress ( kerling natural white , 30 minutes , 32 ° c .) was carried out . the color of the tress was titian red . | 1 |
noncontact tonometers in preferred embodiments according to the present invention will be described hereinafter with reference to the accompanying drawings . referring to fig4 a noncontact tonometer in a first embodiment according to the present invention comprises , as principal components , a placido &# 39 ; s ring pattern projecting system ( light pattern projecting system ) 10 , an observation optical system 20 , an air jetting system ( air blowing means ) 30 , an xy alignment light projecting optical system 40 , an xy alignment detecting optical system 50 , a working distance measuring system 60 , a control system 100 and a display 200 . referring to fig4 the placido &# 39 ; s ring pattern projecting system 10 projects a light pattern consisting of a plurality of concentric rings on the cornea c of the eye e . the placido &# 39 ; s ring pattern projecting system 10 comprises a plurality of light - emitting diodes 11 arranged on concentric circles as shown in fig5 and a diffusing plate 12 provided with a ring pattern consisting of a plurality of concentric rings as shown in fig6 . the placido &# 39 ; s ring pattern projecting system 10 may be similar in configuration to a placido &# 39 ; s pattern projecting system disclosed in jp - a no . 8 - 275920 . in fig6 indicated at a1 to a6 are optically transparent parts and at b1 to b6 are optically opaque parts . the observation optical system 20 is used for observing the anterior segment of the eye e , and observing and recording an image of a placido &# 39 ; s ring . the observation optical system 20 comprises an objective lens 21 , a telecentric diaphragm 22 , an image forming lens 23 and a ccd ( light receiving means ) 24 . the optical axis o of the observation optical system 20 passes the center o &# 39 ; of the pattern of the plurality of rings of the placido &# 39 ; s ring pattern projecting system 10 . the ccd 24 is disposed so as to be optically conjugate with the focal plane of the cornea c of the eye e disposed at a proper working distance w with respect to the objective lens 21 and the image forming lens 23 . illuminating light beams projected by the placido &# 39 ; s ring pattern projecting system 10 are reflected by the cornea c , and a virtual image of the placido &# 39 ; s ring is formed near the focal plane f of the cornea c . since the observation optical system 20 is telecentric with respect to the side of the object , the image of the placido &# 39 ; s ring is formed on the ccd 24 in the same size even if the actual working distance is slightly different from the proper working distance w . the air jetting system 30 jets an air pulse whose pressure to the eye e varies in proportion to time . the air jetting system 30 comprises a cylinder 31 , a piston 32 , a solenoid 33 for driving the piston 32 and an orifice pipe 34 . as shown in fig4 the orifice pipe 34 has one end part penetrating a central part of the objective lens 21 and the other end part connected to a closed end of the cylinder 31 . the piston 32 is driven to compress air in the cylinder 31 , and compressed air is jetted toward the cornea c of the eye e . the present invention measures intraocular tension on the basis of a change in the shape of the image of the placido &# 39 ; s ring before and after an air pulse is begun to be jetted against the cornea c . therefore the applanation of the eye e is unnecessary , and the intensity of the air pulse may be lower than that of an air pulse used in a conventional noncontact tonometer . for example , an air pulse of 5 mmhg in peak pressure is sufficient for measurement . a conventional noncontact tonometer needs an air pulse of about 15 mmhg in peak pressure . the xy alignment light projection optical system 40 projects a position indicating light beam on the eye e to examine the position of the eye e relative to the optical axis o with respect to vertical direction ( direction along the y - axis ), and horizontal direction ( direction along the x - axis ). the xy alignment light projecting optical system 40 comprises a light source 41 , a pinhole plate 42 , a collimator lens 43 , a semitransparent mirror 44 and the objective lens 21 . the pinhole plate 42 is disposed at the front focal point of the collimator lens 43 . a position indicating light beam , i . e ., a beam of parallel light beams , is projected through the objective lens 21 on the eye e . the xy alignment detecting optical system 50 detects the positional relation between the eye e and the optical axis o with respect to directions along the x - axis and the y - axis . the xy alignment detecting optical system 50 comprises the objective lens 21 , the image forming lens 23 , a semitransparent mirror 51 and a light receiving device 52 . the light receiving device 52 is a photodiode capable of measuring the intensity of incident light . the photodiode receives the alignment index light beam projected by the xy alignment light projecting optical system 40 and reflected by the cornea c , and determines the position of the eye e relative to the optical axis o with respect to directions along the x - axis and the y - axis on the basis of the intensity of the incident light . the light receiving device 52 may be a psd ( position sensitive device ) capable of determining the centroid of the intensity of the incident light . the working distance measuring system 60 comprises a light source 61 , a slit plate 62 , a collimator lens 63 , a condenser lens 64 and a light receiving device 65 . light emitted by the light source 61 travels through the slit of the slit plate 62 and is collimated by the collimator lens 63 in a collimated working distance measuring light beam . the working distance measuring light beam falls obliquely on the eye e . the working distance measuring light beam reflected by the cornea c of the eye e travels through the condenser lens 64 and falls on the light receiving device 65 . the light receiving device 65 is , for example , a line sensor capable of supplying a position signal corresponding to the position of the light beams thereon . the light receiving device 65 supplies a signal corresponding to the distance of the eye e from the objective lens 21 . a position on the light receiving device 65 at which the working distance measuring light beam reflected from the cornea c falls corresponds to the distance between the cornea c and the objective lens 21 . the control system 100 comprises an arithmetic and control circuit 101 , an a / d converter 102 and a memory 103 . a detection signal supplied by the light receiving device 52 is given to the arithmetic and control circuit 101 . the solenoid 33 is controlled for operation by the arithmetic and control circuit 101 . the arithmetic and control circuit 101 transfers image data obtained by the a / d conversion of information about an image of the placido &# 39 ; s ring provided by the ccd 24 by the a / d converter 102 to the memory 103 at predetermined time . for example , first image data transfer operation for transferring image data is executed at time t1 between time t0 when an alignment completion signal is supplied and time t2 when an air jetting operation is started . a second image data transfer operation is executed at time t3 before time t4 when the pressure of an air pulse reaches the maximum and t seconds after the time t2 as shown in fig7 . image data thus transferred thereto is stored in the memory 103 . the degree of deformation of the cornea c at time t seconds after the time t2 when the air jetting operation is started when the intraocular tension is 10 mmhg and that of the same at time t seconds after the time t2 when the air jetting operation is started when the intraocular tension is 15 mmhg are greatly different from each other . fig8 shows a conceptional illustration of the deformation of the cornea c . in fig8 a curve ( 1 ) represents a degree of deformation of the cornea c at time t seconds after the start of the air jetting operation for jetting an air pulse of 5 mmhg in pressure when the intraocular tension is 10 mmhg , and a curve ( 2 ) represents a degree of deformation of the cornea c at time t seconds after the start of the air jetting operation for jetting an air pulse of 5 mmhg in pressure when the intraocular tension is 15 mmhg . as is obvious from fig8 the higher the intraocular tension , the more difficult is the cornea c to be depressed . therefore , the higher the intraocular tension , the less is the deformation of the ring pattern formed on the cornea c . accordingly , the intraocular tension of the eye e can be determined through the analysis of the deformation of the ring pattern . the memory 103 stores reference image data on the images of the placido &# 39 ; s ring pattern formed when an air pulse of 5 mmhg in peak pressure ( hereinafter referred to as &# 34 ; 5 mmhg air pulse &# 34 ;) is jetted against eyes respectively having known intraocular tensions . fig9 ( a ) to 9 ( i ) show reference image data on images of the placido &# 39 ; s ring pattern when an 5 mmhg air pulse is jetted against eyes respectively having intraocular tensions of 10 + i mmhg ( i = 1 , 2 , 3 , . . . and 10 ) by way of example . the arithmetic and control circuit 101 compares measured image data with the reference image data , and selects a reference image data most analogous with the measured image data . an intraocular tension corresponding to the selected reference image data is displayed on the display 200 . the arithmetic and control circuit 101 , the ccd 24 and the air jetting system ( air blowing means ) 30 constitute a cornea deformation measuring means . a light source , not shown , for illuminating the anterior segment of the eye e is turned on to illuminate the anterior segment of the eye e . a reflected light beam reflected from the anterior segment of the eye e travels through the objective 21 , the semitransparent mirror 44 , the telecentric diaphragm 22 , the image forming lens 23 and the semitransparent mirror 51 and fall on the ccd 24 . thus , an image of the anterior segment of the eye e is formed on the ccd 24 and the ccd 24 supplies an image signal . the image signal is transferred through the a / d converter 102 and the arithmetic and control circuit 101 to the display 200 . the display 200 displays the image of the anterior segment of the eye e . the light source 41 for xy alignment and the light source 61 for working distance measurement are turned on . xy alignment light emitted by the light source 41 travels through the semitransparent mirror 44 and the objective lens 21 , falls on the eye e , and is reflected by the cornea c of the eye e . the reflected xy alignment light travels through the objective lens 21 , the semitransparent mirror 44 , the telecentric diaphragm 22 , the image forming lens 23 and the semitransparent 51 and falls on the light receiving device 52 . working distance measuring light emitted by the light source 61 travels through the slit of the slit plate 62 , and is collimated by the collimator lens 63 in a collimated slit beam . the collimated slit beam falls on the cornea c of the eye e , is reflected by the cornea c , and the reflected collimated slit beam travels through the condenser lens 64 and falls on the light receiving device 65 . image signals supplied by the light receiving devices 52 and 65 are given to the arithmetic and control circuit 101 . the arithmetic and control circuit 101 makes the display 200 superpose a bright spot , not shown , on the image of the anterior segment displayed on the display 200 at a position represented by the image signal provided by the light receiving device 52 . a joystick , not shown , is operated for motions in directions along the x - axis and the y - axis to make the bright spot displayed on the display 200 coincide with the optical axis o of the noncontact tonometer . the joystick is operated for fore - and - aft motion to measure working distance w , i . e ., the distance between the objective lens 21 and a top point of the cornea c , by the agency of the light receiving device 52 and the arithmetic and control circuit 101 to position the cornea c properly with respect to directions along the optical axis of the noncontact tonometer ( z - axis ). xy alignment using the bright spot and working distance adjustment using the output signal of the light receiving device 65 can be achieved by the generally known methods and hence further description thereof will be omitted . upon the detection of the alignment of the noncontact tonometer with the top part of the cornea c on the basis of the output signals of the light receiving devices 52 and 65 at time t0 , i . e ., when an alignment completion signal is supplied at time t0 , the arithmetic and control circuit 101 drives multiple light - emitting diodes 11 to be turned on . light beams emitted by the light - emitting diodes 11 travel through the optically transparent parts of the ring pattern and fall on the cornea c of the eye e . reflected light beams reflected from the cornea c travel through the objective lens 21 , the semitransparent mirror 44 , the telecentric diaphragm 22 , the image forming lens 23 and the semitransparent mirror 51 , and fall on the ccd 24 . the image of the anterior segment of the eye e and an image of the ring pattern are formed on the ccd 24 . an image signal supplied by the ccd 24 is transferred through the a / d converter 102 to the arithmetic and control circuit 101 . the arithmetic and control circuit 101 stores sample image data on the images of the anterior segment of the eye e and the ring pattern sampled in a period between time t1 and time t2 when an operation for blowing an air pulse against the cornea c is started as first image data in the memory 103 . the arithmetic and control circuit 101 starts compressing air contained in the cylinder 31 at the time t2 by actuating the solenoid 33 to drive the piston 32 . the air pressure ap in the cylinder 31 increases substantially in proportion to time as shown in fig7 and reaches a peak of 5 mmhg at time t4 . the arithmetic and control circuit 101 samples image data on the images of the anterior segment of the eye e and the ring pattern , which are input from the ccd 24 , at time t3 t seconds after the time t2 when the operation for blowing an air pulse against the cornea c is started , and slightly before the time t4 and transfers the sampled image data as second image data to store the data in the memory 103 . after the second image data on the images of the anterior segment of the eye e and the ring pattern are thus stored in the memory 103 , the arithmetic and control circuit 101 compares the data on the ring pattern with the reference data on ring patterns as shown in fig9 ( a ), 9 ( b ), 9 ( c ) and 9 ( i ) for pattern matching . the arithmetic and control circuit 101 selects one of the reference data representing a ring pattern that is the most analogous with the ring pattern and makes the display 200 display an intraocular tension corresponding to the selected reference data . for example , the arithmetic and control circuit 101 makes the display 200 display information indicating that the intraocular tension of the eye e is 10 mmhg , 15 mmhg or p mmhg if the image of the ring pattern represented by the second image data stored in the memory 103 coincides with the image of the ring pattern shown in fig9 ( a ), fig9 ( b ) or fig9 ( i ). the arithmetic and control circuit 101 calculates the radius of curvature of the cornea c on the basis of the image of the ring pattern represented by the first image data stored in the memory 103 , and uses the results of calculation for correcting the intraocular tension determined by pattern matching . a ring pattern of a single ring or a pattern similar to a bar code may be used instead of the ring pattern consisting of the plurality of concentric rings . the noncontact tonometer in the first embodiment measures the deformation of the cornea c of the eye e by the foregoing method comprising projecting the light pattern on the anterior segment of the eye e by the placido &# 39 ; s ring pattern projecting system on the eye e , blowing an air pulse against the cornea c , and measuring the deformed light pattern represented by reflected light . the deformation of the cornea c may be measured by any suitable method other than the foregoing method . for example , a change in the shape of a section of the cornea of the eye caused by blowing air against the cornea may be measured by an optical system based on scheinplug &# 39 ; s principle . a noncontact tonometer in the second embodiment is not provided with any components corresponding to the placido &# 39 ; s ring pattern projecting system 10 and the telecentric diaphragm 22 shown in fig4 . as shown in fig1 , the noncontact tonometer in the second embodiment comprises a slit illuminating system 70 and a anterior segment section photographing system 80 . a section of the cornea c of the eye e is photographed by the slit illuminating system 70 and the anterior segment section photographing system 80 . the noncontact tonometer measures a change in the shape of a section of the cornea c caused by air blown against the cornea c by photographing the section of the cornea c by the slit illuminating system 70 and the anterior segment section photographing system 80 before and after blowing air against the cornea c . the slit illuminating system 70 shapes illuminating light emitted by an infrared light source 71 by a slit formed in a slit plate 72 in a slit light beam , collimates the slit light beam by a collimator lens 73 , and projects the collimated light beam through a semitransparent mirror 74 and 44 and an objective lens 21 on the cornea c . the anterior segment section photographing system 80 receives through an image forming lens 81 the slit light beam projected by the slit illuminating system 70 and reflected from the cornea c by an infrared - sensitive area ccd 82 ( image sensing means ). the ccd 82 has a light receiving surface inclined to the optical axis os of the image forming lens 81 . in this embodiment , the inclination of the surface of the ccd 82 to the optical axis os is 45 °. the slit plate 72 , the image forming lens 81 and the ccd 82 are disposed so that an extension of an optical section of an image of the slit of the slit plate 72 , the principal plane s1 of the image forming lens 81 and an extension s2 of the image forming surface 82a of the ccd 82 meet each other on a single line of intersection . a memory 103 stores reference image data on the images of the placido &# 39 ; s ring pattern formed when an air pulse of 5 mmhg in peak pressure ( hereinafter referred to as &# 34 ; 5 mmhg air pulse &# 34 ;) is jetted against eyes respectively having known intraocular tensions . for example , sectional shape data , not shown , on the shapes of sections of corneas when an 5 mmhg air pulse is jetted against eyes respectively having intraocular tensions of 10 + i mmhg ( i = 1 , 2 , 3 , . . . and 10 ) is stored in the memory 103 . when photographing a section of the cornea c , the noncontact tonometer is aligned with the cornea c with respect to directions along the x - axis and the y - axis . the noncontact tonometer is positioned roughly relative to the cornea c with respect to directions along the z - axis with reference to images displayed on a display 200 . an arithmetic and control circuit 101 turns on an illuminating light source 71 to project the slit light beam on the cornea c . after the noncontact tonometer has been aligned with the cornea c , the arithmetic and control circuit 101 forms an image of a section of the cornea c on the area ccd 82 in a period between time t1 and time t2 ( fig7 ) when an air jetting operation is started . an image signal supplied by the area ccd 82 , i . e ., first image data , is transferred through the arithmetic and control circuit 101 and stored in the memory 103 . the arithmetic and control circuit 101 starts compressing air contained in a cylinder 31 at the time t2 ( fig7 ) by actuating a solenoid 33 to drive a piston 32 . the air pressure ap in the cylinder 31 increases substantially in proportion to time as shown in fig7 and reaches a peak of 5 mmhg at time t4 . the arithmetic and control circuit 101 makes the area ccd 82 form a section of the cornea c at time t3 t seconds after the time t2 when the operation for blowing an air pulse against the cornea c is started , and slightly before the time t4 when the pressure of an air pulse reaches the maximum . then , an image signal supplied by the area ccd 82 is transferred through the arithmetic and control circuit 101 and is stored as second image data in the memory 103 stores . subsequently , the arithmetic and control circuit 101 makes the display 200 display superposed images of the sectional shapes of the cornea c represented by the first image data and the second image data stored in the memory 103 . the arithmetic and control circuit 101 reads sequentially the reference data stored in the memory 103 , compares the images of the sectional shapes of the cornea c represented by the first and the second image data with the reference data . the arithmetic and control circuit 101 selects one of the reference data representing a reference sectional shape that is the most analogous with the sectional shape , and makes the display 200 display an intraocular tension corresponding to the selected reference data . although the invention has been described in its preferred form with a certain degree of particularity , obviously many changes and variations are possible therein . it is therefore to be understood that the present invention may be practiced otherwise than as specifically described herein without departing from the scope and spirit thereof . | 0 |
an event - driven content playback system 10 according to the present invention is schematically illustrated in fig1 . the playback system 10 is installed in a vehicle 12 having vehicle systems 14 , which may include a remote keyless entry ( rke )/ vehicle security system 16 and other vehicle sensors 20 . the rke / vehicle security system 16 may include sensors 17 and actuators 19 for door lock , primary door unlock , all doors unlock , trunk release , panic and remote start , for example . the sensors 20 include any other vehicle sensors whose output may or could generate a warning or indication to a person . the sensors 20 may include low gas warning , low oil pressure warning , low windshield washer fluid warning , seatbelt ( s ) not connected warning , engine problem warning , brake problem warning , airbag problem warning , anti - lock - brake system problem warning , low battery warning , high temperature warning , door ajar warning , trunk ajar warning , hood ajar warning , etc . the playback system 10 further includes a control unit 24 with an interface to the vehicle event system triggers 30 . the control unit 24 interfaces with the vehicle event system trigger 30 to read the signal sent from the vehicle to the specific vehicle event . for example , the control unit 24 intercepts the signal from the vehicle to the door locks to unlock the doors , whether the signal is originated from the rke / ss system or from within the car . as a result the control unit 24 utilizes the vehicle signal and does not require a separate signal to initiate the content playback . the control unit 24 is connected to the vehicle 12 through communication hardware 38 , such as wired and wireless communication hardware , for example , rf , bluetooth , ieee 802 . 11 , usb port , removable media reader , etc . the communication hardware 38 is preferably a wired connection to reduce possible interference . the communication hardware 38 may include wiring to attach to each vehicle system 14 to intercept the system trigger 30 . the system 10 also includes content playback hardware 32 , such as a decoder , amplifier , etc . and a transducer , such as a speaker . the content playback hardware 32 may be arranged such that the user may hear and / or see the content from within the vehicle 12 or from the vehicle 12 exterior , or both . for example , the content playback hardware 32 could include a speaker 34 located within the engine compartment of the vehicle 12 resulting in a user from the exterior of the vehicle 12 being able to hear the content playback . additionally , the content playback hardware 32 can also include a speaker 34 within the passenger compartment allowing the user within the vehicle 12 to hear the content playback . depending on the vehicle function 52 triggered , the control unit 24 may send a signal to either or both of the speakers 34 . alternately , the playback system 10 may be connected through an interface 26 to the content playback hardware 32 , such as the vehicle speakers or lighting , not requiring separate units . the system 10 includes two interfitting portions , a cradle 28 and a core 18 . the cradle substantially 28 includes the interfaces 26 , 30 and may be mounted within the vehicle 12 . the cradle 28 is preferably mounted under the dash of the vehicle 12 or in another easily accessible position . the core 18 is removably connected to the cradle 28 and includes the communication hardware 38 , the content playback hardware 32 , software 40 and storage 42 . alternatively , the content playback hardware 32 could be on the cradle 28 . the core 18 is used to transfer content 50 to the vehicle 12 and to playback content 50 in the vehicle 12 . the software 40 and storage 42 are used for storing programs , algorithms , and other information needed to operate the playback system 10 . the storage 42 may be a hard drive , ram or other memory or digital storage , storing content 50 and associating them with vehicle functions 52 . in the example described here , the content 50 are audio files , such as mp3s , wav , or other complex sound clips , which may be compressed . the control unit 24 is configured to play back the stored content 50 in the event of a set of predefined vehicle functions 52 . upon detecting the occurrence of a vehicle function 52 , the control unit 24 references the storage 42 to obtain the assigned content 50 for the vehicle function 52 . the content 50 plays back through content playback hardware 32 . each vehicle function 52 may be assigned specific content 50 that is pre - selected by the user . for example , different content 50 may be selected for locking the vehicles doors , unlocking the vehicle doors , opening the vehicle trunk , etc . fig2 illustrates one example for distributing the content 50 to the vehicle 12 . a provided software application runs on a computer 56 . the computer 56 includes a display 58 , mouse and keyboard or other input devices 60 . the control unit 24 is connected to the computer 56 through the core 18 , which may be removed from the vehicle 12 . the core 18 includes means for connecting to the computer 56 , such as a usb port or wireless connection , such as bluetooth or wi - fi . in this embodiment , the system 10 can be configured to automatically initiate a data transfer upon connection of the control unit 24 to the computer 56 or allow the user to press a synchronize button on the control unit 24 to transfer the data . the software application permits a user to select content 50 and assign the content 50 to various vehicle functions 52 . the software provides a user - friendly interface to associate content 50 to a vehicle function 52 and an option to preview the content 50 prior to assigning it to a given vehicle function 52 . content 50 may take many forms including but not limited to audio clips , video clips , ring tones , maps , documents etc . and from any source . for example , the user can choose a music clip or a ring - tone to play when he or she triggers the door unlock . another example , the user can choose a music clip or ring tone to play when he / she triggers the trunk unlock . each event may be assigned unique content 50 if desired . the software stores the content 50 in the storage 42 ( shown in fig1 ) on the core 18 . the control unit 24 is then disconnected from the computer 56 and connected to the vehicle 12 by inserting the core 18 into a cradle 28 which is mounted in the vehicle 12 . the cradle 28 includes a plurality of wires 29 that are connected to various wires in the vehicle to monitor desired vehicle functions . in this case , when an event is detected by the control unit 24 for which content is to be played , the control unit 24 accesses the storage 42 to retrieve and playback the content 50 . as can be seen in fig2 , the core 18 includes an override button 63 for selectively temporarily or permanently disabling playback . the override button 63 may occur for a temporary period of time , or pre - determined number of signals sent to the given vehicle function , or permanently until the override button 63 is pressed again . in this manner the user may prevent content playback that may be heard by others at inappropriate times or locations . for example , the user may choose to override the selected content 50 , such as a music clip , playing for the door lock or unlock function prior to attending a funeral . in one embodiment , pressing the override button 63 once disables playback for one hour , twice disables playback for 24 hours , three times disables playback until the override button 63 is pressed a fourth time . the override button 63 may be luminous so that it can remain solid ( on ), flash slowly ( one hour delay ), quickly ( 24 - hour delay ) or off ( disabled ). one way of connecting one of the wires 29 to associate it with one or two vehicle functions 52 ( depending upon the vehicle 12 ) is shown in fig2 a . the wire 29 is connected to a wire 89 between the rke unit 16 and the door lock module 90 . if a relay 92 is needed , the wire 29 is connected between the relay 92 and the door lock module 90 . when the rke unit 16 activates the lock module 90 to lock , e . g . when the rke unit 16 connects wire 89 to ground , that vehicle function 52 is detected on wire 29 . if the rke unit 16 uses the same wire 89 to activate lock module 90 to unlock ( e . g . by connecting wire 89 to high ), then the same wire 29 can be used to detect both the lock and unlock vehicle functions 52 . if it is desired that the manual lock relays ( manual door lock / unlock switches ) 94 do not activate vehicle content 50 , then an optional diode 96 can be placed on wire 89 between the wire 29 and the lock module 90 and lock relay 94 . this will permit the signal from the rke unit 16 to activate the lock module 90 and to be detected by the core 18 and cradle 28 , but the signal from the lock relay 94 to the lock module 90 will not be detected by the core 18 and cradle 28 . it should be noted that one way of dealing with the prospect of circuits that are normally open and connected to either high or ground when activated is to provide circuitry assigning some ( e . g . half ) of the wires 29 to treat open circuits as grounded and the rest to treat open circuits as high . when connecting to systems that signal between high and ground , any of the wires 29 can be used . fig3 shows a main window 62 of the software application running on the computer 56 of fig2 for loading content onto the cradle 18 . the software includes two tabs 64 associated with each of the wires 29 ( fig2 ), one for monitoring a rising edge on the associated wire 29 and one for monitoring a falling edge on the associated wire 29 . thus , each tab 64 corresponds to a different vehicle function 52 ( e . g . door lock , door unlock , etc ). the tabs 64 are initially labeled according to the communication hardware identifiers ( such as the colors of the wires 29 ) for simplicity . the user may rename the setting by double - clicking on the tab 64 . the user may note which color wires are associated with which vehicle functions 52 and then rename the tab 64 accordingly . the software also includes an add button 66 that is used to associate content 50 to a vehicle function 52 ( i . e . tab 64 ). the user selects the desired tab 64 and then selects the add button 66 . the software directs the user through a series of windows for selecting an event playback rule and associating content 50 with that rule . for example , the user may select a dark blue tab 64 a , which ( via choice of wires 29 ) is associated with the door unlock event . the user then selects the add button 66 to associate rules 67 and content 50 with the door unlock event . generally , the content 50 will be played based upon the occurrence of the associated function 52 under the associated rule 67 . upon clicking the add button 66 , a rule window 68 appears , as shown in fig4 . the user selects the desired rule for playing content , e . g . play the content 50 every friday . fig4 displays a list of categories 69 of rules 67 : birthday ( month and day ), time range , temperature range , day of week , and only play a sound ( without rules ). subsequent screens ( not shown ) would allow the user to program specific rules 67 within the selected category 69 . once a rule is selected the content window 70 appears , as shown in fig5 . the user selects the desired content 50 to be played upon the occurrence of the vehicle function 52 ( fig3 ) and the rule 67 selected in fig4 . the selected rule 67 and content 50 would then be displayed in the main window 62 shown in fig3 . as shown , more than one content 50 , each with a different rule 67 , can be associated with each tab 64 ( i . e . vehicle function 52 ). each tab 64 displays a list of the rules and content selected for that vehicle function 52 . the content 50 is prioritized by the order of the list . thus , by moving a rule and content up the list it is given higher priority . any conflicts among rules ( e . g . when more than one rule is satisfied upon the occurrence of the associated vehicle function 52 ) are resolved based upon the order listed , with higher content 50 taking priority . priority buttons 72 can be used to move a rule and content 50 up or down the list . as can be understood , multiple rules and content can be selected for each vehicle function 52 . a default setting ( if no rules 67 are satisfied ) of not playing any content is typically assigned to each setting . alternatively , one content 52 may be assigned as default , as shown , so that it is played if none of the rules 67 are satisfied . the default setting is given lowest priority as rules 67 and content 50 are added . the modify button 74 can be used to modify the content 50 associated with a specific rule . using the example of above , if the friday rule is chosen and the user selects the modify button the software would open the content window 70 so a new content 50 may be chosen . the user may listen to the available content by double - clicking on a song while the content window is open , or by selecting the my tones button 76 and selecting the desired content to be played . if the desired content 50 is not available the user may obtain more by selecting the get tones button 80 , which takes the user to a website where content 50 can be purchased . the content 50 is preferably encoded so that it only plays on the authorized core 18 and the core 18 is programmed to only play properly encoded content 50 . referring to fig6 , one method 100 in which the user may obtain content 50 is to convert content available in one format to the encoded format appropriate for the system 10 . the user may for use a website providing the appropriate conversion software or may purchase and load the appropriate conversion software onto the computer 56 . in the first step 102 the user selects the desired content ( on their own computer 56 , fig2 ) to convert . the user then uploads 104 the content 50 to the website or computer conversion software . upon paying a fee 106 , the website conversion software converts 108 the content 50 to the appropriate encoded format for the system 10 . the user then downloads the converted content 50 and then associates 110 the content 50 with the desired vehicle function 5 as explained above . once the user has completed assigning the desired content 50 to the vehicle function 52 the save changes button 78 is selected to save the changes to the core 18 . the content 50 is assigned to vehicle functions 52 in the manner described above . the core 18 is then connected to the vehicle 12 by fitting within the cradle 28 . although a preferred embodiment of this invention has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this invention . for that reason , the following claims should be studied to determine the true scope of legal coverage available for this invention . | 7 |
the term &# 34 ; pigments &# 34 ; as used herein means both primary pigments that act to form either an opaque white or colored cover when applied to the skin , as well as secondary pigments that extend the covering power of the primary pigments . primary pigments include , for example , titanium dioxide , zinc oxide , kaolin , titanium dioxide - mica , iron oxides and the like . secondary pigments include , for example , talcum , calcium carbonate , silica powder and the like . in general , the amount of primary pigment comprising the composition will be at least about 14 . 5 percent of the total weight of the composition . a preferred composition includes from about 30 percent to about 60 percent by weight of pigment in the cosmetic composition . various additives may be incorporated in the cosmetic composition , for example , to preserve the aqueous systems , to fragrance them and to alter the cosmetic qualities . gums , polymers , or both may be added to aid in suspending solids , to act as film formers or contribute towards a waterproof coverup of the skin . humectants and emollients may be included to improve the feel of the skin . ultraviolet absorbers , antibiotics , bactericides , fungicides , disinfectants , dyes , pearlescents , insect repellants , water repellants , keratolytic agents , absorbents , and anti - caking agents may also be included . for a list of commercially available ingredients , see mccutcheon &# 39 ; s 1982 functional materials . in the presence of some combination of additives that are both water soluble and water insoluble materials , for example , oils , fats and waxes , certain ratios of the alkoxylated surfactants included in the present invention may act as emulsifiers , forming stable lotion and cream vehicles . accordingly , the term &# 34 ; surfactant &# 34 ;, as used herein , includes materials which may be described as surfactants , wetting agents , detergents , or emulsifiers . according to the present invention , two different classes of alkoxylated surfactant must be employed in the cosmetic composition . the term &# 34 ; class &# 34 ; as used herein is employed in mccutcheon &# 39 ; s emulsifiers and detergents , pages 294 - 299 ( mccutcheon publishing co ., 1982 ), herein incorporated by reference . examples of some different &# 34 ; classes &# 34 ; of alkoxylated surfactants are : those derived and based upon lanolin ; those derived and based upon sorbitan ; carboxylated alcohol ethoxylates ; ethoxylated alcohols ; ethoxylated alkyl phenols ; ethoxylated amines or amides ; ethoxylated fatty acids ; ethoxylated fatty esters and oils ; propoxylated and ethoxylated fatty acids , alcohols or alkyl phenols ; sulfates and sulfonates of ethoxylated alkyl phenols ; sulfates of ethoxylated alcohols ; and , block polymers of ethylene and propylene oxide . certain of these alkoxylated nonionic surfactants may be modified to exhibit some anionic properties ( crypto - anionic ) and can be utilized for one , but not both , of the two different surfactant classes . examples of acceptable modified ethoxylates are phosphated ethoxylated fatty amines and salts thereof ( such as jorphox ™, jordan chemical co .) and pareth - 25 - 7 carboxylic acid and salts thereof ( surfine ™, finetex inc .). the alkoxylated surfactants utilized in the present invention comprise polyethoxylated , polypropoxylated or polyethoxy - polypropoxy copolymer surfactants wherein the ethylene oxide average for any given polyethoxy or polypropoxy - polyethoxy copolymer chain within a molecule or polymer block is between 3 and 40 monomer units on the average . a preferred pigmented aqueous cosmetic composition according to this invention includes the amounts of pigment and said surfactants as described above , wherein : said first alkoxylated surfactant is a polyethoxylated ether of a fatty acid alcohol , a polyethoxylated ether derivative of lanolin or partial fatty acid esters thereof , a polyethoxylated derivative of sorbitol or partial fatty acid ester thereof , or a polyethoxylated derivative of glycerol or partial fatty acid ester thereof ; and said second alkoxylated surfactant is a polyethoxylated fatty acid ester , a polypropoxy / polyethoxy copolymer , an acetylated derivative of said first alkoxylated surfactant , or a phosphated polyethoxylated fatty acid amine oxide or salt thereof . as used herein , the terms &# 34 ; fatty acid &# 34 ;, &# 34 ; fatty &# 34 ;, &# 34 ; mixture of fatty acids &# 34 ; or chemical derivatives thereof mean the mixture of organic carboxylic acids or derivatives thereof derived from a naturally occurring oil or fat or a hydrogenated product thereof including coconut oil , castor oil , palm kernel oil , cottonseed oil , peanut oil , olive oil , palm oil , sunflower seed oil , sesame oil , corn oil , safflower oil , poppyseed oil , teaseed oil , kapok oil , rice bran oil , grain sorghum oil , rapeseed oil , linseed oil , soybean oil , perilla oil , hempseed oil , wheatgerm oil , rubberseed oil , tung oil , oiticica oil , cacahuanache oil , whale oil , pilchard oil , japanese sardine oil , menhaden oil , herring oil , fish liver oil , tallow , milk fat or lard . exemplary surfactants that can be included in the cosmetic composition of the present invention are represented by formula i below ## str1 ## wherein : r 1 is h , an alkyl or alkenyl radical derived from a fatty acid or mixture of fatty acids , a glyceryl , lanolin , or a sorbital radical derived from the removal of one hydroxyl group thereof , a fatty acid ester derivative of a glyceryl , lanolin , or sorbital radical derived from the removal of one hydroxyl group thereof , respectively , an alkyl phenyl radical or r 3 ; ## str2 ## r 3 is a straight chain alkyl group having about 1 to about 22 carbon atoms ; ## str3 ## m is h or an alkali metal or ammonium cation ; e is 2 or 3 ; provided that if δ is 1 , then α is 3 to 40 ; provided that when x is n , n → o or ## str4 ## then δ is z and α is 1 to 40 ; further provided that if r 2 is mso 4 , so 3 h , ## str5 ## or m 2 po 4 for said first surfactant , then r 2 is h or ## str6 ## for said second surfactant ; further provided that if β is greater than zero for said first surfactant , then β and γ are both equal to zero for said second surfactant ; further provided that if β is not zero for both surfactants , then at least one of x or r 1 is different for said first and said second surfactants . ( a ) peg patty acid ether and peg / ppg copolymer -- a polyethoxylated fatty acid alcohol ether within formula i in which : r 1 is an alkyl or alkenyl radical derived from a fatty acid ; and ( b ) peg lanolin derivative and peg glycerol derivative -- a polyethoxylated lanolin alcohol described by formula i , where : and a polyethoxylated glycerol or partial fatty acid ester thereof described by formula i , where : r 1 x is glycerol or a partial fatty acid ester derivative of glycerol ; provided that if r 2 is mso 4 or m 2 po 4 for either of said first surfactants , then r 2 is h , -- so 3 h , or ## str7 ## for the other of said surfactant . ( c ) peg glycerol derivative and peg fatty acid ester or oil -- a polyethoxylated glycerol or partial fatty acid ester of glycerol described according to formula i , where : r 1 is a glyceryl radical or a fatty acid ester derivative of a glyceryl radical ; and a polyethoxylated naturally occurring oil , such as castor oil , described according to formula i , where : r 1 x is a fatty acid carboxy or a mixture of fatty acid carboxys , a fatty acid alkoxy or a mixture of fatty acid alkoxys , or a mixture of or acid carboxy and fatty acid alkoxys ; ( d ) anionic peg fatty amide or amine and peg sorbitol derivative -- an anionically modified n , n - bis polyethoxylated derivative of a fatty amine , a fatty amide , or mixtures of fatty amines or amides derives from a naturally occurring oil or fat , described by formula i , where : x is n , n → o or ## str8 ## r 1 is one or more alkyl or alkenyl radicals derived from a fatty acid or a mixture of fatty acids ; and a polyethoxylated sorbitol or partial ester thereof described by formula i , where : r 1 x is sorbitol or a partial fatty acid ester of sorbital ; another preferred combination of surfactants according to this invention is described in which said first surfactant is of the formula r 2 is h , mso 4 , m 2 po 4 , so 3 h or ## str10 ## and in which : r 1 x is sorbitol or a partial fatty acid ester derivative of sorbitol ; r 4 is h , mso 4 , m 2 po 4 , so 3 h or ## str11 ## r 3 is a straight chain alkyl group having about 1 to about 22 carbon atoms ; provided that if r 2 is mso 4 or m 2 po 4 , then r 4 is ______________________________________ ( a ) water , deionized 46 . 0 polyoxyethylene ( 10 ) oleyl ether 2 . 2 poloxamer 124 3 . 8 ( b ) titanium dioxide 20 . 0 zinc oxide 12 . 0 talcum 12 . 0 iron oxides powder , brown 4 . 0______________________________________ procedure : blend and mix ( a ) for 1 minute . blend and mix ( b ) for 2 minutes . mix ( a ) rapidly to create moderate vortex and slowly add ( b ). mix rapidly to form a uniformly thick liquid . repeating example i , but with the two ethoxylates at a total of 4 % [ 8 . 5 % of pigmented weight ] yields a fluid suspension of pigments that remains homogeneous for at least 24 hours . applying the liquid to the skin and allowing to dry yields a uniform , matte film . repeating example i , but with the two ethoxylates at a total of about 9 % [ 19 % of pigment weight ] allows the pigments to be dispersed to form a thin , homogeneous suspension that may be uniformly applied to the skin to form a matte film . ______________________________________ ( a ) water 34 . 5 potassium salt of phosphated n , n -- 2 . 5 bis ethoxylated coco amine oxide ( crypto - anionic ethoxylate ) polysorbate 20 4 . 5 ( b ) titanium dioxide 20 . 0 kaolin 15 . 0 talcum 20 . 0 iron oxide powder , brown 3 . 5______________________________________ procedure : blend and mix ( a ) for 1 minute . blend and mix ( b ) for 2 minutes . mix ( a ) rapidly to create moderate vortex and slowly add ( b ). mix rapidly to form a uniformly thick liquid . example iii ______________________________________ ( a ) water 54 . 2 acetylated polyoxyethylene 2 . 2 ( 10 ) lanolin alcohol polyoxyethylene glyceryl 3 . 6 monolaurate ( b ) mica ( and ) bismuth oxychloride 20 . 0 mica ( and ) iron oxides ( and ) 10 . 0 titanium dioxide talcum 10 . 0______________________________________ procedure : blend and mix ( a ) for 1 minute . blend and mix ( b ) for 2 minutes . mix ( a ) rapidly to create moderate vortex and slowly add ( b ). mix rapidly to form a uniformly thick liquid . ______________________________________ ( a ) water 33 . 8 acrylic / acrylate copolymer 5 . 0 ( 40 % in ammonia water ) disodium edetate 0 . 1 propylene glycol 3 . 0 imidazolidinyl urea 0 . 3 methyl paraben 0 . 2 ( b ) peg - 7 glyceryl cocoate 1 . 6 peg - 40 castor oil 3 . 8 fragrance 0 . 1 ( c ) talc 16 . 0 titanium dioxide 26 . 0 attapulgite 5 . 0 iron oxide powder , brown 5 . 0 quaternium - 15 0 . 1______________________________________ procedure : blend and mix ( a ) for one minute . blend and mix ( b ) for one minute . while mixing ( a ), add ( b ) and mix rapidly to create moderate vortex . add ( c ). mix rapidly to form homogenous , thick pourable liquid . the present invention also may be utilized to prepare highly pigmented , cosmetically elegant liquid emulsions . example v is one such emulsion . ______________________________________ ( a ) caprylic / capric triglyceride 6 . 5 mineral oil ( and ) lanolin 2 . 9 alcohols acetylated polyoxyethylene ( 10 ) 2 . 0 lanolin alcohol polyoxyethylene ( 20 ) sorbitan 1 . 0 monolaurate cetyl alcohol 0 . 4 propylene glycol stearate 4 . 1 ( b ) titanium dioxide 20 . 0 talcum 14 . 8 kaolin 4 . 0 iron oxide powder , brown 2 . 8 ( c ) water 34 . 35 glycerin 2 . 5 polyquaternium - 10 0 . 4 propylene glycol 3 . 5 hydroxyethylcellulose 0 . 25 methyl paraben 0 . 2 imidazolidinyl urea 0 . 3______________________________________ procedure : mix and heat ( a ) to 70 ° c . mix and heat ( c ) to 70 ° c . while mixing ( a ), add ( c ). mix rapidly to create vortex . blend ( b ) and add to vortex . mix and cool to 24 °- 28 ° c . the preceding example v may be prepared as a total block light screen ( ultraviolet and visible light screen ) by incorporating adequate levels of any oil - soluble and / or water - soluble ultraviolet absorbers ( singly or in combination ). exemplary uv absorbers are listed by the otc advisory panel to the u . s . food and drug administration in category i or are directly approved by the f . d . a . ( or foreign government equivalent agency ). the combination of adequate levels of chemical ultraviolet absorbers plus the physical protection afforded by high concentrations of category i titanium dioxide as described in the examples of the present invention , yields a topical light screen of unprecedented protection in a cosmetically acceptable form . ______________________________________ ( a ) caprylic / capric triglyceride 6 . 0 mineral oil ( and ) lanolin 2 . 9 alcohols acetylated polyoxyethylene 2 . 0 ( 10 ) lanolin alcohol polyoxyethylene ( 20 ) sorbitan 1 . 0 monolaurate cetyl alcohol 0 . 5 octyl methoxycinnamate 4 . 0 ( b ) titanium dioxide 14 . 0 talcum 14 . 0 kaolin 4 . 0 iron oxide powder , brown 2 . 5 ( c ) water 36 . 0 glycerin 3 . 0 propylene glycol 3 . 0 polyquaternium - 10 0 . 4 hydroxyethylcellulose 0 . 2 methyl paraben 0 . 1 imidazolidinyl urea 0 . 3 quaternium - 15 0 . 1 hydrolyzed animal protein 1 . 0 benzophenone - 4 5 . 0______________________________________ procedure : mix and heat ( a ) to 70 ° c . mix and heat ( c ) to 70 ° c . while mixing ( a ), add ( c ). mix rapidly to create vortex . blend ( b ) and add to vortex . mix and cool to 24 °- 28 ° c . a semi - solid ( gel - like ) suspension according to the the present invention may be readily prepared utilizing conventional thickening agents . example vii demonstrates one such thickened composition : ______________________________________ ( a ) water 43 . 43 carbomer 940 0 . 99 ( b ) trolamine 99 % 1 . 58 ( c ) polyoxyethylene ( 10 ) oleyl ether 2 . 2 poloxamer 124 3 . 8 ( d ) titanium dioxide 20 . 0 zinc oxide 12 . 0 talcum 12 . 0 iron oxide powder , brown 4 . 0______________________________________ procedure : blend ( a ) rapidly for 30 minutes . then mix at moderate speed and add ( b ). mix for 10 minutes . add ( c ) and mix for 10 minutes . blend and mix ( d ) for 2 minutes then , while mixing gel , sprinkle in d . mix until uniform . example vii yields a semi - solid , cosmetically elegant , highly pigmented product that spreads and dries uniformly on the skin . a semi - solid ( cream - like ) emulsion according to the present invention may be readily prepared , for example , by increasing the concentration of waxy alcohol and ester in example v , as shown in example viii below . ______________________________________ ( a ) caprylic / capric triglyceride 5 . 5 mineral oil ( and ) lanolin 2 . 9 alcohols acetylated polyoxyethylene 2 . 0 ( 10 ) lanolin alcohol polyoxyethylene ( 20 ) sorbitan 1 . 0 monolaurate cetyl alcohol 2 . 4 propylene glycol stearate 8 . 6 ( b ) titanium dioxide 20 . 0 talcum 12 . 0 kaolin 4 . 0 iron oxide powder , brown 2 . 8 ( c ) water 31 . 65 glycerin 2 . 5 propylene glycol 3 . 5 polyquaternium - 10 0 . 4 hydroxyethylcellulose 0 . 25 methyl paraben 0 . 2 imidazolidinyl urea 0 . 3______________________________________ procedure : mix and heat ( a ) to 70 ° c . mix and heat ( c ) to 70 ° c . while mixing ( a ), add ( c ). mix rapidly to create vorte . blend ( b ) and add to vortex . mix and cool to 24 °- 28 ° c . the cream - like semi - solid emulsion contains nearly 50 % pigments , but spreads readily on the skin to give a cosmetically acceptable cover - up film . the following comparative examples demonstrate the need for dual alkoxylated surfactants in order to achieve the desired cosmetic composition . ( a ) repeating example i ( total ethoxylates = 6 . 0 %), but utilizing only polyoxyethylene ( 10 ) oleyl ether at 2 . 2 % results in a stiff non - mixable heavy paste . ( b ) repeating example i with only polyoxyethylene ( 10 ) oleyl ether , at 6 . 0 %, results in a flowable system with white streaks rapidly forming at the surface of the mixture . remixing temporarily eliminates the white surface streaks which reappear within 10 minutes after mixing . ( c ) repeating example i but only with polyoxyethylene ( 10 ) oleyl ether , at a midrange concentration of 4 . 1 % yields a pasty , mixable mass that does not flow . whitish dots appear on surface of mix one hour after preparation . ( a ) repeating example i , but utilizing only poloxamer 124 at 3 . 8 % yields an unctuous paste . separation of orange colored liquid appears at surface of product within 2 hours . remixing yields same results . ( b ) repeating example i , but utilizing only poloxamer 124 at 6 . 0 % results in a mixture that allows for substantial settling of pigments out of suspension with clear , slightly orange fluid above pigments . remixed and applied to skin surface , material dries in varied color streaks . replacement of non - ionic ethoxylate , polysorbate 20 by crypto - anionic ethoxylate in example ii : 1 . repeating example ii ( total combined surfactants 7 %), but utilizing only potassium salt of phosphated n , n - bis ethoxylated coco amine oxide at 7 % of total formula results in a frothy non - uniform mixture with pigments rapidly settling out of suspension . 2 . repeating example ii but replacing polysorbate 20 ( ethoxylated non - ionic ) with the crypto - anionic surfactant pareth - 25 - 7 carboxylic acid yields an unacceptable mixture similar in appearance to the preparation of experiment b ( 1 ). replacement of non - ionic surfactant acetylated polyoxyethylene ( 10 ) lanolin alcohol in example iii with conventional anionic surfactant : 1 . repeating example iii ( total combined surfactants , ( 5 . 8 %), but replacing acetylated polyoxyethylene ( 10 ) lanolin alcohol with sodium lauryl sulfate ( 2 . 6 % of total system ) results in a frothy , whip cream - like mass that non - uniformly streaks the skin . the limits on the amounts of surfactants relative to the amount of pigment included in the compositions according to this invention are shown by the following examples . 1 . repeating example i , but with the two ethoxylates at a total of only 3 . 36 wt % [ 7 % of pigment weight ] results in a thick , paste - like mass . 2 . repeating example i , but with the two ethoxylates at a total of 9 . 84 % of total system [ 20 . 5 % of pigment weight ] gives a watery - thin dispersion of pigments that rapidly settle out of suspension . | 8 |
as required , detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . therefore , specific composition and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed embodiment . the present invention concerns the production of preferred iron humate products from water treatment processes to be used in treating vegetation and in particular crops and the like suffering from iron deficiencies generally referred to as chlorosis . the preparation of the iron humate products or residuals involves the controlled addition of a iron salt coagulant to raw water in a water treatment plant . the iron salt coagulant reacts with organic color producing aquatic humic substances or species in the raw water to form an iron humate product or precipitate which when applied to plants provides useful organic matter and nutrients such as iron . the preferred iron salt coagulant for the process is ferric sulfate or polyferric sulfate . other acceptable iron salts are ferric chloride , ferrous chloride , polyferric chloride , and ferrous sulfate and the like . in order to be acceptable the iron salt coagulant used should be of high purity in terms of generally being free of or having a relatively low heavy metal and organic contamination such as organic corrosion inhibitors and tri - halomethane precursers . preferably the iron salt coagulant is produced from virgin iron sources and virgin acid sources so as to minimize the extraneous contaminants which may not be environmentally safe to apply to soil or may be harmful to vegetation . table i gives a typical specification of a ferric sulfate coagulant that is suitable for treating at least some raw surface water under the present invention . however , allowable contaminant levels may differ depending on the water to be treated and the desired end use application of the recovered iron humate product . the allowable contaminants specified in table i are stricter than the american water works association ( awwa ) current standard for ferric sulfate because this standard only addresses the effects of contaminants in the coagulant on the resultant treated water and not the quality of the resultant sludge residue . table i______________________________________ maximum impurityimpurity concentration ( mg / kg ) ______________________________________arsenic 2cadmium 2chromium 5lead 10mercury 1selenium 3silver 5nitrites 75total organic carbon 15copper 5zinc 10manganese 90barium 6chloride 100fluoride 60titanium 50nitrates 150sodium 1000______________________________________ the most critical parameter affecting the quality of the resultant iron humate product is the reaction or coagulation ph . the optimum coagulation ph will vary depending on the type of surface water , the concentration of organic species present and the type of iron salt coagulant used . the optimum ph in an actual water treatment plant is determined using analytical jar tests of water samples in an iterative approach . a selected quantity of water to be treated is collected in several jars . the ph of the water in the jars is adjusted by the addition of an acid such as sulfuric acid such that the ph of each of the jars is different . a selected quantity of iron salt coagulant is added to each jar and the contents are agitated and then allowed to react or coagulate and then settle . the ph of the jar having the greatest raw water color reduction is identified . several more jars are filled with a selected quantity of the water to be treated . the ph of the water in these jars is adjusted to match the ph identified in the first jar test as resulting in the greatest raw water color reduction . various quantities of iron salt coagulant are then added to these jars . the contents are agitated and then allowed to react or coagulate and then settle . the smallest quantity of iron salt coagulant effecting a preselected or desired level of color reduction is identified . using the identified minimum quantity of iron salt coagulant resulting in the desired color reduction another set of jar tests can be conducted to identify the ph resulting in the greatest color reduction with the identified minimum quantity of iron salt coagulant . typically two iterations of the jar tests are completed to identify an optimum coagulation ph for effecting color reduction and the minimal quantity of iron salt coagulant at that ph to effect the desired reduction . typical optimum coagulation ph values range from 3 . 8 to 5 . 5 for most iron salt coagulants and most colored surface waters . controlling the optimum ph insures using the minimum dosage of iron salt coagulant to effect the required color removal of the raw water . it is theorized that excess iron salts form insoluble iron hydroxides which are not taken up by plants as opposed to the preferred iron humate products . because iron hydroxides are strong adsorbents of trace metals and phosphorous , the presence of the hydroxides in the sludge applied to vegetation can result in metal deficiencies in plants including phosphorous and iron deficiencies . the adsorption of iron from the soil by iron hydroxides may reduce the availability of iron from the preferred iron humate product . additionally , iron hydroxides do not dewater as well as iron humate products and form a gelatinous mass . the production of excess iron hydroxides results in a product that is more difficult to handle and more expensive to transport although the iron humate products are also very insoluble , they can still function as a source of iron nutrients during interactions with plants in soil media . although it is not the intent of applicant to be bound to any specific theory of how such iron is used by the vegetation , it is theorized that in the soil , the iron humate products are converted into a useable form by vegetation allowing the uptake of iron by the vegetation . in an actual water treatment plant application , analytical jar tests should be conducted frequently to verify the optimum treatment ph setpoint and minimum effective iron dosage rate and to compensate for changes in the chemical composition of the raw water to be treated . although an excess iron salt coagulant dosage will still produce a high quality drinking water , it will produce excess and undesirable iron hydroxides in precipates removed from the water and used herein to provide nutrients to vegetation . the preferred water treatment process of the present invention may be incorporated into a continuous flow water treatment system or a batch water treatment system . the steps of the process of the present invention are essentially the same when incorporated into either a continuous flow or batch treatment system except that the steps are time based in a batch reactor and position or location based in a continuous flow reactor . in a continuous flow water treatment system the ph of the raw water in an influent raw water stream is initially lowered to a previously identified optimum coagulation ph in an acidification zone . the ph may be lowered by the addition of an auxiliary acid such as sulfuric acid or by means such as bubbling co 2 into the raw water to form carbonic acid and by other means generally known in the art . the efficiency of the treatment process appears to improve when the ph of the raw water is lowered prior to the addition of an iron salt coagulant as opposed to lowering of the ph concurrently with or after the addition of an iron salt coagulant . however , the ph of the raw water may be lowered before , after or during the addition of the iron salt coagulant . also , for ph control and iron salt coagulant dosage efficiency purposes , it is preferred to use an iron salt coagulant with very low free acidity , so that the ph may be controlled independent of the iron salt dosage . as discussed above , the optimum coagulation ph may change due to changes in the composition of the raw water . analytical jar tests are conducted regularly to identify changes in the optimum coagulation ph and the ph of the water to be treated is adjusted accordingly . downstream of the acidification zone , an iron salt coagulant is added to the influent raw water stream in a flash mixing zone to form a treatment solution . the iron salt coagulant is added to the influent raw water stream at a rate previously calculated to provide the minimum dosage of iron salt coagulant necessary to effect the required color removal from the raw water . as discussed above analytical jar tests are conducted regularly to identify any changes in the minimum dosage necessary to effect the required color removal due to changing characteristics of the raw water . the rate of addition of iron salt coagulant is adjusted to correspond to any identified changes in the minimum dosage requirement . impellers are preferably used in the flash mixing zone to provide rapid , thorough mixing of the raw water and the iron salt coagulant , however it is foreseeable that other rapid mixing means may be incorporated into the process of the present invention the iron salt coagulant and the raw water are preferably mixed in the flash mixing zone for a minimum of 15 seconds . this initial mixing is followed by at least 3 minutes and preferably at least 10 minutes of additional mixing such as is available in a flocculation type mixing zone located downstream of the flash mixing zone . the reaction of the iron salt coagulant with the humic substances and other organic matter in the raw water is nearly complete within three minutes for temperate waters and longer for colder waters . the reaction of iron salt coagulant and humic substances forms iron humate products . after the reaction is complete , the treatment solution is allowed to settle with the iron humate products precipitating out of the solution to form a solids residue . after settling , the resultant treated water is separated from the solids residue ( whether as a floating flocculant or as a precipate that forms a lower solids or sludge layer in the water ). the treated water is preferably chlorinated after separation from the solids residue to minimize the formation of chlorinated organics which will contaminate the residue and the drinking water . the iron humate product in the form of the solid residue is concentrated and dried by conventional equipment being used in the water treatment industry such as settling basins , clarifiers , mechanical filters , sludge drying beds and commercial sludge dryers . the resultant iron humate product typically dewaters very effectively and can achieve air dry solids concentrations up to 88 % by weight solids . the iron - humate product of the present invention is characterized by a high iron concentration ranging from 15 to 45 percent by weight on a dry solids basis and preferably 28 to 33 percent by weight on a dry solids basis , low toxic organic and heavy metal contamination , high concentration of humic substances ( an elemental carbon concentration generally greater than 30 percent by weight on a dry and ash free basis ) and minimal concentration of iron hydroxides . the solids residue is characterized by a concentration of iron complexed as iron hydroxide of less than 25 percent by weight and preferably less than 10 percent by weight of the total iron present . after air drying , it has a medium brown color and has the consistency of a fine porous soil . the iron humate remains nearly insoluble in water ( less than 1 ppm ) or when stored in segregated piles , but slowly releases iron to the vegetation in mixed soil conditions more soluble , nitrogen enriched iron humate products are produced by contacting the partially hydrated iron humate products with a commercially available nitrogen source such as ammonia , ammonium hydroxide , urea , ammonium nitrate , and potassium nitrate . the resultant nitrogen enriched iron humate preferably contains nitrogen in the range of 0 . 5 to 12 percent by weight as nitrogen with a minimum water soluble iron content of 50 ppm as iron . the nitrogen enriched iron humate also turns from a medium brown color to a rich dark brown color . the mixture of the nitrogen enriched iron humate with water forms a dark brown solution , while the filtrate from mixing water with the iron humate is colorless . examples of the processes in accordance with the invention which follow are for the purpose of demonstrating specific processes in accordance with the invention and are not intended to be limiting in scope on the invention or claims . a plant trial was conducted to treat the hillsborough river water in tampa , fla . with ferric sulfate for color removal . sulfuric acid was added upstream of a flash mix tank to maintain a desired coagulation ph at a setpoint of 4 . 5 ph units . a high purity ferric sulfate in accordance with the invention was added at the entrance of the flash mix tank to maintain an average iron dosage of 21 milligrams / liter to treat an average raw water color of 105 standard color units ( scu ) to a maximum of 15 standard color units before chlorination . the raw water dissolved organic carbon ( doc ) averaged 15 . 9 ppm ( an indication of the dissolved humic substances present ) with reduction of the doc in the water by application of ferric sulfate in accordance with the invention averaged over 72 % by weight . the resultant iron humate sludge precipitate was concentrated using a clarifier , mechanically dewatered using a belt filter press to 18 % by weight solids and then dried in a conventional sludge drying bed to a dry solids content of 88 % by weight . this unmodified iron humate contained 32 % by weight iron on a dry solids basis . the humate material , when mixed with excess water , produced a clear filtrate with less than 1 milligram / liter soluble iron . additional elemental and composition data relating to the unmodified iron humate product are provided in tables 2 and 3 . data for tables 2 and 3 were taken from samples of unmodified iron humate taken randomly from the resultant iron humate product . the unmodified iron humate product from above example 1 was contacted with anhydrous ammonia in excess in a pressure vessel at 50 pounds per square inch ( psi ) for 48 hours at ambient temperatures and then dried . the resultant nitrogen content was 4 . 71 % by weight on a dry weight basis . the nitrogen enriched iron humate had turned to a rich dark brown . the iron solubility had increased by a factor of greater than 500 . elemental and compositional analysis of the ammonia - nitrogen enriched iron humate product are provided in tables 2 and 3 . data for tables 2 and 3 were taken from samples of nitrogen enriched iron humate taken randomly from the resultant iron humate product . table 2______________________________________compositional analysis * percent by weight ph ash moisture volatiles iron______________________________________unmodified 4 . 8 49 12 39 32nitrogen enriched 8 . 3 36 14 50 23______________________________________ * the weight percents for ash , moisture , volatiles and iron were determine after roasting the resultant unmodified and ammonianitrogen enriched iron humate products at 1000 ° centigrade until dry . table 3______________________________________elemental analysis percent by weight of dry and ash free humate unmodified nitrogen enrichedelement iron humate iron humate______________________________________carbon 40 43hydrogen 4 6nitrogen 0 . 9 4oxygen 55 46______________________________________ 100 pounds ( dry weight ) of the unmodified iron humate product from above example 1 was mixed with 29 pounds of urea and then stored at ambient temperature and pressure for 24 hours in a closed atmosphere to produce a nitrogen enriched from humate product . the nitrogen content of the nitrogen enriched iron humate had risen from 0 . 6 to 10 . 9 percent by weight . the nitrogen enriched iron humate had turned to a rich dark brown . the iron solubility had increased by a factor of more than 100 . plugs of turf grass and soil from a horticultural field laboratory were prepared for testing in triplicate with dosages of 2 . 5 , 7 . 5 and 25 . 0 pounds of iron humate product made in accordance with example 1 and example 3 per acre applied to separate plots . uniform rates of nitrogen , phosphorous , and potassium were applied to all plots . visual ratings were performed bi - weekly and clippings for growth rate and iron uptake measurements were conducted weekly for two weeks . both the urea - nitrogen enriched iron humate of example 3 and the unmodified iron humate of example 1 were compared against equivalent iron dosages from other iron sources , in particular , ferrous sulfate , a commercial iron ohelate sold under the trademark sequesterene 138 - fe and a control group with no added iron . the results of the iron uptake and vegetation growth measurements for the first two weeks are shown on table 4 . in general , the nitrogen enriched iron humate samples outperformed the unmodified iron humate samples . although the commercial iron products outperformed the iron humates on an efficiency basis , higher dosages of the iron humates outperformed the lower dosages of the commercial organic chelate . all the iron humate samples outperformed the control samples and also had a much greener appearance . table 4______________________________________ fe uptake week 1 week 2iron lbs fe / ( mg growth growth totalsource acre fe / pot *) ( g / pot ) ( g / pot ) growth______________________________________ 1 . iron 2 . 5 0 . 182 . 42 . 60 1 . 02 humate 2 . iron 7 . 5 0 . 151 . 43 . 60 1 . 03 humate 3 . iron 25 . 0 0 . 183 . 51 . 59 1 . 10 humate 4 . nitrogen 2 . 5 0 . 201 . 46 . 69 1 . 15 enriched iron humate 5 . nitrogen 7 . 5 0 . 148 . 40 . 54 . 94 enriched iron humate 6 . nitrogen 25 . 0 0 . 224 . 42 . 69 1 . 11 enriched iron humate 7 . seques - 2 . 5 0 . 176 . 52 . 67 1 . 19 terene 138 - fe 8 . seques - 7 . 5 0 . 301 . 58 . 64 1 . 22 terene 138 - fe 9 . ferrous 25 . 0 0 . 245 . 59 . 65 1 . 24 sulfate10 . control 0 0 . 099 . 35 . 51 . 86______________________________________ * plant growth is expressed in g / pot which indicates the mass of the plant growth per pot in which plants are grown . iron uptake in young citrus trees was tested for the nitrogen enriched and unmodified iron humates of examples 2 and 1 respectively and compared against two commercial iron chelates sold under the trademarks sequesterene 138 - fe and libfer sp and a control group with no added iron nutrients in a soil incubation study over 70 days . the results of the tissue analysis for iron are shown in table 5 . in table 5 , the headings carrizo and swingle represent the root stock of the young citrus trees on which the iron sources were applied . the ammonia - nitrogen enriched iron humate of example 2 showed dramatically higher content than all other iron sources tested . the unmodified iron humate of example 1 showed slightly lower to equivalent performance in comparison to the commercial iron chelates . all tested iron sources performed better than the control group . the preliminary economics indicate that the iron humate products of the present invention are commercially viable compared to available iron sources . the analysis for iron of tissue samples from the citrus leaves of trees treated with the nitrogen enriched iron humate product indicate that these leaves contained more iron than the leaves of trees treated with sequesterene 138 - fe . the cost of an effective amount of the nitrogen enriched iron humate product would be a fraction of the cost for a similarity effective amount of sequesterene 138 - fe based upon the price thereof at the time of filing of this application , while still maintaining a healthy profit for the iron humate producer . table 5______________________________________concentration of iron in leaves of two citrus rootstocks45 days after application of iron source iron in leaves rate ( mg / kg ) iron source g iron / plant carrizo swingle______________________________________nitrogen enriched 2 390 240iron humatenitrogen enriched 1 338 213iron humatenitrogen enriched 0 . 5 241 104iron humateunmodified iron humate 2 235 67sequesterene 138 - fe 0 . 5 225 98sequesterene 138 - fe 1 218 61sequesterene 138 - fe 0 . 25 216 112unmodified iron humate 1 205 98unmodified iron humate 0 . 5 198 70libfer sp 0 . 25 198 58libfer sp 1 190 61libfer sp 0 . 5 180 139control 0 164 44______________________________________ it is to be understood that while certain forms of the present invention have been illustrated and described herein , it is not to be limited to the specific forms or arrangement of parts described and shown . | 8 |
turning now to the drawings wherein like reference numerals designate identical or corresponding parts throughout the several views , and more particularly to fig1 thereof , there is shown an illustrative block diagram of the present invention which illustrates the basic function of the present invention . in fig1 a doorbell switch 10 which is conventionally mounted adjacent a door may be coupled to a conventional doorbell circuit 12 for actuating a doorbell . the doorbell switch 10 is also coupled to a doorbell answering terminal 14 of the present invention . doorbell answering terminal 14 is in turn coupled to the public switched telephone network ( pstn ) 16 just as though it were an ordinary telephone . in addition to the features to be described , the doorbell answering terminal 14 may also include facilities for local answering of the doorbell using a telephone handset as a transducer as well as the normal functionality of an ordinary telephone . some of the specific structure required for this function has been omitted from fig1 for ease of explanation . the remote doorbell answering terminal 14 includes an automatic dialing device ( autodialer ) 18 which is responsive to the actuation of the doorbell switch 10 to automatically dial a predetermined telephone number stored in a memory thereof . the telephone number dialed by the autodialer 18 causes the pstn 16 to connect the remote doorbell answering terminal to a telephone 20 associated with the predetermined telephone number . when the remote telephone is answered , an audio circuit 22 of the remote doorbell answering terminal couples the audio path of the telephone 20 to a loudspeaker 24 and a microphone 26 situated adjacent the door . loudspeaker 24 and microphone 26 may be part of an existing intercom system in one embodiment of the invention , but this is not to be limiting . the combination of loudspeaker 24 and microphone 26 are referred to collectively herein as a door speaker phone 28 . the technology used to provide the function of the door speaker phone 28 may be similar to the technology used in conventional office speaker phones . a call monitoring and control portion 29 of terminal 14 monitors the call and controls the process as will become clear shortly . numerous variations and enhancements of the present invention are possible . for example , it is possible to provide an electronic lock on the door which may be remotely or locally unlocked or locked by entering an appropriate code on a touch tone telephone . this code can be entered after a telephone link is established . the code is entered by the remote keypad and is decoded by a digital signal processor which then either locks or unlocks the door as required by sending an appropriate signal to an electronic lock . it is also to be noted that the present invention , although described in conjunction with the pstn , is not limited to use over conventional analog telephone lines , but is equally well adapted to digital telephone systems and the like . turning now to fig2 a flow chart of the operation of the present invention is shown . the process begins at 30 and the doorbell is pressed or actuated at 32 . when the doorbell switch is actuated at 32 , the terminal checks to see if the autodial feature is enabled at 34 . if not , the process waits at 35 for a predetermined time period , for example one minute . the local off hook signal is continuously monitored and if an off hook signal at a local telephone at 36 has not occurred by this time , control passes to 44 . if the local telephone is taken off hook at 36 , control passes to 38 where the local handset is connected to the door speaker phone to enable conversation between the local telephone and the person who rang the doorbell . the control then passes to 39 where an on hook is awaited at the local telephone . when the on hook is detected , the door speaker phone is disconnected at 40 and the process returns to 30 at 42 . if the autodial is enabled at 34 or no local off hook is detected at 36 , control passes to 44 where the ringing of the doorbell causes the remote doorbell answering terminal 14 to produce a telephone off hook signal at 44 . as previously mentioned , the terminal 14 may actually include a telephone in one embodiment . at step 46 the off hook terminal awaits a dial tone from the pstn 16 . when a dial tone is received at 46 , the autodialer 18 dials the pre - programmed telephone number at 48 . when the remote telephone set 20 goes off hook , the answer is detected at step 50 where control is passed to 52 . at step 52 , the terminal 14 sends an alert signal to the remote telephone 20 to inform the answering party that the call it is taking is not an ordinary phone call , but rather is a call generated in response to actuation of a doorbell switch . this alert signal may be any suitable special signal such as an audible beep or the like which will serve the purpose of alerting the answering party to the nature of the call . this feature is in keeping with the security aspects of the present invention so that an appropriate answer may be given by the answering party which will not let on that no one is home . for example , if the number dialed is that of business , the answering party might be likely to answer the call with a special message such as the name of the business or the like ( e . g . &# 34 ; good morning , xyz plumbing company &# 34 ;). such a response would likely give away the fact that the call is being answered remotely . however , once the answering party is alerted to the nature of the call , an appropriate greeting may be given ( e . g . &# 34 ; hello , who is there ?&# 34 ;). after the alert acknowledge signal is received back by the terminal 14 at 54 , the audio path from the pstn is coupled to the door speaker phone 28 . by making the connection only after the alert acknowledge signal has been detected by the doorbell answering terminal , an inappropriate greeting may still be corrected . at step 58 , the terminal 14 awaits a remote on hook signalling the end of connection . when the remote telephone goes on hook at 58 , the audio path is disconnected from the door speaker phone 28 at 60 . the terminal 14 then goes on hook at 62 and the process ends at 64 . any time during the entire process of fig2 that the local handset is taken off hook , control immediately transfers to step 38 . those skilled in the art will recognize that several of the steps may be interchanged in time , for example 60 and 62 , without departing from the present invention . those skilled in the art will also appreciate that the flow chart of fig2 is simplified for clarity in that the loops at 39 , 46 , 50 , 54 and 58 could potentially result in infinite loops if implemented strictly as shown . in a preferred implementation , an appropriate timer should be activated in these loops , the system will reset itself and then control passed back to 30 if the appropriate response is not obtained in a reasonable time . such use of time out timers is well known in the art and their omission is believed to simplify the description of the invention . also in a preferred implementation , to be described more fully in conjunction with fig3 to follow , the terminal is based upon a digital signal processor which determines the various line conditions at 46 , 50 , 54 and 58 by analyzing the line . the signals generated at 48 and 52 are similarly generated by the digital signal processor . turning now to fig3 a more detailed schematic view of a preferred embodiment of the present invention is shown . in some embodiments , a switch interface 70 may be needed to adapt to the wide variety of doorbells which are commercially available . this interface may include an ac to dc converter , switch debouncer and other common circuitry as would be required to adapt the doorbell switch for use with the present terminal . in the simplest embodiments , the doorbell switch 10 operates a dc circuit and is readily adaptable to providing a simple logic level change to a digital signal processor 72 . in other embodiments , the actual sound of the doorbell may be detected . in the preferred embodiment , digital signal processor 72 is a programmed process such as the texas instruments tms320c17 which is a general purpose signal processing microcomputer with 4k words of read only memory ( rom ) and 256 words of random access memory ( ram ). if required , additional external ram or rom may be added . those skilled in the art will appreciate that other known microcomputers or equivalent analog or digital substitutes may be substituted without departing from the present invention . the output of the switch interface 70 is applied to the digital signal processor 72 either at an interrupt line or an i / o line as desired for the exact implementation . the digital signal processor also receives input from external switches 74 , 76 , and 78 which are respectively handset off hook switch , telephone / door switch and autodial enable switch . the off hook switch is the local telephone handset switch hook . the telephone / door switch is a user selectable switch which selects either the pstn 90 or the door speaker phone 28 that the local telephone handset will access . this switch also affords the user the ability to switch back and forth as desired ( for example in the situation where the user wishes to quickly verify the identity of the person at the door ). the digital signal processor 72 also receives input from a local keypad 82 which in an alternative embodiment may take the place of the switches 76 and 78 . keypad 82 is used to dial out when the terminal 14 is in the telephone mode as selected by switch 76 and is also used an an input device for programming the digital signal processor 72 with the telephone number to be dialed . in one embodiment of the invention , the memory of the digital signal processor 72 stores a plurality of telephone numbers stored by the user in advance . the user may then select one of the numbers from the keypad for dialing using an abreviated code in a manner similar to standard speed calling . the digital signal processor 72 is also coupled to a combo codec circuit 86 which is used for analog to digital conversion of the signals generated locally and received over the phone lines . the digital conversion is needed in the present embodiment so that the digital signal processor may operate digitally on the signals . codec circuit 86 also converts the digital signals generated by the digital signal processor 72 to analog for transmission over phone line 90 to the remote telephone 20 or to speaker 24 . in the present embodiment of the invention , the digital signal processor 72 is used to generate pulse or dtmf signals to effect the dialing and autodialing functions of the present invention . digital signal processor 72 also performs the functions of detecting the dial tone , generating dtmf and alert signals , detecting remote off hook , detecting alert acknowledge , detecting remote on hook as well as any other necessary analysis of telephone line conditions to enable determinations of line conditions . codec circuit 86 may be any suitable commercially available codec such as the texas instruments tcm - 2916 combo codec chip . other manufacturers make similar products which are suitable substitutes . signals such as dtmf tones and other required signals generated by the digital signal processor are converted to analog by codec circuit 86 and transmitted out over the telephone line 90 via a telephone speech network 92 . network 92 may include gain control , hybrid networks , power regulation , surge protection and other known functions implemented to interface an electrical audio signal to a telephone network . digital signal processor 72 also controls an on hook / off hook control switch 94 which takes the terminal on and off hook as desired . codec circuit 86 also converts analog signals received over the phone lines ( or locally generated ) to digital for use by the digital signal processor 72 . terminal 14 also includes a plurality of switches which operate under the control of the digital signal processor 72 and are appropriately switched to control the audio path as required . switch 102 couples the audio signals at microphone 88 of the local telephone handset 80 or the audio signals generated by the remote telephone 20 to the codec circuit 86 for digitizing . the digitized signal may be simply looped through the digital signal processor 72 and converted back to analog by the codec circuit 86 . the signal then passes through a switch 104 for use in answering the doorbell locally or remotely or to switch 106 for use in making normal telephone calls from the handset 80 . to place a call using the terminal as a conventional telephone set the switch 104 disconnects the audio from the loudspeaker 24 and routes the audio from 88 through a switch 106 to the telephone speech network 92 . audio from the pstn is passed through switch 108 to the speaker 98 of the local handset 80 . when using the local handset to answer the doorbell , the switch 102 routes the microphone signal from 88 to codec circuit 86 ( through digital signal processor 72 ) and switch 104 is closed to complete the path in one direction . in the other direction , the switch 108 routes the signal from microphone 26 to speaker 98 . it will be appreciated that various audio amplifiers and the like may be needed in certain paths which have not been shown but which will be evident to those of skill in the art . when the doorbell is answered remotely by remote telephone 20 , the audio from the remote phone 20 is delivered by the speech network 92 to switch 108 , switch 102 , codec 86 ( through digital signal processor 72 ) then to switch 104 and loudspeaker 24 . the microphone 26 signal is passed through switch 106 to network 92 for delivery to the remote telephone 20 . the telephone activity during remote answering of the doorbell switch 10 is monitored by the digital signal processor 14 at all times via the path of speech network 92 to switch 108 to switch 102 and codec circuit 86 . the various switch positions of switch 102 , switch 104 , switch 106 , and switch 108 are shown in table 1 for various conditions of the system . table 1______________________________________ sw . sw . sw . sw . 102 104 106 108______________________________________alert / b o a aautodiallocal phone a o a acalllocal door a c x banswerremote door b c b aanswer______________________________________ a = position a , b = position b , c = closed position , o = no connection , x = don &# 39 ; t care the switching capability of the present invention , it will be noted , allows for communication between a remote telephone user , a local telephone user and a person ringing a doorbell in any combination . this allows the user to answer the doorbell from either a local or remote location without alerting the person at the door to the presence or absence of a person at the premises . thus , a variety of security and convenience features may be implemented . those skilled in the art will also appreciate that once the connection is made between the doorbell and the telephone , any of a plurality of telephone features is at the disposal of the user for a variety of specialized applications . for example , answering services , paging services , security services as well as standard telephone service options such as call waiting , call forwarding and other such features may be integrated within the system to achieve a variety of specialized functions . it should be noted that the ability to answer the doorbell from a local telephone handset may have distinct advantages to the elderly or handicapped who may have difficulty getting up to answer the door . since the local terminal 14 may be easily equipped with a wireless handset as is known in the art , the ability to remotely answer the doorbell is further enhanced . it will also be evident that the door intercom may be coupled to a remote handset by way of a radio frequency link or the like as opposed to a conventional telephone line . further , it should be noted that the three way link made possible by the present invention is under the control of the terminal 14 and / or the user of the local handset and can be controlled in a variety of ways which can be used to the benefit of the owner . numerous uses and benefits will occur to the user which substantially enhance his security and convenience . thus , it is apparent that in accordance with the present invention , a method and apparatus that fully satisfies the aims , advantages and objectives is set forth above . while the invention has been described in conjunction with specific embodiments , it is evident that many alterations , variations and modifications will become apparent to those skilled in the art in light of the foregoing description . accordingly , it is intended that the present invention embrace all such alternatives , modifications and variations as fall within the spirit and broad scope of the appended claims . | 7 |
fig1 illustrates a method for using a performance flag . once the method is started , for example , by detection of a full - capacity utilization situation or starting a critical application , a performance flag is set ( 1 ). the performance flag or its status is monitored by an agent , which reacts to changes in the flag . if the flag is found , a stop command is output ( b ). depending on the outputting of the stop command , the application is terminated ( c ), for example , by forwarding a corresponding command to the application or to the operating system . by terminating the application , computer performance , for example , cpu or ram capacity is kept available . the available computer capacity is available , for example , to another , more - important or more - critical , application . the performance flag is deleted or reset , or its status is reset ( 2 ). the performance flag is deleted , for example , after detection of the end of the full - capacity utilization situation or after termination of the application program or of a critical phase of the application program . the performance flag is monitored , and after it is found that it has been deleted a start command is output ( d ). in one embodiment , an application is started as a function of the outputting of the start command ( e ). the starting of the application is performed by outputting a corresponding command to the operating system , or a start script intended for the purpose can be started . for example , upon execution of the corresponding command or start script , one or more application programs are started . in one embodiment , as shown in fig2 , a method includes an application ( 11 ) that causes the performance flag to be set ( 1 ). once the performance flag is found , a stop command is output ( b ). one or more applications are ascertained as a function of the outputting of the stop command ( 3 ). in one embodiment , the one or more applications that are ascertained are also dependent on an interface ( 4 ), from which the one or more applications , or a list of applications , can be consulted . the interface ( 4 ) is described by the application ( 11 ) that previously set the performance flag , or is described as a function of the particular application . using the interface ( 4 ), depending on the application ( 11 ) that is setting the flag , it is ascertained which other applications should be terminated . in an alternate embodiment , the interface ( 4 ) is dependent on the application ( 11 ) and other applications , so that when the flag is set by the other applications , other lists of applications to be terminated can logically be created . in one embodiment , a stop script is written depending on the applications ascertained ( 5 ). the applications to be terminated are entered in the stop script . the stop script does not have to be separately written , except for the list of applications to be terminated . alternatively , the stop script can be available from the very beginning . for example , the stop script can be generated by the performance module . the applications to be terminated are terminated by execution of the stop script ( c ), for example , by forwarding a command to the application or to the operating system . in one exemplary embodiment , whether the particular application is “ properly ” shut down by forwarding a corresponding command or is abruptly interrupted by forwarding a kill command to the operating system is dependent on which application has set the performance flag . for example , in critical applications , it may be necessary to provide the highest possible computer performance available as fast as possible , while with less - critical applications it may be sufficient to make the computer performance available only after the time needed for shutting down the applications has elapsed . in one embodiment , the application ( 11 ) causes the performance flag to be deleted again ( 6 ). this can be done for instance when the application ( 11 ) ends or when a critical phase of the application ( 11 ) has ended . for example , application ( 11 ) may be performing a patient scan using a radiation - based imaging system . in one embodiment , the performance flag is set at the beginning of a patient scan and deleted again once the scan is concluded . in one embodiment , a start command is output depending on whether the performance flag has been deleted ( d ). one or more applications or a list of applications that are to be started is ascertained depending on the outputting of the start command ( 7 ). the list of applications to be started is dependent on the interface ( 4 ), which is described by the application ( 11 ) that causes the performance flag to be deleted . the list of applications to be started is thus dependent on application ( 11 ). for example , the application that sets the performance flag is identical to the application that deletes the performance flag . alternatively , the flag is set by a first application but deleted by a second application . the application or applications are written in a start script depending on the list of applications to be started that is ascertained ( 8 ). the start script , like the stop script , for example , can already be available from the beginning , so that only the applications to be started have to be entered . the starting of the entered applications is brought about by executing , for example , the start script ( e ). this is done by forwarding corresponding commands to the operating system . in one embodiment , as shown in fig3 , a data processor includes a performance module ( 40 ). the data processor includes a microprocessor ( i . e . cpu ) ( 10 ), in which applications ( 11 , 12 ) are running . the microprocessor ( 10 ) is connected to a working memory ( i . e . ram ) ( 20 ), in which application data for the applications ( 11 , 12 ) are stored in the memory or buffer - stored . the microprocessor ( 10 ) is connected to a memory ( i . e . rom ) ( 30 ), in which executable versions of the application programs ( 11 , 12 ) are stored . in one embodiment , the microprocessor ( 10 ) sets a performance flag ( 41 , 41 ′, 41 ″ . . . ) depending on a corresponding call for one of the application programs ( 11 , 12 ). for example , it may be sufficient for only a single performance flag with only 0 / 1 information to be available . in the exemplary embodiment shown in fig3 , a data word composed of a series of performance flags ( 41 , 41 ′, 41 ″, . . . ) is used , and depending on which of the applications ( 11 , 12 ) sets the flag , one of the various flags is set . the position of the flag set within the series of flags identifies the application ( 11 , 12 ) that has set the flag . for example , flag ( 41 ) can be allocated to the application ( 11 ), and flag ( 41 ′) to the application ( 12 ). in this embodiment , for example , if flag ( 41 ) is set , it is clear that it was set by application ( 11 ) and if flag 41 ′ is set , it is clear that it was set by application ( 12 ). in one embodiment , a performance module 40 monitors the flags ( 41 , 41 ′, 41 ″ . . . ) to determine whether one of them has been set . if the performance module ( 40 ) finds a set performance flag ( 41 , 41 ′, 41 ″ . . . ) then it reads out the interface ( 4 ) in order to obtain a list of applications to be terminated . the performance module ( 40 ) writes the applications to be terminated into the stop script ( 43 ) and causes the stop script ( 43 ) to be executed . the applications entered are terminated by execution of the stop script ( 43 ). in one embodiment , if the performance module ( 40 ) finds that a performance flag ( 41 , 41 ′, 41 ″ . . . ) has been deleted , then it reads out the interface to obtain a list of applications to be started . the performance module ( 40 ) then writes the applications to be started into the start script ( 42 ) and causes that script to be executed . by execution of the start script ( 42 ), the entered applications are started . while the invention has been described above by reference to various embodiments , it should be understood that many changes and modifications can be made without departing from the scope of the invention . it is therefore intended that the foregoing detailed description be regarded as illustrative rather than limiting , and that it be understood that it is the following claims , including all equivalents , that are intended to define the spirit and scope of this invention . | 6 |
the invention provides a manufacturing method which enables the use of an laser release ( eplar ) process , that is based on a field - shielded pixel am - lcd process , to allow flexible coloured lcd displays to be made in standard tft factories . before explaining the invention in detail , the field shielded pixel technology will first be described . the standard tft structure , which is probably used in more than 90 % of current tft lcd display modules ( laptops , lc - tvs , mobile phones etc . ), has a comparatively thin silicon nitride passivation layer above the tft , shown as sin 2 in the cross - section of fig1 ( a ). fig1 ( a ) shows a cross - section of a standard tft structure with a sin passivation layer . fig1 ( b ) shows a cross - section of a field shielded pixel tft with thick polymer passivation layer . in fig1 ( a ), the glass substrate is shown as 10 , and a first gate dielectric silicon nitride layer 12 is provided over the substrate . a second silicon nitride layer 14 functions as a passivation layer . the ito pixel electrode is shown as 16 , and the pixel tft is shown as 18 . fig1 ( b ) differs in that the second silicon nitride layer 14 is replaced by a polymer dielectric layer 20 . the silicon nitride ( sin ) has good dielectric and passivation properties , but it is not practical to deposit sin layers thicker than 0 . 5 · m thick , and usually 0 . 1 to 0 . 4 · m is used . the sin has a dielectric constant of 6 . 4 . the combination of a thin layer with moderately high dielectric constant means that any conducting layers that use sin as a dielectric have a comparatively high capacitance . the effect of this is the ito pixel cannot be allowed to overlay the metal columns or the tft . the voltage applied to the columns changes every line address time and if the ito pixel lies above the columns then capacitive coupling can change the voltage on the pixel , causing vertical cross - talk . if the pixel lies over the tft then it can act as a top - gate to partially turn the tft on when it is meant to be in its off - state , again causing vertical cross - talk . the ito can lie over the row because this only changes voltage once every frame time , immediately before the line is readdressed . this has no perceptive effect on image quality . the lcd material in the display only responds to the field induced by the voltage on the pixel and it does not switch in areas where there is no ito pixel . the restriction on where the pixel can lie in the standard tft structure restricts the effective optical aperture of the lcd displays , as shown in fig2 ( a ). fig2 ( a ) shows the layout of a standard tft structure , with none of the ito pixel 16 overlaying the column or tft . the lcd is only switched in the area above the ito pixel 16 . the row lines are shown as 22 and the column lines are shown as 24 , and contact between the pixel electrode 16 and the tft is by contact holes 26 . fig2 ( b ) shows the layout of field shielded pixel tft structure with ito pixel electrodes above the column and tft . the ito pixel covers a larger area than in the standard structure shown in fig2 ( a ). in particular , the ito pixel electrode , which forms a circuit together with the tft , lies directly over the associated tft , specifically the gate and channel thereof . using the field shielded pixel ( fsp ) structure , shown in cross - section in fig1 ( b ), increases the effective optical aperture of the pixel . in this case , a thicker polymer layer replaces the thin silicon nitride passivation layer of the standard tft structure . the polymer layer is normally 2 or 3 · m thick and typically has a dielectric constant of 3 . this means there has been an increase in thickness by a factor of 10 ( from 0 . 3 · m to 3 · m ) and a reduction in dielectric constant by a factor of 2 . this reduces the capacitance by a factor of 20 . this is low enough to allow the ito pixel 16 to overlay the column and tft without causing vertical cross - talk by either capacitive coupling from the column or by switching the back - channel of the tft on . the passivation layer polymer obviously has to be highly transmissive and have no birefringence because it lies in the optical path of light through the lcd . bcb ( benzocyclobutene ) is usually used as the polymer in fsp structures , but it is very expensive and in principal other clear plastics that can be liquid - cast can be used as well . thin displays are needed for mobile applications . tfts are usually made on 0 . 7 mm thick glass substrates and two are needed to make standard lcds . this makes amlcds at least 1 . 4 mm thick , plus polarisers and optical enhancement films . this is too thick for mobile phone applications , so the displays are usually thinned by a hf etch until both substrates are 0 . 3 mm thick before polariser attachment . this is a very wasteful and polluting process and the displays are still 0 . 6 mm thick . manufacturers have found that if they try to thin them further , then the displays are prone to break . there are also difficulties achieving high optical aperture amlcds . there are two different forms of pattern alignment used in amlcd manufacture . the first is photolithographic alignment , which is used to build up patterns of different metals , dielectrics and semiconductor layers on a substrate . the technique is highly accurate and for amlcd manufacturing it is usually quoted as having an alignment accuracy of approximately 2 · m on substrates that can be as large as 2 × 2 m in size . in fact , the alignment accuracy is usually better than 1 · m . the second kind of alignment is plate - to - plate coupling . this aligns the two sides of the lc cell together . for an amlcd , there will typically be an active matrix array on one plate and colour filters , black mask and ito on the other , as shown in fig3 ( a ). this shows a cross - section through the middle of the pixel , and shows the active plate 30 and passive plate 32 . in fig3 ( a ), l 1 is the gap between the column and the pixel , which must be greater than about 1 · m to prevent excessive capacitive cross - coupling . l 2 is the overlap between the black mask 34 and the ito pixel . l 1 is equal to the minimum gap size plus maximum photolithographic misalignment . l 2 is the maximum misalignment between the two plates . plate to plate alignment tolerances are much larger than photolithographic alignment . there can also be some movement during the contacting and while the seal lines are being cured , so plate to plate coupling accuracy is closer to 10 · m . for high quality displays it is crucial that light can only pass through the pixel ito , where it is modulated to give the desired light transmission level . any light that can pass round the pixel and reach the viewer will lower contrast ratio and mean that the black state is not as black as it could be . this degrades display performance . the black mask must therefore be large enough to accommodate variations in alignment between the plates , which reduces optical aperture . the larger the black mask is , the smaller the optical aperture , which means more power must be used for the lights to get the necessary brightness . fig3 ( b ) shows alignment of the active and passive plate for “ high aperture ” fsp amlcds . l is the overlap between the black mask and the ito pixel . it is equal to the maximum misalignment between the two plates . thus , the fsp structure increases optical aperture , particularly for small pixels . maximising optical aperture is important for maximising brightness of the displays and reducing power consumption , so plate to plate coupling accuracy can effectively be the factor that limits these parameters . an obvious way to improve the optical aperture is to move the colour filter to the active plate . this can be done in two ways for glass substrates . both have been demonstrated in research labs , but are not used in mass production . the first method is to put the colour filter beneath the tft array . it has been reported that this can increase the optical aperture of a 15 ″ xga monitor from about 60 % to 80 %. the colour filter is normally made of dyed polymers that are 1 to 2 · m thick and they give a very uneven profile . there are severe practical difficulties with processing the tfts on these uneven surfaces , but the real problem for this process is processing temperature . the colour filters must not be heated above about 150 ° c . or they start to degrade and lose their colour saturation . the tfts are normally deposited above 300 ° c . this temperature can be lowered to close to 200 ° c ., but if it goes below 200 ° c . then the tfts become too electrically unstable for an acceptable display lifetime . having poor colour saturation or unstable tfts is not acceptable . the second technique is to have colour filters above the tft array . the simplest way to do this is to simply put a colour filter on top of a standard tft array . this is not practical because placing a thick polymer layer over the pixel electrode significantly increases the driving voltage and introduces image retention due to charge motion in the polymer . it is possible to make the tft array , deposit the colour filters , then put the ito above the colour filters with electrical connection through the colour filter layer . this is a difficult process to control requiring good tapered slopes on all the colour filter layers , high quality ito with limited temperature for the deposition and accurate and reliable patterning of ito on top of bumpy polymer layers . this process does not appear to have made it to the manufacturing stage . the invention provides improved processes . three examples are given below for making plastic lcds with a modified eplar process , and one example is given for making high - resolution thin cells with a single glass substrate . in the first two embodiments , standard colour filter technology is used . these are the simplest to implement in standard tft factories but they do have several extra processing steps compared to standard glass based lcds . in the third embodiment the colour filters are ink jet printed onto the tft side of the plastic lcd after the glass substrate on the tft side has been removed and the polyimide plasma etched . plastic displays with ink jet printed colour filters give the largest aperture and the smallest number of process steps . they also benefit from not needing plate to plate alignment during cell making . the first embodiment is shown with reference to fig4 ( a ) to ( q ), as a series of diagrams showing the process sequence in the centre of the tft array during processing . in particular , fig4 shows eplar lcds with fsp pixels and a supporting polyimide grid . the embodiment uses standard lcd cell making with polyimide support layers and fsp structures . it has the advantage of providing a strong polyimide support grid . fig4 ( a ) to ( d ) show the processing steps to form the active plate of an lcd . fig4 ( a ) shows a glass substrate 40 with thin ( 50 to 500 nm ) polyimide layer ( pi - 1 ) followed by deposition and patterning of a metal grid 42 , such as sputtered mo . the grid will lie beneath the rows and columns when the tft array is completed . fig4 ( b ) shows a second , thicker ( 2 to 10 · m ) polyimide layer ( pi - 2 ) spun on the surface of the plate , followed by a first sin passivation layer sin 1 and array of tfts 44 . the steps used to form the tfts are the same as those used in the existing eplar process . polyimide can easily withstand standard processing temperatures and chemicals . fig4 ( c ) shows the tft array finished with field shielded pixel processes , giving a polymer passivation layer 46 over the tfts , and a pixel electrode 47 associated with each tft . the layer 46 is a clear non - birefringent plastic , as explained above , for example bcb . it preferably has a thickness of 1 to 10 · m , more preferably 1 to 5 · m , with dielectric constant 1 to 5 . the pixel electrodes overlie the tfts as explained above , thus forming a fsp configuration . fig4 ( d ) shows an lcd polyimide alignment layer 48 spun onto the surface of the tft array . a rubbing process is used to orientate the lc material . spacers 50 are then added . these are designed to hold the lc cell spacing constant and not allow the substrates to separate . both tacky spheres and active cell spacers that are defined photolithographically have been reported for this purpose . fig4 ( e ) to ( h ) show the steps to fabricate the passive plate . in fig4 ( e ), the colour filter glass substrate 60 is also coated with a thin polyimide layer pi - 1 and a metal grid 62 that will surround the pixels . fig4 ( f ) shows a thicker polyimide layer ( pi - 2 ) and passivation layer sin 1 applied to the colour filter substrate . so far the processing is identical to the first few steps of the processing of the tft plate . fig4 ( g ) shows colour filter material 63 applied on the passivation layer sin 1 , using a standard colour filter process . this is typically formed of 2 to 3 · m thick layers of coloured polymer patterned to the pixel shape . there would normally be a black mask layer beneath the coloured pixels for standard glass am - lcds , but functionally this can be replaced by the metal grid 62 . therefore this process does not increase the mask count for the colour filter plate . fig4 ( h ) shows a planarisation layer 64 , ito common electrode layer 66 and lcd alignment layer 68 on top of the colour filters , which can be implemented with standard am - lcd processes . fig4 ( i ) to ( q ) show the steps to fabricate the display . fig4 ( i ) shows the cell making involving alignment of the top and bottom plates ( active plate 40 and passive plate 60 ), which is again a standard amlcd process . the spacer defines the cell gap . for small cells the glass plates would be cut into strips at this stage . fig4 ( j ) shows cell filling with lcd 70 , using a standard amlcd process . typically after this step the strips will be separated into individual cells . fig4 ( k ) shows the glass substrate 60 on the colour filter side removed by a laser process , as used in the eplar process . the laser light is absorbed in the polyimide layer pi - 1 of the colour filter substrate . the main structural layer that remains is polyimide , which has good strength and has proven to be suitable for use with laser release . in fig4 ( l ), the top polyimide layers are shown as etched by an oxygen plasma in a reactive ion etch ( rie ) system . the metal grid functions as a mask . the rie is highly anisotropic , so there will be little , if any , underetch beneath the metal grid . pi - 1 will be completely removed and pi - 2 will be removed everywhere that it is not covered by the metal grid . the rie etch stops at the silicon nitride layer sin 1 of the colour filter substrate , and the metal grid because oxygen plasmas do not etch these materials . fig4 ( m ) shows a polariser sheet 70 laminated onto the top of the tft array . this will give the array greater mechanical strength . other optical enhancement and protective sheets can also be laminated at this stage . after lamination of the polariser sheet , the row and column interconnects will be made , preferably using a chip - on - glass process . fig4 ( n ) shows the laser release of the active plate glass substrate 40 . as shown in fig4 ( o ), the cell is turned over for processing . in fig4 ( p ), the two polyimide layers pi - 1 and pi - 2 on tft active plate are rie etched by an o 2 plasma down to metal grid and the layer sin 1 . fig4 ( q ) shows an active plate polariser 72 laminated to complete the process , along with any optical enhancement or protective films that are needed for the performance demanded for these cells . the polyimide grid on the tft plate lies underneath the tft array rows and columns , so it would not affect optical performance . the polyimide layer could also be left in the interconnect areas to provide additional mechanical strength in these regions . fig5 shows the macroscopic view of the display making and interconnect process , and shows the polyimide ( and metal grid material ) 80 remaining beneath the interconnect areas . region 81 is the optically active area of the cell with a polyimide grid between the pixels . the external metal grid could be removed by a dip etch , if needed . the explanation of the invention given above demonstrates what would happen in the middle of the display area , and has not described the interconnects to driver electronics , or the scribe and break processes to separate the displays from the mother glass . in reality , one of the great strengths of the eplar process is that it allows interconnects for flexible displays to be made in exactly the same way as they are for glass displays . fig6 shows the glass scribing and cell filling sequence for large numbers of small displays made on large glass substrates . in fig6 ( a ), displays are first made by aligning the active and passive plates . the display areas 82 that will contain the liquid crystal material are defined by a printed seal - line around the pixel array . within the display area there are cell spacers . the glass plates are first scribed horizontally along scribe lines 84 . the passive plate is scribed so that it almost the same size as the lc cell . the active plate is scribed so that there is a ledge that extends beyond the cell ( see fig7 below ), which contains the area for column tcps ( tape chip packages ) or cog ( chip on glass ) connection . the displays are then broken into strips along the scribe lines . this corresponds to the step of fig4 ( i ) above . cell filling is carried out on multiple cells in strips as shown in fig6 ( c ). filling is through a small gap in the seal - line , which is sealed after cell filling . this corresponds to step 4 ( j ). fig6 ( c ) shows the strips of glass scribed vertically . again the tft glass is scribed to leave an edge for the row interconnects while the passive plate scribe lines are close to the edge of the display . fig6 ( d ) shows singulation of the cells . interconnects would be made at this stage for normal displays on glass . electrical interconnects are made after cell singulation . the scribe lines for the two substrates are not the same . fig7 shows the relative size of the substrates after cell making and where tcp ( tape chip packages ) or cog ( chip on glass ) are connected to the tft substrate . in fig7 ( a ), the substrate size and position for tcp drivers is shown . the row tcp driver is shown as 86 , and the column tcp driver is shown as 87 . the tft substrate 88 is larger than the colour filter substrate 89 , extending to give ledges along two sides for row and column lead - in areas . fig7 ( b ) shows the substrate size and position for cog drivers . the column chip - on - glass is shown as 90 and the row chip - on - glass is shown as 92 . a driver signal foil is shown as 94 . during the rie process in fig4 ( p ) the driver foils are already applied to the tft substrate . the foils could be simply protected by having cut - outs in a shield that goes over the displays during the rie process , exposing the display area while protecting the interconnect area and driver foils , as shown in fig8 . fig8 shows the rie of polyimide layers pi - 1 and pi - 2 of the tft substrate using an o 2 plasma 96 . the interconnect foils 100 are protected by plasma shields 102 . during the etching , a support platen 104 is used . the region 106 is where the pi - 2 polyimide layer is etched . multiple displays can be etched at the same time , with the interconnect foils bent down into recesses to improve productivity . a second embodiment is shown in fig9 , in which all the external polyimide is removed . fig9 shows the finished display device , corresponding to fig4 ( q ). by leaving no polyimide on the outside of the lcd cell , some process steps can be omitted , namely the layer pi - 1 and the metal grid in fig4 ( a ) and 4 ( e ) above . by removing the metal grid from the colour filter substrates , it is necessary to reintroduce the black mask layer 110 in the colour filter to prevent light leakage , as shown . the disadvantage of totally removing the external polyimide is that the polyimide reinforcement from the grid in the display area is removed , as well as the continuous polyimide layer in the interconnect area . the particular design and application for which it is designed will determine whether or not this is possible . a lower cost barrel etcher rather than an rie system can then be used to remove the polyimide because anisotropic etching is not necessary . a third embodiment is shown in fig1 which uses external colour filters . this has significant advantages because all of the patterning is carried out on the active plate , there is no need for accurate plate - to - plate coupling and it can have higher optical aperture than any other displays made to date . fig1 ( a ) to 10 ( d ) correspond to fig4 ( a ) to 4 ( d ). the passive plate processing is different . fig1 ( e ) shows a polyimide layer 120 and sin passivation layer sin 1 applied to the passive substrate . in fig1 ( f ), a clear polymer 122 , such as bcb or silicone , is applied to sin 1 , followed by ito 123 and a polyimide alignment layer 124 . the ito and polyimide alignment layer are standard lcd processes . in fig1 ( g ) and 10 ( h ) cell making and filling is shown . this is simpler than assembly of standard colour lcds because there is no pattern on the passive plate . this means that there is no need to align the two plates accurately . for small displays the cells will be cut into strips at this stage . in fig1 ( i ) a laser release is used to remove the glass substrate on the passive plate side of the display . fig1 ( j ) shows plasma etching to remove the polyimide from the passive plate side of the display . fig1 ( k ) shows a polariser sheet 126 applied to the passive plate side of the display , and then turned over for further processing . in fig1 ( i ), rie etching of the polyimide layers is implemented down to the sin 1 , which acts as an etch stop . this leaves wells 128 above the tft plate pixels . for successful ink jet printing of the colour filter inks in the wells , the sin 1 at the bottom of the wells is hydrophilic and the metal grid on top of the polyimide columns is hydrophobic . oxygen and fluorinated gasses can be used for this purpose . fig1 ( m ) shows a first ink 130 ( e . g . blue ) fired into every third polyimide well . inkjet printing into passive plates is already used for mass production of colour filters . completion of colour filter inkjet printing with red and green inks is shown in fig1 ( n ) to form rgb colour filters 132 . in fig1 ( o ) an overcoat 134 is applied to seal in the colour filters . this can be done by ink jet printing or spin coating . fig1 ( p ) shows a polariser sheet 136 laminated onto sin 1 on the active plate side of the array . in this embodiment there is no polyimide left on the passive plate side for reinforcement . it will probably not be needed because there are no driver connections on this side , but polyimide could be left on the substrate if needed . the process above can be modified to leave one plate of glass , by not removing the passive plate glass substrate in step 10 ( i ) above . this would make a thinner glass display with all of the added advantages of high optical aperture and complicated processing confined to one plate and no accurate plate coupling needed . the polariser foil would then be applied to the glass substrate . the glass substrate could be thinner than those used for normal tft processing because they do not need to go through high temperature processes , etching or spinning . etching could also thin them in the normal way , if necessary . various other modifications will be apparent to those skilled in the art . | 7 |
referring firstly to fig1 a - 1d , a tensile switchable supporting frame 1000 of the present invention comprises a frame body 1 , a pivoting shaft 2 , a base 3 and an adjustable tensile structure 4 . the base 3 is pivoted to the frame body 1 via the pivoting shaft 2 so that the frame body 1 is capable of pivoting with respect to the base 3 . the adjustable tensile structure 4 is disposed on the base 3 and can be connected with the pivoting shaft 2 so that the pivoting shaft 2 can drive the adjustable tensile structure 4 to move , as shown in fig2 a - 2c . in order to clearly show the detailed operation mechanism of the adjustable tensile structure 4 when the tensile switchable supporting frame 1000 of the present invention is folded , the frame body 1 is omitted in fig2 c . the detailed structure of the adjustable tensile structure 4 and its operational relations with other elements will be detailed hereinbelow . the adjustable tensile structure 4 comprises an accommodating base 41 , three connecting strings 42 , a first elastic module 43 , a second elastic module 44 , a third elastic module 45 , a positioning plate 46 , a first connecting element 47 and two second connecting elements 48 . the accommodating base 41 is slidably disposed on the base 3 , and two ends of each of the connecting strings 42 are engaged with the pivoting shaft 2 and the accommodating base 41 respectively . when the frame body 1 is folded towards the base 3 so that the frame body 1 pivots with respect to the base 3 , the pivoting shaft 2 pivots along with the frame body 1 to drive the connecting string 42 and the accommodating base 41 to move . specifically , in the adjustable tensile structure 4 of this embodiment , the pivoting shaft 2 comprises three first engaging grooves 20 , the accommodating base 41 comprises three second engaging grooves 410 , and two ends of each of the connecting strings 42 are respectively provided with a protrusion 420 a . the pair of the protrusions 420 a of each connecting strings 42 are correspondingly engaged into a corresponding one of the first engaging grooves 20 and into a corresponding one of the second engaging grooves 410 respectively . it should be noted that each of the connecting strings 42 winds around a part of the surface of the pivoting shaft 2 . accordingly , when the pivoting shaft 2 pivots , each of the connecting strings 42 can be pulled to drive the accommodating base 41 to slide with respect to the base 3 . additionally , the numbers of the connecting strings 42 , of the first engaging grooves 20 and of the second engaging grooves 410 can be correspondingly adjusted in coordination with each other as needed , and one set or more than four sets may be used . next , the structure of the first elastic module 43 and its corresponding connection relations with the accommodating base 41 and the base 3 will be described . the first elastic module 43 is disposed in the accommodating base 41 , and comprises two first tension springs 430 . the accommodating base 41 comprises a plurality of first protrusions 411 , and the base 3 correspondingly comprises a plurality of second protrusions 35 so that two ends of each of the first tension springs 430 are connected with a corresponding one of the first protrusions 411 and a corresponding one of the second protrusions 35 respectively . furthermore , in this embodiment , each of the first protrusions 411 and each of the second protrusions 35 are formed respectively by locking a screw onto the accommodating base 41 and the base 3 ( see fig1 b ). accordingly , the height of each of the first protrusions 411 and each of the second protrusions 35 can be adjusted according to the thickness of each of the ends of each of the tension springs . then , the connection relations between the second elastic module 44 , the accommodating base 41 , the positioning plate 46 and the first connecting element 47 will be described in further details . the second elastic module 44 comprises two second tension springs 440 ; the first connecting element 47 comprises two first extension portions 471 and a first column 470 ; and the positioning plate 46 comprises a first groove 460 . the first groove 460 has a first sliding region 460 a and a first limiting region 460 b that are intercommunicated with each other and extend in different directions . that is , the first sliding region 460 a and the first limiting region 460 b intersect with each other at an angle . in this embodiment , the first sliding region 460 a is parallel to a tensioning direction d of each of the second tension springs 440 ; and the first sliding region 460 a and the first limiting region 460 b are perpendicular to each other , with the angle of 90 °, to present a generally l - shaped form . the second elastic module 44 is disposed in the accommodating base 41 , and two ends of each of the second tension springs 440 are connected with the corresponding first protrusion 411 of the accommodating base 41 and the corresponding first extension portion 471 respectively . the first column 470 penetrates through the first groove 460 , and selectively moves between the first sliding region 460 a and the first limiting region 460 b . the connection relations between the third elastic module 45 , the accommodating base 41 , the positioning plate 46 and the second connecting elements 48 will be described in further details . the third elastic module 45 comprises two third tension springs 450 . each of the second connecting elements 48 comprises a second extension portion 481 and a second column 480 . the positioning plate 46 further comprises two second grooves 461 . each of the second grooves 461 has a second sliding region 461 a and a second limiting region 461 b that communicate with each other and extend in different directions . that is , the second sliding region 461 a and the second limiting region 461 b intersect with each other at an angle . in this embodiment , the second sliding region 461 a and the second limiting region 461 b are perpendicular to each other , with the angle of 90 °, in the same manner as what described above in respect of the first sliding region 460 a and the first limiting region 460 b . the third elastic module 45 is disposed in the accommodating base 41 , and two ends of each of the third elastic modules 45 are correspondingly connected with a corresponding one of the first protrusions 411 and a corresponding one of the second extension portions 481 so that the two ends of each of the third elastic modules 45 are connected with the accommodating base 41 and the second connecting element 48 respectively . each of the second columns 480 penetrates through a corresponding one of the second grooves 461 and selectively moves between each of the second sliding regions 461 a and a corresponding one of the second limiting regions 461 b . accordingly , the third elastic module 45 is connected with the accommodating base 41 and the second connecting element 48 respectively , and the positioning plate 46 is connected with each of the third tension springs 450 via the second connecting element 48 . additionally , in other embodiments of the present invention , the numbers of the first tension springs 430 , the first protrusions 411 and the second protrusions 35 , the numbers of the second tension springs 440 and the first extension portions 471 , and the numbers of the third tension springs 450 , the second connecting elements 48 and the second grooves 461 can all be adjusted in coordination with each other as needed . please refer to fig1 a , fig1 b and fig1 d . the connection relation between the positioning plate 46 and the base 3 will be described hereinafter . the base 3 comprises a through hole 30 , an adjusting knob 31 , a positioning column 32 , an upper surface 33 and a lower surface 34 . the positioning plate 46 comprises a first positioning hole 462 a , a second positioning hole 462 b and a third positioning hole 462 c that are intercommunicated with each other . the adjusting knob 31 is slidably disposed on a lower surface 34 of the base 3 by penetrating the through hole 30 , with a sliding direction thereof being substantially perpendicular to the tensioning direction d . the adjusting knob 31 has two fixing columns 31 a that extend to be fixed to the positioning plate 46 . the positioning column 32 is fixedly disposed on an upper surface 33 of the base 3 . it is noted that the adjusting knob 31 is disposed on the lower surface 34 of the base 3 and accommodated in the through hole 30 without protruding from the lower surface 34 of the base 3 so as to avoid leaning of the supporting frame 1000 when being placed . furthermore , the user will switch the adjusting knob 31 on the lower surface 34 to keep the hands thereof away from the upper surface 33 of the base 3 , thereby avoiding jamming of the hands due to an accidental folding of the frame body 1 . please refer to fig1 a and fig1 b . when the adjusting knob 31 slides in the through hole 30 , the positioning plate 46 is driven to slide so that the positioning column 32 can slide between the first positioning hole 462 a , the second positioning hole 462 b and the third positioning hole 462 c . more specifically , referring to fig1 a and fig1 b , the positioning column 32 is consisted of two elastic pieces 32 a with a gap therebetween . the first positioning hole 462 a , the second positioning hole 462 b and the third positioning hole 462 c communicate with each other via a channel 462 d respectively , and a width of the channel 462 d is smaller than a diameter of each of the positioning holes . therefore , when the adjusting knob 31 is slid to move the positioning column 32 to the channel 462 d , the elastic pieces 32 a can be compressed , due to the gap therebetween , and become close to each other , so as to pass through the channel 462 d . and when the positioning column 32 moves to each of the positioning holes 462 a , 462 b and 462 c , the elastic pieces 32 a restores to the original shape to keep the gap therebetween so that the positioning column 32 can stay at each of the positioning holes . finally , please refer to fig1 a and fig1 b . the frame body 1 is further connected with a connecting base 5 , and the connecting base 5 may be used to be connected with a display module ( not shown in the figures ). in this embodiment , the tensile switchable supporting frame 1000 allows for a three - stage adjustment . operational relations among individual elements when the supporting frame 1000 is adjusted to a first stage , a second stage and a third stage will be described hereinafter . firstly , when the supporting frame 1000 is adjusted to the first stage and the adjusting knob 31 slides to a first location l 1 ( see fig1 d ), the positioning column 32 is engaged into the first positioning hole 462 a so that the positioning plate 46 is positioned at a first position p 1 , as shown in fig1 a . in this case , the first column 470 is positioned in the first sliding region 460 a , and the first column 470 is located at a first end 4601 of the first sliding region 460 a , as shown in fig1 c . at this point , the connecting base 5 has the furthest distance from the base 3 ( i . e ., the display module is located at the highest position ). when the user needs to adjust the height of the display module by moving the connecting base 5 downwards towards the base 3 , the frame body 1 and the pivoting shaft 2 are driven to pivot to get close to the base 3 at the same time . according to the above descriptions and as shown in fig2 c , when the frame body 1 is folded towards the base 3 , the connecting string 42 is winded by the pivoting shaft 2 to pull the accommodating base 41 so to tension the first elastic module 43 . meanwhile , the first connecting element 47 is driven by the accommodating base 41 via the second elastic module 44 to slide the first column 470 from the first end 4601 towards a second end 4602 of the first sliding region 460 a . that is , because the first sliding region 460 a extends in a direction parallel to a tensioning direction d of the second tension spring 440 , the first column 470 can slide in the first sliding region 460 a ; and in a case that one end of the second tension spring 440 is not fixed , each of the second tension springs 440 is not tensioned and only the first tension spring 430 of the first elastic module 43 is tensioned . in other words , only the first tension spring 430 provides a tensile force to achieve a supporting effect during the folding process . referring to fig3 a and fig3 b , when the supporting frame 1000 is adjusted to the second stage and the adjusting knob 31 slides to a second location l 2 , the positioning plate 46 is slid with respect to the base 3 so that the positioning column 32 engages into the second positioning hole 462 b . the positioning plate 46 is positioned at a second position p 2 , and the first column 470 is positioned in the first limiting region 460 b . referring to fig3 c , when the frame body 1 is folded towards the base 3 , the connecting string 42 is winded by the pivoting shaft 2 to pull the accommodating base 41 . because the first limiting region 460 b is perpendicular to the tensioning direction d , the first column 470 positioned in the first limiting region 460 b is limited from sliding . thus , each of the second tension springs 440 is capable of being tensioned . therefore , in the folding process , the first tension springs 430 and the second tension springs 440 are tensioned at the same time , and as a result , a heavier display module can be supported now . it should be particularly noted that , in the aforesaid first stage or second stage ( i . e ., when the adjusting knob 31 is positioned at one of the first location l 1 or the second location l 2 ), none of the third tension springs 450 of the third elastic module 45 will be tensioned during the folding process . this is because that a second width w 2 of the second sliding region 461 a is greater than a first width w 1 of the first sliding region 460 a ( see fig1 b ). so , even if the positioning plate 46 is adjusted from the first position p 1 to the second position p 2 ( i . e ., moves towards the top left corner in fig1 b ), the second column 480 will still stay in the second sliding region 461 a . therefore , the third tension spring 450 will not be tensioned . referring to fig4 b , when the supporting frame 1000 is adjusted to the third stage ( i . e ., when the adjusting knob 31 slides to a third location l 3 ), the positioning plate 46 is driven to slide with respect to the base 3 so that the positioning column 32 engages into the third positioning hole 462 c and the positioning plate 46 is positioned at the third position p 3 , as shown in fig4 a . in this case , the second column 480 moves into the second limiting region 461 b . referring to fig4 c , when the frame body 1 is folded towards the base 3 , the connecting string 42 is winded by the pivoting shaft 2 to pull the accommodating base 41 . because the first limiting region 460 b and the second limiting region 461 b are both perpendicular to the tensioning direction d , the first column 470 and the second column 480 are limited from sliding . therefore , the first tension spring 430 , the second tension spring 440 and the third tension spring 450 are tensioned at the same time . accordingly , by positioning the positioning plate 26 at the first position p 1 , the second position p 2 or the third position p 3 , the supporting frame 1000 of this embodiment can be adjusted to the first stage , the second stage or the third stage to support display modules of different weights respectively , e . g ., a 20 - inch display module of 7 kg , a 21 - inch display module of 9 . 5 kg and a 23 - inch display module of 12 kg . however , this is not intended to limit the tensile forces of the first elastic module 43 , the second elastic module 44 and the third elastic module 45 , and the numbers of the first tension springs 430 , the second tension springs 440 and the third tension springs 450 and the tensile strengths thereof can be adjusted as needed . referring to fig1 a and fig1 b , in order to increase the loading force of the supporting frame 1000 , the tensile switchable supporting frame 1000 of this embodiment further comprises a torsional spring assembly 6 disposed on the base 3 and joined to the pivoting shaft 2 . the torsional spring assembly 6 comprises two torsional spring units 61 connectively sleeve on two sides of the pivoting shaft 2 respectively , to support the weight of display module together . however , in other embodiments of the present invention , the torsional spring assembly 6 may be omitted as needed . according to the above descriptions , by sliding the adjusting knob , the positioning plate can slide to different positions and the number of the elastic modules that are tensioned can be adjusted in multiple stages so that the user can correspondingly adjust the loading force of the supporting frame according to the weight of the purchased display module . furthermore , even if the user replaces the original display module with display modules of different weights , it is only necessary to make a corresponding adjustment by means of the adjusting knob without having to buy a suitable new supporting frame . additionally , the supporting frame of the present invention can provide the user with a better operational experience . the above disclosure is related to the detailed technical contents and inventive features thereof . people skilled in this field may proceed with a variety of modifications and replacements based on the disclosures and suggestions of the invention as described without departing from the characteristics thereof . nevertheless , although such modifications and replacements are not fully disclosed in the above descriptions , they have substantially been covered in the following claims as appended . | 5 |
the following examples relate to preferred methods and procedures for practicing the present invention . example 1 relates to a preferred method for the production of microparticulated protein from the proteinaceous material present in acidified whey . example 2 relates to a preferred method for the production of microparticulated protein from casein micelles and the proteinaceous material present in egg white . example 3 relates to the production of microparticulated protein from the proteinaceous material in whey . example 4 relates to the preparation of a viscous salad dressing . microbiologically , aromatically and particulately clean water produced by a reverse osmosis process is added to a sanitary tank . commercially available liquid whey protein concentrate is treated by ultrafiltration and evaporation until the concentration of protein is about 50 - 55 % by weight , on a dry basis . the whey protein concentrate is added to the water in the sanitary tank with agitation avoiding aeration through the suction side of a positive displacement pump to achieve a solids concentration of about 37 % solids for the mixture . as this mixture is recirculated back to the sanitary tank , a dilute solution of food acid ( acetic , lactic , citric or hydrochloric ; alone or in combination ) is added through an in - line mixer to lower the ph from about 6 . 8 to about 4 . 4 ± 0 . 05 . the ph adjusted mixture is then rigorously deaerated in a versator deaerator / homogenizeer and bottom fed into a holding tank which is equipped for nonaerating agitation . the deaerated mix is then pumped ( 300 lbs / hr ) from the holding tank , by a positive displacement pump through an in - line strainer ( 300 μm cheesecloth ) and a mass flow meter , into a plate heat exchanger which heats the mixture to about 165 °- 180 ° f ., a temperature lower than the target peak temperature which is achieved within a heat and shear generating apparatus (&# 34 ; microcooker &# 34 ;). flow is manually - controlled based on readings from the in - line flow - meter . the heated mixture is pumped directly from the plate heat exchanger into the microcooker apparatus as described in u . s . pat . no . 4 , 823 , 396 with the exception that the inlet and outlet ports have been interchanged or exchanged , i . e ., the inlet port is disposed where the outlet port is shown in the patent drawing and the outlet port is located at the bottom of the bowl shaped vessel and the temperature of the mixture is raised to about 200 ° f . within less than 10 seconds under high shear conditions . rigorous temperature control of the mixture is maintained at 200 ° f . by means of a cascade control loop . the control loop senses the temperature of the product exiting the microcooker and maintains it at 200 ° f . by adjusting the temperature of the mixture leaving the plate heat exchanger . the speed of the rotor in the microcooker is held constant , for example , at about 3715 rpm . at this rpm , the shear rate is about 27 , 000 reciprocal seconds at the tips of the rotor which has a diameter of approximately inches . after exiting the microcooker apparatus , the product flows directly into an eccentric scraped surface heat exchange and is cooled with vigorous agitation to less than 130 ° f . the cooled product then flows through additional heat exchangers ( scraped surface of plate type ) to reduce its temperature to less than 55 ° f . microbiologically , aromatically and particulately clean water ( 16 . 83 wt . %) produced by a reverse osmosis process is heated in a sanitary tank to about 120 ° f . commercially available apple pectin ( 0 . 35 wt . %) dry - blended with sugar ( 5 . 0 wt . %) to assure its complete dispersion and is then added to the water in the sanitary tank by means of a high shear solid / liquid triblender mixer . this mixture is held at about 120 °- 140 ° f . with agitation for about 5 minutes to assure hydration and dissolution of the pectin . the mixture is then cooled to less than about 100 ° f . liquid egg white is ultrafiltered using membrane filters having a molecular weight cut - off of about 10 , 000 . the ultrafiltration reduces the total volume of the liquid egg white by about 50 % and effectively doubles the protein content and halves the sodium content of the egg white . the treated egg white ( 55 wt . %) is added to the pectin solution through the suction side of a positive displacement pump with controlled agitation to avoid aeration . condensed skim milk ( 22 . 65 wt . %) is then added to the mixture through the suction side of a positive displacement pump . as this mixture is recirculated back to the sanitary tank , a dilute solution of food acid ( 0 . 17 wt . %) ( acetic , citric , lactic or hydrochloric ; alone or in combination ) is added through an in - line mixer to lower the ph from about 7 to about 6 . 20 ± 0 . 05 . the ph adjusted mix is then rigorously deaerated in a versator deaerator and bottom - fed into a holding tank which is equipped for non - aerating agitation . the deaerated mixture is then pumped ( 600 lb / hr ) from the holding tank , by a positive displacement pump through an in - line strainer ( 300 μm cheesecloth ) and a mass flow meter into a plate heat exchanger which heats the mixture to about 165 ° f ., a temperature lower than the target peak temperature which is achieved within the microcooker apparatus described in example 1 . at this lower temperature no coagulate will have developed . flow is manually - controlled based upon readings from the in - line flow - meter . the heated mixture is pumped directly from the plate heat exchanger into the microcooker apparatus and the temperature of the mixture is raised to about 185 ° f . within less than about 10 seconds under high sheer conditions . rigorous temperature control is maintained over the temperature of the mixture in the microcooker apparatus by a cascade control loop . the control loop senses the temperature of a product exiting the microcooker and holds the temperature constant by regulating the temperature of the mixture leaving the plate heat exchanger . the speed of the rotor in the microcooker is held constant at about 5400 rpm . at this rpm , the shear rate is about 40 , 000 reciprocal seconds at the tips of the rotor which has a diameter of approximately 7 inches . after exiting the microcooker apparatus , the product flows directly into an eccentric scraped surface heat exchanger and is cooled with vigorous agitation to less than 130 ° f . the cooled product then flows through additional heat exchangers ( scraped surface or plate type ) to reduce its temperature to less than 55 ° f . commercially available liquid whey is treated by ultrafiltration and evaporation to give a mixture having about 42 % by weight solids and about 50 % - 55 % by weight protein , on a dry basis . the resulting whey protein concentrate is deaerated in a versator deaerator and bottom fed into a sanitary tank equipped for a non - aerating agitation . the deaerated mixture is then pumped ( 600 lbs / hr ), by a positive displacement pump through an in - line strainer ( 300 μm cheesecloth ), a mass flow meter and plate heat exchanger which raises the temperature of the mixture to about 170 ° f ., into a heated holding device . the heated holding device includes two concentric scraped surface heat exchangers connected in series . within less than about 10 seconds under high sheer conditions . rigorous temperature control is maintained over the temperature of the mixture in the microcooker apparatus by a cascade control loop . the control loop senses the temperature of a product exiting the microcooker and holds the temperature constant by regulating the temperature of the mixture leaving the plate heat exchanger . the speed of the rotor in the microcooker is held constant at about 5400 rpm . at this rpm , the shear rate is about 40 , 000 reciprical seconds at the tips of the rotor which has a diameter of approximately 7 inches . after exiting the microcooker apparatus , the product flows directly into an eccentric scraped surface heat exchanger and is cooled with vigorous agitation to less than 130 ° f . the cooled product then flows through additional heat exchangers ( scraped surface or plate type ) to reduce its temperature to less than 55 ° f . commercially available liquid whey is treated by ultrafiltration and evaporation to give a mixture having about 42 % by weight solids and about 50 %- 55 % by weight protein , on a dry basis . the resulting whey protein concentrate is deaerated in a versator deaerator and bottom fed into a sanitary tank equipped for a non - aerating agitation . the deaerated mixture is then pumped ( 600 lbs / hr ), by a positive displacement pump through an in - line strainer ( 300 μm cheesecloth ), a mass flow meter and plate heat exchanger which raises the temperature of the mixture to about 170 ° f ., into a heated holding device . the heated holding device includes two concentric scraped surface heat exchangers connected in series . each heat exchanger provides a hold time of about 3 . 6 minutes at a flow rate of about 300 lbs / hr . both of these heat exchangers are heated to maintain the hold temperature set by the plate heat exchanger . the mixture is then pumped from the holding device to an eccentric scraped surface heat exchanger . this scraped surface heat exchanger cools the mixture to a temperature of about 165 ° f ., a temperature lower than the target peak temperature inside a heat and high shear generating apparatus ( microcooker ). the mixture then flows directly into the microcooker apparatus as described in example 1 and the temperature of the mixture is raised to 200 ° f . within 10 seconds under high shear conditions . rigorous temperature control at 200 ° f is maintained in the microcooker by a cascade control loop . the control loop senses the temperature of a product exiting the microcooker and holds the temperature constant by regulating the temperature of the mixture leaving the eccentric scraped surface heat exchanger . the speed of the rotor in the microcooker is held constant at about 5200 rpm . at this rpm , the shear rate is about 40 , 000 reciprocal seconds at the tips of the rotor which has a diameter of approximately 7 inches . after exiting the microcooker apparatus , the product flows directly into an eccentric scraped surface heat exchanger and is cooled with vigorous agitation to less than 130 ° f . the cooled product then flows through an additional heat exchanger ( scraped surface or plate type ) to reduce its temperature to less than 55 ° f . a viscous salad dressing is produced from the ingredients listed in table 1 . table 1______________________________________viscous salad dressingingredients wt . % of composition______________________________________water 25 - 45starch 3 - 6maltodextrin 0 . 2 - 3sugar 5 - 10salt 2 - 4cellulose gel 0 - 2gum / stabilizers 0 . 01 - 0 . 1spice 0 . 01 - 1 . 0potassium sorbate 0 . 05 - 0 . 3sodium benzoate 0 . 05 - 0 . 3edta 0 - 0 . 006vinegar ( 100 gr .) 5 - 15microparticulated protein 10 - 40pectin 0 . 01 - 0 . 1egg yolk 0 . 5 - 3 ( salted ) whole egg 2 - 5oil 0 - 20antioxidant 0 - 0 . 01______________________________________ the dry ingredients , food starch ( 4 . 3 %, dressn 400 starch ), maltodextrin ( 0 . 543 %, lodex 5 maltodextrin ), salt ( 2 . 74 %), sugar ( 8 . 7 %), spice ( 0 . 025 %, mccormick - stange ), edta ( 0 . 003 %, tri - k industries ), potassium sorbate ( 0 . 05 %, tri - k industries ), sodium benzoate ( 0 . 05 %, tri - k industries ) and antioxidant ( 0 . 01 %, sustane antioxidant q , uop ) were blended at ambient temperature and added to a mixture of water ( 34 . 86 %), cellulose gel ( 0 . 852 %, avicel cellulose gel ) and xanthan gum ( 0 . 012 %, keltrol - rd ). the combined mixture was then blended for 10 minutes . the vinegar ( 9 . 13 %, fleischmann ) was added slowly and the mixture was deaerated to give a starch base . the deaerated starch base was heated to 195 ° f . for 30 seconds in a high temperature short time plate pasteurizer and then cooled to 70 ° f . the remaining amount of water ( 0 . 4 wt .%) and the pectin ( 0 . 03 %, hercules jmj } were blended for 5 minutes in a jacketed kettle . the microparticulated protein ( produced according to the procedures of example 2 , 24 . 57 %) was added to the pectin and water and the mixture was blended for 30 minutes without whipping . the starch base , egg yolk ( 1 . 0 %), whole egg ( 3 . 135 %), and corn oil ( 9 . 99 %, adm ) were then added to the fat substitute and pectin mixture and blended for 15 minutes . the combined mixture was then passed through a kinematic mixer at a 45 % shear setting . finally , the sheared product was packaged at 70 ° f . numerous modifications and variations in practice of the invention are expected to occur to those skilled in the art upon consideration of the foregoing descriptions of preferred embodiments thereof . consequently , only such limitations should be placed upon the scope of the invention as appear in the appended claims . | 8 |
teletext signals consist of a sequence of pulses which can have one of two possible levels . one important feature of teletext decoding apparatus is its ability to function under adverse conditions . it is necessary to simulate adverse conditions in a manner that can be repeated , and maintained constant at a known level . the apparatus to be described below achieves this . before describing the apparatus in detail , it will be helpful if a number of terms to be used in the description are explained . firstly , the term &# 34 ; bar height &# 34 ; is defined as a constant level attained by reception of an infinite series of teletext pulses of the same polarity each displaced by a sampling time t . this is shown in fig1 . an &# 34 ; eye &# 34 ; diagram , as shown in fig2 can be formed from a data stream containing a succession of teletext pulses , the &# 34 ; eye &# 34 ; being the clear area in the centre of the diagram . this is achieved by feeding the data stream to the y trace of an oscilloscope , and feeding the data clock , in this example , divided by four and sinusoidally filtered , to the x trace . the &# 34 ; eye &# 34 ; diagram , so - called because the pattern resembles the shape of the human eye , is constructed by overlaying each data pulse at times spaced apart by the sampling or signalling interval . the important parameters of the data pulse affecting the shape of the &# 34 ; eye &# 34 ; diagram are shown in fig3 . before discussing fig3 it is necessary to explain positive and negative pulse signalling . to make the mathematical construction of the eye diagram easier , it is convenient to choose a negative half amplitude data pulse to represent the [ 0 ] state of the data , and a positive half amplitude data pulse to represent the [ 1 ] state of the data . this can always be one in a band - limited line system and is an alternative form of representation to representing the ( 1 ) state by a positive pulse and the ( 0 ) state by no - pulse or zero volts . the process is shown graphically in fig4 . when the two half amplitude pulse sequences of opposite sign are added together they can be seen to be equivalent to the positive pulse / no pulse waveform . fig3 shows a positive and negative half amplitude elemental data pulse of height f ( 0 ). the construction of the bar of height b is shown dotted . the bar is constructed from an infinite series of data pulses displaced by the sampling time t , as previously shown in fig1 . the &# 34 ; eye &# 34 ; diagram is the overlapping , at multiples of the sampling interval , of all the possible sequences of positive and negative pulses . the construction of the positive half of the &# 34 ; eye &# 34 ; diagram can be seen from the following . an infinite sequence of positive pulses only , will produce a bar and hence a line across the eye diagram at height b above the centre line . an isolated positive pulse would produce the dotted trace at height β , the pulse height f ( o ), on the &# 34 ; eye &# 34 ; diagram . the sequence that would produce the minimum trace at height α , would be the sequence of both positive and negative pulses such that all the negative contributions at the sampling times of the positive pulses , and all the positive contributions at the sampling times of the negative pulses , diminish the positive pulse height by amount i . in fig3 the negative portions of the positive pulse which diminish the positive pulse height are | a 2 |, | a 3 | and | a 5 |. also the positive portions of the negative pulse which diminish the positive pulse height are | a 1 | and | a 4 |. the total amount by which the positive pulse is diminished is the sum of all these contributions ; | a 1 |+| a 2 |+| a 3 |+| a 4 |+| a 5 |= i . hence the minimum trace observed at point α will have a height f ( 6 )- i . the eyeheight is given by the ratio a / b which is ## equ1 ## where σ &# 39 ; denotes the k = 0 term has been omitted from thwe summation . by a similar reasoning , it can be seen that the positive contributions at the sampling time of the positive pulse and the negative contributions at the sampling time of the negative pulse , will augment the positive pulse height to produce a trace at γ of total height f ( 0 )+ i . the same reasoning can be applied to the negative pulse to obtain the symmetrical traces in the negative half of the &# 34 ; eye &# 34 ; diagram . sequences , other than those mentioned above , will produce many traces between points α and γ dependent on the sequence . this can be seen in the photograph of an eye pattern of actual data shown in fig2 . the term i is called intersymbol interference . this interference has the effect of bringing the inner edges of the eye closer together . the distance between the two edges at the central point is known as the &# 34 ; eyeheight &# 34 ; and is a measure of the amount of interference . if there is no intersymbol interference , the pulse height must be equal to the bar height and the eyeheight will be unity . the apparatus to be described allows the eyeheight to be altered in a controlled manner and forms the basis of apparatus for testing teletext decoders . the basis of the test apparatus is that the eye - height is degraded by introducing a positive echo pulse which does not overlap the main information carrying pulse and then a negative echo pulse which does not overlap either the main pulse or the positive echo . both the echoes are identical in shape to the main pulse . the main pulse shape has the property that the pulse height is equal to the bar height and has zero intersymbol interference . an example of this signal is shown in fig6 . it is preferred , but not essential for certain pulse shapes , that the spacing between the added positive and negative echo pulses be an integer multiple of the clock period t at which the main pulses are clocked . it can be shown that the eyeheight of the signal containing the main pulse and the two echoes is given by the following expression : however , the bar height , b , can be shown to be given by ## equ4 ## where k = number of clock pulses which is a simple linear relationship with echo pulse magnitude ` a `. hence it can be seen that the bar height , which determines the signal reference level , is unaffected by the addition of the two distortion pulses to the main pulse . as a result of the constant bar height the distorted pulse signal has the same pulse height relative to the bar as does the distorted signal . in the case of the present apparatus , the undistorted pulse has the same height as the bar , so that in consequence the distorted pulse also has the same height as the bar . that is to say , the pulse - to - bar ratio is unaffected by the addition of the distortion pulses . the test apparatus is shown in fig5 and comprises a store 10 which contains teletext information and feeds the information to a transmitter 11 which is controlled by a clock pulse generator 12 . the pulses from the generator 12 , after division in frequency by four , can be fed to the x - axis of an oscilloscope as indicated by the line designated x . the generator 12 also controls the operation of a mixed sync pulse generator 14 and a further pulse generator 15 , whose purpose will be explained later . when teletext data is present , i . e . during lines 17 / 18 and 330 / 331 of the field blanking time of a conventional video signal from the store 10 , each pulse of teletext data is fed to a circuit 16 for adding to it the positive and negative echo pulses . these pulses are derived from the teletext data and their amplitude is proportional to the amplitude of the teletext data pulse . the teletext data is stored as a digital signal . therefore , in order to separate the data pulse and the echo pulses , a digital delay can be introduced by clocking the pulses through a shift register and taking outputs from the shift register at appropriate points . the necessary delay can also be achieved using analogue delay circuits or analogue delay lines . in fig5 each data pulse is fed to a shift register 17 and to an amplitude control circuit 18 . the data pulse is clocked through half of the shift register 17 and an output is then fed to a gate 19 . the data pulse is then clocked through the remaining half of shift register 17 and a further output is fed to a gate 20 . the outputs from the gates 19 and 20 are fed to the amplitude control circuit 18 where each produces an echo pulse of precise amplitude which is independent of the amplitude of the output from the gates . similarly , the data pulse is transformed into a data pulse of precise amplitude in the circuit 18 . the echo pulses are fed to the positive and negative inputs , respectively , of an operational amplifier 21 so that one positive echo pulse and one negative echo pulse is produced for each data pulse . the echo pulses are then fed to an attenuating circuit 22 which controls the amplitude of the echo pulses which are then added to the data pulse in an adder circuit 23 and filtered to form a pulse train as shown in fig6 . this pulse train is then fed to an output where it can be fed to the y - axis of the oscilloscope . with the x - axis of the oscilloscope fed with a signal which is derived from the generator 12 , the y - axis from the output of the test apparatus and the z - axis from a blanking signal derived from the mixed sync pulse generator 14 , the waveform displayed by the oscilloscope will be as shown in fig2 . the effect of the z blanking signal on the oscilloscope is to render the display ineffective except when teletext data should be available . the sync pulses from the generator 14 are added to the signal shown in fig6 prior to the signal being fed to the oscilloscope , to form a normal t . v . signal . by adjusting the attenuation effected by the circuit 22 , the eyeheight can be adjusted linearly from 1 to 0 in a controlled manner , in a stepwise manner if required and the amount of adjustment can be indicated . the same basic apparatus can be used to degrade in a controlled and known manner , other test signals . one such test signal is shown in the bottom right of fig5 and is known as a 1 . 44t pulse / bar signal . this 1 . 44t pulse / bar signal is generated by the generator 15 during active line time of the picture and when no teletext data is being transmitted . once more , echo pulses are added , this time to both the bar and the pulse . the echoes applied to the pulse and bar can be switched off by means of a manual switch leaving only the teletext data containing the echo . this is achieved by means of block 25 in fig5 . the distortion that is applied to the data signal may be switched off during the initial parts of the data signal , particularly the synchronizing portion known as the run - in and the frame code which consist , respectively , of a 16 - bit group followed by an 8 - bit group of data pulses . in this way means is provided to assess the performance of data receivers in distinguishing correctly between ( 0 ) and ( 1 ) pulses in the information portion of the teletext signal , knowing that the synchronizing portion is undistorted and should therefore cause no difficulty to a receiver in achieving its essential initial data synchronization . that is to say the information - receiving portion of the receiver can be tested independently of the bit and word synchronizing portions . a further application of the apparatus is to measure the eyeheight of an incoming signal , once more by adding positive and negative echo signals . such apparatus is shown in fig7 . an input signal having an unknown eyeheight and an undefined pulse shape can be degraded in a precise manner by the following method . the signal is fed to a receiver which converts the signal into a ttl waveform . the data waveform is delayed and positive and negative ` echoes ` of the same magnitude are produced , as before . these echoes are however shaped to have a raised - cosine pulse shape and have the property that they have a magnitude a at one instant of the sampling time and are zero at all other instances of the sampling time . these echoes are then inserted back into the original data . the data now consisting of main pulses of undefined shapes followed by echoes of well - defined shape . it can be shown that the output eyeheight is given by the following expression : ## equ5 ## which is a linear reduction in eyeheight dependent on a which is the amplitude of the echo pulses , where b is the bar height . because both a positive and a negative echo of the same magnitude have been introduced , the level of the signal does not change . if the receiver which is an integral part of the above equipment is known to fail at a particular eyeheight , the unknown eyeheight of the input data stream can be measured . the incoming data is simply reduced in eyeheight until the receiver fails , at this point the output eyeheight of the system is known to be x , the limit of the receiver . the eyeheight x could be found by first inputting data of a known ` eyeheight ` h produced by apparatus similar to that shown in fig3 but it is not necessary to have the facility to alter the &# 34 ; eyeheight &# 34 ;. the unknown input ` eyeheight ` is then given by : ## equ7 ## wherein b 1 and b 2 are the level of each input signal and a 1 and a 2 are the magnitudes of echoes that have to be inserted for the reference input signal of eye height h and the unknown signal of eye height h in , respectively , for failure of the receiver . if the levels b 1 and b 2 are equal and are normalized to unity , the unknown eyeheight h - in becomes : the echo pulses can be added to the data pulse in positions other than those shown in fig6 . for example , they could both be added before the data pulse , or one could be added before and one added after the data pulse . in addition , more than two echo pulses can be added as long as the sum of the amplitudes of the positive echo pulses is equal to the sum of the amplitudes of the negative echo pulses . the test apparatus shown in fig5 is further improved by connecting a uhf or vhf modulator m to the y output of fig5 . this enables the test signals , previously described , to be input via the aerial socket of a conventional television set . this addition , enables the teletext circuits , contained within a domestic television set , to be easily tested . | 7 |
example embodiments will now be described more fully with reference to the accompanying drawings . the exemplary embodiments are provided so that this disclosure will be thorough , and will fully convey the scope to those who are skilled in the art . numerous specific details are set forth such as examples of specific components , devices , and methods , to provide a thorough understanding of embodiments of the present disclosure . it will be apparent to those skilled in the art that specific details need not be employed , that example embodiments may be embodied in many different forms and that neither should be construed to limit the scope of the disclosure . in some example embodiments , well - known processes , well - known device structures , and well - known technologies are not described in detail . referring primarily to fig1 , a hanger clip assembly 10 constructed in accordance with the teachings of the present disclosure is shown to generally include a clip unit 12 and a cord unit 14 . in its most basic application , clip unit 12 is configured and arranged to permit an “ article ” to be releasably clamped . as will be detailed , clip unit 12 is operable in either of a clamped mode or a released mode for permitting such an article to be releasably clamped . in addition , cord unit 14 is attached to clip unit 12 and is configured and arranged to define a closed loop 16 . closed loop 16 is adapted to permit cord unit 14 to be releasably attached to a “ support ” structure . in accordance with one exemplary environmental use of the present invention , fig7 illustrates a pair of hanger clip assemblies 10 that have clip units 12 releasably clamped to an article of clothing 18 and have cord units 14 releasably attached to a support structure shown as a deck rail 20 . those skilled in the art will appreciate that clothing 18 is only intended to be an example of an article that can be releasably clamped by clip unit 12 and that deck rail 20 is only intended to be an example of a support structure to which cord unit 14 can be releasably attached . with particular reference now to fig2 through 5 , an exemplary construction for clip unit 12 will be described in greater detail . clip unit 12 may include a clamp assembly 30 and a biasing member 32 . clamp assembly 30 can include a pair of facing and complementary clamp members 34 and 36 that are interconnected via a bridge member 38 . in particular , clamp members 34 and 36 are connected to bridge member 38 by a pair of living hinges 40 and 42 . biasing member 32 is generally c - shaped spring bracket 46 that is configured and arranged to be mounted over bridge member 38 and between clamp members 34 , 36 to normally bias clamp end portions 34 a , 36 a of clamp members 34 , 36 toward an engaged position . when clamp members 34 , 36 are located in the engaged position shown , due to the biasing applied thereto by spring bracket 46 , clip unit 12 is defined to be functioning in a closed or “ clamped ” mode . in this mode , handle end portions 34 b , 36 b of clamp members 34 , 36 are biased by biasing member 32 to a position displaced from each other . an inward force applied to handle portions 34 b , 36 b by the user functions to overcome the biasing force applied by spring bracket 46 and cause the clamp members 34 , 36 to move to an open or released position whereat clamp end portions 34 a , 36 a are displace . with clamp members 34 , 36 in the released position , clip unit 12 is defined to be functioning in an open or “ released ” mode . with continued reference to fig2 through 5 of the drawings , the enlarged handle portions 34 b , 36 b of clamp members 34 , 36 are generally loop - shaped and include an opening 50 , 52 . openings 50 , 52 are dimensioned to enable a user &# 39 ; s fingers to be comfortably received therein . finger pads 54 , 56 are provided between the terminal ends of handle portions 34 b , 36 b and openings 50 , 52 to provide the user with a frictional gripping surface to facilitate opening of clip unit 12 for moving it from its closed position into its released position . finger pads 54 , 56 can be adhesive attached to outer surfaces of clamp members 34 , 36 or can be mounted via an attachment pin 57 mounted in a throughbore . gripper pads 58 , 60 are provided between the facing surfaces of clamp end portions 34 a , 36 a of clamp members 34 , 36 and provide ridges or other indentations / projections that are adapted to engage and hold an article ( i . e ., a garment ) therebetween under the biasing force applied thereto by spring bracket 46 . intermediate portions 34 c , 36 c of clamp members 34 , 36 include a planar recess configured to be engaged by resilient legs 60 , 62 of spring bracket 46 . legs 60 , 62 are interconnected by a transverse flange 64 which is dimensioned to extend over and engage bridge member 38 of clip 30 . the upper ends of intermediate portions 34 c , 36 c are joined at opposite ends of bridge member 38 via living hinges 40 , 42 . in addition , a cylindrical housing 70 defining an arcuate recess 71 , which is suitably configured to receive a first end portion 72 of cord unit 14 , is formed at or attached to the underside surface of bridge member 38 . first end portion 72 of cord unit 14 is separated from closed loop 16 via a closure member , such as a bracket 74 , that is subsequently enclosed with a shrink wrap logo cover 76 . bracket 74 is positioned to maintain engagement of first end portion 72 within arcuate recess 71 of housing 70 and inhibit unintended disassembly of cord unit 14 from clip unit 12 . the length of closed loop 16 is selected to permit resilient cord material 78 to be used to releasably attach cord unit 14 to any available support structure . fig7 illustrates an arrangement where closed loop 16 surrounds deck rail 20 with clip units 12 passing therethrough to releasably fasten article 18 thereto . the specific length of loop 16 can be varied to provide portable hanging devices 10 of variable sizes for use in different places , environments and applications . additionally , it is possible to expand the cord length . as illustrated in phantom in fig6 , the cord is discontinuous and includes fasteners at each end . the fasteners enable the ends to slide on the respective attached cord enabling length adjustment of the cord unit . during assembly of hanger clip assembly 10 , clip unit 12 is initially assembled by installing u - shaped spring bracket 46 on bridge member 38 such that its resilient legs 60 , 62 exert a biasing force on clamp members 34 , 36 to establish the normally closed position . next , end portion 72 of closed loop 16 is disposed within recess 70 and bracket 745 is secured thereon to prevent removal of cord unit 14 from clip unit 12 . cover 76 is installed over bracket 74 to provide an aesthetic appearance . as noted , portable hanger clip assembly 10 is well suited for use in suspending an article from any support structure . one anticipated use is to suspend wet clothes from a support structure ( i . e ., chair , rail , tree , balcony , curtain rod , door handle , etc . to facilitate air drying . the foregoing description of the embodiments has been provided for purposes of illustration and description . it is not intended to be exhaustive or to limit the disclosure . individual elements or features of a particular embodiment are generally not limited to that particular embodiment , but , where applicable , are interchangeable and can be used in a selected embodiment , even if not specifically shown or described . the same may also be varied in many ways . such variations are not to be regarded as a departure from the disclosure , and all such modifications are intended to be included within the scope of the disclosure . | 3 |
referring to fig1 a concealed object detection system 100 includes a series of vertical posts 105 . multiple detectors 110 are mounted on each post 105 and are coupled to a signal processing system 115 that processes signals from the detectors 110 . the system provides low - cost , real - time , and user - friendly object detection using ultra - low power radar (& lt ;{ fraction ( 1 / 100 )} specific absorption rate “ sar ”). except for frequency band and system / antenna size , each detector 110 is comparable to a detector used for buried mine detection . in particular , the system 100 may be used to apply shallow buried plastic target detection technology to aviation security and other situations to detect explosives and other objects on the body of a person passing through the system . the current , advanced algorithms for the detection of buried land mines yield excellent detection (˜ 100 %) and very low false alarm rates (˜ 0 . 1 %). this result is achieved over widely varying material types and conditions , and may even be used to detect small , plastic - encased , buried antipersonnel mines . for example , the algorithms may be used to detect small plastic mines that are six centimeters in diameter and nearly one centimeter thick , which typically are buried from flush to the surface to five centimeters below the ground . larger plastic mines ( greater than ten centimeters in diameter ) often are buried up to fifteen centimeters deep . concealed object detection is technically similar to mine detection . the radar frequency ( rf ) signal is transmitted from the antenna and the reflected signal energy is detected and processed . the processing methodology determines when the reflected signal appears to be coming from a particular material to be detected ( e . g ., explosives ) and rejects all other reflections . in the case of mines , the algorithms have been very successful in the detection of explosives contained within a plastic housing . in the case of concealed objects on a person , such as explosives that have a form factor of one centimeter of thickness over an extended area of several centimeters in length and width , the detection methodology is similar . the algorithms ‘ see ’ the signal reflected from the person in the same way that the mine detection algorithms ‘ see ’ the signal reflected from the ground . when the explosives are present , the reflected signal will change . it is this change that is recognized by the algorithms and declared as a detection of the explosive material . one implementation uses only three detectors 110 , each of which is similar to a mine detection device . measurements are made over a signal bandwidth from 1 . 5 ghz to 10 ghz . this band is wider and of slightly higher frequency than is normally used for buried mine detection . because clothing transmits higher frequencies than several inches of soil , investigation of this wider band is desirable to support initial optimization of the parameters for the advanced algorithms . rf energy density is less than one hundredth of standard limits . the key factor determining performance is the application of the advanced algorithms to the measured data . in the implementation of fig1 it can be seen that ten detectors 110 are arranged vertically from top to bottom within each post 105 , and face outward from a wall 120 against which they are mounted . as referred to above , each detector 110 includes an antenna , which may include , for example , a cavity - backed spiral or horn antenna . the beam front 125 shows the approximate coverage and overlap of each antenna send / receive beam against the passenger body . it should be apparent from fig1 and from the description herein that four posts 105 and sets of detectors 110 may be used to cover each side ( front , back , and right / left ) of a given passenger . the detector ( s ) 110 may be connected to the electronics box 115 by any conventional means , including , for example , coaxial cable . fig2 illustrates signals produced by the system of fig1 in response to concealed explosives . in particular , fig2 illustrates an amplitude response signal 200 and a time delay signal 205 produced in response to a body 210 that includes an explosive 215 positioned under a clothing layer 220 . as shown , both of the signals 200 and 205 include significant level changes in response to the explosive 215 . the reflection from explosives differs from that of the body based on the material dielectric properties . the signal passes through the explosives , reflects off the body , and passes back through the explosives . as shown , the portion of the signal that encounters the explosive is attenuated and time delayed relative to the reflection from the body alone . fig3 illustrates a signal 300 produced when a person is carrying a concealed boxcutter relative to a signal 305 produced when the person is not carrying a concealed boxcutter . rf energy interacts with the body depending on frequency : the body absorbs from 30 to 300 mhz , partially absorbs from 300 mhz to 6 ghz , partially or diffusely reflects from 6 ghz to 15 ghz , and highly / specularly reflects at & gt ; 15 ghz . previous attempts using frequencies in the highly - reflective region ka - band ( 27 to 33 ghz ) produced specular reflection images , which made processing to detect the concealed objects difficult . ku - band ( 12 to 18 ghz ) studies produced slightly better results but straddled the transition from diffuse to specular reflection at 15 ghz . the techniques may employ the absorption / reflection transition frequency region from 1 . 5 to 10 ghz . in this region , specific frequencies that maintain high dielectric differences between explosives and the body surface coexist with diffuse reflection from the skin and shallow body depths . this maintains radar cross section or reflection of the target without spoofing the detection process through specular reflection above 12 ghz and without driving the radar cross section to unacceptably low levels below 1 ghz . in the region from 1 . 5 to 10 ghz , the explosives dielectric is near 3 , while the body covers ranges of 5 for fat , 10 for bone , 40 for skin , and 50 for muscle . this compares well with the mine detection problem , where the explosives dielectric near 3 was embedded in dielectrics between 4 for sand and 20 for wet loam . the clothing dielectric is near 1 . 1 ( with air at 1 . 0 ) and therefore provides no significant reflection or effect on the rf energy . the higher dielectric is behind the target , and there is typically much greater difference between the explosive dielectric and the body ( for example , explosive to sand is a difference of 1 ; explosive to skin is a difference of 37 ). mine detection equipment transmits 10 milliwatts and yet enough of a signal penetrates soils that have high attenuation characteristics to achieve excellent performance . measurements will be made to determine the minimum possible transmitted signal strength to achieve scanner performance through clothing . allowable general population / uncontrolled exposure sets the toughest limit on exposure to rf radiation . at the frequencies of interests , the allowable density is 1 mw / cm2 ( fcc ) for 30 minutes averaging or about ⅕ to { fraction ( 1 / 10 )} of controlled exposure limits ( ieee and osha ) for 6 minutes averaging time . at the surface of the transmitter , a density of 0 . 1 mw / cm2 is anticipated . exposure through the portal is for less than 10 seconds or about { fraction ( 1 / 200 )} the allowed time period ; this combined with the { fraction ( 1 / 10 )} lower maximum energy density yields a very safe { fraction ( 1 / 2000 )} exposure margin . note : for cell phones 600 mw is allowed ; one could place his head against a transmitter at maximum power of 10 mw and still be { fraction ( 1 / 60 )} of this criteria as well .) the proposed portal system is also well below the specific absorption rate ( sar ) limit of 0 . 4 w / kg . even if somehow an individual absorbed the rf energy from all 40 transmitters employed in one implementation of a portal - based detection system simultaneously , which is physically impossible , the total would be 0 . 008 w / kg for a typical 50 kg individual . this is 50 times less than required ; typical exposure to the two corner set of 20 transmitters would be 100 times less . the walk - through portal scanner of fig1 provides a multi - beam , whole body , low - resolution surface reflectivity imager . as the person walks through the portal scanner , the beams scan first the left side of the body , then the front of the body , then the back of the body , and finally the right side of the body . the actual beam spot size is 5 cm in diameter , and no distance / depth resolution is processed by the algorithms . thus , no surface contour image is provided , only the surface reflectivity is measured . the vertical array of beams scans horizontally and vertically . the array of beams scan only a small vertical angle . together with the horizontal scanning of the array , the surface reflectivity of the person for the left and right sides and the front and back is collected . a flat two - dimensional display is then created of the reflectivity measurements . the rf models that have been developed , updated , and correlated with mine radar background and target characteristics , are extended to the aviation security scenarios through use of the described radar system . the models include target cross - section , snr , and algorithm receiver operating characteristics ( roc ) curves . radar data is collected against targets ( recent examples being the buried mines ) and segregated into algorithm training and testing groups . typically , enough data is collected to separate the groups wholly ( to demonstrate the required pd and far at 90 % confidence , for example ). alternatively , so - called ‘ leave - one - out ’ testing may be performed to achieve nearly the same statistical significance with half the data . training and testing on the same data ( train a / test a ) only provides a lower bound on the bayes error for the population distribution . train a / test b ( or equivalently , leave - one - out training / testing ) provides the upper bound on the bayes error that is practically a more useful predictor of system performance . system performance may be defined in view of pd versus far . both pd and far are evaluated together , preferably using roc curve methodology including confidence intervals . there are two measures of far , per individual and per group . for the former case , using 1 . 75 m 2 for surface area , if the system performance is similar to the mine detection performance , then scaling this performance along the roc curve yields a 2 % far per individual at the required 90 % pd . only 1 in 50 individuals would have to be rescanned using a handheld device , assuming individual and group statistics are similar . an example of the tradeoff between pd and individual far is shown in fig4 . for the aviation security problem , significantly better performance ( near 100 % pd and near 0 far ) is expected because of the relatively controlled / benign environmental factors involved , versus the unconstrained , outdoor , small mine detection problem . specifically , the mine detection technology was designed and successfully tested against three types of backgrounds : gravel , grass , and bare soil . these terrains included , for example , buried roots and rocks . the targets included a 6 cm circular plastic encased explosive that is significantly smaller than a baseline 10 cm by 7 . 6 cm ‘ wallet ’ target . use of radar technology permits the system to provide real - time alerts . typically , a real - time alert is in the form of an audio signal . in some implementations , a two - dimensional offline image is provided to indicate the on - body position of detected objects . for example , icons representing detected objects may be presented on a notional / universal wire - frame body to indicate the location and size of the detected objects . typically , no actual imagery of either the object itself or the subject body will be created or displayed . the two - dimensional plot includes icon and text overlays that indicate the object position and size with absolutely no operator training or interpretation required . detection of concealed metallic or plastic objects poses a significant challenge for the radar hardware . current short pulse or video penetrating radar systems are sensitivity limited by problems with extraneous signal interference competing with the desired signal . the result is an unrecognizable signal , and even after processing and display , the data is unusable . the signal interference arises in most cases due to mismatches in components internal to the radar system , not from external sources . some of the specifics are : ( 1 ) antenna mismatch due to bandwidth limitations and dispersion ; ( 2 ) transmitter waveform sidelobes ; ( 3 ) multiple transmitter / receiver / antenna reflections due to mismatch impedances ; and ( 4 ) non - uniform bandwidth , no absolute control of transmitter . the described frequency stepped radar system design eliminates the problems of the current ‘ short - pulse ’ radar systems to allow for an increase in measurement capability . bandwidth control improves detection of small , non - metallic objects and plastic objects with small cross sections , and a reduction in interference improves sensitivity and signal clarity . the frequency - stepped radar permits operation at an rf duty factor approaching unity , to remove the short - pulse radar requirement that the rf equipment ( transmitter , antenna , and receiver ) be instantaneously broadband . it also achieves a fully coherent radar capability while retaining ( and expanding ) the achievable high - range resolution capability . the significance of the high rf duty factor is that the thermal - noise - limited detection sensitivity of the radar can be achieved using readily available components . in fact , with the high - rf , duty - factor - stepped frequency waveform , the sensitivity limit is dictated by parameters related to the environment in which objects are located . the frequency - stepped radar is fully coherent which allows for compensation of hardware amplitude and phase ( dispersion ) errors over the operating rf band . a bi - static system ( separate transmit and receive antennas ) is used with appropriate calibration and signal processing . the critical technology advantage for the described system proposed lies in the bandwidth control , the resultant sensitivity increase and the antenna match that can be achieved given the frequency bandwidth that must be covered and the various conditions through which the antenna must propagate energy . the overall radar specifications for one implementation are provided below in table 1 . the system employs a derivative , penetrating radar system based on mine detection hardware and software . to the extent available , off - the - shelf electronic components are used to extend / shift current frequency - stepped rf module performance from 1 to 3 ghz to cover the range from 1 . 5 to 10 ghz . fig5 illustrates an antenna design employed in one implementation of the system of fig1 . from the viewpoint of size reduction , the spiral antenna is the most attractive . for an antenna to be an efficient radiator , it must normally have a dimension of at least one - half wavelength . the spiral radiates efficiently when it has an outer circumference of at least one wavelength . this means it needs a maximum diameter of about one - third wavelength . the upper frequency limit for efficient spiral radiation is set by the size of the feed point attachments , and the lower frequency limit is set by the outer diameter of the spiral structure . within these limits , the spiral radiates efficiently in a frequency - independent manner . the input impedance and the radiation patterns will vary little over this frequency range . with any spiral structure , an upper frequency of 10 gigahertz presents no problem . the spiral antenna is constructed by etching the pattern on a printed circuit board . a planar , printed circuit , spiral antenna radiates perpendicularly to the plane of the spiral . the spiral itself is located at the end of a cylindrical metal cavity ( the cavity back ) to provide isolation from neighboring elements and electronics . typically , an absorber is used on the top - side of the spiral inside the cavity to make sure the element responds only downward . separate transmit and receive antennas are used to simplify the electronics , provide spatial separation and reduce very shallow reflections . suitable processing hardware includes a powerpc 750 processor running at 350 mhz on a pmc mezzanine form factor . the powerpc 750 is ideally suited for portable applications due to the small die size and low power consumption of less than 4 watts and its low cost . the described systems and techniques promise to provide low cost , ease of use , and higher performance ( better detection and lower false alarm rate ). a low - cost , user - friendly radar system for difficult concealed object detection employs a comprehensive antenna and rf module design , sophisticated concealed / buried target detection algorithms . data collected against different targets and in different conditions , together with adaptive / advanced algorithms , will enable prediction and ( through testing ), validation of performance for a range of potential operating frequencies . | 7 |
referring now to fig1 to 5 of the drawings which illustrate a first embodiment of the present invention , a focus detecting element having a pair of photodiodes pd1 , pd2 is disposed in the focus reference plane of a lens l , the photodiodes being arranged in parallel on an insulating base plate 1 , with the light receiving surface divided into plurality of areas which are positioned in mutually staggered relation . as best seen in fig2 a semiconductor substrate or base plate 2 is superimposed on the insulating base plate 1 , and the semiconductor base plate is made , for instance , of n type semiconductor . semiconductors 3 and 4 are superimposed on substrate 2 and present light receiving surfaces of the photodiodes , and the semiconductors 3 , 4 are made of a p type , in contrast to the n type of the semiconductor 2 . alternatively , the n and p types may be interchanged . the semiconductors 3 , 4 with the substrate 2 define the aforesaid pair of photodiodes pd1 , pd2 , independently , due to the contact with semiconductor base plate 2 , and connected to output terminals out1 and out2 . out3 is an output terminal connected to the semiconductor base plate 2 . a mask 5 having a checkered pattern consists of transparent portions ai , bi ( where i is a given number ) and opaque portions c , with the upper half a which consists of ai and c covering the light receiving surface of semiconductor 3 and with the lower half b which consists of bi and c covering the light receiving surface of semiconductor 4 , respectively , thus dividing the light receiving surfaces of phtodiodes pd1 , pd2 into light receiving photodiode element defining areas appearing in a staggered relation . the aforesaid photodiodes and mask are advantageously prepared according to the known i . c . circuit technique . the semiconductors 3 , 4 should preferably be as close to each other as possible whicle being mutually electrically insulated . the width t of the semiconductors 3 , 4 is advantageously of the order of several hundreds microns , and the width d of the checkered pattern is advantageously of the order of several tens microns . the width d may be derived from a consideration of a spatial frequency contained in an image formed by the objective lens . however , limitations arising from the aspects of the i . c . circuit technique or sn ratio are imposed thereon . fig3 illustrates the sensing operation of the above described focus detecting element according to the present invention , in which the variation in brightness is shown in relation to the position on the photodiodes pd1 , pd2 . as shown in fig3 a dark light is incident through a transparent portion a2 of the mask on the semiconductor 3 , while a bright light is incident through the transparent portion b2 of the mask on the semiconductor 4 as shown by the line 6 of fig3 . the light having uniform brightness is incident through the remaining transparent portions . assuming that load resistors r1 , r2 having equal resistance are connected to pd1 and pd2 , as shown in fig4 the semiconductor 4 receives more light than semiconductor 3 , so that the photodiode pd2 produces more photocurrent to thereby produce a larger potential across the opposite ends of the resistor r2 than across the opposite ends of r1 . in brief , a voltage corresponding to the difference in potential will appear across the terminals p , q . on the other hand , if the distribution of brightness on the light receiving surface of the element is such shown by the broken line 7 due to off - focusing , the output between the terminals p , q is reduced . accordingly , in the network employing the focus detecting element of the present invention , the focus detecting may be achieved by obtaining the maximum value of the difference in voltages appearing between out1 and out3 and between out2 and out3 . the detecting element described above may be used in a stationary condition , but in order to achieve a more stable or consistent output , the detecting element is advantageously oscillated in a direction parallel to the length of the semiconductors 3 and 4 as shown by the arrow a in fig1 . when the detecting element is shifted by a distance d in parallel with the light receiving surface , then the light incident condition on the semiconductors 3 and 4 are reversed to that shown in fig3 so that a voltage having a polarity reverse to that in the aforesaid case appears across the terminals p , q . in addition , when the detecting element is oscillated at an amplitude of d / 2 , then an a . c . output appears across the terminals p , q as shown in fig5 . as a result , by determining the maximum value of the amplitude of the a . c . output , there may be achieved a highly stabilized or consistent focus detection . in the aforesaid description , the distribution of the brightness of an image over the light receiving surface is so provided as to suit or enhance the detection . however , such a condition is commonly present in the case of an ordinary photographic object . in other words , there exists a contrast of light and shadow in an ordinary photographic object , and hence there exists a spatial frequency component on the boundary of the contrast , as shown in the uppermost portion of fig3 . accordingly , it is possible in general , that the focusing may be achieved by detecting the position of an a . c . output across the terminals of p , q which provides the maximum a . c . output , by oscillating the element . a piezo - electric element for example , may be used as a means for oscillating the detecting element . in addition , a known circuit may be used for processing an output signal appearing across the terminals p , q , it being noted that various methods may be utilized for the aforesaid purpose . referring now to fig6 which illustrates a second embodiment of the present invention , an arrangement is used for achieving a pair of photodiode sets whose light receiving surfaces are divided into areas or sections disposed in a staggered relation . specifically , a plurality of semiconductors 8a , 9a , 8a &# 39 ;, 9a &# 39 ;, 8a &# 34 ; and 9a &# 34 ; of the same size and of heights t and widths d , are located on the semiconductor substrate or base plate 2 in a staggered relation to each other . in this instance , one group of semiconductors 8a , 8a &# 39 ; and 8a &# 34 ; which are spaced in a line are connected by means of connecting wires 8b and 8b &# 39 ;, while the other group of 9a , 9a &# 39 ; and 9a &# 34 ; are connected by 9b and 9b &# 39 ;, thereby presenting a focus detecting element , without using a mask 5 such as given in the first embodiment . as shown in fig6 the two groups of semiconductors are connected to out1 and out2 respectively . in fig7 of the drawing there is illustrated another embodiment of the present invention of the nature of the first embodiment . there is provided in the modified detector element another pair of semiconductors 10 and 11 similar to the pair of semiconductors 3 and 4 and formed on the common semiconductor substrate or base plate 2 carrying the pair of semiconductors 3 , 4 . shown at 12 is a mask of checkered pattern , which consists of c , d in addition to a , b of the mask as used in the first embodiment for the other pair of semiconductors 10 , 11 . in case more than two pairs of photodiodes are placed in the focus reference plane of a lens , more than two pairs of semiconductors may be formed on the common semiconductor base plate 2 , thus presenting a unitary focus detecting element . in fig7 the output terminals of a pair of photodiodes including semiconductors 10 , 11 are shown at out3 , out4 and out5 . according to the present embodiment , a wider range of focus reference plane may be covered , thus promoting the positiveness of the focus detection , as well as the accurate positioning of a plurality of pairs of light receiving surfaces on the same plane , because of the use of the common semiconductor base plate . further , it should be noted that the focus detectng element according to the present invention may be applied not only to a focus adjusting device of a camera , but also to the measurement of otf of a lens . while there have been described and illustrated preferred embodiments of the present invention , it is apparent that numerous alterations , omissions and additions may be made without departing from the spirit thereof . | 6 |
the main component of an apparatus for the transport of blanks 20 is containers or cassettes 21 , in which prefabricated , that is to say punched blanks 20 are accommodated in stacked form . the present exemplary embodiment is concerned with the handling of blanks 20 , such as are used in the cigarette industry for the production of hinge - lid packs . blanks 20 with a contour typical of the design of packs of this type are shown in fig3 . the cassettes 21 are re - usable containers which circulate between the production shop for the blanks 20 , especially a paper factory , and the processing shop , especially a cigarette factory . in the paper factory , the cassettes 21 are filled with blank stacks 22 . filled cassettes 21 are then transported to the processing factory in a suitable way , for example in a stacked position on pallets or the like ( fig4 ). in the processing factory , the cassettes 21 are emptied by the extraction of the blank stacks 22 . the empty cassettes 21 are then nested in one another in a specific way and returned to the paper factory in a space - saving manner as empty stock . in the present exemplary embodiment , each cassette 21 consists of four chambers 23 , each receiving a blank stack 22 . the elongated chambers 23 extend over the entire width of the cassettes 21 which are rectangular , as seen in the plan view . for the loading and emptying of the cassettes 21 , the chambers 23 are open on two sides , in particular at the top and on one longitudinal side of the cassettes 21 , namely the open side 24 . the load - bearing member of the cassette 21 is a stable bottom wall 25 . the blank stacks 22 rest on this . to delimit the chambers 23 from one another , vertical partition wall members are arranged on the top side of the bottom wall 25 . in the present exemplary embodiment , the chambers 23 are limited by vertical webs connected firmly to the bottom wall 25 . here , between adjacent chambers 23 , there are two equally large partition webs 26 lying in one plane and an edge web 27 located at the edge of the bottom wall 25 and extending in the same plane . in the present case , the edge web 27 has a smaller cross - section , in particular a smaller dimension in the direction parallel to the blank stacks 22 , than the partition webs 26 . the edge web 27 is located on that side ( closing side 28 ) of the cassette which is closed for the retention of the blank stacks 22 . arranged on the shorter sides of the cassette 21 are side webs 29 corresponding to the partition webs 26 and one respective corner web 30 corresponding to the edge webs 27 . the outer chambers 23 are limited on the outside of the cassette 21 by the side webs 29 and corner webs 30 . the above - described webs 26 , 27 , 29 , 30 are , on the one hand , aligned in the planes parallel to the chambers 23 . furthermore , however , the webs are also aligned in rows transversely relative to the chambers 23 , that is to say in the longitudinal direction of the cassette 21 . the edge webs 27 and corner webs 30 on the closing side 28 of the cassette 21 are equipped with supporting members for the bearing of the blank stacks 22 . in the present case , arranged laterally respectively on the edge webs 27 and on one side of the corner web 30 are vertical supporting strips 31 , against which edge regions of the blanks 20 bear positively with a fit . the special , approximately trapezoidal cross - sectional form of the supporting strips 31 emerges from the form of the blanks 20 which is characteristic of hinge - lid packs . in particular , these are designed , in the region of a front wall of the hinge - lid pack and in the region of adjoining side tabs , to form side walls of the hinge - lid pack with tooth - shaped projections 32 . the blanks 20 bear by means of these triangular projections 32 or by means of their oblique edges 33 against oblique supporting faces of the correspondingly shaped supporting strips 31 . formed in the region where these adjoin the edge web 27 or corner web 30 is a vertical groove 34 , into which the outermost tip of the projection 32 penetrates and is thereby protected against damage . the cassettes 21 filled with blank stacks 22 are designed to be stacked , for example on pallets . in order , at the same time , to prevent relative shifts of the cassettes 21 in relation to one another , an inter - meshing of the cassettes 21 arranged above one another is provided . in the exemplary embodiment illustrated , the side webs 29 and the corner webs 30 are equipped , on the top side and underside , with projections for positive engagement . as shown , arranged on the top side of the abovementioned webs 29 , 30 are conical centering lugs 35 which , during stacking ( fig4 ), penetrate positively into corresponding conical depressions 36 on the underside of the identical corresponding webs 29 , 30 . the abovementioned members have a self - centering effect during the stacking of the cassettes 21 . however , the suitability of the ( empty ) cassettes for a space - saving stacking nested in one another is of particular importance . for this purpose , orifices 37 and additional orifices 38 are arranged in the bottom wall 25 . these are matched in terms of size and shape to the partition webs 26 , so that the latter can be inserted alternately through the orifices 37 or additional orifices 38 for the nesting of cassettes 21 . the orifices 37 and 38 are respectively arranged aligned in longitudinal and transverse rows . located on the edge of the bottom wall 25 , particularly on its narrow sides , and between adjacent edge webs 27 or corners webs 30 are recesses 39 which are open to the side . the dimensions of these correspond to the cross - sectional dimensions of the side webs 29 . the number of orifices 37 and that of the additional orifices 38 correspond respectively to the number of partition webs 26 of a cassette 21 . the partition webs 26 of two cassettes 21 can thereby be guided completely or partially through the bottom wall 25 of a third cassette . the arrangement is such that orifices 37 are arranged respectively in the same plane as the partition webs 26 serving for limiting a chamber 23 . here , the distance between two adjacent partition webs 26 is filled by an orifice 37 . the additional orifices 38 are arranged centrally between two adjacent orifices 37 , that is to say centrally within a chamber 23 , and are aligned with the orifices 37 , as seen in the longitudinal direction of the cassette 21 . this results in two rows of orifices 37 and additional orifices 38 extending in the longitudinal direction of the cassette 21 and in recesses 39 at the edges . two cassettes 21a , 21b designed in this way , offset transversely , are nested one in the other , specifically in such a way that the partition webs 26 of one cassette 21a are guided from below or from the underside of the bottom wall 25 through the orifices 37 of the second cassette 21b . at the same time , the side webs 29 of the cassette 21a enter the recesses 39 of the cassette 21b . the partition webs 26 and the side webs 29 of the two cassettes 21a , 21b are accordingly aligned in transverse planes , but offset relative to one another , in such a way that the edge webs 27 and corner webs 30 of the two cassettes 21a , 21b extend next to the bottom wall 25 of the other respective cassette 21a , 21b ( fig9 ). for this purpose , the two cassettes 21a , 21b are joined together , offset at 180 ° relative to one another . a pair of cassettes 21a , 21b plugged together in the abovementioned way constitutes a stack unit 40 which already allows a space - saving storage of the cassettes 21a , 21b . however , because of the design of the cassettes 21 , two stack units 40 , 41 with cassettes 21a , 21b on the one hand and 21c , 21d on the other hand can be nested one in the other , in such a way that a block - shaped structure , particularly a stack block 42 consisting of four cassettes 21a to 21d , is obtained . the outer dimensions of the stack block 42 are only slightly larger than the dimensions of an individual cassette 21 . for this purpose , two stack units 40 , 41 are plugged one into the other with their bottom walls 25 remote from one another . the stack units 40 , 41 are at the same time offset in the longitudinal direction relative to one another by the amount of half the width of a chamber 23 . the partition webs 26 and side webs 29 of the stack units 40 , 41 are thereby assigned alternately to the additional orifices 38 of the confronting bottom wall 25 of the other stack unit 40 , 41 . the respective partition webs 26 and side webs 29 enter the additional orifices 38 ( fig1 and 11 ). the altogether four cassettes 21 are easy to handle , particularly storable with a small space requirement , as a unit , namely as a stack block 42 . for the loading of the cassettes 21 , the stack blocks 42 and stack units 40 , 41 are taken apart again in the opposite direction of movement . the partition webs 26 , edge webs 27 , side webs 29 and corner webs 30 are extended as far as the underside of the bottom wall 25 . in particular , in this region , the bottom wall 25 is equipped with bevelled head - like projections 43 corresponding to the abovementioned webs 26 , 27 , 29 , 30 . with the cassettes 21 filled and stacked , the projections 43 on the underside of the bottom wall 25 rest on the upper ends of the webs 26 , 27 , etc . during the stacking of inter - nested empty cassettes 21 , particularly stack blocks 42 ( fig1 ), the projections 43 penetrate in a centring manner into orifices 38 of adjacent cassettes 21 . the cassettes 21 appropriately consist of a one - piece , preferably cast material , especially of plastic . in the present exemplary embodiment , depressions are formed in on the underside of the bottom wall 25 , specifically , on the one hand , centre depressions 44 extending in the longitudinal mid - plane and , on the other hand , retaining depressions 45 formed in on one edge , specifically on the edge confronting the closing side 28 . the first - mentioned depressions 44 extend respectively over the width of a chamber 23 , and projections 43 arranged between adjacent centre depressions 44 serve as a stop for positioning the cassette 21 , especially during unloading . the retaining depressions 45 are important for the ( automatic ) transport of the cassettes 21 . during the supply of blanks 20 to packaging machines , the ( filled ) cassettes 21 are appropriately introduced into the circuit of an overhead conveyor , especially with the features of german patent application p3820735 ( and of a corresponding u . s . pat . no . 5 , 007 , 522 which is expressly incorporated herein by reference ). in this older proposal , the overhead conveyor is equipped with bogie trucks 46 ( fig1 ) which are movable along a running rail 47 above the production and packaging machines . located on the bogie trucks 46 are material holders 48 which are designed so that they can transport either reels of web - shaped packaging material or cassettes 21 . for this purpose , the material holders 48 are equipped with rigid downward - diverging carrying arms 49 . attached to the lower ends of these are horizontal carrier spars 50 directed transversely , that is to say projecting on one side . on these rest the articles to be transported , particularly reels of different diameters or cassettes 21 . the carrier spars 50 are attached rigidly , as parts projecting , that is to say jutting out , on one side , to the carrier arms 49 . reels rest with their circumferential surface on the carrier spars 50 . to protect a reel resting vertically on the carrier spars 50 against transverse or tilting movements , the material holder 48 is designed with rigid side holders which rest supportingly against side faces of the reel . these side holders , assigned respectively in pairs to a reel , are formed by fixed side fences 60 , 62 , 64 of the carrier spars 50 . for this purpose , these side fences are made step - shaped in the longitudinal direction , so that depressions or recesses of differing length in the direction of the carrier spars 50 are obtained . the vertical or slightly divergingly inclined step faces of the steps thus formed constitute the side fences 60 , 62 , 64 . the distances between side fences 60 to 64 , interacting in pairs , are designed to accommodate reels of different axial dimensions . a reel with the smallest dimension in the axial direction rests in an approximately central depression or recess 66 of the carrier spars 50 . this reel is held laterally by the side fences 64 arranged at the shortest distance from one another . a depression or recess 68 , formed at a higher level and with supporting surfaces on both sides of the central recess 66 , serves to receive a larger reel between side fences 62 . finally , there is provided a depression or recess 70 of the smallest depth , but of the greatest width , for receiving the largest reels between the outer side fences 60 . where the transport of cassettes 21 is concerned , an upward - directed nose 51 ( fig6 and 7 ) attached to the free end of each of the carrier spars 50 penetrates into the retaining depression 45 of the cassette 21 . this is thus protected against shifts on the carrier spars 50 during transport . in the region of a packaging machine 52 ( fig1 ), the filled cassettes 21 are received by a first vertical conveyor 53 from the bogie truck 46 of the overhead conveyor and are conveyed downwards . the cassette 21 is deposited by the vertical conveyor 53 on a machine conveyor 54 . this is arranged to run longitudinally at the rear of the packaging machine 52 . in the region of an unloading station 55 , the blank stacks 22 are extracted from the cassette 21 in succession as a result of an upward movement , specifically by means of a stack lifter 56 . this grasps a respective blank stack 22 and conveys it upwards and feeds the blank stacks 22 to a blank magazine ( not shown ) located on the machine . the empty cassettes 21 are transported further on the machine conveyor 54 as far as a second vertical conveyor 57 . this takes over the empty cassettes 21 and transfers them to a bogie truck 46 or to a material holder 48 of the latter . the nesting of several cassettes 21 in one another is carried out at an unloading station of the continuous overhead conveyor , especially manually . | 8 |
the disclosure of the present invention is the flanged ring profile 1 for circular and oval flanged rings 10 , 20 , as depicted in fig1 a , 2 , 3 , 4 , and 5 a and the method for the production of such circular and oval flanged rings . these flanged rings may conform to the smacna t24 profile . the method of production is depicted in fig6 through 19a . fig2 , and 4 show the circular and oval flanged rings 10 , 20 in relationship to ducting 30 and the connection of opposing circular flanged rings 10 . other profiles may be produced by this method . the preferred embodiment of making the disclosed circular flanged ring 10 includes the following materials , steps and process : lfq steel , or other flanged ring band stock 40 material , is normally receipted in coil form and is decoiled and cut into flanged ring band stock strips 41 having strip first and second ends 44 , 46 , as shown in fig1 , the length of the circumference of the circular flanged ring 10 to be produced ( flanged ring band stock strips 41 of widths other than 3 . 875 ″ may also be used with the width limited by the configuration of the spinning die 50 and the dimensions of the desired circular flanged ring 10 ). each flanged ring band stock strip 41 is formed into a band form , which is substantially circular as shown in fig1 a , for ease of affixing the strip first and second ends 44 , 46 together , for example , by butt welding the strip first and second ends 44 , 46 together , with the band forming accomplished by means , for example , with a rolling machine including a pyramid rolling machine . the preferred means of connection of the strip first and second ends 44 , 46 is by butt welding by use of a tungsten inert gas process with no filler . the butt welding forms the strip first and second end weld 48 and concludes the formation of the flanged ring band stock 40 as shown in fig1 b . it is important , for successful spinning and forming of the circular flanged ring 10 , that the butt weld of the strip first and second ends 44 , 46 not produce a seam . any seam , ridge , irregularity or any fill in the weld will increase the probability of the seam cracking , as the flanged ring band stock 40 is stretched in the spinning process , ruining the flanged ring band stock 40 and creating a safety hazard . the flanged ring band stock 40 will be received into and secured into a spinning die 60 as shown in fig1 , 10 a and 10 b . the disclosed process requires the flanged ring band stock 40 to be rotated or spun for forming and trimming . the flanged ring band stock 40 may be fixed in a die which is in turn rotated or spun for presentation to and work by various machine tools . the rotation of the die means and flanged ring band stock 40 may be accomplished , for example , by a lathe with either a vertically or a horizontally mounted lathe output shaft 50 . the preferred embodiment , for example , utilizes a lathe with a horizontally mounted lathe output shaft 50 to which is mounted , via adaptor and or mounting means , a spinning die 60 . the die means may be provided , for example by a spinning die 60 shown in fig9 a , and 9 b , which in the preferred embodiment , consists of a circular base plate 61 formed from approximately 1 ″ thick mild steel plate having a mounting surface 62 and a working surface 64 and an outside diameter approximately 1 ″ greater than the outside diameter of the flanged ring band stock 40 which is selected for forming and trimming . mounting means is provided which enables the lathe output shaft 50 to be located at the effective center of the mounting surface 62 . on the working surface 64 of the base plate 61 a die means or fixture receives and secures the flanged ring band stock 40 and may be provided , for example , by a collar 70 assembled from components consisting of : 1 ) a collar strip 72 consisting of { fraction ( 3 / 8 + l )}″ thick × 2 ″ wide mild steel strip which is rolled to a 2 ″ wide strip in a circular form having an inside diameter approximately { fraction ( 1 / 16 + l )} greater than the outside diameter of the flanged ring band stock 40 and with the strip width of approximately 2 ″. the collar strip 72 has end edges 73 , 74 . the end edge 74 is tack welded to the working surface 64 of the base plate 61 so that the collar 70 and spinning die 60 are concentric around the center of the spinning die 60 . the interior perimeter of the collar 70 , between the end edges 73 , 74 , forms the insertion face 76 ; 2 ) a working surface groove 66 , { fraction ( 1 / 16 )}″×{ fraction ( 1 / 16 )}″, is machined into the working surface 64 of the base plate 61 at the intersection of the collar strip end edge 74 and the working surface 64 . the working surface groove 66 has an outside diameter equal to the inside diameter of the insertion face 76 and inside diameter ideally about { fraction ( 1 / 3 + l )}″ less than the inside diameter of the insertion face 76 . the working surface groove 66 accepts the inserted edge of the flanged ring band stock 40 ; 3 ) a { fraction ( 1 / 2 + l )}″ thick × 1⅜ ″ wide mild steel mating strip 80 in a circular form has a mating surface 84 , mating strip bottom 86 , a mating surface / hem edge 85 , and a mating face 82 at the interior perimeter of the mating strip 80 . the mating strip 80 is flat burned arc with an inside diameter at the mating face approximately about { fraction ( 1 / 16 + l )}″ greater than the flanged ring band stock 40 and is tack welded to the collar strip end edge 73 distal from the working surface 64 such that the 1⅜ ″ wide surface of the mating surface 84 is parallel to the working surface 64 ; 4 ) the collar 70 assembly is continuously welded between the collar strip end edge 74 and the working surface 64 ( collar strip second edge weld 78 ) and between the collar strip end edge 73 and the mating strip bottom 86 ( mating strip bottom weld 88 ) via the mig welding process . the collar 70 or die or fixture means , receiving the flanged ring band stock 40 , may be provided by means other than described including machining or constructing from a single component or other combinations of components and may have a variety of dimensions depending on the final intended dimensions of the circular or oval flanged ring 10 , 20 to be produced . clamping means , including for example cam clamps 90 , as shown in fig9 a , 9 b , 11 , 11 a and 11 b , are affixed to the working surface 64 of the base plate 61 and positioned to rotate and bind the inserted flanged ring band stock 40 between the clamp cam and the inner perimeter of the insertion face 75 thus securing the flanged ring band stock 40 between the cam clamp 90 and the inner perimeter during the spinning , forming and trimming process . depending upon the size of the circular or oval flanged ring 10 , 20 to be produced , there will be at a minimum of two cam clamps 90 for a 14 ″ diameter circular flanged ring 10 and up to eight or more cam clamps 90 for a 60 ″ diameter circular flanged ring 10 . the spinning die 60 means will be balanced and will have material strength sufficient to permit smooth and safe rotation up to and exceeding 3 , 000 rpm . machining or other steps may be necessary to help insure that the spinning die 60 and all structure means or supporting structural member means are truly round and balanced in all axis in order to minimize vibration . the spinning die 60 structure may , for example , include the spinning die 60 , a circular adapter plate 100 and a circular backing plate 110 with means for securing concentrically the adapter plate 100 to the lathe output shaft 50 and the adapter plate 100 to the base plate 61 mounting surface 62 . for the production of circular flanged rings 42 ″ diameter and greater , means for concentrically securing , for structural stability , the backing plate 110 between the adapter plate 100 and the spinning die 60 . the adapter plate 100 , for example , may be composed of a { fraction ( 1 / 2 + l )}″ thick circular steel plate 14 ″ in diameter having an adapter plate obverse and reverse side 102 , 104 and having a fixture means , at the adapter plate reverse side 104 , for concentric attachment to the lathe output shaft 50 including threaded means which may be , for example , a hub 107 providing a female thread for mating with a lathe output shaft 50 . the adapter plate 100 may , for example , have means for concentric attachment to the mounting surface 62 of the base plate 61 including bolt apertures 109 from the adapter plate reverse to obverse sides 104 , 102 having therein threaded means with the bolt apertures 109 symmetrically positioned on a pattern which will be mirrored and matched by bolt apertures 109 from the mounting surface to the working surface 64 of the base plate 61 . the additional mass involved in the spinning die 60 for circular flanged rings 10 of 42 ″ diameter and greater may require additional structural stability which may be provided , for example , by the utilization of a backing plate 110 comprised of a 1 ″ thick circular steel plate 42 ″ in diameter having backing plate obverse and reverse sides 111 , 112 and mounting means for concentrically mating with the adapter plate 100 and the spinning die 60 . mounting means for the backing plate 110 may include , for example , bolt apertures 109 from the backing plate obverse to reverse side 111 , 112 having threaded means therein and symmetrically positioned on a pattern which will be mirrored and matched by bolt apertures 109 for the adapter plate 100 and the spinning die 60 . the spinning die 60 is selected in accordance with the diameter of circular or oval flanged ring 10 , 20 to be produced and the spinning die 60 is mounted , by mounting means , on rotation means including a lathe output shaft 50 . the workpiece in the form of a flanged ring band stock 40 is inserted in the spinning die 60 against and received by the insertion face 75 and mating face 82 and into the working surface groove 66 where it is secured by means including clamp means provided , for example , by cam clamps 90 . the flanged ring band stock 40 is rotated in preparation for the forming and trimming process . the forming and trimming of the flanged ring involves standard machine tools and stabilizing devices including : 1 ) an internal roller 120 , as shown in fig1 , having an internal roller wheel 122 comprising a wheel having a perimeter consisting of a convex wheel working surface and pivot means attached by means to a internal roller tool fixture 124 provided , for example , by an internal roller handle 126 permitting the wheel to rotate in a plane 90 degrees to a longitudinal axis from an internal roller handle first and second ends 127 , 128 when the wheel working surface is in contact with the mating flange 4 portion of the flanged ring band stock 40 when clamped into the spinning die 60 ( the internal roller 120 for the preferred embodiment of the disclosed method has a convex working surface with a { fraction ( 1 / 2 + l )}″ radius and the internal roller handle 126 proximal to the internal roller wheel 122 has five { fraction ( 3 / 4 + l )}″ diameter holes spaced equally 1¼ ″ apart ); 2 ) a radius roller 130 , as shown in fig1 , having a radius roller wheel 132 comprising a wheel having a perimeter consisting of a convex wheel working surface and pivot means attached by means to a radius roller tool fixture 134 provided , for example , by a radius roller handle 136 permitting the wheel to rotate in a plane parallel to a longitudinal axis from a radius roller handle first and second ends 137 , 138 when the wheel working surface is in contact with the hem portion 5 of the flanged ring band stock 40 when clamped into the spinning die 60 ( the radius roller wheel 132 for the preferred embodiment of the disclosed method has a convex working surface with a { fraction ( 1 / 8 + l )}″ radius and the radius roller handle 136 proximal to the radius roller wheel 132 has five { fraction ( 3 / 4 + l )}″ diameter holes spaced equally 1¼ ″ apart ); 3 ) a trim lever 140 , as shown in fig1 , comprising a cutting tip 142 affixed to a trim lever tool fixture 144 provided , for example , by a trim lever handle 146 permitting the cutting tip 142 to extend parallel with a longitudinal axis from the trim lever handle first to second ends 147 , 148 with the cutting tip 142 for cutting or trimming the hem 5 as the step preliminary to the production of the return flange 6 ( the cutting tip 142 for the preferred embodiment of the disclosed method has a { fraction ( 1 / 2 + l )}″ square × 3½ ″ long carbide cutting tip and the trim lever handle 146 proximal to the cutting tip 142 has five { fraction ( 3 / 4 + l )}″ diameter holes spaced equally 1¼ ″ apart ); 4 ) a finishing roller 150 , as shown in fig1 , having a finishing roller wheel 152 having a perimeter consisting of a convex wheel working surface and pivot means attached to a finishing roller tool fixture 154 provided , for example , by a finishing roller handle 156 permitting the finishing roller wheel 152 to rotate in a plane parallel to a longitudinal axis from a finishing roller handle first and second ends 157 , 158 when the wheel working surface is in contact with the return flange 6 portion of the flanged ring band stock 40 when clamped into the spinning die 60 ( the finishing roller wheel 152 for the preferred embodiment of the disclosed method has a convex working surface with a { fraction ( 1 / 2 + l )}″ radius and the finishing roller handle 156 proximal to the finishing roller wheel 152 has five { fraction ( 3 / 4 + l )}″ diameter holes spaced equally 1¼ ″ apart ). the internal roller 120 , radius roller 130 , trim lever 140 and finishing roller 150 are urged against the appropriate portions of the flanged ring band stock 40 by machining process means , including by manual / hand manipulated means , automated machine tool means operated and controlled by computers and computer programs and other process control systems and other machine tool processes . leverage , to manually urge the above machine tools in their function may , for example , be facilitated by the following ; 1 ) tool rest 170 , as shown in fig1 , which is mounted in a position opposing the rotating spinning die 60 at a position where the indicated machine tools may be brought into contact with the flanged ring band stock 40 and undertake the machining steps described . the tool rest 170 may be mounted , for example , on a lathe cradle opposing the spinning die 60 within which the various machine tools will operate on the flanged ring band stock 40 . the tool rest 170 consists , in the preferred embodiment , of a mild steel block 37 ″ long x 3 ″ thick × 4 ″ wide with the tool rest top 172 having 30 apertures sized to receive a { fraction ( 3 / 4 + l )}″ diameter pin and spaced 1⅛ ″ apart along the length of the tool rest top 172 ; 2 ) a power lever 160 , as shown in fig1 , 16 a and 16 b , comprising a power lever head 161 having a power lever head top and a bottom surface 162 , 163 , a top surface pin 164 { fraction ( 3 / 4 + l )}″ diameter ×{ fraction ( 3 / 4 + l )}″ long extending from the power lever head top surface 162 and a bottom surface pin 165 { fraction ( 3 / 4 + l )}″ diameter ×{ fraction ( 3 / 4 + l )}″ long extending from the power lever head bottom surface 163 . the top and bottom surface pins 164 , 165 are ideally parallel to and offset from each other . the power lever head 161 is affixed to a tool fixture provided , for example , by a power lever handle 167 . the power lever 160 is used , in the manual / hand production procedure , to provide the pivot point about which the machine tools are operated to attain the leverage required to form , stretch and trim the flanged ring band stock 40 . in the preferred embodiment of the method of production by hand , a guide plate means is affixed , following formation of the mating flange 4 , to a lathe tail stock 188 , and is bound by friction against the mating flange 4 portion of the flanged ring band stock 40 , thereby securing the flanged ring band stock 40 between the mating surface 84 and the guide plate means . the guide plate means is provided , for example , by a follow block 180 , as shown in fig1 and 19a , preferably comprised of two circular cut plywood pieces 182 , each { fraction ( 3 / 4 + l )}″ thick , secured together to form a 1½ ″ thick combined plywood piece , having an outside diameter ideally substantially equal to the outside diameter of the mating surface 84 . a 1 ″ thick 6 ″ diameter mild steel tail stock plate 184 has a centrally positioned tail stock aperture 186 , sized to receive the lathe tail stock 188 , is concentrically affixed by means , for instance bolt means , to the circular cut plywood pieces 182 . the method disclosed for the production of the circular flanged ring 10 is as follows : i . the adapter plate 100 is mounted to the lathe output shaft 50 . ii . the spinning die 60 ( with backing plate 110 when the circular flanged ring 10 diameter is 42 ″ and greater ) is mounted to the adapter plate 100 . iii . a flanged ring band stock 40 is inserted into the spinning die 60 and secured by clamps , as shown in fig1 . iv . a tool rest 170 is mounted on a lathe cradle . a power lever 160 via a bottom surface pin 165 is inserted into an aperture at the tool rest top 172 . v . the lathe is powered causing the spinning die 60 to revolve . vi . an internal roller 120 is positioned on the top surface pin 164 of the power lever via an aperture in the internal roller handle 126 . the internal roller wheel working surface 122 is positioned on the inside of flanged ring band stock 40 at the outer { fraction ( 1 / 16 + l )}″ of the flanged ring band stock 40 distal from the working surface 62 and causes the portion of the flanged ring band stock 40 extending past the mating face 82 to be stretched and bent against the mating surface 84 forming a mating flange 4 , as shown in fig1 a . the portion of the flanged ring band stock 40 received into the collar 70 and against the insertion face 75 is the insertion flange 3 forming approximately a 90 degree angle with the mating flange 4 , as shown in fig1 a . the portion of the flanged ring band stock 40 extending from the mating flange 4 portion of workpiece distal from the insertion flange 3 and toward the portion of the flanged ring band stock 40 which will include the hem 5 is bent against the mating surface / hem edge 85 forming an approximate 20 degree angle between the hem portion and the mating flange 4 , as shown in fig1 a . this concludes the machine tool activity required of the internal roller 120 . vii . upon conclusion of forming by the internal roller 120 a follow block 180 is positioned against the mating surface 84 . the portion of the flanged ring band stock 40 distal from the insertion flange 3 and mating flange 4 , which will form the hem 5 and the return flange 6 extends beyond the mating surface 84 and the follow block 180 and is accessible to machine tool operations . the internal roller 120 is removed from the power lever 160 and replaced with a radius roller 130 . the radius roller wheel 132 convex working surface is positioned at a 45 degree angle to the mating surface 84 and initially is placed in contact with the follow block 180 in order to bring the radius roller wheel 132 up to speed . the radius roller wheel 132 is then forced onto the exposed portion of the flanged ring band stock 40 at the mating surface / hem edge 85 causing the metal to stretch in contact with and following the contour of the hem surface 76 forming , proximal to the mating flange 4 , the hem 5 , as shown in fig1 b . that portion of the flanged ring band stock 40 most distal from the insertion flange 3 forms an approximately 90 degree angle with the hem 5 and constitutes the portion of the flanged ring band stock 40 which will be formed into the return flange 6 , as shown in fig1 b . viii . the radius roller 130 is removed from the power lever 160 and replaced with the trim lever 140 . the cutting tip 142 is placed in contact with the outside edge of the portion of the flanged ring band stock 40 which will form the return flange 6 and cuts away metal sufficient to leave approximately { fraction ( 3 / 8 + l )}″ for the return flange 6 . ix . the trim lever 140 is removed from the power lever 160 and replaced with the finishing roller 150 . the right side of the finishing roller wheel 152 is placed in contact with the edge of the flanged ring band stock 40 most distal from the insertion flange 3 , at an approximate 45 degree angle with the flanged ring band stock 40 which has been trimmed , allowing the finishing roller wheel 152 to be brought up to the speed of the spinning die 60 . the finishing roller wheel 152 is urged against the edge of the flanged ring band stock 40 causing the metal to fold back onto and in contact with the hem 5 thus forming the return flange 6 . x . the lathe is turned off and the completed circular flanged ring 40 is removed from the spinning die 60 . the method disclosed for the production of the oval flanged ring 20 is as follows : i . a circular flanged ring 10 is produced and is cut along a diameter producing two semi - circular flanged ring portions 22 . ii . smacna t24 linear segments 24 are produced with the smacna t24 flange profile 1 by roll forming or other method . iii . the smacna t24 linear segments 24 are affixed by means , including welding , to the semi - circular flanged ring portions 22 to form the oval flanged ring as shown in fig5 and 5a . fig2 illustrates an alternative to the foregoing described method for producing flanged ring 10 ′. in the alternative method , the mating flange 4 ′ can be produced as described above , and then the outer perimeter of the mating flange trimmed to provide a desired maximum diameter . thereafter the hem 5 ′ and the return flange 6 ′ can be formed as a separate component by various methods , such as bending flat stock over on itself and then rolling the flat stock into a circular ring . the ends of the rolled , bent - over flat stock could be butt welded together , and then welded to the outer perimeter of the flange 4 ′. the hem 5 and flange 6 could instead be formed by a stamping process beginning with a flat , annular workpiece . thereafter , the formed hem and flange could be welded to the outer perimeter of the mating flange 4 ′. producing the hem 5 ′ and return flange 6 ′ as a separate component and then attaching such component to the outer perimeter of the mating flange 4 ′ may not be as efficient as spin - forming the entire flange ring 10 ′ as described above with respect to flange ring 10 . also , this “ 2 - step ” method may result in a certain amount of distortion when the formed hem 5 ′/ flange 6 ′ is welded to the mating flange 4 ′. nonetheless , the 2 - step method may be carried out with less sophisticated tooling than required by the spinning method described above . as a further alternative , it is possible to produce the flanged ring 10 ″ shown in fig2 by forming the insertion flange 3 ′ as one component and the mating flange 4 ″, hem 5 ″ and return flange 6 ″ as a second component . the insertion flange 3 ′ can be produced as shown in fig1 - 10b and as described above . the mating flange 4 ″, hem 5 ″ and return flange 6 ″ could be produced by roll - forming or perhaps by stamping . thereafter , the two components can be assembled by welding the inside perimeter of the mating flange to the end edge of the insertion flange . this alternative technique may suffer from the same disadvantages of the technique shown in fig2 above , including a larger number of manufacturing steps as well as significant distortion or warpage of the flanged ring 10 ″ due to the welding operation . on the other hand , it may be possible to produce the flanged ring 10 ″ using less sophisticated tooling than used to produce the flanged ring 10 , as described above . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention . | 1 |
fig1 shows a cross point memory array area 10 . the memory array area 10 comprises a substrate 12 with a plurality of bottom electrodes 14 formed thereon . an active layer 16 has been deposited overlying the plurality of bottom electrodes 14 . a plurality of top electrodes 18 overly the active layer 16 , such that the active layer 16 is interposed between the bottom electrodes 14 and the top electrodes 18 . the top electrodes 18 and the bottom electrodes 14 are each preferably substantially parallel rows . the top electrodes 18 and the bottom electrodes 14 are arranged in a cross point arrangement such that they cross each other in a regular pattern . a cross point refers to each position where a top electrode crosses a bottom electrode . as shown , the top electrodes and the bottom electrodes are arranged at substantially 90 degrees with respect to each other . the top electrodes and the bottom electrodes can each function as either word lines or bit lines as part of a cross point memory array . fig1 shows just the memory array area . it should be clear that in an actual device , the substrate 12 , the bottom electrodes 14 and the top electrodes 18 may extend well beyond the memory array area , which is defined by the active layer 16 . the active layer is substantially continuous , such that the active layer extends across more than one cross point . the substrate 12 is any suitable substrate material , whether amorphous , polycrystalline or crystalline , such as laalo 3 , si , tin or other material . the bottom electrodes 14 are made of conductive oxide or other conductive material . in a preferred embodiment , the conductive material is a material , such as yba 2 cu 3 o 7 ( ybco ), that allows the epitaxial growth of an overlying perovskite material . in another preferred embodiment , the conductive material is platinum . the bottom electrodes are a thickness in the range of between about 5 nm and about 500 nm . in a preferred embodiment , the bottom electrodes 14 are formed by forming a trench , depositing the conductive material and polishing the conductive material until level with the substrate . the polishing can be accomplished using chemical mechanical polishing ( cmp ) or other suitable means . alternatively , the bottom electrodes may be deposited and patterned without first forming a trench and without polishing . the active layer 16 is a material capable of having its resistivity changed in response to an electrical signal . the active material is preferably a perovskite material , such as a colossal magnetoresistive ( cmr ) material or a high temperature superconducting ( htsc ) material , for example pr 0 . 7 ca 0 . 3 mno 3 ( pcmo ). another example of a suitable material is gd 0 . 7 ca 0 . 3 baco 2 o 5 + 5 . the active layer is preferably between about 5 nm and 500 nm thick . the active layer 16 can be deposited using any suitable deposition technique including pulsed laser deposition , rf - sputtering , e - beam evaporation , thermal evaporation , metal organic deposition , sol gel deposition , and metal organic chemical vapor deposition . the active layer is removed from outside the memory array area by ion milling or other suitable process . it is also possible to form a large recessed area to deposit perovskite material over and then use chemical mechanical polishing ( cmp ) to form an active layer 16 . the top electrodes 18 comprise a conductive material , preferably platinum , copper , silver , or gold . referring now to fig2 , a memory device 20 comprising the memory array area 10 connected to a memory circuit 22 is shown . the memory circuit 22 comprises at least one bit pass transistor 24 connected to at least one load transistor 26 and at least one inverter 28 . these structures are shown schematically , as the formation of the individual semiconductor elements are well known . in a preferred embodiment of a method of making the memory device 20 , one , or more , of transistor structures , interconnects or other components of the memory circuit 22 may be formed prior to the formation of the memory array area 10 . by forming components of the memory circuit 22 prior to the memory array area 10 , possible degradation of the active layer due to subsequent processing is reduced , or eliminated . referring again to fig1 , the active layer is shown with a region 40 ( shown by a dashed circle ) to illustrate the region as transparent for illustration purposes . a bit region 42 is shown . the bit region 42 is a portion of the active layer 16 interposed between the bottom electrodes 14 and the top electrodes 18 such that an electrical signal passing between the top and bottom electrodes passes primarily through the bit region . each bit region corresponds to a cross point . under normal operation , the bit region 42 is formed in the active layer by having its resistivity changed in response to an electrical signal . a bulk region 44 of the active layer 16 is contiguous with the bit region 42 . that portion of the active layer 16 that is not changed by an electrical signal during normal operation forms the bulk region 44 . the bit region 42 acts as a variable resistor that can be changed between at least two resistivity values . changes to the resistivity of the bit region 42 are preferably reversible . the reversibility of the resistivity change may incorporate some hysteresis . for some applications , such as write once read many ( worm ) the resistivity change need not be reversible at all . for example , if the bit region 42 has a cross sectional area of one micrometer by one micrometer and the active layer is ybco deposited to a thickness of 60 nm , the high resistance state is approximately 170 mω and the low resistance state is approximately 10 mω . for a low voltage memory device , if the bit region 42 is biased to 1 volt , the current through the bit will be approximately 6 na for the high resistance state and approximately 100 na for the low resistance state . this example has been provided for illustration purposes only . the resistance values will change depending upon the active layer thickness and material , as well as the cross sectional area of the bit itself . the voltage applied across the bit will further affect the current through the bit . fig3 shows a schematic diagram of a 16 bit , 4 × 4 - memory array , memory block 20 . the memory block 20 comprises the memory array area 10 connected to the memory circuit 22 . in this schematic view the active layer is shown as being an array of resistors connected between the lower electrodes 14 , which are also designated as bit lines b 1 through b 4 , and the upper electrodes 18 , which are also designated as word lines w 1 through w 4 . alternatively , the lower electrodes could be the word lines and the upper electrodes could be the bit lines . the bit lines are connected to the memory circuit 22 . as shown , the lower electrodes are bit lines , so the lower electrodes are connected to the memory circuit 22 . looking at the memory array area 10 , each bit 50 can be treated as comprising primarily a bit resistor 52 with an accompanying bulk resistor 54 in parallel . this array does not require a gated transistor for each bit . there is also no need for a separate capacitor as any data value is stored using a changing resistance of each bit resistor 52 . the total resistance of each bit is going to be controlled primarily by the bit resistor 52 , which acts as a variable resistor . the bit resistor 52 has a resistance that can be changed between at least two values in response to an electrical signal , including a high resistance state and a low resistance state . preferably , the bulk resistor 54 will have a higher resistance than the bit resistor 52 , especially when the bit resistor is in a low resistance state . referring now to the memory circuit 22 , each bit line is connected to the bit pass transistor 24 . the bit pass transistor 24 has a bit pass gate 64 . the bit pass gate 64 contributes to determining which bit is being programmed or read out . the bit pass transistor is connected to the load transistor 26 , which has a load gate 66 , and the inverter 28 . the load transistor is used to determine which memory block is being programmed or read out . the inverter is used in combination with the load transistor to set the output between two voltage levels , so that a binary state can be read out . referring again to the memory array area , the active layer will preferably have a higher resistivity than the resistivity of the low resistance state of the bit region , which corresponds to the bit resistor 52 . if necessary , the resistivity of the active layer can be increase by applying one or more electrical pulses to the active layer during manufacturing . once a device is completed and in operation , it can be programmed and read . it may also be desirable to set all of the bit resistors 52 , especially those along a single word line , to the same resistance level either high resistance or low resistance . this may be used to produce a word erase or a block erase . for example , if n - channel transistors are used for the pass transistor and the load transistor , applying a negative voltage , or a plurality of negative voltage pulses , to a word line ( e . g . w 1 ) and grounding the bit pass gate 64 and the load transistor gate 66 of the memory block 20 , sets all bit resistors 52 at the cross point of the word line to the same resistance state , either high resistance or low resistance . it would also be possible to use positive voltages at the word line , provided the bit pass gate and the load gate are properly biased to allow current to flow through the bit . in another embodiment , p - channel transistors may be used for the bit pass transistor and the load transistor . in which case a positive voltage could be applied to the word line while grounding the bit pass gate and the load gate . a negative voltage pulse may be used provided that a sufficiently negative voltage is applied to the bit pass gate and the load gate to allow current to flow through the bit . the applied voltage , or the plurality of voltage pulses , is preferably at a level that will not damage the active layer material . preferably , all bit resistors 52 at the cross point of the word line will be set to the high resistance level . if a single pulse is not sufficient to change the resistivity of the bit region , multiple voltage pulses , at a level lower than the level at which the active layer would be damaged , can be used to affect the change without damaging the active layer . by repeating the process with the remaining word lines , the entire memory block can be set to the same state . the bit 50 can be programmed by applying an on voltage to the bit pass gate 64 , applying a second on voltage to the load gate 66 , and applying at least one programming voltage pulse to the word line . the voltage pulse applied to the word line is the opposite polarity to the polarity used for the word , or block , erase , such that the resistivity of the bit resistor 52 is changed to the opposite resistivity state . if n - channel transistors are used as described above in one embodiment , the programming pulse will be positive and the resistance of the bit resistor 52 will preferably change from a high resistance state to a low resistance state . the bit pass gate 64 of any unselected bits and the load transistor gate 66 of any unselected memory blocks 20 are connected to ground . any voltage at the cross point of the word line and bit line will be very small , such that no significant change in resistance will occur at unselected bits . as discussed above , the polarity and the voltage applied at the word line , the bit pass gate , and the load gate can be selected depending on whether n - channel or p - channel transistors are used to obtain the desired behavior of the memory circuit . the bit 50 can be read . a load voltage is applied to the load gate 66 . the load voltage is smaller than the threshold voltage of the load transistor 26 . in addition , at this load voltage the saturation current of the load transistor 26 is larger than the current flow through the bit 50 when it is at a high resistance level . but , at this load voltage the saturation current of the load transistor 26 is lower than the current flow through the bit 50 when it is at a low resistance level . the bit pass gate 64 is held at a voltage sufficient to allow current to flow through the bit pass transistor 24 , for example v cc . a readout voltage is applied to the word line . the voltage applied to the word line is preferably a pulse with a voltage lower than the critical voltage necessary to change the resistivity of the bit resistor 52 , and correspondingly the resistivity of the bit 50 . if the bit resistor 52 is at a high resistance state , the current flow through the bit 50 is smaller than the saturation current of the load transistor 26 . the bit line voltage is then lower than the threshold voltage of an n - channel transistor at an input of the inverter 28 . the output voltage of the inverter is then equal to approximately its power supply voltage . if the bit resistor 52 is at a low resistance state , such that the bit 50 is at a low resistance state , a large current tends to flow through the bit 50 . this large current is larger than the saturation current of the load transistor . the bit line voltage is larger than the threshold voltage of an n - channel transistor at an input of the inverter 28 . the output voltage of the inverter is then equal to approximately zero volts , which corresponds to ground . using the example discussed above , the current through the bit is expected to be between 6 na and 100 na . the bias voltage applied at the load gate of the load transistor should be selected so that the saturation current of the load transistor is between 6 na and 100 na , for example 50 na . if the resistance of the bit is high enough that the current through it is less than 50 na current will not flow through the load transistor and the output of the inverter will go to the operation voltage , for example vcc . if the resistance of the bit is low , so that more than 50 na flow through it , the current will flow through the load transistor and the output of the inverter will go to approximately 0 volts , or ground . if it is desired to have the bit at high resistance correspond to 0 volts , and the bit at low resistance correspond to the operation voltage , an additional inverter can be added at the output of the inverter . although a preferred embodiment , and other embodiments have been discussed above , the coverage is not limited to these specific embodiments . rather , the claims shall determine the scope of the invention . | 6 |
fig1 shows three control units 3 , 4 and 5 arranged one after the other in series , which are connected via a cable connection 17 to one another and to a converter unit 2 . the converter unit 2 is arranged in an area difficult to access , for instance on the seabed . it is for example connected via a coaxial cable 12 to a monitoring and supplying device 11 that is e . g . arranged on the seabed together with a converter unit 2 . the distance to be covered via the cable connection 12 may amount up to several 100 kilometers . for the power supply of the converter unit 2 there is a voltage supply with a few 1000 v d . c . voltage . this d . c . voltage supply is transformed by a voltage converter 14 arranged in the converter unit 2 into supply voltages suited for the corresponding control units 3 , 4 and 5 , for instance d . c . voltages in the order of a few 100 v , particularly about 300 v . at the same time , the corresponding data or signals are picked up in the converter unit 2 by means of a corresponding data separation device 13 and transmitted via the cable 17 to the downstream control units 3 , 4 , and 5 . the corresponding data or signals are selectively assigned to the corresponding control unit , a data bus connection , such as a field bus and particularly a can bus 16 , being used for transmitting the data or signals . as a rule , up to 128 addresses can be addressed via this field or can bus 16 , so that up to three or four control units can be addressed via a converter unit in the case of 30 to 40 addresses per control unit 3 , 4 , and 5 . the distance between control unit 3 and converter unit 2 and also the distance of the further control units 4 and 5 depends on the data transmission rate used by means of the field or can bus . at low data transmission rates correspondingly large line lengths are possible , whereas these are smaller at higher data transmission rates . it is also possible to transmit specific data or signals to all control units 3 , 4 , 5 , if these serve , for instance , the group control of said control units . fig2 shows a further embodiment of a power and signal distribution system 1 according to the invention . in this system , eight control units 3 to 10 are connected in parallel with a converter unit 2 . the connection between control units and converter unit is established by analogy with fig1 , with a corresponding connection being provided between each control unit 3 to 10 and the converter unit 2 in the form of a cable 17 , in particular , for voltage and signal supply . to be able to distribute the corresponding signals and / or data in the embodiment according to fig2 , the converter unit 2 comprises a so - called router 18 . said router substantially forms some kind of distributing device which forwards incoming data or signals to specific target networks , or in the present case to control units , this process being called routing . moreover , the cable connection 12 in fig2 is built up by analogy with fig1 and the values regarding voltage , distance , or the like , are also like those of fig1 . it should additionally be noted that like parts are provided in all figures with like reference numerals and are explained in more detail only in part in connection with one figure . fig3 shows a further embodiment of a power and signal distribution system 1 of the invention . this system differs from the system according to fig2 , particularly in the way how the data or signals are forwarded . in fig3 , a separate cable connection 20 is provided for signal transmission , said cable connection 20 together with the power cable connection 19 forming the corresponding cable connection 12 to the monitoring and supplying device 1 . the signal cable connection 20 is designed as a fiber cable 21 , see also fig5 . the values for voltage , distance , or the like , correspond again to those of fig1 and 2 . in fig3 , the corresponding control units 3 to 10 are not shown for the sake of simplicity . it should additionally be noted that corresponding fiber cables 21 may be braided with power cable connection 19 to form the cable connection 12 , wherein for instance ten power cables 19 and a corresponding number of ten signal cable connections 20 may be provided . the number of control units 3 to 10 which can be fed by a converter unit 2 is substantially only determined by the capacity of the converter unit , so that for example , eight , nine , ten or more control units can be supplied by only one converter unit 2 with energy / power and data / signals . for instance , to explore an oil field with a number of converter units that is as small as possible , such a converter unit may be arranged approximately in the center of the oil field , the corresponding monitoring and supplying devices 11 being possibly arranged several 100 kilometers away from said place . in star - shaped configuration with the converter unit 2 the corresponding control units 3 to 10 can then be arranged relative to the converter unit and distributed over the oil field for exploring substantially the whole oil field . in the former described embodiments the power supply has also been carried out via cable connection 12 . in the embodiment according to fig4 , only the data / signal transmission is essentially carried out from the side of the monitoring and supplying device 11 ( see fiber cable 21 ) whereas a separate voltage supply device 24 is used for voltage supply . this separate voltage supply device 24 may already be used on site for instance to feed other devices such as pumps or the like . if this separate voltage supply device 24 is adequately designed for the supply of the corresponding components , it can also be used for the additional supply of the converter unit 2 . the remaining connections between converter unit 2 and control units 3 to 10 are again by analogy particularly with fig2 and 3 . it should here also be noted that it is also possible to replace one of the control units 3 to 10 according to fig2 , or also a plurality of said control units , by a group of control units that are arranged one after the other according to fig1 . in the embodiment shown in fig4 , attention must be paid that due to the design of the corresponding separate voltage supply device 24 and the supply of other components , for instance in the oil field , additional safety measures have to be taken for the power and signal distribution system 1 according to the invention . these safety measures refer , for instance , to the arrangement of a power controller 31 in or on the converter unit 2 . this power controller monitors the voltage transmitted to the converter unit 2 via power feeding 23 from the separate voltage supply device 24 and controls the voltage to assume values needed by the converter unit 2 . furthermore , to prevent possible damage by overvoltages or undervoltages , an emc module 26 may additionally be assigned to the converter unit 2 . such a module serves here to suppress power - induced failures . in the embodiments shown in fig3 and 4 , attention must further be paid that , apart from a router 18 , the converter unit 2 comprises a fiber optic modem 22 . said modem serves to convert the data or signals transmitted via the corresponding fiber cable 21 into electrical data or signals and to transmit them ( see also the observation regarding fig1 ) via a cable and a corresponding field bus to the connected control units 3 to 10 . fig5 is an enlarged view of a corresponding cable connection 12 with a fiber cable 21 as a signal cable connection 20 . a corresponding cable connector 28 is arranged at the end of the cable connection 12 assigned to the converter unit 2 . the various fiber cables 21 and thus also power cable connections 19 are connectable by said connector also below sea level to a corresponding plug of the converter unit 2 . a corresponding side view of the cable connector 28 from the right side in fig5 is shown in fig6 . to be more specific , ten power cable connections 19 and thus ten signal cable connections 20 in the form of fiber cables 21 and the associated connectors , respectively , can be seen in said figure . these are connected with a corresponding mating connector to the converter unit 2 . fig7 shows a section taken along line vii - vii of fig5 . as can be seen , a total of twelve power cable / signal cable connections 19 , 20 are provided , said structure being also analogously applicable to a fiber cable 21 , see fig3 and 4 , on condition that according to fig4 no voltage supply takes place through the corresponding cable connection 12 . according to fig7 , however , a voltage and signal transmission takes place through each of the individual cables shown in sectional view because the corresponding power cable connections 19 and signal cable connections 20 are combined to form said individual cables . ten of said individual cables are used for corresponding control units 3 to 10 while two of said individual cables are configured as substitute lines 29 . in the absence of any voltage supply , see fig4 , the corresponding individual cables only comprise signal cable connections in the form of fiber cables 21 . the ends of the individual cables according to fig7 are then separated with respect to voltage supply and signals ( see fig6 ) so that ten individual connectors for signals and ten individual connectors for voltage are present . fig7 shows such an individual cable 27 on an enlarged scale , comprising nine fibers 30 and being designed as a coaxial cable that simultaneously serves the transmission of the corresponding voltage . hence , it is possible according to the invention to feed several production apparatuses or production trees by taking minimal efforts only by way of one converter unit 2 , and a corresponding control unit 3 to 10 is assigned to every production apparatus as a rule . especially the saving aspect with respect to cable connections that are no longer needed is important according to the invention , and it is particularly possible to control and regulate each of the production trees in real time on site , and safety monitoring can be realized through the exchange of corresponding data . this is also accomplished with a minimal number of units ; see e . g . a converter unit 2 connected to eight control units . the corresponding control unit serves on site in the production apparatus for distributing power and the corresponding control data or signals . while the invention may be susceptible to various modifications and alternative forms , specific embodiments have been shown by way of example in the drawings and have been described in detail herein . however , it should be understood that the invention is not intended to be limited to the particular forms disclosed . the invention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as defined by the following appended claims . additionally , usage of the term “ present invention ” or “ invention ” generally refers to exemplary embodiments of the claimed invention and , as such , subsequent descriptors are not necessarily requirements for every embodiment encompassed by the claims of this application . | 7 |
now , a sound - insulating curtain according to one embodiment of the present invention will be described below with reference to fig1 to 3 as indicated above . in each of the figures as indicated above , the sound - insulating curtain 1 , according to the present invention , is provided with a sound - absorbing core 13 . the sound - absorbing core 13 is formed by placing a non - woven fabric 11 , serving as a porous sheet member having a sound - absorbing property , on a smooth film 12 formed of synthetic resin , and with a cover member 14 , which is placed on this sound - absorbing core 13 and formed of a sound - transmitting material and is almost sheet - shaped . the above - mentioned non - woven fabric 11 is a known flexible porous member , which has been prepared by collecting and combining natural fiber and synthetic fiber together into a sheet , and also has an elastic deformability by which it can be compressed and restored in a thickness direction . the non - woven fabric 11 of which the porous sheet member is formed may cause friction between the fiber materials within the fabric during deformation , so as to absorb an external energy by which the deformation is caused , i . e ., a sound . the thickness of the non - woven fabric 11 is set , for example , as several millimeters . however , the present invention is not limited only to it , and there may appropriately be selected a thickness suitable for the material and the use as the sound - absorbing material . it is necessary to use the same structure in each of the layers of which the sound - absorbing core 13 is formed in a combined state , and there may be applied a multiple structure in which the respective layers have different characteristic properties such as density , etc . so as to widen a frequency band of the sound , which may be absorbed by the respective layers of non - woven fabric . the above - described film 12 is flexible and extremely thin , and has the same area as the non - woven fabric 11 and the smooth surface . the thickness of the film 12 is set as a negligible small value relative to the thickness of the non - woven fabric 11 serving as the porous sheet member , for example as 0 . 1 mm . however , the present invention is not limited only to it , and there may appropriately be selected a thickness suitable for the material and the use as the sound - absorbing material . the sound - absorbing core 13 is formed by placing this film 12 on the non - woven fabric 11 . the sound - absorbing core 13 has a structure , which may provide a weight and flexibility applicable to be used comfortably as a curtain , while improving the sound - absorbing effect . for example , the sound - absorbing core 13 has a structure in which the film 12 has a four - layer structure in which the non - woven fabric 11 is placed between the adjacent layers of the film , and the non - woven fabric 11 has a three - layer structure . the above - described cover member 14 is a thin sheet formed of a cloth having a flameproof property , and has a sound - transmitting property and flexibility , and covers the surface of the sound - absorbing core 13 to protect it . this cover member 14 and the sound - absorbing core 13 are placed one on the other to form a combined body so that the sound - absorbing core 13 is held between the cover members on the opposite sides , and such a combined body is sewn into a combined body to prepare a curtain 1 . the curtain 1 has a structure in which the sound - absorbing core 13 is included between the cover members 14 . the curtain 1 is placed around an object person on the side of which a noise is to be prevented from coming . the noise transmitting toward the object person reaches the curtain 1 to be decayed through the sound - absorbing effect of the non - woven fabric 11 and the film 12 , thus preventing effectively the noise from reaching the object person 80 . now , a method for manufacturing the sound - insulating curtain according to the present invention will be described . first , the non - woven fabrics 11 as the porous sheet member are placed one on the other so that the film 12 is held between the adjacent non - woven fabrics . after there is prepared the sound - absorbing core 13 in which the non - woven fabrics 11 and the films 12 are placed one on the other by the respective set numbers of them , the cover members 14 are placed on the both surfaces of this sound - absorbing core 13 . the combined body in which the sound - absorbing core 13 is placed between the cover members 14 , is continuously sewn in a vertical direction in a hanged state of the curtain , and a plurality of rows of sewn section 15 by sewing is provided at predetermined intervals in a horizontal direction , so as to form a combined body into a whole , thus preparing the curtain 1 . the distance between the rows of sewn section 15 in the horizontal direction of the curtain , i . e ., the distance between the sewing lines is preferably set as a value by which an external appearance of the curtain as folded by an equal interval may be kept in the same manner as the common curtain , and for example as 15 cm . with larger distance than this value , the portions of the curtain which is to be folded may not be formed regularly , resulting in causing improper creases of the curtain as folded , which are misaligned to each other in the vertical direction , thus causing disfigurement of the curtain . by conducting the sewing step , the cover members 14 and the sound - absorbing core 13 , which are placed one on the other , but each have a small friction coefficient and are slippery , are easily kept in a state in which they cannot be separated from each other . in an area excluding the sewn sections of the curtain 1 , each of the non - woven fabrics 11 between which the film 12 is held is placed in a non - compressed state , to contain air to maintain substantially the original thickness of it . in the sewing step , there may be formed pleats , which facilitate the natural bending of the curtain in the hanged state , in order to improve usability when opening and closing the curtain . next , description will be given of use of the sound - insulating curtain according to the present invention . the curtain 1 is placed in the hanged state around an object person who wishes to prevent the noise from coming , in a room space , so that , when the curtain is spread to close it , the curtain exists between the noise source and the object person to insulate the object person from the noise source . the non - woven fabric 11 , which is not robust , is combined to the other member and its surface is covered with the cover member 14 , thus making it possible to place easily the curtain without causing any problem of the handling . in a state in which this curtain 1 is placed , the noise from the noise source spreads and propagates in every directions and the sound , which has come straight from the noise source or reflected once from a ceiling or wall and then directed toward the object person in the room space , reaches the curtain 1 . when the sound reaches the curtain 1 , most of the sound passes through the cover member 14 . the sound , which has passed through the cover member 14 , reaches the non - woven fabric 11 inside the cover member , and a part of the sound is absorbed by the porous non - woven fabric 11 . then the sound , which has passed through the non - woven fabric 11 , reaches the film 12 . in the sewn section 15 of the non - woven fabric 11 and the film 12 , the non - woven fabric 11 is compressed and deformed , thus being in a high restraint state and deteriorated in a sound - absorbing performance in comparison with the other portion . however , the sound may be decayed through the porous material type sound - absorbing effect , so as to prevent the sound from transmitting . in the film 12 , there is caused absorption of the sound mainly through the panel vibration type sound - absorbing effect , thus decaying the sound here . in a boundary area between the non - woven fabric 11 and the film 12 , the frictional resistance of the non - woven fabric 11 to the film 12 is small and the non - woven fabric 11 and the film 12 become slippery to each other , so as to easily cause their displacement and deformation , thus ensuring a state in which there may be provided sufficiently the porous material type sound absorbing effect and the panel vibration type sound - absorbing effect . every time the sound reaches the non - woven fabric 11 or the film 12 , the sound may be decayed through the respective sound - absorbing effects , and finally , on the side of the cover member 14 , which is placed on the rear side of the curtain and opposite to the side on which the sound has been incident , there is no transmission of the sound or a small level of transmitting sound , which may not be perceived as the noise , propagates toward the object person in the inside of the curtain 1 . this makes it possible to decay effectively an energy of the noise , which is apt to propagate from the outside area of the curtain to the inside area of the curtain , to prevent the noise from reaching the object person , and reduce the discomfort of the noise , thus improving remarkably the quality of environment of the sound in the room space . the cover member 14 has a flameproof property imparted to it . accordingly , in use of the curtain 1 in the room space , even if the curtain is mistakenly put close to fire , it is unlikely to result in a problem that the fire spreads to the curtain 1 . accordingly , use of the curtain 1 results in a minimal risk of fire , which results in the curtain 1 being used without any problems in the room space , for example in a hospital room in which a specific consideration of safety is required . in the sound - insulating curtain according to the present invention , the sound - absorbing core 13 in which the non - woven fabrics 11 and the films 12 are combined is covered with the cover members 14 , and they are sewn to form the combined body , and the respective adjacent layers as combined are not put in an excessive restraint condition at the other area than the sewing sections , even after applying the combining step to the combined layers . this structure enables the respective layers to be displaced and deformed due to pressure of the sound , and permits to surely maintain the combined state in use , and provide the respective sound - absorbing effects in these layers , which can be displaced and deformed , to ensure the absorbing performance of the sound in the whole curtain and to decay effectively the noise , which is apt to transmit through the curtain , thus surely preventing the sound from transmitting through the curtain to reach an area through the curtain . the non - woven fabric 11 is disposed , with uniformity , anywhere including the sewing sections so as not to provide any area in which the non - woven fabric 11 is not disposed , thus preventing degradation of the local sound - absorbing performance . in addition , the members each having flexibility are combined and sewn at the minimum necessary portion into a combined body to provide the curtain , thus making it possible to maintain flexibility in the whole curtain , cause a user to easily cope with the handling as the curtain with portions , which are bendable and extensible , and provide the same usability as the common curtain without requiring a specific attention of the user . the sound - insulating curtain of the present invention was actually used in a hanged state and there was made a measurement assessment on a level of transmission of the sound from the sound source . the results were described below . more specifically , the sound - insulating curtain of the present invention was placed in a hanged state in a room space for experiment , the sound ( e . g ., pink noise ) was output from a speaker , a sound pressure level of the sound transmitting through the curtain in a spread and closed state of it was measured in an area , which was apart from the speaker and separated by the curtain in the same room space , and there were measured , as measurement values , an average value and the maximum peak value of the sound pressure level within a measuring time ( e . g ., 30 seconds ). the measurements were made in the same manner in case where the sound - insulating curtain of the present invention was used ( example no . 1 of the present invention ), in case where the curtain was folded together in an opened state , the sound from the speaker directly reached a measurement device without transmitting through the curtain ( comparative example no . 1 ), and in case where there was applied the combined structure in which only the non - woven fabrics were used in the sound - absorbing core of the structural components of the present invention , without providing the film ( comparative example no . 2 ). for the sound - insulating curtain of the present invention , the film of polyvinyl chloride was used , and the curtain containing the non - woven fabrics and the cover members had the maximum thickness of 20 mm at the other area than the sewn section . comparative example no . 2 as indicated above had a structure in which the films were excluded from the sound - insulating curtain of the present invention . in each of the cases of example no . 1 of the present invention and comparative example no . 2 , the curtain was placed so that it was fully spread and the sound from the speaker was incident at right angles on substantially the flat surface of the curtain , and the sound from the speaker was not directly measured . in addition , the curtain had an appropriate length in the vertical direction extending from the upper side to the lower side in the room space , so as to prevent the sound from coming from the upper and lower sides of the curtain . table 1 shows the measurement values of the sound pressure level at places , which were away from the speaker by the same distance , when the sound was output from the speaker in the same manner in example no . 1 of the present invention and the respective comparative examples . however , the room space as the measurement environment was not completely silence and had not a complete sound - insulating structure , and background noise existed . table 1 as indicated above shows that the level of the transmitting sound in any one of the average value and the peak value in example no . 1 of the present invention was more effectively lower than the respective comparative examples . especially , even in comparison with comparative example no . 2 in which the films were excluded from the structure of the curtain of the present invention , the transmitting sound was decayed in example no . 1 of the present invention . it is clearly recognized that the panel vibration type sound - absorbing effect of the film was additionally achieved not only by providing the sound - absorbing effect by the non - woven fabric in the combined body , but also by using the film between the non - woven fabrics , and that the non - woven fabric slid on the film in a contact state to facilitate displacement and deformation , thus clearly revealing achievement of the porous type sound - absorbing effect by the non - woven fabric . it is thus clearly recognized that the sound - insulating curtain of the present invention , which is placed in a hanged state between the sound source and the area in which the sound from the sound source is to be prevented from coming , can achieve an appropriate sound insulation by the sound absorbing effects in the respective components of the curtain , so as to prevent the sound from transmitting into the area on the rear side of the curtain , thus ensuring a state in which the noise , etc . may not easily transmit through the curtain . | 6 |
initially , to be easily understood , wording used upon detailed description of an information processing system 1000 applicable with the present invention will be defined . a “ data set ” refers to data to be input to the information processing system 1000 . the “ data set ” includes one feature or a plurality of features . the “ feature ” may be translated into a “ variable .” a “ function ” defines processing of constructing a new feature from a given feature . the “ function ” is applied to a feature included in a data set . in other words , when the “ function ” is applied to a feature , processing defined by the function is executed for the feature , and a new feature is constructed as a result . in other words , the “ function ” defines an operation applied to a feature . this may be expressed in different words : the function defines processing of transforming a feature into another feature . the “ function ” may be a mapping applied to a feature included in a data set . in other words , a function indicates the above - described operation associated with the function . in other words , a function indicates the above - described processing associated with the function . the processing defined by the “ function ” is , for example , a unary operation . the “ function ” defines an operation such as a trigonometric function ( sin ( x ), cos ( x ), or tan ( x )), a natural logarithm , an absolute value , sign inversion , or the like . the “ function ” may define an operation with a parameter n , such as , log n x , or x n . the processing defined by the “ function ” is , for example , a polynomial operation . the polynomial operation is an operation having a plurality of operands . the “ function ” defines , for example , an arithmetic operation ( addition , subtraction , multiplication , or the like ) between a feature x and a feature y . when the feature x and the feature y are logical values , the “ function ” defines , for example , a logical operation ( and , or , xor , or the like ) applied to a bit value of the feature x and a bit value of the feature y . the processing defined by the “ function ” may be “ processing depending on data ” in which processing is determined according to data . one specific example of the processing depending on data is normalization processing . the “ processing depending on data ” is described below with a specific example . suppose that , for example , a data set including information in which values of names and values of heights of 100 persons are correlated has been input to a data mining device . in this case , the data set includes two features including a feature that is “ name ” and a feature that is “ height .” in this example , the feature that is “ name ” represents the values of the names of the 100 persons . the feature that is “ value of height ” represents the values of the heights of the 100 persons . suppose that the data mining device constructs , by applying a function that defines normalization processing to the feature “ height ”, a new feature that is “ normalized height .” in this case , the data mining device does not individually normalize data for one person included in the feature . suppose that the data mining device has initially received , for example , only a piece of information “ name : n , height : 174 ” of a first person among pieces of information for the 100 persons . in this case , the data mining device does not calculate a new feature “ normalized height ” for the piece of information of the first person . the reason is that only when the data mining device completes the pieces of information of the 100 persons , values necessary for normalization as parameters ( i . e . an average value of the values of “ height ” for the 100 persons and a standard deviation of “ height ” for the 100 persons ) become available , and a function for normalization is fixed as a result . for example , histogram construction , clustering , and principal component analysis are exemplified as other specific examples of such “ processing depending on data ”. ( composition of functions ) in the present application , sequentially applying processing defined by a first function and processing defined by a second function to a feature is described as a “ composition of functions .” suppose that , for example , the first function defines a function that is sin ( x ) and the second function defines a function that is x 2 . when processing defined by the first function and processing defined by the second function are composed , a new function that is ( sin ( x )) 2 or a new function that is sin ( x 2 ) is defined . in this manner , when the first function and the second function are composed , a new third function is defined . processing defined by the third function in this case is described below . when the processing defined by the third function is executed for a target feature , a new feature as described below is constructed . in other words , a new feature constructed when the processing defined by the first function and the processing defined by the second function are sequentially applied to the target feature is constructed by applying the third function . an “ analysis engine ” is analysis processing based on a feature . in other words , the analysis engine receives a feature as an input , executes analysis on the basis of the feature , and outputs the result of analysis . the analysis engine is referred to also as an analysis algorism or the like executed by a data mining device . the analysis engine is an analysis engine that executes processing such as regression analysis , factor analysis , covariance structure analysis , principal component analysis ( principal factor analysis ), discriminant analysis , kernel analysis , heterogeneous regression analysis , cluster analysis , or abnormality detection . “ designation of a type of an analysis engine ” represents reception of a designation of a type of such an analysis engine . the “ analysis engine ” may indicate , for example , a subject ( e . g . a device ) that executes the above - described analysis processing or a program that controls a processor to execute analysis processing . a constraint condition is a requirement to be satisfied by information output by an analysis engine . in other words , the constraint condition is a requirement to be satisfied by an analysis result output by the analysis engine . when a type of the analysis engine is single regression analysis , one specific example of the constraint condition is that “ a chi - square value is equal to or greater than 0 . 9 .” hereinafter , reading out information from a storage device , receiving information from an external device , receiving an input of information from an operator , and the like is collectively described as “ acquiring information .” hereinafter , writing information to a storage device , transmitting information to an external device , presenting information to an operator in a form of screen display , a sound or the like , and the like is collectively described as “ outputting information .” by taking into consideration the above - described definitions of wording , exemplary embodiments of the present invention will be described in detail with reference to the drawings . a first exemplary embodiment is one specific example of the present invention in a case where single regression analysis is designated as a type of the analysis engine . fig1 is a block diagram illustrating an outline of an information processing system 1000 according to the first exemplary embodiment . the information processing system 1000 includes a function storage unit 110 , a function definition unit 120 , a feature construction unit 130 , a test unit 140 , and an output unit 150 . the function storage unit 110 can store a plurality of functions . the function storage unit 110 may be implemented inside the information processing system 1000 , or may be implemented in an external device , not illustrated , accessible by the information processing system 1000 . the function definition unit 120 acquires a plurality of functions from the function storage unit 110 . the function definition unit 120 defines a new function by composing the acquired functions . the feature construction unit 130 acquires a target data set . the feature construction unit 130 may receive an input of a data set from an operator , or may read out a data set from a storage unit , which is not illustrated . the feature construction unit 130 may receive a data set from a device , which is not illustrated , provided outside the information processing system 1000 . the feature construction unit 130 applies a function stored in advance in the function storage unit 110 or a function defined by the function definition unit 120 to a feature included in the data set . accordingly , the feature construction unit 130 constructs a new feature that is a result obtained by applying the function to the feature . the test unit 140 acquires , from , for example , the operator , a designation of a type of the analysis engine and a designation of the constraint condition . in the first exemplary embodiment , the test unit 140 acquires “ single regression analysis ” as the type of the analysis engine . the test unit 140 acquires a designation of , among a plurality of features included in the data set , a feature that is an objective variable to be predicted by a function . the test unit 140 inputs , as an explanatory variable , the new feature constructed by the feature construction unit 130 to a single regression analysis engine ( not illustrated ). the test unit 140 acquires a regression equation output by the single regression analysis engine . the test unit 140 tests whether the regression equation satisfies the constraint condition . the output unit 150 outputs , for example , a regression equation that satisfies the requirement . hereinafter , with reference to fig1 to fig8 , details of the function storage unit 110 , the function definition unit 120 , the feature construction unit 130 , the test unit 140 , and the output unit 150 will be described . fig2 is a diagram illustrating one example of a data set input to the information processing system 1000 illustrated in fig1 . as illustrated in fig2 , the data set includes information that correlates , for a plurality of persons , for example , an id ( identifier ), a value of height , a value of weight , and an annual consumption of ice cream with one another . each of “ height ,” “ weight ,” and “ annual consumption of ice cream ” illustrated in fig2 is equivalent to the “ feature .” fig3 is a diagram illustrating one example of information stored in the function storage unit 110 illustrated in fig1 . as illustrated in fig3 , a plurality of functions are stored in the function storage unit 110 . as illustrated in fig3 , processing defined by a function the function id ( identifier ) of which is “ function 1 ” is x . here , x represents identity mapping . processing defined by a function the function id of which is “ function 2 ” is sin ( x ). here , sin represents a sine function . processing defined by a function the function id of which is “ function 3 ” is x 2 . here , x 2 represents a function of squaring a value of x . in the following description , a function is indicated by a function id of the function . for example , the function 2 indicates a function the function id of which is the function 2 . with reference to fig1 and fig4 , details of the function definition unit 120 illustrated in fig1 are described . fig4 is a diagram illustrating new functions 4 and 5 output when the function definition unit 120 acquires the functions 1 and 3 illustrated in fig3 . as illustrated in fig4 , the function definition unit 120 acquires the functions 1 to 3 , and constructs the new functions 4 and 5 . the function definition unit 120 defines the new function 4 by composing , for example , the function 2 and the function 3 . as illustrated in fig4 , processing defined by the function 4 is ( sin ( x 2 )). the function definition unit 120 may change an order for composing functions . the function definition unit 120 may define the function 5 by composing , for example , the function 2 and the function 3 . as illustrated in fig4 , processing defined by the function 5 is ( sin ( x )) 2 . with reference to fig1 and fig5 , details of the feature construction unit 130 illustrated in fig1 are described below . as illustrated in fig1 , the feature construction unit 130 acquires a data set as a target . the feature construction unit 130 may acquire a designation of a feature that is an objective variable . suppose that , for example , the feature construction unit 130 acquires a designation of a feature that is “ annual consumption of ice cream ” as a feature that is an objective variable . further suppose that the feature construction unit 130 acquires the function 5 ( i . e . ( sin ( x )) 2 ) from the function storage unit 110 . the feature construction unit 130 selects one feature to be input to the function from features ( i . e . “ height ” and “ weight ”) other than the feature designated as the objective variable , among a plurality of features included in the data set . suppose that the feature construction unit 130 selects , for example , a value that is “ height .” the feature construction unit 130 applies the selected function ( sin ( x )) 2 to the selected feature “ height ” and constructs a new feature . a new feature constructed as the result is illustrated in fig5 . fig5 is a diagram illustrating a new feature constructed by the feature construction unit 130 applying the function ( sin ( x )) 2 to the feature “ height ”. assuming that , for example , n features are received and m functions are received , the feature construction unit 130 constructs n times m new features . assuming that the feature construction unit 130 receives two features that are “ height ” and “ weight ”, and receives five functions from the function 1 to the function 5 , the feature construction unit 130 constructs 2 times 5 = 10 new features . in other words , the feature construction unit 130 constructs ten new features listed below . however , the feature construction unit 130 does not have to construct all of the ten new features described above . the feature construction unit 130 outputs the constructed features . details of the test unit 140 illustrated in fig1 are described below with reference to fig1 , fig6 , fig7 , and fig8 . the following description is merely one specific example of an operation of the test unit 140 , and the operation of the test unit 140 is not interpreted restrictively . suppose that the test unit 140 acquires “ single regression analysis ” as a type of the analysis engine , acquires “ annual consumption of ice cream ” as a feature that is an objective variable , and acquires a condition that is “ a chi - square value is equal to or greater than 0 . 9 ” as a constraint condition . in other words , the test unit 140 executes regression analysis according to an equation that is y ( annual consumption of ice cream )= ax + b . here , y is an objective variable . x is an explanatory variable . symbols a and b are constants . the test unit 140 analyzes an extent how well a feature ( explanatory variable ) constructed by the feature construction unit 130 can explain the annual consumption of ice cream ( objective variable ). the test unit 140 acquires a feature included in a data set acquired by the feature construction unit 130 . the test unit 140 acquires a feature output by the feature construction unit 130 . the test unit 140 selects one feature from a plurality of acquired features . suppose that , for example , the test unit 140 selects a feature that is “ height .” fig6 is a graph illustrating a result obtained by the test unit 140 selecting a feature that is “ height ” as an explanatory variable and executing single regression analysis on the basis of the explanatory variable . as illustrated in fig6 , as the result of the single regression analysis , a result that is a = 0 . 0322 and b = 3 . 7137 is obtained , and a chi - square value is 0 . 031 . fig7 is a graph illustrating a result obtained by the test unit 140 selecting a feature that is “( sin ( height )) 2 ” as an explanatory variable and executing single regression analysis on the basis of the explanatory variable . as illustrated in fig7 , as the result of the single regression analysis , a result that is a = 11 . 179 and b = 3 . 0349 is obtained , and a chi - square value is 0 . 998 . the test unit 140 executes , for each acquired feature , processing of inputting a feature to an analysis engine ( in the example described above , a single regression analysis engine ), processing of acquiring an analysis result ( i . e . a regression equation and a chi - square value ) output by the analysis engine , and processing of testing whether the analysis result ( i . e . the chi - square value ) satisfies the constraint condition . fig8 is a diagram illustrating a result obtained by the test unit 140 executing processing individually for ten types of features constructed by the feature construction unit 130 . as illustrated in fig8 , an explanatory variable satisfying the constraint condition , that is “ a chi - square value is equal to or greater than 0 . 9 ,” is “( sin ( height ))” only . the fact that a chi - square value satisfies the constraint condition when “( sin ( height ))” is selected as the explanatory variable means , in other words , that it is possible to explain an individual annual consumption of ice cream according to a relational equation that is y = ax + b by using a value derived by squaring a value obtained by substituting a value of height into a sine function ( sin ). in contrast , as illustrated in other examples of fig8 , when another feature is selected as the explanatory variable , the chi - square value does not satisfy a testing threshold . this means that it is not possible to explain an individual annual consumption of ice cream on the basis of a value of the another feature when being along the relational equation that is y = ax + b . the output unit 150 outputs , for example , a regression equation satisfying the requirement . the output unit 150 may operate as described below . suppose that , for example , the constraint condition is satisfied by an analysis result obtained by an analysis engine to which , for example , a feature a described below : feature a is : a value derived by squaring a value obtained by substituting a value of a feature b into a sine function ( sin ). in this case , the output unit 150 may output information that “ preprocessing should be executed to substitute a value of a feature that is height into a sine function ( sin ) and to further square an obtained value .” alternatively , the output unit 150 may output information that “ an analysis result satisfying the constraint condition can be obtained by inputting , to a designated analysis engine , a value derived by squaring a value obtained by substituting a value of a feature that is height into a sine function ( sin ).” alternatively , the output unit 150 may output information that is “ a value derived by squaring a value obtained by substituting a value of a feature that is height into a sine function ( sin ).” the output unit 150 may output such information together with a type of a designated analysis engine and a file name of a data set . next , an operation of the information processing system 1000 according to the first exemplary embodiment is described below . fig9 is a flowchart illustrating the operation of the information processing system 1000 according to the first exemplary embodiment . the function definition unit 120 acquires functions from the function storage unit 110 ( step s 101 ). the function definition unit 120 defines a new function by composing the acquired existing functions ( step s 102 ). the feature construction unit 130 inputs a feature to the new function , and calculates a value output in accordance with the function as a new feature . the feature construction unit 130 constructs a new feature for , for example , all combinations of the functions and the features ( step s 103 ). the operation shown in step s 103 may be expressed in different words : inputting an acquired feature to a function , and calculating a value output in accordance with the function as a new feature . the test unit 140 selects , from a plurality of new features , a specific feature ( step s 104 ). the test unit 140 analyzes an extent how well a designated objective variable can be explained on the basis of the specific feature ( explanatory variable ). as a result , the test unit 140 obtains an analysis result ( i . e . a regression equation and a chi - square value ) ( step s 105 ). the test unit 140 repeats the operation shown in step s 105 for all of the features constructed by the feature construction unit 130 ( step s 106 ). the test unit 140 tests whether an analysis result satisfying a constraint condition is obtained ( step s 107 ). the operation shown in step s 107 may be executed during repetition from step s 104 to step s 106 . when an analysis result satisfying the constraint condition is obtained ( yes in step s 107 ), the output unit 150 outputs the analysis result satisfying the constraint condition ( step s 108 ). when an analysis result satisfying the constraint condition is not obtained ( no in step s 107 ), the output unit 150 does not output an analysis result satisfying the constraint condition . an operation and an effect produced by the information processing system 1000 according to the first exemplary embodiment are described below . according to the first exemplary embodiment , it is possible to provide the information processing system 1000 that contributes to accuracy improvement in analysis processing . the reason is that the feature construction unit 130 according to the first exemplary embodiment calculates a function for a feature , and constructs a new feature . owing to such a configuration , the information processing system 1000 is able to “ increase the number of features that are candidates for an explanatory variable .” this may be rephrased as : it is possible to “ increase the number of candidates for a feature for verifying a hypothesis .” therefore , the present exemplary embodiment increases a possibility that an explanatory variable sufficiently explaining an objective variable is selected , and achieves an advantageous effect that accuracy of data mining is improved . in the example described above , features input from an operator 900 , i . e . features included in a data set are of three types (“ height ,” “ weight ,” and “ annual consumption of ice cream ”). in the example , one of the three types of features ( i . e . “ annual consumption of ice cream ”) is designated as an objective variable . in this case , substantial candidates for an explanatory variable are two types of features (“ height ” and “ weight ”) other than the annual consumption of ice cream . the information processing system 1000 constructs , as described above , ten new features on the basis of two types of features included in a data set that is a target and functions ( the functions 1 to 3 ) stored in the function storage unit 110 or a function ( the function 4 or 5 ) defined by the function definition unit 120 . thus the information processing system 1000 can improve accuracy of data mining because of an increase of a possibility that a feature sufficiently explaining an objective variable is selected by increasing the number of features that are candidates for an explanatory variable . the function definition unit 120 according to the first exemplary embodiment defines a new function by composing a plurality of functions . owing to such a configuration , the information processing system 1000 is able to construct a new feature by using a function other than a function prepared in advance . accordingly , the feature construction unit 130 can construct more types of features . the information processing system 1000 according to the first exemplary embodiment can output procedures of pre - processing that should be executed for a feature in order to improve accuracy of data mining . the reason is that , when obtaining an analysis result satisfying a constraint condition , the output unit 150 according to the first exemplary embodiment outputs a feature input to an analysis engine to obtain the analysis result . alternatively , the reason is that the output unit 150 outputs information showing processing which should be executed for a feature included in a data set in order to obtain an analysis result satisfying a constraint condition . the information processing system 1000 according to the first exemplary embodiment can reduce quantity of work of an analysis engineer who executes data analysis . the reason is that the feature construction unit 130 of the information processing system 1000 according to the first exemplary embodiment constructs a new feature on the basis of a plurality of features . and the test unit 140 of the information processing system 1000 selects , among constructed new features , a feature that meets a predetermined standard . in other words , the test unit 140 inputs , for example , a new feature which is constructed to an analysis engine that executes analysis processing on the basis of a feature which is input . and , the test unit 140 tests whether information output by the analysis engine satisfies a predetermined requirement . when , for example , the information which is output satisfies the predetermined requirement , the test unit 140 selects the feature that is input to the analysis engine . the predetermined requirement ( i . e . constraint condition ) means that , for example , a correlation with an objective variable is higher than a predetermined standard . in other words , when an analysis engineer inputs a plurality of features to the information processing system 1000 , the information processing system 1000 can automatically or semi - automatically construct a feature highly correlated with the objective variable . specifically , according to , for example , the information processing system 1000 of the first exemplary embodiment , even when the analysis engineer does not know that there is a strong correlation between “ individual annual consumption of ice cream ” and “( sin ( height )) 2 ,” the analysis engineer is able to obtain an analysis result with high accuracy . the reason is that on the basis of a feature that is “ height ,” the information processing system 1000 constructs a new feature that is “( sin ( height )) 2 .” in other words , when the analysis engineer inputs a feature that is “ height ” to the information processing system 1000 , the information processing system 1000 can construct a feature highly correlated with an objective variable , i . e . ( sin ( height )) 2 automatically or semi - automatically for the user . according to the information processing system 1000 of the first exemplary embodiment , an analysis engineer who executes data analysis can notice that there is a strong correlation between an objective variable and a feature which is newly constructed . for example , the analysis engineer who executes data analysis can notice that there is a strong correlation between “ individual annual consumption of ice cream ” and “( sin ( height )) 2 .” the function definition unit 120 may read out an operator including a continuous value parameter n from the function storage unit 110 and substitute an optional value into n to define a new function . the operator including a continuous value parameter n is , for example , log n x or x n . when , for example , the function definition unit 120 reads out a function that defines log n x , the function definition unit 120 defines a new function such as log 2 x , log 3 x , log 5 x , or the like . the test unit 140 may receive , for example , a designation of multiple regression analysis as a type of the analysis engine . suppose that , for example , the test unit 140 receives a designation of multiple regression analysis ( z = ax + by + c ). here , z is an objective variable . x is a first explanatory variable . y is a second explanatory variable . symbols a , b , and c each are constants . suppose that the test unit 140 acquires , for example , ten features from the feature construction unit 130 . in this case , the number of ways of selecting a combination of the first explanatory variable x and the second explanatory variable y is 45 (=( 10 times 9 ) divided by 2 ). the test unit 140 repeats the operations shown in step s 104 to step s 106 illustrated in fig9 for 45 combinations of the explanatory variables . the test unit 140 may receive curvilinear regression analysis as a type of the analysis engine . in this case , the test unit 140 receives a designation of a type of a curve such as an exponential function , a gaussian function , or the like . the modification examples described above are also applicable to other exemplary embodiments . a second exemplary embodiment is one specific example of the present invention in a case where discriminant analysis is designated as a type of the analysis engine . fig1 is a block diagram illustrating a configuration of an information processing system 1001 according to the second exemplary embodiment . as illustrated in fig1 , the information processing system 1001 according to the second exemplary embodiment may have the following configuration . including a function storage unit 111 instead of the function storage unit 110 according to the first exemplary embodiment . including a function definition unit 121 instead of the function definition unit 120 . including a feature construction unit 131 instead of the feature construction unit 130 . including a test unit 141 instead of the test unit 140 . the first exemplary embodiment and the second exemplary embodiment are different in a data set to be handled and a type of the analysis engine to be designated . fig1 is a diagram illustrating one example of a data set input to the information processing system 1001 illustrated in fig1 . the data set illustrated in fig1 may be also referred to in another way as multivariable data . as illustrated in fig1 , the data set includes information that correlates a feature 1 to a feature 4 with each identifier for a plurality of persons . the data set illustrated in fig1 is data representing , for example , answer results of a questionnaire for the plurality of persons . each feature is an answer to a question item included in the questionnaire . the contents of the feature 1 to the feature 4 are listed below . specifically , the question item and the value indicated by the answer are listed for each of the features . feature 1 : which do you like better , dogs or cats ? ( dogs are indicated by 0 and cats are indicated by 1 ), feature 2 : age ? ( an age of 40 or more is indicated by 0 and an age of less than 40 is indicated by 1 ), feature 3 : gender ? ( a male is indicated by 0 and a female is indicated by 1 ), and feature 4 : which do you like better , sushi or tempura ? ( sushi is indicated by 0 and tempura is indicated by 0 ). fig1 is a diagram illustrating one example of information stored in the function storage unit 111 illustrated in fig1 . as illustrated in fig1 , the function storage unit 111 stores the functions 1 to 4 . the function 1 defines identity mapping x . the function 2 defines a logical product ( and ) operation of values of two features . the function 3 defines a logical sum ( or ) operation of values of two features . the function 4 defines a negation ( not ) of a value of a feature . details of the function definition unit 121 illustrated in fig1 are described below with reference to an example illustrated in fig1 . fig1 is a diagram illustrating a function 5 newly defined by the function definition unit 121 combining the functions 1 to 4 . the function 5 defines exclusive or ( xor ). as illustrated in fig1 , the function definition unit 121 defines a new function by combining the functions 1 to 4 . various variations are conceivable in a manner of combining the functions 1 to 4 . one example illustrated in fig1 is one variation of the manner of combining . fig1 is a diagram illustrating the function 5 ( xor ) defined by combining the function 2 ( and ), the function 3 ( or ), and the function 4 ( not ). the function definition unit 121 may combine the functions 1 to 4 and define a new function such as negative and ( nand ) or negative or ( nor ). details of the feature construction unit 131 illustrated in fig1 are described below with reference to an example illustrated in fig1 . fig1 is a diagram illustrating one specific example for a new feature constructed by the feature construction unit 131 . the feature construction unit 131 selects one function from a plurality of new functions defined by the function definition unit 121 . the feature construction unit 131 selects one feature or a combination of features from a plurality of features included in a data set which is input . suppose that , for example , the feature construction unit 131 selects “ nand ” as a function , and selects the feature 1 and the feature 2 as features . new features constructed by the feature construction unit 131 as the result are listed in fig1 . the feature construction unit 131 constructs new features , for example , for all of the new functions defined by the function definition unit 121 . the feature construction unit 131 does not have to construct new features for all of the new functions . return to the description referring to fig1 . here , suppose that “ discriminant analysis ” is designated as a type of the analysis engine for the test unit 141 . further suppose that the feature 4 ( i . e . “ which of sushi and tempura is preferred ”) is designated as an objective variable for the test unit 141 . suppose that the test unit 141 acquires a condition that is “ a concordance rate is equal to or greater than 95 %” as a constraint condition ( i . e . a requirement that should be satisfied by information output by the analysis engine ). the “ concordance rate ” is an index indicating a degree of concordance between values of a selected feature and values of a feature designated as a prediction target . the test unit 141 analyzes whether “ which of sushi and tempura is preferred ” can be sufficiently explained on the basis of the new features constructed by the feature construction unit 131 . details of the test unit 141 are described below . the test unit 141 acquires new features constructed by the feature construction unit 131 . the test unit 141 selects one feature from a plurality of features which are acquired . suppose that , for example , the test unit 141 selects a feature that is the “ feature 3 .” the test unit 141 calculates a concordance rate between values of the selected feature and values of a feature designated as a prediction target . referring to fig1 , in the data for 13 persons illustrated , a value of the feature 3 is in concordance with a value of the feature 4 for data of five persons . therefore , in the data for the 13 persons illustrated , a concordance rate between values of the feature 3 and values of the feature 4 is 0 . 38 (= 5 / 13 ). the number of persons whose data is used to calculate the concordance rate may be designated , for example , in advance . the test unit 141 calculates the concordance rate with values of the objective variable “ which of sushi and tempura is preferred ” for all of the features that are acquired . fig1 is a diagram illustrating results of processing executed by the test unit 141 for the features constructed by the feature construction unit 131 . as illustrated in fig1 , a concordance rate between values obtained by applying exclusive or ( xor ) to the feature 1 and the feature 3 and values of the feature 4 is 100 %, which satisfies the constraint condition . in other words , this shows that the preference for “ sushi ” or “ tempura ” can be explained on the basis of the values of exclusive or xor of the “ feature 1 ” and the “ feature 3 ” in the questionnaire results . an operation and an effect produced by the information processing system 1001 according to the second exemplary embodiment are described below . according to the second exemplary embodiment , it is possible to provide the information processing system 1001 that contributes to accuracy improvement in analysis processing . the reason is that the feature construction unit 131 according to the second exemplary embodiment applies a function to a feature , and thereby constructs a new feature . owing to such a configuration , the information processing system 1001 can “ increases the number of features that are candidates for an explanatory variable .” this may be rephrased as : it is possible to “ increase the number of candidates for a feature to verify a hypothesis .” the present exemplary embodiment increases a possibility that an explanatory variable sufficiently explaining an objective variable is selected , and achieves an advantageous effect that accuracy of data mining is improved . the function definition unit 121 according to the second exemplary embodiment defines a new function by composing a plurality of functions . owing to such a configuration , the information processing system 1001 constructs a new feature by using a function other than a function prepared in advance . this enables the feature construction unit 131 to construct a larger number of types of features . the information processing system 1001 according to the second exemplary embodiment can output procedures of pre - processing that should be executed for a feature in order to improve accuracy of data mining . the reason is that , when obtaining an analysis result satisfying a constraint condition , the output unit 150 according to the second exemplary embodiment outputs a feature input to an analysis engine to obtain the analysis result . alternatively , the reason is that the output unit 150 outputs information showing processing which should be executed for a feature included in a data set in order to obtain an analysis result satisfying a constraint condition . fig1 is a block diagram illustrating a configuration of an information processing system 1002 according to a third exemplary embodiment . as illustrated in fig1 , the information processing system 1002 includes a function definition unit 122 , a feature construction unit 132 , and a test unit 142 . the function definition unit 122 defines a new function by composing a plurality of functions . the feature construction unit 132 applies the new function to a feature , and defines a new feature that is a result obtained by applying the function to the feature . the test unit 142 receives a selection of an analysis engine , receives an input of a requirement satisfied by information output by the analysis engine , inputs the new feature to the analysis engine which is selected , acquires information output by the analysis engine , and tests whether the acquired information satisfies the requirement . according to the third exemplary embodiment , it is possible to provide the information processing system 1002 that contributes to accuracy improvement in analysis processing . hardware with which the information processing system ( computer ) 1000 illustrated in fig1 is implemented includes a cpu ( central processing unit ) 1 , a memory 2 , a storage device 3 , and a communication interface ( i / f ) 4 . the information processing system 1000 may include an input device 5 or an output device 6 . a function of the information processing 100 is achieved , for example , by the cpu 1 executing a computer program ( a software program , hereinafter , described simply as a “ program ”) loaded into the memory 2 . in execution , the cpu 1 appropriately controls the communication interface 4 , the input device 5 , and the output device 6 . the present invention described using , as examples , the present exemplary embodiment and the exemplary embodiments described below may be achieved with a non - volatile storage medium 8 such as a compact disc storing the program . the program stored in the storage medium 8 is read out , for example , by a drive device 7 . communication performed by the information processing system 1000 is achieved by an application program controlling the communication interface 4 by using , for example , a function provided by an os ( operating system ). the input device 5 is , for example , a keyboard , a mouse , or a touch panel . the output device 6 is , for example , a display . the information processing system 1000 may be achieved with two or more physically separated devices communicably connected with one another by cable , wireless , or a combination thereof . the hardware configuration example illustrated in fig1 is applicable to the exemplary embodiments described above . the information processing system 1000 may be a dedicated device . the hardware configurations of the information processing system 1000 and each function block thereof are not limited to the above configurations . the analysis engine does not have to be implemented in the identical device that is the information processing system 1000 . the analysis engine may only be accessible to the information processing system 1000 . the above - described modification examples are applicable to other exemplary embodiments . as described above , the present invention has been described by exemplifying cases where single regression analysis , multi - regression analysis , and discriminant analysis are designated as a type of the analysis engine . the present invention is not limited to the exemplary embodiments described above and can be carried out in various modes . the present invention is also applicable to data mining using an analysis engine other than the types exemplified in the exemplary embodiments . the exemplary embodiments described above can be carried out in appropriate combinations . the present invention is not limited to the exemplary embodiments described above and can be carried out in various modes . the block division illustrated in each of the block diagrams is a configuration illustrated for convenience of explanation . the present invention described using each of the exemplary embodiments as an example is , regarding implementation thereof , not limited to the configuration illustrated in each of the block diagrams . while exemplary embodiments to carry out the present invention have been described , the exemplary embodiments are intended for understanding the present invention easily , and are not intended for construing the present invention limitedly . it should be understood that the present invention can be modified and improved without departing from its spirit and the present invention includes equivalents thereof . this application is based upon and claims the benefit of priority from u . s . patent application u . s . 61 / 883 , 660 , filed on sep . 27 , 2013 , the disclosure of which is incorporated herein in its entirety by reference . the present invention described using the above - described exemplary embodiments as examples can be used for , for example , a tool supporting data mining . | 6 |
a preferred embodiment of the invention will be illustratively described , in conjunction with the accompanying drawings , in which : fig1 is a simplified view in perspective of a filter / demineralizer unit of the invention , shown cut - away at a cylindrical sector , to reveal the internal relation of parts ; fig3 is a sectional view taken at 3 -- 3 in fig2 ; and fig4 is an enlarged fragmentary view in vertical section to show upper - end detail of fig2 . in fig1 and 2 , the filter / demineralizer unit of the invention is seen to be contained within an upstanding outer cylindrical housing or tank 10 which has upper and lower end - bell closures 11 - 12 , and which relies upon a cylindrical base shell 13 and flange 14 for floor - mounting . the upper end bell 11 is annular , and an elongate inner cylindrical shell 15 is secured to and depends from the central opening of end bell 11 . in this suspension , the lower end of inner shell 15 approaches but is in vertically offset relation with the bottom closure 12 of housing 10 , being preferably centrally stabilized as by radial struts or spider formations 16 which reference to the inner wall surface of housing 10 . a screen 17 carried at the bottom end of inner shell 15 functionally separates a demineralizing chamber ( in the annular volume between cylinders 10 - 15 ) from a filter chamber ( within the inner cylinder 15 ), and a single liquid flow through these chambers , in succession , is shown by directional arrows . this flow passes from an inlet connection 18 , with upwardly directed discharge at 19 into the upper region of the demineralizing chamber , which will be understood to be filled with demineralizing - resin beads , to an upper - region level ( shown by legend in fig2 ), thus providing in the outer chamber a deep - bed resin filter for crud removal and for demineralization of water . the demineralized product is screened at 17 prior to upward central flow within inner shell 15 , where further filtering is made through a miltiple - element filter - cartridge means 20 prior to discharge via an outlet connection 21 , at a short and otherwise closed upwardly projecting end 22 of inner 15 . for loading and servicing of the resin bed , a normally closed upper sluice connection 25 is provided to the upper region of the outer chamber , at angular offset from the influent connection 18 - 19 , and a normally closed lower sluice connection 26 includes an elbow , for direct horizontal access through an opening 27 in shell 13 . a vent connection 28 to the upper end of the outer chamber and a vent connection 29 to the upper end of the inner chamber ( via outlet 21 ) are shown open but will be understood to be usable with customary relief - value or other protective devices ( not shown ). the inner chamber is shown detachably closed by a lid 30 having spaced flanges 31 which are apertured for alignment with pairs of lugs 32 at the upper end of shell extension 22 , bolt ( 33 ) retention of the closure . at its lower end , the screen 17 is seen in fig2 as a hub of wedgewire having a closed bottom - end wall and an upper flange which is removably bolted to an end flange of inner shell 15 . concentrically aligned beneath screen 17 is an access neck 34 forming part of the lower end bell 12 , and it is to this neck 34 that the mounting flange 35 of the lower sluice connection 26 is removably bolted , to complete normal bottom - end closure of housing 10 . the inside diameter of neck 34 will be understood to exceed that of any screen 17 or screen - mounting parts that may be used at the lower end of shell 15 . within the inner shell 15 , a circumferential shoulder 36 is shown formed in or secured to the inner wall of shell 15 , for elevational location of an upper flange 37 forming part of the filter cartridge unit 20 ; preferably shoulder 36 is so positioned that the entire filter unit 20 is contained within housing 10 , i . e ., beneath the point of shell ( 15 ) suspension from end bell 11 . such a filter unit is commercially available from various sources , and for present purposes , we indicate suitability of the so - called disposable - cage cartridge filter manufactured under the mark filterite , by filterite corporation of timonium , md . it suffices here to state that cartridge unit 20 comprises an upper panel which serves as the mounting flange 37 and which has a pattern of plural apertures through which a corresponding plurality of inner volumes of individual elongate filter cartridges 38 communicate . the lower ends of the individual cartridges 38 are closed and suitably spaced by a lower panel 39 which provides for flow access to the outside surfaces of all filter cartridges . although not shown in the detail of fig4 it will be understood that a suitable gasket or seal ring is preferably interposed between shoulder 36 and flange 37 . and it is also preferred that axially stiff spacer means , such as a cylindrical shell 40 with large perforations be interposed between lid 30 and flange 37 , to enable a secured lid 30 to drive flange 37 into sealed engagement with shoulder 36 . it will be seen that the described invention meets all stated objectives . the single unit performs all functions which have previously required two separate units . in the indicated condensate - recovery environment , the unit provides a deep - bed resin filter , with all conveniences of independent access for loading and maintenance of resin , and it also provides a cartridge filter and internal - screen ( 17 ) connection with all conveniences of independent access for fast filter - cartridge replacement , when needed , to assure optimum protection of downstream plant components , i . e ., protection from resin fines . the construction in necessarily light - weight and compact , and it minimizes leakage , in that interconnecting joints are avoided , due to an integrally formed interconnected relation of the two chambers . it may be designed internally for maximum pressure differentials ( in the order of 2 psi ) which are vastly more simple to accommodate than the 100 psi order of magnitude required of each of the separate prior devices . while the invention has been described in detail for a preferred embodiment , it wll be understood that modifications may be made without departure from the scope of the invention . | 1 |
fig1 a shows a drilling rig &# 39 ; s substructure 11 supporting a drill floor 12 with a drawworks 14 positioned on the drill floor 12 . the substructure 11 and drill floor 12 have an open area a into which equipment can be moved . as shown in fig1 c the substructure 11 is in a lower position and a truck t has moved a bottom section 20 of a mast according to the present invention toward the drill floor 12 . an a - frame 13 is connected to the bottom section 20 of the mast . mast raising cylinders 22 are in position for connection to the bottom section 20 . as shown in fig1 d , the truck t is stopped moving the bottom section 20 into the area a . the bottom section 20 is then connected to the mast raising cylinders 22 . the positions substructure raising cylinders 18 are adjusted and the a - frame 13 is connected to the drill floor 12 . as shown in fig1 e , legs 21 of the mast 21 legs are swung open for bolting to mast shoes 23 of the drill floor 12 . the mast raising cylinders 22 are then extended and the truck t is moved away . the mast raising cylinders 22 are then retracted to lower the bottom section 20 . as shown in fig1 f , a truck r has moved a midsection 30 of a mast according to the present invention toward the bottom section 20 . fig1 g shows the truck r stopped after moving the midsection 30 adjacent a projecting end of the bottom section 20 . the sub cylinder 18 and the mast cylinder 22 are raised to raise jaw members according to the present invention of the bottom section 20 adjacent corresponding connection members 32 according to the present invention of the midsection 30 . fig1 i - 1l show the bottom section 20 and fig1 m - 1p show the midsection 30 . the bottom section 20 has two legs 20 a each with a jaw member 29 having a slot 23 in each of two spaced - apart plates 24 . a space 25 is formed between ends of the plates 24 . a throat 25 a is formed between flared out portions 25 b of the plates 24 ( or separate pieces 25 b are used connected to the plates ). two legs 20 r each have a connection member 26 with two spaced - apart plates 27 and holes 28 . a throat 27 a is formed between flared out portions 27 b of the plates 27 . a throat 27 c is formed between flared out portions 27 d of the plates 27 . in certain aspects of the present invention , any one or two throats described above may be deleted , or they may all be deleted . as shown in fig1 f - 1l , the midsection 30 has two legs 31 each with a connection member 32 having a transverse bar 33 . each leg has a connection member 35 with holes 38 corresponding , upon section connection , to the location of the holes 28 of the connection members 26 . ends of the connection members 32 are sized for movement into the spaces 25 of the jaw members 29 and the bars 33 are sized for receipt in the slots 23 . the connection members 35 are sized for receipt between the plates 27 of the connection members 26 and pins are insertable through the holes 28 , 38 to lock the two mast sections together . if one jaw member connects to one connection member and the other jaw - member / connection / member connection has not been fully effected , raising of the bottom section will force the other connection member into contact with and engagement with the other jaw member , facilitating alignment of the two sections and their connection . the truck r moves the midsection 30 adjacent the bottom section 20 so that ends of the connection members 32 move into the spaces 25 of the jaw member 29 and the bars 33 then move into the slots 23 . the connection members 35 are moved through the throats 27 a between the plates 27 and pins are inserted through the holes 28 , 38 to lock the two sections together . it is within the scope of this invention to delete one of the jaw members 29 and to releasably connect the two sections of the mast together at the location of the deleted jaw member 29 in any suitable fashion ( e . g ., but not limited to ) with bolt ( s ) bolting the two sections together . upon interengagement of the connection members of the sections 20 , 30 , as shown in fig1 h , and insertion of locking pins through the holes 28 , 38 , the mast raising cylinders 22 are partially extended so the truck r can move away . the mast raising cylinders 22 are then further extended and a racking board b is opened . fig2 shows a bottom section 120 of a mast according to the present invention ( like the bottom section 20 ); and fig3 shows a midsection 130 of a mast according to the present invention ( like a midsection 30 ). as shown in fig2 , the bottom section 120 has four legs 122 and a series of interconnecting beams 121 . a square tube 123 spans two of the legs 122 . each of two of the legs 122 has a jaw member 126 like the jaw members 29 , fig1 f and the two opposite legs 122 have end connection members 127 ( like the connection members 27 , fig1 f ). a jaw member 126 has a body 126 a which includes two spaced - apart plates 126 p secured to a leg 122 ; a slot 126 b ; an upright projection 126 c ; and a throat 126 d ( like the throat 25 a , fig1 l ) between two flared out parts which decreases in width from an outer end to an inner end . an end connection member 127 has a body 127 a with two spaced - apart plates 127 p each with a flared end 127 e so that the plates 127 p together form an open throat 127 t which decreases in width from the outer end to the inner end . each plate 127 p has a hole 127 h for receiving a removable locking pin . a throat 127 x is formed between parts 127 y . the throat 127 t is like the throat 27 c , fig1 l and the throat 127 x is like the throat 27 a , fig1 l . as shown in fig3 , the midsection 30 has four legs 132 and a series of interconnecting beams 131 . each of two of the legs 132 has a connection member 136 and the two opposite legs have a connection member 137 . each connection member 136 has a body 136 a made of two plates 136 p . a bar 136 b is held by and projects slightly from the plates 136 p . each connection member 137 has a body 137 a made of two plates 137 p . each plate 137 p has a hole 137 h for receiving a removable locking pin . as shown in fig4 a - 4c the midsection 130 has been moved on a truck into position adjacent the bottom section 120 ( e . g . as in fig1 f and prior to fig1 g ). the truck moves the midsection 130 directly above the bottom section 120 ( fig4 c ). a substructure ( e . g . like the substructure 11 ) raises the bottom section . for mating of the upper mast section initially to the lower mast section , both sections are oriented so that they are sloping downwards towards each other to insure that the upper jaws 126 come to a mating position before the opposite connections . the jaws 126 are then brought into contact with the mating bars 136 b of the lower connection members by raising the lower mast section using the hydraulic cylinders . continued raising then forces the mating ends of the mast sections upwards rotating them so that the gap between the lower connections is forced closed . the flared design on the lower connections forces them into alignment as they are forced closed . as shown in fig4 f and 4g , the hydraulic cylinders ( substructure raising cylinders and mast raising cylinders ) have been raised to raise the bottom section 120 level with the midsection 130 , moving the connection member 137 fully into the connection member 127 . pins 129 have not yet been inserted into and through the holes 127 h , 137 h . the bars 136 b are in the slots 126 s . the two sides of the mast can be misaligned when the connection method starts which can result in a jaw and bar on one side being tensioned while the opposite jaw and bar are floating — but this is self - corrected as the raising process continues and the total mast begins to be lifted . as shown in fig4 g and 4h , the substructure raising cylinders and the mast raising cylinders have been adjusted to install the pins 129 have been inserted through the connection member 127 , 137 . pins 139 have not yet been inserted into the slots 126 b . each pin 139 has a body 139 a with a lower projection 139 c which is sized and configured to fit into a space 131 formed by surfaces of the connection member 126 and of the bars 136 b . once the pins 139 have been inserted and the two mast sections 120 , 130 are connected , the mast is ready to be raised . the present invention , therefore , provides in some , but not in necessarily all , embodiments a method for connection two parts of a mast of a drilling rig , the method including : connecting a bottom mast section to a support , the bottom mast section having bottom connection apparatus ; moving a second mast section adjacent the bottom mast section , the second mast section releasably connected to a vehicle and said moving done by moving said vehicle , the second mast section having second connection apparatus ; and moving the bottom mast section so that the bottom connection apparatus contacts the second connection apparatus and engages the second connection apparatus to secure the bottom mast section to the second mast section . such a method may one or some , in any possible combination , of the following : releasing the second mast section from the vehicle , and moving the vehicle away from the second mast section ; raising with mast raising apparatus the mast comprising the bottom mast section secured to the second mast section ; wherein the support is a substructure with raising apparatus , the method further including : raising the substructure with the raising apparatus to move the bottom mast section with respect to the second mast section to facilitate engagement of the bottom connection apparatus with the second connection apparatus ; locking together the bottom connection apparatus and the second connection apparatus ; the bottom mast section comprises a jaw member connected to the bottom mast section with a throat and a slot , the second connection apparatus comprises a an insertion member with a bar , the insertion member sized and located for receipt of an end thereof in the throat of the jaw member and the bar sized and located for receipt within the slot , the method further including moving the bottom mast section to move the end of the insertion member into the throat and to move the bar into the slot ; the jaw member has two spaced - apart plates each with a flared portion and a throat defined between the flared portions , the method further including moving an end of the insertion member into the throat ; the bottom mast section is two legs each with a jaw member connected thereto , each with a throat and a slot , the second connection apparatus comprises an insertion member with a bar , the insertion member sized and located for receipt of an end thereof in the throat of the jaw member and the bar sized and located for receipt within the slot , the method further including moving the bottom mast section to move the ends of the insertion members into the throats and to move the bars into the slots ; the jaw member has two spaced - apart plates each with a flared portion and a throat defined between the flared portions , the method further including moving an end of the insertion member into the throat ; wherein the bottom mast section has a primary connection member connected thereto and spaced - apart from the jaw member , the second mast section has a secondary connection member connected thereto , the method further including securing the secondary connection member to the primary connection member ; the primary connection member has two spaced - apart plates each with an outwardly flared portion and includes a throat between the outwardly flared portions of the two spaced - apart plates for facilitating entry of part of the secondary connection apparatus between the two spaced - apart plates ; the bottom mast section has two legs each with a primary connection member connected thereto and spaced - apart from a jaw member , the second mast section has two legs each with a secondary connection member connected thereto , the method further including securing the secondary connection members to the primary connection members ; the primary connection members each have two spaced - apart plates each with an outwardly flared portion and include a throat between the outwardly flared portions of the two spaced - apart plates for facilitating entry of part of the secondary connection apparatuses between the two spaced - apart plates ; and / or wherein the support is a substructure with raising apparatus , the method further including raising the substructure with the raising apparatus to move the bottom mast section with respect to the second mast section to engage the bottom connection apparatus with the secondary connection apparatus , and said raising aligning the bottom mast section with the second mast section as the substructure is raised . the present invention , therefore , provides in some , but not in necessarily all , embodiments a mast system for rig operations , the mast system including : a support , a bottom mast section connected to the support ; the bottom mast section having bottom connection apparatus ; a second mast section adjacent and connectible to the bottom mast section , the second mast section releasably connected to a vehicle for moving the second mast section ; the second mast section having second connection apparatus ; and the bottom mast section movable on the support so that the bottom connection apparatus can contact the second connection apparatus and engage the second connection apparatus to secure the bottom mast section to the second mast section . such a mast system may one or some , in any possible combination , of the following : wherein the support is a substructure with raising apparatus , the substructure with the raising apparatus able to raise the bottom mast section with respect to the second mast section prior to facilitate engagement of the bottom connection apparatus with the second connection apparatus ; locking apparatus for locking together the bottom connection apparatus and the second connection apparatus ; the bottom mast section having a jaw member connected to the bottom mast section , the jaw member having a throat and a slot , the second connection apparatus comprising an insertion member with a bar , the insertion member sized and located for receipt of an end thereof in the throat of the jaw member and the bar sized and located for receipt within the slot , and the bottom mast section movable to move the end of the insertion member into the throat and to move the bar into the slot ; the jaw member has two spaced - apart plates each with a flared portion and a throat defined between the flared portions , the throat for receipt therein of an end of the insertion member into the throat ; the bottom mast section having two legs each with a jaw member connected to a leg and each with a throat and a slot , the second mast section having two legs each with a second connection apparatus comprising an insertion member with a bar , the insertion member sized and located for receipt of an end thereof in the throat of a jaw member and the bar sized and located for receipt within a slot of the jaw member , and the bottom mast section movable to move the ends of the insertion members into the throats and to move the bars into the slots ; the bottom mast section having a primary connection member connected thereto and spaced - apart from the jaw member , the second mast section having a secondary connection member connected thereto , and the secondary connection member securable to the primary connection member ; and / or the bottom mast section has two legs each with a primary connection member connected thereto and spaced - apart from a jaw member , the second mast section has two legs each with a secondary connection member connected thereto , and each secondary connection member securable to an adjacent primary connection member ; the primary connection member has two spaced - apart plates each flared out and including a throat defined between the two spaced - apart plates for facilitating entry of part of the second connection apparatus between the two spaced - apart plates . the systems and methods of the inventions described in the following pending u . s . patent applications , co - owned with the present invention , filed on even date herewith , naming donnally et al as inventors , fully incorporated herein for all purposes , may be used with certain embodiments of the present invention , the applications entitled : “ drilling rig structure installation and methods ”; “ drilling rig drawworks installation ”; and “ drilling rigs and erection methods ”. in conclusion , therefore , it is seen that the present invention and embodiments disclosed herein and those in the appended claims are well adapted to do the objectives and obtain the ends set forth . certain changes can be made in the subject matter without departing from the spirit and the scope of this invention . changes are possible within the scope of this invention and it is further intended that each element or step recited in any of the following claims is to be understood as referring to the step literally and / or to all equivalent elements or steps . the following claims are intended to cover the invention as broadly as legally possible in whatever form it may be utilized . the invention claimed herein is new and novel in accordance with 35 u . s . c . § 102 and satisfies the conditions for patentability in § 102 . the invention claimed herein is not obvious in accordance with 35 u . s . c . § 103 and satisfies the conditions for patentability in § 103 . this specification and the claims are in accordance with all of the requirements of 35 u . s . c . § 112 . the inventors may rely on the doctrine of equivalents to determine and assess the scope of their invention and of the claims that follow as they may pertain to apparatus not materially departing from , but outside of , the literal scope of the invention as set forth in the following claims . all patents and applications identified herein are incorporated fully herein for all purposes . it is the express intention of the applicant not to invoke 35 u . s . c . § 112 , paragraph 6 for any limitations of any of the claims herein , except for those in which the claim expressly uses the words ‘ means for ’ together with an associated function . in this patent document , the word “ comprising ” is used in its non - limiting sense to mean that items following the word are including , but items not specifically mentioned are not excluded . a reference to an element by the indefinite article “ a ” does not exclude the possibility that more than one of the element is present , unless the context clearly requires that there be one and only one of the elements . | 4 |
with reference to fig1 - 2 , a sealant backer assembly 10 in one embodiment of this invention has a generally rectangular cross - sectional profile and includes a structural sponge component 12 occupying most of the volume defined by the sealant backer assembly 10 , a rigid hard backing element 14 , an adhesive element in the form of a thin layer 16 and a thin releasable element 18 . the sealant backer assembly 10 is further defined by top and bottom faces 11 a , 11 b and lateral faces 11 c , 11 d . with reference to fig1 - 3 , the structural sponge component 12 has opposed first and second faces 13 , 15 and is made of a suitable material such that the component 12 can withstand a force exerted by an underlying row of masonry elements such as bricks 24 . the length and width of the structural sponge component 12 is such that it can fit in a space between a window frame 30 and a row of masonry elements such as bricks 24 or stucco elements 37 ( fig7 ) defining a window sill or door threshold . the structural sponge component 12 may , for example , be of a length and a width substantially equal to those of a portion of a horizontal frame member 31 of the window frame 30 or door frame protruding from the plane of the exterior face 33 of an inner wooden frame wall 26 . the structural sponge component 12 may be made , for example , of a material including closed cell blended epdm neoprene . the hard backing element 14 has a thickness substantially smaller than that of the structural sponge component 12 and is made of a rigid plastic resin material . while the hard backing element 14 is described as being made from a plastic resin , persons of ordinary skill in the art will appreciate that other materials may be substituted , so long as they are suitable to withstand the force applied by masonry elements such as bricks 24 or stucco elements 37 ( fig7 ) contacting the bottom surface of the hard backing element 14 . in this embodiment , the hard backing element 14 has a length and a width that are substantially equal to those of the first face 13 of the structural sponge component 12 and is adhesively affixed to the first face 13 by any suitable methods or components , such as adhesive . alternatively , other methods of affixing or adjoining these two surfaces may be substituted , so long as they are suitably chosen to maintain the required integrity of the interface between the structural sponge component 12 and the hard backing element 14 . alternatively , the hard backing element 14 may be integrally formed with at least a portion of the structural sponge component 12 . with continued reference to fig1 - 3 , a coupling element in the form of a thin adhesive layer 16 substantially covers the second face 15 of the structural sponge component 12 . the adhesive layer 16 is made of a suitable material such that it can bond or be at least partially integrally formed with the second face 15 of the structural sponge component 12 . the adhesive layer 16 may include a pressure - sensitive adhesive , so long as it is also suitable to bond to the protruding portion of the bottom surface 17 of the horizontal frame member 31 of the window frame 30 or door frame . alternatively , a different type of coupling element may be substituted for the adhesive layer 16 , so long as it is suitably coupled to the structural sponge component 12 and can be suitably coupled to a surface such as the bottom surface 17 of the horizontal frame member 31 . a thin , releasable element 18 has a length and width substantially equal to those of the second face 15 of the structural sponge component 12 and the adhesive layer 16 . the releasable element 18 substantially covers the exposed surface of the adhesive layer 16 , thereby facilitating storage , handling and transportation of the sealant backer assembly 10 until it is ready for deployment . with reference to fig3 , an exemplary conventional window frame 30 having an outer surface 40 rests over an inner wall 26 made of wood , and generally covers a window opening 39 communicating the interior and exterior of an architectural structure such as a residence . the inner wall 26 includes an exterior face 33 and an oppositely located interior face 35 . an outer wall 28 , having masonry elements in the form of bricks 20 , includes an exterior face 29 and an interior face 27 that is proximate and faces the exterior face 33 of the inner wall 26 . the inner and outer walls 26 , 28 are separated by a cavity or gap . in this embodiment , the outer wall 28 includes several rows of bricks 20 and layers of a bonding element in the form of mortar elements 22 positioned between adjacent layers of bricks 20 . the window frame 30 includes a horizontal frame member 31 having a bottom surface 17 , a portion of which protrudes beyond the plane defined by the exterior face 33 of the inner wall 26 . the horizontal frame member 31 is generally designed to lie over a horizontal surface 26 a of the inner wall 26 . a relative thin and flexible through - wall flashing member 34 has a vertical portion 34 a positioned immediately between the exterior face 33 of the inner wall 26 and the interior face 27 of the outer wall 28 and further includes a generally horizontal portion 34 b positioned between adjacent layers of bricks 20 and which extends beyond the exterior face 29 of the outer wall 28 , thereby providing a drip surface element 36 . the through - wall flashing member 34 is made of a suitable material such as one conventionally known as 40 mil adhesive backed flashing , such that it can provide an impermeable barrier to moisture or water that may penetrate the outer wall 28 and otherwise reach the interior of the architectural structure . water or moisture that penetrates the outer wall 28 will thus reach the exterior face of the through - wall flashing member 34 and exit along the drip surface element 36 . with continued reference to fig3 , a relatively thin , flexible flashing member 38 is conventionally positioned between the horizontal frame member 31 and the horizontal surface 26 a and is further partially juxtaposed over the vertical portion 34 a of the through - wall flashing member 34 . the wrap flashing member 38 is made of an impermeable material suitable to withstand the weight of the window frame 30 resting thereon while preventing the penetration of water or moisture from the exterior and into the interior of the architectural structure . a row of bricks 24 is depicted prior to installation and formation of a window sill under the window frame 30 . each of the bricks 24 includes an upper surface 41 , a back surface 43 and an edge 45 at the juncture between the upper surface 41 and the back surface 43 . with reference to fig3 - 5 , an exemplary formation of a window sill and installation of the sealant backer assembly 10 are depicted . more particularly referring to fig3 , a masonry element in the form of a brick 24 is shown ready for deployment and is intended to partially define the window sill . such deployment includes disposing the brick 24 over a mortar element 22 in the outer wall 28 in a region proximate the window frame 30 . the thin , releasable element 18 is removed from the sealant backer assembly 10 as depicted by arrow 46 , thereby exposing the adhesive layer 16 . the sealant backer assembly 10 is then disposed over the protruding portion of the bottom surface 17 of the horizontal frame member 31 of the window frame 30 , as indicated by the arrow 48 , and oriented such that the adhesive layer 16 contacts the bottom surface 17 . with reference to fig4 , a brick 24 is shown having been disposed over the mortar element 22 in the outer wall 28 . the sealant backer assembly 10 has been disposed as described above against the bottom surface 17 on the window frame 30 . a subsequent step in the formation of the window sill includes reorienting or tilting the brick 24 in the direction depicted by the arrow 39 , to thereby allow the upper surface 41 of the sill brick 24 to slope downwardly without substantially deforming the structural sponge component , thereby facilitating drainage of water away from the window frame 30 . with reference to fig5 - 6 , the brick 24 is depicted in an exemplary final position showing a downward - sloping angle of the surface 41 . reorienting of the bricks 24 generally includes causing contact to occur between the respective edges 45 of each of the bricks 24 and the bottom face 11 b on the hard backing element 14 of the sealant backer assembly 10 . a flexible sealant member 32 is applied against the outwardly - facing lateral face 11 c of the sealant backer assembly 10 and the upper surface 41 of the brick 24 , thereby closing a gap otherwise present , created at the juncture between the irregular surface 41 of the brick 24 and the bottom face 11 b of the sealant backer assembly 10 . the sealant member 32 is made of a suitable flexible , impermeable and weather - resistant material and may be generally solid even if in flowable form during initial application . the sealant member 32 is further made of a material suitable to bond with the upper surface 41 of the brick 24 or with any other type of masonry element as well as with surfaces of the window frame 30 . with reference to fig6 , the sealant member 32 substantially closes the gap between the outer surface 40 of the window frame 30 and the upper surface 41 of the bricks 24 . the edge 45 of each of the bricks 24 contacts the bottom face 11 b on the hard backing element 14 of the sealant backer assembly 10 . any force applied by the edge 45 against the bottom face 11 b on the hard backing element 14 will be distributed by the hard backing element 14 and partially deform the underlying structural sponge component 12 . any individual edge 45 will not compress the sponge component 12 any significant amount , but collectively the edges 45 of the bricks 24 may exert pressure distributed across the sponge component 12 to compress it . with reference to fig7 - 7a , in which like - reference numerals refer to like features in fig1 - 6 , the sealant backer assembly 10 is shown associated with the formation of an outer masonry wall including masonry elements in the form of stucco elements 37 . unlike the illustrative application of fig1 - 6 , in the exemplary application of fig7 - 7a the stucco elements 37 are placed relatively closer to the inner wall 26 and substantially under the horizontal frame 31 of the window frame 30 . in this exemplary embodiment , the main purpose of the sealant backer assembly 10 is to provide a backing surface for reception of a sealant 32 and as a vertical stopping surface for the stucco elements 37 . the relationship and description of the sealant 32 with respect to the window frame 30 , stucco elements 37 and sealant backer assembly 10 is similar to that described above for the embodiment of fig3 - 6 . while the embodiments of fig3 - 7a depict a sealant backer assembly 10 associated with masonry elements such as bricks 24 and stucco elements 37 under a window frame 30 , persons of ordinary skill in the art will appreciate that , alternatively , sealant backer assembly 10 may be similarly used in association with masonry or non - masonry elements forming a door threshold ( not shown ) around a door frame ( not shown ) communicating the exterior and interior of an architectural structure through an opening . with reference to fig8 - 9a , in which like reference numerals refer to like features in fig3 - 6 , an alternative embodiment of a sealant backer assembly 50 having a generally irregular cross - sectional profile , exemplarily approximating a square profile , includes a structural sponge component 52 occupying most of the volume defined by the sealant backer assembly 50 , and a rigid hard backing element 54 affixed thereto . the sealant backer assembly 50 is further defined by top and bottom faces 56 , 58 , front and back faces 55 , 57 , and end faces 60 , 62 . the hard backing element 54 is similar to the hard backing element 14 of the sealant backer assembly 10 of fig1 - 2 , the description and functionality of which may be referred to for an understanding of the hard backing element 54 as well . the structural sponge component 52 has opposed first and second faces 56 , 53 and is made of a suitable material such that the sponge component 52 can withstand a force exerted by an underlying row of masonry elements such as bricks 24 or stucco elements 37 ( fig7 ). the length and width of the structural sponge component 52 is such that it can fit , in a compressed condition , in a channel such as a “ j ” channel 64 along a horizontal frame member 51 of a window frame 61 or door frame . the structural sponge component 52 is made of a resilient material , such as a material including closed cell blended epdm neoprene . during deployment , the exemplary sealant backer assembly 50 is compressed such that the front and back faces 55 , 57 are pushed inwardly permitting the sponge component 52 to fit in the channel 64 of the horizontal frame member 51 of the window frame 61 . the channel 64 is defined by a leg member 66 having a bottom surface 68 and an inner surface 70 , a substantially flat surface 72 along the horizontal frame member 51 , and a substantially flat back surface 74 . the sealant backer assembly 50 is disposed in the channel 64 such that the hard backing element 54 is left , as shown , outside the channel 64 . alternatively , however , the sealant backer assembly 50 may be disposed in the channel 64 such that the entire backer assembly fits within the channel 64 , so long as the sealant backer assembly 50 may be frictionally held in the channel 64 , so long as the sealant backer assembly 50 may be frictionally held in the channel 64 . after deployment , the sponge component 52 expands such that the front and back faces 55 , 57 respectively press against the inner surface 70 of the leg member 66 and the back surface 74 of the channel 64 . with reference to fig9 - 9a , other steps in the formation of a masonry sill are similar to those described above for the embodiment of fig3 - 6 , the description of which may be referred to for an understanding of the embodiment of fig9 - 9a as well . unlike the embodiment of fig3 - 6 , however , the exemplary embodiment of fig9 - 9a depicts the sealant 32 being applied such that it also contacts the bottom surface 68 of the leg member 66 of the channel 64 . while the exemplary embodiment of fig8 - 9a depict the sealant backer assembly 50 in association with the formation of a window sill including bricks , persons of ordinary skill in the art will appreciate that the backer assembly 50 may alternatively be used with the formation of sills and outer walls including other masonry elements such as stucco or non - masonry elements . similarly , the sealant backer assembly 50 may be used in conjunction with the formation of a door threshold around a door frame ( not shown ). advantageously , since the formation of a window sill or door threshold and installation of a sealant backer assembly 10 , 50 as shown results in no direct contact between the window frame 30 and masonry elements such as bricks 24 , the window frame 30 is less susceptible to relative contraction and expansion of the inner wall with respect to the masonry elements . any expansion or contraction - related upward , downward or lateral movement of the inner wall with respect to the bricks 24 or the like is absorbed by a corresponding deformation and / or expansion of selected portions of the structural sponge component 12 , 52 of the sealant backer assembly 10 , 50 . accordingly , many further embodiments , applications and modifications of the invention will become readily apparent to those of ordinary skill in the art without departing from the scope of the invention which is defined by the claims appended hereto . | 4 |
fig1 shows a temperature forcing unit , generally at 10 , manufactured by the thermonics corporation which provides a temperature controlled environment for one device . temperature forcing unit 10 includes control and temperature generation unit 12 , temperature control tube 14 , support arm 16 , airflow tube 18 and single device fixture 20 . temperature control tube 14 has fixture 20 at one end which provides a chamber for a device to be tested . control tube 14 further has wiring ( not shown ) that runs from the control tube , through support arm 16 to control and temperature generation unit 12 , for the heating elements ( not shown ) in the control tube and for up and down motion control ( not shown ) of the control tube which is activated by control and temperature unit 12 or manually by buttons on the tops of handles 22 and 24 . the up and down motion is pneumatically controlled . support arm 16 provides alignment controls at 26 , 28 and 30 . air flow tube 18 ducts cold air from control and temperature generation unit 12 to temperature control tube 14 . heated air is provided by the heaters within temperature control tube 14 . control and temperature generation unit 12 controls the volume and temperature of conditioned air that exits temperature control tube 14 . typically , temperature forcing unit 10 is used in conjunction with an integrated circuit testing system to temperature test a single device . fig2 shows an integrated circuit testing system that includes a device tester 32 , test head 34 and connecting cables 35 . the integrated circuit testing system shown in fig2 is an m - 16 tester manufactured by texas instruments incorporated . a keyboard 36 and a display terminal 38 , also shown in fig2 are typically connected to device tester 32 . device tester 32 has a variety of performance boards that can be selected for the testing of various devices . a device to be tested 40 is placed in an appropriate test socket 42 and the socket is mounted onto an appropriate performance board 44 . performance board 44 is attached to the top of test head 34 , as shown in fig3 . next , temperature control tube 14 is lowered around device 40 until it mates with the surface of performance board 44 , as shown in fig4 . fixture 20 usually includes a single device chamber 46 , as shown in fig5 having a single port outlet 48 that is coupled to temperature control tube 14 . single device chamber 46 closely surrounds the device to be tested to control the conditioned air flow . since air flow is critical to successful temperature testing , an air tight seal is not desirable . air must be allowed to flow past the device under test . this can be accomplished by allowing air to flow out from under single device chamber 46 . if an air tight seal is created between fixture 20 and device test head 34 , air must flow out from under single device chamber 46 and through exhaust ports 50 which vent the conditioned air to exhaust ports ( not shown ) on control tube 14 . the device to be tested 40 is now ready for temperature testing . device tester 32 and control and temperature generation unit 12 respond to commands entered by an operator . in a production environment , there may be some interfacing between device tester 32 and control and temperature generation unit 12 in which a software program may generate commands for the entire procedure for a selected device . temperature forcing unit 10 and device tester 32 together effectively temperature test a device . while a temperature forcing unit 10 manufactured by thermonics has been mentioned , similar temperature forcing units are available from other manufacturers , such as temptronics and fts . in each case , a temperature forcing unit is available that will provide a temperature controlled environment for a single device . and while an m - 16 tester has been described , other testers are commercially available . but the use of a device tester having the ability to simultaneously test up to 8 devices is overkill when one is reminded that presently available temperature forcing units accommodate only one device at a time . various attempts have been made to place more than one device within single device fixture 20 . the results have not been satisfactory . even when the single device chamber 46 has been redesigned to accommodate more than one test device , there are constant problems with controlling the volume and direction of conditioned air flow over the multiple devices under test . devices closer to the single air flow outlet reach the desired temperature more rapidly than devices spaced farther away from the air flow outlet . in some cases the more remote devices never reach the desired temperatures . in most cases , the temperatures amongst the devices are not uniform . needless to say , these results are not satisfactory to the manufacturer or to the customer . what is needed is a device fixture used in conjunction with a standard temperature forcing unit which adequately provides direction and flow control of conditioned air to multiple devices under test . fig6 shows a multiple device fixture 52 attached to temperature control tube 14 in lieu of single device fixture 20 , according to a preferred embodiment of the invention . fig7 shows an open multiple device fixture 52 attached to control tube 14 . multiple device fixture 52 includes a base 54 , guide rails 56 and a lid 58 . fig8 shows multiple device fixture 52 by itself . in fig9 lid 58 mates with base 54 to form a testing chamber within . multiple device fixture 52 should be constructed from a material or materials that can withstand the necessary temperature extremes while at the same time providing some insulative properties . a material manufactured by dupont having the tradename &# 34 ; delrin &# 34 ; may be used since it has excellent insulative properties and an ability to withstand a wide range of temperature extremes . other materials having similar beneficial properties may also be used . fig1 shows a plan view of base 54 . a pair of flanges , 60 and 62 , are attached to opposite sides of base 54 . each flange has two holes 64 , drilled and tapped , for guide rails 56 ( not shown ), and a hole 66 through which a fastener ( not shown ) may be inserted to secure base 54 to device test head 34 . fig1 shows a side sectional view of base 54 taken along the section lines 2 -- 2 of fig1 . fig1 shows a partial sectional view of base 54 taken along the section lines 3 -- 3 , 4 -- 4 and 5 -- 5 of fig1 . an optional base insert 70 is also shown in fig1 . while it is not necessary to have a base insert for the use of the multiple device fixture , a base insert can aid in controlling the escape of conditioned air around the bottom of base 54 . fig1 shows one possible embodiment of a base insert 70 . base insert 70 is dimensioned to fit within base 54 . base insert 70 includes mounting holes 72 and application holes 74 dimensioned to fit around the devices to be tested . base insert 70 may be secured to base 54 with screws or small bolts ( not shown ) as required . fig1 shows an elevational view of a thumbscrew 76 . thumbscrew 76 may be inserted through hole 66 of base 54 , shown in fig1 , to secure base 54 to test head 34 . in the embodiment of the invention shown in fig1 , two thumbscrews 76 are required to secure base 54 to test head 34 . fig1 shows an elevational view of a coupling device , shown generally at 78 , that couples the temperature control tube 14 to lid 58 . coupling device 78 includes an upper disc surface 80 and a lower disc surface 82 . the diameter of upper disc surface 80 is smaller than the diameter of lower disc surface 82 . fig1 shows a plan view of coupling device 78 , including mounting holes 84 , vent holes 86 and a support hole 88 that is dimensioned to accommodate an air input nozzle 100 ( not shown ). in a preferred embodiment of the invention , coupling device 78 is made out of aluminum for ease of construction . fig1 shows a top plan view of lid 58 . lid 58 includes a top surface 90 , sidewalls 92 and guide rail guides 94 . top surface 90 includes a hole 96 dimensioned to accommodate upper disc surface 80 of coupling device 78 . fig1 shows an air input coupling device 98 having an air input nozzle 100 , an upper interface plate 102 and a lower interface plate 104 with upper interface plate 102 having a smaller diameter than lower interface plate 104 . a hole 106 is drilled or formed the length of air input coupling device 98 . hole 106 allows air to flow from temperature control tube 14 to lid 58 . fig1 shows a plan view of air input coupling device 98 , including mounting holes 108 . in a preferred embodiment of the invention , air input coupling device 98 is also made out of aluminum for ease of construction and the fact that aluminum can withstand higher temperatures than delrin can . fig2 shows a top plan view of a lid insert 110 including mounting holes 112 , air nozzle holes 114 and access holes 116 . while eight air nozzle holes 114 in straight rows and columns are shown in fig2 , lid insert 110 may include as many air nozzle holes in as many configurations as needed . fig2 is a top plan view of lid insert 110 , including air manifold 118 , air tubes 120 and threaded elbows 122 . air manifold 118 should have as many threaded holes 124 as necessary to accommodated the required air tubes 120 . in a preferred embodiment of the invention , there are eight threaded holes 124 . air manifold 118 also includes two mounting holes 126 . screws or bolts are passed through holes 126 of air manifold 118 to mounting holes 108 of air input coupling device 98 to secure air manifold 118 to air input coupling device 98 . fig2 shows an enlarged sectional view of fig8 taken along the section lines 6 -- 6 and 7 -- 7 ( without air nozzles ). upper disc surface 80 of coupling device 78 is positioned within hole 96 of top plate 90 with lower disc surface 82 abutting the inside of top plate 90 . coupling device 78 should be rotatable within hole 96 . next , coupling device 78 is secured to temperature control tube 14 with screws or bolts ( not shown ) through mounting holes 84 . since coupling device 78 also supports lid 58 , lid 58 is rotatably attached to control tube 14 . a secondary surface layer 132 , having both a support hole 134 that accommodates air input nozzle 100 of air input coupling device 98 and a recessed area 136 that accommodates lower interface plate 104 , is positioned under lower disc surface 82 . next , air input nozzle 100 of air input coupling device 98 is inserted through support hole 134 of secondary surface layer 132 and through support hole 88 of coupling device 78 and into the air flow cavity ( not shown ) of control tube 14 . lower disc interface plate 104 of air input coupling device 98 is secured to interface surface 130 of air manifold 118 with screws or bolts ( not shown ) through mounting holes 108 of air input coupling device 98 and mounting holes 126 of air manifold 118 . lid insert 110 is then secured with screws or bolts ( not shown ) to the inside of lid 58 . the vacant space between lid insert 110 and the top surface 90 of lid 58 may optionally be filled with an insulative material . fig2 shows an air nozzle 137 having a threaded end 138 and an output end 140 . a hollow passageway 142 is formed from threaded end 138 to output end 140 . fig2 shows a bottom plan view of lid insert 110 . in the embodiment of the invention shown in fig2 , eight air nozzles 136 are secured to respective threaded elbows 122 . the diameter of hollow passageway 142 of the outer air nozzles 136 is larger than the diameter of the inner air nozzles 136 to equalize air flow . as an alternative to various hollow passageway diameters , all hollow passageway diameters can be the same if individually controlled regulators ( not shown ) are used in conjunction with each air nozzle . the length of each air nozzle is selected so that its output end is as close to the device under test as possible without restricting air flow . thus , devices of different sizes will require air nozzles of different lengths . certain package types exist that have a vertical rather than a horizontal orientation . for the testing of these vertical packages , air nozzle 136 must be modified to direct conditioned air onto the vertical package . as shown in fig2 , air nozzle 136 has a threaded end 138 an output end 140 and a hollow passageway 142 that is formed from threaded end 138 vertically until it intersects a horizontal output port 144 that exits the side of air nozzle 136 . both the length of the air nozzle and the positioning of the horizontal output port is dependent upon the size and location of the device to be tested . in another embodiment of the invention , shown in fig2 , horizontal output ports 144 exit out opposite sides of air nozzle 136 to direct condition air onto two devices simultaneously . while specific embodiments of the present invention are disclosed herein , they are not to be construed in a limiting sense . for example , the multiple device fixture can be modified to fit just about any temperature forcing unit . and while the multiple device fixture has been described having a base , guide rails and a lid , an alternative embodiment of the multiple device fixture may do away with the base if a mechanism is used that properly aligns and seats the multiple device fixture over the devices to be tested . repeatability of alignment and seating is required for a multiple device fixture not having a base . the physical size of the multiple device fixture can be expanded or altered , depending upon the number and sizes of the devices to be tested , and is limited only by the constraints of the temperature forcing unit . while the embodiments thus described show up to eight air nozzles , there is no reason why this number cannot be expanded . air manifolds and lid inserts can be custom designed to accommodate a variety in the number and location of air nozzles . if by chance there are unnecessary air nozzles in a particular application , the unused air nozzles can be plugged at the nozzle or removed and plugs inserted at the threaded elbow . and while the multiple device fixture has been described being used with a device tester , the multiple device fixture may also be used in bench testing of devices . it is therefore contemplated that the appended claims will cover any such modifications or embodiments as fall within the true scope of the invention . | 8 |
fig1 shows a multi - algorithmic name search system 100 according to a first preferred embodiment of the present invention , in block schematic form . in this embodiment , system 100 sequentially performs three basic processes . first , system 100 selects a search strategy based on the cultural origin , distribution , language or ethnicity of the name in question and pre - processes the name to break it into its component parts for processing . second , a subset of the available database records is selected , based on a culture - relevant key - indexing strategy . the objective of this subsetting process is to select a set of keys that are likely matches for the name in question . finally , the records selected in the second process are subjected to a similarity measurement , using a complex algorithm tailored according to the selected search strategy , to evaluate and rank - order potential matches . thus , system 100 adopts a search strategy that is specific to the ethnicity or cultural origin of the name to be matched and implements that strategy by performing a two - pass search with algorithms particularly adapted for searching those names . referring now to fig1 , system 100 comprises name classifier module 102 , variant generation module 104 , name reference library 106 , name retrieval technology processing module 108 , retrieval module 110 , and precision filter and sorting module 112 . system 100 has an input query 101 and an output 114 . processing of a query begins with evaluation of the searched name by name classifier module 102 . name classifier module 102 evaluates spelling , word segmentation , titles , prefixes and suffixes , and other identifiable features of the name to determine whether it falls into one of a predetermined set of identified cultural origins , including , for example , chinese , arabic , hispanic , or russian . anglo names and names which do not fall into one of the predetermined set of special - case cultures are classified as “ other ” and processed according to a generic cultural algorithm . appropriate pre - processing is also performed to segment the name appropriately ( standardize the handling of spacing between name segments and the order of the segments ) and identify apparent surnames , given names , honorifics , etc ., that are part of the input name . the operation of the name classifier in this regard is unique and inventive . to determine the type of name , name classifier module 102 may use one or more of the following , depending on the observed characteristics of the name in question : a list of names which occur with high frequency in various cultures ( used to preemptively type common names without extensive algorithmic processing ), culture - specific linguistic rules in the form of a titles , affixes , and qualifiers ( taq ) lookup table , n - gram based name typing , and name length . n - gram name typing according to the present invention may be performed as a digraph , trigraph or other n - gram analysis where both positional and distributional properties of the n - grams ( e . g ., digraphs and trigraphs ) are used in the algorithm for making the type determination . name classifier module 102 preferably operates according to the software design description in appendix a , which forms a part of this specification . fig3 shows the software modules incorporated in name classifier module 102 in more detail . name classifier module 102 incorporates a name classifier control module 302 , a linguistically informed decision ( lid ) processor 304 , a digraph distribution processor 306 , and a final decision processor 309 . digraph distribution processor 306 incorporates digraph information processor 312 and digraph intermediate decision processor 314 . lid processor 304 incorporates linguistic information aggregator 308 and lid intermediate decision processor 310 . lid aggregator 308 includes high frequency name processor 316 , morphological processor 318 , title / affix / qualifier ( taq ) processor 320 , and ngram processor 322 . lid processor 304 accumulates and weighs factors from multiple knowledge sources to determine whether there is sufficient evidence to identify the input name as belonging to a particular ethnicity , e . g . hispanic , arabic , etc . linguistic information aggregator 308 performs linguistic analysis , gathering information and scoring for the input name . in the preferred embodiment , linguistic information aggregator 308 generates scores from four data sources . high frequency name processor 316 accesses a high frequency name data store of names that occur frequently in particular cultures . a match with one of these names causes aggregator 308 to retrieve and record the culture associated with the name and a confidence score associated with that name . taq processor 320 breaks the name into particles and makes use of the information contained in those particles to match a list of titles , affixes , and qualifiers commonly used in names of various cultures , to help determine cultural affinity . the input name is segmented based on spaces in the name , and for each segment present in the input name , taq processor 320 determines whether that segment is a particle present in a taq data store . if so , taq processor 320 retrieves and records the culture , name field , and confidence score associated with that taq particle . morphological processor 318 processes morphological elements such as “- ovich ” which suggest a particular cultural affinity . morphological processor 318 determines whether morphemes in a morpheme data store are present in the input name by searching for matching substrings of the name segments in the input name . for each morpheme found in the input name , morphological processor 318 records the morpheme found , the culture , name field , and confidence level associated with that morpheme . n - gram processor 322 searches the input name for strings of letters that occur with statistical significance in names with a given cultural affinity . for each n - gram present in an associated n - gram data store , n - gram processor 322 determines whether that n - gram is present in the input name . when a match is found , the processor records the n - gram found , the culture , name field , and score associated with that n - gram . to avoid conflict between treatment of name segments and particles by the various processing modules operating on the input name , an order of precedence is established for processing . the order of precedence is preferably taq particle , morpheme , and then n - gram . that is , if a string of letters is identified as a taq particle , that string or any substring cannot also be identified as a morpheme or n - gram for that culture . if a string is identified as a morpheme , that string and its substrings cannot be considered as part of an n - gram for that culture . locating the name among the high frequency names for a culture does not preclude morpheme or n - grams processing of the high frequency name , but if the confidence level in the high frequency match is high , further processing may not be necessary . fig4 is a schematic diagram showing the structure and operation of linguistically informed decision processor 304 in more detail . linguistic information aggregator 308 collects necessary information from the input name 402 and name reference library 106 , which includes the tables and other data used by linguistic information aggregator 308 ( including high frequency name processor 316 , morphological processor 318 , title / affix / qualifier ( taq ) processor 320 , and ngram processor 322 , all shown in fig3 ). a sample structure for these tables is shown in fig5 . as shown in fig4 , processed information from linguistic information aggregator 308 passes to lid intermediate decision processor 310 , where it is processed and the results passed to digraph distribution processor 306 or to final decision processor 309 ( shown in fig3 ). lid intermediate decision processor 310 makes a preliminary decision about the cultural affinity of the name , based on the scoring information gathered by linguistic information aggregator 308 . processor 310 determines whether enough linguistic information has been gathered by lia 308 to confidently determine that the input name belongs to one of the cultures identified by the system . processor 310 accepts as input one aggregate lid score for each culture , as well as an aggregate lid score for “ other .” for each score , processor 310 compares the score to a lid threshold for the appropriate culture . if the lid score for a culture exceeds the threshold for that culture , processor 310 returns a value of “ true ” for the indicated culture . a “ true ” value for a culture indicates that enough evidence has been gathered to confidently identify the name as belonging to that culture . a “ false ” value for a culture indicates that not enough evidence has been accumulated to suggest that the name belongs to that culture . alternatively , processor 310 may return a value for each culture equal to the lid score minus the lid threshold for that culture ; in this case , negative values correspond to “ false ” and positive values correspond to a “ true ” indication . names which are strongly associated with one culture based on the output of lid intermediate decision processor 310 will not be processed further to identify their cultural origin , i . e . digraph and other analysis will be skipped . assuming the name has not been definitely identified , the surname portion is processed by digraph distribution processor 306 . based on a statistical model derived from digraph distribution statistics for names within various cultures , processor 306 computes a likelihood that the input name has a particular cultural origin . the information gathered from lid and digraph processing is combined , along with any other available information on the person ( such as country of birth ), in final decision processor 309 . the available factors are weighted according to their confidence level to maximize the likelihood of an accurate ethnic origin evaluation . the result is an output indicating the likely classification of the name . following name typing , the system executes name variant generation module 104 , which pre - processes the names according to culture - specific rules to generate query regularizations , based on algorithms adapted specifically for the cultural origin of the name in question , as determined by the name classifier . variant generation module 104 also generates query expansions , i . e ., identifies expected variants of the name to enhance matching capability . as noted above , preferably , specialized processing is provided for each of a variety of ethnic name origins . appendices b and c , which form a part of this specification , are software design descriptions for preprocessing and search algorithms for arabic and hispanic type names , respectively . as an example of such processing , the hispanic processing algorithm referenced in appendix c will now be discussed in some detail . fig6 is a flowchart showing a preferred embodiment of hispanic name processing used in the present invention . the process begins in name classification in block 602 when the input name is identified as an hispanic name . the name is then fed to hispanic name preprocessor in block 604 , and to the hispanic search engine in block 606 , which searches database 608 . then , an hispanic sorter and filter are applied in block 610 . the process produces sorted hispanic search results as an output in block 612 . fig7 is an expanded flowchart showing an operational process of the hispanic name preprocessor , referenced in block 604 of fig6 . the hispanic name processor prepares a name which has been identified as hispanic for processing by the hispanic search engine by identifying name segments and determining their disposition , manipulating the name segments to generate additional query formats , determining name length and record gender , specifying the frequency character of each name segment , and generating search keys . the process begins with a name length determiner operation on block 702 , which determines the length of the surname . next , the name is processed by a hispanic surname segmenter in block 704 . this operation divides surnames exceeding a predetermined length ( e . g . nine characters ) into component segments to compensate for the fact that fixed size data fields often do not accommodate an entire hispanic surname , leading data entry operators to conjoin name segments in a single field . then , additional query records are generated for the separated segments and alias records are added for the separated surname segments . this process accesses a high frequency surname type data store to identify surname portions that should be separated . for example , this operation would separate “ ramirezdelapaz ” in the surname field into ramirez dela paz and “ perezdelopez ” into perez de lopez by finding the known surname components de and dela . an hispanic taq processor operates in block 706 to scan the given name and surname for known titles , affixes , and qualifiers which do not have useful search value . taq elements such as del , dela , de , and san are then flagged to be either deleted , disregarded during matching operations , or removed . delete means that the segment is disregarded for the remainder of the name search process and contributes marginal information to the filter process , but is not actually removed from the record . disregard means the segment is disregarded in the remainder of the name search process but contributes to evaluation in the filter process . remove means that a segment conjoined to the name stem is removed from the stem , and then flagged to be either deleted or disregarded as appropriate . the hispanic segment positioner in block 708 operates to move any high frequency surname found in the given name field into the surname field . the name is then formatted by an hispanic name formatter in block 710 to generate additional name formats in case the record has more than two surname stems . next , the name is processed by a segment position identifier in block 712 to identify the relative position of each of the surname and given name stems . hispanic names generally contain more than one stem in the given name and surname . in a given name , the leftmost name stem generally indicates gender ; in a surname , the leftmost stem is the family name and the other stems are differentiators . therefore , it is important to identify names that are out of position so that this may be corrected and their relevance appropriately evaluated during the search . next , the likely gender of the name is identified by a hispanic gender identifier in block 714 . the gender identifier attempts to predict gender based on the gender marker of the leftmost given name segment , but may also rely on ( or override the apparent gender ) based on additional information such as a gender indicated as associated with the search name . the name is processed by a frequency path director in block 716 which directs a record for high frequency processing or low frequency processing depending on the presence or absence of high frequency surnames in the input name string . in fig8 , the flow of operation of the hispanic search engine 606 is shown in more detail . as described above , the frequency path director operates in block 716 and then determines in block 802 whether the surname contains all high frequency segments . if so , control passes to the high frequency processor in block 804 . if not , control passes to the low frequency processor in block 806 . the high frequency processor operation begins in block 808 with generation of keys for the given names . then , in block 810 , records are retrieved according to a high frequency surname matrix and the given name keys . control then passes to filter and sorter 610 ( shown in fig5 ). low frequency processor operation begins in block 812 where each low frequency surname segment is examined to identify related high frequency and low frequency surnames , in blocks 814 and 816 . this processing loop continues until names related to the segments have been identified . a “ relationship ” to a high frequency surname is determined by digraph comparison . if the number of identical digraphs exceeds a specified threshold , the surname is deemed to be a mere spelling variant of the similar high frequency surname . if the surnames all relate to known high frequency names , control passes through block 818 to block 808 in the high frequency processor . if the surnames have mixed high and low frequency relationships , control passes through block 820 to block 808 . if all surnames have low frequency , control passes through block 822 to block 824 . in block 824 , a year of birth range is determined for the name . records are then retrieved based on name content ( same or different ), position of the name segments , the year of birth range , the record gender , and possibly additional restrictions based on the given name . referring again to fig1 , the typing and processing of names within the system is preferably informed by cultural information encoded in a name reference library 106 . the factors included in name reference library 106 are identified in the database structures shown in appendix d , which forms a part of this specification . appendix e , which also forms a part of this specification , provides additional flowcharts and software descriptions for a preferred embodiment of name classifier module 102 and the hispanic name search algorithms . significantly , as part of name regularization for the purpose of generating an index key for a first pass through the database , the present invention applies the international phonetic alphabet to generate index keys , rather than using a soundex or another conventional key . the ipa algorithm , according to the present invention , generates keys by segmenting ( e . g . syllabifying ) the name in question and converting it to ipa representation . in this manner , the system generates a key or set of keys which identify a set of pronounced equivalents , rather than generating a key by letter similarity , as in the traditional soundex method . significantly , the system generates multiple keys in ipa representation for most names , since most names have multiple possible pronunciations . the system determines multiple possible pronunciations of the name , where applicable , and associates an ipa key with each possible pronunciation . then , records matching any of the ipa keys for a name are then selected for further consideration and comparison . to program the ipa conversion , a rule set is generated that relates spelling to sounds . a different rule set is preferably generated for each ethnic origin of name , since pronunciations of apparently similar names may vary significantly based on origin . to generate a rule set , preferably a database of single name elements is obtained , such as a census list . the names in the list may are then manually tagged for their ethnic origin a variety of sources may then be used to determine possible pronunciations . these sources include native speaker knowledge and textual information . the rules are written broadly so that the most plausible pronunciations will be captured with some certainty . rules for languages not written in roman characters will necessarily take into account transcription variations . the rules are written in a predetermined notation which can be processed effectively by the system . a typical rule format is : which is interpreted to mean that the letters sc preceded by anything and followed by the letters le can be pronounced as [ s ] or [ sk ], e . g . muscle and mosclin . the rules should also be written to account for predictable articulatory processes such as movement of the soft palate , which might lead to a slightly different pronunciation . as an example of the advantages of matching on ipa , consider a query on the name lee . converted to the ipa string [ li ], exact matches with numerous spelling variants are automatic , including leigh and li . typical prior - art character based matches will fail to retrieve leigh or li , since the percentage of character overlap is minimal . conversely , a standard index matching system such as soundex will categorize lee and li identically , but will still miss leigh , given the presenve of a salient letter ( g ), and will retrieve a large number of names of low relevance , including lu , liao , low , louie , lahoya , and lehew . the ipa analysis process is further described in appendix f , which forms a part of this specification . while the ipa key generation , according to the present invention , provides a significant functional advantage in many cases , it should be noted that it may not be desirable to apply ipa processing to all classes of names . for example , the inventors have found that names of arabic and chinese origin are better processed using custom regularization algorithms rather than by the generalized ipa approach , since names acknowledged as similar in these cultures are often quite distinct phonologically . following regularization and expansion , name retrieval technology processing module 108 is applied . these algorithms facilitate more complete retrieval , by compensating for transpositions ; deleting affixes , where appropriate ; and compensating for inverted surnames , deleted surnames and nicknames . each of these algorithms uses stored information defining naming conventions for a particular culture in the manner described herein . next , retrieval module 110 is applied to the results of the preprocessing performed by name classifier 102 , variant generation module 104 , and retrieval technology module 108 . retrieval module 110 retrieves records matching the keys ( ipa or other culture - specific keys ) generated by the operation of the first three modules . these records are then provided to precision filter and sorting module 112 , which compares each record to the query name to determine a similarity / equivalence measurement defining the “ distance ” between the query name and the record name . precision filter and sorting module 112 may perform segment position comparisons , character comparisons , phonological similarity comparisons , structural similarity comparisons , phono - feature - distance comparisons , and / or n - gram comparisons . the output 114 of precision filter and sorting module 112 is then provided to the user . the output preferably consists of a rank - ordered list of records in descending order of likelihood of matching the query name . one preferred embodiment implementing many desirable features of the system shown in fig1 is a standalone database search and retrieval program . in addition to including the features described above ( and in further detail in the appendices ), this embodiment of the invention may preferably be implemented according to the disclosure in appendices g , h , i , and j , which form a part of this specification and are : a narrative description , technical plan , acceptance test , and source code listing respectively for a system demonstrating numerous features of the present invention . another desirable implementation of the invention is as a set of name searching tools which may be provided as one or more application programming interfaces ( apis ) for use in developing custom database management and searching applications . a flowchart for one embodiment of an api embodiment is shown in fig2 . further detail of the implementation of this embodiment is provided in appendices k ( software design description ), l ( default parameters ), m ( developer &# 39 ; s documentation ) and n ( source code listing ), each of which forms a part of this specification . operation of elements in the embodiment of fig2 are generally similar to like operational features described with reference to fig1 . as shown in fig2 , a preferred embodiment of an api - based name searching system 200 comprises name extraction tools 202 and name comparison tools 212 . name extraction tools 202 comprise intelligent search data generator ( isdg ) 204 and associated intelligent search database 203 , intelligent pre - processor 205 , name classifier 206 , name regularizer 208 , and phonetic key generator 210 . name comparison tools 212 comprise name evaluator 214 and results manager 216 , with scored name data 215 as an intermediate step . the system receives as an input name data 201 , and provides ordered similar data 218 as an output from name comparison tools 212 . the output of isdg 204 is search data 220 , which is provided to data update and data access applications 222 and from there to the name comparison tools 212 as query and candidate search data 226 . a names database with intelligent search data 224 is provided in association with data update and data access applications 222 . the embodiment of fig2 , like that described previously with reference to fig1 , implements a multifaceted approach to multicultural name searching . for example , in the hispanic culture , an individual typically has a compound family name ( e . g ., — arantxa sanchez vicario ), the first of which ( sanchez ) provides the more valuable identifying information . in contrast , although portuguese names also typically have compound family names and look very similar to hispanic names ( e . g ., maria ferreira dos santos ), the second family name ( dos santos ) provides the more valuable identifying information . if a single solution were proposed where , for example , the last name is considered the most important name , as in american names , hispanic names would not be adequately accommodated . the disclosed embodiment automatically applies whatever resources will adequately address the problem at hand , whether the variation is cross - cultural or arises from spelling variation , from transcription from other writing systems , from sound similarity , or from missing or additional information . in operation , the user system supplies both a query name and a database name to the system . the system employs linguistic intelligence to separate the name into its integral components in intelligent preprocessor 205 . further linguistic intelligence is employed to compare the two names in name evaluator 214 . the result of the comparison is a scored database name , scored name data 215 . the scored name is passed to results manager 216 , which collects and orders the names that are scored against a single query name . the final output is an ordered set of scored database names , ordered similar data 218 . the cornerstone of this embodiment is a programming library ( functions and classes ) that enables a developer to add fuzzy logic personal name searching to an application . for example , the developer may perform operations such as “ give me the 10 closest names to ‘ james slesinger ’ from my database ”, or “ give me all the names from my database that match ‘ john wong ’ with a degree of confidence of 0 . 9 ” or “ tell me the degree of similarity between ‘ paul vanesann ’ and ‘ p vanlesann ’”. the system incorporates and uses a variety of linguistic techniques to achieve these results , in the manner described previously with respect to a standalone name searching system . users can enhance the functionality of the apis by incorporating their business rules and data into the name comparison process . this embodiment provides fine granularity when comparing names . that is , names are scored and ranked more precisely , which is important when dealing with large volumes of data . the technology incorporates numerous parameters ( to customize the user &# 39 ; s search comparison ). from the user / developer perspective , the name search system is quite simple to utilize . a typical name search requires the use of just four classes ( snqueryparms , snquerynamedata , snevalnamedata , and snresultslist ). in addition , it is important to note that the extra code required to integrate this name search technology is minimal . the api name search interface is simplified by the fact that it makes no assumptions about the data and how it is stored . the user provides the api with the query name as well as the names from the database as input 201 . the library routine then presents names which are likely matches , and qualifies their degree of similarity . from the perspective of the developer , the tool is straightforward and easy to integrate . searches via the api embodiment are configurable by adjusting any of 43 parameters ( see appendix l for defaults ). each parameter controls some aspect of how two names are evaluated when determining if they are similar . some of the more basic parameters set thresholds for determining how close two names must be to be considered a match . other parameters control more complex processing , such as how to handle multi - segment names . in general , only a small set of parameters need to be adjusted by the developer , because reasonable defaults exist for each one . the api embodiment also provides pre - defined packages of parameters , each tailored to a particular culture or ethnicity . for example , hispanic names have certain characteristics such as compound surnames ( e . g ., torres de la cruz ) that can cause problems when searching for hispanic names using conventional , anglo - centric methods . the hispanic parameters package contains settings that address hispanic - specific name issues . new cultural / ethnic parameter packages can be established and existing packages can be modified as desired . the preferred embodiment uses a c ++ object framework , so that users / developers can extend the existing product functionality to incorporate additional data elements in the scoring algorithm or create evaluation methods specific to their business or application needs . for example , a database might contain a social security number , in addition to given name and surname . although the name search technology only compares name data , a developer can take advantage of class inheritance ( a feature of c ++), and easily subclass the program &# 39 ; s snevalnamedata and snquerynamedata objects to include social security numbers or any other desired data element ( s ). these data elements can then be used in the methods that score evaluation names and determine which evaluation names are matches . in other words , record matching can be performed using name data in conjunction with other available data element information . users / developers can also provide custom methods for determining if an evaluation name matches a query name or not . the default method compares the average of the given name score and surname score to a user / developer supplied threshold value . however , a more complex method may be desired . for example , the business rules of an application might dictate that a name cannot be considered a match unless either the surname or given name is an exact match . by overriding the default method , the developer can easily implement this logic in just a few lines of code . the functions provided in the api embodiment will now be described in more detail . the available functions include comparing a query name with one or more candidate names to produce an ordered list of candidate names with the highest probability of representing the same named person . this functionality is referenced as the name comparison tools 212 . the basic name checking tool employs multiple evaluation techniques to evaluate and score two names . the name checking tool incorporates information regarding variations in spelling , discrepancy in the number of name segments ( amount of information included ), exclusion of expected information , and positional information to establish a name score , which indicates the probability that the two names represent the same individual . the tool is controlled by a set of configurable parameters . the tool also manages and produces an ordered or unordered list of candidate names with the highest probability of representing the same named person , based on the developer defined criteria for establishing a set of results . various culture specific callable modules are available as extensions to the name check tool , including a name classifier that culturally classifies name data , a name regularizer that levels variations in name data to a single representation , and a phonetic name key that represents name data based on phonetic similarity . again , each of these tools and modules incorporates the methods and technology described above with reference to fig1 and 3 - 8 . the program also generates and stores intelligent search data for use in extracting relevant subsets of data from large data bases for further evaluation . these mechanisms will facilitate more efficient name searching while ensuring complete and accurate results . this functionality is referenced as the name extraction tool ( s ). the disclosed embodiment provides users / developers with the capability to compare two names to determine the probability that they both represent the same named individual or to compare a single query name with a set of candidate names to determine which candidate names are most likely to represent the same named individual . when a set of candidate names is evaluated , the apis enable the user / developer to define the criteria for producing their own ordered list of results . the criteria for defining an ordered list of results include the following : the top x candidate names ( i . e ., the x candidate names scoring the highest probability that they represent the same named individual ; e . g ., the top ten candidate names ); all candidate names whose name score exceeds a predefined name threshold ( e . g ., if the threshold = 0 , all candidate names will be returned in an ordered list ); or the top x candidate names whose name score exceeds a pre - defined name threshold . name comparison tools 212 include a name evaluator 214 , which employs multiple evaluation techniques to evaluate and score two names . name evaluator 214 incorporates information regarding variations in spelling , inclusion of additional information , exclusion of expected information , and positional information in order to establish a name score , which indicates the probability that the two names represent the same individual . name evaluator 214 is controlled by a set of configurable parameters . results manager 216 uses the intermediate scoring information provided by name evaluator 214 to manage and produce an ordered list of candidate names with the highest probability of representing the same named person , based on the developer - defined criteria for establishing the results . name extraction tools 202 include an intelligent search data generator ( isdg ) 204 which generates one or more search data values that facilitate extraction of relevant information from a data base for further comparative analysis . this tool is an important component of any search system that must search large volumes of data to locate similar name data , to the extent that it is not feasible to retrieve and evaluate every name record in a data base to determine its relevance to a query name . isdg 204 provides a motivated method for retrieving all relevant information from a data base while reducing the amount of non - relevant information retrieved . this tool can provide significant performance improvements while also ensuring an accurate and complete name search . various culture - specific tools are available as extensions to isdg 204 to address specific issues such as the cultural classification of name data , performed by name classifier 206 ; leveling of variations in name data to a single representation , performed by name regularizer 208 ; and the representation of name data based on phonetic similarity , performed by phonetic key generator 210 . thus , there has been disclosed an improved system and method , in multiple embodiments , for searching personal name databases , with maximum simplicity and ease of integration , maximum flexibility , and maximum extensibility . | 8 |
fig1 discloses a preferred arrangement for a uv photoconductor sensor 10 having a source electrode 12 and a drain electrode 16 lying on the surface of an n - type semiconductor active layer 20 of photoconductor sensor 10 . uv radiation directed onto the top surface of active layer 20 reduces the electrical resistance of active layer 20 by a factor of 4 or more , and elements to be described shortly allow this resistance change to be detected . a substrate 27 , typically formed of sapphire , supports active layer 20 , with an intermediate layer 22 , typically of aluminum nitride , not shown in fig1 interposed between active layer 20 and substrate 27 . intermediate layer 22 is necessary for active layer 20 to have the desired characteristic of selective and high sensitivity in the uv spectral band of wavelengths in the approximate range of 200 to 365 nm . active layer 20 comprises mostly gallium nitride although there may be fractional concentrations of aluminum nitride and indium nitride therein for controlling spectral response . hereafter , we will refer to gallium nitride as the constituent of active layer 20 , but the reader should understand that there may be detectable fractions of both indium nitride and aluminum nitride in active layer 20 . we prefer to deposit both the intermediate layer 22 and the active layer 20 using the mocvd process mentioned above , and it is this process that has been used to produce the functional devices 10 we have made so far . for the most part we use standard mocvd deposition practices . for our version of the process however , we have found that specific ranges for these parameters produce active layers 20 with the appropriate electrical characteristics . these specific ranges will be specified in the details of the process which we describe below . as is conventional for producing active layers using the mocvd process , a sapphire wafer having space on its deposition for hundreds of individual sensors is coated with the active layer , and then as a later step in the process , sawed into individual sensors . this is an entirely conventional aspect of our process . the change in resistivity of active layer 20 is detected by sensing the resistance between a source electrode 12 and a drain electrode 16 , which comprise the metallization , i . e ., surface electrical conductor elements , for this device . source electrode 12 has a series of spaced apart parallel fingers 13 . drain electrode 16 has a plurality of spaced apart fingers 17 interleaved with , spaced apart from , and parallel to the fingers 13 of electrode 12 as shown in fig1 . the pattern shown for electrodes 12 and 16 in fig1 is far from true scale because of the very small dimensions involved . in one preferred embodiment , each finger 13 and 17 may be approximately 40 μm wide , 900 μm long , 0 . 46 μm thick , and spaced from its adjoining finger ( s ) 13 or 17 by 80 μm . each electrode has 4 fingers 13 or 17 as shown . fig2 is a cross section of sensor 10 in the vicinity of a finger 13 and a finger 17 as indicated by the cross section arrow of fig1 . one can see a part of the individual fingers 13 and 17 sitting atop the active layer 20 and making ohmic contact therewith . active layer 20 is shown as having three individual sublayers or regions which we refer to hereafter as a variable depletion region 20a , a conduction channel 20b , and a fixed depletion region 20c . these three regions have effective thickness dimensions respectively of t d1 , t c , and t d2 . depletion regions 20a and 20c have a deficiency of current carriers , i . e . donor sites , and thus have a relatively high intrinsic resistance . conduction channel 20b has an excess of donor sites and thus has a relatively low resistance . active layer 20 is designed so that over its entire volume there is an average of approximately 10 15 to 5 × 10 16 donor sites in excess of acceptor sites per cc ., or 13 to 650 donor sites in excess of acceptor sites per 10 9 gallium or other metal atoms . the absence of donor sites in depletion regions 20a and 20c is a boundary or surface effect in layer 20 , occurring near its two surfaces . we theorize that incident uv radiation symbolized by the wiggly arrow 30 affects conduction characteristics of active layer 20 by altering the relative thicknesses t d1 and t c of depletion region 20a and conduction channel 20b . the thickness of depletion region 20c is relatively constant because uv radiation cannot penetrate volume 20a and channel 20b to reach depletion volume 20c to alter its conduction characteristic . when incident uv radiation intensity is relatively low , t c is small relative to t d1 and because the highly conductive cross sectional area of conduction channel 20b is relatively small , resistance between fingers 13 and 17 is large . when incident uv radiation intensity is relatively large , t c actually changes quantitatively , becoming much larger relative to t d1 and increasing the cross sectional area of conduction channel 20b . the larger area of conduction channel 20 decreases the resistance between fingers 13 and 17 . this change in resistance is significant , typically at least a factor of 4 or more , and can easily be detected by conventional electrical circuitry . incident uv radiation intensity can be measured in at least two different ways , photons per unit area per second , and watts per unit area . these measures of radiation intensity are interchangeable . the reader should realize that the representation in fig2 of the depletion regions 20a and 20c is idealized . it is certain that the actual transitions from depletion regions 20a and 20c to conduction channel 20b are not nearly as well defined as shown in fig2 . it is possible that there is a gradient over perhaps several percent of the total thickness of active layer 20 , in the concentration of donor sites from the lowest in each of the depletion regions 20a and 20c to the highest in the conduction channel 20b . the actual shape of regions 20a and 20c and channel 20b is also idealized in fig2 . it is likely that these shapes are not as rectangular as shown . what the actual shapes are though is not easy to predict at this time . at any rate , the quantitative values of these dimensions may be considered equivalent for the heuristic purposes intended here . furthermore , the resistance change occurring for a preselected change in incident uv radiation when the present uv radiation level is small , is much greater percentagewise than when the present uv radiation is relatively large . this decreasing sensitivity to changes in uv radiation intensity as a function of increasing uv radiation intensity is shown in fig3 which is a plot of gain for a typical sensor 10 versus incident uv radiation intensity . one can see that near the lowest appreciable level of uv radiation , a small change in the level of uv radiation causes a relatively large change in current flow . as uv radiation intensity increases , the change in current flow becomes increasingly smaller percentagewise . silicon is well known as one element which provides donor sites in gallium nitride and other nitride semiconductors . in a currently preferred embodiment of this sensor 10 we have a substantially uniform concentration of silicon atoms of approximately 10 15 to 8 × 10 16 throughout the active layer 20 , which is sufficient to create a donor site in excess of acceptor site concentration of 10 15 to 5 × 10 16 per cc . in another possible form of active layer 20 , a relatively high concentration of silicon atoms is provided in the center of the thickness of active layer 20 , within the conduction channel 20b to form the required donor sites . this concentration of silicon atoms is created by appropriately modifying the deposition step which forms active layer 20 . an appropriate average concentration of silicon atoms is 10 17 to 5 × 10 18 per cc within a centrally located narrow layer in active layer 20 . the layer may be no thicker than 1 to 100 nm , and is created during the growth of conduction channel 20b , by briefly altering the composition of the gasses from which active layer 20 is deposited . although silicon has been found to provide suitable results for providing donor sites , other materials may also be as suitable or even better . we have previously mentioned that smaller amounts of aluminum and indium can be included as constituents of active layer 20 to achieve certain desirable characteristics in spectral response . one tendency noted in some samples of sensor 10 having the previously described structure , is sharply reduced gain at temperatures at and below approximately - 40 ° c . we believe , based on experience and analysis , that including dopants comprising germanium , sulphur , selenium , and tin in active layer 20 instead of silicon may reduce this tendency substantially . accordingly , active layers 20 having such dopants comprising germanium , sulphur , selenium , and tin form a part of our invention . appropriate uniform concentrations here too are from 10 15 to 8 × 10 16 atoms per cc within active layer 20 . fig3 is a representative graph showing the relationship between gain and uv light intensity . the gain values on the ordinate are the actual number of electrons which flow to form the signal current due to a certain bias voltage between electrodes 12 and 16 , and responsive to a single photon of the specified wavelength impinging on the active layer 20 . one can see that gain tends to uniformly decrease with increasing uv light intensity . the values at very low levels of light intensity may not exhibit this decreasing gain characteristic , so the criterion is strictly true only for uv light intensity above some very low level , perhaps 10 - 9 w / mm 2 . in this test , there were four different tests performed , as shown in the legend . two were for uv light impinging directly on active layer 20 and two were with the uv light shining through the substrate 27 . note that sapphire is transparent to uv radiation . two different frequencies were tested as shown , to determine frequency dependency of gain . we have developed a version of the mocvd process for producing photoconductor 10 . fig4 is an outline diagram of the mocvd equipment which we use to deposit the aluminum nitride intermediate layer 30 and the gallium nitride active layer 20 . the person with ordinary skill in the art of practicing mocvd processes knows that such processes are complex , and that their reproducibility and repeatability sometimes depends on factors which cannot be identified or accurately controlled . when components for apparatus such as that of fig4 are first chosen , it is axiomatic that there will be a runup period during which yields will be lower than one expects . as the skilled user gains more experience with the apparatus , yields will increase and the occurrence of bad batches which must be totally discarded will become much less frequent . furthermore , we have discovered certain parameters which we at the present time find to be critical , and these will all be identified and explained . the mocvd deposition apparatus 50 shown in fig4 includes a cylindrical deposition chamber 55 defining an inner volume 60 . chamber 55 has an inner volume 60 defined by an inner wall 57 , an inner bottom 74 integral with inner wall 74 , and a top cover 52 . top cover 52 is clamped against a flange 54 with an o - ring 53 between them to prevent leaks . chamber 55 also has an outer wall 59 spaced from inner wall 57 . the space formed between inner wall 57 and outer wall 59 , and inner bottom 74 and outer bottom 75 defines a cooling jacket 58 through which cooling water can circulate . cooling water enters jacket 58 from an external source through a cold water inlet 62 and exits jacket 58 through outlet 64 after having been heated to boiling . a bottom plate 98 is clamped against flange 103 of chamber 55 with an o - ring 101 to prevent leakage . in our commercial embodiment the top cover 52 and bottom plate 98 are formed of stainless steel and the remainder of the chamber 55 described to this point is formed of quartz glass . a pedestal 67 is mounted for rotation within chamber 55 on a shaft 70 . a motor not shown , is magnetically connected to shaft 70 so that pedestal 67 can be rotated at any preselected speed . we prefer a rotational speed for shaft 70 of 1 rps for the entire deposition process involved here . pedestal 67 supports a susceptor 65 comprising graphite and having a silicon carbide coating . susceptor 65 is for supporting and heating a wafer 68 which comprises the substrate which receives the intermediate and active layers during the deposition process . shaft 70 , pedestal 67 , and susceptor 65 are all centrally located within volume 60 in our embodiment , and we believe that this enhances desirable uniform flow of gasses within volume 60 . a temperature sensor 72 has an optical temperature probe 69 which fits through a hollow core in shaft 70 and pedestal 67 with its end adjacent to the bottom surface of susceptor 65 resting on pedestal 67 . the temperature sensor 72 receives radiation indicative of the susceptor 65 temperature transmitted by the probe 69 , and provides a control signal on a path 74 . while this is the most accurate means of sensing temperature of susceptor 65 which we know at the present time , it is not as accurate as we would like . in fact , we believe that a better means of measuring susceptor 65 temperature would enhance the performance of this process . an external rf coil 71 is wound around the exterior of chamber 55 and powered by a 650 khz rf generator 73 during deposition steps . in our embodiment , coil 71 has 5 turns rather than the 2 turns shown . by applying rf power to coil 71 , it is possible to heat susceptor 65 and a wafer 68 sitting on it , to any temperature suitable for mocvd processes , and at least 1100 ° c . a temperature set point value is supplied by the operator to rf generator 73 . rf generator 73 also recieves a signal from the temperature sensor 72 which indicates the temperature of susceptor 65 . rf generator 73 adjusts its output to coil 71 so as to maintain the susceptor temperature at the set point . in this way , the temperature of wafer 68 can be held to a desired value with resonable accuracy . in the two deposition steps of our process , the temperature of wafer 68 is quite critical ; pains should be taken to hold the temperatures specified below with good accuracy . the gasses in which are entrained the materials to be deposited on wafer 68 are introduced through tubes 86 and 89 in cover 52 . inlet tubes 86 and 89 have a gas - tight mounting in cover 52 . a quartz glass inlet portion of tube 86 projects through cover 52 so that its end 94 is below the inner ( bottom ) surface of cover 52 by an appreciable amount . a supply tube 78 for tri - ethyl gallium ( teg ) is connected to inlet tube 86 by a flow control valve 81 . a supply tube 76 for ammonia ( nh 3 ) is connected to inlet tube 89 by a flow control valve 84 . by adjusting valves 81 and 84 , the flow rates of teg and ammonia into volume 60 can be accurately controlled . ammonia and teg flow rates appear to be critical process parameters . gasses within volume 60 exit through an exhaust port 96 and duct 104 . a vacuum pump 105 reduces pressure with chamber 55 to the desired value of 76 torr or less , with a flow control valve 106 setting the actual desired chamber pressure of 76 torr . it is possible to provide for adding other materials to either the ammonia or the teg stream as well . for example , there is shown in fig4 a further supply tube 110 , in this example for silane entrained in hydrogen gas , is shown . a valve 113 controls the flow of this silane - containing gas stream to an inlet tube 117 , by which the silane is introduced into the teg stream . the following process steps table defines the operating steps and their order for producing active layers of gallium nitride on wafers 68 suitable for sawing into sensors 10 of the type described after the metallization has been added . the process parameters table defines the parameter values and apparatus dimensions to be used in the process steps . it is not possible to determine for every one of this rather extensive list of parameters , which of the values may turn out to be critical . for example , we have found that the spacing between end 94 of tube 86 and the top of wafer 68 specified below , provides acceptable performance both from the standpoint of product characteristics and of yield . yet this is not a parameter which is easy to change in an operating system , and there may well be other values which function as well or even better . we strongly recommend that a person wishing to practice this invention should start with the values we provide in order to minimize the time required to optimize the process for his or her particular installation . there are many other requirements for successfully operating an mocvd process which are well know to those of skill in the art . these are documented in a number of sources , such as the stringfellow reference identified above . allow sufficient water to flow into inlet 62 to maintain wall 57 and bottom 74 near 100 ° c . adjust valve 96 throughout following steps to maintain pressure in volume 60 at 76 torr adjust rf generator 73 to hold temperature of susceptor 65 temperature at * 750 ° c . ( range 740 ° to 775 ° c .) ( critical value -- must be held as accurately as possible ; the actual optimized value will usually be in the specified range ) for a 10 minute first interval , allow tri - ethyl aluminum ( tea ) to flow through valve 81 to maintain a partial pressure of tea within inlet tube 94 of 2 . 4 × 10 - 3 torr and a total flow of gasses through tube 94 of 881 standard cc / min , and ammonia to flow through valve 84 to maintain a partial pressure of ammonia of 0 . 42 torr within inlet tube 89 and a total flow of gasses through tube 89 of 1942 standard cc / min adjust rf generator 73 to raise the temperature of susceptor 65 to 1000 ° c . ( range 1000 ° to 1050 ° c .) and hold for an 80 minute second interval , allow tri - ethyl gallium ( teg ) to flow through valve 81 to maintain a partial pressure of teg within inlet tube 94 of 3 × 10 - 2 torr and a total flow of gasses through tube 94 of 780 standard cc / min ; ammonia to flow through valve 84 to maintain a partial pressure of ammonia of 0 . 63 torr within inlet tube 89 and a total flow of gasses through tube 89 of 3015 standard cc / min a ) during the second interval of 80 min , allow silane or other gas containing other dopant elements to flow through valve 113 and tube 117 to maintain a partial pressure of silane or other gas within tube 94 of 4 × 10 - 6 torr ; ( preferred embodiment ) or b ) during a subinterval of from 6 sec to 10 min centered in the second interval of 80 min , allow silane or other gas containing other dopant elements to flow through valve 113 and tube 117 to maintain a partial pressure of silane or other gas within tube 94 of 1 . 5 × 10 - 5 torr ; cool wafer 68 to room temperature , maintaining flow of the ammonia stream until the wafer 68 temperature has fallen to at least 400 ° c . ; add metallization patterns as shown in fig1 according to well known photolithographic processes ; test individual sensor sites ______________________________________process parameter table______________________________________tri - ethyl gallium purity , silicon parts / billion & lt ; 30volume 60 diameter 7 . 0 cmvolume 60 height 29 cmsusceptor 65 diameter 5 . 1 cmsusceptor 65 height 3 . 8 cmdistance tube 94 projects into volume 60 3 . 6 cminside diameter of tube 94 0 . 3 cminside diameter of tube 91 0 . 46 cmdistance between end of tube 94 and top of wafer 68 14 . 48 cm______________________________________ we have determined that the amount of silicon in the active layer 20 is critical . it is difficult to maintain the integrity of the process if the silicon content of the teg is not consistently low and all other potential sources of silicon are sufficiently and consistently low ( except for the silane of course ). the concentration of silicon in the active layer 20 cannot otherwise be accurately controlled . | 7 |
with reference now to the drawings , and in particular to fig1 through 6 thereof , a new carrying device embodying the principles and concepts of an embodiment of the disclosure and generally designated by the reference numeral 10 will be described . as best illustrated in fig1 through 6 , the writing utensil carrying assembly 10 generally comprises a holder 12 to contain a plurality of writing utensils 14 . the writing utensils 14 may be pens or pencils or the like . the holder 12 comprises a panel 16 that has a front side 18 , a back side 20 and a perimeter edge 22 extending therebetween . a plurality of sleeves 24 is coupled to the front side 18 and the sleeves 24 extend between a top side 26 and a bottom side 28 of the perimeter edge 22 . the sleeves 24 are spaced between a first lateral side 30 and a second lateral side 32 of the perimeter edge 22 . each of the sleeves 24 has an open end 34 and the open end 34 may insertably receive one of the writing utensils 14 . a pocket 36 is coupled to the back side 20 and the pocket 36 has an aperture 38 therein to insertably receive an item 40 . the aperture 38 may have a closure 40 comprising a zipper or the like . a strap 42 is coupled to the holder 12 and the strap 42 may wrapped around an object 44 such that the holder 12 is retained on the object 44 . the object 44 may be a cover of a book or the like . the strap 42 has a first end 46 and a second end 48 . the first end 46 is coupled to the top side 26 and the second end 48 is coupled to the bottom side 28 . the strap 42 has a break therein to define a first portion 50 and a second portion 52 . additionally , the break defines a distal end 54 of each of the first portion 50 and the second portion 52 with respect to the holder 12 . as shown in fig4 , the strap 42 may be one of a pair of straps 60 each positioned adjacent to one of the first lateral side 30 and the second lateral side 32 of the perimeter edge 22 . in an alternative embodiment as shown in fig6 , the first end 46 of the strap 42 is coupled to the first lateral side 30 of the perimeter edge 22 and the second end 48 of the strap 42 is coupled to the second lateral side 32 of the perimeter edge 22 . the strap 42 may be wrapped around an arm 53 of a user 55 such that the writing utensils 14 are oriented to extend along the arm 53 of the user 55 . a first coupler 56 and a second coupler 58 are provided . the first coupler 56 is coupled to the first portion 50 and the first coupler 56 is positioned adjacent to the distal end 54 of the first portion 50 . the second coupler 58 is coupled to the second portion 52 and the second coupler 58 is positioned adjacent to the distal end 54 of the second portion 52 . the first coupler 56 engages the second coupler 58 . the first 56 and second 58 couplers may comprise hook and loop fasteners . in use , the strap 42 is wrapped around the object 44 and the first 56 and second 58 couplers are coupled together . the writing utensils 14 are positioned in the sleeves 24 to be transported on the object 44 . the holder 12 may be utilized in an educational environment , a medical environment or an administrative environment . additionally , the holder 12 ensures the writing utensils 14 are always available . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of an embodiment enabled by the disclosure , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by an embodiment of the disclosure . therefore , the foregoing is considered as illustrative only of the principles of the disclosure . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the disclosure to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the disclosure . in this patent document , the word “ comprising ” is used in its non - limiting sense to mean that items following the word are included , but items not specifically mentioned are not excluded . a reference to an element by the indefinite article “ a ” does not exclude the possibility that more than one of the element is present , unless the context clearly requires that there be only one of the elements . | 0 |
hereinafter , preferred embodiments of the present invention will be described in detail with reference to the drawings so that the purpose , features and advantages of the present invention will be better understood . it should be understood that the embodiments shown in the drawings are not to limit the scope of the invention , but merely to illustrate the true spirit of the technical solution of the present invention . fig1 shows a schematically top view of the structure of a wireless passive temperature and humidity sensor 100 according to the present invention . as shown in fig1 , the sensor 100 comprises a piezoelectric substrate 106 , an integrated antenna 104 , a feeding network 105 , a temperature measuring resonator 101 , a reference resonator 102 , and / or a humidity measuring resonator 103 , wherein the temperature measuring resonator 101 and the humidity measuring resonator 103 are measuring resonators . the piezoelectric substrate 106 is a temperature dependent crystal or film . the hardness , density and size of the piezoelectric will be changed with temperature . in the practice , material , slice orientation and thickness of the piezoelectric substrate 106 may be selected according to a specific application . preferably , the piezoelectric substrate 106 is made of lithium niobate , quartz , zinc oxide , aluminum nitride , cadmium sulfide , or lanthanum gallium silicate or the like . in addition , the bottom of the substrate further comprises a supporting layer . preferably , the support layer is made of ceramics or metals , and the thickness of the supporting layer can be determined as desired . the integrated antenna 104 is a miniaturized integrated antenna . in this embodiment , it may be a meander line dipole antenna , a microstrip patch , an inverted - f or a slot antenna . the radio frequency ground of the antenna is connected with the ground of the sensor . meanwhile , the feed efficiency can be improved via an optional impedance matching network . the integrated antenna is used for delivery or feedback of temperature and / or humidity signal , and also used for the power supply of the humidity measuring resonator , temperature measuring resonator and the reference resonator . the feeding network 105 is connected to the antenna port , for example , through microstrip lines or bonding wires . the length , diameter or width of microstrip lines or bonding wires can be determined as desired . the resonators 101 , 102 and 103 are surface acoustic wave resonators , which respectively comprise interdigital transducers 101 b , 102 b and 103 b , and respectively comprise short circuit reflectors 101 a , 102 a and 103 a . interdigital transducers work at the same frequency with corresponding reflectors , and resonators . the resonators operate at resonance frequencies f 1 , f 2 and f 3 which are adjacent but not overlapping respectively . resonators 101 , 102 and 103 are connected in parallel , and the reference resonator 101 h as a different angle θ r relative to the substrate &# 39 ; s crystal orientation as compared to measuring resonators 102 and 103 . preferably , the angle θ r ranges from 25 ° to 45 °. fig2 shows a schematically section view of the structure of the wireless passive temperature and humidity sensor 100 according to the present invention , wherein the substrate 107 is a passive substrate acting as a supporter . in this embodiment , the substrate 107 is a metal bracket . the piezoelectric substrate 106 is a temperature dependent piezoelectric crystal which can be formed by fixed the slices prepared by single crystal growth process on the bracket , or the piezoelectric substrate 106 is a piezoelectric film which can be coated on the surface of the bracket via physical or chemical vapor phase film deposition . then , metal film structures 202 ( i . e ., the interdigital transducers of the resonators ) with specific shape and thickness are processed on the piezoelectric substrate via surface micromachining processes , such as , photolithography , laser engraving , printing or bonding , etc . said metal film structures may be made of aluminum , gold , tungsten , copper , titanium and its alloys . it should be noted that each of the resonators 101 , 102 , 103 may be made on a single or a group of piezoelectric substrates with a single layer or stratified layers . resonators 101 , 102 and 103 may be packaged by two packaging methods , namely by a film coating 201 or a housing 203 . wherein , the film coating 201 may be applied on the surfaces of the piezoelectric substrate and the metal film structure via vapor or liquid phase film deposition . in this embodiment , alumina oxide material ( or silicon oxide and other materials ) is used to form a passivated surface so that the temperature measuring resonator 101 and the reference resonator 102 are sealed . alternatively , porous materials with high porosity , such as , zinc oxide or aluminum nitride , are used to form a hydrophilic thin - film coating 201 absorbing vapor in order to package the humidity measuring resonator 103 , wherein the upper surface of the hydrophilic thin - film coating 201 is exposed to external environment . in the embodiment shown in the drawings , porous materials with high porosity , such as , zinc oxide or aluminum nitride , are used to form a hydrophilic thin - film coating 201 absorbing vapor to package the humidity measurement resonator 103 , while a metal , ceramic or plastic housing is fixed over the temperature measuring resonator 101 and the reference resonator 102 via bonding or welding to package the temperature measuring resonator and the reference resonator . in another preferred embodiment , an interdigital transducer with aluminum or copper layer , comprising a lithium niobate substrate is used in the sensor 100 , wherein thickness of the aluminum or copper layer is 160 nm . a metal bracket is provided at the bottom of the piezoelectric substrate , wherein thickness of the metal bracket may range from 600 micrometers to a few millimeters . preferably , in this embodiment , the thickness of the metal bracket is 1 mm . resonators 101 , 102 , and 103 respectively contains 50 pairs of electrodes and reflection gratings with 100 period length symmetrically distributed at both sides of the resonator 100 . the designed operating frequency of the sensor is about 860 mhz . first , the humidity measuring resonator 103 is packaged by porous zinc oxide film , and then the temperature measuring resonator 101 and the reference resonator 102 are inertly packaged by silicon oxide film . fig3 is a graph showing the frequency spectrum structure and frequency difference according to an embodiment of the sensor 100 of the present invention . in this example , resonators operates at frequencies f 1 , f 2 and f 3 respectively , wherein the temperature measurement resonator works at frequency f 1 , the reference resonator works at frequency f 2 , and the humidity measurement resonator works at frequency f 3 . frequency difference δf t is used for modulating the temperature and frequency difference δf h is used for modulating humidity . it should be noted that when there are sensors of same type nearby , preferred frequency range is required to avoid frequency conflicts and ensure that the remote sensing device can simultaneously query ( i . e . detect and identify ) these sensors . fig4 and 5 is a graph showing the relationship between humidity , temperature and frequency of an embodiment , wherein fig4 shows the change of frequency with that of relative humidity during humidity measurement and fig5 shows the change of frequency and frequency difference with that of temperature and humidity . specifically , the coating ( film ) on the upper surface of the humidity measuring resonator changes its density ρ with outside environment vapor partial pressure c v according to the following rule : wherein , k is a constant determined by film thickness , ρ v is vapor density . moreover , the thickness of the film becomes thicker with the adsorption of steam . fig5 shows that these two changes cause the change of high - frequency sound waves velocity of the humidity measuring resonator coated with the film , thereby causes the frequency change . when relative humidity changes within the range of 0 % to 100 %, frequency change can reach 150 ppm . it should be noted that , at this time , frequency difference δf h for modulating humidity is a total frequency difference including frequency changes caused by possible temperature change δt = t − t 0 with respect to room temperature and humidity change δh = h − h 0 with respect to reference ambient humidity ( wherein t 0 is room temperature , h 0 is reference ambient humidity ), the relative humidity is obtained in the following manner : δ h − h c =√{ square root over ( σ i = 0 m β i ( δ f h ) i + σ i = 0 p γ i ( δ f t ) i )} ( 4 ) wherein , h c , β i ( i = 0 . . . m ), and γ i ( i = 0 . . . p ) are calibration coefficients , and the calibration coefficients are calibrated through curve fitting or solving vector equations via iterative method in the factory . the process can be divided into two steps : firstly , the frequency difference δf h between humidity measuring resonator 103 and reference resonator 102 is measured under preset humidity h 0 . . . h ( m + 1 ) and ambient temperature t 0 , then the following equation can be established and h c , β i ( i = 0 . . . m ) can be iteratively solved then , the frequency difference δf h between humidity measuring resonator 103 and reference resonator 102 as well as the frequency difference δf t between reference resonator 102 and temperature measuring resonator 101 are measured based on the preset temperature t 0 . . . t p and ambient humidity h 0 , establishing the following equation and solve further , a larger number of measurement sampling points than the length of the undetermined vector ( i . e . more than m + 2 humidity sample points or more than p + 1 temperature sample points ) may be taken so as to be fitted to obtain the calibration parameters described above . humidity measurement process and calibration methods described above enable the sensor to extract humidity directly . it should be noted that during the above humidity measurement , frequency drift caused by aging of devices has been compensated by frequency difference δf t and δf h , thereby there is no need to re - calibrate the coefficients when used , thus ensuring the long - term stability of humidity measurement . temperature change δt with respect to calibrated ambient temperature in the factory can be extracted via high order polynomial of δf t : δ t − t c =√{ square root over ( σ i = 0 n α i ( δ f t ) i )} ( 7 ) wherein , calibration coefficients t c , α i ( i = 0 . . . n ) are calibrated through solving vector equations via iterative method in the factory , comprising the following step : measuring the frequency difference between the reference resonator 102 and the temperature measuring resonator 101 based on the preset temperature t 0 . . . t n + 1 , establishing the following equation and solving t c , α i ( i = 0 . . . n ) via iterative method : similarly , in the above temperature measurement , frequency drift caused by aging of devices has been compensated by the frequency difference δf t , thereby there is no need to re - calibrate the coefficients when used , thus ensuring the long - term stability of humidity measurement . in another embodiment of the present invention , said temperature and humidity sensor ( not shown ) collaborates with a remote sensing device to constitute a sensor system , wherein the remote sensing device can be an appropriate one known in the art and will not be elaborated here . said remote sensing device employs band - limited frequency modulated continuous electromagnetic wave to illuminate and interrogate said sensor . after the sensor antenna receives the wave , the saw resonators ( including the temperature measuring resonator 101 , the reference resonator 102 and the humidity measuring resonator 103 ) are motivated . at this time , the piezoelectric film substrate deforms and is charged , thereby it remains transient oscillations and feeds frequencies of resonators back to the remote sensing device via antennas after the irradiation is stopped . said remote sensing device may include a human - machine interface and have the function of data processing , thereby it is able to directly display the temperature and humidity values locally and to alarm according to the preset threshold . moreover , the remote sensing device may also include a wired or wireless repeater or hub , so as to achieve cluster and maintain simplex or duplex communications with a remote monitoring device , thereby deliver the temperature and / or humidity data to the remote control device to perform the cluster network networking capability . further , it should be noted that , when only temperature is to be measured , the sensor system of the present invention may not include a humidity measuring resonator . similarly , when only humidity is to be measured , the sensor system of the present invention may not include a temperature measuring resonator . moreover , depending on the application , more temperature measuring resonators and / or more humidity measuring resonator and / or more reference resonators may be provided in one sensor so as to improve accuracy and reliability of measurement . preferred embodiments of the present invention has been described in detail , while it is to be understood that , after reading the above teachings of the present invention , those skilled in the art may make various modifications to the present invention . all these equivalent forms also fall into the scope limited by attached claims of the present application . | 6 |
the fully assembled street graphic cage of the present invention is depicted in fig1 wherein the post top light fixture 10 sits atop a light post 12 in standard fashion for illumination of a predefined area therebelow . the post top light fixture 10 , as seen in conjunction with fig2 is comprised of a prismatic refractive globe or other lamp enclosing device which itself is surrounded by the street graphic cage 20 . the street graphic cage 20 , depicted in fig1 and 2 , may attach directly to the light post support and also be affixed to the globe 14 at the lower portion thereof . the street graphic cage 20 provides a mechanism for supporting a plurality of sign panels 18 and logo blocks 16 in illuminating relationship with the globe 14 and light source or lamp located therein . used in conjunction with the post top light fixture 10 and street graphic cage 20 of the present invention are a plurality of sign panels 18 which may be acrylic having high gloss vinyl . as shown in fig2 the translucent sign panel 18 may be slightly deformed or bent for insertion into one of the panel apertures 27 formed in the upper frame element 24 . the sign panel 18 is received within the panel aperture and as depicted the upper frame element 24 may have a plurality of apertures located therein for receiving the opal acrylic sign panels 18 . as shown in the embodiment of the figures , four panel apertures 27 are provided for displaying the panels in 90 degree segments around the upper frame element . however , a number of varying implementations for use of panel apertures in conjunction with translucent panels fall within the teaching of the invention described herein and no unnecessary limitations are to be interpreted from the exemplary construction depicted . turning now to fig3 and 4 depicting the street graphic cage 20 of the present invention and its implementation on a post top environment , it is clear that the street graphic cage 20 of the present invention allows previous post top luminaires to be converted into graphic panel displays . as the lamp or other light source within the globe 14 emits light from the globe 14 , the street graphic cage 20 of the present invention positions the translucent sign panels 18 in a position wherein the plurality of acrylic signs 20 may be readily illuminated and visible , either day or night . the cage 20 , as shown in fig3 may be constructed of aluminum or other rigid supporting material . the street graphic cage 20 has a lower frame element 22 , an upper frame element 24 and ribs 23 connecting the two . in this example , the lower and upper frame elements 22 and 24 are depicted as being annular . however , any geometric construct allowing the panels apertures to position the panels within illumination distance from the light source within the globe 14 is sufficient . further , lower and upper frame elements can be formed alternatively in square , rectangular or other geometries matching the lamp support or other desired feature . the street graphic cage 20 depicted has a plurality of ribs which connect the lower frame element 22 with the upper frame element 24 . the lower frame element 22 may be firmly retained within the lamp post support 13 around the exterior of the globe 14 . the lower frame element 22 can be overlaid onto the lamp post support and affixed thereto by a plurality of screws or other retention elements , as shown in fig6 or may be interiorly positioned between the globe and the lamp post support . the ribs 23 connect the upper frame element 24 to the rigid connection to the lamp post support 13 and support the upper frame element 24 . as can be seen from the figures however , alternatively the upper frame element 24 may also be positioned on the lamp top 29 such that the panels 18 are readily illuminated within the need for support . in the construction shown , the upper frame element 24 has a plurality of panel apertures 27 and also a plurality of block apertures 28 . the panel apertures receive sign panels 18 while the block apertures receive the logo blocks 16 . logo blocks 16 may be translucent logo blocks or may alternatively be metal decorative blocks affixed to the upper frame element 24 in the block aperture 28 . the upper frame element 24 may be viewed as having an upper cylindrical frame member 51 and a lower cylindrical frame member 52 which form the upper and lower edges or walls of the panel apertures 27 . as shown in this example , the panel apertures therefore are constructed in rectangular geometry with the upper cylindrical frame member 51 forming the upper side or edge of the panel aperture while the lower cylindrical frame member 52 forms the lower side or edge of the panel aperture . the logo blocks 28 formed in the upper frame element 24 may separate the panel apertures and form the side walls or edge thereof . as depicted , the logo blocks may be squared . as shown in fig5 a close up of the street graphic cage 20 of the present invention is depicted wherein the panel apertures 27 are apparent as well as the retaining tabs 31 a and 31 b which hold the panel 18 in position . as can be seen from the figure , the positioning of the panel apertures 27 allows the plurality of panels 18 be removed and changed within the necessity of entry in to the globe 14 or other aspects of the post top light . thus , a tool - less ability to modify the panels is provided . the panels 18 are retained in proper position within the panel apertures by opposing tabs 31 a , 31 b and allow the panels to be either slid down into proper positioning or they may be slightly bent , placed into position and then released wherein the outward flexing of the panels then forces the side edges into the retention tabs 31 a , 31 b within the upper frame element 24 . also shown in fig5 is the block aperture 28 which receives the logo blocks 16 . the logo blocks 16 may be either translucent logo blocks having user definable indicia on them as with the translucent acrylic sign panels 18 or may be solid cast aluminum decorative blocks affixed within the logo block apertures 28 . as shown in fig3 and 5 , the translucent logo blocks 16 may be retained within the apertures 28 by use of brackets 32 and similarly be illuminated by the lamp or other light source located within the globe 14 . alternatively , decorative blocks which are rigid in construction may be affixed to the brackets 32 by use of screws which may enter through apertures 33 in brackets 32 to firmly hold the logo block in place . turning to fig7 an alternative embodiment of the logo block aperture 23 is shown in upper frame 24 . the upper frame 24 at the point of the logo block aperture 23 is defined with a first and a second retaining elements 44 a and 44 b which allow tool - less changing of the logo block 16 a . as shown , the block 16 may have a washer 41 attached to the upper portion by a threaded screw 42 . affixed to the lower portion of the logo block 16 a is spring or clip 43 which is also attached by screw 42 . when a change of the logo block 16 a is desired , the new block may be easily inserted into aperture 23 by placing washer 41 and clip 43 behind the retaining elements 44 a and 44 b . this allows the logo blocks 16 a to be easily replaced for seasonal displays or other particularized special occasion . these tool - less installable logo blocks 16 a therefore provide an alternative to the other blocks shown or with solid or welded cast aluminum logo blocks . the modular design of the street graphic cage 20 therefore accepts the aluminum blocks , tool - less clip on mounted and screw attached logo blocks as shown herein . the street graphic cage 20 of the present invention used in conjunction with the post top refractive globe 14 allows for the efficient backlighting of the translucent panels 18 located with the plurality of panel apertures 27 . the street graphic cage 20 may be modular with the post top light source and allows for ready interchangeability of the panels 18 without entry into the post top light fixture . thus , the plurality of panels 18 or logo panels 16 may be readily changed without disassembly of the street cage or entry into the post top light fixture . the foregoing detailed description is given primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom for modifications will become obvious to those skilled in the art upon reading this disclosure and may be made without departing from the spirit of the invention and scope of the appended claims . | 8 |
it has now been found that the above scheme offers several advantages over previous separation techniques , such as ( 1 ) clean , anhydrous hcl is obtained by distillation in step ( a ); ( 2 ) the yield loss of hf associated with the process is limited to that associated with the 32 / hf azeotrope despite never isolating the azeotrope ; ( 3 ) any unreacted hf and 30 , along with intermediate 31 , in the reactor effluent can be recovered for recycle to the reactor at the beginning of the separation train , prior to step ( a ), by distillation , thus avoiding contamination by downstream equipment and allowing materials of construction requirements to be relaxed , and ( 4 ) distillation control of the hcl column in step ( a ) is enhanced by allowing the reboiler to operate on bubble point control . if the reboiler contained an azeotrope , the temperature and compositon of the bottoms would be invariant regardless of the heat supplied to the reboiler , making it difficult to control the heat input to the column . since the hcl column operates under constant pressure , “ bubble point ” as used herein refers to the temperature at which a chemical mixture starts to boil ; it is called a bubble point because the boiling temperature will start to increase immediately as the mixture starts boiling provided it is not azeotropic , so that there is no boiling point in the common sense of the word . the pressure of the hcl column is typically in the 100 psig to 500 psig range . at pressures of 210 psig , the overhead temperature would be about − 19 ° c ., depending on the amount of any minor impurities . the hcl column bottoms is a mixture whose bubble point depends on the amount and composition of the high boiling cofeed and any recycle from step ( c ). the principal determinants for a preferred high boiling cofeed ( or cofeeds ) are that it ( or they ) be significantly less volatile than 32 , chemically inert in the system , thermally stable , and have a low enough boiling point to give a reasonable bubble point at the bottom of the column in step ( c ). a preferred boiling point range for the cofeed ( s ) is − 30 ° c . to + 70 ° c . preferred compounds are chlorocarbons , hydrochlorofluorocarbons or hydrofluorocarbons containing 1 to 4 carbons . particularly preferred is 30 since it is employed as a feedstock in the process . acid wash step ( b ) can employ conventional techniques . for example , the stream from step ( a ) can either be vaporized into a low pressure water absorber / caustic scrubber system or scrubbed by an aqueous base under pressure in a liquid phase mixer / settler system . if scrubbed in a gas phase system , it would first be dried and compressed before feeding a high pressure distillation . if a high pressure liquid system is used , simple drying would suffice before feeding the distillation system . the effluent from the wash system is then fed to the final distillation column of step ( c ), which is normally operated at a pressure similar to that used for the hcl column . | 2 |
the invention is an arrangement of holes and grooves lace attachments that can be combined in over a hundred possible ways . a lace 24 goes through a hole attachment 22 and goes by a groove attachment 23 one or more times . when the lace crosses over a frontal shoe opening 21 for the purpose of closing the shoe , the lace goes from the hole attachment to the groove attachment or vice versa as the case may be . the two ends of the lace are found secured prior to wearing the shoes and can be either : ( b ) one end tied to the shoe upper and the other end attached to an annulus 49 or , in all embodiments , two devices are added to the lace circuit : 1 . one device is a slack reducing means which can be either : ( a ) a slack reducing attachment 54 placed further apart from the edge of the shoe frontal opening . ( b ) a protrusion with transversal horizontal grooves 42 on its surface . 2 . the second device is a hinged fastener of the type shown in fig3 and 3a with a tension lever 20 and a groove 25 or of the type shown in fig1 with a hole 56 to engage the lace . but many other types of tension lever are possible . a typical embodiment is illustrated in fig1 with the shoe open , and fig1 a with the shoe closed . on one side of shoe frontal opening 21 are protrusions with peripheral groove 23 , and tension lever 20 . on the opposite side of the shoe are the protrusions with holes 22 . the lace arrangement with the shoe open and closed is detailed in fig2 and 2a . in these 2 drawings , each end of the lace is secured to the shoe upper with a stopper 27 blocking the lace from entering a single hole attachment 29 . the lace arrangement in fig1 & amp ; la utilizes protrusions with two holes fig4 . this auxiliary improvement pre - disposes the formation of a loop 26 to be wrapped around opposite protrusion with groove 23 . for closing the shoe fig2 a , the lace is held by groove 25 of lever 20 , fig3 & amp ; 3a . once lever 20 is closed , the tighten lace banks against a ridge 32 and , if elected in the construction of the fastener , is maintained against ridge 32 by passing in a gap 34 under a bulge 33 . another embodiment is shown in fig1 and 10a where holes and grooves attachments now alternate in pairs . this time , a loop 28 crosses an opposite one as the lace leaves the hole to go to the groove . one end of the lace is attached by a connecting member 51 to an annulus 49 . the permanent slack in the lace can be adjusted where the lace is tied to member 51 . a tension lever 50 has grooves facing the shoe upon its closing . in this embodiment the tension lever does not need a ridge to hold the tension because of the annulus . in embodiment shown in fig1 and 11a , the hole attachment is a half ring 63 and the lace is tied by a knot 55 to establish a permanent slack . the overlapping loops are between two hole attachments on the same side of the shoe frontal opening . a lace holder 53 maintains the lace as it goes to the back of the shoe . endless loop arrangement 62 is shown in fig1 and 15a . a single hole protrusion 61 above the shoe upper has hole parallel with the edge of the shoe upper . in embodiment shown in fig1 and 17a , the lace is separated in two circuits with two fasteners . this arrangement for high cut shoes permits a different tension level around the ankle . in many embodiments the lace is engaged directly in one of the grooves of the tension lever . to prevent the lace under tension from pushing against the foot and unsnapping the fastener the lace banks against ridge 32 . ridge 32 extends along grooves 25 on both side of lever 20 . this ridge is a substitute for the rigidity of the metallic annulus . the user &# 39 ; s only motions for closing the shoe with the present invention are to grasp the lace as it leaves the hole attachment and position the lace in the grooves . to make this task easier , the hole attachment is designed to constrain the lace into making a loop by coming in and out of a pair of holes 30 above the shoe upper . the protrusion has a recess 38 making it easy to grasp the lace for positioning around the groove . a lace phantom path 40 inside two holes protrusion 22 is shown on fig4 a . exit of lace by a notch 39 can be used to hold the end of the lace . the typical shoe hook is improved in this invention to prevent anything from being caught accidentally and causing injury . in fig5 the lace is held by a shallow peripheral groove 41 with just enough width and depth for the lace . whenever a tension lever with a hole or a twin hole to hold the lace is used , there is a need for a device to regulate the slack in the lace . one of transversal surface groove 42 is used to regulate the slack and change tension in the lace circuit . fig7 is a front view of a rotating lace catcher . gap 34 under rotating bulge 33 extends at a end of hinge movable part 35 . when the lever with the lace engaged in the groove is rotated , the bulge rotates with it and the lace is caught in gap 34 when the fastener closes . with the catcher , - he lace is maintained below the hinge &# 39 ; s fulcrum and adds security against the lever snapping open under foot pressure . in fig8 a stationary bulge 43 extends at a end of the hinge &# 39 ; s stationary part 36 . here , the bulge does not rotate with the lever . when the lever rotates toward its close position , the elasticity in the lace causes it to pass over the bulge and take position in gap 34 . one concern with the tension lever is to have it un - snap under strenuous foot activities such as tennis . several types of locking means can be added to the fastener to prevent the tension lever from opening under tension . fig9 shows a plate 31 supporting lever &# 39 ; s hinge , extending to the length of the lever . on the plate is a number of nearly vertical studs 44 , one stud for each corresponding groove on the lever . at the base of each stud is an under - cut 45 facing the hinge that catches the lace once the lever is closed . in the center of each groove 25 is a curved recess 46 perpendicular to the plane of the lever . upon closure of the lever , stud 44 enters into recess 46 of the corresponding groove . the lace is caught by under - cut 45 of the stud . fig9 a shows a variation of the preceding locking means . an under - cut 47 in stud 44 faces the end of the lever . in the center of each groove is a cavity 48 on the vertical wall of the groove . when the lever is closed , stud 44 takes position inside cavity 48 . the lace is then caught by under - cut 47 . fig1 shows an alternate lever lock being a ring 59 attached to a support 60 on the shoe upper . the ring can be tilted to catch and hold down a raised end of lever 37 . in this version of the tension lever , a twin hole 56 is mounted on a lever 57 and the lace is circuited in the twin holes where it slides freely . the lace goes in the center of the hinge where it passes over rotating bulge 33 to be caught in gap 34 . stud 44 on plate 31 enters into an aperture 58 upon closing of lever 57 and under - cut 47 catches the lace and holds the lever closed . under tension , the lace banks against ridge 32 . lace tensioning with the lever is regulated by a slack reducing attachment 54 as in fig1 . annulus 49 transfers the line of pull by the lace on lever 50 , below the lever &# 39 ; s hinge fulcrum . it prevents lace tension to : connecting member 51 holds the floating annulus and the lace . the lace slides inside member 51 and the lace pressure is distributed on the entire lace . the slack necessary and sufficient to install the lace in the grooves should be less than 2 inches . beyond this , the slack is reduced by other means than the tension lever . changing the slack in the lace can be done with a protrusion having multiple grooves as shown in fig6 ; or slack reducing protrusion with groove 54 installed further away from the edge of shoe frontal opening as in fig1 . in many embodiments , the lace is secured to the shoe upper . one preferred way to immobilize the end of the lace is - o have the lace going in and out of small member 27 that itself cannot go through hole 29 as shown in fig2 . having the lace traversing the hole in member 27 , and after having made a sharp bend come back into the same hole , is sufficient from preventing the lace from slipping inside the hole . notch 39 of protrusion shown in fig4 can be used in the same manner to hold the end to the lace and so can a hole in connecting member 51 shown in fig1 . the common shoelace requirements of flexibility with gripping properties to hold the knots is out of order . the preferred lace for most of the proposed embodiments has a slippery surface to slide easily in the holes and around the grooves . the sliding improves distribution of tension on the entire lace . the lace can now be made : ( 1 ) more resistant , ( 2 ) more durable , ( 3 ) less pliable and subject to fraying ( 4 ) less soft and subject to becoming dirty than the common shoe lace ; by using more synthetic material in the lace composition . a lace less flaccid than ordinary shoe lace will maintain its general position and be easier to position around the grooves and disengaged from same . the usual requirements for the tongue are linked to the space between the edges of the frontal openings . in conventional shoes , this space serves several functions : ( c ) to cushion the foot against lace pressure , pressure which increases with the width of the frontal opening . without holes into the shoe upper , as it is possible with many embodiments of the invention , the tongue can be sewn to one side of the shoe frontal opening . this would resolve the problem of tongue migration under strong foot motions . at rest , the opening of the shoe is completely un - restricted as shown in fig1 and 2 . once the foot is in place the shoe frontal opening is closed fig1 a and 2a . on one side of the shoe frontal opening are holes 22 and on the other side of the opening are grooves 23 . fig2 a shows the ends of the lace secured in attachments 1a and 6a to set the slack in the lace . once the slack is set for the wearer there is no need to change it again . the lace goes in and out of protrusion with two holes in lace attachments 2a , 3a , 4a and 5a . each time , the lace makes loop 26 . once the foot is in place , the shoe is closed ; fig1 a and 2a . the lace is wrapped , possibly with one hand , around protrusions with groove 23 in attachments 2b , 3b , and 4b . loop 26 is wide enough for the finger to grab inside it and carry it around groove 23 . when pulling loop around 3b , the preceding loop is already in place around 2b . the need for slack in the lace remains nearly constant and is sufficient to go around each peripheral groove , one at a time . when the lace is engaged on all the grooves of the protrusions the last loop is engaged in one of the groove of the tension lever . the tension lever in fig3 stands in an open position . upon closing the lever in fig3 a the lace slides down against bulge 33 to take position in gap 34 . fig1 and 10a . in this embodiment , holes 29 and grooves 23 alternate in pairs . crossing loops 28 are disengaged from grooves 23 to open the shoe . each end of the lace is tied to annulus 49 by connecting member 51 . member 51 is also used to regulate the slack in the lace . in this version of the tension lever , the grooves face the shoe upon closure . starting from the middle of the lace between eyelets 1a and 1b , the even attachments are grooves and the odd attachments are holes . one half of the lace goes from 1a to 2b to 3a to 4b to 5a and to the annulus . the second half of the lace goes from 1b to 2a , 3b , 4a , to 5b and to the annulus . embodiment where grooves are on one side of the shoe opening . fig1 and 11a . in this embodiment grooves 23 are on one side of the shoe opening and holes 63 on the other side . this disposition allows for the use of the common shoe lace . in 1b , 1a , 2a , 2b , 3a , 4a , 5a , 6a , 7a are holes and in 3b , 4b , 5b , 6b are grooves . tension lever 57 with hole 56 and ridge 32 as shown in fig1 and 13 is at the heel . the lace goes around part of the ankle increasing the security of the attachment to the foot . the lace makes an overlapping loop 52 as it crosses its path going up and down the shoe frontal opening . permanent knot 55 between 1a and 1b is pre set to the proper slack for the desired tension . afterwards , the lace is placed around the grooves and one snap of the tension lever establishes the final tension . to remove the shoe , the tension lever is opened releasing slack in the lace . the lace is then disengaged from the grooves while held in its general position by the holes . an alternative to having the wearer knot the ends of the lace between 1a and 1b is the looped lace . slack in the looped lace can be manipulated with secondary groove attachment 54 or with attachments having multiple grooves as shown in fig6 . fig1 and 15a . this embodiment is possible with the two previous arrangements . the two ends of the lace are either tied together or secured to the shoe upper . the hole attachments shown here are protrusions above the shoe upper with one hole 61 . lace holders 53 holds the lace around the ankle . the lace makes endless loop 62 . the floating annulus channels the tension created by the lever on the entire lace . many variations of the preceding embodiments are possible . the specifications are the same : 1 . the two ends of the lace are secured as follows : ( b ) one end tied to the shoe upper and the other end tied to a member holding an annulus . ( e ) both ends tied at the factory or an endless loop . 2 . the lace is engaged alternatively into the hole attachment and on the groove attachment and when the lace crosses over the shoe frontal opening , the lace goes from the groove to the hole or vice versa as the case may be . 3 . the tension in the lace is established by a fastener . accordingly , the reader will see that the lace arrangement with fastener of this invention can be used effectively to replace the ordinary lace for all kinds of shoes . the inserting of the foot in the shoe and its removal have been made simple . the opening and closing of the shoe that are separate and distinct operations have also been made simple . comfort , adaptability , versatility , safety , reliability and durability are qualities apparently inherent with the invention . these qualities generally have an enormous market appeal . the appearance of the shoe is bound to be enhanced by these improvements . although the preceding description contains many specificities , these should not be construed as limiting the scope of the invention but are only intended to show the versatility of the invention and the many ways the described elements can be fabricated and combined in hundreds of ways to satisfy different requirements . for example , a shoe for soccer may require a continuous strip of material for the holes and grooves attachment , on each edge of the shoe frontal opening , with no space between each attachment . the tension lever in the back of the shoe may have to be encased in plastic rubber . the descriptions only disclose some of the possibilities of the invention but the scope of the invention is to be determined by the claims and their legal equivalents rather than by the examples given . | 0 |
the present invention will be described in detail in conjunction with what is presently considered as preferred or typical embodiments thereof by reference to the drawings . in the following description , like reference characters designate like or corresponding parts throughout the several views . now , referring to a functional block diagram of fig1 and a flow chart of fig2 the valve timing control system for an internal combustion engine according to a first embodiment of the present invention will be described in detail . the basic structures and operations of the variable valve timing mechanism ( vvt ) as well as peripheral equipment associated therewith are essentially same as those described hereinbefore by reference to fig1 to 28 . accordingly , repeated description thereof will be unnecessary . fig1 is a functional block diagram for illustrating conceptually and functionally operation programs executed by an electronic control unit ( also referred to as the ecu ) 100a incorporated in the valve timing control system according to the first embodiment of the invention . to say in another way , fig1 shows various functional modules which can be realized in the form of operation programs executed by a microcomputer of the electronic control unit ( ecu ) 100a which constitutes a major part of the valve timing control system according to the invention . at this juncture , it should be added that the hardware structure including the variable valve timing mechanism to which the teachings of the invention incarnated in the instant embodiment can be applied is essentially same as or similar to that shown in fig1 , and the former differs from the latter in that some of the operation program modules executed by the microcomputer incorporated in the ecu 100a are changed or modified . in fig1 parts or components like as or equivalent to those mentioned hereinbefore are designated by like reference characters and repeated description thereof will be omitted . referring to fig1 the ecu 100a is comprised of an engine operation state detecting means 201 , a desired valve timing arithmetic means 202 , an actual valve timing detecting means 203 , an actual valve timing control means 204 and a learning means 206 , for thereby controlling a current i flowing through the linear solenoid ( hereinafter also referred to as the linear solenoid current i ) of the oil control valve ( ocv ) 80 which is designed for driving the variable valve timing mechanism 40 , as described hereinbefore in conjunction with the conventional technique . the engine operation state detecting means 201 serves to detect the operation state d of the engine on the basis of output signals of the various types of sensors , while the desired valve timing arithmetic means 202 serves to arithmetically determine a desired valve timing to for at least one of the intake valve 17 and the exhaust valve 18 in dependence on the engine operation state d as detected . on the other hand , the actual valve timing detecting means 203 is so designed as to detect an actual valve timing ta for at least one of the intake valve 17 and the exhaust valve 18 , while the actual valve timing control means 204 is designed to generate a control quantity ( the linear solenoid current i defined hereinbefore ) for the variable valve timing mechanism 40 so that a timing deviation of the actual valve timing ta from the desired valve timing to ( i . e ., difference between the actual valve timing ta and the desired valve timing to ) becomes zero . more specifically , the actual valve timing control means 204 is so designed as to arithmetically determine the control quantity ( linear solenoid current i ) while correcting the control quantity i with a learned value lrn used as a maximum retard reference value . the variable valve timing mechanism 40 is driven by the oil control valve 80 to alter the open / close timing for at least one of the intake valve 17 and the exhaust valve 18 , as described before . further , the leaning means 206 is designed to acquire or fetch the actual valve timing ta in the course of operation of the engine 1 to thereby determine the most retarded valve timing value on the basis of the fetched actual valve timing ta to be reflected in the learned value lrn required for the arithmetic determination of the actual valve timing ta . more specifically , the learning means 206 is so designed that whenever the actual valve timing ta as detected in the engine operation range inclusive of the idle operation state is retarded more than the learned value lrn , the detected value of the actual valve timing ta is immediately reflected in the learned value . next , referring to fig2 description will be directed to the learning operation or procedure executed in the valve timing control system according to the first embodiment of the present invention . the program corresponding to the flow chart illustrated in fig2 is executed by the cpu 102 incorporated in the microcomputer 101 ( see fig2 ) periodically at a predetermined interval , e . g . every 25 msec . at first , in a step sl shown in fig2 the engine operation state signals such as the crank angle signal period t , the engine rotation number ne , the phase difference time δt , the intake air quantity q , the throttle opening degree e , the cooling water temperature w , etc . which are derived from the output signals of the various sensors are fetched by the cpu 102 . in succession , in a step s2 , a provisional maximum retard valve timing td1 ( corresponding to the detected value of the actual valve timing ta ) is arithmetically determined as the currently most retarded valve timing td in accordance with the expression ( 1 ) mentioned hereinbefore . further , in a step s3 , the most retarded valve timing td ( i - 1 ) learned in the preceding program cycle ( hereinafter referred to as the preceding most retarded valve timing ) is read out as a preceding learned value lrn . next , in a step s4 , the provisional most retarded valve timing td1 ( hereinafter also referred to as the currently detected value or simply as the detected value ) is compared with the preceding most retarded valve timing td ( i - 1 ) for thereby deciding whether or not the relation or condition that td1 & lt ; td ( i - 1 ) is satisfied , i . e ., whether or not the currently detected value td1 is more retarded than the preceding most retarded valve timing td ( i - 1 ). when the currently detected value td1 indicates greater retard than that indicated by the preceding most retarded valve timing td ( i - 1 ) in the step s4 ( i . e ., when the decision step s4 results in affirmation &# 34 ; yes &# 34 ;), the processing proceeds to a step s5 . by contrast , when it is decided in the step s4 that the detected value td1 indicates retard smaller than or equal to the preceding most retarded valve timing td ( i - 1 ) ( i . e ., when the decision step s4 results in negation &# 34 ; no &# 34 ;), the processing proceeds to a step s6 . in the step s5 , the detected value td1 is stored as the current most retarded valve timing td , whereon the processing proceeds to a step s7 . on the other hand , in the step s6 , the preceding most retarded valve timing td ( i - 1 ) is intactly held as the currently most retarded valve timing td , whereon the processing proceeds to the step s7 . in the step s7 , the actual valve timing ta is arithmetically determined in accordance with the expression ( 2 ) mentioned hereinbefore . subsequently , in a step s8 , a target or desired valve timing to is arithmetically determined on the basis of the quantities indicated by the engine operation state signals , i . e ., the engine rotation number ( rpm ) ne , the intake air flow q , the throttle opening degree θ and the cooling water temperature w . finally , in the step s9 , the cpu arithmetically determines such linear solenoid current i that the actual valve timing ta ( i . e ., the arithmetically determined value in the step s7 ) can converge to the target or desired valve timing to ( i . e ., the value arithmetically determined in the step s8 ), to thereby output a duty signal corresponding to the current control quantity i to the linear solenoid of the oil control valve 80 , whereupon the processing routine illustrated in fig2 comes to an end ( return ). in general , the learned value which is used as the reference value for the intended control is updated under various conditions with a view to preventing erroneous or incorrect learning . in this conjunction , it should be noted that since the most retarded valve timing td of the variable valve timing mechanism 40 is always influential during the valve timing control , the timing td should desirably be corrected as speedily as possible in conformance with the detected value of the actual valve timing ta . according to the teachings of the invention incarnated in the first embodiment , the most retarded valve timing td ( learned value lrn ) can always be set to the optimum value in the course of operation of the engine 1 , as described above . thus , the optimum value can be resumed immediately even when the most retarded valve timing td is learned erroneously , whereby the quality of the engine exhaust gas can be protected against degradation . in the case of the valve timing control system according to the first embodiment of the invention , the learned value lrn is updated unconditionally when the detected value of the actual valve timing ta is retarded more than the precedently learned value . however , such arrangement may be adopted that the detected value of the actual valve timing ta is reflected in the learned value lrn when the detected value of the actual valve timing ta indicates retard which exceeds that indicated by the precedently learned value by a predetermined value . in the following , referring to a flow chart of fig3 description will be made of the valve timing control system according to a second embodiment of the present invention in which the detected value of the actual valve timing ta is reflected in the learned value lrn only when the detected value of the actual valve timing ta indicates retard greater than that indicated by the precedently learned value by a predetermined value . incidentally , the functional arrangement of the ecu 100a according to the instant embodiment of the invention is substantially same as that shown in fig1 . further , the steps s1 to s3 and steps s5 to s9 shown in fig3 are similar to those described hereinbefore by reference to fig2 . besides , the step s41 shown in fig3 corresponds to the step s4 described previously . now referring to fig3 after the detected value td1 and the preceding most retarded valve timing td ( i - 1 ) have been arithmetically determined in the steps s2 and s3 , respectively , the detected value td1 is compared with the preceding most retarded valve timing td ( i - 1 ) in the step s41 . in other words , by taking into consideration a predetermined value th used as a reference value for comparison , it is decided in the step s41 whether or not a condition that td1 & lt ; td ( i - 1 )- th is satisfied , i . e ., whether the currently detected value td1 indicates retard greater than the preceding most retarded valve timing td ( i - 1 ) by the predetermined value th . in this conjunction , the predetermined value th may be set so as to be equivalent to the crank angle of approximately approximately 2 ° in consideration of elongation ( expansion )/ contraction of the timing belt 23 ( see fig1 ) and other factors . when it is decided in the step s41 that td1 & lt ; td ( i - 1 )- th , i . e ., when the decision step s41 results in affirmation &# 34 ; yes &# 34 ;, the processing proceeds to the step s5 . by contrast , when it is decided that td1 ≧ td ( i - 1 )- th , i . e ., when the decision step s41 results in negation &# 34 ; no &# 34 ;, the processing proceeds to the step s6 . in this way , the most retarded valve timing td can be set with high reliability without being affected by the influence of elongation / contraction of the timing belt 23 . thereafter , the actual valve timing control means 204 arithmetically determines the control quantity i through the processing steps s7 , s8 and s9 , as described hereinbefore to thereby output the corresponding control signal to the oil control valve 80 . in the case of the valve timing control system according to the first and second embodiments of the invention , the currently detected value of the actual valve timing ta is reflected straightforwardly in the learned value lrn . however , such arrangement can be adopted that a value obtained by multiplying the currently detected value by a predetermined ratio is reflected in the learned value lrn . in this conjunction , the predetermined ratio will hereinafter be also referred to as the reflection ratio only for convenience of the description . parenthetically , the value of the reflection ratio should not be greater than &# 34 ; 1 &# 34 ; ( one ) ( i . e ., should be ≦ 1 ). now , referring to a flow chart of fig4 description will be directed to the valve timing control system according to a third embodiment of the invention in which the detected value corrected by the predetermined reflection ratio is reflected in the learned value lrn . in fig4 the steps s1 to s3 , s41 and steps s6 to s9 are similar to those described previously by reference to fig3 . further , a step s51 shown in fig4 corresponds to the step s5 described hereinbefore . it should be noted that the step s4 shown in fig2 is replaced by a step s41 shown in fig4 . referring to fig4 when it is decided in the step s41 ( or step s4 ) that the detected value td1 indicates retard greater than the learned value lrn , i . e ., when the decision step s41 results in affirmation &# 34 ; yes &# 34 ;, the processing proceeds to a step s51 . in the step s51 , the learning means 206 multiplies the detected value td1 ( i . e ., the detected value of the actual valve timing ta ) by a predetermined reflection ratio kt ( i . e ., reflection ratio or coefficient of a fixed value in this case ), to thereby update correspondingly the learned value lrn , whereon the most retarded valve timing td is determined arithmetically in accordance with the following expression ( 3 ): in the above expression , it is assumed that the reflection ratio kt for the detected value td1 of the most retarded valve timing td is set to a fixed value which is not greater than &# 34 ; 1 &# 34 ; ( one ), by way of example . by multiplying the detected value td1 by the reflection ratio kt to thereby reflect the result of the multiplication in the most retarded valve timing td , as described above , influence of noise components or the like superposed on the currently detected value can be suppressed , to an advantage . in the valve timing control system according to the third embodiment of the invention , the reflection ratio kt is set to the fixed value . however , the reflection ratio kt can be set variably in dependence on the engine speed or engine rotation number ( rpm ) ne . a fourth embodiment of the invention is directed to the valve timing control system in which the reflection ratio kt is set variably in dependence on the engine rotation number ( rpm ) ne . fig5 is a view for illustrating graphically in what manner the reflection ratio kt set variably is changed as a function of the engine rotation number in the system according to the fourth embodiment of the invention . referring to fig5 the reflection ratio kt is set to a maximum value (= 1 ( one )) so long as the engine rotation number ne falls within an intermediate - speed range rn , while the value of the reflection ratio kt is decreased in the other engine speed ( rpm ) ranges . in that case , the intermediate - speed range rn of the engine rotation number ne should preferably be set to a range of 1500 to 3000 rpm . as deviation of the engine speed from the intermediate - speed range rn increases , the reflection ratio kt is regulated to assume a smaller value . ordinarily , variation of the engine rotation number ne is more remarkable in the lower engine - rotation speed ranges than the intermediate - speed range rn . accordingly , the reflection ratio kt should be set to a smaller value in the lower speed range in order to evade effectively the influence of variation of the engine speed or engine rotation number ne . on the other hand , in a higher - rotation speed range where the engine rotation number ne is not smaller than that in the intermediate - speed range rn , elongation of the timing belt 23 will become significant . accordingly , the reflection ratio kt should be set to a small value for suppressing the influence of elongation of the timing belt 23 . in this manner , by setting variably the reflection ratio kt to a value which depends on the engine rotation number ne , as illustrated characteristically in fig5 the most retarded valve timing td can be set optimally with high reliability without being affected by the influences of variation of the engine rotation number and elongation of the timing belt 23 . at this juncture , it should be mentioned that the characteristic relation between the reflection ratio kt and the engine rotation number ne such as illustrated in fig5 can be easily stored in a memory in the form of a map data table with the engine rotation number ne being used as index . in that case , determination of the reflection ratio kt can be much facilitated . further , it should be added that although the - maximum value of the reflection ratio kt in the intermediate - speed range rn is set to &# 34 ; 1 &# 34 ; ( one ), it may be set to any given value , e . g . &# 34 ; 0 . 8 &# 34 ; provided that it remains smaller than one . in the valve timing control system according to the fourth embodiment of the invention , the engine rotation number ne is used as the parameter for setting the reflection ratio kt variably . however , such arrangement can also be adopted that the reflection ratio kt is set variably in dependence on a number of times the most retarded valve timing td ( i . e ., the learned value lrn ) has been updated . hereinafter , this parameter will also be referred to simply as the update frequency record cltd only for convenience of the description . now , referring to fig6 and 7 , description will be made of the valve timing control system according to a fifth embodiment of the present invention in which the reflection ratio kt is set variably in dependence on the update frequency record cltd defined above . incidentally , fig6 is a flow chart for illustrating the processing procedure according to the instant embodiment of the invention , and fig7 is a view for graphically illustrating a characteristic relation between the reflection ratio kt and the update frequency record cltd of the most retarded valve timing td ( learned value lrn ). according to the instant embodiment of the invention , the leaning means 206 is so designed as to set the reflection ratio kt to a smaller value as the update frequency record cltd of the learned value lrn increases , as can be seen in fig7 . at this juncture , it should be added that a maximum value kt1 ( i . e ., an initial value ) of the reflection ratio kt should preferably be set to ca . &# 34 ; 0 . 8 &# 34 ;. in fig6 the steps s1 to s3 , s41 , s51 and steps s6 to s9 are similar to those described previously by reference to fig4 . the instant embodiment differs from the third embodiment described hereinbefore by reference to fig4 in that steps s10 and s11 are additionally provided in succession to the step s51 and that the step s4 shown in fig2 is replaced by the step s41 . referring to fig6 when the learning means 206 updates the most retarded valve timing td in the step s51 , the processing proceeds to the step s10 where a value of an update counter , i . e ., the update frequency record cltd , is incremented by one . in succession , in the step s11 , the learning means 206 determines arithmetically the reflection ratio kt in consideration of the update frequency record cltd in accordance with the following expression ( 4 ): as can be seen from the above expression ( 4 ), the reflection ratio kt is set to a maximum value kt1 ( e . g . &# 34 ; 0 . 8 &# 34 ;) in the initial state ( cltd = 0 ) and decreased gradually as the update frequency record cltd increases or increments , as illustrated in fig7 . furthermore , as can be seen from the expression ( 4 ), when the update frequency record cltd is incremented one thousand times or more , the reflection ratio kt is set to &# 34 ; 0 &# 34 ; ( zero ) because then 1000 - cltd = 0 . parenthetically , relations between the reflection ratio kt given by the expression ( 4 ) and the update frequency record cltd as illustrated in fig7 can be stored in a memory in the form of a map data table with the update frequency record cltd being used as the index , for thereby facilitating the arithmetic operation as involved . by decreasing the reflection ratio kt as the update frequency record cltd of the learned value lrn increases in this manner , it is possible to reduce the reflection ratio kt as the learning process proceeds , to thereby mitigate progressively the influence of the learned value to the valve open / close timing control . in general , the state in which the learned value lrn is updated successively is an unstable state in which the reference for the control is susceptible to variation , which in turn means an unfavorable engine operation state for the valve open / close timing control . accordingly , when the update frequency record cltd ( i . e ., the number of times the learned value lrn has been updated ) increases , the reflection ratio kt should preferably be decreased , to thereby avoid the influence of unstable engine operation state . in the valve timing control system according to the fifth embodiment of the invention , the reflection ratio kt is set to &# 34 ; 0 &# 34 ; ( zero ) when the update frequency record cltd reaches the upper limit frequency records ( e . g . one thousand of times ). however , such arrangement can also be adopted that the update frequency record cltd is clipped when it has reached a predetermined update frequency value ( e . g . nine hundreds of times ) and the reflection ratio kt is fixed to a constant value ( e . g . 0 . 1 × kt1 ) after the update frequency record cltd has reached the predetermined value . a sixth embodiment of the invention is directed to the arrangement mentioned above . thus , according to the instant embodiment of the invention , the detected value td1 can be reflected in the most retarded valve timing td at the reflection ratio kt which is constantly greater than &# 34 ; 0 &# 34 ; ( zero ). needless to say , the upper limit value of the update frequency record cltd is not limited to any specific value such as &# 34 ; one thousand of times &# 34 ; mentioned above but can be set to a given update frequency value such as ten times or so . besides , the update frequency record cltd may be stored as the so - called backup data in a memory so that the update frequency record cltd can be held in the memory even after turn - off of the key switch employed for starting the engine , so that automatic initialization can be realized upon succeeding start of the engine . in the valve timing control system according to the sixth embodiment of the invention , the update frequency record cltd is determined simply by counting . however , such arrangement may equally be adopted that the update frequency value cltd is determined or effectuated only when the update processing is performed successively or consecutively . referring to a flow chart illustrated in fig8 description will be made of a valve timing control system according to a seventh embodiment of the present invention in which the update frequency value cltd is incremented when the update processing is performed successively . in the flow chart shown in fig8 the steps s1 to s3 , s41 , s51 and the steps s6 to s11 are similar to those described previously by reference to fig6 . the instant embodiment differs from the fifth embodiment described previously in that a step s61 is provided additionally to the step s6 . further , it should be added that the step s4 shown in fig2 is replaced by a step s41 shown in fig8 . referring to fig8 when the result of comparison between the detected value td1 and the preceding most retarded valve timing td ( i - 1 ) does not satisfy the retard condition in the step s41 , i . e ., when the decision step s41 results in negation &# 34 ; no &# 34 ;, the processing executed by the learning means 206 proceeds to the step s61 in succession to the step s6 in which the update frequency record cltd is reset to zero , whereon the processing proceeds to the step s7 . in this way , the update frequency record cltd is immediately cleared to zero when the learned value lrn is not updated consecutively . in other words , the update frequency record cltd is incremented by counting or validated only when the update processing is executed consecutively . thus , even when the reflection ratio kt is being decreased through the update processing of the learned value lrn , the reflection ratio kt can be resumed to the maximum value ( the initial value ) kt1 upon every occurrence of the state in which the reflection ratio kt is not updated . in this manner , decreasing of the learned value lrn in excess can be evaded effectively . in the case of the valve timing control system described hereinbefore in conjunction with the second embodiment of the invention , the detected value of the valve timing ta is compared with the precedently learned value while taking into consideration the predetermined value th in the step s41 in order to suppress the influence of elongation / contraction of the timing belt 23 . however , such arrangement may also be adopted that the detected value of the actual valve timing ta is reflected in the learned value lrn when the state in which the detected value indicates retard greater than that indicated by the precedently learned value has continued for a predetermined period . referring to a flow chart illustrated in fig9 description will be made of the valve timing control system according to an eighth embodiment of the present invention which is so designed that the detected value is reflected in the learned value lrn only when the retard state mentioned above has continued for a - predetermined period . in fig9 steps s1 to s9 are similar to those mentioned hereinbefore by reference to fig2 . the instant embodiment differs from the second embodiment described previously in that steps s12 to s14 are additionally provided in succession to the step s4 shown in fig2 . in the valve timing control system according to the eighth embodiment , it is decided in the step s4 shown in fig9 whether td1 & lt ; td ( i - 1 ). when the decision step s4 results in affirmation &# 34 ; yes &# 34 ;, the processing proceeds to the step s12 before executing the step s5 of updating the most retarded valve timing td . in the step s12 , decision is made whether or not a value ctw of an update wait timer constituted by a down - counter ( which value indicates lapse of a predetermined time period tw ) is &# 34 ; 0 &# 34 ; ( zero ) or greater than zero . when it is decided that the value ctw ( indicating lapse of the predetermined time period tw ) is equal to zero ( i . e ., when the decision step s12 results in &# 34 ; yes &# 34 ;), the processing proceeds to the step s5 and then the most retarded valve timing td is updated . on the other hand , when it is decided in the step s12 that the value ctw is greater than zero ( ctw & gt ; 0 ), the processing proceeds to the step s13 , and the update wait timer value ctw is decremented . then , the processing proceeds to the step s6 for holding the current most retarded valve timing td . in this way , so long as the update wait timer value ctw remains continuously greater than &# 34 ; 0 &# 34 ; as of the first decision of the retard state in the step s4 , the processing does not proceed to the step s5 but the most retarded valve timing td is held in the step s6 . on the contrary , when it is decided in the step s4 that the detected value td1 indicates retard equal to or greater than the preceding most retarded valve timing td ( i - 1 )( i . e ., when the decision step s4 results in &# 34 ; no &# 34 ;), the processing proceeds to a step s14 before executing the processing in the step s6 , and a predetermined time period ( wait time ) tw is set as the update wait timer value ctw . in general , the response characteristic of the intake valve 17 as well as that of the exhaust valve 18 is such that about 100 msec is taken for the valves 17 and 18 to respond in reality to a change of the desired valve timing to ( see fig1 ). accordingly , the predetermined time period tw mentioned above should preferably be set to a time period which is equivalent to ca . 100 msec . in terms of the crank angle . the number of times the phase difference between the crank angle signal sgt and the cam angle signal sgc has been measured can be determined by counting the number of times of the crank angle period is detected , whereby lapse of the predetermined time period tw can be discriminatively decided as well . thus , detection error ascribable to elongation / contraction of the timing belt 23 and variation of the engine rotation number can be eliminated , whereby the most retarded valve timing td can be essentially set with higher reliability when compared with the case where the updating of the learned value lrn is executed immediately upon decision that the detected value td1 indicates the retard state . in the valve timing control system according to the eighth embodiment of the invention , the detected value is compared with the precedently learned value without taking into consideration the predetermined value th in the step s4 of deciding the retard indicated by the detected value td1 . however , such arrangement can also be adopted in which the retard state indicated by the detected value is decided by taking into account the predetermined value th mentioned hereinbefore . fig1 is a flow chart for illustrating learning operation or procedure according to a ninth embodiment of the present invention which is designed for deciding the retard state indicated by the detected value by taking into consideration the predetermined value th . the instant embodiment differs from the eighth embodiment ( fig9 ) described above in respect to the step s41 . in the valve timing control system according to the ninth embodiment , the processing proceeds to a step s12 when decision is made in the step s41 shown in fig1 that the retard indicated by the detected value td1 is smaller than that of the preceding most retarded valve timing td ( i - 1 ) minus the predetermined value th or td1 & lt ; td ( i - 1 )- th ( i . e ., when the decision step s41 results in affirmation &# 34 ; yes &# 34 ;). on the other hand , when it is decided in the step s41 that the detected value td1 is not smaller than the preceding most retarded valve timing td ( i - 1 ) minus the predetermined value th or td1 ≧ td ( i - 1 )- th ( i . e ., when the decision step s41 results in negation &# 34 ; no &# 34 ;), the processing proceeds to the step s13 where the processing procedure described previously is executed . as the result of this , the retard state indicated by the detected value td1 can be decided by taking into consideration the retard quantity given by the predetermined value th ( crank angle of ca . two degrees ) while the update processing of the most retard valve timing td is executed after the retard state indicated by the detected value td1 has been continued for the predetermined time period tw . in this manner , according to the teachings of the invention incarnated in the ninth embodiment thereof , only when the state in which the retard indicated by the detected value td1 is not smaller than the predetermined value th has continued for the predetermined time period tw , the detected value td1 is reflected in the leaned value . thus , the detection errors due to the elongation / contraction of the timing belt 23 and variation of the engine rotation number ( rpm ) can further be suppressed , whereby the most retarded valve timing td can be set with higher reliability . in the valve timing control system according to the ninth embodiment of the invention , the most retarded valve timing td is updated without considering the reflection ratio kt in the step s5 of updating the learned value . however , such arrangement can equally be adopted in which the learned value is updated by taking into account the reflection ratio kt mentioned hereinbefore in conjunction with the third embodiment of the invention . fig1 is a flow chart for illustrating learning operation of the valve timing control system according to a tenth embodiment of the present invention which is designed for updating the learned value by taking into account the reflection ratio kt . the instant embodiment differs from the ninth embodiment ( fig1 ) described above in respect to a step s51 . parenthetically , the step s41 shown in fig1 can be replaced by the step s4 shown in fig9 . in the valve timing control system according to the tenth embodiment , the processing proceeds to the step s51 when it is decided in a step s12 shown in fig1 that the update wait timer value ctw is equal to &# 34 ; 0 &# 34 ; ( zero ) ( i . e ., when the decision step s12 results in &# 34 ; yes &# 34 ;). in the step s51 , the learning means 206 determines arithmetically the most retarded valve timing td by using the reflection ratio kt ( kt ≦ 1 ) in accordance with the expression ( 3 ) mentioned hereinbefore . thus , the detection errors ascribable to the variation of the engine rotation number ( rpm ) can be suppressed more effectively , whereby the most retarded valve timing td can be set with higher reliability . in the valve timing control system according to the tenth embodiment of the invention , it is presumed that the reflection ratio kt is a fixed value . however , the reflection ratio kt may be set variably in consideration of the update frequency record cltd defined previously ( in conjunction with the fifth embodiment of the invention ). fig1 is a flow chart for illustrating learning operation according to an eleventh embodiment of the present invention , in which the reflection ratio kt is set variably by taking into account the update frequency record cltd . as can be seen in fig1 , the instant embodiment differs from the tenth embodiment described above by reference to fig1 only in that steps s10 and s11 are additionally provided in succession to the step s51 . further , it should be added that the step s41 shown in fig1 may be replaced by the step s4 shown in fig9 . referring to fig1 , whenever the learning means 206 updates the learned value in the step s51 , the processing proceeds to the step s10 where the update frequency record ( the number of times the learned value has been updated ) cltd is determined . subsequently , the reflection ratio kt is set variably in the step s11 . at this juncture , it should be noted that the maximum value kt1 of the reflection ratio kt is set to ca . &# 34 ; 0 . 8 &# 34 ; and that the reflection ratio kt is decremented to a smaller value as the update frequency record cltd of the learned value lrn increases , as described hereinbefore ( refer to fig7 ). in this way , when updating of the learned value is executed at high frequency , the reflection ratio kt is decreased . thus , the detection errors due to variation of the engine rotation number and the like can be eliminated more positively , which enables the most retarded valve timing td to be set with high reliability . in the valve timing control system according to the eleventh embodiment of the invention , dispersion of the detected value td1 is not considered . however , such arrangement is equally conceivable in which the reflection ratio kt is set variably by taking into account the dispersion of the detected value td1 . fig1 is a flow chart for illustrating learning operation in the system according to a twelfth embodiment of the present invention , in which the reflection ratio kt is set variably in dependence on dispersion of the detected value td1 . referring to fig1 , the instant embodiment differs from the tenth embodiment described previously by reference to fig1 only in the respect that steps s15 to s21 are additionally provided in succession to the step s41 and the steps s12 , s13 and s14 . parenthetically , the step s41 shown in fig1 may be replaced by the step s4 shown in fig9 . the learning means 206 is so designed as to set variably the reflection ratio kt in dependence on the dispersion of the actual valve timing ta in the predetermined time period tw such that the reflection ratio kt is set to a smaller value as the dispersion increases . in the following description , it is assumed , by way of example , that a maximum ratio ( tdmin / tdmax ) of a lower limit value tdmin of the detected value td1 to an upper limit value tdmax thereof is used as a parameter indicating the dispersion of the detected value td1 . at first , it is decided in the step s12 shown in fig1 whether or not the update wait timer value ctw is equal to zero ( ctw = 0 ). when the decision step s12 results in affirmation &# 34 ; yes &# 34 ;, the processing proceeds to the step s15 before executing the learned value update processing step s51 . in the step s15 , the reflection ratio kt is set on the basis of the maximum value kt1 of the reflection ratio kt and the maximum ratio (= tdmin / tdmax ) of the detected value td1 in accordance with the following expression ( 5 ): as is apparent from the above expression , the reflection ratio kt is set to a smaller value as the dispersion in the predetermined time period tw which is indicated by the maximum ratio tdmin / tdmax increases , whereby reflection of the detected value td1 in the learned value lrn can be suppressed or restricted when dispersion of the detected value td1 is remarkable , indicating that reliability of the detected value td1 is low . on the other hand , when it is decided in the step s12 that the predetermined time period tw during which the detected value td1 continues to indicate the retard state and that the update wait timer value ctw is greater than zero ( ctw & gt ; 0 ) ( i . e ., when the decision step s12 results in negation &# 34 ; no &# 34 ;), the learning means 206 decrements the update wait timer value ctw in the step s13 . thereafter , the processing proceeds to the step s16 where decision is made whether or not the detected value td1 retards beyond the lower limit value tdmin ( i . e ., whether or not td1 & lt ; tdmin ). when the detected value td1 does not indicate the retard state and when the update wait timer value ctw is reset to the predetermined time period tw in the step s14 , the learning means 206 executes the steps s17 and s18 in precedence to the step s6 of holding the learned value . in other words , the preceding most retarded valve timing td ( i - 1 ) is set as the lower limit value tdmin in the step s17 , and the upper limit value tdmax is cleared to &# 34 ; 0 &# 34 ; ( zero ) in the step s18 , whereon the processing proceeds to the step s6 . when it is decided in the step s16 that td1 & lt ; tdmin , i . e ., when the decision step s16 results in &# 34 ; yes &# 34 ;, the detected value td1 is updated for registration as the lower limit value tdmin in the step s19 , whereon the processing proceeds to the step s20 . the lower limit value tdmin updated in the step s19 is used for the arithmetic determination of the reflection ratio kt in accordance with the expression ( 5 ) in the step s15 after lapse of the predetermined time period tw . further , when it is decided in the step s16 that td1 ≧ tdmin , i . e ., when decision step s16 results in &# 34 ; no &# 34 ;, the processing proceeds to the step s20 without executing the step s19 . in the step s20 , decision is made whether or not the detected value td1 indicates retard which is short of the upper limit value tdmax ( i . e ., td1 & gt ; tdmax ), representing that the detected timing advances when compared with the upper limit value tdmax . when it is decided in the step s20 that td1 & gt ; tdmax , i . e ., when decision step s20 results in &# 34 ; yes &# 34 ;, the detected value td1 is updated for registration as the upper limit value tdmax in the step s21 , whereon the processing proceeds to the step s6 . on the contrary , when it is decided in the step s20 that td1 ≦ tdmax , i . e ., when decision step s20 results in &# 34 ; no &# 34 ;, the processing proceeds straightforwardly to the step s6 . in this conjunction , it is to be noted that since the upper limit value tdmax is initially cleared to &# 34 ; 0 &# 34 ; ( zero ) in the step s18 , the processing proceeds first to the step s21 without fail , where the upper limit value is updated over the predetermined time period tw . the upper limit value tdmax updated in the step s21 is used for the arithmetic operation for setting the reflection ratio kt in accordance with the expression ( 5 ) in the step s15 after lapse of the predetermined time period tw . as will now be appreciated , the reflection ratio kt is set to the maximum value kt1 ( e . g . &# 34 ; 0 . 8 &# 34 ;) when the dispersion of the detected value td1 is practically zero , while the reflection ratio kt is reduced as the dispersion of the detected value td1 increases . thus , when the dispersion of the detected value td1 varies remarkably to such extent that high reliability can not be ensured , reflection of the detected value td1 in the learned value lrn can be suppressed , whereby the detection errors due to variation of the engine rotation number is excluded without fail , and at the same time the most retarded valve timing td ensuring high reliability can be set . in the valve timing control system according to the twelfth embodiment of the invention , the maximum ratio (= tdmin / tdmax ) is used as the parameter indicating the dispersion of the detected value td1 . however , a maximum difference or deviation (= tdmax - tdmin ) of the detected value td1 may be used , substantially to the same effect . besides , although the reflection ratio kt is set variably by resorting to the arithmetic operation in accordance with the expression ( 5 ), values of the reflection ratio kt corresponding to those of the dispersion may be determined previously and the relations therebetween may be stored in the memory in the form of a map data table with the values of dispersion being used as the index . in the valve timing control system according to the twelfth embodiment of the invention , the reflection ratio kt is set variably in dependence on the dispersion of the detected value td1 in the predetermined time period tw . however , such arrangement can also be adopted in which the reflection ratio kt is set variably in dependence on the timing deviation or difference between the detected value td1 and the learned value lrn ( i . e ., the preceding most retarded valve timing td ( i - 1 )) in the predetermined time period tw . fig1 is a flow chart for illustrating learning operation according to a fourteenth embodiment of the present invention , in which the reflection ratio kt is set variably in dependence on the above - mentioned difference or deviation of timing ( hereinafter referred to as the timing deviation ). as can be seen from fig1 , the instant embodiment differs from the twelfth embodiment described previously by reference to fig1 only in the respect that the step s15 is replaced by a step s25 and that the steps s18 , s20 and s21 are omitted . parenthetically , the step s41 shown in fig1 may be replaced by the step s4 shown in fig9 . according to the teachings of the invention incarnated in the instant embodiment , the learning means 206 is so designed or programmed as to set variably the reflection ratio kt in dependence on the timing deviation or difference between the actual valve timing ta and the learned value lrn in the predetermined time period tw so that the reflection ratio kt assumes a smaller value as the magnitude of the timing deviation increases . in the description which follows , it is presumed , by way of example , that a timing ratio (= tdmin / td ( i - 1 )) of the lower limit value tdmin of the detected value td1 to the preceding most retarded valve timing td ( i - 1 ) is employed as a parameter indicating the timing deviation . at first , when it is decided in the step s12 shown in fig1 that the update wait timer value ctw is equal to zero ( i . e ., when the decision step s12 results in &# 34 ; yes &# 34 ;), the processing executed by the learning means 206 proceeds to the step s25 in precedence to the leaned value updating step s51 to thereby set variably the reflection ratio kt on the basis of the maximum value kt1 of the reflection ratio kt and the timing ratio ( tdmin / td ( i - 1 )) in accordance with the following expression ( 6 ): in this manner , the reflection ratio kt is set to a smaller value as the timing deviation ( the timing ratio ) in the predetermined time period or interval tw increases , whereby reflection of the detected value td1 in the learned value lrn is suppressed when the timing deviation is large , indicating that reliability is rather poor . on the other hand , when it is decided in the step s12 that the update wait timer value ctw is greater than zero ( ctw & gt ; 0 ) ( i . e ., when the decision step s12 results in &# 34 ; no &# 34 ;), the learning means 206 executes the processings of the steps s13 , s16 and s19 mentioned previously , whereon the step s6 of holding the learned value is executed . further , when it is decided in the step s41 that td1 ≧ td ( i - 1 )- th ( i . e ., when the decision step s41 results in negation &# 34 ; no &# 34 ;), the learning means 206 executes the processing steps s14 and s17 described above , whereon the processing proceeds to the step s6 of holding the learned value . as will now be appreciated , the reflection ratio kt is set to a maximum value kt1 ( e . g . &# 34 ; 0 . 8 &# 34 ;) when the timing deviation ( timing ratio ) is practically zero , while being decreased as the timing deviation increases . thus , when the timing deviation is large , indicating poor reliability , the reflection of the detected value td1 in the learned value lrn is suppressed for eliminating the detection error due to variation of the engine rotation number , whereby the most retarded valve timing td can be set with high reliability . in the valve timing control system according to the fourteenth embodiment of the invention , the timing ratio (= tdmin / td ( i - 1 )) is used as the parameter indicating the timing deviation . however , in the valve timing control system according to a fifteenth embodiment of the invention the timing difference ( td ( i - 1 )- tdmin ) between the lower limit value tdmin for the detected values td1 and the preceding most retarded valve timing td ( i - 1 ) ( or deviation of the former from the latter ) is employed as the parameter indicating the timing deviation . with such arrangement , substantially same advantageous effect as that of the fourteenth embodiment can be achieved . in this conjunction , it should be added that although the reflection ratio kt is set variably by resorting to the arithmetic operation in accordance with the expression ( 6 ), the reflection ratios kt corresponding to individual values of the timing ratio may be previously determined and stored in a memory in the form of a map data table with the timing ratio being used as the index . in the valve timing control system according to the fourteenth embodiment of the invention , the reflection ratio kt is set variably in dependence on the magnitude of the timing deviation . according to a sixteenth embodiment of the invention , it is proposed that the reflection ratio kt is set variably in dependence on variation of the timing deviation so that the reflection ratio kt can assume a smaller value as variation of the timing deviation becomes more remarkable . many features and advantages of the present invention are apparent from the detailed description and thus it is intended by the appended claims to cover all such features and advantages of the system which fall within the true spirit and scope of the invention . further , since numerous modifications and combinations will readily occur to those skilled in the art , it is not intended to limit the invention to the exact construction and operation illustrated and described . accordingly , all suitable modifications and equivalents may be resorted to , falling within the spirit and scope of the invention . | 5 |
fig1 shows a bioreactor 10 according to the present invention comprising a vessel 11 , a thermostated jacket 12 with inlet and outlet ports 13 , 14 , a ph and temperature sensors 15 , 16 , a dissolved oxygen probe 17 , a service port 18 , a removable top 19 , a removable bottom 19 bis and a gas supplying device 19 ter . in a preferred embodiment of the present invention the bioreactor 10 of fig1 comprises a cylindrical vessel 11 made of non - toxic biocompatible material such as pyrex ™ or stainless steel . the vessel 11 is surrounded by the jacket 12 to provide temperature control by circulation of a heating fluid through inlet and outlet ports 13 , 14 . heating / cooling fluid interior coils may alternatively be used . a ph probe 15 , a temperature sensor 16 , a dissolved oxygen probe 17 and a port 18 for feeding and sample collection during closed course working are coupled to vessel 11 . vessel 11 has removable top 19 and removable bottom 19 bis , which are hermetically sealed to the vessel by o - rings ( not shown ) and / or latches or bolts ( not shown ). the bioreactor 10 comprises a frame housing preferably made of steel , which keeps the vessel 11 in horizontal or vertical positions . bioreactor 10 , vessel 11 , top 19 and bottom 19 bis are capable of being opened so that operators may access the interior for maintenance and manual work . the cylindrical vessel 11 is loaded through suitable opening in the bottom 19 bis by the liquid suspension of biomass and a matrix compounds which are for examples collagen , agar , dextranes , peptones , alginates , carrageenan or analogous organic macromolecules in such concentration to produce a solid matrix gel below 40 ° c . such a matrix may further contain radio - opaque materials , such as barium salts , and / or promoters for nmr imaging detection such as magnetic particles and nmr shift reagents . typically , the collagen concentration is of from 0 . 01 to 3 % ( w / v ) and agar concentration is of from 0 . 5 to 3 % ( w / v ). alternatively , the vessel 11 is filled with porous scaffolding material such as , for examples , glass fibers and fabrics , common fibers or fabrics , porous ceramic bodies , paper sheets , foam of organic synthetic or natural polymers and cellulose solids , all of which hold the biomass included in the above mentioned matrix compounds . these scaffolding materials may alternatively fill the vessel 11 and are there imbued by liquid suspension of the biomass and matrix compounds . alternatively , in the case of plant and yeast cells , liquid suspension of the biomass is used without matrix compounds . the vessel 11 thus filled , is then exposed to a gas flow saturated by a mixture of gaseous silicon alkoxides according to the present invention . said gas flow is supplied by the gas supplying device 19 ter removably connected to the bottom 19 bis . the mixture of gaseous silicon alkoxides of the present invention produces a uniform and continuous siliceous layer on the surface of the matrix gel or on the surface of the biomass . the exposure time of the silicon alkoxide gaseous flux depends on the layer thickness ( v . m . sglavo et al . j . mat . science 34 , 3587 1999 ). the siliceous layer thickness is a linear function of the exposition time up to 500 μg of silicon deposited per cm 2 of treated surface . the siliceous layer thus obtained provides an inorganic deposit attached to the matrix surface , independently of matrix chemical composition , geometry , shape , or presence of scaffolding materials . when the siliceous layer produced according to the process of the present invention is formed , the mobile phase of the bioreactor may be circulated through the removable bottom 19 bis . this latter will be equipped with a gas spreader 20 supplying biomass oxygenation . the mobile phase may be used for feeding the biomass and for recovery of product compounds . mobile phase circulation is provided by a feed pump ( not shown ) and moves in a closed circuit through the removable top 19 . the removable top 19 may comprise an outlet port 21 for the discharge of the gaseous flux saturated by silicon alkoxides and volatile byproducts of the siliceous layer formation . alternatively , the top 19 may comprise an outlet port for mobile phase circulation . in this embodiment , it may be connected to a line of extractors ( not shown ) providing liquid / liquid and / or gas / liquid continuous separation of desired products from the mobile phase . a reservoir connected to cover 19 may alternatively be used for substitution of the exhausted mobile phase and its storage for discontinuous working of the bioreactor . furthermore , the top 19 may comprise a spray nozzle 22 for producing droplets of the matrix solution . the spray nozzle 22 may be fed by the flux of silicon alkoxide gaseous mixture used to coat the droplets by the siliceous layer . in this embodiment , the removable bottom 19 bis may comprise the bubbling apparatus 19 ter used to saturate a non toxic gaseous flux by silicon alkoxides which invest falling droplets . the present invention will be further described with reference to the examples provided below merely by way of non restrictive illustrations . activity of urease in 1 % agar and immobilized by the siliceous layer 640 u of urease ( purchased from sigma , 99 % purity ) were mixed with 20 ml of 1 % ( w / w ) agar ( purchased from fmc , 99 % purity ) in water . the solution was poured into a glass pyrex ™ cylinder 30 mm in diameter and 300 mm in height in sterile conditions . the cylinder mouth and cover were closed and the cylinder was placed in a frame housing maintaining the vessel in horizontal position in a thermostated bath at 37 ° c . an external electrical motor imparted axial rotation to the cylinder at a rate of 5 rpm until the creation of a gel 0 . 7 mm thick on the internal wall of the cylinder . the mouth was connected to a gaseous flux saturated by a ch 3 sih ( oet ) 2 and si ( oet ) 4 mixture obtained by bubbling the gaseous flux into a 25 / 75 volumetric liquid solution of those silicon alkoxides at 80 ° c . the carrier gas was air and the flux was 0 . 4 l / min . the flux was prolonged for 12 minutes . after completion of this operation , the cylinder was filled with a phosphatic buffer solution at ph = 8 . 0 and stored at 37 ° c . for 15 hr with a 5 rpm rotation . after this time , samples of the buffer solution were collected ; samples were also collected after 15 hr storage at ph = 8 . 0 from another vessel containing the same urease load in the 0 . 7 mm thick agar gel not coated by the siliceous layer . the protein content in the samples was determined according to a modified lowry &# 39 ; s method ( peterson g . l ., anal . biochem . 83 : 346 ( 1977 )). samples from the bioreactor not immobilized by the siliceous layer have a protein content corresponding to 100 % urease leaching from the agar gel . samples from the bioreactor with the siliceous immobilizing layer contain 0 . 7 % of the protein content ( 100 %= protein content measured in the case of non - immobilized samples ). the enzymatic activity of urease was determined by monitoring the in - time decrease in the urea concentration in solutions starting from initial conditions of 5 μg of urea per 1u of free or immobilized urease . the urea concentration was determined with the diacethyl monoxime method ( ceriotti g . and spadaro l ., clin . chim . acta 11 : 519 1965 ). experiments were simultaneously carried out for solutions : 1 . holding free urease , 2 . holding urease in the agar not coated by the siliceous layer , and 3 . holding urease in the agar coated by the siliceous layer . the activities of the enzyme in cases 1 . and 2 . were identical ( same maximum rate and same michaelis - menten constant ). in case 3 ., a definite improvement activity was observed ( 80 % increase of maximum rate with same michaelis - menten constant ). production of lignanic class drugs from ruta graveolens cells immobilized by the siliceous layer a sponge like layer of foam polyurethane 1 cm in thickness ( density = 0 . 1 g / ml ) was cut into disks 3 . 0 cm in diameter . disks were sterilized with steam at 120 ° c . and treated with a cell suspension culture of ruta graveolens ( generated from the sprout in 1995 ) holding 0 . 1 g of wet cell mass per ml . the medium was gamborg &# 39 ; s basal growth b5 solution supplemented with 3 % ( w / v ) sucrose , 2 . 6 mg / l 2 , 4 - dichlorophenoxyacetic acid , 0 . 30 mg / l kinetin , and 0 . 30 mg / l naphthalenacetic acid . the ph was adjusted to 5 . 7 with phosphatic acid . the disks were kept in the suspension in sterile conditions at 25 ° c . on a gyratory shaker operating at 100 rpm in a 12 hr period for 10 days . disks were drawn out and hung to dry in a sterile hood at 30 ° c . for 2 hours . the average cell load was 0 . 3 g of wet mass per disk volume . 1000 disks joined by a metal yarn were introduced into a pyrex ™ cylindrical glass bioreactor 10 l in volume ( 15 cm in diameter , 57 cm in height ). the reactor was maintained in a vertical position and treated from the bottom mouth with dry air at 30 ° c . ( flux = 0 . 8 l / min .) for 1 hour , then with a 5 l / minute air flux saturated by a ch 3 sih ( oet ) 2 and si ( oet ) 4 mixture obtained by bubbling the gaseous flux into a 30 / 70 volumetric mixture of those silicon alkoxides at 75 ° c . gaseous flux treatment lasted for 80 min . gas admission was changed from the bottom mouth to the top cover with a 2 minute frequency , acting on a 4 - way tap which connected the top and bottom sides to the gas flux entry and discharge . the reactor was immediately filled with the above described medium , which was changed after 30 minutes . retained cell viability was determined by mtt ( mossman t . j . immunol , methods 65 : 55 ( 1983 )) and was 92 % with respect to viability measured before immobilization . the micrograph of fig2 shows details of the siliceous layer immobilized cells on the polyurethane scaffolding material . temperature was maintained at 23 ° c . by circulation of thermostated water through a jacket surrounding the reactor . circulation of the medium was provided by an external peristaltic pump operating with a delivery capacity of 5 l / hr . the liquid was passed through 4 liquid / liquid extractors ; the preferred extraction liquid was a chloro solvent . the bottom mouth region was equipped with a gas spreader which provided an air flux of 10 l / hr . this flux was carried to the top cover and washed by bubbling into a phosphatic buffer at ph 7 . 2 . the production of lignanic class drugs was observed in the chloro solvent used for liquid extraction and in the water solution used for washing discharged gas . lignanic products were recovered by extraction with butanol - ethylacetate and separated by chromatography on sephadex and by hplc ( jasco model pu 1580 ) using as solvent chloroform / methanol in a 9 / 1 volumetric ratio . the total product mass was 160 mg per day . identification of lignanic products was made by fab mass spectrometry . identified products were podophillotoxin , diphyllin and justicidin - a as major components , representing 80 % of the total mass . reactor productivity was maintained for 20 weeks upon 5 day frequency additions of sucrose to restore its concentration to 3 % ( w / v ). cell mortality appeared after 16 weeks and total mortality was observed after 20 weeks from siliceous layer immobilization . molecular cut - off of siliceous layers obtained from different mixtures of silicon alkoxides a ) hep - g2 cells were cultivated over a collagen layer deposited on petri dishes 6 cm in diameter . the collagen matrix was obtained by heating a 0 . 1 % ( w / v ) collagen solution at 37 ° c . the medium was dulbecco &# 39 ; s modified eagle &# 39 ; s medium supplemented with 10 % of fetal bovine serum . after cellular confluence to monolayer morphology , cells were coated with a 50 μm layer of collagen solution 0 . 1 % ( w / v ). after consolidation , cell viability was 96 %, as determined by trypan blue exclusion . samples were treated with medium and stored at 37 ° c . for 24 hours in a humidified atmosphere of 95 % air and 5 % co 2 . the medium was removed and 8 petri dishes were mounted in a pyrex ™ glass cylinder 70 mm in diameter and 25 cm in height . a metal frame left 1 . 5 cm height space between dishes . siliceous layer deposition was made according to example 1 ( temperature in cylinder = 30 ° c ., exposure time = 8 minutes , 8 petri dishes ). after reaction , samples were immediately covered by the specified medium , which was replaced after 3 hours . the tiazolyl blue mtt assay for cell viability indicated 95 % cell viability . 18 hours after siliceous layer coating , the biomass was subjected to lysis by reaction with a solution of tris - hcl 50 mm ( purchased from sigma ) at ph = 8 . 0 , nan 3 0 . 02 % ( w / v ), and aprotinin 1 μg / ml ( purchased from sigma ). after 24 hours , the solution was analyzed by the sds - polyacrylamide gel separation procedure ( sambrook j . et al . “ molecular cloning : a laboratory manual ” cold spring harbour laboratory press 1989 ). samples were denatured at 100 ° c . for 3 minutes in 1 × sds gel loading buffer ( 50 mm tris - hcl , ph = 6 . 8 , 100 mm dithiotreitol , 2 % w / v sds , 0 . 1 % ( w / v ) bromophenol blue , 10 % ( w / v ) glycerol ). chromatographic runs were made on the mini protean ii apparatus of biorad ( 25 mm tris , 250 mm glycine , 0 . 1 % ( w / v ) sds , ph = 8 . 3 as mobile phase ) operating at 180 v for 45 minutes . the gel was then incubated for 30 minutes 50 % ( v / v ) methanol and 12 % ( v / v ) acetic acid solution washed three times with 10 % ( v / v ) ethanol plus 5 % v / v acetic acid solution for 5 minutes , incubated with 3 . 4 mm k 2 cr 2 o 7 and 3 . 2 mm hno 3 solution , and then washed again three times with double distilled water . samples were incubated with 12 mm agno 3 solution for 30 minutes . protein band development resulted by treatment with 0 . 28 m na 2 co 3 and 0 . 02 % ( w / v ) formaldehyde solution and fixing in 1 % ( v / v ) acetic acid solution . referring to fig3 , protein distribution is illustrated as a function of the molecular weight of 5 samples coated with siliceous layer and subjected to lysis and 2 control samples ( c1 , c2 ) not coated by the siliceous layer but similarly subjected to lysis . protein distributions obtained from coated samples and numbered t1 to t5 do not show traces of proteins with m . w . higher than 90 , 000 da . b ) the same procedures of example 3a were repeated in case of using , for the siliceous layer deposition , a 0 . 4 l / minute air flux saturated by a ch 3 sih ( oet ) 2 , ch 3 si ( oet ) 3 and si ( oet ) 4 mixture obtained by bubbling the gaseous flux into oct . 20 , 1970 volumetric mixture of those alkoxides at 80 ° c . protein distribution obtained from the coated samples subjected to lysis did not show traces of protein with m . w . higher than 150 , 000 da . c ) the same procedures of example 3a were repeated in case of saturation of the gaseous flux by a ch 3 sih ( oet ) 2 , ch 3 si ( oet ) 3 , and si ( oet ) 4 mixture in the volumetric ratio 20 / 20 / 60 at 75 ° c . protein distribution obtained from the coated samples subjected to lysis do not show traces of proteins with m . w . higher than 10 , 000 da . activity of bacillus polymyxa and bacillus subtilis in 1 % agar and immobilized by the siliceous layer a stock of b . polymyxa was purchased from atcc . a fraction of this culture was inoculated in 50 ml medium constituted of a solution of : yeast extract / casein / glucose / sucrose / nacl / mgso 4 = 2 . 5 / 2 . 5 / 8 / 2 / 1 / 0 . 5 g / l ; the suspension was buffered at ph 7 . 3 and supplemented with 1 ml of cacl 2 2h 2 o / feso 4 7h 2 o / znso 4 7h 2 o / cuso 4 5h 2 o / mnso 4 4h 2 o = 1 / 1 / 1 / 0 . 5 / 4 g / l . the suspension was stored for 3 days at 27 ° c . 5 ml of the suspension were diluted with 1 l of medium constituted of said compounds in concentrations = 2 . 5 / 2 . 5 / 18 / 2 / 1 / 0 . 5 g / l supplemented by tryptone ( 2 g / l ) and ammonium sulfate ( 1 g / l ) and buffered at ph 7 . 3 . the obtained suspension was stored at 27 ° c . for 5 days under stirring . agar was added to this suspension up to a 1 % ( w / v ) concentration . 30 l of the suspension were poured into a stainless steel cylinder 20 cm in diameter and 100 cm in height , filled with 5000 disks of glass wool , 35 mm in diameter and 10 mm in height , obtained from a texture with density = 0 , 2 g / ml . these disks were randomly arranged in the cylinder . the suspension was set aside for 30 minutes and then spurted out of the cylinder . the cylinder was placed in a frame housing maintaining the horizontal position of the vessel and under rotation at 5 rpm . the disks were here treated with a gaseous flux of silicon alkoxides , as described in example 2 . treatment lasted for 6 hours . the vessel in the vertical position was filled with the above described medium . the viability of the biomass was checked by monitoring glucose consumption over a period of 8 weeks . consumption of 1 . 3 g / l of glucose per day was constant and the original 18 g / l glucose concentration was restored by addition of glucose every two days . identical processing was used for immobilization of b . subtilis . in both cases , microscopic observations revealed the total absence of microorganisms released in the solution . samples of the medium were collected for detecting the concentration of polymyxine and bacitracine , respectively . antibiotic activity was tested by antibiograms on escherichia coli as polymyxine sensitive stocks and on staphylococcus aureus as bacitracine sensitive organism . dilution of original samples with saline determined the trend of polymyxine and bacitracine production during the 8 weeks of observation . determination of critical shearing stress of a 0 . 1 μm thick siliceous layer on collagen the critical shearing stress of the siliceous layer on collagen was determined by fluid mechanic experiments . a glass duct 120 cm long , 8 cm wide and 2 cm high was connected to a feed pump . water was put into the duct , kept horizontal , starting from a minimum flow of 5 l / minute . a 0 . 1 mm thick collagen layer , consolidated from a 0 , 1 % ( w / v ) solution , was deposited on the base of the duct , and flow was increased up to the removal of the layer . the corresponding critical flow gave a collagen critical shearing stress value of 0 . 5 pa . the same experiment was carried out in the case of collagen coated by the siliceous layer , deposited according the procedure described in example 2 using a 3 minute treatment . critical shearing stress resulted to be 15 pa . alginate microspheres containing ( 1 × 10 7 cells / ml ; 2 , 400 cells / microsphere ) were produced by conventional air - jet extrusion ( lim f . and sun a . m . science , 210 : 908 ( 1980 ). the alginate solution ( 1 . 5 % w / v na - alginate in 0 . 9 % nacl solution ) containing jurkat cells , a human lymphocyte cell line , was loaded into a sterile syringe barrel and the piston is guided by a uniformly driven pushing device . a sterile needle ( 0 . 3 mm internal diameter , 0 . 5 mm external diameter ) was connected to the syringe and placed into a coaxial air - jet extrusion nozzle ( 0 . 65 mm diameter ). air - flux ranging from 0 . 4 l / minute to 0 . 8 l / minute was bubbled into a solution of ch 3 sih ( oet ) 2 and si ( oet ) 4 ( 25 / 75 volumetric mixture ) at 80 ° c . the organosilane saturated air flux entered the air - jet extrusion nozzle , providing the siliceous coating and the dripping - off of the alginate drop from the needle tip . microsphere diameter ranged from 0 . 2 mm to 0 . 8 mm depending on the gaseous flux . microspheres , dropped into a 100 mm calcium chloride solution , were kept in this solution for 5 minutes and transferred into a cell culture medium ( rpmi 1640 ). cell viability was tested by the mtt assay and displayed more than 80 % viability . the encapsulated jurkat cells were stimulated with phorbol esters to secrete interleukin 2 ( il - 2 ), a lymphokine of 15 , 000 da . after 24 hour of stimulation , il - 2 levels were determined in the surrounding culture medium ( 226 pg / ml ) by a human il - 2 elisa detection kit ( sigma chemical company , saint louis , mo ., usa , i - 8273 ). the presence of the siliceous layer was demonstrated by osmotic lysis of microspheres in demineralized water . dilution of calcium ions resulted in disruption of alginate microspheres so that free cells were liberated in solution ( fig4 b ). referring to fig4 d , in the case of microspheres coated by the siliceous layer residual portions of the layer were observed together with free cells . pancreatic islets were obtained from lewis rats pancreas surgically isolated according to standard procedures . 200 / 300 islets were deposited on a 220 mesh net , suspended in a 1 , 5 ml swining filter holder , and fluxed for 15 seconds with a 0 . 1 l / minute air saturated at 80 ° c . by ch 3 sih ( oet ) 2 and si ( oet ) 4 ( 25 / 75 volumetric mixture ). islets were transferred into a cell culture medium ( dmem ) and incubated at 37 ° c . in a 5 % co 2 atmosphere for 24 hours . the islets were tested in vitro in a perfusion chamber with hank &# 39 ; s balanced salt solution ( hbss , 0 , 5 ml / min ) and a glucose challenge ( 20 mm in hbss from fraction 4 to fraction 10 , solid bar in fig5 ) for detection of insulin secretion . fractions were collected every 2 minutes . insulin content was determined in each fraction by a rat specific insulin antibody kit in an elisa apparatus . coated islets showed an insulin release trend imposable to the one obtained for control islets ( see fig5 ). experiments were carried according to literature methods ( wang t . et al . nature biotechnology 15 : 358 ( 1997 )). pancreatic langherans islets deriving from lewis rats ( 240 g of weight ), both control and coated by a siliceous layer as previously described in this example , were utilized for allogenic surgical transplantation to male sprague - dawley rats ( 280 g of weight ) made stably diabetic ( glycemia over 300 mg / 100 ml ) by the intra peritoneal administration of streptozotocin ( 6 mg / 100 g ). both donor and recipient rats were operated under anesthesia by halothane in a sterile operating room . islets , approximately 600 per rat , were implanted between one kidney and its adrenal gland . post - operative care included administration of one insulin injection to aid recovery of rats and transplanted islets from surgical stress . for the determination of blood glucose levels , blood samples ( 100 μl ) were collected from the tail of both control and transplanted rats once 8 days prior to surgery and , after , every 3 to 4 days for the first two weeks and then once every week . as shown in fig6 , the control animal group ( n = 6 ) transplanted with non coated islets , regained diabetic blood glucose levels ( 300 mg / 100 ml ) 15 days following surgery , whereas animals ( n = 6 ) transplanted with islets coated by the siliceous layer were still normoglycemic up to 43 days following implantation . ( i ) complement activation . hepg2 cells were cultivated on petri dishes according to the procedure described in example 3a 0 . 5 ml of human blood plasma , in the absence of complement or with zymosan activation , were deposited on the collagen layer . samples were stored for 30 minutes at 37 ° c . ( fushimi f ., nakayama m ., nishimura k ., hiyoshi t . artificial organs 22 ( 10 ): 821 – 826 ( 1998 )). c5a levels were determined by elisa analysis of the solution : the level measured for the sample treated with zymosan was considered 100 % level . the same experiment was carried out with hepg2 cells in the collagen coated by the siliceous layer , prepared according to example 3a ( exposure time 6 minutes , 6 petri dishes ). the c5a complement concentration was 5 % of the zymosan treated sample . ( ii ) kallicrein activity . hepg2 cells were cultivated on petri dishes according to the procedure described in example 3a 0 . 5 ml of bovine plasma solution ( containing citrate and diluted from 3 to 5 volumes with 60 ml tris - hcl ) were deposited on the collagen layer . samples were stored for 60 minutes at 4 ° c . the supernatant liquid was treated with z - fe - arg - 7 - amino - 4 - methyl - coumarin which detected the conversion of prekallicrein to kallicrein operated by factor xii ( fushimi f ., nakayama m ., nishimura k ., hiyoshi t . artificial organs 22 ( 10 ): 821 – 826 ( 1998 )). the kallicrein level resulting from this analysis was considered 100 %. the same experiment was carried out with hepg2 cells in collagen coated by the siliceous layer , prepared according to example 8a ( i ). the kallicrein level was 3 % of the non coated sample . ( iii ) platelet adhesion . experiments of platelet adhesion on the siliceous layer deposited on the collagen matrix were carried out according to example 8a ( i ) ( fushimi f ., nakayama m ., nishimura k ., hiyoshi t . artificial organs 22 ( 10 ): 821 – 826 ( 1998 )). results indicated the total absence of platelet activation by the siliceous layer . ( iv ) red blood cell hemolysis . possible red blood cell lysis induced by contact with the siliceous layer , or by release of toxic substances from the layer , was evaluated according to reported procedures ( drabkin d . l ., austin j . h . j . biol . chem . 98 : 719 ( 1932 )) by measuring the spectrophotometric concentration ( λ = 540 nm ) of hemoglobin in blood samples stored in contact with the siliceous layer deposited on the collagen matrix according to example 8a ( i ). no lysis was observed after 3 hr at 37 ° c . biocompatibility in vivo was assessed by the injection of both silica treated and normal collagen coated dextran microspheres ( cytodex , pharmacia , approximately 100 μm in diameter ) in the hind leg muscles of mice . groups of microspheres were laid on a 220 mesh stainless steel net in a 30 ml cylindrical teflon reaction chamber with inlet and outlet ports on opposite sides of the net . the microspheres were treated with an air flux saturated as described in example 2 for 30 minutes . treated microspheres were then collected in 3 ml of sterile cell culture medium and concentrated by centrifugation ( 200 × g for 5 minutes ). both treated and control microspheres were then resuspended in sterile phosphate buffered saline ( ph 7 . 4 ) to a concentration of 6 million microspheres per milliliter of buffer . three groups of 5 mice were injected by sterile syringes with 50 μl of a silica treated microsphere suspension , three groups of 5 control mice were similarly injected with a suspension of non treated microspheres ; all animals were anesthetized during this operation . mice were then sacrificed for autoptical observation and tissue collection at 2 weeks , 4 weeks and 12 weeks following injection . no signs of inflammation , pain or functional loss appeared to be present during the period of between microsphere injection and sacrifice in all groups . at the end of each test period , mice were sacrificed with excess anesthesia and the hind leg muscle collected for macroscopical inspection and histological analysis . no signs of infection , inflammatory processes , bleeding or fibrosis were macroscopically evident at the injection site in all animal groups . the subsequent microscopical observation of muscle tissue morphology of 5 μm thick histological slices following geimsa staining , resulted in the absence of any sign of edema , protein extravasation , leukocyte cell infiltration and fibrotic scar tissue formation at the site of injection in treated animal groups , whereas in control animals there was evidence of fibrotic reaction in the tissue around the control uncoated microspheres . | 2 |
in the basic circuit diagram shown in fig1 an antenna 1 receives high frequency broadcast signals and feeds them to a high frequency receiver , e . g . a radio receiver 2 . this receiver includes , inter alia , a superheterodyne , voltage - controllable oscillator 3 whose frequency can be changed by means of a variable capacitance diode ( not shown ) whose capacitance can be controlled by a tuning voltage . a counting device 4 is further provided to periodically count the oscillations of the superheterodyne oscillator 3 relating to the intermediate frequency of the receiver . the counter state thus represents the value of the broadcast frequency to which the receiver is presently tuned . in an indicator 5 the count present in the counting device 4 can be represented in a decimal form . the display 5 can be controlled in a multiplex manner in which the information identifying the individual digits to be displayed are fed to indicator 5 sequentially in time . multiplex signals are available for the multiplex operation which signals occur , for example , in the form of a logic &# 34 ; 0 &# 34 ; sequentially in time , each signal representing a respective multiplex phase as this is described in detail in the above - cited application . each digit is thus associated with a respective multiplex signal , or phase . to provide the desired display and to generate the required multiplex phase signals and control clock pulses , units 4 and 5 could be constituted by the circuit shown in fig2 of u . s . pat . no . 3 , 581 , 065 . for the purpose of tuning to a certain station , the number identifying the desired station or frequency is fed in via an input keyboard 8 , or some other input device , beginning with the most significant digit of that number . if , for example , the number is 95 . 7 , the nine is fed in first , followed by the five and then the seven . the signals representing the fed - in number are conducted via a coder 7 to an intermediate memory 9 and from there the representations of each digit are delivered in succession in multiplex operation to a comparator 6 . the coder 7 converts the signals into , for example , a bcd code , in which form the digits of the number representing the counter state of counting device 4 are also available . comparator 6 receives , in succession in the same multiplex operation , the signals representing the counter state of counting device 4 . comparison between the two numbers is thus made in multiplex operation , i . e . the corresponding digits of the two numbers are compared sequentially in time , the comparison beginning with the most significant digit . units 6 , 7 , 8 and 9 can have the form , and operate in the manner , disclosed in the above - cited earlier application , the necessary multiplex control signals being provided by device 4 . the comparator 6 , for example a commercially available 4 - bit , type 7485 comparator , is provided with three outputs 11 , 12 and 13 , which are associated with the possible comparison results , respectively , &# 34 ; equality of the digits &# 34 ;, providing a signal at output 11 , and the two inequality results &# 34 ; digits of the first number greater than digit of the second number &# 34 ;, providing a signal at output 12 , and &# 34 ; digit of the first number less than digit of the second number &# 34 ;, providing a signal at output 13 . the two latter outputs , 12 and 13 , influence a bistable flip stage , e . g . a flip - flop 10 . the output of flip - flop 10 is connected to the input of an amplifier circuit 16 to generate at the amplifier output the tuning voltage . the existing stable state of the flip - flop determines the direction of change of the tuning voltage . in this connection , the first mentioned output 11 of comparator 6 for the equality result will initially not be considered . each one of the two possible stable states of flip - flop 10 is associated with a respective one of the two inequality results of comparator 6 . upon a change from one inequality result to the other , flip - flop 10 thus reverses its stable state . these changes in state are counted by a counter 15 to the output of which is connected a coder 19 . coder 19 , for example , has three outputs which are each connected , via a respective resistor 20 , 21 , or 22 , to a bus bar 17 leading to the above - mentioned amplifier 16 . the current i flowing in bus bar 17 determines the level of the charging or discharging current supplied to a capacitor 18 connected to the output of amplifier 16 . the voltage across capacitor 18 is the tuning voltage for the superheterodyne oscillator 3 and is fed thereto via a line 14 . whether the capacitor 18 is discharged or charged , depends on the stable state of flip - flop 10 . coder 19 converts the counter state of counter 15 which is available , for example , in bcd code , to , for example , a 1 - of - 3 code . in dependence on the counter state of counter 15 , one of the three outputs of coder 19 is thus switched to present a binary &# 34 ; 1 &# 34 ; potential . the resistors 20 , 21 , and 22 are selected to have different resistance values in a ratio , for example , such as 1 : 10 : 100 , i . e . the resistance of resistors 21 and 22 being 10 times and 100 times , respectively , that of resistor 20 . at the beginning of the tuning process , the relatively small resistor 20 , for example , is connected to a binary &# 34 ; 1 &# 34 ; potential so that a relatively large current i flows to amplifier 16 . as a result , the voltage across capacitor 18 will change relatively quickly so that the tuning process initially takes place at a high rate of frequency change . if now , in the course of the tuning process , the inequality result changes for the first time , i . e . the state of flip - flop 10 changes once and the counter state of counter 15 , which at the beginning of the tuning process had been set to zero , changes to a count of &# 34 ; one &# 34 ;, only resistor 21 , for example , receives a binary &# 34 ; 1 &# 34 ; potential , while the other two resistors 20 and 22 are switched off , or open circuited . since resistor 21 has a larger resistance value than resistor 20 , a smaller current flows through line 17 to amplifier 16 after the first change in the inequality result . tuning now takes place at a tuning rate which has been reduced by a ratio of 1 : 10 . upon the next change in the inequality result , another counting pulse is delivered to counter 15 . now the relatively large resistance of resistor 22 becomes effective . the tuning rate is thus again reduced by a ratio of 1 : 10 . although fig1 shows an arrangement for varying the tuning rate in only three stages , it is a matter of course that a different number of stages and resistors can also be selected . in the selection of the tuning rate , care must be taken that it is not made too high since otherwise equality between the two numbers to be compared may , under certain circumstances , not dependably be attained . it must be considered that the oscillator oscillations are counted periodically and that new counting results therefore are available only at certain points in time . the adjustment time for one decade step , i . e . the time required for the oscillator frequency to change by one decade step during the tuning process , must be greater than the time required to supply a new counting result to superheterodyne oscillator 3 so that the respective step or the respective digit , respectively , can be considered during the tuning process . fig2 shows a portion of the circuit of fig1 . the 4 - bit comparator 6 receives , in multiplex operation , the corresponding digits of the number fed in via keyboard 8 and of the number representing the presently received frequency , each one being in bcd code and being supplied via 4 lines . the three outputs 11 , 12 and 13 of comparator 6 lead to a gating circuit 31 which controls a 1 - bit memory 33 as well as , via lines 23a and 23b , flip - flop 10 . as already mentioned , the state of flip - flop 10 depends on the inequality results at outputs 12 and 13 . the gate circuit 31 is shown in fig5 of the earlier u . s . application ser . no . 708 , 754 . upon equality between the currently - supplied digits of the two numbers , a logic &# 34 ; 1 &# 34 ; appears at the output 11 and this is fed to memory 33 only under certain conditions and is stored therein . as described in detail in the above - cited earlier application , equality with respect to the first , i . e . most significant , digit is always evaluated first . only when the most significant digits of the two numbers are identical , will the comparison of the next most significant , or second , digit be evaluated . the outputs from comparator 6 for any desired digit are evaluated only if all higher order , or more significant , digits are already identical . if , for example , at the beginning of the comparison only the third digits of the two numbers accidentally coincide , this coincidence must not be evaluated because the more significant digits differ from one another . this condition is satisfied by the operation of gating circuit 31 in conjunction with gate 32 . gate 32 is controlled during the multiplex phase signal of the first digit , or position , via an inverter 32a . gate 31 can correspond to gate 60 shown in fig5 of the earlier application , and circuit 31 can include the components 55 and 61 of fig5 of the earlier application . as described in detail in the above - cited earlier application , gating circuit 31 permits a logic &# 34 ; 1 &# 34 ;, which occurs upon coincidence at output 11 , to pass to memory 33 only if a logic &# 34 ; 1 &# 34 ; reaches gate 32 from inverter 32a or from the output of memory 33 , i . e . either the first digit is being compared or the preceding comparison result transferred into memory 33 was a positive one . memory 33 is activated by one clock pulse during each multiplex phase . each such clock pulse causes the logic signal then emitted by gating circuit 31 to be stored in memory 33 and to be available at its output to control gate 32 . in fig2 the inequality results at the outputs 12 and 13 of comparator 6 are supplied to flip - flop 10 via gating circuit 31 and lines 23a and 23b . one clock pulse is furnished to flip - flop 10 via line 26 at each multiplex phase so as to flip flip - flop 10 to that stable state determined by the nature of the respective inequality result . since the respective stable position of flip - flop 10 determines the direction of the tuning process , the output of flip - flop 10 is connected to amplifier 16 , as shown in fig1 . moreover , the output of flip - flop 10 is connected , via a line 24 , with a differentiating circuit 30 which feeds a counting pulse to counter 15 after each change of state of flip - flop 10 . through the already mentioned line 26 , the counter receives one clock pulse for counting with each multiplex phase . furthermore , counter 15 is set to its zero state at the beginning of each tuning process by a signal applied to terminal 25 . in dependence on the counter state of counter 15 , the coder 19 , which has already been mentioned in connection with the description of fig1 applies a binary &# 34 ; 1 &# 34 ; potential to one of the different resistors 20 , 21 , and 22 so that a current , whose magnitude depends on how often the inequality result of comparator 6 has changed , flows to amplifier 16 . amplifier 16 may be , for example , an integrated module ca 3080 manufactured and sold by rca . this is an amplifier which feeds capacitor 18 with the current it receives from line 17 . fig3 illustrates a modified portion of the circuit of fig2 according to another embodiment of the invention . a pulse generator 27 is provided which produces pulses at a constant frequency . via a programmable divider 28 , these pulses are fed to a converter 29 , e . g . a low - pass filter or integrator , which generates a direct voltage or direct current , respectively , in dependence on the frequency of the pulses it receives . via line 17 , the resulting direct current flows to amplifier 16 which , in the above - described manner , charges or discharges , respectively , capacitor 18 , thus generating the tuning voltage fed to the superheterodyne oscillator via line 14 . the graduated variation in the rate of tuning voltage , and hence tuning frequency , change is effected in the circuit of fig3 in that the dividing ratio of the programmable divider 28 is set and changed in dependence on the number of changes in the inequality results . counter 15 again counts the number of changes in the inequality results and enables coder 19 , which here effects such a conversion of the counter state present in a bcd code that coder 19 is able to set the dividing ratio in dependence on the counter state . at the beginning of the tuning process , i . e . at the counter state of zero , the dividing ratio is relatively small , i . e . the frequency of the pulses fed to converter 29 is high . thus the rate of tuning is also high . if the counter state is &# 34 ; one &# 34 ;, the dividing ratio of the programmable divider 28 is increased . with identical pulse width , the frequency of the pulses fed to converter 29 is thus reduced , for example , by the factor 1 : 10 so that the rate of tuning is also correspondingly less . after the next change in the inequality result , when the counter state is &# 34 ; two &# 34 ;, the dividing ratio is reduced further so that the tuning rate is again reduced , etc . until equality of the two numbers has been attained . care must be taken in connection with the frequency division that the pulse width of the pulses whose frequencies have been divided down remains substantially unchanged so that the direct voltage or direct current , respectively , appearing at the output of converter 29 is dependent on the frequency of the pulses . converter 29 may be formed , in the simplest case , by a low - pass filter . fig4 shows a 2 - bit counter 15 , resistors 20 , 21 , 22 and a coder 19 connected between the outputs of the counter 15 and the resistors 20 , 21 , 22 . the coder 19 includes three nor - gates 34 , 35 , 36 . each nor - gate has three inputs . one input of each nor - gate is connected to a bus bar . this bus bar is connected with the output of the one - bit memory 33 in fig2 . so the gates 34 , 35 and 36 are persistent blocked when there is coincidence between all digits of the two numbers which are compared in the comparator 6 in fig2 . the other inputs of the gates 34 to 36 are connected with the outputs q 1 and q 2 and the inverted outputs q 1 and q 2 of the counter 15 in the shown manner . fig5 shows the logic diagram of the circuit of fig4 . the state no . 1 , 2 and 3 represent a 1 - of - 3 code . the state no . 4 is the maximum count state of counter 15 . in the case of state no . 4 all outputs of the coder 19 are blocked so that the current flow through all resistors 20 , 21 and 22 is prevented . it will be understood that the above description of the present invention is susceptible to various modifications , changes and adaptations , and the same are intended to be comprehended within the meaning and range of equivalents of the appended claims . | 7 |
the heat stable caprylic capric acid stabilizes the carotenoids , to explain further a heat stable grade of caprylic capric acid used as a stabilizer in the saponification process which protects the carotenoids from degradation or loss when exposed at a higher temperature and reaction time during the saponification process , and this also helps to increase the overall yield of carotenoids . thus the present invention overcomes the necessity for the use of organic chemicals in the saponification process and the difficulty of stabilizing carotenoids during the saponification process which require high temperature and long reaction time . the carotenoid stabilizer is of lower than 12 . 0 % ( w / w ) of the saponification reaction mixture , preferably lower than 11 . 0 % ( w / w ), more preferably lower than 10 . 0 % ( w / w ), most preferably lower than 9 . 0 % ( w / w ). ( a ) the oleoresin used in the process is from different sources from plants and microorganisms . more preferably carotenoid rich oleoresin derived from plant sources like marigold , tomato , palm , wolfberry , pilli , gac fruit , adonis flowers and derived from microbial sources like yeast , fungi , algae and bacteria . ( b ) the oleoresin is loaded into reactor and homogenized vigorously for 5 to 10 min at a temperature of about 30 ° c . to 60 ° c ., more preferably 35 ° c . to 55 ° c . and most preferably 40 ° c . to 52 ° c . ( c ) the homogenized oleoresin is hydrolyzed in a reactor with addition of 0 . 5 to 1 volumes of 40 - 55 % of aqueous potassium hydroxide solution , of the quantity of the oleoresin , to this reaction mixture 1 to 1 . 5 times of fatty alcohol is added and homogenized further , more preferably fatty alcohol like lauryl myristyl alcohol or pure form of lauryl alcohol or myristyl alcohol were used . to the above reaction mixture 3 % to 10 %, more preferably 4 % to 9 % and most preferably 4 . 1 % to 9 % of caprylic capric acid is added , at a temperature ranging between 60 ° c . and 100 ° c . for a time period of 30 min to 90 min . the degree of saponification is evaluated by chromatographic techniques to ensure the completion of the process . ( d ) the saponified reaction mixture is further cooled down to a temperature of about 30 ° c . to 60 ° c ., more preferably 35 ° c . to 55 ° c . and most preferably 40 ° c . to 52 ° c . to the cooled reaction mixture 1 to 6 times , more preferably 1 . 5 to 4 times and most preferably 2 to 3 times of demineralized water is added and stirred for 5 to 20 min , more preferably 6 to 15 min and most preferably 8 to 12 min . ( e ) to the cooled saponification reaction mixture , optionally alcohol like ethyl alcohol with low moisture content added about 2 to 10 times of the oleoresin content for crystallization of carotenoids and to remove the unwanted impurities like lipids and fats . ( f ) the alcohol treated mixture is filtered through filter press by pumping the mass into the filtered press . the mass in the filter washed with warm water of 50 ° c . to 60 ° c . until the ph of the mass is till neutral . ( g ) the wet mass from the filter - press is dried in warm water jacketed conical blender under vacuum at a temperature of 40 ° c . to 50 ° c . till the moisture and solvent impurities are below the permissible limit as per the pharmacopeia . ( h ) the resulting crystals contains at least 90 % of carotenoids by uv - vis spectrophotometer and the chemical recovery of the active in the end product is between 70 % to 95 % and the variable conditions thereof utilized based on the above process parameters by certain modification of the process and the reaction mixtures herein . ( i ) the finished active carotenoids obtained are used for formulating formulations like , oil , cold water dispersible formulation , beadlets , granules , and powders with different concentrations depending upon the applications . the following examples are just illustrative , but not limiting , of the methods of the present invention . other adjustments or modification or adaptations of the variety of process or reaction conditions and ingredients or reagents normally encountered in phyto chemistry and which are obvious to those skilled in the art are within the spirit and scope of the invention . 11 . 7 gms of lutein ester oleoresin with 135 . 1 gm / kg of lutein ester content is taken 500 ml round bottomed flask , the oleoresin is homogenized for 5 to 10 min under stirring at a temperature of about 45 deg c . using hot water bath . aqueous koh [ 2 . 3 gms 95 % koh in 3 . 5 gms of water ] is added to the homogenized oleoresin slowly . to this 1 gm of caprylic capric acid and 5 gms of lauryl alcohol were added and properly homogenized under stirring . the saponification reaction is carried out at a temperature of about 80 deg c . for 60 min . the saponification reaction is monitered by thin layer chromatographic run . once the saponification reaction is completed , 25 gms of hot deminerized water is added to the mixture and stirred for 10 min . this diluted mixture is filtered under vacuum condition , during filtration , fresh hot deminerized water of about 100 gms were added continuously to the crystals to neutralize the crystals ph and to remove the unwanted impurities in the crystals . the wet crystals are then collected and dried under vacuum at a temperature of about 50 deg c . for an hour . the carotenoid crystals recovered has a purity for the total carotenoids is about 92 . 43 % by uv - vis spectrophotometer analysis and the chemical recovery of the final product is 78 . 2 % 10 kg of lutein ester oleoresin with 135 . 1 gm / kg of lutein ester content is taken 50 liters capacity reactor with an agitator . the oleoresin is homogenized for 5 to 10 min under stirring at a temperature of about 45 deg c . using hot water in the jacket of the reactor as the heating medium . aqueous koh [ 1 . 95 kg 95 % koh in 3 . 0 kg of water ] is added to the homogenized oleoresin slowly . to this 860 gms of caprylic capric acid and 4 . 3 kg of lauryl alcohol were added and properly homogenized under stirring . the saponification reaction is carried out at a temperature of about 80 deg c . for 60 min . the saponification reaction is monitered by thin layer chromatographic run . once the saponification reaction is completed , 25 . 0 kg of hot deminerized water is added to the mixture and stirred for 10 min . this diluted mixture is centrifuged in high speed centrifuge to recover the crystals , during centrifugation , fresh hot deminerized water of about 100 kg were added continuously to the crystals to netralize the crystals ph and to remove the unwanted impurities in the crystals . the wet crystals are then collected and dryed under vacuum at a temperature of about 50 deg c . for an hour . the carotenoid crystals recovered has a purity for the total carotenoids is about 91 . 75 % by uv - vis spectrophotometer analysis and the chemical recovery of the final product is 80 . 17 % 5 kg of lutein ester oleoresin with 135 . 1 gm / kg of lutein ester content is taken 50 liters capacity reactor with an agitator . the oleoresin is homogenized for 5 to 10 min under stirring at a temperature of about 45 deg c . using hot water in the jacket of the reactor as the heating medium . aqueous koh [ 0 . 975 kg 95 % koh in 1 . 5 kg of water ] is added to the homogenized oleoresin slowly . to this 430 gms of caprylic capric acid and 2 . 15 kg of lauryl alcohol were added and properly homogenized under stirring . the saponification reaction is carried out at a temperature of about 80 deg c . for 60 min . the saponification reaction is monitered by thin layer chromatographic run . once the saponification reaction is completed , 12 . 5 kg of ethyl alcohol is added to the mixture and stirred for 10 min . this diluted mixture is centrifuged in high speed centrifuge to recover the crystals , during centrifugation , fresh ethyl alcohol of about 50 kg were added continuously to the crystals to neutralize the crystals ph and to remove the unwanted impurities in the crystals . the wet crystals are then collected and dried under vacuum at a temperature of about 50 deg c . for an hour . the carotenoid crystals recovered has a purity for the total carotenoids is about 93 . 59 % by uv - vis spectrophotometer analysis and the chemical recovery of the final product is 82 . 03 % 1 . agarwal s , rao a v . carotenoids and chronic diseases . drug metabolism drug interact 2000 ; 17 ( 1 - 4 ): 189 - 210 2000 . pmid : 15130 . 2 . international agency for research on cancer . iarc handbooks of cancer prevention : carotenoids . lyon : international agency for research on cancer ; 1998 . 3 . delgado - vargas f , jimenez a r , paredes - lopez o . natural pigments : carotenoids , anthocyanins , and betalains — characteristics , biosynthesis , processing , and stability . crit rev food sci nutr 2000 may : 40 ( 3 ): 173 - 289 2000 . pmid : 15150 . 4 . handelman g j . the evolving role of carotenoids in human biochemistry . nutrition 2001 october : 17 ( 10 ): 818 - 22 2001 . pmid : 15100 . 5 . krinsky n i . carotenoids as antioxidants . nutrition 2001 october : 17 ( 10 ): 815 - 7 2001 . pmid : 15110 . 6 . young a j , lowe g m . antioxidant and prooxidant properties of carotenoids . arch biochem biophys 2001 jan . 1 ; 385 ( 1 ): 20 - 7 2001 . pmid : 15120 . | 2 |
in the figures , an embodiment of the present invention is shown as a spice container package 10 including a serving lid closure 14 and a container 18 . the serving lid closure 14 and the container 18 are integrally molded together of plastic material as a one piece unitarily molded . preferably , the assembled spice container package is generally rectangular in configuration similar to many of the spice container packages as seen in supermarkets . however , inventive features may also be employed in non - rectangular package designs and / or in other closures . while multiple pieces could be used , the serving lid closure 14 is preferably a one piece integrally molded plastic member ( with the serving lid closure 14 also being integrally molded with the container ) as shown in the drawings . as such , multiple molding of separate parts may not be necessitated . additionally , the serving lid closure 14 can be molded using relatively simple molding technique between two mold halves potentially with a one pull mold process ( slots 70 in outer skirt may be formed with pins from the side or may permit resilient mold release through slight flexure ). the serving lid closure 14 generally includes a base 22 and a cover 30 , which are joined by an elongate hinge 32 . a tamper strip 26 is disposed intermediate the cover 30 and the container 18 and joined to each of the two respective components by virtue of hinges 34 and 38 , which are very thin segments of plastic material which allow the serving lid to be folded relative to the container during assembly . specifically , during assembly , the base 22 is first folded relative to the cover 30 through hinge 32 ( and the flaps may releasably snap onto the base over the dispensing port ); and then the entire serving lid closure 14 is rotated and pivoted relative to the container 18 about the tamper strip 26 ( via hinges 34 and 38 ) so that the base 22 of the serving lid closure 14 is telescopically received on the free edge of the container sidewall and can be secured directly to the top portion of the side wall of the container 18 . the hinges 34 and 38 for the tamper strip 26 are sufficiently thin to allow for manual removal and tearing such that tamper strip 26 also serves as a tear strip that can be manually removed relatively easily through manual manipulation . typically the tamper strip 26 will include printed indicia on its front face ( along the front of the package ) indicating that it can be pulled and removed or otherwise indicating that it is a feature evident of tampering . in the assembled position , the tamper strip 26 is releasably and tearable away from the flaps of the cover 30 and the top of the container 18 . the base 22 includes a platform 42 through which a plurality of dispensing ports 46 are formed ( e . g ., such as a spoon port , a sift port and a pour port as shown ). the cover 30 comprises a plurality of flaps 62 joined by hinge 32 . each flap 62 are independently movable and covers one of the dispensing ports 46 to allow for selective manual access to the dispensing ports 46 when in use . the longitudinal hinge 32 for the flaps 62 is sufficiently thin segments of plastic to allow for pivoting motion and also sufficiently thick so as to prevent inadvertent manual tear away . a different aspect of the disclosed embodiment which can be used and employed independent of the tamper strip related features is the provision for reliably and preferably permanently locking the serving lid closure 14 to the container 18 . between the container 18 and serving lid closure 14 is provided a mounting interface with interacting snap structures located at discrete locations including as shown locking tabs 66 and locking slots 70 . in the disclosed embodiment , the locking tabs 66 are formed approximate the top of the container side wall ( at opposing ends and / or opposing sides ), while complimentary locking slots 70 are formed into the serving lid closure 14 . alternative methods of fixing and permanently securing the serving lid to the container include welding , staking , gluing or other securing mechanisms . as shown , the base 22 of the serving lid closure 14 includes an inner rectangular skirt 74 and an outer rectangular skirt 78 , which both depend downwardly from the platform 42 . the inner skirt 74 is slidably received and may engage the inner surface of the container 18 proximate a top and thereof . the outer skirt 78 which defines the locking slots 70 is received over the exterior surface of the side wall of the container 18 . to assist in assembly , cam surfaces 82 and 86 are provided to facilitate temporary flexing of the outer skirt 78 outwardly away relative to the side wall of the container 18 during assembly to allow the locking tabs 66 to snap into the locking slots 70 ( e . g . note the locking tabs 66 may be in the form of a wedge ). upon receipt of the locking tabs 66 into the locking slots 70 , locking segments 90 formed along the lower edge of the locking slots 70 of the outer skirt 78 release back inwardly to engage the underside of the locking tab 66 to permanently secure the container 18 to the serving lid closure 14 so as to prevent easy manual removal . as shown after assembly , the resilient flexure in the outer skirt 78 is relieved once it is allowed to flex back inwardly after it clears the underside of the locking tabs 66 . preferably , a tamper shield 94 which transitions the container sidewall to a thickness about the same ( or greater if desired ) than the perimeter of the outer skirt 78 is provided so as to prevent easy manual manipulation of the locking segments 90 which could allow for tampering of the serving lid closure . the tamper shield preferably extends around the periphery of the container sidewall and may be a triangular thickened region of the sidewall as shown . thus , the design provides a mechanical lock between the closure 14 and the container 18 to greatly reduce the possibility of removal without causing visual damage to one or both of the components , particularly without the availability of tools . to assemble the device , the cover of the serving lid closure is folded relative to the base . thereafter , the serving lid closure and the container are pushed together in order to permanently lock the serving lid closure to the container . thereafter , the consumer must remove the tamper evident strip in order to access the product such as spices , dry flowable granular product or other product that may be contained within the container . all references , including publications , patent applications , and patents cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) is to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . | 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.